These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

RNA regulons: coordination of post-transcriptional events  

Microsoft Academic Search

Recent findings demonstrate that multiple mRNAs are co-regulated by one or more sequence-specific RNA-binding proteins that orchestrate their splicing, export, stability, localization and translation. These and other observations have given rise to a model in which mRNAs that encode functionally related proteins are coordinately regulated during cell growth and differentiation as post-transcriptional RNA operons or regulons, through a ribonucleoprotein-driven mechanism.

Jack D. Keene

2007-01-01

2

Post-transcriptional RNA regulons affecting cell cycle and proliferation.  

PubMed

The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

Blackinton, Jeff G; Keene, Jack D

2014-10-01

3

Reconstruction of the Core and Extended Regulons of Global Transcription Factors  

Microsoft Academic Search

The processes underlying the evolution of regulatory networks are unclear. To address this question, we used a comparative genomics approach that takes advantage of the large number of sequenced bacterial genomes to predict conserved and variable members of transcriptional regulatory networks across phylogenetically related organisms. Specifically, we developed a computational method to predict the conserved regulons of transcription factors across

Yann S. Dufour; Patricia J. Kiley; Timothy J. Donohue

2010-01-01

4

Reconstruction of the Core and Extended Regulons of Global Transcription Factors  

PubMed Central

The processes underlying the evolution of regulatory networks are unclear. To address this question, we used a comparative genomics approach that takes advantage of the large number of sequenced bacterial genomes to predict conserved and variable members of transcriptional regulatory networks across phylogenetically related organisms. Specifically, we developed a computational method to predict the conserved regulons of transcription factors across ?-proteobacteria. We focused on the CRP/FNR super-family of transcription factors because it contains several well-characterized members, such as FNR, FixK, and DNR. While FNR, FixK, and DNR are each proposed to regulate different aspects of anaerobic metabolism, they are predicted to recognize very similar DNA target sequences, and they occur in various combinations among individual ?-proteobacterial species. In this study, the composition of the respective FNR, FixK, or DNR conserved regulons across 87 ?-proteobacterial species was predicted by comparing the phylogenetic profiles of the regulators with the profiles of putative target genes. The utility of our predictions was evaluated by experimentally characterizing the FnrL regulon (a FNR-type regulator) in the ?-proteobacterium Rhodobacter sphaeroides. Our results show that this approach correctly predicted many regulon members, provided new insights into the biological functions of the respective regulons for these regulators, and suggested models for the evolution of the corresponding transcriptional networks. Our findings also predict that, at least for the FNR-type regulators, there is a core set of target genes conserved across many species. In addition, the members of the so-called extended regulons for the FNR-type regulators vary even among closely related species, possibly reflecting species-specific adaptation to environmental and other factors. The comparative genomics approach we developed is readily applicable to other regulatory networks. PMID:20661434

Dufour, Yann S.; Kiley, Patricia J.; Donohue, Timothy J.

2010-01-01

5

Comparative genomics and evolution of regulons of the LacI-family transcription factors  

PubMed Central

DNA-binding transcription factors (TFs) are essential components of transcriptional regulatory networks in bacteria. LacI-family TFs (LacI-TFs) are broadly distributed among certain lineages of bacteria. The majority of characterized LacI-TFs sense sugar effectors and regulate carbohydrate utilization genes. The comparative genomics approaches enable in silico identification of TF-binding sites and regulon reconstruction. To study the function and evolution of LacI-TFs, we performed genomics-based reconstruction and comparative analysis of their regulons. For over 1300 LacI-TFs from over 270 bacterial genomes, we predicted their cognate DNA-binding motifs and identified target genes. Using the genome context and metabolic subsystem analyses of reconstructed regulons, we tentatively assigned functional roles and predicted candidate effectors for 78 and 67% of the analyzed LacI-TFs, respectively. Nearly 90% of the studied LacI-TFs are local regulators of sugar utilization pathways, whereas the remaining 125 global regulators control large and diverse sets of metabolic genes. The global LacI-TFs include the previously known regulators CcpA in Firmicutes, FruR in Enterobacteria, and PurR in Gammaproteobacteria, as well as the three novel regulators—GluR, GapR, and PckR—that are predicted to control the central carbohydrate metabolism in three lineages of Alphaproteobacteria. Phylogenetic analysis of regulators combined with the reconstructed regulons provides a model of evolutionary diversification of the LacI protein family. The obtained genomic collection of in silico reconstructed LacI-TF regulons in bacteria is available in the RegPrecise database (http://regprecise.lbl.gov). It provides a framework for future structural and functional classification of the LacI protein family and identification of molecular determinants of the DNA and ligand specificity. The inferred regulons can be also used for functional gene annotation and reconstruction of sugar catabolic networks in diverse bacterial lineages. PMID:24966856

Ravcheev, Dmitry A.; Khoroshkin, Matvei S.; Laikova, Olga N.; Tsoy, Olga V.; Sernova, Natalia V.; Petrova, Svetlana A.; Rakhmaninova, Aleksandra B.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.

2014-01-01

6

Reconstruction of Escherichia coli transcriptional regulatory networks via regulon-based associations  

PubMed Central

Background Network reconstruction methods that rely on covariance of expression of transcription regulators and their targets ignore the fact that transcription of regulators and their targets can be controlled differently and/or independently. Such oversight would result in many erroneous predictions. However, accurate prediction of gene regulatory interactions can be made possible through modeling and estimation of transcriptional activity of groups of co-regulated genes. Results Incomplete regulatory connectivity and expression data are used here to construct a consensus network of transcriptional regulation in Escherichia coli (E. coli). The network is updated via a covariance model describing the activity of gene sets controlled by common regulators. The proposed model-selection algorithm was used to annotate the likeliest regulatory interactions in E. coli on the basis of two independent sets of expression data, each containing many microarray experiments under a variety of conditions. The key regulatory predictions have been verified by an experiment and literature survey. In addition, the estimated activity profiles of transcription factors were used to describe their responses to environmental and genetic perturbations as well as drug treatments. Conclusion Information about transcriptional activity of documented co-regulated genes (a core regulon) should be sufficient for discovering new target genes, whose transcriptional activities significantly co-vary with the activity of the core regulon members. Our ability to derive a highly significant consensus network by applying the regulon-based approach to two very different data sets demonstrated the efficiency of this strategy. We believe that this approach can be used to reconstruct gene regulatory networks of other organisms for which partial sets of known interactions are available. PMID:19366454

Zare, Hossein; Sangurdekar, Dipen; Srivastava, Poonam; Kaveh, Mostafa; Khodursky, Arkady

2009-01-01

7

Diverse Genetic Regulon of the Virulence-Associated Transcriptional Regulator MucR in Brucella abortus 2308  

PubMed Central

The Ros-type regulator MucR is one of the few transcriptional regulators that have been linked to virulence in Brucella. Here, we show that a Brucella abortus in-frame mucR deletion strain exhibits a pronounced growth defect during in vitro cultivation and, more importantly, that the mucR mutant is attenuated in cultured macrophages and in mice. The genetic basis for the attenuation of Brucella mucR mutants has not been defined previously, but in the present study the genes regulated by MucR in B. abortus have been elucidated using microarray analysis and real-time reverse transcription-PCR (RT-PCR). In B. abortus 2308, MucR regulates a wide variety of genes whose products may function in establishing and maintaining cell envelope integrity, polysaccharide biosynthesis, iron homeostasis, genome plasticity, and transcriptional regulation. Particularly notable among the MucR-regulated genes identified is arsR6 (nolR), which encodes a transcriptional regulator previously linked to virulence in Brucella melitensis 16 M. Importantly, electrophoretic mobility shift assays (EMSAs) determined that a recombinant MucR protein binds directly to the promoter regions of several genes repressed by MucR (including arsR6 [nolR]), and in Brucella, as in other alphaproteobacteria, MucR binds to its own promoter to repress expression of the gene that encodes it. Overall, these studies have uncovered the diverse genetic regulon of MucR in Brucella, and in doing so this work has begun to define the MucR-controlled genetic circuitry whose misregulation contributes to the virulence defect of Brucella mucR mutants. PMID:23319565

Caswell, Clayton C.; Elhassanny, Ahmed E. M.; Planchin, Emilie E.; Roux, Christelle M.; Weeks-Gorospe, Jenni N.; Ficht, Thomas A.; Dunman, Paul M.

2013-01-01

8

Reconstruction of Escherichia coli transcriptional regulatory networks via regulon-based associations  

Microsoft Academic Search

BACKGROUND: Network reconstruction methods that rely on covariance of expression of transcription regulators and their targets ignore the fact that transcription of regulators and their targets can be controlled differently and\\/or independently. Such oversight would result in many erroneous predictions. However, accurate prediction of gene regulatory interactions can be made possible through modeling and estimation of transcriptional activity of groups

Hossein Zare; Dipen Sangurdekar; Poonam Srivastava; Mostafa Kaveh; Arkady Khodursky

2009-01-01

9

Transcription Factor Family-Based Reconstruction of Singleton Regulons and Study of the Crp/Fnr, ArsR, and GntR Families in Desulfovibrionales Genomes  

PubMed Central

Accurate detection of transcriptional regulatory elements is essential for high-quality genome annotation, metabolic reconstruction, and modeling of regulatory networks. We developed a computational approach for reconstruction of regulons operated by transcription factors (TFs) from large protein families and applied this novel approach to three TF families in 10 Desulfovibrionales genomes. Phylogenetic analyses of 125 regulators from the ArsR, Crp/Fnr, and GntR families revealed that 65% of these regulators (termed reference TFs) are well conserved in Desulfovibrionales, while the remaining 35% of regulators (termed singleton TFs) are species specific and show a mosaic distribution. For regulon reconstruction in the group of singleton TFs, the standard orthology-based approach was inefficient, and thus, we developed a novel approach based on the simultaneous study of all homologous TFs from the same family in a group of genomes. As a result, we identified binding for 21 singleton TFs and for all reference TFs in all three analyzed families. Within each TF family we observed structural similarities between DNA-binding motifs of different reference and singleton TFs. The collection of reconstructed regulons is available at the RegPrecise database (http://regprecise.lbl.gov/RegPrecise/Desulfovibrionales.jsp). PMID:23086211

Rodionov, Dmitry A.; Price, Morgan N.; Arkin, Adam P.; Dubchak, Inna

2013-01-01

10

A New Member of the Escherichia coli fad Regulon: Transcriptional Regulation of fadM (ybaW)?  

PubMed Central

Recently, Nie and coworkers (L. Nie, Y. Ren, A. Janakiraman, S. Smith, and H. Schulz, Biochemistry 47:9618-9626, 2008) reported a new Escherichia coli thioesterase encoded by the ybaW gene that cleaves the thioester bonds of inhibitory acyl-coenzyme A (CoA) by-products generated during ?-oxidation of certain unsaturated fatty acids. These authors suggested that ybaW expression might be regulated by FadR, the repressor of the fad (fatty acid degradation) regulon. We report mapping of the ybaW promoter and show that ybaW transcription responded to FadR in vivo. Moreover, purified FadR bound to a DNA sequence similar to the canonical FadR binding site located upstream of the ybaW coding sequence and was released from the promoter upon the addition of long-chain acyl-CoA thioesters. We therefore propose the designation fadM in place of ybaW. Although FadR regulation of fadM expression had the pattern typical of fad regulon genes, its modulation by the cyclic AMP (cAMP) receptor protein-cAMP complex (CRP-cAMP) global regulator was the opposite of that normally observed. CRP-cAMP generally acts as an activator of fad gene expression, consistent with the low status of fatty acids as carbon sources. However, glucose growth stimulated fadM expression relative to acetate growth, as did inactivation of CRP-cAMP, indicating that the complex acts as a negative regulator of this gene. The stimulation of fadM expression seen upon deletion of the gene encoding adenylate cyclase (?cya) was reversed by supplementation of the growth medium with cAMP. Nie and coworkers also reported that growth on a conjugated linoleic acid isomer yields much higher levels of FadM thioesterase activity than does growth on oleic acid. In contrast, we found that the conjugated linoleic acid isomer was only a weak inducer of fadM expression. Although the gene is not essential for growth, the high basal level of fadM expression under diverse growth conditions suggests that the encoded thioesterase has functions in addition to ?-oxidation. PMID:19684132

Feng, Youjun; Cronan, John E.

2009-01-01

11

Genome-wide profiling of Hfq-binding RNAs uncovers extensive post-transcriptional rewiring of major stress response and symbiotic regulons in Sinorhizobium meliloti.  

PubMed

The RNA chaperone Hfq is a global post-transcriptional regulator in bacteria. Here, we used RNAseq to analyze RNA populations from the legume symbiont Sinorhizobium meliloti that were co-immunoprecipitated (CoIP-RNA) with a FLAG-tagged Hfq in five growth/stress conditions. Hfq-bound transcripts (1315) were largely identified in stressed bacteria and derived from small RNAs (sRNAs), both trans-encoded (6.4%) and antisense (asRNAs; 6.3%), and mRNAs (86%). Pull-down with Hfq recovered a small proportion of annotated S. meliloti sRNAs (14% of trans-sRNAs and 2% of asRNAs) suggesting a discrete impact of this protein in sRNA pathways. Nonetheless, Hfq selectively stabilized CoIP-enriched sRNAs, anticipating that these interactions are functionally significant. Transcription of 26 Hfq-bound sRNAs was predicted to occur from promoters recognized by the major stress ? factors ?(E2) or ?(H1/2). Recovery rates of sRNAs in each of the CoIP-RNA libraries suggest a large impact of Hfq-assisted riboregulation in S. meliloti osmoadaptation. Hfq directly targeted 18% of the predicted S. meliloti mRNAs, which encode functionally diverse proteins involved in transport and metabolism, ?(E2)-dependent stress responses, quorum sensing, flagella biosynthesis, ribosome, and membrane assembly or symbiotic nitrogen fixation. Canonical targeting of the 5' regions of two of the ABC transporter mRNAs by the homologous Hfq-binding AbcR1 and AbcR2 sRNAs leading to inhibition of protein synthesis was confirmed in vivo. We therefore provide a comprehensive resource for the systems-level deciphering of hitherto unexplored S. meliloti stress and symbiotic post-transcriptional regulons and the identification of Hfq-dependent sRNA-mRNA regulatory pairs. PMID:24786641

Torres-Quesada, Omar; Reinkensmeier, Jan; Schlüter, Jan-Philip; Robledo, Marta; Peregrina, Alexandra; Giegerich, Robert; Toro, Nicolás; Becker, Anke; Jiménez-Zurdo, Jose I

2014-05-01

12

Transcriptional Profiling of Cross Pathway Control in Neurospora crassa and Comparative Analysis of the Gcn4 and CPC1 Regulons  

Microsoft Academic Search

Identifying and characterizing transcriptional regulatory networks is important for guiding experimental tests on gene function. The characterization of regulatory networks allows comparisons among both closely and distantly related species, providing insight into network evolution, which is predicted to correlate with the adaptation of different species to particular environmental niches. One of the most intensely studied regulatory factors in the yeast

Chaoguang Tian; Takao Kasuga; Matthew S. Sachs; N. Louise Glass

2007-01-01

13

Inferring condition-specific modulation of transcription factor activity in yeast through regulon-based analysis of genomewide expression  

Microsoft Academic Search

Background: A key goal of systems biology is to understand how genomewide mRNA expression levels are controlled by transcription factors (TFs) in a condition-specific fashion. TF activity is frequently modulated at the post-translational level through ligand binding, covalent modification, or changes in sub-cellular localization. In this paper, we demonstrate how prior information about regulatory network connectivity can be exploited to

André Boorsma; Xiang-Jun Lu; Anna Zakrzewska; Frans M. Klis; Harmen J. Bussemaker

2008-01-01

14

Inferring Condition-Specific Modulation of Transcription Factor Activity in Yeast through Regulon-Based Analysis of Genomewide Expression  

Microsoft Academic Search

BackgroundA key goal of systems biology is to understand how genomewide mRNA expression levels are controlled by transcription factors (TFs) in a condition-specific fashion. TF activity is frequently modulated at the post-translational level through ligand binding, covalent modification, or changes in sub-cellular localization. In this paper, we demonstrate how prior information about regulatory network connectivity can be exploited to infer

André Boorsma; Xiang-Jun Lu; Anna Zakrzewska; Frans M. Klis; Harmen J. Bussemaker; Guillaume Bourque

2008-01-01

15

Functional Analysis of 14 Genes That Constitute the Purine Catabolic Pathway in Bacillus subtilis and Evidence for a Novel Regulon Controlled by the PucR Transcription Activator  

PubMed Central

The soil bacterium Bacillus subtilis has developed a highly controlled system for the utilization of a diverse array of low-molecular-weight compounds as a nitrogen source when the preferred nitrogen sources, e.g., glutamate plus ammonia, are exhausted. We have identified such a system for the utilization of purines as nitrogen source in B. subtilis. Based on growth studies of strains with knockout mutations in genes, complemented with enzyme analysis, we could ascribe functions to 14 genes encoding enzymes or proteins of the purine degradation pathway. A functional xanthine dehydrogenase requires expression of five genes (pucA, pucB, pucC, pucD, and pucE). Uricase activity is encoded by the pucL and pucM genes, and a uric acid transport system is encoded by pucJ and pucK. Allantoinase is encoded by the pucH gene, and allantoin permease is encoded by the pucI gene. Allantoate amidohydrolase is encoded by pucF. In a pucR mutant, the level of expression was low for all genes tested, indicating that PucR is a positive regulator of puc gene expression. All 14 genes except pucI are located in a gene cluster at 284 to 285° on the chromosome and are contained in six transcription units, which are expressed when cells are grown with glutamate as the nitrogen source (limiting conditions), but not when grown on glutamate plus ammonia (excess conditions). Our data suggest that the 14 genes and the gde gene, encoding guanine deaminase, constitute a regulon controlled by the pucR gene product. Allantoic acid, allantoin, and uric acid were all found to function as effector molecules for PucR-dependent regulation of puc gene expression. When cells were grown in the presence of glutamate plus allantoin, a 3- to 10-fold increase in expression was seen for most of the genes. However, expression of the pucABCDE unit was decreased 16-fold, while expression of pucR was decreased 4-fold in the presence of allantoin. We have identified genes of the purine degradation pathway in B. subtilis and showed that their expression is subject to both general nitrogen catabolite control and pathway-specific control. PMID:11344136

Schultz, Anna C.; Nygaard, Per; Saxild, Hans H.

2001-01-01

16

Differential Transcription of the tcpPH Operon Confers Biotype-Specific Control of the Vibrio cholerae ToxR Virulence Regulon  

Microsoft Academic Search

Epidemic strains of Vibrio cholerae O1 are divided into two biotypes, classical and El Tor. In both biotypes, regulation of virulence gene expression depends on a cascade in which ToxR activates expression of ToxT, and ToxT activates expression of cholera toxin and other virulence genes. In the classical biotype, maximal expression of this ToxR regulon in vitro occurs at 30°C

YVETTE M. MURLEY; PATRICIA A. CARROLL; KAREN SKORUPSKI; RONALD K. TAYLOR; STEPHEN B. CALDERWOOD

1999-01-01

17

Comparison of the PhoPQ Regulon in Escherichia coli and Salmonella typhimurium  

E-print Network

Comparison of the PhoPQ Regulon in Escherichia coli and Salmonella typhimurium Pieter Monsieurs,1 as a transcriptional regulator that responds to Mg2+ starvation both in Escherichia coli and Salmonella typhimurium.g., pathogenesis in S. typhimurium). Key words: PhoPQ regulon -- Escherichia coli -- Salmonella typhimirium

18

Characterization of the GbdR Regulon in Pseudomonas aeruginosa  

PubMed Central

Pseudomonas aeruginosa displays tremendous metabolic diversity, controlled in part by the abundance of transcription regulators in the genome. We have been investigating P. aeruginosa's response to the host, particularly changes regulated by the host-derived quaternary amines choline and glycine betaine (GB). We previously identified GbdR as an AraC family transcription factor that directly regulates choline acquisition from host phospholipids (via binding to plcH and pchP promoters), is required for catabolism of the choline metabolite GB, and is an activator that induces transcription in response to GB or dimethylglycine. Our goal was to characterize the GbdR regulon in P. aeruginosa by using genetics and chemical biology in combination with transcriptomics and in vitro DNA-binding assays. Here we show that GbdR activation regulates transcription of 26 genes from 12 promoters, 11 of which have measureable binding to GbdR in vitro. The GbdR regulon includes the genes encoding GB, dimethylglycine, sarcosine, glycine, and serine catabolic enzymes and the BetX and CbcXWV quaternary amine transport proteins. We characterized the GbdR consensus binding site and used it to identify that the recently characterized acetylcholine esterase gene, choE (PA4921), is also regulated by GbdR. The regulon member not directly controlled by GbdR is the secreted lipase gene lipA, which was also the only regulon member repressed under GbdR-activating conditions. Determination of the GbdR regulon provides deeper understanding of how GbdR links bacterial metabolism and virulence. Additionally, identification of two uncharacterized regulon members suggests roles for these proteins in response to choline metabolites. PMID:24097953

Hampel, Ken J.; LaBauve, Annette E.; Meadows, Jamie A.; Fitzsimmons, Liam F.; Nock, Adam M.

2014-01-01

19

Transcriptome profiling defines a novel regulon modulated by the LysR-type transcriptional regulator MexT in Pseudomonas aeruginosa  

PubMed Central

The LysR-family regulator MexT modulates the expression of the MexEF-OprN efflux system in the human pathogen Pseudomonas aeruginosa. Recently, we demonstrated that MexT regulates certain virulence phenotypes, including the type-three secretion system and early attachment independent of its role in regulating MexEF-OprN. In this study, transcriptome profiling was utilized to investigate the global nature of MexT regulation in P. aeruginosa PAO1 and an isogenic mexEF mutant. Twelve genes of unknown function were highly induced by overexpressing MexT independent of MexEF-OprN. A well-conserved DNA motif was identified in the upstream regulatory region of nine of these genes and upstream of mexE. Reporter fusion analysis demonstrated that the expression of the genes was significantly induced by MexT in P. aeruginosa and a heterogenous Escherichia coli strain and that the conserved sequence was required for this induction. The conserved DNA motif was further characterized as the MexT binding site by site-directed mutagenesis and electrophoretic mobility shift assays. Genes containing this conserved regulatory sequence were identified across other Pseudomonas species, and their expression was activated by MexT. Thus, a novel regulon directly modulated by MexT, that includes but is independent of mexEF-oprN, has been identified. PMID:19846594

Tian, Zhe-Xian; Fargier, Emilie; Mac Aogáin, Micheál; Adams, Claire; Wang, Yi-Ping; O’Gara, Fergal

2009-01-01

20

Synthesis of chloroplast galactolipids in apicomplexan parasites.  

PubMed

Monogalactosyldiacylglycerol and digalactosyldiacylglycerol are major chloroplast lipids of algae and land plants and are synthesized within the plastid envelope. Here we report that in Toxoplasma gondii and Plasmodium falciparum lysates, radiolabeled UDP-galactose is incorporated into monogalactosylcerebrosides, monogalactosyldiacylglycerol, and digalactosyldiacylglycerol due to distinct enzymological activities. Furthermore, DGDG is immunologically detected in apicomplexans. PMID:12456013

Maréchal, Eric; Azzouz, Nahid; de Macedo, Cristiana Santos; Block, Maryse A; Feagin, Jean E; Schwarz, Ralph T; Joyard, Jacques

2002-08-01

21

Quorum sensing transcriptional regulator QseA is essential for the expression of multiple virulence regulons of enterohemorrhagic Escherichia coli O157:H7  

Technology Transfer Automated Retrieval System (TEKTRAN)

Introduction and Objectives: QseA is one of several transcriptional regulators that regulates the virulence gene expression in enterohemorrhagic Escherichia coli (EHEC) O157:H7 through quorum sensing. QseA has been shown to regulate the expression of the locus of enterocyte effacement (LEE), non-LEE...

22

ExsD is a negative regulator of the Pseudomonas aeruginosa type III secretion regulon.  

PubMed

Expression of the Pseudomonas aeruginosa type III secretion system is induced by contact with eukaryotic cells, serum or low Ca2+ concentrations. We report that ExsD, a unique protein, is a negative regulator of the type III regulon. Localization studies indicate that ExsD is not secreted by P. aeruginosa. To determine the role of exsD, a non-polar deletion was returned to the chromosome by allelic exchange. The delta exsD mutant is competent for type III secretion and translocation of the ExoU cytotoxin to eukaryotic host cells. To examine the effect of ExsD on transcription, lacZ transcriptional reporter fusions were integrated into the chromosome. Promoters controlling transcription of genes encoding the type III secretory, regulatory and effector proteins demonstrated significant derepression in the delta exsD background. Expression of ExsD from a multicopy plasmid completely repressed transcription of the regulon. Although a mutant in pscC, encoding a structural component of the type III translocase, is repressed for expression of the regulon, a delta exsD, pscC:: omega double mutant is derepressed. Bacterial two-hybrid data indicate that ExsD binds the transcriptional activator of the regulon, ExsA. We conclude that ExsD is a negative regulator and propose that ExsD functions as an ExsA antiactivator to regulate transcription of the regulon. PMID:12421316

McCaw, Michelle L; Lykken, Guinevere L; Singh, Pradeep K; Yahr, Timothy L

2002-11-01

23

Calcium Regulation and Signaling in Apicomplexan Parasites  

Microsoft Academic Search

Apicomplexan parasites rely on calcium-mediated signaling for a variety of vital functions including protein secretion, motility,\\u000a cell invasion, and differentiation. These functions are controlled by a variety of specialized systems for uptake and release\\u000a of calcium, which acts as a second messenger, and on the functions of calcium-dependent proteins. Defining these systems in\\u000a parasites has been complicated by their evolutionary

Kisaburo Nagamune; Silvia N. Moreno; Eduardo N. Chini; L. David Sibley

24

Apicomplexan apicortins possess a long disordered N-terminal extension.  

PubMed

A new protein, termed apicortin, has recently been identified, which occurs only in the placozoan animal Trichoplax adhaerens and in the genomes of all currently sequenced apicomplexan parasites (e.g., Toxoplasma, Plasmodium, etc.). Apicortins unite two conserved domains, a DCX motif and a partial p25alpha sequence, which are singly found in diverse other proteins, in doublecortins and TPPPs, respectively. Here I show that although apicortin has a limited phylogenomic distribution, its occurrence is broader than thought previously. It has been identified in another primitive opisthokont, in the chytrid fungus, Spizellomyces punctatus. Apicortins can be divided into two subgroups: apicomplexan and non-apicomplexan ones. The main difference is that the former ones possess a long, N-terminal extension predicted to be disordered, which is missing in the other subgroup. The appearance of the extension in apicomplexan apicortins is an "innovation" of this phylum, and may play a functional role in the protein-protein interactions. PMID:21463710

Orosz, Ferenc

2011-07-01

25

Definition of the ?W Regulon of Bacillus subtilis in the Absence of Stress  

PubMed Central

Bacteria employ extracytoplasmic function (ECF) sigma factors for their responses to environmental stresses. Despite intensive research, the molecular dissection of ECF sigma factor regulons has remained a major challenge due to overlaps in the ECF sigma factor-regulated genes and the stimuli that activate the different ECF sigma factors. Here we have employed tiling arrays to single out the ECF ?W regulon of the Gram-positive bacterium Bacillus subtilis from the overlapping ECF ?X, ?Y, and ?M regulons. For this purpose, we profiled the transcriptome of a B. subtilis sigW mutant under non-stress conditions to select candidate genes that are strictly ?W-regulated. Under these conditions, ?W exhibits a basal level of activity. Subsequently, we verified the ?W-dependency of candidate genes by comparing their transcript profiles to transcriptome data obtained with the parental B. subtilis strain 168 grown under 104 different conditions, including relevant stress conditions, such as salt shock. In addition, we investigated the transcriptomes of rasP or prsW mutant strains that lack the proteases involved in the degradation of the ?W anti-sigma factor RsiW and subsequent activation of the ?W-regulon. Taken together, our studies identify 89 genes as being strictly ?W-regulated, including several genes for non-coding RNAs. The effects of rasP or prsW mutations on the expression of ?W-dependent genes were relatively mild, which implies that ?W-dependent transcription under non-stress conditions is not strictly related to RasP and PrsW. Lastly, we show that the pleiotropic phenotype of rasP mutant cells, which have defects in competence development, protein secretion and membrane protein production, is not mirrored in the transcript profile of these cells. This implies that RasP is not only important for transcriptional regulation via ?W, but that this membrane protease also exerts other important post-transcriptional regulatory functions. PMID:23155385

Zweers, Jessica C.; Nicolas, Pierre; Wiegert, Thomas; van Dijl, Jan Maarten; Denham, Emma L.

2012-01-01

26

Identification of the CRE-1 Cellulolytic Regulon in Neurospora crassa  

PubMed Central

Background In filamentous ascomycete fungi, the utilization of alternate carbon sources is influenced by the zinc finger transcription factor CreA/CRE-1, which encodes a carbon catabolite repressor protein homologous to Mig1 from Saccharomyces cerevisiae. In Neurospora crassa, deletion of cre-1 results in increased secretion of amylase and ?-galactosidase. Methodology/Principal Findings Here we show that a strain carrying a deletion of cre-1 has increased cellulolytic activity and increased expression of cellulolytic genes during growth on crystalline cellulose (Avicel). Constitutive expression of cre-1 complements the phenotype of a N. crassa ?cre-1 strain grown on Avicel, and also results in stronger repression of cellulolytic protein secretion and enzyme activity. We determined the CRE-1 regulon by investigating the secretome and transcriptome of a ?cre-1 strain as compared to wild type when grown on Avicel versus minimal medium. Chromatin immunoprecipitation-PCR of putative target genes showed that CRE-1 binds to only some adjacent 5?-SYGGRG-3? motifs, consistent with previous findings in other fungi, and suggests that unidentified additional regulatory factors affect CRE-1 binding to promoter regions. Characterization of 30 mutants containing deletions in genes whose expression level increased in a ?cre-1 strain under cellulolytic conditions identified novel genes that affect cellulase activity and protein secretion. Conclusions/Significance Our data provide comprehensive information on the CRE-1 regulon in N. crassa and contribute to deciphering the global role of carbon catabolite repression in filamentous ascomycete fungi during plant cell wall deconstruction. PMID:21980519

Sun, Jianping; Glass, N. Louise

2011-01-01

27

N-Acetylgalactosamine Utilization Pathway and Regulon in Proteobacteria  

PubMed Central

We used a comparative genomics approach to reconstruct the N-acetyl-d-galactosamine (GalNAc) and galactosamine (GalN) utilization pathways and transcriptional regulons in Proteobacteria. The reconstructed GalNAc/GalN utilization pathways include multiple novel genes with specific functional roles. Most of the pathway variations were attributed to the amino sugar transport, phosphorylation, and deacetylation steps, whereas the downstream catabolic enzymes in the pathway were largely conserved. The predicted GalNAc kinase AgaK, the novel variant of GalNAc-6-phosphate deacetylase AgaAII and the GalN-6-phosphate deaminase AgaS from Shewanella sp. ANA-3 were validated in vitro using individual enzymatic assays and reconstitution of the three-step pathway. By using genetic techniques, we confirmed that AgaS but not AgaI functions as the main GalN-6-P deaminase in the GalNAc/GalN utilization pathway in Escherichia coli. Regulons controlled by AgaR repressors were reconstructed by bioinformatics in most proteobacterial genomes encoding GalNAc pathways. Candidate AgaR-binding motifs share a common sequence with consensus CTTTC that was found in multiple copies and arrangements in regulatory regions of aga genes. This study provides comprehensive insights into the common and distinctive features of the GalNAc/GalN catabolism and its regulation in diverse Proteobacteria. PMID:22711537

Leyn, Semen A.; Gao, Fang; Yang, Chen; Rodionov, Dmitry A.

2012-01-01

28

Characterization of the YdeO Regulon in Escherichia coli  

PubMed Central

Enterobacteria are able to survive under stressful conditions within animals, such as acidic conditions in the stomach, bile salts during transfer to the intestine and anaerobic conditions within the intestine. The glutamate-dependent (GAD) system plays a major role in acid resistance in Escherichia coli, and expression of the GAD system is controlled by the regulatory cascade consisting of EvgAS > YdeO > GadE. To understand the YdeO regulon in vivo, we used ChIP-chip to interrogate the E. coli genome for candidate YdeO binding sites. All of the seven operons identified by ChIP-chip as being potentially regulated by YdeO were confirmed as being under the direct control of YdeO using RT-qPCR, EMSA, DNaseI-footprinting and reporter assays. Within this YdeO regulon, we identified four stress-response transcription factors, DctR, NhaR, GadE, and GadW and enzymes for anaerobic respiration. Both GadE and GadW are involved in regulation of the GAD system and NhaR is an activator for the sodium/proton antiporter gene. In conjunction with co-transcribed Slp, DctR is involved in protection against metabolic endoproducts under acidic conditions. Taken all together, we suggest that YdeO is a key regulator of E. coli survival in both acidic and anaerobic conditions. PMID:25375160

Yamanaka, Yuki; Oshima, Taku; Ishihama, Akira; Yamamoto, Kaneyoshi

2014-01-01

29

Microarray Analysis of the Ler Regulon in Enteropathogenic and Enterohaemorrhagic Escherichia coli Strains  

PubMed Central

The type III protein secretion system is an important pathogenicity factor of enteropathogenic and enterohaemorrhagic Escherichia coli pathotypes. The genes encoding this apparatus are located on a pathogenicity island (the locus of enterocyte effacement) and are transcriptionally activated by the master regulator Ler. In each pathotype Ler is also known to regulate genes located elsewhere on the chromosome, but the full extent of the Ler regulon is unclear, especially for enteropathogenic E. coli. The Ler regulon was defined for two strains of E. coli: E2348/69 (enteropathogenic) and EDL933 (enterohaemorrhagic) in mid and late log phases of growth by DNA microarray analysis of the transcriptomes of wild-type and ler mutant versions of each strain. In both strains the Ler regulon is focused on the locus of enterocyte effacement – all major transcriptional units of which are activated by Ler, with the sole exception of the LEE1 operon during mid-log phase growth in E2348/69. However, the Ler regulon does extend more widely and also includes unlinked pathogenicity genes: in E2348/69 more than 50 genes outside of this locus were regulated, including a number of known or potential pathogenicity determinants; in EDL933 only 4 extra-LEE genes, again including known pathogenicity factors, were activated. In E2348/69, where the Ler regulon is clearly growth phase dependent, a number of genes including the plasmid-encoded regulator operon perABC, were found to be negatively regulated by Ler. Negative regulation by Ler of PerC, itself a positive regulator of the ler promoter, suggests a negative feedback loop involving these proteins. PMID:24454682

Shaw, Robert K.; Islam, Md. Shahidul; Patel, Mala; Snyder, Lori A. S.; Lee, David J.; Penn, Charles W.; Busby, Stephen J. W.; Pallen, Mark J.

2014-01-01

30

Microarray analysis of the Ler regulon in enteropathogenic and enterohaemorrhagic Escherichia coli strains.  

PubMed

The type III protein secretion system is an important pathogenicity factor of enteropathogenic and enterohaemorrhagic Escherichia coli pathotypes. The genes encoding this apparatus are located on a pathogenicity island (the locus of enterocyte effacement) and are transcriptionally activated by the master regulator Ler. In each pathotype Ler is also known to regulate genes located elsewhere on the chromosome, but the full extent of the Ler regulon is unclear, especially for enteropathogenic E. coli. The Ler regulon was defined for two strains of E. coli: E2348/69 (enteropathogenic) and EDL933 (enterohaemorrhagic) in mid and late log phases of growth by DNA microarray analysis of the transcriptomes of wild-type and ler mutant versions of each strain. In both strains the Ler regulon is focused on the locus of enterocyte effacement - all major transcriptional units of which are activated by Ler, with the sole exception of the LEE1 operon during mid-log phase growth in E2348/69. However, the Ler regulon does extend more widely and also includes unlinked pathogenicity genes: in E2348/69 more than 50 genes outside of this locus were regulated, including a number of known or potential pathogenicity determinants; in EDL933 only 4 extra-LEE genes, again including known pathogenicity factors, were activated. In E2348/69, where the Ler regulon is clearly growth phase dependent, a number of genes including the plasmid-encoded regulator operon perABC, were found to be negatively regulated by Ler. Negative regulation by Ler of PerC, itself a positive regulator of the ler promoter, suggests a negative feedback loop involving these proteins. PMID:24454682

Bingle, Lewis E H; Constantinidou, Chrystala; Shaw, Robert K; Islam, Md Shahidul; Patel, Mala; Snyder, Lori A S; Lee, David J; Penn, Charles W; Busby, Stephen J W; Pallen, Mark J

2014-01-01

31

Comparative Genomics of DtxR Family Regulons for Metal Homeostasis in Archaea.  

PubMed

The DtxR family consists of metal-dependent transcription factors (DtxR-TFs) that regulate the expression of genes involved in metal homeostasis in the cell. The majority of characterized DtxR-TFs belong to Bacteria. In the current work, we applied a comparative genomics approach to predict DNA-binding sites and reconstruct regulons for DtxR-TFs in Archaea. As a result, we inferred 575 candidate binding sites for 139 DtxR-TFs in 77 genomes from 15 taxonomic orders. Novel DNA motifs of archaeal DtxR-TFs that have a common palindromic structure were classified into 10 distinct groups. By combining functional regulon reconstructions with phylogenetic analysis, we selected 28 DtxR-TF clades and assigned them metal specificities and regulator names. The reconstructed FetR (ferrous iron), MntR (manganese), and ZntR (zinc) regulons largely contain known or putative metal uptake transporters from the FeoAB, NRAMP, ZIP, and TroA families. A novel family of putative iron transporters (named Irt), including multiple FetR-regulated paralogs, was identified in iron-oxidizing Archaea from the Sulfolobales order. The reconstructed DtxR-TF regulons were reconciled with available transcriptomics data in Archaeoglobus, Halobacterium, and Thermococcus spp. PMID:25404694

Leyn, Semen A; Rodionov, Dmitry A

2015-02-01

32

folA, a New Member of the TyrR Regulon in Escherichia coli K-12  

Microsoft Academic Search

The TyrR regulon of Escherichia coli K-12 comprises at least eight separate transcription units (6). These various transcrip- tion units have been identified over time by observing fluctu- ations in the levels of particular proteins caused by the pres- ence or absence of the amino acid phenylalanine or tyrosine in the medium or as a result of the introduction of

Ji Yang; Yoshito Ogawa; Helen Camakaris; Tomohiro Shimada; Akira Ishihama; A. J. Pittard

2007-01-01

33

Toxoplasma gondii Rhoptry Discharge Correlates with Activation of the Early Growth Response 2 Host Cell Transcription Factor  

Microsoft Academic Search

Toxoplasma gondii is a ubiquitous apicomplexan parasite that can cause severe disease in fetuses and immune-compromised patients. Rhoptries, micronemes, and dense granules, which are secretory or- ganelles unique to Toxoplasma and other apicomplexan parasites, play critical roles in parasite growth and virulence. To understand how these organelles modulate infected host cells, we sought to identify host cell transcription factors triggered

Eric D. Phelps; Kristin R. Sweeney; Ira J. Blader

2008-01-01

34

The shikimate pathway in apicomplexan parasites: implications for drug development.  

PubMed

The shikimate pathway provides basic building blocks for a variety of aromatic compounds including aromatic amino acids, ubiquinone, folate and compounds of the secondary metabolism. The seven enzymatic reactions of the pathway lead to the generation of chorismate from simple products of the carbohydrate metabolism, namely erythrose 4-phosphate and phosphoenolpyruvate. The shikimate pathway is present in plants, bacteria, fungi and chromalveolata to which the apicomplexan parasites belong. As it is absent from humans, the enzymes of the shikimate pathway are attractive targets for antimicrobial drug development. Inhibition of the pathway is effective in controlling growth of certain apicomplexan parasites including the malaria parasite Plasmodium falciparum. Yet, despite being an attractive drug target, our knowledge of the shikimate pathway in this parasite group is lacking. The current review summarizes the available information and discusses aspects of the genetic organization of the shikimate pathway in apicomplexan parasites. Compounds acting on shikimate pathway enzymes will be presented and discussed in light of their impact for antiapicomplexan/antiplasmodial drug development. PMID:23747859

Derrer, Bianca; Macheroux, Peter; Kappes, Barbara

2013-01-01

35

iRegulon: From a Gene List to a Gene Regulatory Network Using Large Motif and Track Collections  

PubMed Central

Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from http://iregulon.aertslab.org. PMID:25058159

Imrichová, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein

2014-01-01

36

A Novel Candidate Vaccine for Cytauxzoonosis Inferred from Comparative Apicomplexan Genomics  

PubMed Central

Cytauxzoonosis is an emerging infectious disease of domestic cats (Felis catus) caused by the apicomplexan protozoan parasite Cytauxzoon felis. The growing epidemic, with its high morbidity and mortality points to the need for a protective vaccine against cytauxzoonosis. Unfortunately, the causative agent has yet to be cultured continuously in vitro, rendering traditional vaccine development approaches beyond reach. Here we report the use of comparative genomics to computationally and experimentally interpret the C. felis genome to identify a novel candidate vaccine antigen for cytauxzoonosis. As a starting point we sequenced, assembled, and annotated the C. felis genome and the proteins it encodes. Whole genome alignment revealed considerable conserved synteny with other apicomplexans. In particular, alignments with the bovine parasite Theileria parva revealed that a C. felis gene, cf76, is syntenic to p67 (the leading vaccine candidate for bovine theileriosis), despite a lack of significant sequence similarity. Recombinant subdomains of cf76 were challenged with survivor-cat antiserum and found to be highly seroreactive. Comparison of eleven geographically diverse samples from the south-central and southeastern USA demonstrated 91–100% amino acid sequence identity across cf76, including a high level of conservation in an immunogenic 226 amino acid (24 kDa) carboxyl terminal domain. Using in situ hybridization, transcription of cf76 was documented in the schizogenous stage of parasite replication, the life stage that is believed to be the most important for development of a protective immune response. Collectively, these data point to identification of the first potential vaccine candidate antigen for cytauxzoonosis. Further, our bioinformatic approach emphasizes the use of comparative genomics as an accelerated path to developing vaccines against experimentally intractable pathogens. PMID:23977000

Tarigo, Jaime L.; Scholl, Elizabeth H.; Bird, David McK.; Brown, Corrie C.; Cohn, Leah A.; Dean, Gregg A.; Levy, Michael G.; Doolan, Denise L.; Trieu, Angela; Nordone, Shila K.; Felgner, Philip L.; Vigil, Adam; Birkenheuer, Adam J.

2013-01-01

37

Modulation of the Host Cell Proteome by the Intracellular Apicomplexan Parasite Toxoplasma gondii?  

PubMed Central

To investigate how intracellular parasites manipulate their host cell environment at the molecular level, we undertook a quantitative proteomic study of cells following infection with the apicomplexan parasite Toxoplasma gondii. Using conventional two-dimensional electrophoresis, difference gel electrophoresis (DIGE), and mass spectrometry, we identified host proteins that were consistently modulated in expression following infection. We detected modification of protein expression in key metabolic pathways, including glycolysis, lipid and sterol metabolism, mitosis, apoptosis, and structural-protein expression, suggestive of global reprogramming of cell metabolism by the parasite. Many of the differentially expressed proteins had not been previously implicated in the response to the parasite, while others provide important corroborative protein evidence for previously proposed hypotheses of pathogen-cell interactions. Significantly, over one-third of all modulated proteins were mitochondrial, and this was further investigated by DIGE analysis of a mitochondrion-enriched preparation from infected cells. Comparison of our proteomic data with previous transcriptional studies suggested that a complex relationship exits between transcription and protein expression that may be partly explained by posttranslational modifications of proteins and revealed the importance of investigating protein changes when interpreting transcriptional data. To investigate this further, we used phosphatase treatment and DIGE to demonstrate changes in the phosphorylation states of several key proteins following infection. Overall, our findings indicate that the host cell proteome responds in a dramatic way to T. gondii invasion, in terms of both protein expression changes and protein modifications, and reveal a complex and intimate molecular relationship between host and parasite. PMID:17967855

Nelson, M. M.; Jones, A. R.; Carmen, J. C.; Sinai, A. P.; Burchmore, R.; Wastling, J. M.

2008-01-01

38

Conservation of a Gliding Motility and Cell Invasion Machinery in Apicomplexan Parasites  

Microsoft Academic Search

Most Apicomplexan parasites, including the human pathogens Plasmodium , Toxoplasma , and Cryptosporidium , actively invade host cells and display gliding motility, both actions powered by parasite mi- crofilaments. In Plasmodium sporozoites, thrombo- spondin-related anonymous protein (TRAP), a mem- ber of a group of Apicomplexan transmembrane proteins that have common adhesion domains, is neces- sary for gliding motility and infection

Stefan Kappe; Thomas Bruderer; Soren Gantt; Hisashi Fujioka; Victor Nussenzweig; Robert Ménard

1999-01-01

39

The small FNR regulon of Neisseria gonorrhoeae: comparison with the larger Escherichia coli FNR regulon and interaction with the NarQ-NarP regulon  

PubMed Central

Background Neisseria gonorrhoeae can survive during oxygen starvation by reducing nitrite to nitrous oxide catalysed by the nitrite and nitric oxide reductases, AniA and NorB. The oxygen-sensing transcription factor, FNR, is essential for transcription activation at the aniA promoter, and full activation also requires the two-component regulatory system, NarQ-NarP, and the presence of nitrite. The only other gene known to be activated by the gonococcal FNR is ccp encoding a cytochrome c peroxidase, and no FNR-repressed genes have been reported in the gonococcus. In contrast, FNR acts as both an activator and repressor involved in the control of more than 100 operons in E. coli regulating major changes in the adaptation from aerobic to anaerobic conditions. In this study we have performed a microarray-led investigation of the FNR-mediated responses in N. gonorrhoeae to determine the physiological similarities and differences in the role of FNR in cellular regulation in this species. Results Microarray experiments show that N. gonorrhoeae FNR controls a much smaller regulon than its E. coli counterpart; it activates transcription of aniA and thirteen other genes, and represses transcription of six genes that include dnrN and norB. Having previously shown that a single amino acid substitution is sufficient to enable the gonococcal FNR to complement an E. coli fnr mutation, we investigated whether the gonococcal NarQ-NarP can substitute for E. coli NarX-NarL or NarQ-NarP. A plasmid expressing gonococcal narQ-narP was unable to complement E. coli narQP or narXL mutants, and was insensitive to nitrate or nitrite. Mutations that progressively changed the periplasmic nitrate sensing region, the P box, of E. coli NarQ to the sequence of the corresponding region of gonococcal NarQ resulted in loss of transcription activation in response to the availability of either nitrate or nitrite. However, the previously reported ligand-insensitive ability of gonococcal NarQ, the "locked on" phenotype, to activate either E. coli NarL or NarP was confirmed. Conclusion Despite the sequence similarities between transcription activators of E. coli and N. gonorrhoeae, these results emphasise the fundamental differences in transcription regulation between these two types of pathogenic bacteria. PMID:17261178

Whitehead, Rebekah N; Overton, Tim W; Snyder, Lori AS; McGowan, Simon J; Smith, Harry; Cole, Jeff A; Saunders, Nigel J

2007-01-01

40

Genomic Reconstruction of the Transcriptional Regulatory Network in Bacillus subtilis  

PubMed Central

The adaptation of microorganisms to their environment is controlled by complex transcriptional regulatory networks (TRNs), which are still only partially understood even for model species. Genome scale annotation of regulatory features of genes and TRN reconstruction are challenging tasks of microbial genomics. We used the knowledge-driven comparative-genomics approach implemented in the RegPredict Web server to infer TRN in the model Gram-positive bacterium Bacillus subtilis and 10 related Bacillales species. For transcription factor (TF) regulons, we combined the available information from the DBTBS database and the literature with bioinformatics tools, allowing inference of TF binding sites (TFBSs), comparative analysis of the genomic context of predicted TFBSs, functional assignment of target genes, and effector prediction. For RNA regulons, we used known RNA regulatory motifs collected in the Rfam database to scan genomes and analyze the genomic context of new RNA sites. The inferred TRN in B. subtilis comprises regulons for 129 TFs and 24 regulatory RNA families. First, we analyzed 66 TF regulons with previously known TFBSs in B. subtilis and projected them to other Bacillales genomes, resulting in refinement of TFBS motifs and identification of novel regulon members. Second, we inferred motifs and described regulons for 28 experimentally studied TFs with previously unknown TFBSs. Third, we discovered novel motifs and reconstructed regulons for 36 previously uncharacterized TFs. The inferred collection of regulons is available in the RegPrecise database (http://regprecise.lbl.gov/) and can be used in genetic experiments, metabolic modeling, and evolutionary analysis. PMID:23504016

Leyn, Semen A.; Kazanov, Marat D.; Sernova, Natalia V.; Ermakova, Ekaterina O.; Novichkov, Pavel S.

2013-01-01

41

Comparison of Protective Immune Responses to Apicomplexan Parasites  

PubMed Central

Members of the phylum Apicomplexa, which includes the species Plasmodium, Eimeria, Toxoplasma, and Babesia amongst others, are the most successful intracellular pathogens known to humankind. The widespread acquisition of antimicrobial resistance to most drugs used to date has sparked a great deal of research and commercial interest in the development of vaccines as alternative control strategies. A few antigens from the asexual and sexual stages of apicomplexan development have been identified and their genes characterised; however, the fine cellular and molecular details of the effector mechanisms crucial for parasite inhibition and stimulation of protective immunity are still not entirely understood. This paper provides an overview of what is currently known about the protective immune response against the various types of apicomplexan parasites and focuses mainly on the similarities of these pathogens and their host interaction. Finally, the evolutionary relationships of these parasites and their hosts, as well as the modulation of immune functions that are critical in determining the outcome of the infection by these pathogenic organisms, are discussed. PMID:21876783

Frölich, Sonja; Entzeroth, Rolf; Wallach, Michael

2012-01-01

42

Evolution of a Bacterial Regulon Controlling Virulence Homeostasis  

E-print Network

Evolution of a Bacterial Regulon Controlling Virulence and Mg2+ Homeostasis J. Christian Perez1,2¤a governs virulence and Mg2+ homeostasis in several bacterial species. We establish that the ancestral Pho Regulon Controlling Virulence and Mg2+ Homeostasis. PLoS Genet 5(3): e1000428. doi:10.1371/journal

Granada, Universidad de

43

Members of the Sinorhizobium meliloti ChvI regulon identified by a DNA binding screen  

PubMed Central

Background The Sinorhizobium meliloti ExoS/ChvI two component regulatory system is required for N2-fixing symbiosis and exopolysaccharide synthesis. Orthologous systems are present in other Alphaproteobacteria, and in many instances have been shown to be necessary for normal interactions with corresponding eukaryotic hosts. Only a few transcriptional regulation targets have been determined, and as a result there is limited understanding of the mechanisms that are controlled by the system. Results In an attempt to better define the members of the regulon, we have applied a simple in vitro electrophoretic screen for DNA fragments that are bound by the ChvI response regulator protein. Several putative transcriptional targets were identified and three were further examined by reporter gene fusion experiments for transcriptional regulation. Two were confirmed to be repressed by ChvI, while one was activated by ChvI. Conclusions Our results suggest a role for ChvI as both a direct activator and repressor of transcription. The identities and functions of many of these genes suggest explanations for some aspects of the pleiotropic phenotype of exoS and chvI mutants. This work paves the way for in depth characterization of the ExoS/ChvI regulon and its potential role in directing bacteria-host relationships. PMID:23758731

2013-01-01

44

Relation of intracellular signal levels and promoter activities in the gal regulon of Escherichia coli  

PubMed Central

Transcription of many genes is regulated by combinations of multiple signals. In Escherichia coli combinatorial control is typical in the case of operons related to utilization of different sugars in the absence of glucose. To understand regulation of the transport and metabolic pathways in the galactose system, we measured activities of the six gal regulon promoters simultaneously, using an in vitro transcription system containing purified components. Input functions were computed based on the experimental measurements. We observed four different shapes of input functions. From the results we can conclude that the structure of the regulatory network is insufficient for the determination of signal integration. It is the actual structure of the promoter and regulatory region, the mechanism of transcription regulation, and the interplay between transcription factors that shape the input function to be suitable for adaptation. PMID:19559028

Krishna, Sandeep; Orosz, László; Sneppen, Kim; Adhya, Sankar; Semsey, Szabolcs

2009-01-01

45

The parasite specific substitution matrices improve the annotation of apicomplexan proteins  

PubMed Central

Background A number of apicomplexan genomes have been sequenced successfully in recent years and this would help in understanding the biology of apicomplexan parasites. The members of the phylum Apicomplexa are important protozoan parasites (Plasmodium, Toxoplasma and Cryptosporidium etc) that cause some of the deadly diseases in humans and animals. In our earlier studies, we have shown that the standard BLOSUM matrices are not suitable for compositionally biased apicomplexan proteins. So we developed a novel series (SMAT and PfFSmat60) of substitution matrices which performed better in comparison to standard BLOSUM matrices and developed ApicoAlign, a sequence search and alignment tool for apicomplexan proteins. In this study, we demonstrate the higher specificity of these matrices and make an attempt to improve the annotation of apicomplexan kinases and proteases. Results The ROC curves proved that SMAT80 performs best for apicomplexan proteins followed by compositionally adjusted BLOSUM62 (PSI-BLAST searches), BLOSUM90 and BLOSUM62 matrices in terms of detecting true positives. The poor E-values and/or bit scores given by SMAT80 matrix for the experimentally identified coccidia-specific oocyst wall proteins against hematozoan (non-coccidian) parasites further supported the higher specificity of the same. SMAT80 uniquely detected (missed by BLOSUM) orthologs for 1374 apicomplexan hypothetical proteins against SwissProt database and predicted 70 kinases and 17 proteases. Further analysis confirmed the conservation of functional residues of kinase domain in one of the SMAT80 detected kinases. Similarly, one of the SMAT80 detected proteases was predicted to be a rhomboid protease. Conclusions The parasite specific substitution matrices have higher specificity for apicomplexan proteins and are helpful in detecting the orthologs missed by BLOSUM matrices and thereby improve the annotation of apicomplexan proteins which are hypothetical or with unknown function. PMID:23281791

2012-01-01

46

Evidence classification of high-throughput protocols and confidence integration in RegulonDB  

PubMed Central

RegulonDB provides curated information on the transcriptional regulatory network of Escherichia coli and contains both experimental data and computationally predicted objects. To account for the heterogeneity of these data, we introduced in version 6.0, a two-tier rating system for the strength of evidence, classifying evidence as either ‘weak’ or ‘strong’ (Gama-Castro,S., Jimenez-Jacinto,V., Peralta-Gil,M. et al. RegulonDB (Version 6.0): gene regulation model of Escherichia Coli K-12 beyond transcription, active (experimental) annotated promoters and textpresso navigation. Nucleic Acids Res., 2008;36:D120–D124.). We now add to our classification scheme the classification of high-throughput evidence, including chromatin immunoprecipitation (ChIP) and RNA-seq technologies. To integrate these data into RegulonDB, we present two strategies for the evaluation of confidence, statistical validation and independent cross-validation. Statistical validation involves verification of ChIP data for transcription factor-binding sites, using tools for motif discovery and quality assessment of the discovered matrices. Independent cross-validation combines independent evidence with the intention to mutually exclude false positives. Both statistical validation and cross-validation allow to upgrade subsets of data that are supported by weak evidence to a higher confidence level. Likewise, cross-validation of strong confidence data extends our two-tier rating system to a three-tier system by introducing a third confidence score ‘confirmed’. Database URL: http://regulondb.ccg.unam.mx/ PMID:23327937

Weiss, Verena; Medina-Rivera, Alejandra; Huerta, Araceli M.; Santos-Zavaleta, Alberto; Salgado, Heladia; Morett, Enrique; Collado-Vides, Julio

2013-01-01

47

An Expression-Driven Approach to the Prediction of Carbohydrate Transport and Utilization Regulons in the Hyperthermophilic Bacterium Thermotoga maritima  

Microsoft Academic Search

Comprehensive analysis of genome-wide expression patterns during growth of the hyperthermophilic bac- terium Thermotoga maritima on 14 monosaccharide and polysaccharide substrates was undertaken with the goal of proposing carbohydrate specificities for transport systems and putative transcriptional regulators. Saccharide-induced regulons were predicted through the complementary use of comparative genomics, mixed- model analysis of genome-wide microarray expression data, and examination of upstream

Shannon B. Conners; Clemente I. Montero; Donald A. Comfort; Keith R. Shockley; Matthew R. Johnson; Swapnil R. Chhabra; Robert M. Kelly

2005-01-01

48

Transcription  

NSDL National Science Digital Library

A detailed depiction of transcription, the first stage of protein synthesis. This is the second in a series of three animations on protein synthesis. To begin at the beginning, go to Protein Synthesis - A general overview.

49

Chemical Biology Approaches for the study of Apicomplexan Parasites  

PubMed Central

Chemical biology and the techniques the field encompasses provide scientists with the means to address biological questions in ever evolving and technically sophisticated ways. They facilitate the dissection of molecular mechanisms of cell phenomena on timescales not achievable by other means. Libraries of small molecules, bioorthogonal chemistries and technical advances in mass-spectrometry techniques enable the modern chemical biologist to tackle even the most difficult of biological questions. It is because of their broad applicability that these approaches are well suited to systems less tractable to more classical genetic methods. As such, the parasite community has embraced them with great success. Some of these successes and the continuing evolution of chemical biology applied to apicomplexans will be discussed. PMID:24333788

Child, Matthew Andrew

2014-01-01

50

[The molecular mechanisms of erythrocyte invasion of Plasmodium spp. as a model organism of apicomplexan protozoa].  

PubMed

Apicomplexan protozoa are a phylum of parazites that includes medically and agriculturally important pathogens. They are named for their cell apex which contains a number of organelles (rhoptri, micronemes, conoid, apical polar ring, dense granules and apicoplast), important for their invasion and development within host cells. Among important apicomplexan parasites that affect human health directly or indirectly are Plasmodium spp., Toxoplasma gondii, Cryptosporodium, Eimeria, Babesia, and Theileria. Apicomplexan parasites move and actively enter host cells by substrate-dependent gliding motility. In these parasites, gliding motility and host cell invasion are driven by an actomyosin-based system (Glydeosome). A gliding motor machinery is embeded between the plasma membrane and inner membrane complex (IMC), a unique double membrane layer. A unique actomyosin motor powers both host cell invasion and locomotion of apicomplexan invasive stage. The cytoplasmic motor, a transmembrane bridge, and surface ligants essential for cell invasion are conserved among the main apicomplexan pathogens. In this review, erythrocytet invasion of Plasmodial merozit, which is a model organism of apicomplexan parasites, has been reviewed in detail. PMID:21391195

?ah?n, ?zzet; Yaman, Ozan; Hamamci, Berna; Çet?nkaya, Ülfet

2010-01-01

51

Comparative genomics of the KdgR regulon in Erwinia chrysanthemi 3937 and other gamma-proteobacteria.  

PubMed

In the plant-pathogenic enterobacterium Erwinia chrysanthemi, almost all known genes involved in pectin catabolism are controlled by the transcriptional regulator KdgR. In this study, the comparative genomics approach was used to analyse the KdgR regulon in completely sequenced genomes of eight enterobacteria, including Erw. chrysanthemi, and two Vibrio species. Application of a signal recognition procedure complemented by operon structure and protein sequence analysis allowed identification of new candidate genes of the KdgR regulon. Most of these genes were found to be controlled by the cAMP-receptor protein, a global regulator of catabolic genes. At the next step, regulation of these genes in Erw. chrysanthemi was experimentally verified using in vivo transcriptional fusions and an attempt was made to clarify the functional role of the predicted genes in pectin catabolism. Interestingly, it was found that the KdgR protein, previously known as a repressor, positively regulates expression of two new members of the regulon, phosphoenolpyruvate synthase gene ppsA and an adjacent gene, ydiA, of unknown function. Other predicted regulon members, namely chmX, dhfX, gntB, pykF, spiX, sotA, tpfX, yeeO and yjgK, were found to be subject to classical negative regulation by KdgR. Possible roles of newly identified members of the Erw. chrysanthemi KdgR regulon, chmX, dhfX, gntDBMNAC, spiX, tpfX, ydiA, yeeO, ygjV and yjgK, in pectin catabolism are discussed. Finally, complete reconstruction of the KdgR regulons in various gamma-proteobacteria yielded a metabolic map reflecting a globally conserved pathway for the catabolism of pectin and its derivatives with variability in transport and enzymic capabilities among species. In particular, possible non-orthologous substitutes of isomerase KduI and a new oligogalacturonide transporter in the Vibrio species were detected. PMID:15528647

Rodionov, Dmitry A; Gelfand, Mikhail S; Hugouvieux-Cotte-Pattat, Nicole

2004-11-01

52

RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more  

PubMed Central

This article summarizes our progress with RegulonDB (http://regulondb.ccg.unam.mx/) during the past 2 years. We have kept up-to-date the knowledge from the published literature regarding transcriptional regulation in Escherichia coli K-12. We have maintained and expanded our curation efforts to improve the breadth and quality of the encoded experimental knowledge, and we have implemented criteria for the quality of our computational predictions. Regulatory phrases now provide high-level descriptions of regulatory regions. We expanded the assignment of quality to various sources of evidence, particularly for knowledge generated through high-throughput (HT) technology. Based on our analysis of most relevant methods, we defined rules for determining the quality of evidence when multiple independent sources support an entry. With this latest release of RegulonDB, we present a new highly reliable larger collection of transcription start sites, a result of our experimental HT genome-wide efforts. These improvements, together with several novel enhancements (the tracks display, uploading format and curational guidelines), address the challenges of incorporating HT-generated knowledge into RegulonDB. Information on the evolutionary conservation of regulatory elements is also available now. Altogether, RegulonDB version 8.0 is a much better home for integrating knowledge on gene regulation from the sources of information currently available. PMID:23203884

Salgado, Heladia; Peralta-Gil, Martin; Gama-Castro, Socorro; Santos-Zavaleta, Alberto; Muñiz-Rascado, Luis; García-Sotelo, Jair S.; Weiss, Verena; Solano-Lira, Hilda; Martínez-Flores, Irma; Medina-Rivera, Alejandra; Salgado-Osorio, Gerardo; Alquicira-Hernández, Shirley; Alquicira-Hernández, Kevin; López-Fuentes, Alejandra; Porrón-Sotelo, Liliana; Huerta, Araceli M.; Bonavides-Martínez, César; Balderas-Martínez, Yalbi I.; Pannier, Lucia; Olvera, Maricela; Labastida, Aurora; Jiménez-Jacinto, Verónica; Vega-Alvarado, Leticia; del Moral-Chávez, Victor; Hernández-Alvarez, Alfredo; Morett, Enrique; Collado-Vides, Julio

2013-01-01

53

Eimeripain, a Cathepsin B-Like Cysteine Protease, Expressed throughout Sporulation of the Apicomplexan Parasite Eimeria tenella  

PubMed Central

The invasion and replication of Eimeria tenella in the chicken intestine is responsible for avian coccidiosis, a disease that has major economic impacts on poultry industries worldwide. E. tenella is transmitted to naïve animals via shed unsporulated oocysts that need contact with air and humidity to form the infectious sporulated oocysts, which contain the first invasive form of the parasite, the sporozoite. Cysteine proteases (CPs) are major virulence factors expressed by protozoa. In this study, we show that E. tenella expresses five transcriptionally regulated genes encoding one cathepsin L, one cathepsin B and three cathepsin Cs. Biot-LC-LVG-CHN2, a cystatin derived probe, tagged eight polypeptides in unsporulated oocysts but only one in sporulated oocysts. CP-dependant activities were found against the fluorescent substrates, Z-FR-AMC and Z-LR-AMC, throughout the sporulation process. These activities corresponded to a cathepsin B-like enzyme since they were inhibited by CA-074, a specific cathepsin B inhibitor. A 3D model of the catalytic domain of the cathepsin B-like protease, based on its sequence homology with human cathepsin B, further confirmed its classification as a papain-like protease with similar characteristics to toxopain-1 from the related apicomplexan parasite, Toxoplasma gondii; we have, therefore, named the E. tenella cathepsin B, eimeripain. Following stable transfection of E. tenella sporozoites with a plasmid allowing the expression of eimeripain fused to the fluorescent protein mCherry, we demonstrated that eimeripain is detected throughout sporulation and has a punctate distribution in the bodies of extra- and intracellular parasites. Furthermore, CA-074 Me, the membrane-permeable derivative of CA-074, impairs invasion of epithelial MDBK cells by E. tenella sporozoites. This study represents the first characterization of CPs expressed by a parasite from the Eimeria genus. Moreover, it emphasizes the role of CPs in transmission and dissemination of exogenous stages of apicomplexan parasites. PMID:22457711

Rieux, Anaïs; Gras, Simon; Lecaille, Fabien; Niepceron, Alisson; Katrib, Marilyn; Smith, Nicholas C.; Lalmanach, Gilles; Brossier, Fabien

2012-01-01

54

Divergence of the SigB regulon and pathogenesis of the Bacillus cereus sensu lato group  

PubMed Central

Background The Bacillus cereus sensu lato group currently includes seven species (B. cereus, B. anthracis, B. mycoides, B. pseudomycoides, B. thuringiensis, B. weihenstephanensis and B. cytotoxicus) that recent phylogenetic and phylogenomic analyses suggest are likely a single species, despite their varied phenotypes. Although horizontal gene transfer and insertion-deletion events are clearly important for promoting divergence among these genomes, recent studies have demonstrated that a major basis for phenotypic diversity in these organisms may be differential regulation of the highly similar gene content shared by these organisms. To explore this hypothesis, we used an in silico approach to evaluate the relationship of pathogenic potential and the divergence of the SigB-dependent general stress response within the B. cereus sensu lato group, since SigB has been demonstrated to support pathogenesis in Bacillus, Listeria and Staphylococcus species. Results During the divergence of these organisms from a common “SigB-less” ancestor, the placement of SigB promoters at varied locations in the B. cereus sensu lato genomes predict alternative structures for the SigB regulon in different organisms. Predicted promoter changes suggesting differential transcriptional control of a common gene pool predominate over evidence of indels or horizontal gene transfer for explaining SigB regulon divergence. Conclusions Four lineages of the SigB regulon have arisen that encompass different gene contents and suggest different strategies for supporting pathogenesis. This is consistent with the hypothesis that divergence within the B. cereus sensu lato group rests in part on alternative strategies for regulation of a common gene pool. PMID:23088190

2012-01-01

55

Re-emergence of the apicomplexan theileria equi in the United States: Elimination of persistent infection and transmission risk  

Technology Transfer Automated Retrieval System (TEKTRAN)

Arthropod-borne apicomplexan pathogens that cause asymptomatic persistent infections present a significant challenge due to their life-long transmission potential. Although anti-microbials have been used to ameliorate acute disease in animals and humans, chemotherapeutic efficacy for apicomplexan pa...

56

In silico discovery of the dormancy regulons in a number of Actinobacteria genomes  

SciTech Connect

Mycobacterium tuberculosis is a dangerous Actinobacteria infecting nearly one third of the human population. It becomes dormant and phenotypically drug resistant in response to stresses. An important feature of the M. tuberculosis pathogenesis is the prevalence of latent infection without disease, making understanding of the mechanisms used by the bacteria to exist in this state and to switch to metabolically active infectious form a vital problem to consider. M. tuberculosis dormancy is regulated by the three-component regulatory system of two kinases (DosT and DevS) and transcriprional regulator (DevR). DevR activates transcription of a set of genes, which allow the bacteria to survive long periods of anaerobiosis, and may be important for long-term survival within the host during latent infection. The DevR-regulon is studied experimentally in M. tuberculosis and few other phylogenetically close Mycobacteria spp. As many other two-component systems, the devRS operon is autoregulated. However, the mechanism of the dormancy is not completely clear even for these bacteria and there is no data describing the dormancy regulons in other species.

Gerasimova, Anna; Dubchak, Inna; Arkin, Adam; Gelfand, Mikhail

2010-11-16

57

N-acetylgalactosamine utilization pathway and regulon in proteobacteria: genomic reconstruction and experimental characterization in Shewanella.  

PubMed

We used a comparative genomics approach to reconstruct the N-acetyl-d-galactosamine (GalNAc) and galactosamine (GalN) utilization pathways and transcriptional regulons in Proteobacteria. The reconstructed GalNAc/GalN utilization pathways include multiple novel genes with specific functional roles. Most of the pathway variations were attributed to the amino sugar transport, phosphorylation, and deacetylation steps, whereas the downstream catabolic enzymes in the pathway were largely conserved. The predicted GalNAc kinase AgaK, the novel variant of GalNAc-6-phosphate deacetylase AgaA(II) and the GalN-6-phosphate deaminase AgaS from Shewanella sp. ANA-3 were validated in vitro using individual enzymatic assays and reconstitution of the three-step pathway. By using genetic techniques, we confirmed that AgaS but not AgaI functions as the main GalN-6-P deaminase in the GalNAc/GalN utilization pathway in Escherichia coli. Regulons controlled by AgaR repressors were reconstructed by bioinformatics in most proteobacterial genomes encoding GalNAc pathways. Candidate AgaR-binding motifs share a common sequence with consensus CTTTC that was found in multiple copies and arrangements in regulatory regions of aga genes. This study provides comprehensive insights into the common and distinctive features of the GalNAc/GalN catabolism and its regulation in diverse Proteobacteria. PMID:22711537

Leyn, Semen A; Gao, Fang; Yang, Chen; Rodionov, Dmitry A

2012-08-10

58

Comparative genome analysis reveals a conserved family of actin-like proteins in apicomplexan parasites  

PubMed Central

Background The phylum Apicomplexa is an early-branching eukaryotic lineage that contains a number of important human and animal pathogens. Their complex life cycles and unique cytoskeletal features distinguish them from other model eukaryotes. Apicomplexans rely on actin-based motility for cell invasion, yet the regulation of this system remains largely unknown. Consequently, we focused our efforts on identifying actin-related proteins in the recently completed genomes of Toxoplasma gondii, Plasmodium spp., Cryptosporidium spp., and Theileria spp. Results Comparative genomic and phylogenetic studies of apicomplexan genomes reveals that most contain only a single conventional actin and yet they each have 8–10 additional actin-related proteins. Among these are a highly conserved Arp1 protein (likely part of a conserved dynactin complex), and Arp4 and Arp6 homologues (subunits of the chromatin-remodeling machinery). In contrast, apicomplexans lack canonical Arp2 or Arp3 proteins, suggesting they lost the Arp2/3 actin polymerization complex on their evolutionary path towards intracellular parasitism. Seven of these actin-like proteins (ALPs) are novel to apicomplexans. They show no phylogenetic associations to the known Arp groups and likely serve functions specific to this important group of intracellular parasites. Conclusion The large diversity of actin-like proteins in apicomplexans suggests that the actin protein family has diverged to fulfill various roles in the unique biology of intracellular parasites. Conserved Arps likely participate in vesicular transport and gene expression, while apicomplexan-specific ALPs may control unique biological traits such as actin-based gliding motility. PMID:16343347

Gordon, Jennifer L; Sibley, L David

2005-01-01

59

Comparative genomics and functional analysis of rhamnose catabolic pathways and regulons in bacteria  

PubMed Central

L-rhamnose (L-Rha) is a deoxy-hexose sugar commonly found in nature. L-Rha catabolic pathways were previously characterized in various bacteria including Escherichia coli. Nevertheless, homology searches failed to recognize all the genes for the complete L-Rha utilization pathways in diverse microbial species involved in biomass decomposition. Moreover, the regulatory mechanisms of L-Rha catabolism have remained unclear in most species. A comparative genomics approach was used to reconstruct the L-Rha catabolic pathways and transcriptional regulons in the phyla Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Thermotogae. The reconstructed pathways include multiple novel enzymes and transporters involved in the utilization of L-Rha and L-Rha-containing polymers. Large-scale regulon inference using bioinformatics revealed remarkable variations in transcriptional regulators for L-Rha utilization genes among bacteria. A novel bifunctional enzyme, L-rhamnulose-phosphate aldolase (RhaE) fused to L-lactaldehyde dehydrogenase (RhaW), which is not homologous to previously characterized L-Rha catabolic enzymes, was identified in diverse bacteria including Chloroflexi, Bacilli, and Alphaproteobacteria. By using in vitro biochemical assays we validated both enzymatic activities of the purified recombinant RhaEW proteins from Chloroflexus aurantiacus and Bacillus subtilis. Another novel enzyme of the L-Rha catabolism, L-lactaldehyde reductase (RhaZ), was identified in Gammaproteobacteria and experimentally validated by in vitro enzymatic assays using the recombinant protein from Salmonella typhimurium. C. aurantiacus induced transcription of the predicted L-Rha utilization genes when L-Rha was present in the growth medium and consumed L-Rha from the medium. This study provided comprehensive insights to L-Rha catabolism and its regulation in diverse Bacteria. PMID:24391637

Rodionova, Irina A.; Li, Xiaoqing; Thiel, Vera; Stolyar, Sergey; Stanton, Krista; Fredrickson, James K.; Bryant, Donald A.; Osterman, Andrei L.; Best, Aaron A.; Rodionov, Dmitry A.

2013-01-01

60

A chemical potentiator of copper-accumulation used to investigate the iron-regulons of Saccharomyces cerevisiae  

PubMed Central

The extreme resistance of Saccharomyces cerevisiae to copper is overcome by 2-(6-benzyl-2-pyridyl)quinazoline (BPQ), providing a chemical-biology tool which has been exploited in two lines of discovery. First, BPQ is shown to form a red (BPQ)2Cu(I) complex and promote Ctr1-independent copper-accumulation in whole cells and in mitochondria isolated from treated cells. Multiple phenotypes, including loss of aconitase activity, are consistent with copper-BPQ mediated damage to mitochondrial iron–sulphur clusters. Thus, a biochemical basis of copper-toxicity in S. cerevisiae is analogous to other organisms. Second, iron regulons controlled by Aft1/2, Cth2 and Yap5 that respond to mitochondrial iron–sulphur cluster status are modulated by copper-BPQ causing iron hyper-accumulation via upregulated iron-import. Comparison of copper-BPQ treated, untreated and copper-only treated wild-type and fra2? by RNA-seq has uncovered a new candidate Aft1 target-gene (LSO1) and paralogous non-target (LSO2), plus nine putative Cth2 target-transcripts. Two lines of evidence confirm that Fra2 dominates basal repression of the Aft1/2 regulons in iron-replete cultures. Fra2-independent control of these regulons is also observed but CTH2 itself appears to be atypically Fra2-dependent. However, control of Cth2-target transcripts which is independent of CTH2 transcript abundance or of Fra2, is also quantified. Use of copper-BPQ supports a substantial contribution of metabolite repression to iron-regulation. PMID:24895027

Foster, Andrew W; Dainty, Samantha J; Patterson, Carl J; Pohl, Ehmke; Blackburn, Hannah; Wilson, Clare; Hess, Corinna R; Rutherford, Julian C; Quaranta, Laura; Corran, Andy; Robinson, Nigel J

2014-01-01

61

Evolution of Chloroplast Transcript Processing in Plasmodium and Its Chromerid Algal Relatives  

PubMed Central

It is well understood that apicomplexan parasites, such as the malaria pathogen Plasmodium, are descended from free-living algae, and maintain a vestigial chloroplast that has secondarily lost all genes of photosynthetic function. Recently, two fully photosynthetic relatives of parasitic apicomplexans have been identified, the ‘chromerid’ algae Chromera velia and Vitrella brassicaformis, which retain photosynthesis genes within their chloroplasts. Elucidating the processes governing gene expression in chromerid chloroplasts might provide valuable insights into the origins of parasitism in the apicomplexans. We have characterised chloroplast transcript processing pathways in C. velia, V. brassicaformis and P. falciparum with a focus on the addition of an unusual, 3? poly(U) tail. We demonstrate that poly(U) tails in chromerids are preferentially added to transcripts that encode proteins that are directly involved in photosynthetic electron transfer, over transcripts for proteins that are not involved in photosynthesis. To our knowledge, this represents the first chloroplast transcript processing pathway to be associated with a particular functional category of genes. In contrast, Plasmodium chloroplast transcripts are not polyuridylylated. We additionally present evidence that poly(U) tail addition in chromerids is involved in the alternative processing of polycistronic precursors covering multiple photosynthesis genes, and appears to be associated with high levels of transcript abundance. We propose that changes to the chloroplast transcript processing machinery were an important step in the loss of photosynthesis in ancestors of parasitic apicomplexans. PMID:24453981

Dorrell, Richard G.; Drew, James; Nisbet, R. Ellen R.; Howe, Christopher J.

2014-01-01

62

Comparative Genomics of the Apicomplexan Parasites Toxoplasma gondii and Neospora caninum: Coccidia  

E-print Network

Comparative Genomics of the Apicomplexan Parasites Toxoplasma gondii and Neospora caninum: Coccidia, Canada, 8 Laboratory of Parasitic Diseases, National Institutes of Health, National Institute of Allergy is a zoonotic protozoan parasite which infects nearly one third of the human population and is found

Arnold, Jonathan

63

Apical membrane antigen 1 mediates apicomplexan parasite attachment but is dispensable for host cell invasion  

PubMed Central

Apicomplexan parasites invade host cells by forming a ring-like junction with the cell surface and actively sliding through the junction inside an intracellular vacuole. Apical membrane antigen 1 is conserved in apicomplexans and a long-standing malaria vaccine candidate. It is considered to have multiple important roles during host cell penetration, primarily in structuring the junction by interacting with the rhoptry neck 2 protein and transducing the force generated by the parasite motor during internalization. Here, we generate Plasmodium sporozoites and merozoites and Toxoplasma tachyzoites lacking apical membrane antigen 1, and find that the latter two are impaired in host cell attachment but the three display normal host cell penetration through the junction. Therefore, apical membrane antigen 1, rather than an essential invasin, is a dispensable adhesin of apicomplexan zoites. These genetic data have implications on the use of apical membrane antigen 1 or the apical membrane antigen 1–rhoptry neck 2 interaction as targets of intervention strategies against malaria or other diseases caused by apicomplexans. PMID:24108241

Bargieri, Daniel Y.; Andenmatten, Nicole; Lagal, Vanessa; Thiberge, Sabine; Whitelaw, Jamie A.; Tardieux, Isabelle; Meissner, Markus; Ménard, Robert

2013-01-01

64

Protein level identification of the Listeria monocytogenes Sigma H, Sigma L, and Sigma C regulons  

PubMed Central

Background Transcriptional regulation by alternative sigma (?) factors represents an important mechanism that allows bacteria to rapidly regulate transcript and protein levels in response to changing environmental conditions. While the role of the alternative ? factor ?B has been comparatively well characterized in L. monocytogenes, our understanding of the roles of the three other L. monocytogenes alternative ? factors is still limited. In this study, we employed a quantitative proteomics approach using Isobaric Tags for Relative and Absolute Quantitation (iTRAQ) to characterize the L. monocytogenes ?L, ?H, and ?C protein regulons. Proteomic comparisons used a quadruple alternative ? factor mutant strain (?BCHL) and strains expressing a single alternative ? factor (i.e., ?L, ?H, and ?C; strains ?BCH, ?BCL, and ?BHL) to eliminate potential redundancies between ? factors. Results Among the three alternative ? factors studied here, ?H provides positive regulation for the largest number of proteins, consistent with previous transcriptomic studies, while ?L appears to contribute to negative regulation of a number of proteins. ?C was found to regulate a small number of proteins in L. monocytogenes grown to stationary phase at 37°C. Proteins identified as being regulated by multiple alternative ? factors include MptA, which is a component of a PTS system with a potential role in regulation of PrfA activity. Conclusions This study provides initial insights into global regulation of protein production by the L. monocytogenes alternative ? factors ?L, ?H, and ?C. While, among these ? factors, ?H appears to positively regulate the largest number of proteins, we also identified PTS systems that appear to be co-regulated by multiple alternative ? factors. Future studies should not only explore potential roles of alternative ? factors in activating a “cascade” of PTS systems that potentially regulate PrfA, but also may want to explore the ?L and ?C regulons under different environmental conditions to identify conditions where these ? factors may regulate larger numbers of proteins or genes. PMID:23841528

2013-01-01

65

Genome-wide analysis of the RpoN regulon in Geobacter sulfurreducens  

PubMed Central

Background The role of the RNA polymerase sigma factor RpoN in regulation of gene expression in Geobacter sulfurreducens was investigated to better understand transcriptional regulatory networks as part of an effort to develop regulatory modules for genome-scale in silico models, which can predict the physiological responses of Geobacter species during groundwater bioremediation or electricity production. Results An rpoN deletion mutant could not be obtained under all conditions tested. In order to investigate the regulon of the G. sulfurreducens RpoN, an RpoN over-expression strain was made in which an extra copy of the rpoN gene was under the control of a taclac promoter. Combining both the microarray transcriptome analysis and the computational prediction revealed that the G. sulfurreducens RpoN controls genes involved in a wide range of cellular functions. Most importantly, RpoN controls the expression of the dcuB gene encoding the fumarate/succinate exchanger, which is essential for cell growth with fumarate as the terminal electron acceptor in G. sulfurreducens. RpoN also controls genes, which encode enzymes for both pathways of ammonia assimilation that is predicted to be essential under all growth conditions in G. sulfurreducens. Other genes that were identified as part of the RpoN regulon using either the computational prediction or the microarray transcriptome analysis included genes involved in flagella biosynthesis, pili biosynthesis and genes involved in central metabolism enzymes and cytochromes involved in extracellular electron transfer to Fe(III), which are known to be important for growth in subsurface environment or electricity production in microbial fuel cells. The consensus sequence for the predicted RpoN-regulated promoter elements is TTGGCACGGTTTTTGCT. Conclusion The G. sulfurreducens RpoN is an essential sigma factor and a global regulator involved in a complex transcriptional network controlling a variety of cellular processes. PMID:19624843

2009-01-01

66

The iron stimulon and fur regulon of Geobacter sulfurreducens and their role in energy metabolism.  

PubMed

Iron plays a critical role in the physiology of Geobacter species. It serves as both an essential component for proteins and cofactors and an electron acceptor during anaerobic respiration. Here, we investigated the iron stimulon and ferric uptake regulator (Fur) regulon of Geobacter sulfurreducens to examine the coordination between uptake of Fe(II) and the reduction of Fe(III) at the transcriptional level. Gene expression studies across a variety of different iron concentrations in both the wild type and a ?fur mutant strain were used to determine the iron stimulon. The stimulon consists of a broad range of gene products, ranging from iron-utilizing to central metabolism and iron reduction proteins. Integration of gene expression and chromatin immunoprecipitation (ChIP) data sets assisted in the identification of the Fur transcriptional regulatory network and Fur's role as a regulator of the iron stimulon. Additional physiological and transcriptional analyses of G. sulfurreducens grown with various Fe(II) concentrations revealed the depth of Fur's involvement in energy metabolism and the existence of redundancy within the iron-regulatory network represented by IdeR, an alternative iron transcriptional regulator. These characteristics enable G. sulfurreducens to thrive in environments with fluctuating iron concentrations by providing it with a robust mechanism to maintain tight and deliberate control over intracellular iron homeostasis. PMID:24584254

Embree, Mallory; Qiu, Yu; Shieu, Wendy; Nagarajan, Harish; O'Neil, Regina; Lovley, Derek; Zengler, Karsten

2014-05-01

67

Genome-Wide Definition of the SigF Regulon in Mycobacterium tuberculosis  

PubMed Central

In Mycobacterium tuberculosis the alternative sigma factor SigF controls the expression of a particular subset of genes by altering RNA polymerase specificity. Here, we utilize two genome-wide approaches to identify SigF-binding sites: chromatin immunoprecipitation (ChIP-on-chip) and microarray analysis of SigF-mediated transcripts. Since SigF is not an abundant protein in the logarithmic phase of growth, a pristinamyin IA-inducible system was used to control its expression. We identified 67 high-affinity SigF-binding sites and 16 loci where a SigF promoter directs the expression of a transcript. These loci include sigF itself, genes involved in lipid and intermediary metabolism and virulence, and at least one transcriptional regulator (Rv2884), possibly acting downstream of SigF. In addition, SigF was also found to direct the transcription of the gene for small RNA F6. Many loci were also found where SigF may be involved in antisense transcription, and in two cases (Rv1358 and Rv1870c) the SigF-dependent promoter was located within the predicted coding sequence. Quantitative PCR confirmed the microarray findings and 5?-rapid amplification of cDNA ends was used to map the SigF-specific transcriptional start points. A canonical SigF consensus promoter sequence GGTTT-N(15-17)-GGGTA was found prior to 11 genes. Together, these data help to define the SigF regulon and show that SigF not only governs expression of proteins such as the virulence factor, HbhA, but also impacts novel functions, such as noncoding RNAs and antisense transcripts. PMID:22307756

Hartkoorn, Ruben C.; Sala, Claudia; Uplekar, Swapna; Busso, Philippe; Rougemont, Jacques

2012-01-01

68

Use of a promiscuous, constitutively-active bacterial enhancer-binding protein to define the ?54 (RpoN) regulon of Salmonella Typhimurium LT2  

PubMed Central

Background Sigma54, or RpoN, is an alternative ? factor found widely in eubacteria. A significant complication in analysis of the global ?54 regulon in a bacterium is that the ?54 RNA polymerase holoenzyme requires interaction with an active bacterial enhancer-binding protein (bEBP) to initiate transcription at a ?54-dependent promoter. Many bacteria possess multiple bEBPs, which are activated by diverse environmental stimuli. In this work, we assess the ability of a promiscuous, constitutively-active bEBP—the AAA+ ATPase domain of DctD from Sinorhizobium meliloti—to activate transcription from all ?54-dependent promoters for the characterization of the ?54 regulon of Salmonella Typhimurium LT2. Results The AAA+?ATPase domain of DctD was able to drive transcription from nearly all previously characterized or predicted ?54-dependent promoters in Salmonella under a single condition. These promoters are controlled by a variety of native activators and, under the condition tested, are not transcribed in the absence of the DctD AAA+?ATPase domain. We also identified a novel ?54-dependent promoter upstream of STM2939, a homolog of the cas1 component of a CRISPR system. ChIP-chip analysis revealed at least 70 ?54 binding sites in the chromosome, of which 58% are located within coding sequences. Promoter-lacZ fusions with selected intragenic ?54 binding sites suggest that many of these sites are capable of functioning as ?54-dependent promoters. Conclusion Since the DctD AAA+?ATPase domain proved effective in activating transcription from the diverse ?54-dependent promoters of the S. Typhimurium LT2 ?54 regulon under a single growth condition, this approach is likely to be valuable for examining ?54 regulons in other bacterial species. The S. Typhimurium ?54 regulon included a high number of intragenic ?54 binding sites/promoters, suggesting that ?54 may have multiple regulatory roles beyond the initiation of transcription at the start of an operon. PMID:24007446

2013-01-01

69

Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry.  

PubMed

We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 ?M exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB. PMID:24861620

Jha, Ramesh K; Kern, Theresa L; Fox, David T; M Strauss, Charlie E

2014-07-01

70

Genome wide analysis of the complete GlnR nitrogen-response regulon in Mycobacterium smegmatis  

PubMed Central

Background Nitrogen is an essential element for bacterial growth and an important component of biological macromolecules. Consequently, responding to nitrogen limitation is critical for bacterial survival and involves the interplay of signalling pathways and transcriptional regulation of nitrogen assimilation and scavenging genes. In the soil dwelling saprophyte Mycobacterium smegmatis the OmpR-type response regulator GlnR is thought to mediate the transcriptomic response to nitrogen limitation. However, to date only ten genes have been shown to be in the GlnR regulon, a vastly reduced number compared to other organisms. Results We investigated the role of GlnR in the nitrogen limitation response and determined the entire GlnR regulon, by combining expression profiling of M. smegmatis wild type and glnR deletion mutant, with GlnR-specific chromatin immunoprecipitation and high throughput sequencing. We identify 53 GlnR binding sites during nitrogen limitation that control the expression of over 100 genes, demonstrating that GlnR is the regulator controlling the assimilation and utilisation of nitrogen. We also determine a consensus GlnR binding motif and identify key residues within the motif that are required for specific GlnR binding. Conclusions We have demonstrated that GlnR is the global nitrogen response regulator in M. smegmatis, directly regulating the expression of more than 100 genes. GlnR controls key nitrogen stress survival processes including primary nitrogen metabolism pathways, the ability to utilise nitrate and urea as alternative nitrogen sources, and the potential to use cellular components to provide a source of ammonium. These studies further our understanding of how mycobacteria survive nutrient limiting conditions. PMID:23642041

2013-01-01

71

Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus  

PubMed Central

Background The catabolite control protein A (CcpA) is a member of the LacI/GalR family of transcriptional regulators controlling carbon-metabolism pathways in low-GC Gram-positive bacteria. It functions as a catabolite repressor or activator, allowing the bacteria to utilize the preferred carbon source over secondary carbon sources. This study is the first CcpA-dependent transcriptome and proteome analysis in Staphylococcus aureus, focussing on short-time effects of glucose under stable pH conditions. Results The addition of glucose to exponentially growing S. aureus increased the expression of genes and enzymes of the glycolytic pathway, while genes and proteins of the tricarboxylic acid (TCA) cycle, required for the complete oxidation of glucose, were repressed via CcpA. Phosphotransacetylase and acetate kinase, converting acetyl-CoA to acetate with a concomitant substrate-level phosphorylation, were neither regulated by glucose nor by CcpA. CcpA directly repressed genes involved in utilization of amino acids as secondary carbon sources. Interestingly, the expression of a larger number of genes was found to be affected by ccpA inactivation in the absence of glucose than after glucose addition, suggesting that glucose-independent effects due to CcpA may have a particular impact in S. aureus. In the presence of glucose, CcpA was found to regulate the expression of genes involved in metabolism, but also that of genes coding for virulence determinants. Conclusion This study describes the CcpA regulon of exponentially growing S. aureus cells. As in other bacteria, CcpA of S. aureus seems to control a large regulon that comprises metabolic genes as well as virulence determinants that are affected in their expression by CcpA in a glucose-dependent as well as -independent manner. PMID:19450265

2009-01-01

72

Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium  

SciTech Connect

Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond (Toronto); (WU-MED)

2010-09-21

73

The DtxR Regulon of Corynebacterium glutamicum  

Microsoft Academic Search

Previous studies with Corynebacterium diphtheriae and Mycobacterium species revealed that the transcrip- tional regulator DtxR and its ortholog IdeR play a central role in the control of iron metabolism. In the present work, we used genome-based approaches to determine the DtxR regulon of Corynebacterium glutamicum ,a nonpathogenic relative of C. diphtheriae. First, global gene expression of a dtxR deletion mutant

Julia Wennerhold; Michael Bott

2006-01-01

74

Prevalence and intensity of blood apicomplexan infections in reptiles from Romania.  

PubMed

In order to evaluate prevalence and intensity of apicomplexan hemoparasites in free-ranging reptiles from Romania, blood smears were collected from European pond turtles (Emys orbicularis), sand lizards (Lacerta agilis), and spur-thighed tortoises (Testudo graeca). All three host species were positive for blood parasites, with prevalence of infected individuals between 60.71% and 100% and variable intensity. Similarities and differences with other epidemiological data are discussed. PMID:18283494

Mihalca, A D; Racka, K; Gherman, C; Ionescu, D T

2008-04-01

75

A Novel Copper-Responsive Regulon in Mycobacterium tuberculosis  

PubMed Central

In this work we describe the identification of a copper-inducible regulon in Mycobacterium tuberculosis (Mtb). Among the regulated genes was Rv0190/MT0200, a paralogue of the copper metalloregulatory repressor CsoR. The five-locus regulon, which includes a gene that encodes the copper-protective metallothionein MymT, was highly induced in wild type Mtb treated with copper, and highly expressed in an Rv0190/MT0200 mutant. Importantly, the Rv0190/MT0200 mutant was hyper-resistant to copper. The promoters of all five loci share a palindromic motif that was recognized by the gene product of Rv0190/MT0200. For this reason we named Rv0190/MT0200 RicR for regulated in copper repressor. Intriguingly, several of the RicR-regulated genes, including MymT, are unique to pathogenic Mycobacteria. The identification of a copper-responsive regulon specific to virulent mycobacterial species suggests copper homeostasis must be maintained during an infection. Alternatively, copper may provide a cue for the expression of genes unrelated to metal homeostasis, but nonetheless necessary for survival in a host. PMID:21166899

Festa, Richard A.; Jones, Marcus B.; Butler-Wu, Susan; Sinsimer, Daniel; Gerads, Russell; Bishai, William R.; Peterson, Scott N.; Darwin, K. Heran

2010-01-01

76

Evolutionarily Divergent, Unstable Filamentous Actin Is Essential for Gliding Motility in Apicomplexan Parasites  

PubMed Central

Apicomplexan parasites rely on a novel form of actin-based motility called gliding, which depends on parasite actin polymerization, to migrate through their hosts and invade cells. However, parasite actins are divergent both in sequence and function and only form short, unstable filaments in contrast to the stability of conventional actin filaments. The molecular basis for parasite actin filament instability and its relationship to gliding motility remain unresolved. We demonstrate that recombinant Toxoplasma (TgACTI) and Plasmodium (PfACTI and PfACTII) actins polymerized into very short filaments in vitro but were induced to form long, stable filaments by addition of equimolar levels of phalloidin. Parasite actins contain a conserved phalloidin-binding site as determined by molecular modeling and computational docking, yet vary in several residues that are predicted to impact filament stability. In particular, two residues were identified that form intermolecular contacts between different protomers in conventional actin filaments and these residues showed non-conservative differences in apicomplexan parasites. Substitution of divergent residues found in TgACTI with those from mammalian actin resulted in formation of longer, more stable filaments in vitro. Expression of these stabilized actins in T. gondii increased sensitivity to the actin-stabilizing compound jasplakinolide and disrupted normal gliding motility in the absence of treatment. These results identify the molecular basis for short, dynamic filaments in apicomplexan parasites and demonstrate that inherent instability of parasite actin filaments is a critical adaptation for gliding motility. PMID:21998582

Skillman, Kristen M.; Diraviyam, Karthikeyan; Khan, Asis; Tang, Keliang; Sept, David; Sibley, L. David

2011-01-01

77

Amino acid contacts between sigma 70 domain 4 and the transcription activators RhaS and RhaR  

E-print Network

The RhaS and RhaR proteins are transcription activators that respond to the availability Of L-rhamnose and activate transcription of the operons in the Escherichia coli L-rhamnose catabolic regulon. RhaR activates transcription ...

Wickstrum, J. R.; Egan, Susan M.

2004-09-01

78

Effects of Enrichment on Expression of Key Nutrient Regulons in Extremophiles in Hydrothermal Springs at Yellowstone National Park  

NASA Astrophysics Data System (ADS)

To cope with nutrient limitation, micro-organisms have evolved diverse means to increase acquisition of nutrients such as ammonium, nitrate, and phosphate and trace metals when they become limiting. These strategies typically involve production of compound-specific transporters (i.e., ammonium transporters) or extracellular enzymes (i.e., alkaline phosphatase). Genes that encode these proteins are often under the control of shared regulatory proteins called regulons. Regulons of genes for N, P, or Fe metabolism ultimately affect the transport of vital nutrients into and out of cells and thus help organisms deal with nutrient limitation. Regulons for N, P, and Fe have been found and studied ex situ for model organisms under various nutrient-limiting conditions but are relatively unstudied in the field, especially in hydrothermal systems. The aim of this study was to characterize transcription patterns of genes for N, P, and Fe processing under experimental nutrient enrichment in a complex microbial community from an alkaline hot spring located in Yellowstone National Park. Microbial mat samples and hot spring water were placed in bottles, subjected to a fully factorial manipulation of N (125 ?M N as ammonium nitrate), phosphorus (7.8 ?M P as sodium phosphate), and Fe (7.8 x 10-2 ?M Fe as ferric citrate), and incubated overnight at in situ temperatures. Following incubation, hot spring water was filtered and preserved for nutrient analyses and biomass subsamples were snap-frozen for molecular analysis. Chemical analysis showed a total removal of NH4 and PO4 from the water in all treatments. NO3 decreased slightly in most treatments (control, +N, +P, +Fe, +PFe, and +NPFe) but increased in the others (+NFe and +NP). Interestingly, Fe concentrations were lower in amended samples (+Fe, +NFe, +PFe, and +NPFe) than in unamended samples (control, +N, +P, +NP). To assess the transcriptional responses, primers were designed to target genes controlled by the ferric uptake regulator (Fur), phosphate-responsive signal transduction pathway (Pho), and the nitrogen transcriptional regulator TnrA. These genes-glnA, nrgAB, narB, yusV, asnRS, gltA, pstS, tagA, and phoA- have been successfully sequenced in our microbial mat community. Gene expression work is currently underway to determine if transcription of these genes is altered under single nutrient limitation and/or co-limitation, thus reflecting the results seen in the water chemistry data.

Knowlton, M.; Elser, J. J.; Poret-peterson, A. T.

2011-12-01

79

The NsrR Regulon in Nitrosative Stress Resistance of Salmonella enterica serovar Typhimurium  

PubMed Central

SUMMARY Nitric oxide (NO·) is an important mediator of innate immunity. The facultative intracellular pathogen Salmonella has evolved mechanisms to detoxify and evade the antimicrobial actions of host-derived NO· produced during infection. Expression of the NO·-detoxifying flavohemoglobin Hmp is controlled by the NO·-sensing transcriptional repressor NsrR and is required for Salmonella virulence. In this study we show that NsrR responds to very low NO· concentrations, suggesting that it plays a primary role in the nitrosative stress response. Additionally, we have defined the NsrR regulon in Salmonella enterica sv. Typhimurium 14028s using transcriptional microarray, qRT-PCR and in silico methods. A novel NsrR-regulated gene designated STM1808 has been identified, along with hmp, hcp-hcr, yeaR-yoaG, ygbA and ytfE. STM1808 and ygbA are important for S. Typhimurium growth during nitrosative stress, and the hcp-hcr locus plays a supportive role in NO· detoxification. ICP-MS analysis of purified STM1808 suggests that it is a zinc metalloprotein, with histidine residues H32 and H82 required for NO· resistance and zinc binding. Moreover, STM1808 and ytfE promote Salmonella growth during systemic infection of mice. Collectively, these findings demonstrate that NsrR-regulated genes in addition to hmp are important for NO· detoxification, nitrosative stress resistance and Salmonella virulence. PMID:22831173

Karlinsey, Joyce E.; Bang, Iel-Soo; Becker, Lynne A.; Frawley, Elaine R.; Porwollik, Steffen; Robbins, Hannah F.; Thomas, Vinai Chittezham; Urbano, Rodolfo; McClelland, Michael; Fang, Ferric C.

2012-01-01

80

RNA regulons in Hox 5' UTRs confer ribosome specificity to gene regulation.  

PubMed

Emerging evidence suggests that the ribosome has a regulatory function in directing how the genome is translated in time and space. However, how this regulation is encoded in the messenger RNA sequence remains largely unknown. Here we uncover unique RNA regulons embedded in homeobox (Hox) 5' untranslated regions (UTRs) that confer ribosome-mediated control of gene expression. These structured RNA elements, resembling viral internal ribosome entry sites (IRESs), are found in subsets of Hox mRNAs. They facilitate ribosome recruitment and require the ribosomal protein RPL38 for their activity. Despite numerous layers of Hox gene regulation, these IRES elements are essential for converting Hox transcripts into proteins to pattern the mammalian body plan. This specialized mode of IRES-dependent translation is enabled by an additional regulatory element that we term the translation inhibitory element (TIE), which blocks cap-dependent translation of transcripts. Together, these data uncover a new paradigm for ribosome-mediated control of gene expression and organismal development. PMID:25409156

Xue, Shifeng; Tian, Siqi; Fujii, Kotaro; Kladwang, Wipapat; Das, Rhiju; Barna, Maria

2015-01-01

81

Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii  

PubMed Central

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

2013-01-01

82

The CBF1-dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp.  

PubMed

The meristematic tissues of temperate woody perennials must acclimate to freezing temperatures to survive the winter and resume growth the following year. To determine whether the C-repeat binding factor (CBF) family of transcription factors contributing to this process in annual herbaceous species also functions in woody perennials, we investigated the changes in phenotype and transcript profile of transgenic Populus constitutively expressing CBF1 from Arabidopsis (AtCBF1). Ectopic expression of AtCBF1 was sufficient to significantly increase the freezing tolerance of non-acclimated leaves and stems relative to wild-type plants. cDNA microarray experiments identified genes up-regulated by ectopic AtCBF1 expression in Populus, demonstrated a strong conservation of the CBF regulon between Populus and Arabidopsis and identified differences between leaf and stem regulons. We studied the induction kinetics and tissue specificity of four CBF paralogues identified from the Populus balsamifera subsp. trichocarpa genome sequence (PtCBFs). All four PtCBFs are cold-inducible in leaves, but only PtCBF1 and PtCBF3 show significant induction in stems. Our results suggest that the central role played by the CBF family of transcriptional activators in cold acclimation of Arabidopsis has been maintained in Populus. However, the differential expression of the PtCBFs and differing clusters of CBF-responsive genes in annual (leaf) and perennial (stem) tissues suggest that the perennial-driven evolution of winter dormancy may have given rise to specific roles for these 'master-switches' in the different annual and perennial tissues of woody species. PMID:17080948

Benedict, Catherine; Skinner, Jeffrey S; Meng, Rengong; Chang, Yongjian; Bhalerao, Rishikesh; Huner, Norman P A; Finn, Chad E; Chen, Tony H H; Hurry, Vaughan

2006-07-01

83

Identification of the Alternative Sigma Factor SigX Regulon and Its Implications for Pseudomonas aeruginosa Pathogenicity  

PubMed Central

Pseudomonas aeruginosa is distinguished by its broad metabolic diversity and its remarkable capability for adaptation, which relies on a large collection of transcriptional regulators and alternative sigma (?) factors. The largest group of alternative ? factors is that of the extracytoplasmic function (ECF) ? factors, which control key transduction pathways for maintenance of envelope homeostasis in response to external stress and cell growth. In addition, there are specific roles of alternative ? factors in regulating the expression of virulence and virulence-associated genes. Here, we analyzed a deletion mutant of the ECF ? factor SigX and applied mRNA profiling to define the SigX-dependent regulon in P. aeruginosa in response to low-osmolarity-medium conditions. Furthermore, the combination of transcriptional data with chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) led to the identification of the DNA binding motif of SigX. Genome-wide mapping of SigX-binding regions revealed enrichment of downstream genes involved in fatty acid biosynthesis, type III secretion, swarming and cyclic di-GMP (c-di-GMP) signaling. In accordance, a sigX deletion mutant exhibited altered fatty acid composition of the cell membrane, reduced cytotoxicity, impaired swarming activity, elevated c-di-GMP levels, and increased biofilm formation. In conclusion, a combination of ChIP-seq with transcriptional profiling and bioinformatic approaches to define consensus DNA binding sequences proved to be effective for the elucidation of the regulon of the alternative ? factor SigX, revealing its role in complex virulence-associated phenotypes in P. aeruginosa. PMID:24187091

Blanka, Andrea; Schulz, Sebastian; Eckweiler, Denitsa; Franke, Raimo; Bielecka, Agata; Nicolai, Tanja; Casilag, Fiordiligie; Düvel, Juliane; Abraham, Wolf-Rainer; Kaever, Volkhard

2013-01-01

84

Virulence regulons of enterotoxigenic Escherichia coli.  

PubMed

Enterotoxigenic Escherichia coli is frequently associated with travelers' diarrhea and is a leading cause of infant and childhood mortality in developing countries. Disease is dependent upon the orchestrated expression of enterotoxins, flexible adhesive pili, and other virulence factors. Both the heat-labile (LT) and heat-stable (ST-H) enterotoxins are regulated at the level of transcription by cAMP-receptor protein which represses the expression of LT while activating expression of ST-H. The expression of many different serotypes of adhesive pili is regulated by Rns, a member of the AraC family that represents a subgroup of conserved virulence regulators from several enteric pathogens. These Rns-like regulators recognize similar DNA binding sites, and a compiled sequence logo suggests they may bind DNA through both major and minor groove interactions. These regulators are also tempting targets for novel therapeutics because they play pivotal roles during infection. To that end, high-throughput screens have begun to identify compounds that inhibit the activity of these regulators, predominately by interfering with DNA binding. PMID:24203442

Munson, George P

2013-12-01

85

The apicomplexan Cryptosporidium parvum possesses a single mitochondrial-type ferredoxin and ferredoxin:NADP+ reductase system  

PubMed Central

We have successfully expressed recombinant mitochondrial-type ferredoxin (mtFd) and ferredoxin:NADP+ reductase (mtFNR) from Cryptosporidium parvum and characterized their biochemical features for the first time for an apicomplexan. Both C. parvum mtFd (CpmtFd) and FNR (CpmtFNR) were obtained and purified as holo-proteins, in which the correct assembly of [2Fe–2S] cluster in Fd and that of FAD in FNR were confirmed and characterized by UV/vis and electron paramagnetic resonance. These proteins were fully functional and CpmtFNR was capable of transferring electrons from NADPH to CpmtFd in a cytochrome c-coupled assay that followed a typical Michaelis-Menten kinetics. Apicomplexan mtFd and mtFNR proteins were evolutionarily divergent from their counterparts in humans and animals and could be explored as potential drug targets in Cryptosporidium and other apicomplexans. PMID:20737579

Lei, Cheng; Rider, S Dean; Wang, Cai; Zhang, Haili; Tan, Xiangshi; Zhu, Guan

2010-01-01

86

Expanding the Direct HetR Regulon in Anabaena sp. Strain PCC 7120  

PubMed Central

In response to a lack of environmental combined nitrogen, the filamentous cyanobacterium Anabaena sp. strain PCC 7120 differentiates nitrogen-fixing heterocyst cells in a periodic pattern. HetR is a transcription factor that coordinates the regulation of this developmental program. An inverted repeat-containing sequence in the hepA promoter required for proheterocyst-specific transcription was identified based on sequence similarity to a previously characterized binding site for HetR in the promoter of hetP. The binding affinity of HetR for the hepA site is roughly an order of magnitude lower than that for the hetP binding site. A BLAST search of the Anabaena genome identified 166 hepA-like sites that occur as single or tandem sites (two binding sites separated by 13 bp). The vast majority of these sites are present in predicted intergenic regions. HetR bound five representative single binding sites in vitro, and binding was abrogated by transversions in the binding sites that conserved the inverted repeat nature of the sites. Binding to four representative tandem sites was not observed. Transcriptional fusions of the green fluorescent protein gene gfp with putative promoter regions associated with the representative binding sites indicated that HetR could function as either an activator or repressor and that activation was cell-type specific. Taken together, we have expanded the direct HetR regulon and propose a model in which three categories of HetR binding sites, based on binding affinity and nucleotide sequence, contribute to three of the four phases of differentiation. PMID:24375104

Videau, Patrick; Ni, Shuisong; Rivers, Orion S.; Ushijima, Blake; Feldmann, Erik A.; Cozy, Loralyn M.; Kennedy, Michael A.

2014-01-01

87

Regulon of the N-acetylglucosamine utilization regulator NagR in Bacillus subtilis.  

PubMed

N-Acetylglucosamine (GlcNAc) is the most abundant carbon-nitrogen biocompound on earth and has been shown to be an important source of nutrients for both catabolic and anabolic purposes in Bacillus species. In this work we show that the GntR family regulator YvoA of Bacillus subtilis serves as a negative transcriptional regulator of GlcNAc catabolism gene expression. YvoA represses transcription by binding a 16-bp sequence upstream of nagP encoding the GlcNAc-specific EIIBC component of the sugar phosphotransferase system involved in GlcNAc transport and phosphorylation, as well as another very similar 16-bp sequence upstream of the nagAB-yvoA locus, wherein nagA codes for N-acetylglucosamine-6-phosphate deacetylase and nagB codes for the glucosamine-6-phosphate (GlcN-6-P) deaminase. In vitro experiments demonstrated that GlcN-6-P acts as an inhibitor of YvoA DNA-binding activity, as occurs for its Streptomyces ortholog, DasR. Interestingly, we observed that the expression of nag genes was still activated upon addition of GlcNAc in a ?yvoA mutant background, suggesting the existence of an auxiliary transcriptional control instance. Initial computational prediction of the YvoA regulon showed a distribution of YvoA binding sites limited to nag genes and therefore suggests renaming YvoA to NagR, for N-acetylglucosamine utilization regulator. Whole-transcriptome studies showed significant repercussions of nagR deletion for several major B. subtilis regulators, probably indirectly due to an excess of the crucial molecules acetate, ammonia, and fructose-6-phosphate, resulting from complete hydrolysis of GlcNAc. We discuss a model deduced from NagR-mediated gene expression, which highlights clear connections with pathways for GlcNAc-containing polymer biosynthesis and adaptation to growth under oxygen limitation. PMID:21602348

Bertram, Ralph; Rigali, Sébastien; Wood, Natalie; Lulko, Andrzej T; Kuipers, Oscar P; Titgemeyer, Fritz

2011-07-01

88

Copper trafficking in the CsoR regulon of Streptomyces lividans.  

PubMed

In the actinobacterium Streptomyces lividans copper homeostasis is controlled through the action of the metalloregulator CsoR. Under copper stress, cuprous ions bind to apo-CsoR resulting in the transcriptional derepression of genes encoding for copper efflux systems involving CopZ-like copper chaperones and CopA-like P-type ATPases. Whether CsoR obtains copper via a protein-protein mediated trafficking mechanism is unknown. In this study we have characterised the copper trafficking properties of two S. lividans CopZ proteins (SLI_1317 and SLI_3079) under the transcriptional control of a CsoR (SLI_4375). Our findings indicate that both CopZ-proteins have cysteine residues in the Cu(i) binding MX1CX2X3C motif with acid-base properties that are modulated for a high cuprous ion affinity and favourable Cu(i)-exchange with a target. Using electrophoretic mobility shift assays transfer of Cu(i) is shown to occur in a unidirectional manner from the CopZ to the CsoR. This transfer proceeds via a shallow thermodynamic affinity gradient and is also kinetically favoured through the modulation of the acid-base properties of the cysteine residues in the Cys2His cuprous ion binding motif of CsoR. Using RNA-seq coupled with the mechanistic insights of Cu(i) transfer between CopZ and CsoR in vitro, we propose a copper trafficking pathway for the CsoR regulon that initially involves the buffering of cytosolic copper by three CopZ chaperones followed by transfer of Cu(i) to CsoR to illicit a transcriptional response. PMID:25409712

Chaplin, Amanda K; Tan, Benedict G; Vijgenboom, Erik; Worrall, Jonathan A R

2015-01-24

89

On the necessity and biological significance of threshold-free regulon prediction outputs.  

PubMed

The in silico prediction of cis-acting elements in a genome is an efficient way to quickly obtain an overview of the biological processes controlled by a trans-acting factor, and connections between regulatory networks. Several regulon prediction web tools are available, designed to identify DNA motifs predicted to be bound by transcription factors using position weight matrix-based algorithms. In this paper we expose and discuss the conflicting objectives of software creators (bioinformaticians) and software users (biologists), who aim for reliable and exhaustive prediction outputs, respectively. Software makers, concerned with providing tools that minimise the number of false positive hits, often impose a stringent threshold score for a sequence to be included in the list of the putative cis-acting sites. This rigidity eventually results in the identification of strongly reliable but largely straightforward sites, i.e. those associated with genes already anticipated to be targeted by the studied transcription factor. Importantly, this biased identification of strongly bound sequences contrasts with the biological reality where, in many circumstances, a weak DNA-protein interaction is required for the appropriate gene's expression. We show here a series of transcriptionally controlled systems involving weakly bound cis-acting elements that could never have been discovered because of the policy of preventing software users from modifying the screening parameters. Proposing only trustworthy prediction outputs thus prevents biologists from fully utilising their knowledge background and deciding to analyse statistically irrelevant hits that could nonetheless be potentially involved in subtle, unexpected, though essential cis-trans relationships. PMID:25387521

Rigali, Sébastien; Nivelle, Renaud; Tocquin, Pierre

2015-02-20

90

d-Allose Catabolism of Escherichia coli: Involvement of alsI and Regulation of als Regulon Expression by Allose and Ribose  

PubMed Central

Genes involved in allose utilization of Escherichia coli K-12 are organized in at least two operons, alsRBACE and alsI, located next to each other on the chromosome but divergently transcribed. Mutants defective in alsI (allose 6-phosphate isomerase gene) and alsE (allulose 6-phosphate epimerase gene) were Als?. Transcription of the two allose operons, measured as ?-galactosidase activity specified by alsI-lacZ+ or alsE-lacZ+ operon fusions, was induced by allose. Ribose also caused derepression of expression of the regulon under conditions in which ribose phosphate catabolism was impaired. PMID:10559180

Poulsen, Tim S.; Chang, Ying-Ying; Hove-Jensen, Bjarne

1999-01-01

91

D-Allose catabolism of Escherichia coli: involvement of alsI and regulation of als regulon expression by allose and ribose.  

PubMed

Genes involved in allose utilization of Escherichia coli K-12 are organized in at least two operons, alsRBACE and alsI, located next to each other on the chromosome but divergently transcribed. Mutants defective in alsI (allose 6-phosphate isomerase gene) and alsE (allulose 6-phosphate epimerase gene) were Als(-). Transcription of the two allose operons, measured as beta-galactosidase activity specified by alsI-lacZ(+) or alsE-lacZ(+) operon fusions, was induced by allose. Ribose also caused derepression of expression of the regulon under conditions in which ribose phosphate catabolism was impaired. PMID:10559180

Poulsen, T S; Chang, Y Y; Hove-Jensen, B

1999-11-01

92

Genome-scale analyses of Escherichia coli and Salmonella enterica AraC reveal noncanonical targets and an expanded core regulon.  

PubMed

Escherichia coli AraC is a well-described transcription activator of genes involved in arabinose metabolism. Using complementary genomic approaches, chromatin immunoprecipitation (ChIP)-chip, and transcription profiling, we identify direct regulatory targets of AraC, including five novel target genes: ytfQ, ydeN, ydeM, ygeA, and polB. Strikingly, only ytfQ has an established connection to arabinose metabolism, suggesting that AraC has a broader function than previously described. We demonstrate arabinose-dependent repression of ydeNM by AraC, in contrast to the well-described arabinose-dependent activation of other target genes. We also demonstrate unexpected read-through of transcription at the Rho-independent terminators downstream of araD and araE, leading to significant increases in the expression of polB and ygeA, respectively. AraC is highly conserved in the related species Salmonella enterica. We use ChIP sequencing (ChIP-seq) and RNA sequencing (RNA-seq) to map the AraC regulon in S. enterica. A comparison of the E. coli and S. enterica AraC regulons, coupled with a bioinformatic analysis of other related species, reveals a conserved regulatory network across the family Enterobacteriaceae comprised of 10 genes associated with arabinose transport and metabolism. PMID:24272778

Stringer, Anne M; Currenti, Salvatore; Bonocora, Richard P; Baranowski, Catherine; Petrone, Brianna L; Palumbo, Michael J; Reilly, Andrew A; Zhang, Zhen; Erill, Ivan; Wade, Joseph T

2014-02-01

93

Microarray Analysis of Pseudomonas aeruginosa Quorum-Sensing Regulons: Effects of Growth Phase and Environment†  

PubMed Central

Bacterial communication via quorum sensing (QS) has been reported to be important in the production of virulence factors, antibiotic sensitivity, and biofilm development. Two QS systems, known as the las and rhl systems, have been identified previously in the opportunistic pathogen Pseudomonas aeruginosa. High-density oligonucleotide microarrays for the P. aeruginosa PAO1 genome were used to investigate global gene expression patterns modulated by QS regulons. In the initial experiments we focused on identifying las and/or rhl QS-regulated genes using a QS signal generation-deficient mutant (PAO-JP2) that was cultured with and without added exogenous autoinducers [N-(3-oxododecanoyl) homoserine lactone and N-butyryl homoserine lactone]. Conservatively, 616 genes showed statistically significant differential expression (P ? 0.05) in response to the exogenous autoinducers and were classified as QS regulated. A total of 244 genes were identified as being QS regulated at the mid-logarithmic phase, and 450 genes were identified as being QS regulated at the early stationary phase. Most of the previously reported QS-promoted genes were confirmed, and a large number of additional QS-promoted genes were identified. Importantly, 222 genes were identified as being QS repressed. Environmental factors, such as medium composition and oxygen availability, eliminated detection of transcripts of many genes that were identified as being QS regulated. PMID:12644477

Wagner, Victoria E.; Bushnell, Daniel; Passador, Luciano; Brooks, Andrew I.; Iglewski, Barbara H.

2003-01-01

94

PTS Phosphorylation of Mga Modulates Regulon Expression and Virulence in the Group A Streptococcus  

PubMed Central

SUMMARY The ability of a bacterial pathogen to monitor available carbon sources in host tissues provides a clear fitness advantage. In the group A streptococcus (GAS), the virulence regulator Mga contains homology to phosphotransferase system (PTS) regulatory domains (PRDs) found in sugar operon regulators. Here we show that Mga was phosphorylated in vitro by the PTS components EI/HPr at conserved PRD histidines. A ?ptsI (EI-deficient) GAS mutant exhibited decreased Mga activity. However, PTS-mediated phosphorylation inhibited Mga-dependent transcription of emm in vitro. Using alanine (unphosphorylated) and aspartate (phosphomimetic) mutations of PRD histidines, we establish that a doubly phosphorylated PRD1 phosphomimetic (D/DMga4) is completely inactive in vivo, shutting down expression of the Mga regulon. Although D/DMga4 is still able to bind DNA in vitro, homo-multimerization of Mga is disrupted and the protein is unable to activate trancription. PTS- mediated regulation of Mga activity appears to be important for pathogenesis, as bacteria expressing either nonphosphorylated (A/A) or phosphomimetic (D/D) PRD1 Mga mutants were attenuated in a model of GAS invasive skin disease. Thus, PTS-mediated phosphorylation of Mga may allow the bacteria to modulate virulence gene expression in response to carbohydrate status. Furthermore, PRD-containing virulence regulators (PCVRs) appear to be widespread in Gram-positive pathogens. PMID:23651410

Hondorp, Elise R.; Hou, Sherry C.; Hause, Lara L.; Gera, Kanika; Lee, Ching-En; McIver, Kevin S.

2013-01-01

95

Binase-like guanyl-preferring ribonucleases are new members of Bacillus PhoP regulon.  

PubMed

Extracellular low-molecular weight guanyl-preferring ribonucleases (LMW RNases) of Bacillus sp. comprise a group of hydrolytic enzymes that share highly similar structural and catalytic characteristics with barnase, a ribonuclease from Bacillus amyloliquefaciens, and binase, a ribonuclease from Bacillus intermedius. Although the physical-chemical and catalytic properties of Bacillus guanyl-preferring ribonucleases are very similar, there is considerably more variation in the environmental conditions that lead to the induction of the genes encoding these RNases. Based on structural differences of their genes the guanyl-preferring ribonucleases have been sub-divided into binase-like and barnase-like groups. Here we show the ability of the key regulator of phosphate deficiency response, PhoP, to direct the transcription of the binase-like RNases but not barnase-like RNases. These results, together with our demonstration that binase-like RNases are induced in response to phosphate starvation, allow us to categorise this group of ribonucleases as new members of Bacillus PhoP regulon. In contrast, the barnase-like ribonucleases are relatively insensitive to the phosphate concentration and the environmental conditions that are responsible for their induction, and the regulatory elements involved, are currently unknown. PMID:25238955

Ulyanova, Vera; Vershinina, Valentina; Ilinskaya, Olga; Harwood, Colin R

2015-01-01

96

Overlapping Alternative Sigma Factor Regulons in the Response to Singlet Oxygen in Rhodobacter sphaeroides? †  

PubMed Central

Organisms performing photosynthesis in the presence of oxygen have to cope with the formation of highly reactive singlet oxygen (1O2) and need to mount an adaptive response to photooxidative stress. Here we show that the alternative sigma factors RpoHI and RpoHII are both involved in the 1O2 response and in the heat stress response in Rhodobacter sphaeroides. We propose RpoHII to be the major player in the 1O2 response, whereas RpoHI is more important for the heat stress response. Mapping of the 5? ends of RpoHII- and also RpoHI/RpoHII-dependent transcripts revealed clear differences in the ?10 regions of the putative promoter sequences. By using bioinformatic tools, we extended the RpoHII regulon, which includes genes induced by 1O2 exposure. These genes encode proteins which are, e.g., involved in methionine sulfoxide reduction and in maintaining the quinone pool. Furthermore, we identified small RNAs which depend on RpoHI and RpoHII and are likely to contribute to the defense against photooxidative stress and heat stress. PMID:20304993

Nuss, Aaron M.; Glaeser, Jens; Berghoff, Bork A.; Klug, Gabriele

2010-01-01

97

The Ins and Outs of Nuclear Trafficking: Unusual Aspects in Apicomplexan Parasites  

PubMed Central

Apicomplexa is a phylum within the kingdom Protista that contains some of the most significant threats to public health. One of the members of this phylum, Toxoplasma gondii, is amenable to molecular genetic analyses allowing for the identification of factors critical for colonization and disease. A pathway found to be important for T. gondii pathogenesis is the Ran network of nuclear trafficking. Bioinformatics analysis of apicomplexan genomes shows that while Ran is well conserved, the key regulators of Ran—Regulator of Chromosome Condensation 1 and Ran GTPase activating protein—are either highly divergent or absent. Likewise, several import and export receptor molecules that are crucial for nuclear transport are either not present or have experienced genetic drift such that they are no longer recognizable by bioinformatics tools. In this minireview we describe the basics of nuclear trafficking and compare components within apicomplexans to defined systems in humans and yeast. A detailed analysis of the nuclear trafficking network in these eukaryotes is required to understand how this potentially unique cellular biological pathway contributes to host–parasite interactions. PMID:19348590

Frankel, Matthew B.

2009-01-01

98

An atomic-resolution view of neofunctionalization in the evolution of apicomplexan lactate dehydrogenases  

PubMed Central

Malate and lactate dehydrogenases (MDH and LDH) are homologous, core metabolic enzymes that share a fold and catalytic mechanism yet possess strict specificity for their substrates. In the Apicomplexa, convergent evolution of an unusual LDH from MDH produced a difference in specificity exceeding 12 orders of magnitude. The mechanisms responsible for this extraordinary functional shift are currently unknown. Using ancestral protein resurrection, we find that specificity evolved in apicomplexan LDHs by classic neofunctionalization characterized by long-range epistasis, a promiscuous intermediate, and few gain-of-function mutations of large effect. In canonical MDHs and LDHs, a single residue in the active-site loop governs substrate specificity: Arg102 in MDHs and Gln102 in LDHs. During the evolution of the apicomplexan LDH, however, specificity switched via an insertion that shifted the position and identity of this ‘specificity residue’ to Trp107f. Residues far from the active site also determine specificity, as shown by the crystal structures of three ancestral proteins bracketing the key duplication event. This work provides an unprecedented atomic-resolution view of evolutionary trajectories creating a nascent enzymatic function. DOI: http://dx.doi.org/10.7554/eLife.02304.001 PMID:24966208

Boucher, Jeffrey I; Jacobowitz, Joseph R; Beckett, Brian C; Classen, Scott; Theobald, Douglas L

2014-01-01

99

Sphingolipid synthesis and scavenging in the intracellular apicomplexan parasite, Toxoplasma gondii  

PubMed Central

Sphingolipids are essential components of eukaryotic cell membranes, particularly the plasma membrane, and are involved in a diverse array of signal transduction pathways. Mammals produce sphingomyelin (SM) as the primary complex sphingolipid via the well characterised SM synthase. In contrast yeast, plants and some protozoa utilise an evolutionarily related inositol phosphorylceramide (IPC) synthase to synthesise IPC. This activity has no mammalian equivalent and IPC synthase has been proposed as a target for anti-fungals and anti-protozoals. However, detailed knowledge of the sphingolipid biosynthetic pathway of the apicomplexan protozoan parasites was lacking. In this study bioinformatic analyses indicated a single copy orthologue of the putative SM synthase from the apicomplexan Plasmodium falciparum (the causative agent of malaria) was a bona fide sphingolipid synthase in the related model parasite, Toxoplasma gondii (TgSLS). Subsequently, TgSLS was indicated, by complementation of a mutant cell line, to be a functional orthologue of the yeast IPC synthase (AUR1p), demonstrating resistance to the well characterised AUR1p inhibitor aureobasidin A. In vitro, recombinant TgSLS exhibited IPC synthase activity and, for the first time, the presence of IPC was demonstrated in T. gondii lipid extracts by mass spectrometry. Furthermore, host sphingolipid biosynthesis was indicated to influence, but be non-essential for, T. gondii proliferation, suggesting that whilst scavenging does take place de novo sphingolipid synthesis may be important for parasitism. PMID:23246819

Pratt, Steven; Wansadhipathi-Kannangara, Nilu K.; Bruce, Catherine R.; Mina, John G.; Shams-Eldin, Hosam; Casas, Josefina; Hanada, Kentaro; Schwarz, Ralph T.; Sonda, Sabrina; Denny, Paul W.

2013-01-01

100

Novel components of the Apicomplexan moving junction reveal conserved and coccidia-restricted elements  

PubMed Central

Apicomplexan parasites generally invade their host cells by anchoring the parasite to the host membrane through a structure called the moving junction (MJ). This moving junction is also believed to sieve host proteins from the nascent parasitophorous vacuole membrane, which likely protects the pathogen from lysosomal destruction. Previously identified constituents of the Toxoplasma MJ have orthologues in Plasmodium, indicating a conserved structure throughout the Apicomplexa. We report here two novel MJ proteins, RON5 and RON8. While RON5 is conserved in Plasmodium, RON8 appears restricted to the coccidia. RON8, which is likely essential, coimmunoprecipitates RON5 and known MJ proteins from extracellular parasites, indicating a preformed complex exists within the parasites. Upon secretion, we show that RON8 within the MJ localizes to the cytoplasmic face of the host plasma membrane. To examine interactions between RON8 and the host cell, we expressed RON8 in mammalian cells and show that it targets to its site of action at the periphery in a manner dependent on the C-terminal portion of the protein. The discovery of RON5 and RON8 provides new insight into conserved and unique elements of the MJ, furthering our understanding of how the moving junction contributes to the intricate mechanism of Apicomplexan invasion. PMID:19134112

Straub, Kurtis W.; Cheng, Stephen J.; Sohn, Catherine S.; Bradley, Peter J.

2009-01-01

101

Two global regulatory systems (Crp and Arc) control the cobalamin/propanediol regulon of Salmonella typhimurium.  

PubMed

The genes for cobalamin (vitamin B12) biosynthesis (cob) are coregulated with genes for degradation of propanediol (pdu). Both the cob and pdu operons are induced by propanediol by means of a positive regulatory protein, PocR. This coregulation of a synthetic and a degradative pathway reflects the fact that vitamin B12 is a required cofactor for the first enzyme in propanediol breakdown. The cob/pdu regulon is induced by propanediol under two sets of growth conditions, i.e., during aerobic respiration of a poor carbon source and during anaerobic growth. We provide evidence that, under aerobic conditions, the Crp/cyclic AMP system is needed for all induction of the pocR, cob, and pdu genes. Anaerobically, the Crp/cyclic AMP and ArcA/ArcB systems act additively to support induction of the same three transcription units. The fact that these global control systems affect expression of the gene for the positive regulatory protein (pocR) as well as the pdu and cob operons is consistent with our previous suggestion that these two global controls may act directly only on the pocR gene; their control over the cob and pdu operons may be an indirect consequence of their effect on the level of PocR activator protein. The reported experiments were made possible by the observation that pyruvate supports aerobic growth of all of the mutants tested (cya, crp, arcA, and arcB); pyruvate also supports anaerobic growth of these mutants if the alternative electron acceptor, fumarate, is provided. By using pyruvate as a carbon source, it was possible to grow all of these mutant strains under identical conditions and compare their expression of the cob/pdu regulon. The role of Crp in control of vitamin B12 synthesis suggests that the major role of vitamin B12 in Salmonella spp. is in catabolism of carbon sources; the coregulation of the cob and pdu operons suggests that propanediol is the major vitamin B12-dependent carbon source. PMID:8226666

Ailion, M; Bobik, T A; Roth, J R

1993-11-01

102

Conserved CO-FT regulons contribute to the photoperiod flowering control in soybean  

PubMed Central

Background CO and FT orthologs, belonging to the BBX and PEBP family, respectively, have important and conserved roles in the photoperiod regulation of flowering time in plants. Soybean genome experienced at least three rounds of whole genome duplications (WGDs), which resulted in multiple copies of about 75% of genes. Subsequent subfunctionalization is the main fate for paralogous gene pairs during the evolutionary process. Results The phylogenic relationships revealed that CO orthologs were widespread in the plant kingdom while FT orthologs were present only in angiosperms. Twenty-eight CO homologous genes and twenty-four FT homologous genes were gained in the soybean genome. Based on the collinear relationship, the soybean ancestral CO ortholog experienced three WGD events, but only two paralogous gene pairs (GmCOL1/2 and GmCOL5/13) survived in the modern soybean. The paralogous gene pairs, GmCOL1/2 or GmCOL5/13, showed similar expression patterns in pair but different between pairs, indicating that they functionally diverged. GmFTL1 to 7 were derived from the same ancestor prior to the whole genome triplication (WGT) event, and after the Legume WGD event the ancestor diverged into two branches, GmFTL3/5/7 and GmFTL1/2/4/6. GmFTL7 were truncated in the N-terminus compared to other FT-lineage genes, but ubiquitously expressed. Expressions of GmFTL1 to 6 were higher in leaves at the flowering stage than that at the seedling stage. GmFTL3 was expressed at the highest level in all tissues except roots at the seedling stage, and its circadian pattern was different from the other five ones. The transcript of GmFTL6 was highly accumulated in seedling roots. The circadian rhythms of GmCOL5/13 and GmFT1/2/4/5/6 were synchronized in a day, demonstrating the complicate relationship of CO-FT regulons in soybean leaves. Over-expression of GmCOL2 did not rescue the flowering phenotype of the Arabidopsis co mutant. However, ectopic expression of GmCOL5 did rescue the co mutant phenotype. All GmFTL1 to 6 showed flower-promoting activities in Arabidopsis. Conclusions After three recent rounds of whole genome duplications in the soybean, the paralogous genes of CO-FT regulons showed subfunctionalization through expression divergence. Then, only GmCOL5/13 kept flowering-promoting activities, while GmFTL1 to 6 contributed to flowering control. Additionally, GmCOL5/13 and GmFT1/2/3/4/5/6 showed similar circadian expression profiles. Therefore, our results suggested that GmCOL5/13 and GmFT1/2/3/4/5/6 formed the complicate CO-FT regulons in the photoperiod regulation of flowering time in soybean. PMID:24397545

2014-01-01

103

Non-canonical CRP sites control competence regulons in Escherichia coli and many other ?-proteobacteria  

PubMed Central

Escherichia coli's cAMP receptor protein (CRP), the archetypal bacterial transcription factor, regulates over a hundred promoters by binding 22 bp symmetrical sites with the consensus core half-site TGTGA. However, Haemophilus influenzae has two types of CRP sites, one like E.coli's and one with the core sequence TGCGA that regulates genes required for DNA uptake (natural competence). Only the latter ‘CRP-S’ sites require both CRP and the coregulator Sxy for activation. To our knowledge, the TGTGA and TGCGA motifs are the first example of one transcription factor having two distinct binding-site motifs. Here we show that CRP-S promoters are widespread in the ?-proteobacteria and demonstrate their Sxy-dependence in E.coli. Orthologs of most H.influenzae CRP-S-regulated genes are ubiquitous in the five best-studied ?-proteobacteria families, Enterobacteriaceae, Pasteurellaceae, Pseudomonadaceae, Vibrionaceae and Xanthomonadaceae. Phylogenetic footprinting identified CRP-S sites in the promoter regions of the Enterobacteriaceae, Pasteurellaceae and Vibrionaceae orthologs, and canonical CRP sites in orthologs of genes known to be Sxy-independent in H.influenzae. Bandshift experiments confirmed that E.coli CRP-S sequences are low affinity binding sites for CRP, and mRNA analysis showed that they require CRP, cAMP (CRP's allosteric effector) and Sxy for gene induction. This work suggests not only that the ?-proteobacteria share a common DNA uptake mechanism, but also that, in the three best studied families, their competence regulons share both CRP-S specificity and Sxy dependence. PMID:17068078

Cameron, Andrew D. S.; Redfield, Rosemary J.

2006-01-01

104

Genome-Wide Analysis of the Salmonella Fis Regulon and Its Regulatory Mechanism on Pathogenicity Islands  

PubMed Central

Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica. PMID:23717649

Wang, Quan; Wang, Lei

2013-01-01

105

Characterization of the Oxygen-Responsive NreABC Regulon of Staphylococcus aureus? †  

PubMed Central

Here, we investigate the functionality of the oxygen-responsive nitrogen regulation system NreABC in the human pathogen Staphylococcus aureus and evaluate its role in anaerobic gene regulation and virulence factor expression. Deletion of nreABC resulted in severe impairment of dissimilatory nitrate and nitrite reduction and led to a small-colony phenotype in the presence of nitrate during anaerobic growth. For characterization of the NreABC regulon, comparative DNA microarray and proteomic analyses between the wild type and nreABC mutant were performed under anoxic conditions in the absence and presence of nitrate. A reduced expression of virulence factors was not observed in the mutant. However, both the transcription of genes involved in nitrate and nitrite reduction and the accumulation of corresponding proteins were highly decreased in the nreABC mutant, which was unable to utilize nitrate as a respiratory oxidant and, hence, was forced to use fermentative pathways. These data were corroborated by the quantification of the extracellular metabolites lactate and acetate. Using an Escherichia coli-compatible two-plasmid system, the activation of the promoters of the nitrate and nitrite reductase operons and of the putative nitrate/nitrite transporter gene narK by NreBC was confirmed. Overall, our data indicate that NreABC is very likely a specific regulation system that is essential for the transcriptional activation of genes involved in dissimilatory reduction and transport of nitrate and nitrite. The study underscores the importance of NreABC as a fitness factor for S. aureus in anoxic environments. PMID:18820014

Schlag, Steffen; Fuchs, Stephan; Nerz, Christiane; Gaupp, Rosmarie; Engelmann, Susanne; Liebeke, Manuel; Lalk, Michael; Hecker, Michael; Götz, Friedrich

2008-01-01

106

NUROP Congress Paper A Second Quorum Sensing Regulon in Burkholderia pseudomallei  

Microsoft Academic Search

Burkholderia pseudomallei, a Gram-negative soil bacterium, is the causative agent of melioidosis. Quorum sensing is a mechanism responsible for the regulated expression of virulence genes in many bacterial pathogens. The first quorum sensing regulon in B. pseudomallei, Ai s\\/Air, was recently identified in our laboratory. The report describes the identification of a second quorum sensing regulon, RhlI\\/RhlR, in B. pseudomallei

107

Deciphering the Ubiquitin-Mediated Pathway in Apicomplexan Parasites: A Potential Strategy to Interfere with Parasite Virulence  

PubMed Central

Background Reversible modification of proteins through the attachment of ubiquitin or ubiquitin-like modifiers is an essential post-translational regulatory mechanism in eukaryotes. The conjugation of ubiquitin or ubiquitin-like proteins has been demonstrated to play roles in growth, adaptation and homeostasis in all eukaryotes, with perturbation of ubiquitin-mediated systems associated with the pathogenesis of many human diseases, including cancer and neurodegenerative disorders. Methodology/Principal Findings Here we describe the use of an HMM search of functional Pfam domains found in the key components of the ubiquitin-mediated pathway necessary to activate and reversibly modify target proteins in eight apicomplexan parasitic protozoa for which complete or late-stage genome projects exist. In parallel, the same search was conducted on five model organisms, single-celled and metazoans, to generate data to validate both the search parameters employed and aid paralog classification in Apicomplexa. For each of the 13 species investigated, a set of proteins predicted to be involved in the ubiquitylation pathway has been identified and demonstrates increasing component members of the ubiquitylation pathway correlating with organism and genome complexity. Sequence homology and domain architecture analyses facilitated prediction of apicomplexan-specific protein function, particularly those involved in regulating cell division during these parasite's complex life cycles. Conclusions/Significance This study provides a comprehensive analysis of proteins predicted to be involved in the apicomplexan ubiquitin-mediated pathway. Given the importance of such pathway in a wide variety of cellular processes, our data is a key step in elucidating the biological networks that, in part, direct the pathogenicity of these parasites resulting in a massive impact on global health. Moreover, apicomplexan-specific adaptations of the ubiquitylation pathway may represent new therapeutic targets for much needed drugs against apicomplexan parasites. PMID:18545708

Ponts, Nadia; Yang, Jianfeng; Chung, Duk-Won Doug; Prudhomme, Jacques; Girke, Thomas; Horrocks, Paul; Le Roch, Karine G.

2008-01-01

108

Exposure of Bacillus subtilis to low pressure (5 kilopascals) induces several global regulons, including those involved in the SigB-mediated general stress response.  

PubMed

Studies of how microorganisms respond to pressure have been limited mostly to the extreme high pressures of the deep sea (i.e., the piezosphere). In contrast, despite the fact that the growth of most bacteria is inhibited at pressures below ?2.5 kPa, little is known of microbial responses to low pressure (LP). To study the global LP response, we performed transcription microarrays on Bacillus subtilis cells grown under normal atmospheric pressure (?101 kPa) and a nearly inhibitory LP (5 kPa), equivalent to the pressure found at an altitude of ?20 km. Microarray analysis revealed altered levels of 363 transcripts belonging to several global regulons (AbrB, CcpA, CodY, Fur, IolR, ResD, Rok, SigH, Spo0A). Notably, the highest number of upregulated genes, 86, belonged to the SigB-mediated general stress response (GSR) regulon. Upregulation of the GSR by LP was confirmed by monitoring the expression of the SigB-dependent ctc-lacZ reporter fusion. Measuring transcriptome changes resulting from exposure of bacterial cells to LP reveals insights into cellular processes that may respond to LP exposure. PMID:24878601

Waters, Samantha M; Robles-Martínez, José A; Nicholson, Wayne L

2014-08-01

109

The FurA regulon in Anabaena sp. PCC 7120: in silico prediction and experimental validation of novel target genes  

PubMed Central

In the filamentous cyanobacterium Anabaena sp. PCC 7120, the ferric uptake regulator FurA functions as a global transcriptional regulator. Despite several analyses have focused on elucidating the FurA-regulatory network, the number of target genes described for this essential transcription factor is limited to a handful of examples. In this article, we combine an in silico genome-wide predictive approach with experimental determinations to better define the FurA regulon. Predicted FurA-binding sites were identified upstream of 215 genes belonging to diverse functional categories including iron homeostasis, photosynthesis and respiration, heterocyst differentiation, oxidative stress defence and light-dependent signal transduction mechanisms, among others. The probabilistic model proved to be effective at discerning FurA boxes from non-cognate sequences, while subsequent electrophoretic mobility shift assay experiments confirmed the in vitro specific binding of FurA to at least 20 selected predicted targets. Gene-expression analyses further supported the dual role of FurA as transcriptional modulator that can act both as repressor and as activator. In either role, the in vitro affinity of the protein to its target sequences is strongly dependent on metal co-regulator and reducing conditions, suggesting that FurA couples in vivo iron homeostasis and the response to oxidative stress to major physiological processes in cyanobacteria. PMID:24503250

González, Andrés; Angarica, Vladimir Espinosa; Sancho, Javier; Fillat, María F.

2014-01-01

110

RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach  

SciTech Connect

RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at http://regpredict.lbl.gov.

Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna

2010-05-26

111

Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti†  

PubMed Central

We have sequenced the genome of the emerging human pathogen Babesia microti and compared it with that of other protozoa. B. microti has the smallest nuclear genome among all Apicomplexan parasites sequenced to date with three chromosomes encoding ?3500 polypeptides, several of which are species specific. Genome-wide phylogenetic analyses indicate that B. microti is significantly distant from all species of Babesidae and Theileridae and defines a new clade in the phylum Apicomplexa. Furthermore, unlike all other Apicomplexa, its mitochondrial genome is circular. Genome-scale reconstruction of functional networks revealed that B. microti has the minimal metabolic requirement for intraerythrocytic protozoan parasitism. B. microti multigene families differ from those of other protozoa in both the copy number and organization. Two lateral transfer events with significant metabolic implications occurred during the evolution of this parasite. The genomic sequencing of B. microti identified several targets suitable for the development of diagnostic assays and novel therapies for human babesiosis. PMID:22833609

Cornillot, Emmanuel; Hadj-Kaddour, Kamel; Dassouli, Amina; Noel, Benjamin; Ranwez, Vincent; Vacherie, Benoît; Augagneur, Yoann; Brès, Virginie; Duclos, Aurelie; Randazzo, Sylvie; Carcy, Bernard; Debierre-Grockiego, Françoise; Delbecq, Stéphane; Moubri-Ménage, Karina; Shams-Eldin, Hosam; Usmani-Brown, Sahar; Bringaud, Frédéric; Wincker, Patrick; Vivarès, Christian P.; Schwarz, Ralph T.; Schetters, Theo P.; Krause, Peter J.; Gorenflot, André; Berry, Vincent; Barbe, Valérie; Ben Mamoun, Choukri

2012-01-01

112

Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti.  

PubMed

We have sequenced the genome of the emerging human pathogen Babesia microti and compared it with that of other protozoa. B. microti has the smallest nuclear genome among all Apicomplexan parasites sequenced to date with three chromosomes encoding ?3500 polypeptides, several of which are species specific. Genome-wide phylogenetic analyses indicate that B. microti is significantly distant from all species of Babesidae and Theileridae and defines a new clade in the phylum Apicomplexa. Furthermore, unlike all other Apicomplexa, its mitochondrial genome is circular. Genome-scale reconstruction of functional networks revealed that B. microti has the minimal metabolic requirement for intraerythrocytic protozoan parasitism. B. microti multigene families differ from those of other protozoa in both the copy number and organization. Two lateral transfer events with significant metabolic implications occurred during the evolution of this parasite. The genomic sequencing of B. microti identified several targets suitable for the development of diagnostic assays and novel therapies for human babesiosis. PMID:22833609

Cornillot, Emmanuel; Hadj-Kaddour, Kamel; Dassouli, Amina; Noel, Benjamin; Ranwez, Vincent; Vacherie, Benoît; Augagneur, Yoann; Brès, Virginie; Duclos, Aurelie; Randazzo, Sylvie; Carcy, Bernard; Debierre-Grockiego, Françoise; Delbecq, Stéphane; Moubri-Ménage, Karina; Shams-Eldin, Hosam; Usmani-Brown, Sahar; Bringaud, Frédéric; Wincker, Patrick; Vivarès, Christian P; Schwarz, Ralph T; Schetters, Theo P; Krause, Peter J; Gorenflot, André; Berry, Vincent; Barbe, Valérie; Ben Mamoun, Choukri

2012-10-01

113

Focus on the ringleader: the role of AMA1 in apicomplexan invasion and replication  

PubMed Central

Apicomplexan parasites exhibit an unusual mechanism of host cell penetration. A central player in this process is the protein apical membrane antigen 1 (AMA1). Although essential for invasion, the precise functional roles AMA1 plays have been unclear. Several recent studies have provided important, functional insight into its role within the multiprotein complex that comprises the moving junction (MJ). Initially formed at the apical tip of the invading parasite, the MJ represents a ring-like region of contact between the surfaces of the invading parasite and host cell, even as the invaginated host plasma membrane is forced inward by the penetrating parasite. This review discusses these and other recent insights into AMA1 with a particular emphasis on studies conducted in Plasmodium and Toxoplasma. PMID:21659001

Tyler, Jessica S.; Treeck, Moritz; Boothroyd, John C.

2011-01-01

114

A Bayesian Change point model for differential gene expression patterns of the DosR regulon of Mycobacterium tuberculosis  

PubMed Central

Background Low oxygen availability has been shown previously to stimulate M. tuberculosis to establish non-replicative persistence in vitro. The two component sensor/regulator dosRS is a major mediator in the transcriptional response of M. tuberculosis to hypoxia and controls a regulon of approximately 50 genes that are induced under this condition. The aim of this study was to determine whether the induction of the entire DosR regulon is triggered as a synchronous event or if induction can unfold as a cascade of events as the differential expression of subsets of genes is stimulated by different oxygen availabilities. Results A novel aspect of our work is the use of chemostat cultures of M. tuberculosis which allowed us to control environmental conditions very tightly. We exposed M. tuberculosis to a sudden drop in oxygen availability in chemostat culture and studied the transcriptional response of the organism during the transition from a high oxygen level (10% dissolved oxygen tension or DOT) to a low oxygen level (0.2% DOT) using DNA microarrays. We developed a Bayesian change point analysis method that enabled us to detect subtle shifts in the timing of gene induction. It results in probabilities of a change in gene expression at certain time points. A computational analysis of potential binding sites upstream of the DosR-controlled genes shows how the transcriptional responses of these genes are influenced by the affinity of these binding sites to DosR. Our study also indicates that a subgroup of DosR-controlled genes is regulated indirectly. Conclusion The majority of the dosR-dependent genes were up-regulated at 0.2% DOT, which confirms previous findings that these genes are triggered by hypoxic environments. However, our change point analysis also highlights genes which were up-regulated earlier at levels of about 8% DOT indicating that they respond to small fluctuations in oxygen availability. Our analysis shows that there are pairs of divergent genes where one gene in the pair is up-regulated before the other, presumably for a flexible response to a constantly changing environment in the host. PMID:18294384

Zhang, Yi; Hatch, Kim A; Wernisch, Lorenz; Bacon, Joanna

2008-01-01

115

Identified members of the Streptomyces lividans AdpA regulon involved in differentiation and secondary metabolism  

PubMed Central

Background AdpA is a key transcriptional regulator involved in the complex growth cycle of Streptomyces. Streptomyces are Gram-positive bacteria well-known for their production of secondary metabolites and antibiotics. Most work on AdpA has been in S. griseus, and little is known about the pathways it controls in other Streptomyces spp. We recently discovered interplay between ClpP peptidases and AdpA in S. lividans. Here, we report the identification of genes directly regulated by AdpA in S. lividans. Results Microarray experiments revealed that the expression of hundreds of genes was affected in a S. lividans adpA mutant during early stationary phase cultures in YEME liquid medium. We studied the expression of the S. lividans AdpA-regulated genes by quantitative real-time PCR analysis after various times of growth. In silico analysis revealed the presence of potential AdpA-binding sites upstream from these genes; electrophoretic mobility shift assays indicated that AdpA binds directly to their promoter regions. This work identifies new pathways directly controlled by AdpA and that are involved in S. lividans development (ramR, SLI7885 also known as hyaS and SLI6586), and primary (SLI0755-SLI0754 encoding CYP105D5 and Fdx4) or secondary (cchA, cchB, and hyaS) metabolism. Conclusions We characterised six S. lividans AdpA-dependent genes whose expression is directly activated by this pleiotropic regulator. Several of these genes are orthologous to bldA-dependent genes in S. coelicolor. Furthermore, in silico analysis suggests that over hundred genes may be directly activated or repressed by S. lividans AdpA, although few have been described as being part of any Streptomyces AdpA regulons. This study increases the number of known AdpA-regulated pathways in Streptomyces spp. PMID:24694298

2014-01-01

116

RNA-Seq analysis reveals a six-gene SoxR regulon in Streptomyces coelicolor.  

PubMed

The redox-regulated transcription factor SoxR is conserved in diverse bacteria, but emerging studies suggest that this protein plays distinct physiological roles in different bacteria. SoxR regulates a global oxidative stress response (involving > 100 genes) against exogenous redox-cycling drugs in Escherichia coli and related enterics. In the antibiotic producers Streptomyces coelicolor and Pseudomonas aeruginosa, however, SoxR regulates a smaller number of genes that encode membrane transporters and proteins with homology to antibiotic-tailoring enzymes. In both S. coelicolor and P. aeruginosa, SoxR-regulated genes are expressed in stationary phase during the production of endogenously-produced redox-active antibiotics. These observations suggest that SoxR evolved to sense endogenous secondary metabolites and activate machinery to process and transport them in antibiotic-producing bacteria. Previous bioinformatics analysis that searched the genome for SoxR-binding sites in putative promoters defined a five-gene SoxR regulon in S. coelicolor including an ABC transporter, two oxidoreductases, a monooxygenase and an epimerase/dehydratase. Since this in silico screen may have missed potential SoxR-targets, we conducted a whole genome transcriptome comparison of wild type S. coelicolor and a soxR-deficient mutant in stationary phase using RNA-Seq. Our analysis revealed a sixth SoxR-regulated gene in S. coelicolor that encodes a putative quinone oxidoreductase. Knowledge of the full complement of genes regulated by SoxR will facilitate studies to elucidate the function of this regulatory molecule in antibiotic producers. PMID:25162599

Naseer, Nawar; Shapiro, Joshua A; Chander, Monica

2014-01-01

117

RNA-Seq Analysis Reveals a Six-Gene SoxR Regulon in Streptomyces coelicolor  

PubMed Central

The redox-regulated transcription factor SoxR is conserved in diverse bacteria, but emerging studies suggest that this protein plays distinct physiological roles in different bacteria. SoxR regulates a global oxidative stress response (involving >100 genes) against exogenous redox-cycling drugs in Escherichia coli and related enterics. In the antibiotic producers Streptomyces coelicolor and Pseudomonas aeruginosa, however, SoxR regulates a smaller number of genes that encode membrane transporters and proteins with homology to antibiotic-tailoring enzymes. In both S. coelicolor and P. aeruginosa, SoxR-regulated genes are expressed in stationary phase during the production of endogenously-produced redox-active antibiotics. These observations suggest that SoxR evolved to sense endogenous secondary metabolites and activate machinery to process and transport them in antibiotic-producing bacteria. Previous bioinformatics analysis that searched the genome for SoxR-binding sites in putative promoters defined a five-gene SoxR regulon in S. coelicolor including an ABC transporter, two oxidoreductases, a monooxygenase and an epimerase/dehydratase. Since this in silico screen may have missed potential SoxR-targets, we conducted a whole genome transcriptome comparison of wild type S. coelicolor and a soxR-deficient mutant in stationary phase using RNA-Seq. Our analysis revealed a sixth SoxR-regulated gene in S. coelicolor that encodes a putative quinone oxidoreductase. Knowledge of the full complement of genes regulated by SoxR will facilitate studies to elucidate the function of this regulatory molecule in antibiotic producers. PMID:25162599

Naseer, Nawar; Shapiro, Joshua A.; Chander, Monica

2014-01-01

118

The Listeria monocytogenes ?B Regulon and Its Virulence-Associated Functions Are Inhibited by a Small Molecule  

PubMed Central

ABSTRACT The stress-responsive alternative sigma factor ?B is conserved across diverse Gram-positive bacterial genera. In Listeria monocytogenes, ?B regulates transcription of >150 genes, including genes contributing to virulence and to bacterial survival under host-associated stress conditions, such as those encountered in the human gastrointestinal lumen. An inhibitor of L. monocytogenes ?B activity was identified by screening ~57,000 natural and synthesized small molecules using a high-throughput cell-based assay. The compound fluoro-phenyl-styrene-sulfonamide (FPSS) (IC50 = 3.5 µM) downregulated the majority of genes previously identified as members of the ?B regulon in L. monocytogenes 10403S, thus generating a transcriptional profile comparable to that of a 10403S ?sigB strain. Specifically, of the 208 genes downregulated by FPSS, 75% had been identified previously as positively regulated by ?B. Downregulated genes included key virulence and stress response genes, such as inlA, inlB, bsh, hfq, opuC, and bilE. From a functional perspective, FPSS also inhibited L. monocytogenes invasion of human intestinal epithelial cells and bile salt hydrolase activity. The ability of FPSS to inhibit ?B activity in both L. monocytogenes and Bacillus subtilis indicates its utility as a specific inhibitor of ?B across multiple Gram-positive genera. PMID:22128349

Palmer, M. Elizabeth; Chaturongakul, Soraya; Wiedmann, Martin; Boor, Kathryn J.

2011-01-01

119

Regulation of Rugosity and Biofilm Formation in Vibrio cholerae: Comparison of VpsT and VpsR Regulons and Epistasis Analysis of vpsT, vpsR, and hapR? †  

PubMed Central

Vibrio cholerae undergoes phenotypic variation that generates two morphologically different variants, termed smooth and rugose. The transcriptional profiles of the two variants differ greatly, and many of the differentially regulated genes are controlled by a complex regulatory circuitry that includes the transcriptional regulators VpsR, VpsT, and HapR. In this study, we identified the VpsT regulon and compared the VpsT and VpsR regulons to elucidate the contribution of each positive regulator to the rugose variant transcriptional profile and associated phenotypes. We have found that although the VpsT and VpsR regulons are very similar, the magnitude of the gene regulation accomplished by each regulator is different. We also determined that cdgA, which encodes a GGDEF domain protein, is partially responsible for the altered vps gene expression between the vpsT and vpsR mutants. Analysis of epistatic relationships among hapR, vpsT, and vpsR with respect to a whole-genome expression profile, colony morphology, and biofilm formation revealed that vpsR is epistatic to hapR and vpsT. Expression of virulence genes was increased in a vpsR hapR double mutant relative to a hapR mutant, suggesting that VpsR negatively regulates virulence gene expression in the hapR mutant. These results show that a complex regulatory interplay among VpsT, VpsR, HapR, and GGDEF/EAL family proteins controls transcription of the genes required for Vibrio polysaccharide and virulence factor production in V. cholerae. PMID:17071756

Beyhan, Sinem; Bilecen, Kivanc; Salama, Sofie R.; Casper-Lindley, Catharina; Yildiz, Fitnat H.

2007-01-01

120

Cellular Noise Regulons Underlie Fluctuations in Saccharomyces cerevisiae  

PubMed Central

Summary Stochasticity is a hallmark of cellular processes and different classes of genes show large differences in their cell-to-cell variability (noise). To decipher the sources and consequences of this noise, we systematically measured pairwise correlations between large numbers of genes, including those with high variability. We find that there is substantial pathway variability shared across similarly regulated genes. This induces quantitative correlations in the expression of functionally related genes such as those involved in the Msn2/4 stress response pathway, amino-acid biosynthesis, and mitochondrial maintenance. Bioinformatic analyses and genetic perturbations suggest that fluctuations in PKA and Tor signaling contribute to pathway-specific variability. Our results argue that a limited number of well-delineated “noise regulons” operate across a yeast cell, and that such coordinated fluctuations enable a stochastic but coherent induction of functionally related genes. Finally, we show that pathway noise is a quantitative tool for exploring pathway features and regulatory relationships in un-stimulated systems. PMID:22365828

Stewart-Ornstein, Jacob; Weissman, Jonathan S.; El-Samad, Hana

2012-01-01

121

Modulation of hexa-acyl pyrophosphate lipid A population under Escherichia coli phosphate (Pho) regulon activation.  

PubMed

Environmental phosphate is an important signal for microorganism gene regulation, and it has recently been shown to trigger some key bacterial virulence mechanisms. In many bacteria, the Pho regulon is the major circuit involved in adaptation to phosphate limitation. The Pho regulon is controlled jointly by the two-component regulatory system PhoR/PhoB and by the phosphate-specific transport (Pst) system, which both belong to the Pho regulon. We showed that a pst mutation results in virulence attenuation in extraintestinal pathogenic Escherichia coli (ExPEC) strains. Our results indicate that the bacterial cell surface of the pst mutants is altered. In this study, we show that pst mutants of ExPEC strains display an increased sensitivity to different cationic antimicrobial peptides and vancomycin. Remarkably, the hexa-acylated 1-pyrophosphate form of lipid A is significantly less abundant in pst mutants. Among differentially expressed genes in the pst mutant, lpxT coding for an enzyme that transfers a phosphoryl group to lipid A, forming the 1-diphosphate species, was found to be downregulated. Our results strongly suggest that the Pho regulon is involved in lipid A modifications, which could contribute to bacterial surface perturbations. Since the Pho regulon and the Pst system are conserved in many bacteria, such a lipid A modification mechanism could be widely distributed among gram-negative bacterial species. PMID:18515419

Lamarche, Martin G; Kim, Sang-Hyun; Crépin, Sébastien; Mourez, Michael; Bertrand, Nicolas; Bishop, Russell E; Dubreuil, J Daniel; Harel, Josée

2008-08-01

122

Analysis of the ArcA regulon in anaerobically grown Salmonella enterica sv. Typhimurium  

PubMed Central

Background Salmonella enterica serovar Typhimurium (S. Typhimurium) is a Gram-negative pathogen that must successfully adapt to the broad fluctuations in the concentration of dissolved dioxygen encountered in the host. In Escherichia coli, ArcA (Aerobic Respiratory Control) helps the cells to sense and respond to the presence of dioxygen. The global role of ArcA in E. coli is well characterized; however, little is known about its role in anaerobically grown S. Typhimurium. Results We compared the transcriptional profiles of the virulent wild-type (WT) strain (ATCC 14028s) and its isogenic arcA mutant grown under anaerobic conditions. We found that ArcA directly or indirectly regulates 392 genes (8.5% of the genome); of these, 138 genes are poorly characterized. Regulation by ArcA in S. Typhimurium is similar, but distinct from that in E. coli. Thus, genes/operons involved in core metabolic pathways (e.g., succinyl-CoA, fatty acid degradation, cytochrome oxidase complexes, flagellar biosynthesis, motility, and chemotaxis) were regulated similarly in the two organisms. However, genes/operons present in both organisms, but regulated differently by ArcA in S. Typhimurium included those coding for ethanolamine utilization, lactate transport and metabolism, and succinate dehydrogenases. Salmonella-specific genes/operons regulated by ArcA included those required for propanediol utilization, flagellar genes (mcpAC, cheV), Gifsy-1 prophage genes, and three SPI-3 genes (mgtBC, slsA, STM3784). In agreement with our microarray data, the arcA mutant was non-motile, lacked flagella, and was as virulent in mice as the WT. Additionally, we identified a set of 120 genes whose regulation was shared with the anaerobic redox regulator, Fnr. Conclusion(s) We have identified the ArcA regulon in anaerobically grown S. Typhimurium. Our results demonstrated that in S. Typhimurium, ArcA serves as a transcriptional regulator coordinating cellular metabolism, flagella biosynthesis, and motility. Furthermore, ArcA and Fnr share in the regulation of 120 S. Typhimurium genes. PMID:21418628

2011-01-01

123

Global Analysis of Apicomplexan Protein S-Acyl Transferases Reveals an Enzyme Essential for Invasion  

PubMed Central

The advent of techniques to study palmitoylation on a whole proteome scale has revealed that it is an important reversible modification that plays a role in regulating multiple biological processes. Palmitoylation can control the affinity of a protein for lipid membranes, which allows it to impact protein trafficking, stability, folding, signalling and interactions. The publication of the palmitome of the schizont stage of Plasmodium falciparum implicated a role for palmitoylation in host cell invasion, protein export and organelle biogenesis. However, nothing is known so far about the repertoire of protein S-acyl transferases (PATs) that catalyse this modification in Apicomplexa. We undertook a comprehensive analysis of the repertoire of Asp-His-His-Cys cysteine-rich domain (DHHC-CRD) PAT family in Toxoplasma gondii and Plasmodium berghei by assessing their localization and essentiality. Unlike functional redundancies reported in other eukaryotes, some apicomplexan-specific DHHCs are essential for parasite growth, and several are targeted to organelles unique to this phylum. Of particular interest is DHHC7, which localizes to rhoptry organelles in all parasites tested, including the major human pathogen P. falciparum. TgDHHC7 interferes with the localization of the rhoptry palmitoylated protein TgARO and affects the apical positioning of the rhoptry organelles. This PAT has a major impact on T. gondii host cell invasion, but not on the parasite’s ability to egress. PMID:23638681

Frénal, Karine; Tay, Chwen L; Mueller, Christina; Bushell, Ellen S; Jia, Yonggen; Graindorge, Arnault; Billker, Oliver; Rayner, Julian C; Soldati-Favre, Dominique

2013-01-01

124

Lipid Synthesis in Protozoan Parasites: a Comparison Between Kinetoplastids and Apicomplexans  

PubMed Central

Lipid metabolism is of crucial importance for pathogens. Lipids serve as cellular building blocks, signalling molecules, energy stores, posttranslational modifiers, and pathogenesis factors. Parasites rely on a complex system of uptake and synthesis mechanisms to satisfy their lipid needs. The parameters of this system change dramatically as the parasite transits through the various stages of its life cycle. Here we discuss the tremendous recent advances that have been made in the understanding of the synthesis and uptake pathways for fatty acids and phospholipids in apicomplexan and kinetoplastid parasites, including Plasmodium, Toxoplasma, Cryptosporidium, Trypanosoma and Leishmania. Lipid synthesis differs in significant ways between parasites from both phyla and the human host. Parasites have acquired novel pathways through endosymbiosis, as in the case of the apicoplast, have dramatically reshaped substrate and product profiles, and have evolved specialized lipids to interact with or manipulate the host. These differences potentially provide opportunities for drug development. We outline the lipid pathways for key species in detail as they progress through the developmental cycle and highlight those that are of particular importance to the biology of the pathogens and/or are the most promising targets for parasite-specific treatment. PMID:23827884

Ramakrishnan, Srinivasan; Serricchio, Mauro; Striepen, Boris; Bütikofer, Peter

2013-01-01

125

A global role for Fis in the transcriptional control of metabolism and type III secretion in Salmonella enterica serovar Typhimurium  

Microsoft Academic Search

Fis is a key DNA-binding protein involved in nucleoid organization and modulation of many DNA transactions, including transcription in enteric bacteria. The regulon of genes whose expression is influenced by Fis in Salmonella enterica serovar Typhimurium (S. typhimurium) has been defined by DNA microarray analysis. These data suggest that Fis plays a central role in coordinating the expression of both

Arlene Kelly; Martin D. Goldberg; Ronan K. Carroll; Vittoria Danino; Jay C. D. Hinton; Charles J. Dorman

2004-01-01

126

Defining the CREB RegulonA Genome-Wide Analysis of Transcription Factor Regulatory Regions  

Microsoft Academic Search

7 ) were serum starved with DMEM for 14 hr and treated with 10 ?M forskolin or 1.9 dideoxy forskolin for 1 hr. Two biological replicates were used to prepare ~10 ?g of total RNA using both the Trizol and Rneasy kits according to the manufacturer's in- structions. Each sample was analyzed by the OHSU Gene Microar- ray Shared Resource

Soren Impey; Sean R. McCorkle; Hyunjoo Cha-Molstad; Jami M. Dwyer; Gregory S. Yochum; Jeremy M. Boss; Shannon McWeeney; John J. Dunn; Gail Mandel; Richard H. Goodman

2004-01-01

127

Non-canonical CRP sites control competence regulons in Escherichia coli and many other  

E-print Network

Non-canonical CRP sites control competence regulons in Escherichia coli and many other g for DNA uptake (natural competence). Only the latter `CRP-S' sites require both CRP and the coregulator that the g-proteobacteria share a common DNA uptake mechanism, but also that, in the three best studied

Redfield, Rosemary J. "Rosie"

128

moaR, a gene that encodes a positive regulator of the monoamine regulon in Klebsiella aerogenes.  

PubMed Central

We cloned and sequenced a Klebsiella aerogenes gene (moaR) for activation of arylsulfatase synthesis by tyramine. This gene was cloned by complementation of a K. aerogenes mutant in which tyramine fails to relieve the arylsulfatase repression caused by sulfur compounds. The moaR gene also activated induction of the synthesis of both tyramine oxidase and the 30-kDa protein that is specifically induced by high concentrations of tyramine or catecholamines. The moaR gene on the chromosome of the wild-type strain of K. aerogenes was disrupted by homologous recombination with a plasmid containing the inactivated moaR. The resultant mutant showed the same phenotype as previously isolated atsT mutant strains that are negative for the derepressed synthesis of arylsulfatase. In this mutant strain, tyramine also failed to induce the synthesis of tyramine oxidase or the production of a 30-kDa protein. The moaR gene is capable of encoding a protein of 26,238 Da. The putative MoaR protein has a helix-turn-helix motif in its C terminus. Thus, it seems likely that the MoaR protein regulates the operons by binding to the regulatory region of the monoamine regulon. The MoaR protein is subject to autogenous control, which was shown by use of a moaR'-lacZ transcriptional fusion. Images PMID:8407801

Azakami, H; Sugino, H; Yokoro, N; Iwata, N; Murooka, Y

1993-01-01

129

Mitochondrial genome of Babesia orientalis, apicomplexan parasite of water buffalo (Bubalus babalis, Linnaeus, 1758) endemic in China  

PubMed Central

Background Apicomplexan parasites of the genus Babesia, Theileria and Plasmodium are very closely related organisms. Interestingly, their mitochondrial (mt) genomes are highly divergent. Among Babesia, Babesia orientalis is a new species recently identified and specifically epidemic to the southern part of China, causing severe disease to water buffalo. However, no information on the mt genome of B. orientalis was available. Methods Four pairs of primers were designed based on the full genome sequence of B. orientalis (unpublished data) and by aligning reported mt genomes of B. bovis, B. bigemina, and T. parva. The entire mt genome was amplified by four sets of PCR. The obtained mt genome was annotated by aligning with published apicomplexan mt genomes and Artemis software v11. Phylogenetic analysis was performed by using cox1 and cob amino acid sequences. Results The complete mt genome of B. orientalis (Wuhan strain) was sequenced and characterized. The entire mt genome is 5996 bp in length with a linear form, containing three protein-coding genes including cytochrome c oxidase I (cox1), cytochrome b (cob) and cytochrome c oxidase III (cox3) and six rRNA large subunit gene fragments. The gene arrangement in B. orientalis mt genome is similar to those of B. bovis, B. gibsoni and Theileria parva, but different from those of T. orientalis, T. equi and Plasmodium falciparum. Comparative analysis indicated that cox1 and cob genes were more conserved than cox3. Phylogenetic analysis based on amino acid sequences of cox1, cob and cox1 + cob, respectively, revealed that B. orientalis fell into Babesia clade with the closest relationship to B. bovis. Conclusions The availability of the entire mt genome sequences of B. orientalis provides valuable information for future phylogenetic, population genetics and molecular epidemiological studies of apicomplexan parasites. PMID:24580772

2014-01-01

130

Babesia divergens and Neospora caninum apical membrane antigen 1 structures reveal selectivity and plasticity in apicomplexan parasite host cell invasion  

PubMed Central

Host cell invasion by the obligate intracellular apicomplexan parasites, including Plasmodium (malaria) and Toxoplasma (toxoplasmosis), requires a step-wise mechanism unique among known host–pathogen interactions. A key step is the formation of the moving junction (MJ) complex, a circumferential constriction between the apical tip of the parasite and the host cell membrane that traverses in a posterior direction to enclose the parasite in a protective vacuole essential for intracellular survival. The leading model of MJ assembly proposes that Rhoptry Neck Protein 2 (RON2) is secreted into the host cell and integrated into the membrane where it serves as the receptor for apical membrane antigen 1 (AMA1) on the parasite surface. We have previously demonstrated that the AMA1-RON2 interaction is an effective target for inhibiting apicomplexan invasion. To better understand the AMA1-dependant molecular recognition events that promote invasion, including the significant AMA1-RON2 interaction, we present the structural characterization of AMA1 from the apicomplexan parasites Babesia divergens (BdAMA1) and Neospora caninum (NcAMA1) by X-ray crystallography. These studies offer intriguing structural insight into the RON2-binding surface groove in the AMA1 apical domain, which shows clear evidence for receptor–ligand co-evolution, and the hyper variability of the membrane proximal domain, which in Plasmodium is responsible for direct binding to erythrocytes. By incorporating the structural analysis of BdAMA1 and NcAMA1 with existing AMA1 structures and complexes we were able to define conserved pockets in the AMA1 apical groove that could be targeted for the design of broadly reactive therapeutics. PMID:23169033

Tonkin, Michelle L; Crawford, Joanna; Lebrun, Maryse L; Boulanger, Martin J

2013-01-01

131

The Copper-Responsive RicR Regulon Contributes to Mycobacterium tuberculosis Virulence  

PubMed Central

ABSTRACT As with most life on Earth, the transition metal copper (Cu) is essential for the viability of the human pathogen Mycobacterium tuberculosis. However, infected hosts can also use Cu to control microbial growth. Several Cu-responsive pathways are present in M. tuberculosis, including the regulated in copper repressor (RicR) regulon, which is unique to pathogenic mycobacteria. In this work, we describe the contribution of each RicR-regulated gene to Cu resistance in vitro and to virulence in animals. We found that the deletion or disruption of individual RicR-regulated genes had no impact on virulence in mice, although several mutants had Cu hypersensitivity. In contrast, a mutant unable to activate the RicR regulon was not only highly susceptible to Cu but also attenuated in mice. Thus, these data suggest that several genes of the RicR regulon are required simultaneously to combat Cu toxicity in vivo or that this regulon is also important for resistance against Cu-independent mechanisms of host defense. IMPORTANCE Mycobacterium tuberculosis is the causative agent of tuberculosis, killing millions of people every year. Therefore, understanding the biology of M. tuberculosis is crucial for the development of new therapies to treat this devastating disease. Our studies reveal that although host-supplied Cu can suppress bacterial growth, M. tuberculosis has a unique pathway, the RicR regulon, to defend against Cu toxicity. These findings suggest that Cu homeostasis pathways in both the host and the pathogen could be exploited for the treatment of tuberculosis. PMID:24549843

Shi, Xiaoshan; Festa, Richard A.; Ioerger, Thomas R.; Butler-Wu, Susan; Sacchettini, James C.; Darwin, K. Heran; Samanovic, Marie I.

2014-01-01

132

Genome-Wide Analysis of Cell Type-Specific Gene Transcription during Spore Formation in Clostridium difficile  

PubMed Central

Clostridium difficile, a Gram positive, anaerobic, spore-forming bacterium is an emergent pathogen and the most common cause of nosocomial diarrhea. Although transmission of C. difficile is mediated by contamination of the gut by spores, the regulatory cascade controlling spore formation remains poorly characterized. During Bacillus subtilis sporulation, a cascade of four sigma factors, ?F and ?G in the forespore and ?E and ?K in the mother cell governs compartment-specific gene expression. In this work, we combined genome wide transcriptional analyses and promoter mapping to define the C. difficile ?F, ?E, ?G and ?K regulons. We identified about 225 genes under the control of these sigma factors: 25 in the ?F regulon, 97 ?E-dependent genes, 50 ?G-governed genes and 56 genes under ?K control. A significant fraction of genes in each regulon is of unknown function but new candidates for spore coat proteins could be proposed as being synthesized under ?E or ?K control and detected in a previously published spore proteome. SpoIIID of C. difficile also plays a pivotal role in the mother cell line of expression repressing the transcription of many members of the ?E regulon and activating sigK expression. Global analysis of developmental gene expression under the control of these sigma factors revealed deviations from the B. subtilis model regarding the communication between mother cell and forespore in C. difficile. We showed that the expression of the ?E regulon in the mother cell was not strictly under the control of ?F despite the fact that the forespore product SpoIIR was required for the processing of pro-?E. In addition, the ?K regulon was not controlled by ?G in C. difficile in agreement with the lack of pro-?K processing. This work is one key step to obtain new insights about the diversity and evolution of the sporulation process among Firmicutes. PMID:24098137

Saujet, Laure; Soutourina, Olga; Monot, Marc; Shelyakin, Pavel V.; Gelfand, Mikhail S.; Dupuy, Bruno; Henriques, Adriano O.; Martin-Verstraete, Isabelle

2013-01-01

133

The Gal3p transducer of the GAL regulon interacts with the Gal80p repressor in its ligand-induced closed conformation  

PubMed Central

A wealth of genetic information and some biochemical analysis have made the GAL regulon of the yeast Saccharomyces cerevisiae a classic model system for studying transcriptional activation in eukaryotes. Galactose induces this transcriptional switch, which is regulated by three proteins: the transcriptional activator Gal4p, bound to DNA; the repressor Gal80p; and the transducer Gal3p. We showed previously that NADP appears to act as a trigger to kick the repressor off the activator. Sustained activation involves a complex of the transducer Gal3p and Gal80p mediated by galactose and ATP. We solved the crystal structure of the complex of Gal3p–Gal80p with ?-D-galactose and ATP to 2.1 Å resolution. The interaction between the proteins occurs only when Gal3p is in a “closed” state induced by ligand binding. The structure of the complex provides a rationale for the phenotypes of several well-known Gal80p and Gal3p mutants as well as the lack of galactokinase activity of Gal3p. PMID:22302941

Lavy, Tali; Kumar, P. Rajesh; He, Hongzhen; Joshua-Tor, Leemor

2012-01-01

134

Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus  

SciTech Connect

Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. Despite the growing number of genome-scale gene expression studies, our abilities to convert the results of these studies into accurate regulatory annotations and to project them from model to other organisms are extremely limited. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. However, even orthologous regulators with conserved DNA-binding motifs may control substantially different gene sets, revealing striking differences in regulatory strategies between the Shewanella spp. and E. coli. Multiple examples of regulatory network rewiring include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), and numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. NagR for N-acetylglucosamine catabolism and PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp).

Rodionov, Dmitry A.; Novichkov, Pavel; Stavrovskaya, Elena D.; Rodionova, Irina A.; Li, Xiaoqing; Kazanov, Marat D.; Ravcheev, Dmitry A.; Gerasimova, Anna V.; Kazakov, Alexey E.; Kovaleva, Galina Y.; Permina, Elizabeth A.; Laikova, Olga N.; Overbeek, Ross; Romine, Margaret F.; Fredrickson, Jim K.; Arkin, Adam P.; Dubchak, Inna; Osterman, Andrei L.; Gelfand, Mikhail S.

2011-06-15

135

Transcriptomic Analysis Reveals Evidence for a Cryptic Plastid in the Colpodellid Voromonas pontica, a Close Relative of Chromerids and Apicomplexan Parasites  

PubMed Central

Colpodellids are free-living, predatory flagellates, but their close relationship to photosynthetic chromerids and plastid-bearing apicomplexan parasites suggests they were ancestrally photosynthetic. Colpodellids may therefore retain a cryptic plastid, or they may have lost their plastids entirely, like the apicomplexan Cryptosporidium. To find out, we generated transcriptomic data from Voromonas pontica ATCC 50640 and searched for homologs of genes encoding proteins known to function in the apicoplast, the non-photosynthetic plastid of apicomplexans. We found candidate genes from multiple plastid-associated pathways including iron-sulfur cluster assembly, isoprenoid biosynthesis, and tetrapyrrole biosynthesis, along with a plastid-type phosphate transporter gene. Four of these sequences include the 5? end of the coding region and are predicted to encode a signal peptide and a transit peptide-like region. This is highly suggestive of targeting to a cryptic plastid. We also performed a taxon-rich phylogenetic analysis of small subunit ribosomal RNA sequences from colpodellids and their relatives, which suggests that photosynthesis was lost more than once in colpodellids, and independently in V. pontica and apicomplexans. Colpodellids therefore represent a valuable source of comparative data for understanding the process of plastid reduction in humanity's most deadly parasite. PMID:24797661

Gile, Gillian H.; Slamovits, Claudio H.

2014-01-01

136

DB-AT: a 2015 update to the Full-parasites database brings a multitude of new transcriptomic data for apicomplexan parasites.  

PubMed

The previous release of our Full-parasites database (http://fullmal.hgc.jp/) brought enhanced functionality, an expanded full-length cDNA content, and new RNA-Seq datasets from several important apicomplexan parasites. The 2015 update witnesses the major shift in the databases content with focus on diverse transcriptomes of the apicomplexan parasites. The content of the database was substantially enriched with transcriptome information for new apicomplexan parasites. The latest version covers a total of 17 species, with addition of our newly generated RNA-Seq data of a total of 909 150 388 tags. Moreover, we have generated and included two novel and unique datasets, which represent diverse nature of transcriptomes in individual parasites in vivo and in vitro. One is the data collected from 116 Indonesian patients infected with Plasmodium falciparum. The other is a series of transcriptome data collected from a total of 38 single cells of P. falciparum cultured in vitro. We believe that with the recent advances our database becomes an even better resource and a unique platform in the analysis of apicomplexan parasites and their interaction with their hosts. To adequately reflect the recent modifications and the current content we have changed the database name to DB-AT-DataBase of Apicomplexa Transcriptomes. PMID:25414358

J?kalski, Marcin; Wakaguri, Hiroyuki; Kischka, Tabea G; Nishikawa, Yoshifumi; Kawazu, Shin-Ichiro; Matsubayashi, Makoto; Kawahara, Fumiya; Tsuji, Naotoshi; Cao, Shinuo; Sunaga, Fujiko; Xuan, Xuenan; Okubo, Kazuhiro; Igarashi, Ikuo; Tuda, Josef; Mongan, Arthur E; Eshita, Yuki; Maeda, Ryuichiro; Maka?owski, Wojciech; Suzuki, Yutaka; Yamagishi, Junya

2015-01-28

137

Evidence of tRNA cleavage in apicomplexan parasites: half-tRNAs as new potential regulatory molecules of Toxoplasma gondii and Plasmodium berghei  

Technology Transfer Automated Retrieval System (TEKTRAN)

Several lines of evidence demonstrated that organisms ranging from bacteria to higher animals possess a regulated endonucleolytic cleavage pathway producing half-tRNA fragments. In the present study, we investigated the occurrence of this phenomenon in two distantly related apicomplexan parasites, T...

138

Arabidopsis CBF1 and CBF3 have a different function than CBF2 in cold acclimation and define different gene classes in the CBF regulon  

PubMed Central

The C-repeat-binding factor (CBF)/dehydration-responsive element-binding factor (DREB1) proteins constitute a small family of Arabidopsis transcriptional activators (CBF1/DREB1B, CBF2/DREB1C, and CBF3/DREB1A) that play a prominent role in cold acclimation. A fundamental question about these factors that remains to be answered is whether they are functionally equivalent. Recently, we reported that CBF2 negatively regulates CBF1 and CBF3 expression, and that CBFs are subjected to different temporal regulation during cold acclimation, which suggested this might not be the case. In this study, we have analyzed the expression of CBF genes in different tissues of Arabidopsis, during development and in response to low temperature, and characterized RNA interference (RNAi) and antisense lines that fail to accumulate CBF1 or/and CBF3 mRNAs under cold conditions. We found that CBF1 and CBF3 are regulated in a different way than CBF2. Moreover, in contrast to CBF2, CBF1 and CBF3 are not involved in regulating other CBF genes and positively regulate cold acclimation by activating the same subset of CBF-target genes. All these results demonstrate that CBF1 and CBF3 have different functions than CBF2. We also found that the CBF regulon is composed of at least two different kind of genes, one of them requiring the simultaneous expression of both CBF1 and CBF3 to be properly induced. This indicates that CBF1 and CBF3 have a concerted additive effect to induce the whole CBF regulon and the complete development of cold acclimation. PMID:18093929

Novillo, Fernando; Medina, Joaquín; Salinas, Julio

2007-01-01

139

Functional analysis of Ralstonia solanacearum PrhG regulating the hrp regulon in host plants.  

PubMed

Genes in the hrp regulon encode component proteins of the type III secretion system and are essential for the pathogenicity of Ralstonia solanacearum. The hrp regulon is controlled by HrpB. We isolated several genes regulating hrpB expression from the Japanese strain OE1-1 using minitransposon mutagenesis. Among them, we mainly focused on two genes, hrpG and prhG, which are the positive regulators of hrpB. Although the global virulence regulator PhcA negatively regulated hrpG expression via prhIR, it positively regulated prhG expression. We further investigated the contrasting regulation of hrpG and prhG by PhcA and speculated that R. solanacearum may switch from HrpG to PrhG for hrpB activation in a cell density-dependent manner. Although the prhG mutant proliferated similarly to the wild-type in leaf intercellular spaces and in xylem vessels of the host plants, it was less virulent than the wild-type. The expression of the popA operon, which belongs to the hrp regulon, was significantly reduced in the prhG mutant by more than half in the leaf intercellular spaces and more than two-thirds in the xylem vessels when compared with the wild-type. PMID:23704782

Zhang, Yong; Chen, Li; Yoshimochi, Takeshi; Kiba, Akinori; Hikichi, Yasufumi; Ohnishi, Kouhei

2013-08-01

140

Response of Desulfovibrio vulgaris Hildenborough to hydrogen peroxide: enzymatic and transcriptional analyses.  

PubMed

We studied the effect of hydrogen peroxide (H(2)O(2)) stress on the anaerobic sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough. In a lactate/sulfate medium, growth was affected from 0.1 mM H(2)O(2) and totally inhibited at 0.7 mM. Surprisingly, transcript analyses revealed that the PerR regulon exhibited opposite regulation in the presence of 0.1 and 0.3 mM H(2)O(2). The variations in peroxidase- and superoxide dismutase-specific activities in the cell-free extracts of H(2)O(2)-stressed cultures were related to changes in the corresponding transcript abundance. Our data suggest that sod, sor, ngr and tpx genes, in addition to the PerR regulon, belong to the H(2)O(2) stimulon. PMID:20695895

Brioukhanov, Andrei L; Durand, Marie-Claire; Dolla, Alain; Aubert, Corinne

2010-09-01

141

Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks  

SciTech Connect

Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the result, we demonstrate considerable interconnection between various nitrogen-oxides-responsive regulatory systems for the denitrification and NO detoxification genes and evolutionary plasticity of this transcriptional network.

Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.; Alm, EricJ.; Gelfand, Mikhail S.

2005-09-01

142

Activation of the SoxR regulon in Streptomyces coelicolor by the extracellular form of the pigmented antibiotic actinorhodin.  

PubMed

The redox-sensitive transcription factor SoxR in enteric bacteria senses and regulates the cellular response to superoxide and nitric oxide. In other bacterial groups, however, it may respond to redox-active small molecules, as demonstrated for pyocyanin sensing in pseudomonads. The antibiotic-producing soil bacterium Streptomyces coelicolor contains a gene for an SoxR homologue (SCO1697) whose DNA recognition helix is identical to that of Escherichia coli SoxR. Using the E. coli SoxR binding sequence, we predicted five candidate genes of the SoxR regulon and demonstrated that SoxR binds to their promoter regions and activates their expression concurrently with the production of the blue antibiotic actinorhodin (a benzoisochromanequinone). These genes encode a probable NADPH-dependent flavin reductase (SCO2478), an NADPH-dependent quinone reductase (SCO4266), an ABC transporter (SCO7008), a monooxygenase (SCO1909), and a hypothetical protein (SCO1178). Addition of actinorhodin to exponentially growing cells activated the expression of SoxR target genes in an SoxR-dependent manner. The secreted ?-actinorhodin was over 10-fold more effective in activation than the intracellular form of actinorhodin, suggesting that SoxR is specified to respond more to exogenous signals than to intracellular metabolites. The ?soxR mutant was not compromised in resistance against oxidants but was slow in forming aerial mycelium on R2YE medium with reduced sporulation, and its production of actinorhodin and undecylprodigiosin was lowered by about 50% and 30%, respectively, compared to that of the wild type. These results support the proposal that SoxR senses redox-active molecules, such as actinorhodin in S. coelicolor, and induces a protective function against them. It also functions to ensure that cells undergo optimal differentiation and secondary metabolite production. PMID:21037009

Shin, Jung-Ho; Singh, Atul K; Cheon, Dong-Joo; Roe, Jung-Hye

2011-01-01

143

Activation of the SoxR Regulon in Streptomyces coelicolor by the Extracellular Form of the Pigmented Antibiotic Actinorhodin?  

PubMed Central

The redox-sensitive transcription factor SoxR in enteric bacteria senses and regulates the cellular response to superoxide and nitric oxide. In other bacterial groups, however, it may respond to redox-active small molecules, as demonstrated for pyocyanin sensing in pseudomonads. The antibiotic-producing soil bacterium Streptomyces coelicolor contains a gene for an SoxR homologue (SCO1697) whose DNA recognition helix is identical to that of Escherichia coli SoxR. Using the E. coli SoxR binding sequence, we predicted five candidate genes of the SoxR regulon and demonstrated that SoxR binds to their promoter regions and activates their expression concurrently with the production of the blue antibiotic actinorhodin (a benzoisochromanequinone). These genes encode a probable NADPH-dependent flavin reductase (SCO2478), an NADPH-dependent quinone reductase (SCO4266), an ABC transporter (SCO7008), a monooxygenase (SCO1909), and a hypothetical protein (SCO1178). Addition of actinorhodin to exponentially growing cells activated the expression of SoxR target genes in an SoxR-dependent manner. The secreted ?-actinorhodin was over 10-fold more effective in activation than the intracellular form of actinorhodin, suggesting that SoxR is specified to respond more to exogenous signals than to intracellular metabolites. The ?soxR mutant was not compromised in resistance against oxidants but was slow in forming aerial mycelium on R2YE medium with reduced sporulation, and its production of actinorhodin and undecylprodigiosin was lowered by about 50% and 30%, respectively, compared to that of the wild type. These results support the proposal that SoxR senses redox-active molecules, such as actinorhodin in S. coelicolor, and induces a protective function against them. It also functions to ensure that cells undergo optimal differentiation and secondary metabolite production. PMID:21037009

Shin, Jung-Ho; Singh, Atul K.; Cheon, Dong-Joo; Roe, Jung-Hye

2011-01-01

144

In the NadR regulon, adhesins and diverse meningococcal functions are regulated in response to signals in human saliva.  

PubMed

The Neisseria meningitidis regulator NadR was shown to repress expression of the NadA adhesin and play a major role in NadA phase-variable expression. In this study, we identified through microarray analysis over 30 genes coregulated with nadA in the NadR mutant and defined members of the NadR regulon through in vitro DNA-binding assays. Two distinct types of promoter architectures (I and II) were identified for NadR targets, differing in both the number and position of NadR-binding sites. All NadR-regulated genes investigated were found to respond to 4-hydroxyphenylacetic acid (4HPA), a small molecule secreted in human saliva, which was previously demonstrated to induce nadA expression by alleviating NadR-dependent repression. Interestingly, two types of NadR 4HPA responsive activities were found on different NadR targets corresponding to the two types of genes identified by different promoter architectures: while NadA and the majority of NadR targets (type I) are induced, only the MafA adhesins (type II) are corepressed in response to the same 4HPA signal. This alternate behavior of NadR was confirmed in a panel of strains in response to 4HPA and after incubation in saliva. The in vitro NadR binding activity at type I and type II promoter regions is differentially affected by 4HPA, suggesting that the nature of the NadR binding sites may define the regulation to which they will be subjected. We conclude that NadR coordinates a broad transcriptional response to signals present in human saliva, mimicked in vitro by 4HPA, enabling the meningococcus to adapt to the relevant host niche. PMID:22081399

Fagnocchi, Luca; Pigozzi, Eva; Scarlato, Vincenzo; Delany, Isabel

2012-01-01

145

In the NadR Regulon, Adhesins and Diverse Meningococcal Functions Are Regulated in Response to Signals in Human Saliva  

PubMed Central

The Neisseria meningitidis regulator NadR was shown to repress expression of the NadA adhesin and play a major role in NadA phase-variable expression. In this study, we identified through microarray analysis over 30 genes coregulated with nadA in the NadR mutant and defined members of the NadR regulon through in vitro DNA-binding assays. Two distinct types of promoter architectures (I and II) were identified for NadR targets, differing in both the number and position of NadR-binding sites. All NadR-regulated genes investigated were found to respond to 4-hydroxyphenylacetic acid (4HPA), a small molecule secreted in human saliva, which was previously demonstrated to induce nadA expression by alleviating NadR-dependent repression. Interestingly, two types of NadR 4HPA responsive activities were found on different NadR targets corresponding to the two types of genes identified by different promoter architectures: while NadA and the majority of NadR targets (type I) are induced, only the MafA adhesins (type II) are corepressed in response to the same 4HPA signal. This alternate behavior of NadR was confirmed in a panel of strains in response to 4HPA and after incubation in saliva. The in vitro NadR binding activity at type I and type II promoter regions is differentially affected by 4HPA, suggesting that the nature of the NadR binding sites may define the regulation to which they will be subjected. We conclude that NadR coordinates a broad transcriptional response to signals present in human saliva, mimicked in vitro by 4HPA, enabling the meningococcus to adapt to the relevant host niche. PMID:22081399

Fagnocchi, Luca; Pigozzi, Eva; Scarlato, Vincenzo

2012-01-01

146

BCKDH: The Missing Link in Apicomplexan Mitochondrial Metabolism Is Required for Full Virulence of Toxoplasma gondii and Plasmodium berghei  

PubMed Central

While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens. PMID:25032958

Oppenheim, Rebecca D.; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P.; Billker, Oliver; McConville, Malcolm J.; Soldati-Favre, Dominique

2014-01-01

147

The LicT protein acts as both a positive and a negative regulator of loci within the bgl regulon of Streptococcus mutans.  

PubMed

An open reading frame (ORF) that would encode a putative antiterminator protein (LicT) of the BglG family was identified in the genomic DNA sequence of Streptococcus mutans. A DNA sequence that would encode a potential ribonucleic antiterminator (RAT) site in the mRNA at which the putative antitermination protein LicT would bind was located immediately downstream from this ORF. These putative antitermination components are upstream of a glucose-independent beta-glucoside-utilization system that is responsible for aesculin utilization by S. mutans NG8 in the presence of glucose. It was hypothesized that these putative regulatory components were an important mechanism that was involved with the controlled expression of the S. mutans bglP locus. A strain of S. mutans containing a licT : : Omega-Kan2 insertional mutation was created. This strain could not hydrolyse aesculin in the presence of glucose. The transcriptional activity associated with other genes from the bgl regulon was determined in the licT : : Omega-Kan2 genetic background using lacZ transcriptional fusions and beta-galactosidase assays to determine the effect of LicT on these loci. The LicT protein had no significant effect on the expression of the bglC promoter, a regulator of the bglA locus. However, it is essential for the optimal expression of bglP. These data correlate with the phenotype observed on aesculin plates for the S. mutans wild-type strain NG8 and the licT : : Omega-Kan2 strain. Thus, the glucose-independent beta-glucoside-specific phosphotransferase system (PTS) regulon in S. mutans relies on LicT for BglP expression and, in turn, aesculin transport in the presence of glucose. Interestingly, LicT also seems to negatively regulate the expression of the bglA promoter region. In addition, the presence of the S. mutans licT gene has been shown to be able to activate a cryptic beta-glucoside-specific operon found in Escherichia coli. PMID:12724394

Cote, Christopher K; Honeyman, Allen L

2003-05-01

148

The monoamine regulon including syntheses of arylsulfatase and monoamine oxidase in bacteria.  

PubMed

Bacterial cells respond to monoamine compounds, such as tyramine, dopamine, octopamine, or norepinephrine, and induce the syntheses of tyramine oxidase encoded by tynA and monoamine oxidase encoded by maoA. These monoamine compounds also derepress the synthesis of atsA-specified arylsulfatase that is repressed by sulfur compounds. These complex mechanisms of regulons regulated by monoamine and sulfur compounds has been analyzed by cloning and characterization of genes that are involved in the repression and derepression of the synthesis of arylsulfatase. The atsA gene forms an operon with the atsB gene, which encodes an activator of the expression of atsA. The negative regulator gene for arylsulfatase was found to code for dihydrofolate reductase (folA). The maoA gene forms an operon with the maoC gene, which has similarity to a dehydrogenase involved in the tyramine metabolism. The moaF gene encoding a 30-kDa protein, which is induced by tyramine, also forms an operon with the moaE gene. Finally, the moaR gene, which is induced by monoamine, was found to play a central role in the positive regulation of the expression of the monoamine regulon (moa) including the atsBA, maoCA, moaEF, and tyn operons. The moaR expression is subject to autogenous regulation and to cAMP-CRP control. The MoaR protein has a helix-turn-helix motif in its C terminus. Thus, the MoaR protein probably regulates the operons by binding to the regulatory region of the moa regulon. PMID:8695909

Murooka, Y; Azakami, H; Yamashita, M

1996-06-01

149

Cryptosporidium is more closely related to the gregarines than to coccidia as shown by phylogenetic analysis of apicomplexan parasites inferred using small-subunit ribosomal RNA gene sequences.  

PubMed

The phylogenetic placement of gregarine parasites (Apicomplexa: Gregarinasina) within the Apicomplexa was derived by comparison of small-subunit ribosomal RNA gene sequences. Gregarine sequences were obtained from Gregarina niphandrodes Clopton, Percival, and Janovy, 1991, and Monocystis agilis Stein, 1848 (Eugregarinorida Léger 1900), as well as from Ophriocystis elektroscirrha McLaughlin and Myers, 1970 (Neogregarinorida Grassé 1953). The sequences were aligned with several other gregarine and apicomplexan sequences from GenBank and the resulting data matrix analyzed by parsimony and maximum-likelihood methods. The gregarines form a monophyletic clade that is a sister group to Cryptosporidium spp. The gregarine/ Cryptosporidium clade is separate from the other major apicomplexan clade containing the coccidia, adeleids, piroplasms, and haemosporinids. The trees indicate that the genus Cryptosporidium has a closer phylogenetic affinity with the gregarines than with the coccidia. These results do not support the present classification of the Cryptosporidiidae in the suborder Eimerioirina Léger, 1911. PMID:10540950

Carreno, R A; Martin, D S; Barta, J R

1999-11-01

150

A small-molecule cell-based screen led to the identification of biphenylimidazoazines with highly potent and broad-spectrum anti-apicomplexan activity.  

PubMed

An in vitro screening of the anti-apicomplexan activity of 51 compounds, stemming from our chemical library and from chemical synthesis, was performed. As a study model, we used Toxoplasma gondii (T. gondii), expressing ?-galactosidase for the colorimetric assessment of drug activity on parasites cultivated in vitro. This approach allowed the validation of a new series of molecules with a biphenylimidazoazine scaffold as inhibitors of T. gondii growth in vitro. Hence, 8 molecules significantly inhibited intracellular replication of T. gondii in vitro, with EC50 < 1 ?M, while being non-toxic for human fibroblasts at these concentrations. Most attractive candidates were then selected for further biological investigations on other apicomplexan parasites (Neospora caninum, Besnoitia besnoiti, Eimeria tenella and Plasmodium falciparum). Finally, two compounds were able to inhibit growth of four different apicomplexans with EC50 in the submicromolar to nanomolar range, for each parasite. These data, including the broad anti-parasite spectrum of these inhibitors, define a new generation of potential anti-parasite compounds of wide interest, including for veterinary application. Studies realized on E. tenella suggest that these molecules act during the intracellular development steps of the parasite. Further experiments should be done to identify the molecular target(s) of these compounds. PMID:25462254

Moine, Espérance; Denevault-Sabourin, Caroline; Debierre-Grockiego, Françoise; Silpa, Laurence; Gorgette, Olivier; Barale, Jean-Christophe; Jacquiet, Philippe; Brossier, Fabien; Gueiffier, Alain; Dimier-Poisson, Isabelle; Enguehard-Gueiffier, Cécile

2015-01-01

151

Characterization of the Fur Regulon in Pseudomonas syringae pv. tomato DC3000?†  

PubMed Central

The plant pathogen Pseudomonas syringae pv. tomato DC3000 (DC3000) is found in a wide variety of environments and must monitor and respond to various environmental signals such as the availability of iron, an essential element for bacterial growth. An important regulator of iron homeostasis is Fur (ferric uptake regulator), and here we present the first study of the Fur regulon in DC3000. Using chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-seq), 312 chromosomal regions were highly enriched by coimmunoprecipitation with a C-terminally tagged Fur protein. Integration of these data with previous microarray and global transcriptome analyses allowed us to expand the putative DC3000 Fur regulon to include genes both repressed and activated in the presence of bioavailable iron. Using nonradioactive DNase I footprinting, we confirmed Fur binding in 41 regions, including upstream of 11 iron-repressed genes and the iron-activated genes encoding two bacterioferritins (PSPTO_0653 and PSPTO_4160), a ParA protein (PSPTO_0855), and a two-component system (TCS) (PSPTO_3382 to PSPTO_3380). PMID:21784947

Butcher, Bronwyn G.; Bronstein, Philip A.; Myers, Christopher R.; Stodghill, Paul V.; Bolton, James J.; Markel, Eric J.; Filiatrault, Melanie J.; Swingle, Bryan; Gaballa, Ahmed; Helmann, John D.; Schneider, David J.; Cartinhour, Samuel W.

2011-01-01

152

Characterization of the CopR regulon of Lactococcus lactis IL1403.  

PubMed

To identify components of the copper homeostatic mechanism of Lactococcus lactis, we employed two-dimensional gel electrophoresis to detect changes in the proteome in response to copper. Three proteins upregulated by copper were identified: glyoxylase I (YaiA), a nitroreductase (YtjD), and lactate oxidase (LctO). The promoter regions of these genes feature cop boxes of consensus TACAnnTGTA, which are the binding site of CopY-type copper-responsive repressors. A genome-wide search for cop boxes revealed 28 such sequence motifs. They were tested by electrophoretic mobility shift assays for the interaction with purified CopR, the CopY-type repressor of L. lactis. Seven of the cop boxes interacted with CopR in a copper-sensitive manner. They were present in the promoter region of five genes, lctO, ytjD, copB, ydiD, and yahC; and two polycistronic operons, yahCD-yaiAB and copRZA. Induction of these genes by copper was confirmed by real-time quantitative PCR. The copRZA operon encodes the CopR repressor of the regulon; a copper chaperone, CopZ; and a putative copper ATPase, CopA. When expressed in Escherichia coli, the copRZA operon conferred copper resistance, suggesting that it functions in copper export from the cytoplasm. Other member genes of the CopR regulon may similarly be involved in copper metabolism. PMID:17993525

Magnani, David; Barré, Olivier; Gerber, Simon D; Solioz, Marc

2008-01-01

153

The ResD Response Regulator, through Functional Interaction with NsrR and Fur, Plays Three Distinct Roles in Bacillus subtilis Transcriptional Control  

PubMed Central

The ResD response regulator activates transcription of diverse genes in Bacillus subtilis in response to oxygen limitation. ResD regulon genes that are the most highly induced during nitrate respiration include the nitrite reductase operon (nasDEF) and the flavohemoglobin gene (hmp), whose products function in nitric oxide (NO) metabolism. Transcription of these genes is also under the negative control of the NO-sensitive NsrR repressor. Recent studies showed that the NsrR regulon contains genes with no apparent relevance to NO metabolism and that the ResD response regulator and NsrR coordinately regulate transcription. To determine whether these genes are direct targets of NsrR and ResD, we used chromatin affinity precipitation coupled with tiling chip (ChAP-chip) and ChAP followed by quantitative PCR (ChAP-qPCR) analyses. The study showed that ResD and NsrR directly control transcription of the ykuNOP operon in the Fur regulon. ResD functions as an activator at the nasD and hmp promoters, whereas it functions at the ykuN promoter as an antirepressor of Fur and a corepressor for NsrR. This mechanism likely participates in fine-tuning of transcript levels in response to different sources of stress, such as oxygen limitation, iron limitation, and exposure to NO. PMID:24214949

Henares, Bernadette; Kommineni, Sushma; Chumsakul, Onuma; Ogasawara, Naotake; Ishikawa, Shu

2014-01-01

154

Cross-Reactive Immunity to Mycobacterium tuberculosis DosR Regulon-Encoded Antigens in Individuals Infected with Environmental, Nontuberculous Mycobacteria? †  

PubMed Central

Mycobacterium tuberculosis DosR regulon-encoded antigens are highly immunogenic in M. tuberculosis-infected humans and are associated with latent tuberculosis infection. We have investigated the hypothesis that infection with or exposure to nontuberculous mycobacteria (NTM) can induce cross-reactive immunity to M. tuberculosis DosR regulon-encoded antigens since responsiveness has been observed in non-M. tuberculosis-exposed but purified protein derivative-responsive individuals. M. tuberculosis DosR regulon-encoded antigen-specific T-cell responses were studied in peripheral blood mononuclear cells (PBMCs) of NTM-infected/exposed individuals. BLASTP was used to determine the presence of M. tuberculosis DosR regulon-encoded protein orthologs among environmental mycobacteria and nonmycobacteria. Significant gamma interferon production was observed in PBMCs from NTM-infected/exposed individuals in response to M. tuberculosis DosR regulon-encoded antigens. DosR regulon-encoded protein orthologs were prominently present in tuberculous and environmental mycobacteria and surprisingly also in nonmycobacteria. The ubiquitous presence of the highly conserved DosR master regulator protein Rv3133c suggests that this is a general adaptive bacterial response regulator. We report a first series of M. tuberculosis antigens to which cross-reactive immunity is induced by NTM infection/exposure. The high conservation of M. tuberculosis DosR regulon-encoded antigens most likely enables them to induce cross-reactive T-cell responses. PMID:19737909

Lin, May Young; Reddy, T. B. K.; Arend, Sandra M.; Friggen, Annemieke H.; Franken, Kees L. M. C.; van Meijgaarden, Krista E.; Verduyn, Marleen J. C.; Schoolnik, Gary K.; Klein, Michel R.; Ottenhoff, Tom H. M.

2009-01-01

155

The TviA auxiliary protein renders the Salmonella enterica serotype Typhi RcsB regulon responsive to changes in osmolarity  

PubMed Central

In response to osmolarity, Salmonella enterica serotype Typhi (S. Typhi) regulates genes required for Vi capsular antigen expression oppositely to those required for motility and invasion. Previous studies suggest that osmoregulation of motility, invasion and capsule expression is mediated through the RcsC/RcsD/RcsB phosphorelay system. Here we performed gene expression profiling and functional studies to determine the role of TviA, an auxiliary protein of the RcsB response regulator, in controlling virulence gene expression in S. Typhi. TviA repressed expression of genes encoding flagella and the invasion associated type III secretion system (T3SS-1) through repression of the flagellar regulators flhDC and fliZ, resulting in reduced invasion, reduced motility and reduced expression of FliC. Both RcsB and TviA repressed expression of flhDC, but only TviA altered flhDC expression in response to osmolarity. Introduction of tviA into S. enterica serotype Typhimurium rendered flhDC transcription sensitive to changes in osmolarity. These data suggest that the auxiliary TviA protein integrates a new regulatory input into the RcsB regulon of S. Typhi, thereby altering expression of genes encoding flagella, the Vi antigen and T3SS-1 in response to osmolarity. PMID:19703107

Winter, Sebastian E.; Winter, Maria G.; Thiennimitr, Parameth; Gerriets, Valerie A.; Nuccio, Sean-Paul; Rüssmann, Holger; Bäumler, Andreas J.

2009-01-01

156

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.  

PubMed

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans. PMID:3325779

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

157

Transcription Factors in Escherichia coli Prefer the Holo Conformation  

PubMed Central

The transcriptional regulatory network of Escherichia coli K-12 is among the best studied gene networks of any living cell. Transcription factors bind to DNA either with their effector bound (holo conformation), or as a free protein (apo conformation) regulating transcription initiation. By using RegulonDB, the functional conformations (holo or apo) of transcription factors, and their mode of regulation (activator, repressor, or dual) were exhaustively analyzed. We report a striking discovery in the architecture of the regulatory network, finding a strong under-representation of the apo conformation (without allosteric metabolite) of transcription factors when binding to their DNA sites to activate transcription. This observation is supported at the level of individual regulatory interactions on promoters, even if we exclude the promoters regulated by global transcription factors, where three-quarters of the known promoters are regulated by a transcription factor in holo conformation. This genome-scale analysis enables us to ask what are the implications of these observations for the physiology and for our understanding of the ecology of E. coli. We discuss these ideas within the framework of the demand theory of gene regulation. PMID:23776535

Balderas-Martínez, Yalbi Itzel; Savageau, Michael; Salgado, Heladia; Pérez-Rueda, Ernesto; Morett, Enrique; Collado-Vides, Julio

2013-01-01

158

LuxR- and Acyl-Homoserine-Lactone-Controlled Non-lux Genes Define a Quorum-Sensing Regulon in Vibrio fischeri  

PubMed Central

The luminescence (lux) operon (luxICDABEG) of the symbiotic bacterium Vibrio fischeri is regulated by the transcriptional activator LuxR and two acyl-homoserine lactone (acyl-HSL) autoinducers (the luxI-dependent 3-oxo-hexanoyl-HSL [3-oxo-C6-HSL] and the ainS-dependent octanoyl-HSL [C8-HSL]) in a population density-responsive manner called quorum sensing. To identify quorum-sensing-regulated (QSR) proteins different from those encoded by lux genes, we examined the protein patterns of V. fischeri quorum-sensing mutants defective in luxI, ainS, and luxR by two-dimensional polyacrylamide gel electrophoresis. Five non-Lux QSR proteins, QsrP, RibB, AcfA, QsrV, and QSR 7, were identified; their production occurred preferentially at high population density, required both LuxR and 3-oxo-C6-HSL, and was inhibited by C8-HSL at low population density. The genes encoding two of the QSR proteins were characterized: qsrP directs cells to synthesize an apparently novel periplasmic protein, and ribB is a homolog of the Escherichia coli gene for 3,4-dihydroxy-2-butanone 4-phosphate synthase, a key enzyme for riboflavin synthesis. The qsrP and ribB promoter regions each contained a sequence similar to the lux operon lux box, a 20-bp region of dyad symmetry necessary for LuxR/3-oxo-C6-HSL-dependent activation of lux operon transcription. V. fischeri qsrP and ribB mutants exhibited no distinct phenotype in culture. However, a qsrP mutant, in competition with its parent strain, was less successful in colonizing Euprymna scolopes, the symbiotic host of V. fischeri. The newly identified QSR genes, together with the lux operon, define a LuxR/acyl-HSL-responsive quorum-sensing regulon in V. fischeri. PMID:10781550

Callahan, Sean M.; Dunlap, Paul V.

2000-01-01

159

Transcriptional Regulation of the Cellobiose Operon of Streptococcus mutans? §  

PubMed Central

The ability of Streptococcus mutans to catabolize cellobiose, a ?-linked glucoside generated during the hydrolysis of cellulose, is shown to be regulated by a transcriptional regulator, CelR, which is encoded by an operon with a phospho-?-glucosidase (CelA) and a cellobiose-specific sugar phosphotransferase system (PTS) permease (EIICel). The roles of CelR, EIICel components, and certain fructose/mannose-PTS permeases in the transcriptional regulation of the cel locus were analyzed. The results revealed that (i) the celA and celB (EIIBCel) gene promoters require CelR for transcriptional activation in response to cellobiose, but read-through from the celA promoter contributes to expression of the EIICel genes; (ii) the EIICel subunits were required for growth on cellobiose and for transcriptional activation of the cel genes; (iii) CcpA plays little direct role in catabolite repression of the cel regulon, but loss of specific PTS permeases alleviated repression of cel genes in the presence of preferred carbohydrates; and (iv) glucose could induce transcription of the cel regulon when transported by EIICel. CelR derivatives containing amino acid substitutions for five conserved histidine residues in two PTS regulatory domains and an EIIA-like domain also provided important insights regarding the function of this regulator. Based on these data, a model for the involvement of PTS permeases and the general PTS proteins enzyme I and HPr was developed that reveals a critical role for the PTS in CcpA-independent catabolite repression and induction of cel gene expression in S. mutans. PMID:19168613

Zeng, Lin; Burne, Robert A.

2009-01-01

160

FITBAR: a web tool for the robust prediction of prokaryotic regulons  

PubMed Central

Background The binding of regulatory proteins to their specific DNA targets determines the accurate expression of the neighboring genes. The in silico prediction of new binding sites in completely sequenced genomes is a key aspect in the deeper understanding of gene regulatory networks. Several algorithms have been described to discriminate against false-positives in the prediction of new binding targets; however none of them has been implemented so far to assist the detection of binding sites at the genomic scale. Results FITBAR (Fast Investigation Tool for Bacterial and Archaeal Regulons) is a web service designed to identify new protein binding sites on fully sequenced prokaryotic genomes. This tool consists in a workbench where the significance of the predictions can be compared using different statistical methods, a feature not found in existing resources. The Local Markov Model and the Compound Importance Sampling algorithms have been implemented to compute the P-value of newly discovered binding sites. In addition, FITBAR provides two optimized genomic scanning algorithms using either log-odds or entropy-weighted position-specific scoring matrices. Other significant features include the production of a detailed genomic context map for each detected binding site and the export of the search results in spreadsheet and portable document formats. FITBAR discovery of a high affinity Escherichia coli NagC binding site was validated experimentally in vitro as well as in vivo and published. Conclusions FITBAR was developed in order to allow fast, accurate and statistically robust predictions of prokaryotic regulons. This feature constitutes the main advantage of this web tool over other matrix search programs and does not impair its performance. The web service is available at http://archaea.u-psud.fr/fitbar. PMID:21070640

2010-01-01

161

Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses  

SciTech Connect

The Arc two-component system is a global regulator controlling many genes involved in aerobic/anaerobic respiration and fermentative metabolism in Escherichia coli. Shewanella oneidensis MR-1 contains a gene encoding a putative ArcA homolog with {approx} 81% amino acid sequence identity to the E. coli ArcA protein but not a full-length arcB gene. To understand the role of ArcA in S. oneidensis, an arcA deletion strain was constructed and subjected to both physiological characterization and microarray analysis. Compared to the wild-type MR-1, the mutant exhibited impaired aerobic growth and a defect in utilizing DMSO in the absence of O{sub 2}. Microarray analyses on cells grown aerobically and anaerobically on fumarate revealed that expression of 1009 genes was significantly affected (p < 0.05) by the mutation. In contrast to E. coli ArcA, the protein appears to be dispensable in regulation of the TCA cycle in S. oneidensis. To further determine genes regulated by the Arc system, an ArcA recognition weight matrix from DNA-binding data and bioinformatics analysis was generated and used to produce an ArcA sequence affinity map. By combining both techniques, we identified an ArcA regulon of at least 50 operons, of which only 6 were found to be directly controlled by ArcA in E. coli. These results indicate that the Arc system in S. oneidensis differs from that in E. coli substantially in terms of its physiological function and regulon while their binding motif are strikingly similar.

Gao, Haichun [University of Oklahoma; Wang, Xiaohu [Baylor College of Medicine, Huston; Yang, Zamin Koo [ORNL; Palzkill, Timothy [Baylor College of Medicine, Huston; Zhou, Jizhong [University of Oklahoma

2008-01-01

162

1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon  

SciTech Connect

The dha regulon in Klebsiella pneumoniae enables the organism to grown anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydoxyacetone and was screened for the production of 1, 3-PD. The cosmid pTC1 (42.5 kn total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycersol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1, 3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering.

I-Teh Tong; Hans H. Liao; Cameron, D.C. (Univ. of Wisconsin, Madison (United States))

1991-12-01

163

PspG, a New Member of the Yersinia enterocolitica Phage Shock Protein Regulon  

PubMed Central

The Yersinia enterocolitica phage shock protein (Psp) system is induced when the Ysc type III secretion system is produced or when only the YscC secretin component is synthesized. Some psp null mutants have a growth defect when YscC is produced and a severe virulence defect in animals. The Y. enterocolitica psp locus is made up of two divergently transcribed cistrons, pspF and pspABCDycjXF. pspA operon expression is dependent on RpoN (?54) and the enhancer-binding protein PspF. Previous data indicated that PspF also controls at least one gene that is not part of the psp locus. In this study we describe the identification of pspG, a new member of the PspF regulon. Predicted RpoN-binding sites upstream of the pspA genes from different bacteria have a common divergence from the consensus sequence, which may be a signature of PspF-dependent promoters. The Y. enterocolitica pspG gene was identified because its promoter also has this signature. Like the pspA operon, pspG is positively regulated by PspF, negatively regulated by PspA, and induced in response to the production of secretins. Purified His6-PspF protein specifically interacts with the pspA and pspG control regions. A pspA operon deletion mutant has a growth defect when the YscC secretin is produced and a virulence defect in a mouse model of infection. These phenotypes were exacerbated by a pspG null mutation. Therefore, PspG is the missing component of the Y. enterocolitica Psp regulon that was previously predicted to exist. PMID:15262928

Green, Rebecca C.; Darwin, Andrew J.

2004-01-01

164

Binding motifs in bacterial gene promoters modulate transcriptional effects of global regulators CRP and ArcA  

SciTech Connect

Bacterial gene regulation involves transcription factors (TF) that bind to DNA recognition sequences in operon promoters. These recognition sequences, many of which are palindromic, are known as regulatory elements or transcription factor binding sites (TFBS). Some TFs are global regulators that can modulate the expression of hundreds of genes. In this study we examine global regulator half-sites, where a half-site, which we shall call a binding motif (BM), is one half of a palindromic TFBS. We explore the hypothesis that the number of BMs plays an important role in transcriptional regulation, examining empirical data from transcriptional profiling of the CRP and ArcA regulons. We compare the power of BM counts and of full TFBS characteristics to predict induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full TFBS quality or location.

Leuze, Mike; Karpinets, Tatiana V.; Syed, Mustafa H.; Beliaev, Alex S.; Uberbacher, Edward

2012-05-30

165

Model of transcriptional activation by MarA in Escherichia coli.  

PubMed

The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond. PMID:20019803

Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G

2009-12-01

166

Positive Transcriptional Feedback Controls Hydrogenase Expression in Alcaligenes eutrophus H16  

PubMed Central

The protein HoxA is the central regulator of the Alcaligenes eutrophus H16 hox regulon, which encodes two hydrogenases, a nickel permease and several accessory proteins required for hydrogenase biosynthesis. Expression of the regulatory gene hoxA was analyzed. Screening of an 8-kb region upstream of hoxA with a promoter probe vector localized four promoter activities. One of these was found in the region immediately 5? of hoxA; the others were correlated with the nickel metabolism genes hypA1, hypB1, and hypX. All four activities were independent of HoxA and of the minor transcription factor ?54. Translational fusions revealed that hoxA is expressed constitutively at low levels. In contrast to these findings, immunoblotting studies revealed a clear fluctuation in the HoxA pool in response to conditions which induce the hox regulon. Quantitative transcript assays indicated elevated levels of hyp mRNA under hydrogenase-derepressing conditions. Using interposon mutagenesis, we showed that the activity of a remote promoter is required for hydrogenase expression and autotrophic growth. Site-directed mutagenesis revealed that PMBH, which directs transcription of the structural genes of the membrane-bound hydrogenase, contributes to the expression of hoxA under hydrogenase-derepressing conditions. Thus, expression of the hox regulon is governed by a positive feedback loop mediating amplification of the regulator HoxA. These results imply the existence of an unusually large (ca. 17,000-nucleotide) transcript. PMID:10482509

Schwartz, Edward; Buhrke, Thorsten; Gerischer, Ulrike; Friedrich, Bärbel

1999-01-01

167

Large-Scale Mapping and Validation of Escherichia coli Transcriptional Regulation from a Compendium of Expression Profiles  

PubMed Central

Machine learning approaches offer the potential to systematically identify transcriptional regulatory interactions from a compendium of microarray expression profiles. However, experimental validation of the performance of these methods at the genome scale has remained elusive. Here we assess the global performance of four existing classes of inference algorithms using 445 Escherichia coli Affymetrix arrays and 3,216 known E. coli regulatory interactions from RegulonDB. We also developed and applied the context likelihood of relatedness (CLR) algorithm, a novel extension of the relevance networks class of algorithms. CLR demonstrates an average precision gain of 36% relative to the next-best performing algorithm. At a 60% true positive rate, CLR identifies 1,079 regulatory interactions, of which 338 were in the previously known network and 741 were novel predictions. We tested the predicted interactions for three transcription factors with chromatin immunoprecipitation, confirming 21 novel interactions and verifying our RegulonDB-based performance estimates. CLR also identified a regulatory link providing central metabolic control of iron transport, which we confirmed with real-time quantitative PCR. The compendium of expression data compiled in this study, coupled with RegulonDB, provides a valuable model system for further improvement of network inference algorithms using experimental data. PMID:17214507

Thaden, Joshua T; Mogno, Ilaria; Wierzbowski, Jamey; Cottarel, Guillaume; Kasif, Simon; Collins, James J; Gardner, Timothy S

2007-01-01

168

Mobilization of Processed, Membrane-Tethered SPT23 Transcription Factor by CDC48 UFD1\\/NPL4, a Ubiquitin-Selective Chaperone  

Microsoft Academic Search

The OLE pathway of yeast regulates the level of the ER-bound enzyme ?9-fatty acid desaturase OLE1, thereby controlling membrane fluidity. A central component of this regulon is the transcription factor SPT23, a homolog of mammalian NF-?B. SPT23 is synthesized as an inactive, ER membrane-anchored precursor that is activated by regulated ubiquitin\\/proteasome-dependent processing (RUP). We now show that SPT23 dimerizes prior

Michael Rape; Thorsten Hoppe; Ingo Gorr; Marian Kalocay; Holger Richly; Stefan Jentsch

2001-01-01

169

In silico analysis reveals substantial variability in the gene contents of the gamma proteobacteria LexA-regulon  

Microsoft Academic Search

Motivation: Motif-prediction algorithm capabilities for the anal- ysis of bacterial regulatory networks and the prediction of new regulatory sites can be greatly enhanced by the use of com- parative genomics approaches. In this study, we make use of a consensus-building algorithm and comparative genomics to conduct an in-depth analysis of the LexA-regulon of gamma proteobacteria, and we use the inferred

Ivan Erill; Marcos Escribano; Susana Campoy; Jordi Barbé

2003-01-01

170

A cell–cell signaling peptide activates the PlcR virulence regulon in bacteria of the Bacillus cereus group  

PubMed Central

PlcR is a pleiotropic regulator that activates the expression of genes encoding various virulence factors, such as phospholipases C, proteases and hemolysins, in Bacillus thuringiensis and Bacillus cereus. Here we show that the activation mechanism is under the control of a small peptide: PapR. The papR gene belongs to the PlcR regulon and is located 70 bp downstream from plcR. It encodes a 48-amino-acid peptide. Disruption of the papR gene abolished expression of the PlcR regulon, resulting in a large decrease in hemolysis and virulence in insect larvae. We demonstrated that the PapR polypeptide was secreted, then reimported via the oligopeptide permease Opp. Once inside the cell, a processed form of PapR, presumably a pentapeptide, activated the PlcR regulon by allowing PlcR to bind to its DNA target. This activating mechanism was found to be strain specific, with this specificity determined by the first residue of the penta peptide. PMID:12198157

Slamti, Leyla; Lereclus, Didier

2002-01-01

171

Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis.  

PubMed

Summary The CBF cold response pathway has a prominent role in cold acclimation. The pathway includes action of three transcription factors, CBF1, 2 and 3 (also known as DREB1b, c and a, respectively), that are rapidly induced in response to low temperature followed by expression of the CBF-targeted genes (the CBF regulon) that act in concert to increase plant-freezing tolerance. The results of transcriptome profiling and mutagenesis experiments, however, indicate that additional cold response pathways exist and may have important roles in life at low temperature. To further understand the roles that the CBF proteins play in configuring the low temperature transcriptome and to identify additional transcription factors with roles in cold acclimation, we used the Affymetrix GeneChip containing probe sets for approximately 24,000 Arabidopsis genes to define a core set of cold-responsive genes and to determine which genes were targets of CBF2 and 6 other transcription factors that appeared to be coordinately regulated with CBF2. A total of 514 genes were placed in the core set of cold-responsive genes, 302 of which were upregulated and 212 downregulated. Hierarchical clustering and bioinformatic analysis indicated that the 514 cold-responsive transcripts could be assigned to one of seven distinct expression classes and identified multiple potential novel cis-acting cold-regulatory elements. Eighty-five cold-induced genes and eight cold-repressed genes were assigned to the CBF2 regulon. An additional nine cold-induced genes and 15 cold-repressed genes were assigned to a regulon controlled by ZAT12. Of the 25 core cold-induced genes that were most highly upregulated (induced over 15-fold), 19 genes (84%) were induced by CBF2 and another two genes (8%) were regulated by both CBF2 and ZAT12. Thus, the large majority (92%) of the most highly induced genes belong to the CBF and ZAT12 regulons. Constitutive expression of ZAT12 in Arabidopsis caused a small, but reproducible, increase in freezing tolerance, indicating a role for the ZAT12 regulon in cold acclimation. In addition, ZAT12 downregulated the expression of the CBF genes indicating a role for ZAT12 in a negative regulatory circuit that dampens expression of the CBF cold response pathway. PMID:15634197

Vogel, Jonathan T; Zarka, Daniel G; Van Buskirk, Heather A; Fowler, Sarah G; Thomashow, Michael F

2005-01-01

172

Rcs signaling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility  

PubMed Central

Summary In Salmonella enterica, an activated Rcs signaling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes - fliPQR - located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signaling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

Wang, Qingfeng; Harshey, Rasika M.

2009-01-01

173

Comparative Proteomic Analysis of the PhoP Regulon in Salmonella enterica Serovar Typhi Versus Typhimurium  

PubMed Central

Background S. Typhi, a human-restricted Salmonella enterica serovar, causes a systemic intracellular infection in humans (typhoid fever). In comparison, S. Typhimurium causes gastroenteritis in humans, but causes a systemic typhoidal illness in mice. The PhoP regulon is a well studied two component (PhoP/Q) coordinately regulated network of genes whose expression is required for intracellular survival of S. enterica. Methodology/Principal Findings Using high performance liquid chromatography mass spectrometry (HPLC-MS/MS), we examined the protein expression profiles of three sequenced S. enterica strains: S. Typhimurium LT2, S. Typhi CT18, and S. Typhi Ty2 in PhoP-inducing and non-inducing conditions in vitro and compared these results to profiles of phoP?/Q? mutants derived from S. Typhimurium LT2 and S. Typhi Ty2. Our analysis identified 53 proteins in S. Typhimurium LT2 and 56 proteins in S. Typhi that were regulated in a PhoP-dependent manner. As expected, many proteins identified in S. Typhi demonstrated concordant differential expression with a homologous protein in S. Typhimurium. However, three proteins (HlyE, STY1499, and CdtB) had no homolog in S. Typhimurium. HlyE is a pore-forming toxin. STY1499 encodes a stably expressed protein of unknown function transcribed in the same operon as HlyE. CdtB is a cytolethal distending toxin associated with DNA damage, cell cycle arrest, and cellular distension. Gene expression studies confirmed up-regulation of mRNA of HlyE, STY1499, and CdtB in S. Typhi in PhoP-inducing conditions. Conclusions/Significance This study is the first protein expression study of the PhoP virulence associated regulon using strains of Salmonella mutant in PhoP, has identified three Typhi-unique proteins (CdtB, HlyE and STY1499) that are not present in the genome of the wide host-range Typhimurium, and includes the first protein expression profiling of a live attenuated bacterial vaccine studied in humans (Ty800). PMID:19746165

Charles, Richelle C.; Harris, Jason B.; Chase, Michael R.; Lebrun, Lauren M.; Sheikh, Alaullah; LaRocque, Regina C.; Logvinenko, Tanya; Rollins, Sean M.; Tarique, Abdullah; Hohmann, Elizabeth L.; Rosenberg, Ian; Krastins, Bryan; Sarracino, David A.; Qadri, Firdausi; Calderwood, Stephen B.; Ryan, Edward T.

2009-01-01

174

Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria  

PubMed Central

Background Catabolite repression control (CRC) is an important global control system in Pseudomonas that fine tunes metabolism in order optimise growth and metabolism in a range of different environments. The mechanism of CRC in Pseudomonas spp. centres on the binding of a protein, Crc, to an A-rich motif on the 5' end of an mRNA resulting in translational down-regulation of target genes. Despite the identification of several Crc targets in Pseudomonas spp. the Crc regulon has remained largely unexplored. Results In order to predict direct targets of Crc, we used a bioinformatics approach based on detection of A-rich motifs near the initiation of translation of all protein-encoding genes in twelve fully sequenced Pseudomonas genomes. As expected, our data predict that genes related to the utilisation of less preferred nutrients, such as some carbohydrates, nitrogen sources and aromatic carbon compounds are targets of Crc. A general trend in this analysis is that the regulation of transporters is conserved across species whereas regulation of specific enzymatic steps or transcriptional activators are often conserved only within a species. Interestingly, some nucleoid associated proteins (NAPs) such as HU and IHF are predicted to be regulated by Crc. This finding indicates a possible role of Crc in indirect control over a subset of genes that depend on the DNA bending properties of NAPs for expression or repression. Finally, some virulence traits such as alginate and rhamnolipid production also appear to be regulated by Crc, which links nutritional status cues with the regulation of virulence traits. Conclusions Catabolite repression control regulates a broad spectrum of genes in Pseudomonas. Some targets are genus-wide and are typically related to central metabolism, whereas other targets are species-specific, or even unique to particular strains. Further study of these novel targets will enhance our understanding of how Pseudomonas bacteria integrate nutritional status cues with the regulation of traits that are of ecological, industrial and clinical importance. PMID:21108798

2010-01-01

175

Characterization of the SigD Regulon of C. difficile and Its Positive Control of Toxin Production through the Regulation of tcdR  

PubMed Central

Clostridium difficile intestinal disease is mediated largely by the actions of toxins A (TcdA) and B (TcdB), whose production occurs after the initial steps of colonization involving different surface or flagellar proteins. In B. subtilis, the sigma factor SigD controls flagellar synthesis, motility, and vegetative autolysins. A homolog of SigD encoding gene is present in the C.difficile 630 genome. We constructed a sigD mutant in C. difficile 630 ?erm to analyze the regulon of SigD using a global transcriptomic approach. A total of 103 genes were differentially expressed between the wild-type and the sigD mutant, including genes involved in motility, metabolism and regulation. In addition, the sigD mutant displayed decreased expression of genes involved in flagellar biosynthesis, and also of genes encoding TcdA and TcdB as well as TcdR, the positive regulator of the toxins. Genomic analysis and RACE-PCR experiments allowed us to characterize promoter sequences of direct target genes of SigD including tcdR and to identify the SigD consensus. We then established that SigD positively regulates toxin expression via direct control of tcdR transcription. Interestingly, the overexpression of FlgM, a putative anti-SigD factor, inhibited the positive regulation of motility and toxin synthesis by SigD. Thus, SigD appears to be the first positive regulator of the toxin synthesis in C. difficile. PMID:24358307

El Meouche, Imane; Peltier, Johann; Monot, Marc; Soutourina, Olga; Pestel-Caron, Martine; Dupuy, Bruno; Pons, Jean-Louis

2013-01-01

176

Proteomic profiling of ClpXP substrates after DNA damage reveals extensive instability within SOS regulon.  

PubMed

ClpXP, a bacterial AAA+ protease, controls intracellular levels of many stress-response proteins. To investigate substrate profile changes caused by a specific environmental stress, quantitative mass spectrometry (SILAC) was used to analyze proteins trapped by ClpXP(trap) before and after DNA damage. The abundance of half of the trapped proteins changed more than 3-fold after damage. Overrepresented substrates included the DNA-repair proteins RecN and UvrA. Among SOS-response proteins, 25% were ClpXP substrates and, importantly, nearly all of the highly induced regulon members were rapidly degraded. Other proteins, including the stress regulator sigma(S), were underrepresented in ClpXP(trap) after DNA damage; overproduction experiments suggest that simple substrate competition does not account for this reduced recognition. We conclude that damage-response proteins are an unusually rapidly degraded family and that ClpXP has substantial capacity to process the influx of newly synthesized substrates while maintaining the ability to degrade its other substrates in an environmentally responsive manner. PMID:16630889

Neher, Saskia B; Villén, Judit; Oakes, Elizabeth C; Bakalarski, Corey E; Sauer, Robert T; Gygi, Steven P; Baker, Tania A

2006-04-21

177

Salmonella typhimurium flhE, a conserved flagellar regulon gene required for swarming  

PubMed Central

The Salmonella typhimurium gene flhE is located at the end of a large flagellar locus in at least 10 peritrichously flagellated Gram-negative bacterial genera, but it shares no significant similarity with other genes. This study shows that flhE is transcribed as part of an flhBAE flagellar operon, under the control of the flagellar master regulator FlhD2C2. Deletion of the chromosomal flhE gene did not affect swimming motility, but it abolished swarming motility across solid agar. Swarming was restored to the ?flhE mutant by the 130 aa putative envelope protein FlhE, but not by a truncated version lacking the N-terminal signal peptidase I recognition sequence. The ?flhE mutant was indistinguishable from the wild-type parent in number and distribution of flagella, secretion of flagellin subunits, and flagellar gene expression, and there were no obvious differences in cell-surface LPS and extracellular polysaccharide. The ?flhE mutant was able to swarm when non-ionic surfactant was included in agar medium, and it showed differences to the wild-type in binding calcofluor and Congo red dyes, and in biofilm production. The data show that the flhE gene is part of the flagella regulon but that it has no role in flagella biogenesis. It appears, nevertheless, to act at the cell envelope to influence flagella-dependent swarming. PMID:17259626

Stafford, Graham P.; Hughes, Colin

2008-01-01

178

Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator  

SciTech Connect

Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened or eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.

Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.; Llinás, Manuel (Princeton); (UW-MED)

2010-11-05

179

Global analysis of photosynthesis transcriptional regulatory networks.  

PubMed

Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ?34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ?FnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

Imam, Saheed; Noguera, Daniel R; Donohue, Timothy J

2014-12-01

180

Global Analysis of Photosynthesis Transcriptional Regulatory Networks  

PubMed Central

Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ?34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ?FnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.

2014-01-01

181

Identification and characterization of transcription networks in environmentally significant species  

SciTech Connect

Understanding the regulation of gene expression, transcription regulation in particular, is one of the grand challenges of molecular biology. Transcription regulation is arguably the most important foundation of cellular function, since it exerts the most fundamental control of the abundance of virtually all of a cell's functional macromolecules. Nevertheless, this process, perhaps because of its difficulty, has been the subject of only a limited number of genomic level analyses. We have undertaken bioinformatics projects to address this issue by developing (1) a cross-species comparison method (i.e. phylogenetic footprinting) for the identification of transcription factor binding sites, (2) a Bayesian clustering method to identify regulons, (3) an improved scanning algorithm that uses a position weight matrix and several related species sequence data to locate transcription factor binding sites, and (4) a method to predict cognate binding sites for transcription factors of unknown specificity. These bioinformatics methods were developed using the model proteobacterium Escherichia coli, with further applications to the genomes of environmentally significant microbes (Rhodopseudomonas palustris, Shewanella oneidensis) in later years of the grant.

Lawrence, Charles E.; McCue, Lee Ann

2005-11-30

182

Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium  

PubMed Central

Background The Salmonella PreA/PreB two-component system (TCS) is an ortholog of the QseBC TCS of Escherichia coli. In both Salmonella and E. coli, this system has been shown to affect motility and virulence in response to quorum-sensing and hormonal signals, and to affect the transcription of the Salmonella enterica serovar Typhimurium (S. Typhimurium) pmrAB operon, which encodes an important virulence-associated TCS. Results To determine the PreA/PreB regulon in S. Typhimurium, we performed DNA microarrays comparing the wild type strain and various preA and/or preB mutants in the presence of ectopically expressed preA (qseB). These data confirmed our previous findings of the negative effect of PreB on PreA gene regulation and identified candidate PreA-regulated genes. A proportion of the activated loci were previously identified as PmrA-activated genes (yibD, pmrAB, cptA, etc.) or were genes located in the local region around preA, including the preAB operon. The transcriptional units were defined in this local region by RT-PCR, suggesting three PreA activated operons composed of preA-preB, mdaB-ygiN, and ygiW-STM3175. Several putative virulence-related phenotypes were examined for preAB mutants, resulting in the observation of a host cell invasion and slight virulence defect of a preAB mutant. Contrary to previous reports on this TCS, we were unable to show a PreA/PreB-dependent effect of the quorum-sensing signal AI-2 or of epinephrine on S. Typhimurium with regard to bacterial motility. Conclusion This work further characterizes this unorthadox OmpR/EnvZ class TCS and provides novel candidate regulated genes for further study. This first in-depth study of the PreA/PreB regulatory system phenotypes and regulation suggests significant comparative differences to the reported function of the orthologous QseB/QseC in E. coli. PMID:19236707

2009-01-01

183

Transcription factories  

PubMed Central

There is considerable evidence that transcription does not occur homogeneously or diffusely throughout the nucleus, but rather at a number of specialized, discrete sites termed transcription factories. The factories are composed of ~4–30 RNA polymerase molecules, and are associated with many other molecules involved in transcriptional activation and mRNA processing. Some data suggest that the polymerase molecules within a factory remain stationary relative to the transcribed DNA, which is thought to be reeled through the factory site. There is also some evidence that transcription factories could help organize chromatin and nuclear structure, contributing to both the formation of chromatin loops and the clustering of active and co-regulated genes. PMID:23109938

Rieder, Dietmar; Trajanoski, Zlatko; McNally, James G.

2012-01-01

184

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.  

PubMed

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

Zhu, Y; Lin, E C

1988-05-01

185

Transcriptional profile induced by furazolidone treatment of Shigella flexneri.  

PubMed

Shigella flexneri is a facultative intracellular pathogen responsible for endemic shigellosis especially in developing countries. Furazolidone, a nitrofuran derivative, is very effective against the infection with S. flexneri. To examine potential effects of furazolidone on this germ, a whole-genome DNA microarray was constructed and transcriptional profiles of the responses to furazolidone were determined. The expressing data revealed adaptive responses of S. flexneri to oxidative stress induced by furazolidone treatment. Iron metabolism was found to be disturbed by furazolidone through derepression of the iron uptake regulon. In addition, energy metabolism, amino acid metabolism, cofactors metabolism, and DNA repair system were also affected by the drug. These data establish a potential for furazolidone to enhance free radical reactions through reductive activation by oxygen-sensitive nitroreductase. Moreover, we provide evidence that furazolidone is able to cause metabolic dysfunction, which cannot always be attributed to oxidative stress, and interactions between reductive metabolites of furazolidone and S. flexneri should be considered. PMID:17851659

Fu, Hua; Leng, Wenchuan; Wang, Jing; Zhang, Wenliang; Peng, Junping; Wang, Lingling; Jin, Qi

2007-12-01

186

Transcriptional autoregulation of the Salmonella typhimurium phoPQ operon.  

PubMed Central

The Salmonella typhimurium PhoP-PhoQ two-component regulatory system controls the expression of several genes, some of which are necessary for virulence. During a screening for PhoP-regulated genes, we identified the phoPQ operon as a PhoP-activated locus. beta-Galactosidase activity originating from phoPQ-lac transcriptional fusions required the presence of both the transcriptional regulator PhoP and its cognate sensor-kinase PhoQ. At low concentrations, PhoQ stimulated expression of phoPQ-lac transcriptional fusions. However, larger amounts of PhoQ protein without a concomitant increase in PhoP failed to activate phoPQ-lac fusions. Two different transcripts are produced from the phoPQ operon during exponential growth. These transcripts define two promoters: phoPp1, which requires both PhoP and PhoQ for activity and which is environmentally regulated, and phoPp2, which remains active in the absence of PhoP and PhoQ but which is slightly stimulated by these proteins. The pattern of transcriptional autoregulation was also observed at the protein level with anti-PhoP antibodies. In sum, autoregulation of the phoPQ operon provides several levels of control for the PhoP-PhoQ regulon. First, environmental signals would stimulate PhoQ to phosphorylate the PhoP protein that is produced at basal levels from the PhoP-PhoQ-independent promoter. Then, phospho-PhoP would activate transcription of phoPp1, resulting in larger amounts of PhoP and PhoQ and increased expression of PhoP-activated genes. A return to basal levels could be mediated by a posttranscriptional mechanism by which translation of the mRNA produced from phoPp1 is inhibited. PMID:7543474

Soncini, F C; Véscovi, E G; Groisman, E A

1995-01-01

187

Elucidating the Regulon of Multidrug Resistance Regulator RarA in Klebsiella pneumoniae  

PubMed Central

RarA is an AraC-type regulator in Klebsiella pneumoniae, which, when overexpressed, confers a low-level multidrug-resistant (MDR) phenotype linked to the upregulation of both the acrAB and oqxAB efflux genes. Increased rarA expression has also been shown to be integral in the development of tigecycline resistance in the absence of ramA in K. pneumoniae. Given its phenotypic role in MDR, microarray analyses were performed to determine the RarA regulon. Transcriptome analysis was undertaken using strains Ecl8?rarA/pACrarA-2 (rarA-expressing construct) and Ecl8?rarA/pACYC184 (vector-only control) using bespoke microarray slides consisting of probes derived from the genomic sequences of K. pneumoniae MGH 78578 (NC_009648.1) and Kp342 (NC_011283.1). Our results show that rarA overexpression resulted in the differential expression of 66 genes (42 upregulated and 24 downregulated). Under the COG (clusters of orthologous groups) functional classification, the majority of affected genes belonged to the category of cell envelope biogenesis and posttranslational modification, along with genes encoding the previously uncharacterized transport proteins (e.g., KPN_03141, sdaCB, and leuE) and the porin OmpF. However, genes associated with energy production and conversion and amino acid transport/metabolism (e.g., nuoA, narJ, and proWX) were found to be downregulated. Biolog phenotype analyses demonstrated that rarA overexpression confers enhanced growth of the overexpresser in the presence of several antibiotic classes (i.e., beta-lactams and fluoroquinolones), the antifungal/antiprotozoal compound clioquinol, disinfectants (8-hydroxyquinoline), protein synthesis inhibitors (i.e., minocycline and puromycin), membrane biogenesis agents (polymyxin B and amitriptyline), DNA synthesis (furaltadone), and the cytokinesis inhibitor (sanguinarine). Both our transcriptome and phenotypic microarray data support and extend the role of RarA in the MDR phenotype of K. pneumoniae. PMID:23318802

De Majumdar, Shyamasree; Veleba, Mark; Finn, Sarah; Fanning, Séamus

2013-01-01

188

Elucidating the regulon of multidrug resistance regulator RarA in Klebsiella pneumoniae.  

PubMed

RarA is an AraC-type regulator in Klebsiella pneumoniae, which, when overexpressed, confers a low-level multidrug-resistant (MDR) phenotype linked to the upregulation of both the acrAB and oqxAB efflux genes. Increased rarA expression has also been shown to be integral in the development of tigecycline resistance in the absence of ramA in K. pneumoniae. Given its phenotypic role in MDR, microarray analyses were performed to determine the RarA regulon. Transcriptome analysis was undertaken using strains Ecl8?rarA/pACrarA-2 (rarA-expressing construct) and Ecl8?rarA/pACYC184 (vector-only control) using bespoke microarray slides consisting of probes derived from the genomic sequences of K. pneumoniae MGH 78578 (NC_009648.1) and Kp342 (NC_011283.1). Our results show that rarA overexpression resulted in the differential expression of 66 genes (42 upregulated and 24 downregulated). Under the COG (clusters of orthologous groups) functional classification, the majority of affected genes belonged to the category of cell envelope biogenesis and posttranslational modification, along with genes encoding the previously uncharacterized transport proteins (e.g., KPN_03141, sdaCB, and leuE) and the porin OmpF. However, genes associated with energy production and conversion and amino acid transport/metabolism (e.g., nuoA, narJ, and proWX) were found to be downregulated. Biolog phenotype analyses demonstrated that rarA overexpression confers enhanced growth of the overexpresser in the presence of several antibiotic classes (i.e., beta-lactams and fluoroquinolones), the antifungal/antiprotozoal compound clioquinol, disinfectants (8-hydroxyquinoline), protein synthesis inhibitors (i.e., minocycline and puromycin), membrane biogenesis agents (polymyxin B and amitriptyline), DNA synthesis (furaltadone), and the cytokinesis inhibitor (sanguinarine). Both our transcriptome and phenotypic microarray data support and extend the role of RarA in the MDR phenotype of K. pneumoniae. PMID:23318802

De Majumdar, Shyamasree; Veleba, Mark; Finn, Sarah; Fanning, Séamus; Schneiders, Thamarai

2013-04-01

189

The Transcriptional Regulator VqmA Increases Expression of the Quorum-Sensing Activator HapR in Vibrio cholerae  

PubMed Central

Vibrio cholerae is the causative agent of the severe diarrheal disease cholera. A number of environmental stimuli regulate virulence gene expression in V. cholerae, including quorum-sensing signals. At high cell densities, quorum sensing in V. cholerae invokes a series of signal transduction pathways in order to activate the expression of the master regulator HapR, which then represses the virulence regulon and biofilm-related genes and activates protease production. In this study, we identified a transcriptional regulator, VqmA (VCA1078), that activates hapR expression at low cell densities. Under in vitro inducing conditions, constitutive expression of VqmA represses the virulence regulon in a HapR-dependent manner. VqmA increases hapR transcription as measured by the activity of the hapR-lacZ reporter, and it increases HapR production as measured by Western blotting. Using a heterogenous luxCDABE cosmid, we found that VqmA stimulates quorum-sensing regulation at lower cell densities and that this stimulation bypasses the known LuxO-small-RNA regulatory circuits. Furthermore, we showed that VqmA regulates hapR transcription directly by binding to its promoter region and that expression of vqmA is cell density dependent and autoregulated. The physiological role of VqmA is also discussed. PMID:16547031

Liu, Zhi; Hsiao, Ansel; Joelsson, Adam; Zhu, Jun

2006-01-01

190

Genome-wide transcription map of an archaeal cell cycle  

PubMed Central

Relative RNA abundance was measured at different cell-cycle stages in synchronized cultures of the hyperthermophilic archaeon Sulfolobus acidocaldarius. Cyclic induction was observed for >160 genes, demonstrating central roles for transcriptional regulation and cell-cycle-specific gene expression in archaeal cell-cycle progression. Many replication genes were induced in a cell-cycle-specific manner, and novel replisome components are likely to be among the genes of unknown function with similar induction patterns. Candidate genes for the unknown genome segregation and cell division machineries were also identified, as well as seven transcription factors likely to be involved in cell-cycle control. Two serine-threonine protein kinases showed distinct cell-cycle-specific induction, suggesting regulation of the archaeal cell cycle also through protein modification. Two candidate recognition elements, CCR boxes, for transcription factors in control of cell-cycle regulons were identified among gene sets with similar induction kinetics. The results allow detailed characterization of the genome segregation, division, and replication processes and may, because of the extensive homologies between the archaeal and eukaryotic information machineries, also be applicable to core features of the eukaryotic cell cycle. PMID:17307872

Lundgren, Magnus; Bernander, Rolf

2007-01-01

191

Aminopeptidase N1 (EtAPN1), an M1 Metalloprotease of the Apicomplexan Parasite Eimeria tenella, Participates in Parasite Development  

PubMed Central

Aminopeptidases N are metalloproteases of the M1 family that have been reported in numerous apicomplexan parasites, including Plasmodium, Toxoplasma, Cryptosporidium, and Eimeria. While investigating the potency of aminopeptidases as therapeutic targets against coccidiosis, one of the most important avian diseases caused by the genus Eimeria, we identified and characterized Eimeria tenella aminopeptidase N1 (EtAPN1). Its inhibition by bestatin and amastatin, as well as its reactivation by divalent ions, is typical of zinc-dependent metalloproteases. EtAPN1 shared a similar sequence, three-dimensional structure, and substrate specificity and similar kinetic parameters with A-M1 from Plasmodium falciparum (PfA-M1), a validated target in the treatment of malaria. EtAPN1 is synthesized as a 120-kDa precursor and cleaved into 96-, 68-, and 38-kDa forms during sporulation. Further, immunolocalization assays revealed that, similar to PfA-M1, EtAPN1 is present during the intracellular life cycle stages in both the parasite cytoplasm and the parasite nucleus. The present results support the hypothesis of a conserved role between the two aminopeptidases, and we suggest that EtAPN1 might be a valuable target for anticoccidiosis drugs. PMID:24839124

Gras, Simon; Byzia, Anna; Gilbert, Florence B.; McGowan, Sheena; Drag, Marcin; Niepceron, Alisson; Lecaille, Fabien; Lalmanach, Gilles; Brossier, Fabien

2014-01-01

192

Identification and characterization of Toxoplasma?SIP, a conserved apicomplexan cytoskeleton protein involved in maintaining the shape, motility and virulence of the parasite.  

PubMed

Apicomplexa possess a complex pellicle that is composed of a plasma membrane and a closely apposed inner membrane complex (IMC) that serves as a support for the actin-myosin motor required for motility and host cell invasion. The IMC consists of longitudinal plates of flattened vesicles, fused together and lined on the cytoplasmic side by a subpellicular network of intermediate filament-like proteins. The spatial organization of the IMC has been well described by electron microscopy, but its composition and molecular organization is largely unknown. Here, we identify a novel protein of the IMC cytoskeletal network in Toxoplasma gondii, called TgSIP, and conserved among apicomplexan parasites. To finely pinpoint the localization of TgSIP, we used structured illumination super-resolution microscopy and revealed that it likely decorates the transverse sutures of the plates and the basal end of the IMC. This suggests that TgSIP might contribute to the organization or physical connection among the different components of the IMC. We generated a T.gondii?SIP deletion mutant and showed that parasites lacking TgSIP are significantly shorter than wild-type parasites and show defects in gliding motility, invasion and reduced infectivity in mice. PMID:25088010

Lentini, Gaelle; Kong-Hap, Marie; El Hajj, Hiba; Francia, Maria; Claudet, Cyrille; Striepen, Boris; Dubremetz, Jean-François; Lebrun, Maryse

2015-01-01

193

Convergence of the Transcriptional Responses to Heat Shock and Singlet Oxygen Stresses  

PubMed Central

Cells often mount transcriptional responses and activate specific sets of genes in response to stress-inducing signals such as heat or reactive oxygen species. Transcription factors in the RpoH family of bacterial alternative ? factors usually control gene expression during a heat shock response. Interestingly, several ?-proteobacteria possess two or more paralogs of RpoH, suggesting some functional distinction. We investigated the target promoters of Rhodobacter sphaeroides RpoHI and RpoHII using genome-scale data derived from gene expression profiling and the direct interactions of each protein with DNA in vivo. We found that the RpoHI and RpoHII regulons have both distinct and overlapping gene sets. We predicted DNA sequence elements that dictate promoter recognition specificity by each RpoH paralog. We found that several bases in the highly conserved TTG in the ?35 element are important for activity with both RpoH homologs; that the T-9 position, which is over-represented in the RpoHI promoter sequence logo, is critical for RpoHI–dependent transcription; and that several bases in the predicted ?10 element were important for activity with either RpoHII or both RpoH homologs. Genes that are transcribed by both RpoHI and RpoHII are predicted to encode for functions involved in general cell maintenance. The functions specific to the RpoHI regulon are associated with a classic heat shock response, while those specific to RpoHII are associated with the response to the reactive oxygen species, singlet oxygen. We propose that a gene duplication event followed by changes in promoter recognition by RpoHI and RpoHII allowed convergence of the transcriptional responses to heat and singlet oxygen stress in R. sphaeroides and possibly other bacteria. PMID:23028346

Dufour, Yann S.; Imam, Saheed; Koo, Byoung-Mo; Green, Heather A.; Donohue, Timothy J.

2012-01-01

194

Deciphering the regulon of Streptomyces coelicolor AbrC3, a positive response regulator of antibiotic production.  

PubMed

The atypical two-component system (TCS) AbrC1/C2/C3 (encoded by SCO4598, SCO4597, and SCO4596), comprising two histidine kinases (HKs) and a response regulator (RR), is crucial for antibiotic production in Streptomyces coelicolor and for morphological differentiation under certain nutritional conditions. In this study, we demonstrate that deletion of the RR-encoding gene, abrC3 (SCO4596), results in a dramatic decrease in actinorhodin (ACT) and undecylprodiginine (RED) production and delays morphological development. In contrast, the overexpression of abrC3 in the parent strain leads to a 33% increase in ACT production in liquid medium. Transcriptomic analysis and chromatin immunoprecipitation with microarray technology (ChIP-chip) analysis of the ?abrC3 mutant and the parent strain revealed that AbrC3 directly controls ACT production by binding to the actII-ORF4 promoter region; this was independently verified by in vitro DNA-binding assays. This binding is dependent on the sequence 5'-GAASGSGRMS-3'. In contrast, the regulation of RED production is not due to direct binding of AbrC3 to either the redZ or redD promoter region. This study also revealed other members of the AbrC3 regulon: AbrC3 is a positive autoregulator which also binds to the promoter regions of SCO0736, bdtA (SCO3328), absR1 (SCO6992), and SCO6809. The direct targets share the 10-base consensus binding sequence and may be responsible for some of the phenotypes of the ?abrC3 mutant. The identification of the AbrC3 regulon as part of the complex regulatory network governing antibiotic production widens our knowledge regarding TCS involvement in control of antibiotic synthesis and may contribute to the rational design of new hyperproducer host strains through genetic manipulation of such systems. PMID:24509929

Rico, Sergio; Santamaría, Ramón I; Yepes, Ana; Rodríguez, Héctor; Laing, Emma; Bucca, Giselda; Smith, Colin P; Díaz, Margarita

2014-04-01

195

Deciphering the Regulon of Streptomyces coelicolor AbrC3, a Positive Response Regulator of Antibiotic Production  

PubMed Central

The atypical two-component system (TCS) AbrC1/C2/C3 (encoded by SCO4598, SCO4597, and SCO4596), comprising two histidine kinases (HKs) and a response regulator (RR), is crucial for antibiotic production in Streptomyces coelicolor and for morphological differentiation under certain nutritional conditions. In this study, we demonstrate that deletion of the RR-encoding gene, abrC3 (SCO4596), results in a dramatic decrease in actinorhodin (ACT) and undecylprodiginine (RED) production and delays morphological development. In contrast, the overexpression of abrC3 in the parent strain leads to a 33% increase in ACT production in liquid medium. Transcriptomic analysis and chromatin immunoprecipitation with microarray technology (ChIP-chip) analysis of the ?abrC3 mutant and the parent strain revealed that AbrC3 directly controls ACT production by binding to the actII-ORF4 promoter region; this was independently verified by in vitro DNA-binding assays. This binding is dependent on the sequence 5?-GAASGSGRMS-3?. In contrast, the regulation of RED production is not due to direct binding of AbrC3 to either the redZ or redD promoter region. This study also revealed other members of the AbrC3 regulon: AbrC3 is a positive autoregulator which also binds to the promoter regions of SCO0736, bdtA (SCO3328), absR1 (SCO6992), and SCO6809. The direct targets share the 10-base consensus binding sequence and may be responsible for some of the phenotypes of the ?abrC3 mutant. The identification of the AbrC3 regulon as part of the complex regulatory network governing antibiotic production widens our knowledge regarding TCS involvement in control of antibiotic synthesis and may contribute to the rational design of new hyperproducer host strains through genetic manipulation of such systems. PMID:24509929

Rico, Sergio; Santamaría, Ramón I.; Yepes, Ana; Rodríguez, Héctor; Laing, Emma; Bucca, Giselda; Smith, Colin P.

2014-01-01

196

Transcriptional analysis of the bglP gene from Streptococcus mutans  

PubMed Central

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

Cote, Christopher K; Honeyman, Allen L

2006-01-01

197

Identification of genetic loci and transcriptional networks that confer virulence and survival of Brucella melitensis  

E-print Network

screens .......................... 17 Discussion ........................................................................... 21 III BRUCELLA MELITENSIS QUORUM SENSING REGULON: CONTRIBUTIONS OF THE N-DODECANOYL HOMOSERINE LACTONE SIGNALING...

Weeks, Jenni Nichole

2009-05-15

198

Dehydrogenase GRD1 Represents a Novel Component of the Cellulase Regulon in Trichoderma reesei (Hypocrea jecorina) ? † §  

PubMed Central

Trichoderma reesei (Hypocrea jecorina) is nowadays the most important industrial producer of cellulase and hemicellulase enzymes, which are used for pretreatment of cellulosic biomass for biofuel production. In this study, we introduce a novel component, GRD1 (glucose-ribitol dehydrogenase 1), which shows enzymatic activity on cellobiose and positively influences cellulase gene transcription, expression, and extracellular endo-1,4-?-d-glucanase activity. grd1 is differentially transcribed upon growth on cellulose and the induction of cellulase gene expression by sophorose. The transcription of grd1 is coregulated with that of cel7a (cbh1) under inducing conditions. GRD1 is further involved in carbon source utilization on several carbon sources, such as those involved in lactose and d-galactose catabolism, in several cases in a light-dependent manner. We conclude that GRD1 represents a novel enhancer of cellulase gene expression, which by coregulation with the major cellulase may act via optimization of inducing mechanisms. PMID:21602376

Schuster, André; Kubicek, Christian P.; Schmoll, Monika

2011-01-01

199

Role of the Fur Regulon in Iron Transport in Bacillus subtilis  

Microsoft Academic Search

The Bacillus subtilis ferric uptake regulator (Fur) protein mediates the iron-dependent repression of at least 20 operons encoding 40 genes. We investigated the physiological roles of Fur-regulated genes by the con- struction of null mutations in 14 transcription units known or predicted to function in siderophore biosynthesis or iron uptake. We demonstrate that ywbLMN, encoding an elemental iron uptake system

Juliane Ollinger; Kyung-Bok Song; Haike Antelmann; Michael Hecker; John D. Helmann

2006-01-01

200

Energetic Consequences of nitrite stress in Desulfovibrio vulgarisHildenborough, inferred from global transcriptional analysis  

SciTech Connect

Many of the proteins that are candidates for bioenergetic pathways involved with sulfate respiration in Desulfovibrio spp. have been studied, but complete pathways and overall cell physiology remain to be resolved for many environmentally relevant conditions. In order to understand the metabolism of these microorganisms under adverse environmental conditions for improved bioremediation efforts, Desulfovibrio vulgaris Hildenborough was used as a model organism to study stress response to nitrite, an important intermediate in the nitrogen cycle. Previous physiological studies demonstrated that growth was inhibited by nitrite and that nitrite reduction was observed to be the primary mechanism of detoxification. Global transcriptional profiling with whole-genome microarrays revealed coordinated cascades of responses to nitrite in pathways of energy metabolism, nitrogen metabolism, oxidative stress response, and iron homeostasis. In agreement with previous observations, nitrite-stressed cells showed a decrease in the expression of genes encoding sulfate reduction functions in addition to respiratory oxidative phosphorylation and ATP synthase activity. Consequently, the stressed cells had decreased expression of the genes encoding ATP-dependent amino acid transporters and proteins involved in translation. Other genes up-regulated in response to nitrite include the genes in the Fur regulon, which is suggested to be involved in iron homeostasis, and genes in the Per regulon, which is predicted to be responsible for oxidative stress response.

He, Qiang; Huang, Katherine H.; He, Zhili; Alm, Eric J.; Fields,Matthew W.; Hazen, Terry C.; Arkin, Adam P.; Wall, Judy D.; Zhou, Jizhong

2005-11-03

201

Computational identification of the Spo0A-phosphate regulon that is essential for the cellular differentiation and development in Gram-positive spore-forming bacteria  

Microsoft Academic Search

Spo0A-phosphate is essential for the initiation of cellular differentiation and developmental pro- cesses in Gram-positive spore-forming bacteria. Here we combined comparative genomics with analyses of microarray expression profiles to iden- tify the Spo0A-phosphate regulon in Bacillus subti- lis. The consensus Spo0A-phosphate DNA-binding motif identified from the training set based on differ- ent computational algorithms is an 8 bp sequence, TTGTCGAA.

Jiajian Liu; Kai Tan; Gary D. Stormo

2003-01-01

202

Promoter analysis of the PHO81 gene encoding a 134 kDa protein bearing ankyrin repeats in the phosphatase regulon of Saccharomyces cerevisiae  

Microsoft Academic Search

The PH081 gene encoding one of the regulators of the phosphatase regulon in Saccharomyces cerevisiae was mapped 9.8 centimorgans distal from the ser2 locus on the right arm of chromosome VII. Determination of the nucleotide sequence of cloned PH081 DNA revealed a 3537 by open reading frame encoding a 134 kDa protein. This protein has six repeats of a 33-amino

Nobuo Ogawa; Ken-ichi Noguchi; Yasuji Yamashita; Takaomi Yasuhara; Naoyuki Hayashi; Kazuya Yoshida; Yasuji Oshima

1993-01-01

203

Regulation of the Escherichia coli Allantoin Regulon: Coordinated Function of the Repressor AllR and the Activator AllS  

Microsoft Academic Search

The allantoin regulon of Escherichia coli, formed by three operons expressed from promoters allAP, gclP and allDP, is involved in the anaerobic utilization of allantoin as nitrogen source. The expression of these operons is under the control of the repressor AllR. The hyperinduction of one of these promoters (allDP) by allantoin in an AllR defective mutant suggested the action of

Maria R. Rintoul; Eva Cusa; Laura Baldomà; Josefa Badia; Larry Reitzer; Juan Aguilar

2002-01-01

204

Host Cells Participate in the In Vitro Effects of Novel Diamidine Analogues against Tachyzoites of the Intracellular Apicomplexan Parasites Neospora caninum and Toxoplasma gondii?  

PubMed Central

The in vitro effects of 19 dicationic diamidine derivatives against the proliferative tachyzoite stages of the apicomplexan parasites Neospora caninum and Toxoplasma gondii were investigated. Four compounds (DB811, DB786, DB750, and DB766) with similar structural properties exhibited profound inhibition of tachyzoite proliferation. The lowest 50% inhibitory concentrations were found for DB786 (0.21 ?M against Neospora and 0.22 ?M against Toxoplasma) and DB750 (0.23 ?M against Neospora and 0.16 ?M against Toxoplasma), with complete proliferation inhibition at 1.7 ?M for both drugs against both species. DB750 and DB786 were chosen for further studies. Electron microscopy of N. caninum-infected human foreskin fibroblast (HFF) cultures revealed distinct alterations and damage of parasite ultrastructure upon drug treatment, while host cells remained unaffected. For true parasiticidal efficacy against N. caninum, a treatment duration of 3 h at 1.7 ?M was sufficient for DB750, while a longer treatment period (24 h) was necessary for DB786. Pretreatment of tachyzoites for 1 h prior to host cell exposure had no effect on infectivity. However, pretreatment of uninfected host cells had a significant adverse effect on N. caninum proliferation: exposure of HFFs to 1.7 ?M DB750 for 6, 12, or 24 h, followed by infection with N. caninum tachyzoites and subsequent culture in the absence of DB750, resulted in significantly delayed parasite proliferation. This suggests that either (i) these compounds or their respective active metabolites were still present after the removal of the drugs or (ii) the drug treatments reversibly impaired some functional activities in HFFs that were essential for parasite proliferation and/or survival. PMID:18362190

Leepin, Angela; Stüdli, Angela; Brun, Reto; Stephens, Chad E.; Boykin, David W.; Hemphill, Andrew

2008-01-01

205

Genome-Wide Analysis of the Pho Regulon in a pstCA Mutant of Citrobacter rodentium  

PubMed Central

The phosphate-specific transport operon, pstSCAB-phoU, of Gram-negative bacteria is an essential part of the Pho regulon. Its key roles are to encode a high-affinity inorganic phosphate transport system and to prevent activation of PhoB in phosphate-rich environments. In general, mutations in pstSCAB-phoU lead to the constitutive expression of the Pho regulon. Previously, we constructed a pstCA deletion mutant of Citrobacter rodentium and found it to be attenuated for virulence in mice, its natural host. This attenuation was dependent on PhoB or PhoB-regulated gene(s) because a phoB mutation restored virulence for mice to the pstCA mutant. To investigate how downstream genes may contribute to the virulence of C. rodentium, we used microarray analysis to investigate global gene expression of C. rodentium strain ICC169 and its isogenic pstCA mutant when grown in phosphate-rich medium. Overall 323 genes of the pstCA mutant were differentially expressed by at least 1.5-fold compared to the wild-type C. rodentium. Of these 145 were up-regulated and 178 were down-regulated. Differentially expressed genes included some involved in phosphate homoeostasis, cellular metabolism and protein metabolism. A large number of genes involved in stress responses and of unknown function were also differentially expressed, as were some virulence-associated genes. Up-regulated virulence-associated genes in the pstCA mutant included that for DegP, a serine protease, which appeared to be directly regulated by PhoB. Down-regulated genes included those for the production of the urease, flagella, NleG8 (a type III-secreted protein) and the tad focus (which encodes type IVb pili in Yersinia enterocolitica). Infection studies using C57/BL6 mice showed that DegP and NleG8 play a role in bacterial virulence. Overall, our study provides evidence that Pho is a global regulator of gene expression in C. rodentium and indicates the presence of at least two previously unrecognized virulence determinants of C. rodentium, namely, DegP and NleG8. PMID:23226353

Cheng, Catherine; Wakefield, Matthew J.; Yang, Ji; Tauschek, Marija; Robins-Browne, Roy M.

2012-01-01

206

RegR Virulence Regulon of Rabbit-Specific Enteropathogenic Escherichia coli Strain E22  

PubMed Central

AraC-like regulators play a key role in the expression of virulence factors in enteric pathogens, such as enteropathogenic Escherichia coli (EPEC), enterotoxigenic E. coli, enteroaggregative E. coli, and Citrobacter rodentium. Bioinformatic analysis of the genome of rabbit-specific EPEC (REPEC) strain E22 (O103:H2) revealed the presence of a gene encoding an AraC-like regulatory protein, RegR, which shares 71% identity to the global virulence regulator, RegA, of C. rodentium. Microarray analysis demonstrated that RegR exerts 25- to 400-fold activation on transcription of several genes encoding putative virulence-associated factors, including a fimbrial operon (SEF14), a serine protease, and an autotransporter adhesin. These observations were confirmed by proteomic analysis of secreted and heat-extracted surface-associated proteins. The mechanism of RegR-mediated activation was investigated by using its most highly upregulated gene target, sefA. Transcriptional analyses and electrophoretic mobility shift assays showed that RegR activates the expression of sefA by binding to a region upstream of the sefA promoter, thereby relieving gene silencing by the global regulatory protein H-NS. Moreover, RegR was found to contribute significantly to virulence in a rabbit infection experiment. Taken together, our findings indicate that RegR controls the expression of a series of accessory adhesins that significantly enhance the virulence of REPEC strain E22. PMID:23340312

Srikhanta, Yogitha N.; Hocking, Dianna M.; Praszkier, Judyta; Wakefield, Matthew J.; Yang, Ji; Tauschek, Marija

2013-01-01

207

Elucidation of the RamA Regulon in Klebsiella pneumoniae Reveals a Role in LPS Regulation.  

PubMed

Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J; Bengoechea, José; Gally, David L; Fanning, Séamus; Elborn, Joseph S; Schneiders, Thamarai

2015-01-01

208

Elucidation of the RamA Regulon in Klebsiella pneumoniae Reveals a Role in LPS Regulation  

PubMed Central

Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P.; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J.; Bengoechea, José; Gally, David L.; Fanning, Séamus; Elborn, Joseph S.; Schneiders, Thamarai

2015-01-01

209

Comparative genomics analysis of NtcA regulons in cyanobacteria: regulation of nitrogen assimilation and its coupling to photosynthesis  

PubMed Central

We have developed a new method for prediction of cis-regulatory binding sites and applied it to predicting NtcA regulated genes in cyanobacteria. The algorithm rigorously utilizes concurrence information of multiple binding sites in the upstream region of a gene and that in the upstream regions of its orthologues in related genomes. A probabilistic model was developed for the evaluation of prediction reliability so that the prediction false positive rate could be well controlled. Using this method, we have predicted multiple new members of the NtcA regulons in nine sequenced cyanobacterial genomes, and showed that the false positive rates of the predictions have been reduced on an average of 40-fold compared to the conventional methods. A detailed analysis of the predictions in each genome showed that a significant portion of our predictions are consistent with previously published results about individual genes. Intriguingly, NtcA promoters are found for many genes involved in various stages of photosynthesis. Although photosynthesis is known to be tightly coordinated with nitrogen assimilation, very little is known about the underlying mechanism. We postulate for the fist time that these genes serve as the regulatory points to orchestrate these two important processes in a cyanobacterial cell. PMID:16157864

Su, Zhengchang; Olman, Victor; Mao, Fenglou; Xu, Ying

2005-01-01

210

Identification of the copper regulon in Saccharomyces cerevisiae by DNA microarrays.  

PubMed

In Saccharomyces cerevisiae, copper ions regulate gene expression through the two transcriptional activators, Ace1 and Mac1. Ace1 mediates copper-induced gene expression in cells exposed to stressful levels of copper salts, whereas Mac1 activates a subset of genes under copper-deficient conditions. DNA microarray hybridization experiments revealed a limited set of yeast genes differentially expressed under growth conditions of excess copper or copper deficiency. Mac1 activates the expression of six S. cerevisiae genes, including CTR1, CTR3, FRE1, FRE7, YFR055w, and YJL217w. Two of the last three newly identified Mac1 target genes have no known function; the third, YFR055w, is homologous to cystathionine gamma-lyase encoded by CYS3. Several genes that are differentially expressed in cells containing a constitutively active Mac1, designated Mac1(up1), are not direct targets of Mac1. Induction or repression of these genes is likely a secondary effect of cells because of constitutive Mac1 activity. Elevated copper levels induced the expression of the metallothioneins CUP1 and CRS5 and two genes, FET3 and FTR1, in the iron uptake system. Copper-induced FET3 and FTR1 expression arises from an indirect copper effect on cellular iron pools. PMID:10922376

Gross, C; Kelleher, M; Iyer, V R; Brown, P O; Winge, D R

2000-10-13

211

Broad genomic and transcriptional analysis reveals a highly derived genome in dinoflagellate mitochondria  

Microsoft Academic Search

BACKGROUND: Dinoflagellates comprise an ecologically significant and diverse eukaryotic phylum that is sister to the phylum containing apicomplexan endoparasites. The mitochondrial genome of apicomplexans is uniquely reduced in gene content and size, encoding only three proteins and two ribosomal RNAs (rRNAs) within a highly compacted 6 kb DNA. Dinoflagellate mitochondrial genomes have been comparatively poorly studied: limited available data suggest

Christopher J Jackson; John E Norman; Murray N Schnare; Michael W Gray; Patrick J Keeling; Ross F Waller

2007-01-01

212

Pho regulon promoter-mediated transcription of the key pathway gene aroG Fbr improves the performance of an l -phenylalanine-producing Escherichia coli strain  

Microsoft Academic Search

DAHP synthase (EC 4.1.2.15) is one of the key enzymes involved in aromatic amino acid biosynthesis in Escherichia coli. An approximately twofold decrease in DAHP synthase activity level was detected in the late growth phase of the l-phenylalanine (Phe)-producing E. coli strain, in which this enzyme encoded by aroG4 is resistant to feedback inhibition. An additional copy of aroG4 that

Vera G. Doroshenko; Irina S. Tsyrenzhapova; Alexander A. Krylov; Evgeniya M. Kiseleva; Vladimir Yu. Ermishev; Svetlana M. Kazakova; Irina V. Biryukova; Sergey V. Mashko

2010-01-01

213

Role of the Fur regulon in iron transport in Bacillus subtilis.  

PubMed

The Bacillus subtilis ferric uptake regulator (Fur) protein mediates the iron-dependent repression of at least 20 operons encoding approximately 40 genes. We investigated the physiological roles of Fur-regulated genes by the construction of null mutations in 14 transcription units known or predicted to function in siderophore biosynthesis or iron uptake. We demonstrate that ywbLMN, encoding an elemental iron uptake system orthologous to the copper oxidase-dependent Fe(III) uptake system of Saccharomyces cerevisiae, is essential for growth in low iron minimal medium lacking citric acid. 2,3-Dihydroxybenzoyl-glycine (Itoic acid), the siderophore precursor produced by laboratory strains of B. subtilis, is of secondary importance. In the presence of citrate, the YfmCDEF ABC transporter is required for optimal growth. B. subtilis is unable to grow in minimal medium containing the iron chelator EDDHA unless the ability to synthesize the intact bacillibactin siderophore is restored (by the introduction of a functional sfp gene) or exogenous siderophores are provided. Utilization of the catecholate siderophores bacillibactin and enterobactin requires the FeuABC importer and the YusV ATPase. Utilization of hydroxamate siderophores requires the FhuBGC ABC transporter together with the FhuD (ferrichrome) or YxeB (ferrioxamine) substrate-binding proteins. Growth with schizokinen or arthrobactin is at least partially dependent on the YfhA YfiYZ importer and the YusV ATPase. We have also investigated the effects of a fur mutation on the proteome and documented the derepression of 11 Fur-regulated proteins, including a newly identified thioredoxin reductase homolog, YcgT. PMID:16672620

Ollinger, Juliane; Song, Kyung-Bok; Antelmann, Haike; Hecker, Michael; Helmann, John D

2006-05-01

214

Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363?  

PubMed Central

Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363?ccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric ?35 sequence at an average position of ?56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative ?35 and ?10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical ?10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism. PMID:17028270

Zomer, Aldert L.; Buist, Girbe; Larsen, Rasmus; Kok, Jan; Kuipers, Oscar P.

2007-01-01

215

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation  

PubMed Central

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

216

GntR-Type Transcriptional Regulator PckR Negatively Regulates the Expression of Phosphoenolpyruvate Carboxykinase in Corynebacterium glutamicum  

PubMed Central

The pck (cg3169) gene of Corynebacterium glutamicum encodes a phosphoenolpyruvate carboxykinase (PEPCK). Here, a candidate transcriptional regulator that binds to the promoter region of pck was detected using a DNA affinity purification approach. An isolated protein was identified to be PckR (Cg0196), a GntR family transcriptional regulator which consists of 253 amino acids with a mass of 27 kDa as measured by peptide mass fingerprinting. The results of electrophoretic mobility shift assays verified that PckR specifically binds to the pck promoter. The putative regulator binding region extended from position ?44 to ?27 (an 18-bp sequence) relative to the transcriptional start point of the pck gene. We measured the expression of pck in a pckR deletion mutant by using quantitative real-time reverse transcription-PCR. The expression level of pck in the pckR mutant was 7.6 times higher than that in wild-type cells grown in glucose. Comparative DNA microarray hybridizations and bioinformatic searches revealed the gene composition of the transcriptional regulon of C. glutamicum. Based on these results, PckR seemed to play an important role in the regulation of PEPCK in C. glutamicum grown in glucose. In particular, these assays revealed that PckR acts as a repressor of pck expression during glucose metabolism. PMID:22366416

Hyeon, Jeong Eun; Kang, Dae Hee; Kim, Young In; You, Seung Kyou

2012-01-01

217

A Bayesian Change point model for differential gene expression patterns of the DosR regulon of Mycobacterium tuberculosis  

E-print Network

Abstract Background Low oxygen availability has been shown previously to stimulate M. tuberculosis to establish non-replicative persistence in vitro. The two component sensor/regulator dosRS is a major mediator in the transcriptional response of M...

Zhang, Yi; Hatch, Kim A; Wernisch, Lorenz; Bacon, Joanna

2008-02-22

218

HIV-1 Reverse Transcription  

PubMed Central

Reverse transcription and integration are the defining features of the Retroviridae; the common name “retrovirus” derives from the fact that these viruses use a virally encoded enzyme, reverse transcriptase (RT), to convert their RNA genomes into DNA. Reverse transcription is an essential step in retroviral replication. This article presents an overview of reverse transcription, briefly describes the structure and function of RT, provides an introduction to some of the cellular and viral factors that can affect reverse transcription, and discusses fidelity and recombination, two processes in which reverse transcription plays an important role. In keeping with the theme of the collection, the emphasis is on HIV-1 and HIV-1 RT. PMID:23028129

Hu, Wei-Shau; Hughes, Stephen H.

2012-01-01

219

Inhibiting eukaryotic transcription  

PubMed Central

This review first discusses ways in which we can evaluate transcription inhibition, describe changes in nuclear structure due to transcription inhibition, and report on genes that are paradoxically stimulated by transcription inhibition. Next, it summarizes the characteristics and mechanisms of commonly used inhibitors: ?-amanitin is highly selective for RNAP II and RNAP III but its action is slow, actinomycin D is fast but its selectivity is poor, CDK9 inhibitors such as DRB and flavopiridol are fast and reversible but many genes escape transcription inhibition. New compounds, such as triptolide, are fast and selective and able to completely arrest transcription by triggering rapid degradation of RNAP II. PMID:21922053

2011-01-01

220

A workflow for genome-wide mapping of archaeal transcription factors with ChIP-seq  

PubMed Central

Deciphering the structure of gene regulatory networks across the tree of life remains one of the major challenges in postgenomic biology. We present a novel ChIP-seq workflow for the archaea using the model organism Halobacterium salinarum sp. NRC-1 and demonstrate its application for mapping the genome-wide binding sites of natively expressed transcription factors. This end-to-end pipeline is the first protocol for ChIP-seq in archaea, with methods and tools for each stage from gene tagging to data analysis and biological discovery. Genome-wide binding sites for transcription factors with many binding sites (TfbD) are identified with sensitivity, while retaining specificity in the identification the smaller regulons (bacteriorhodopsin-activator protein). Chromosomal tagging of target proteins with a compact epitope facilitates a standardized and cost-effective workflow that is compatible with high-throughput immunoprecipitation of natively expressed transcription factors. The Pique package, an open-source bioinformatics method, is presented for identification of binding events. Relative to ChIP-Chip and qPCR, this workflow offers a robust catalog of protein–DNA binding events with improved spatial resolution and significantly decreased cost. While this study focuses on the application of ChIP-seq in H. salinarum sp. NRC-1, our workflow can also be adapted for use in other archaea and bacteria with basic genetic tools. PMID:22323522

Wilbanks, Elizabeth G.; Larsen, David J.; Neches, Russell Y.; Yao, Andrew I.; Wu, Chia-Ying; Kjolby, Rachel A. S.; Facciotti, Marc T.

2012-01-01

221

Global position analysis of the Pseudomonas aeruginosa quorum-sensing transcription factor LasR  

PubMed Central

Summary In Pseudomonas aeruginosa quorum sensing (QS), the transcriptional regulator LasR controls the expression of more than 300 genes. Several of these genes are activated indirectly via a second, subordinate QS regulator, RhlR. Conserved sequence elements upstream of individual other genes have been shown to bind LasR in vitro. To comprehensively identify all regions that are bound by LasR in vivo, we employed chromatin immunoprecipitation in conjunction with microarray analysis. We identified 35 putative promoter regions that direct the expression of up to 74 genes. In vitro DNA binding studies allowed us to distinguish between cooperative and non-cooperative LasR binding sites, and allowed us to build consensus sequences according to the mode of binding. Five promoter regions were not previously recognized as QS-controlled. Two of the associated transcript units encode proteins involved in the cold-shock response and in Psl exopolysaccharide synthesis, respectively. The LasR regulon includes seven genes encoding transcriptional regulators, while secreted factors and secretion machinery are the most overrepresented functional categories overall. This supports the notion that the core function of LasR is to coordinate the production of extracellular factors, although many of its effects on global gene expression are likely mediated indirectly by regulatory genes under its control. PMID:19682264

Gilbert, Kerrigan B.; Kim, Tae Hoon; Gupta, Rashmi; Greenberg, E. P.; Schuster, Martin

2009-01-01

222

Toxoplasma Transcription Factor TgAP2XI-5 Regulates the Expression of Genes Involved in Parasite Virulence and Host Invasion*  

PubMed Central

Gene regulation in apicomplexan parasites, a phylum containing important protozoan parasites such as Plasmodium and Toxoplasma, is poorly understood. The life cycle of Toxoplasma gondii is complex, with multiple proliferation and differentiation steps, of which tachyzoite proliferation is the most relevant to pathogenesis in humans and animals. Tachyzoites express invasion and virulence factors that are crucial for their survival and manipulation of host cell functions. The expression of those factors is tightly controlled during the tachyzoite cell cycle to permit their correct packaging in newly formed apical secretory organelles named micronemes and rhoptries in the daughter cells. However, little is known about the factors that control the expression of genes encoding the virulence factors present in these parasite-specific secretory organelles. We report that the plant-like nuclear factor TgAP2XI-5 targets more than 300 gene promoters and actively controls the transcription of these genes. Most of these target genes, including those that are essential for parasite virulence, showed a peak of expression in the S and M phases of the cell cycle. Furthermore, we identified the cis-regulatory element recognized by TgAP2XI-5 and demonstrated its ability to actively drive gene transcription. Our results demonstrated that TgAP2XI-5 is a novel DNA sequence-specific transcription factor associated with promoter activation. TgAP2XI-5 may regulate gene transcription of crucial virulence factors in T. gondii. PMID:24025328

Walker, Robert; Gissot, Mathieu; Huot, Ludovic; Alayi, Tchilabalo Dilezitoko; Hot, David; Marot, Guillemette; Schaeffer-Reiss, Christine; Van Dorsselaer, Alain; Kim, Kami; Tomavo, Stanislas

2013-01-01

223

Appropriate DevR (DosR)-Mediated Signaling Determines Transcriptional Response, Hypoxic Viability and Virulence of Mycobacterium tuberculosis  

PubMed Central

Background The DevR(DosR) regulon is implicated in hypoxic adaptation and virulence of Mycobacterium tuberculosis. The present study was designed to decipher the impact of perturbation in DevR-mediated signaling on these properties. Methodology/Principal Findings M. tb complemented (Comp) strains expressing different levels of DevR were constructed in Mut1* background (expressing DevR N-terminal domain in fusion with AphI (DevRN-Kan) and in Mut2?devR background (deletion mutant). They were compared for their hypoxia adaptation and virulence properties. Diverse phenotypes were noted; basal level expression (?5.3±2.3 µM) when induced to levels equivalent to WT levels (?25.8±9.3 µM) was associated with robust DevR regulon induction and hypoxic adaptation (Comp 9* and 10*), whereas low-level expression (detectable at transcript level) as in Comp 11* and Comp15 was associated with an adaptation defect. Intermediate-level expression (?3.3±1.2 µM) partially restored hypoxic adaptation functions in Comp2, but not in Comp1* bacteria that co-expressed DevRN-Kan. Comp* strains in Mut1* background also exhibited diverse virulence phenotypes; high/very low-level DevR expression was associated with virulence whereas intermediate-level expression was associated with low virulence. Transcription profiling and gene expression analysis revealed up-regulation of the phosphate starvation response (PSR) in Mut1* and Comp11* bacteria, but not in WT/Mut2?devR/other Comp strains, indicating a plasticity in expression pathways that is determined by the magnitude of signaling perturbation through DevRN-Kan. Conclusions/Significance A minimum DevR concentration of ?3.3±1.2 µM (as in Comp2 bacteria) is required to support HspX expression in the standing culture hypoxia model. The relative intracellular concentrations of DevR and DevRN-Kan appear to be critical for determining dormancy regulon induction, hypoxic adaptation and virulence. Dysregulated DevRN-Kan-mediated signaling selectively triggers the PSR in bacteria expressing no/very low level of DevR. Our findings illustrate the important role of appropriate two-component- mediated signaling in pathogen physiology and the resilience of bacteria when such signaling is perturbed. PMID:22563409

De Majumdar, Shyamasree; Vashist, Atul; Dhingra, Sakshi; Gupta, Rajesh; Singh, Alka; Challu, Vijay K.; Ramanathan, V. D.; Kumar, Prahlad; Tyagi, Jaya Sivaswami

2012-01-01

224

TRANSCRIPT REQUEST FORM Transcript Charges: $7.00 per Transcript  

E-print Network

) must obtain transcripts from their own school registrars. Express delivery (Overnight not available to all locations. Address and recipient phone number must be listed below). Non-Degree/Eli Whitney Attend Summer Session Attend. dates: ___________ Qty Delivery instructions (pickup or send out) and any special

225

Control of Proteobacterial Central Carbon Metabolism by the HexR Transcriptional Regulator. A Case Study in Shewanella oneidensis  

SciTech Connect

Bacteria exploit multiple mechanisms for controlling central carbon metabolism (CCM). Thus, a bioinformatic analysis together with some experimental data implicated HexR transcriptional factor as a global CCM regulator in some lineages of Gammaproteobacteria operating as a functional replacement of Cra regulator characteristic of Enterobacteriales. In this study we combined a large-scale comparative genomic reconstruction of HexRcontrolled regulons in 87 species of Proteobacteria with the detailed experimental analysis of HexR regulatory network in Shewanella oneidensis model system. Although nearly all of the HexR-controlled genes are associated with CCM, remarkable variations were revealed in the scale (from 1-2 target operons in Enterobacteriales up to 20 operons in Aeromonadales) and gene content of HexR regulons between 11 compared lineages. A predicted 17-bp pseudo-palindrome with a consensus tTGTAATwwwATTACa, was confirmed as HexR-binding motif for 15 target operons (comprising 30 genes) by in vitro binding assays. The negative effect of the key CCM intermediate, 2-keto-3-deoxy-6- phosphogluconate, on the DNA-regulator complex formation was verified. A dual mode of HexR action on various target promoters, repression of genes involved in catabolic pathways and activation of gluconeogenic genes, was for the first time predicted by the bioinformatc analysis and experimentally verified by changed gene expression pattern in S. oneidensis AhexR mutant. Phenotypic profiling revealed the inability of this mutant to grow on lactate or pyruvate as a single carbon source. A comparative metabolic flux analysis of wild-type and mutant strains of S. oneidensis using 13Clactate labeling and GC-MS analysis confirmed the hypothesized HexR role as a master regulator of gluconeogenic flux from pyruvate via the transcriptional activation of phosphoenolpyruvate synthase (PpsA).

Leyn, Semen; Li, Xiaoqing; Zheng, Qijing; Novichkov, Pavel; Reed, Samantha B.; Romine, Margaret F.; Fredrickson, Jim K.; Yang, Chen; Osterman, Andrei L.; Rodionov, Dmitry A.

2011-08-17

226

Organization of transcription.  

PubMed

Investigations into the organization of transcription have their origins in cell biology. Early studies characterized nascent transcription in relation to discernable nuclear structures and components. Advances in light microscopy, immunofluorescence, and in situ hybridization helped to begin the difficult task of naming the countless individual players and components of transcription and placing them in context. With the completion of mammalian genome sequences, the seemingly boundless task of understanding transcription of the genome became finite and began a new period of rapid advance. Here we focus on the organization of transcription in mammals drawing upon information from lower organisms where necessary. The emerging picture is one of a highly organized nucleus with specific conformations of the genome adapted for tissue-specific programs of transcription and gene expression. PMID:20668006

Chakalova, Lyubomira; Fraser, Peter

2010-09-01

227

Organization of Transcription  

PubMed Central

Investigations into the organization of transcription have their origins in cell biology. Early studies characterized nascent transcription in relation to discernable nuclear structures and components. Advances in light microscopy, immunofluorescence, and in situ hybridization helped to begin the difficult task of naming the countless individual players and components of transcription and placing them in context. With the completion of mammalian genome sequences, the seemingly boundless task of understanding transcription of the genome became finite and began a new period of rapid advance. Here we focus on the organization of transcription in mammals drawing upon information from lower organisms where necessary. The emerging picture is one of a highly organized nucleus with specific conformations of the genome adapted for tissue-specific programs of transcription and gene expression. PMID:20668006

Chakalova, Lyubomira; Fraser, Peter

2010-01-01

228

Roles for Arabidopsis CAMTA Transcription Factors in Cold-Regulated Gene Expression and Freezing Tolerance[W][OA  

PubMed Central

The Arabidopsis thaliana CBF cold response pathway plays a central role in cold acclimation. It is characterized by rapid cold induction of genes encoding the CBF1-3 transcription factors, followed by expression of the CBF gene regulon, which imparts freezing tolerance. Our goal was to further the understanding of the cis-acting elements and trans-acting factors involved in expression of CBF2. We identified seven conserved DNA motifs (CM), CM1 to 7, that are present in the promoters of CBF2 and another rapidly cold-induced gene encoding a transcription factor, ZAT12. The results presented indicate that in the CBF2 promoter, CM4 and CM6 have negative regulatory activity and that CM2 has both negative and positive activity. A Myc binding site in the CBF2 promoter was also found to have positive regulatory effects. Moreover, our results indicate that members of the calmodulin binding transcription activator (CAMTA) family of transcription factors bind to the CM2 motif, that CAMTA3 is a positive regulator of CBF2 expression, and that double camta1 camta3 mutant plants are impaired in freezing tolerance. These results establish a role for CAMTA proteins in cold acclimation and provide a possible point of integrating low-temperature calcium and calmodulin signaling with cold-regulated gene expression. PMID:19270186

Doherty, Colleen J.; Van Buskirk, Heather A.; Myers, Susan J.; Thomashow, Michael F.

2009-01-01

229

ATP-dependent RecG helicase is required for the transcriptional regulator OxyR function in Pseudomonas species.  

PubMed

The oxyR gene appears to reside in an operon with the recG helicase gene in many bacteria, including pathogenic Pseudomonas aeruginosa and Pseudomonas putida. Analysis of P. putida transcriptomes shows that many OxyR-controlled genes are regulated by the ATP-dependent RecG helicase and that RecG alone modulates the expression of many genes. We found that purified RecG binds to the promoters of many OxyR-controlled genes and that expression of these genes was not induced under conditions of oxidative stress in recG mutants of P. aeruginosa, P. putida, and Escherichia coli. In vitro data revealed that promoters containing palindromic sequences are essential for RecG binding and that single-strand binding proteins and ATP are also needed for RecG to promote transcription, whereas a magnesium ion has the opposite effect. The OxyR tetramer preferentially binds to promoters after RecG has generated linear DNA in the presence of ATP; otherwise, the OxyR dimer has higher affinity. This study provides new insights into the mechanism of bacterial transcription by demonstrating that RecG might be required for the induction of the OxyR regulon by unwinding palindromic DNA for transcription. This work describes a novel bacterial transcriptional function by RecG helicase with OxyR and may provide new targets for controlling Pseudomonas species pathogen. PMID:22621928

Yeom, Jinki; Lee, Yunho; Park, Woojun

2012-07-13

230

Inferring Transcriptional Regulatory Network  

Microsoft Academic Search

\\u000a Genes are coordinately regulated and expressed as forming various transcriptional modules or networks to carry out complex\\u000a and condition-specific biological functions in living cells. In this chapter, we describe a series of new methodologies for\\u000a identifying transcriptional modules and regulatory networks and examining their evolutionarily conserved and divergent patterns\\u000a from gene expression and transcription factor data. The methods are based

Ming Zhan

231

Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa  

PubMed Central

Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction. This systematic analysis illustrates the similarities and differences in regulation of hemicellulose degradation among filamentous fungi. PMID:22345350

Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

2012-01-01

232

Relationship of the superoxide dismutase genes, sodA and sodB, to the iron uptake (/ital fur/) regulon in /ital Escherichia coli/ K-12  

SciTech Connect

Expression of sodA, as indicated by MnSod activity is normal in /ital fur/ mutants. This suggests that sodA is not a member of the /ital fur/ regulon and that the putative Fe-binding, regulatory protein of sodA, suggested by Moody and Hassan is not the Fur protein. by contrast, expression of sodB, as indicated by FeSod activity, is completely blocked in /ital fur/ mutants and the effect is restored by transformation with a plasmid having a normal /ital fur/ locus. The observations suggest that Fur, either directly or indirectly, controls SodB biosynthesis. Additional observations are described which indicate that SodB and Fur act together in a complicated fashion to control the biosynthesis of enterobactin. 26 refs., 3 tabs.

Niederhoffer, E.C.; Naranjo, C.M.; Fee, J.A.

1988-01-01

233

The CBF1-dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp  

Microsoft Academic Search

The meristematic tissues of temperate woody perennials must acclimate to freezing temperatures to survive the win- ter and resume growth the following year. To determine whether the C-repeat binding factor (CBF) family of tran- scription factors contributing to this process in annual her- baceous species also functions in woody perennials, we investigated the changes in phenotype and transcript profile of

CATHERINE BENEDICT; JEFFREY S. SKINNER; RENGONG MENG; YONGJIAN CHANG; RISHIKESH BHALERAO; NORMAN P. A. HUNER; CHAD E. FINN; TONY H. H. CHEN; VAUGHAN HURRY

2006-01-01

234

Molecular cloning, mapping, and regulation of Pho regulon genes for phosphonate breakdown by the phosphonatase pathway of Salmonella typhimurium LT2.  

PubMed Central

Two pathways exist for cleavage of the carbon-phosphorus (C-P) bond of phosphonates, the C-P lyase and the phosphonatase pathways. It was previously demonstrated that Escherichia coli carries genes (named phn) only for the C-P lyase pathway and that Enterobacter aerogenes carries genes for both pathways (K.-S. Lee, W. W. Metcalf, and B. L. Wanner, J. Bacteriol. 174:2501-2510, 1992). In contrast, here it is shown that Salmonella typhimurium LT2 carries genes only for the phosphonatase pathway. Genes for the S. typhimurium phosphonatase pathway were cloned by complementation of E. coli delta phn mutants. Genes for these pathways were proven not to be homologous and to lie in different chromosomal regions. The S. typhimurium phn locus lies near 10 min; the E. coli phn locus lies near 93 min. The S. typhimurium phn gene cluster is about 7.2 kb in length and, on the basis of gene fusion analysis, appears to consist of two (or more) genes or operons that are divergently transcribed. Like that of the E. coli phn locus, the expression of the S. typhimurium phn locus is activated under conditions of Pi limitation and is subject to Pho regulon control. This was shown both by complementation of the appropriate E. coli mutants and by the construction of S. typhimurium mutants with lesions in the phoB and pst loci, which are required for activation and inhibition of Pho regulon gene expression, respectively. Complementation studies indicate that the S. typhimurium phn locus probably includes genes both for phosphonate transport and for catalysis of C-P bond cleavage. PMID:7592415

Jiang, W; Metcalf, W W; Lee, K S; Wanner, B L

1995-01-01

235

The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis  

PubMed Central

Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: ?E, ?K, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The ?E factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the ?E regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of ?K. Next, ?K activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by ?K while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

2004-01-01

236

Transcriptional Responses of Uropathogenic Escherichia coli to Increased Environmental Osmolality Caused by Salt or Urea  

PubMed Central

Uropathogenic Escherichia coli (UPEC) is the most common causative agent of urinary tract infections in humans. The majority of urinary infections develop via ascending route through the urethra, where bacterial cells come in contact with human urine prior to reaching the bladder or kidneys. Since urine contains significant amounts of inorganic ions and urea, it imposes osmotic and denaturing stresses on bacterial cells. In this study, we determined the transcriptional adaptive responses of UPEC strain CFT073 to the presence of 0.3 M NaCl or 0.6 M urea in the growth medium. The cell responses to these two osmolytes were drastically different. Although most of the genes of the osmotically inducible regulon were overexpressed in medium with salt, urea failed to stimulate osmotic stress response. At the same time, UPEC colonization genes encoding type 1 and F1C fimbriae and capsule biosynthesis were transcriptionally induced in the presence of urea but did not respond to increased salt concentration. We speculate that urea can potentially be sensed by uropathogenic bacteria to initiate infection program. In addition, several molecular chaperone genes were overexpressed in the presence of urea, whereas adding NaCl to the medium led to an upregulation of a number of anaerobic metabolism pathways. PMID:23090957

Withman, Benjamin; Gunasekera, Thusitha S.; Beesetty, Pavani; Agans, Richard

2013-01-01

237

The RclR Protein Is a Reactive Chlorine-specific Transcription Factor in Escherichia coli *  

PubMed Central

Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance. PMID:24078635

Parker, Benjamin W.; Schwessinger, Emily A.; Jakob, Ursula; Gray, Michael J.

2013-01-01

238

Genomic Expression Program Involving the Haa1p-Regulon in Saccharomyces cerevisiae Response to Acetic Acid  

PubMed Central

Abstract The alterations occurring in yeast genomic expression during early response to acetic acid and the involvement of the transcription factor Haa1p in this transcriptional reprogramming are described in this study. Haa1p was found to regulate, directly or indirectly, the transcription of approximately 80% of the acetic acid-activated genes, suggesting that Haa1p is the main player in the control of yeast response to this weak acid. The genes identified in this work as being activated in response to acetic acid in a Haa1p-dependent manner include protein kinases, multidrug resistance transporters, proteins involved in lipid metabolism, in nucleic acid processing, and proteins of unknown function. Among these genes, the expression of SAP30 and HRK1 provided the strongest protective effect toward acetic acid. SAP30 encode a subunit of a histone deacetylase complex and HRK1 encode a protein kinase belonging to a family of protein kinases dedicated to the regulation of plasma membrane transporters activity. The deletion of the HRK1 gene was found to lead to the increase of the accumulation of labeled acetic acid into acid-stressed yeast cells, suggesting that the role of both HAA1 and HRK1 in providing protection against acetic acid is, at least partially, related with their involvement in the reduction of intracellular acetate concentration. PMID:20955010

Becker, Jorg D.; Sá-Correia, Isabel

2010-01-01

239

ASTP Onboard Voice Transcription  

NASA Technical Reports Server (NTRS)

The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

1975-01-01

240

Discovery of a diverse clade of gregarine apicomplexans (Apicomplexa: Eugregarinorida) from Pacific eunicid and onuphid polychaetes, including descriptions of Paralecudina n. gen., Trichotokara japonica n. sp., and T. eunicae n. sp.  

PubMed

Marine gregarines are poorly understood apicomplexan parasites with large trophozoites that inhabit the body cavities of marine invertebrates. Two novel species of gregarines were discovered in polychaete hosts collected in Canada and Japan. The trophozoites of Trichotokara japonica n. sp. were oval to rhomboidal shaped, and covered with longitudinal epicytic folds with a density of six to eight folds/micron. The nucleus was situated in the middle of the cell, and the mucron was elongated and covered with hair-like projections; antler-like projections also extended from the anterior tip of the mucron. The distinctively large trophozoites of Trichotokara eunicae n. sp. lacked an elongated mucron and had a tadpole-like cell shape consisting of a bulbous anterior region and a tapered tail-like posterior region. The cell surface was covered with longitudinal epicytic folds with a density of three to five folds/micron. Small subunit (SSU) rDNA sequences of both species were very divergent and formed a strongly supported clade with the recently described species Trichotokara nothriae and an environmental sequence (AB275074). This phylogenetic context combined with the morphological features of T. eunicae n. sp. required us to amend the description for Trichotokara. The sister clade to the Trichotokara clade consisted of environmental sequences and Lecudina polymorpha, which also possesses densely packed epicyctic folds (3-5 folds/micron) and a prominently elongated mucron. This improved morphological and molecular phylogenetic context justified the establishment of Paralecudina (ex. Lecudina) polymorpha n. gen. et comb. PMID:23347320

Rueckert, Sonja; Wakeman, Kevin C; Leander, Brian S

2013-01-01

241

Genome-Scale Co-Expression Network Comparison across Escherichia coli and Salmonella enterica Serovar Typhimurium Reveals Significant Conservation at the Regulon Level of Local Regulators Despite Their Dissimilar Lifestyles  

PubMed Central

Availability of genome-wide gene expression datasets provides the opportunity to study gene expression across different organisms under a plethora of experimental conditions. In our previous work, we developed an algorithm called COMODO (COnserved MODules across Organisms) that identifies conserved expression modules between two species. In the present study, we expanded COMODO to detect the co-expression conservation across three organisms by adapting the statistics behind it. We applied COMODO to study expression conservation/divergence between Escherichia coli, Salmonella enterica, and Bacillus subtilis. We observed that some parts of the regulatory interaction networks were conserved between E. coli and S. enterica especially in the regulon of local regulators. However, such conservation was not observed between the regulatory interaction networks of B. subtilis and the two other species. We found co-expression conservation on a number of genes involved in quorum sensing, but almost no conservation for genes involved in pathogenicity across E. coli and S. enterica which could partially explain their different lifestyles. We concluded that despite their different lifestyles, no significant rewiring have occurred at the level of local regulons involved for instance, and notable conservation can be detected in signaling pathways and stress sensing in the phylogenetically close species S. enterica and E. coli. Moreover, conservation of local regulons seems to depend on the evolutionary time of divergence across species disappearing at larger distances as shown by the comparison with B. subtilis. Global regulons follow a different trend and show major rewiring even at the limited evolutionary distance that separates E. coli and S. enterica. PMID:25101984

Zarrineh, Peyman; Sánchez-Rodríguez, Aminael; Hosseinkhan, Nazanin; Narimani, Zahra; Marchal, Kathleen; Masoudi-Nejad, Ali

2014-01-01

242

Global transcriptional response of Caulobacter crescentus to iron availability  

PubMed Central

Background In the alpha subclass of proteobacteria iron homeostasis is controlled by diverse iron responsive regulators. Caulobacter crescentus, an important freshwater ?-proteobacterium, uses the ferric uptake repressor (Fur) for such purpose. However, the impact of the iron availability on the C. crescentus transcriptome and an overall perspective of the regulatory networks involved remain unknown. Results In this work we report the identification of iron-responsive and Fur-regulated genes in C. crescentus using microarray-based global transcriptional analyses. We identified 42 genes that were strongly upregulated both by mutation of fur and by iron limitation condition. Among them, there are genes involved in iron uptake (four TonB-dependent receptor gene clusters, and feoAB), riboflavin biosynthesis and genes encoding hypothetical proteins. Most of these genes are associated with predicted Fur binding sites, implicating them as direct targets of Fur-mediated repression. These data were validated by ?-galactosidase and EMSA assays for two operons encoding putative transporters. The role of Fur as a positive regulator is also evident, given that 27 genes were downregulated both by mutation of fur and under low-iron condition. As expected, this group includes many genes involved in energy metabolism, mostly iron-using enzymes. Surprisingly, included in this group are also TonB-dependent receptors genes and the genes fixK, fixT and ftrB encoding an oxygen signaling network required for growth during hypoxia. Bioinformatics analyses suggest that positive regulation by Fur is mainly indirect. In addition to the Fur modulon, iron limitation altered expression of 113 more genes, including induction of genes involved in Fe-S cluster assembly, oxidative stress and heat shock response, as well as repression of genes implicated in amino acid metabolism, chemotaxis and motility. Conclusions Using a global transcriptional approach, we determined the C. crescentus iron stimulon. Many but not all of iron responsive genes were directly or indirectly controlled by Fur. The iron limitation stimulon overlaps with other regulatory systems, such as the RpoH and FixK regulons. Altogether, our results showed that adaptation of C. crescentus to iron limitation not only involves increasing the transcription of iron-acquisition systems and decreasing the production of iron-using proteins, but also includes novel genes and regulatory mechanisms. PMID:23941329

2013-01-01

243

Transcripts and Translations Transcripts from outside the United States  

E-print Network

Transcripts and Translations Transcripts from outside the United States: If you have attended photocopies as original documents. Translations of transcripts from outside the United States: If your official transcript is in a language other than English, you will need to have this translated before we

Barrash, Warren

244

Inference of expanded Lrp-like feast/famine transcription factor targets in a non-model organism using protein structure-based prediction.  

PubMed

Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer. PMID:25255272

Ashworth, Justin; Plaisier, Christopher L; Lo, Fang Yin; Reiss, David J; Baliga, Nitin S

2014-01-01

245

Inference of Expanded Lrp-Like Feast/Famine Transcription Factor Targets in a Non-Model Organism Using Protein Structure-Based Prediction  

PubMed Central

Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer. PMID:25255272

Ashworth, Justin; Plaisier, Christopher L.; Lo, Fang Yin; Reiss, David J.; Baliga, Nitin S.

2014-01-01

246

Promoter and regulon analysis of nitrogen assimilation factor, sigma54, reveal alternative strategy for E. coli MG1655 flagellar biosynthesis.  

PubMed

Bacteria core RNA polymerase (RNAP) must associate with a sigma factor to recognize promoter sequences. Promoters recognized by the sigma(54) (or sigma(N)) associated RNA polymerase are unique in having conserved positions around -24 and -12 nucleotides upstream from the transcriptional start site. Using DNA microarrays representing the entire Escherichia coli genome and promoter validation approaches, we identify 40 in vivo targets of sigma(54), the nitrogen assimilation sigma factor, and estimate that there are 70 sigma(54) promoters in total. Immunoprecipitation assays have been performed to further evaluate the efficiency of our approaches. In addition, promoter consensus binding search and primer extension assay helped us to identify a new sigma(54) promoter carried by insB-5 in the upstream of flhDC operon. The involvement of sigma(54) in flagellar biosynthesis in sequenced E. coli strain MG1655 indicates a fluid gene regulation phenomenon carried by some mobile elements in bacteria genome. PMID:19969540

Zhao, Kai; Liu, Mingzhu; Burgess, Richard R

2010-03-01

247

Mapping Yeast Transcriptional Networks  

PubMed Central

The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms. PMID:24018767

Hughes, Timothy R.; de Boer, Carl G.

2013-01-01

248

Transcript CONTU Meeting #10.  

ERIC Educational Resources Information Center

Testimony on the copyrightability of computer software was heard at the 10th Commission meeting held at the New York Public Library in November 1976. This transcript of the meeting also includes reports of the Commission subcommittees on photocopying, software, networks, and data bases. (Author/AP)

National Commission on New Technological Uses of Copyrighted Works, Washington, DC.

249

Screening of transcription factors with transcriptional initiation activity.  

PubMed

A majority of mammalian promoters are associated with CpG islands. CpG island promoters frequently lack common core promoter elements, such as the TATA box, and often have dispersed transcription start sites. The mechanism through which CpG island promoters are transcriptionally initiated remains unclear. We speculate that some transcription factors can direct transcription initiation by themselves. To test this hypothesis, we screened a variety of transcription factors to see whether they could initiate transcription. Most transcription factors, including specificity protein 1 (Sp1) and nuclear factor Y (NF-Y), showed little transcriptional initiation activity. However, nuclear respiratory factor 1 (NRF-1), the basic helix-loop-helix/leucine zipper (bHLH/ZIP) family of proteins and the E-twenty six (Ets) family of proteins had strong transcriptional activity. We further demonstrated that these transcription factors initiate dispersed transcription. Our studies provide perspectives to the mechanism of transcription initiation from CpG island promoters. PMID:23933270

Zhang, Lang; Yu, Haoyue; Wang, Pan; Ding, Qingyang; Wang, Zhao

2013-11-15

250

Tailoring the Models of Transcription  

PubMed Central

Molecular biology is a rapidly evolving field that has led to the development of increasingly sophisticated technologies to improve our capacity to study cellular processes in much finer detail. Transcription is the first step in protein expression and the major point of regulation of the components that determine the characteristics, fate and functions of cells. The study of transcriptional regulation has been greatly facilitated by the development of reporter genes and transcription factor expression vectors, which have become versatile tools for manipulating promoters, as well as transcription factors in order to examine their function. The understanding of promoter complexity and transcription factor structure offers an insight into the mechanisms of transcriptional control and their impact on cell behaviour. This review focuses on some of the many applications of molecular cut-and-paste tools for the manipulation of promoters and transcription factors leading to the understanding of crucial aspects of transcriptional regulation. PMID:23567272

Pance, Alena

2013-01-01

251

The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis  

PubMed Central

Efg1 (a member of the APSES family) is an important regulator of hyphal growth and of the white-to-opaque transition in Candida albicans and very closely related species. We show that in Candida parapsilosis?Efg1 is a major regulator of a different morphological switch at the colony level, from a concentric to smooth morphology. The rate of switching is at least 20-fold increased in an efg1 knockout relative to wild type. Efg1 deletion strains also have reduced biofilm formation, attenuated virulence in an insect model, and increased sensitivity to SDS and caspofungin. Biofilm reduction is more dramatic in in vitro than in in vivo models. An Efg1 paralogue (Efh1) is restricted to Candida species, and does not regulate concentric-smooth phenotype switching, biofilm formation or stress response. We used ChIP-seq to identify the Efg1 regulon. A total of 931 promoter regions bound by Efg1 are highly enriched for transcription factors and regulatory proteins. Efg1 also binds to its own promoter, and negatively regulates its expression. Efg1 targets are enriched in binding sites for 93 additional transcription factors, including Ndt80. Our analysis suggests that Efg1 has an ancient role as regulator of development in fungi, and is central to several regulatory networks. PMID:23895281

Connolly, Leona A; Riccombeni, Alessandro; Grózer, Zsuzsana; Holland, Linda M; Lynch, Denise B; Andes, David R; Gácser, Attila; Butler, Geraldine

2013-01-01

252

A Large Family of Antivirulence Regulators Modulates the Effects of Transcriptional Activators in Gram-negative Pathogenic Bacteria  

PubMed Central

We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44–100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family. PMID:24875828

Santiago, Araceli E.; Ruiz-Perez, Fernando; Jo, Noah Y.; Vijayakumar, Vidhya; Gong, Mei Q.; Nataro, James P.

2014-01-01

253

Improved predictions of transcription factor binding sites using physicochemical features of DNA.  

PubMed

Typical approaches for predicting transcription factor binding sites (TFBSs) involve use of a position-specific weight matrix (PWM) to statistically characterize the sequences of the known sites. Recently, an alternative physicochemical approach, called SiteSleuth, was proposed. In this approach, a linear support vector machine (SVM) classifier is trained to distinguish TFBSs from background sequences based on local chemical and structural features of DNA. SiteSleuth appears to generally perform better than PWM-based methods. Here, we improve the SiteSleuth approach by considering both new physicochemical features and algorithmic modifications. New features are derived from Gibbs energies of amino acid-DNA interactions and hydroxyl radical cleavage profiles of DNA. Algorithmic modifications consist of inclusion of a feature selection step, use of a nonlinear kernel in the SVM classifier, and use of a consensus-based post-processing step for predictions. We also considered SVM classification based on letter features alone to distinguish performance gains from use of SVM-based models versus use of physicochemical features. The accuracy of each of the variant methods considered was assessed by cross validation using data available in the RegulonDB database for 54 Escherichia coli TFs, as well as by experimental validation using published ChIP-chip data available for Fis and Lrp. PMID:22923524

Maienschein-Cline, Mark; Dinner, Aaron R; Hlavacek, William S; Mu, Fangping

2012-12-01

254

Characterisation of a putative AraC transcriptional regulator from Mycobacterium smegmatis  

PubMed Central

Summary MSMEG_0307 is annotated as a transcriptional regulator belonging to the AraC protein family and is located adjacent to the arylamine N-acetyltransferase (nat) gene in Mycobacterium smegmatis, in a gene cluster, conserved in most environmental mycobacterial species. In order to elucidate the function of the AraC protein from the nat operon in M. smegmatis, two conserved palindromic DNA motifs were identified using bioinformatics and tested for protein binding using electrophoretic mobility shift assays with a recombinant form of the AraC protein. We identified the formation of a DNA:AraC protein complex with one of the motifs as well as the presence of this motif in 20 loci across the whole genome of M. smegmatis, supporting the existence of an AraC controlled regulon. To characterise the effects of AraC in the regulation of the nat operon genes, as well as to gain further insight into its function, we generated a ?araC mutant strain where the araC gene was replaced by a hygromycin resistance marker. The level of expression of the nat and MSMEG_0308 genes was down-regulated in the ?araC strain when compared to the wild type strain indicating an activator effect of the AraC protein on the expression of the nat operon genes. PMID:25443504

Evangelopoulos, Dimitrios; Gupta, Antima; Lack, Nathan A.; Maitra, Arundhati; ten Bokum, Annemieke M.C.; Kendall, Sharon; Sim, Edith; Bhakta, Sanjib

2014-01-01

255

Global transcriptional control by glucose and carbon regulator CcpA in Clostridium difficile  

PubMed Central

The catabolite control protein CcpA is a pleiotropic regulator that mediates the global transcriptional response to rapidly catabolizable carbohydrates, like glucose in Gram-positive bacteria. By whole transcriptome analyses, we characterized glucose-dependent and CcpA-dependent gene regulation in Clostridium difficile. About 18% of all C. difficile genes are regulated by glucose, for which 50% depend on CcpA for regulation. The CcpA regulon comprises genes involved in sugar uptake, fermentation and amino acids metabolism, confirming the role of CcpA as a link between carbon and nitrogen pathways. Using combination of chromatin immunoprecipitation and genome sequence analysis, we detected 55 CcpA binding sites corresponding to ?140 genes directly controlled by CcpA. We defined the C. difficile CcpA consensus binding site (creCD motif), that is, ‘RRGAAAANGTTTTCWW’. Binding of purified CcpA protein to 19 target creCD sites was demonstrated by electrophoretic mobility shift assay. CcpA also directly represses key factors in early steps of sporulation (Spo0A and SigF). Furthermore, the C. difficile toxin genes (tcdA and tcdB) and their regulators (tcdR and tcdC) are direct CcpA targets. Finally, CcpA controls a complex and extended regulatory network through the modulation of a large set of regulators. PMID:22989714

Antunes, Ana; Camiade, Emilie; Monot, Marc; Courtois, Emmanuelle; Barbut, Frédéric; Sernova, Natalia V.; Rodionov, Dmitry A.; Martin-Verstraete, Isabelle; Dupuy, Bruno

2012-01-01

256

Non-transcriptional regulatory processes shape transcriptional network dynamics  

PubMed Central

Preface Information about the extra- or intracellular environment is often captured as biochemical signals propagating through regulatory networks. These signals eventually drive phenotypic changes, typically by altering gene expression programs in the cell. Reconstruction of transcriptional regulatory networks has given a compelling picture of bacterial physiology, but transcriptional network maps alone often fail to describe phenotypes. In many cases, the dynamical performance of transcriptional regulatory networks depends on post-transcriptional or post-translational regulation and pleiotropic effects. Cellular response dynamics are ultimately determined by interactions between transcriptional and non-transcriptional networks with dramatic implications for physiology and evolution. Here, we provide an overview of non-transcriptional interactions that can affect the performance of natural and synthetic bacterial regulatory networks. PMID:21986901

Ray, J. Christian J.; Tabor, Jeffrey J.; Igoshin, Oleg A.

2013-01-01

257

Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638.  

PubMed

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ?rcsB mutant was affected in its plant growth promoting ability. PMID:25607953

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

2015-01-01

258

Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638  

PubMed Central

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ?rcsB mutant was affected in its plant growth promoting ability. PMID:25607953

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

2015-01-01

259

Control of Transcriptional Elongation  

PubMed Central

Elongation is becoming increasingly recognized as a critically controlled step in transcriptional regulation. While traditional genetic and biochemical studies have identified major players of transcriptional elongation, our understanding of the importance and roles of these factors is evolving rapidly through the recent advances in genome-wide and single-molecule technologies. Here we focus on how elongation can modulate the transcriptional outcome through the rate-liming step of RNA polymerase II pausing near promoters, and how the participating factors were identified. Among the factors we describe are NELF and DSIF, the pausing factors, and P-TEFb, the key player in pause release. We also describe non-exclusive models for how pausing is achieved by making use of high resolution genome-wide mapping of paused Pol II relative to promoter elements and the first nucleosome. We also discuss Pol II elongation through the bodies of genes and the roles of FACT and Spt6, the factors that allow Pol II to move through nucleosomes. PMID:24050178

Kwak, Hojoong; Lis, John T.

2014-01-01

260

Transcriptional network classifiers  

PubMed Central

Background Gene interactions play a central role in transcriptional networks. Many studies have performed genome-wide expression analysis to reconstruct regulatory networks to investigate disease processes. Since biological processes are outcomes of regulatory gene interactions, this paper develops a system biology approach to infer function-dependent transcriptional networks modulating phenotypic traits, which serve as a classifier to identify tissue states. Due to gene interactions taken into account in the analysis, we can achieve higher classification accuracy than existing methods. Results Our system biology approach is carried out by the Bayesian networks framework. The algorithm consists of two steps: gene filtering by Bayes factor followed by collinearity elimination via network learning. We validate our approach with two clinical data. In the study of lung cancer subtypes discrimination, we obtain a 25-gene classifier from 111 training samples, and the test on 422 independent samples achieves 95% classification accuracy. In the study of thoracic aortic aneurysm (TAA) diagnosis, 61 samples determine a 34-gene classifier, whose diagnosis accuracy on 33 independent samples achieves 82%. The performance comparisons with three other popular methods, PCA/LDA, PAM, and Weighted Voting, confirm that our approach yields superior classification accuracy and a more compact signature. Conclusions The system biology approach presented in this paper is able to infer function-dependent transcriptional networks, which in turn can classify biological samples with high accuracy. The validation of our classifier using clinical data demonstrates the promising value of our proposed approach for disease diagnosis. PMID:19761563

Chang, Hsun-Hsien; Ramoni, Marco F

2009-01-01

261

The Salmonella Spi1 Virulence Regulatory Protein HilD Directly Activates Transcription of the Flagellar Master Operon flhDC  

PubMed Central

Infection of intestinal epithelial cells is dependent on the Salmonella enterica serovar Typhimurium pathogenicity island 1 (Spi1)-encoded type III injectisome system and flagellar motility. Thus, the expression of virulence and flagellar genes is subject to tight regulatory control mechanisms in order to ensure the correct spatiotemporal production of the respective gene products. In this work, we reveal a new level of cross-regulation between the Spi1 and flagellar regulatory systems. Transposon mutagenesis identified a class of mutants that prevented flhDC autorepression by overexpressing HilD. HilD, HilC, RtsA, and HilA comprise a positive regulatory circuit for the expression of the Spi1 genes. Here, we report a novel transcriptional cross talk between the Spi1 and flagellar regulons where HilD transcriptionally activates flhDC gene expression by binding to nucleotides ?68 to ?24 upstream from the P5 transcriptional start site. We additionally show that, in contrast to the results of a previous report, HilA does not affect flagellar gene expression. Finally, we discuss a model of the cross-regulation network between Spi1 and the flagellar system and propose a regulatory mechanism via the Spi1 master regulator HilD that would prime flagellar genes for rapid reactivation during host infection. PMID:24488311

Singer, Hanna M.; Kühne, Caroline; Deditius, Julia A.

2014-01-01

262

Nascent transcript sequencing visualizes transcription at nucleotide resolution.  

PubMed

Recent studies of transcription have revealed a level of complexity not previously appreciated even a few years ago, both in the intricate use of post-initiation control and the mass production of rapidly degraded transcripts. Dissection of these pathways requires strategies for precisely following transcripts as they are being produced. Here we present an approach (native elongating transcript sequencing, NET-seq), based on deep sequencing of 3' ends of nascent transcripts associated with RNA polymerase, to monitor transcription at nucleotide resolution. Application of NET-seq in Saccharomyces cerevisiae reveals that although promoters are generally capable of divergent transcription, the Rpd3S deacetylation complex enforces strong directionality to most promoters by suppressing antisense transcript initiation. Our studies also reveal pervasive polymerase pausing and backtracking throughout the body of transcripts. Average pause density shows prominent peaks at each of the first four nucleosomes, with the peak location occurring in good agreement with in vitro biophysical measurements. Thus, nucleosome-induced pausing represents a major barrier to transcriptional elongation in vivo. PMID:21248844

Churchman, L Stirling; Weissman, Jonathan S

2011-01-20

263

New Family of Tungstate-Responsive Transcriptional Regulators in Sulfate-Reducing Bacteria  

PubMed Central

The trace elements molybdenum and tungsten are essential components of cofactors of many metalloenzymes. However, in sulfate-reducing bacteria, high concentrations of molybdate and tungstate oxyanions inhibit growth, thus requiring the tight regulation of their homeostasis. By a combination of bioinformatic and experimental techniques, we identified a novel regulator family, tungstate-responsive regulator (TunR), controlling the homeostasis of tungstate and molybdate in sulfate-reducing deltaproteobacteria. The effector-sensing domains of these regulators are similar to those of the known molybdate-responsive regulator ModE, while their DNA-binding domains are homologous to XerC/XerD site-specific recombinases. Using a comparative genomics approach, we identified DNA motifs and reconstructed regulons for 40 TunR family members. Positional analysis of TunR sites and putative promoters allowed us to classify most TunR proteins into two groups: (i) activators of modABC genes encoding a high-affinity molybdenum and tungsten transporting system and (ii) repressors of genes for toluene sulfonate uptake (TSUP) family transporters. The activation of modA and modBC genes by TunR in Desulfovibrio vulgaris Hildenborough was confirmed in vivo, and we discovered that the activation was diminished in the presence of tungstate. A predicted 30-bp TunR-binding motif was confirmed by in vitro binding assays. A novel TunR family of bacterial transcriptional factors controls tungstate and molybdate homeostasis in sulfate-reducing deltaproteobacteria. We proposed that TunR proteins participate in protection of the cells from the inhibition by these oxyanions. To our knowledge, this is a unique case of a family of bacterial transcriptional factors evolved from site-specific recombinases. PMID:23913324

Rajeev, Lara; Luning, Eric G.; Zane, Grant M.; Siddartha, Kavya; Rodionov, Dmitry A.; Dubchak, Inna; Arkin, Adam P.; Wall, Judy D.; Mukhopadhyay, Aindrila

2013-01-01

264

Transients in chloroplast gene transcription  

SciTech Connect

Transcriptional regulation of chloroplast genes is demonstrated by Quantitative Polymerase Chain Reaction (qPCR). These genes encode apoproteins of the reaction centres of photosystem I and photosystem II. Their transcription is regulated by changes in wavelength of light selectively absorbed by photosystem I and photosystem II, and therefore by the redox state of an electron carrier located between the two photosystems. Chloroplast transcriptional redox regulation is shown to have greater amplitude, and the kinetics of transcriptional changes are more complex, than suggested by previous experiments using only DNA probes in Northern blot experiments. Redox effects on chloroplast transcription appear to be superimposed on an endogenous rhythm of mRNA abundance. The functional significance of these transients in chloroplast gene transcription is discussed.

Puthiyaveetil, Sujith [School of Biological and Chemical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom); Allen, John F. [School of Biological and Chemical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom)], E-mail: j.f.allen@qmul.ac.uk

2008-04-18

265

The heat-inducible essential response regulator WalR positively regulates transcription of sigI, mreBH and lytE in Bacillus subtilis under heat stress.  

PubMed

The actin homolog MreBH governs cell morphogenesis of Bacillus subtilis through localization of the cell wall hydrolase LytE. The alternative sigma factor SigI of B. subtilis coordinately regulates transcription of mreBH and lytE. Transcription of sigI, mreBH and lytE is heat-inducible. The essential response regulator WalR (YycF) plays a key role in coordinating cell wall metabolism with cell proliferation. We now demonstrate that mreBH is a new member of the WalR regulon. We also found that WalR can positively and directly regulate sigI transcription under heat stress through a binding site located upstream of the ?(I) promoter of sigI. In addition, we found that a WalR binding site located upstream of the SigI binding site in the regulatory region of lytE is important for lytE expression under heat stress. Moreover, we found that walR is a new member of the heat shock stimulon of B. subtilis. WalR appears to coordinately and positively regulate transcription of sigI, mreBH and lytE under heat stress. Finally, our work shows for the first time that WalR can stimulate activities of ?(I) promoters under heat stress. PMID:24125693

Huang, Wan-Zhen; Wang, Jyun-Jhih; Chen, Hui-Ju; Chen, Jung-Tze; Shaw, Gwo-Chyuan

2013-12-01

266

Promoter-mediated transcriptional dynamics.  

PubMed

Genes in eukaryotic cells are typically regulated by complex promoters containing multiple binding sites for a variety of transcription factors, but how promoter dynamics affect transcriptional dynamics has remained poorly understood. In this study, we analyze gene models at the transcriptional regulation level, which incorporate the complexity of promoter structure (PS) defined as transcriptional exits (i.e., ON states of the promoter) and the transition pattern (described by a matrix consisting of transition rates among promoter activity states). We show that multiple exits of transcription are the essential origin of generating multimodal distributions of mRNA, but promoters with the same transition pattern can lead to multimodality of different modes, depending on the regulation of transcriptional factors. In turn, for similar mRNA distributions in the models, the mean ON or OFF time distributions may exhibit different characteristics, thus providing the supplemental information on PS. In addition, we demonstrate that the transcriptional noise can be characterized by a nonlinear function of mean ON and OFF times. These results not only reveal essential characteristics of promoter-mediated transcriptional dynamics but also provide signatures useful for inferring PS based on characteristics of transcriptional outputs. PMID:24461023

Zhang, Jiajun; Zhou, Tianshou

2014-01-21

267

Initiation of HIV Reverse Transcription  

PubMed Central

Reverse transcription of retroviral genomes into double stranded DNA is a key event for viral replication. The very first stage of HIV reverse transcription, the initiation step, involves viral and cellular partners that are selectively packaged into the viral particle, leading to an RNA/protein complex with very specific structural and functional features, some of which being, in the case of HIV-1, linked to particular isolates. Recent understanding of the tight spatio-temporal regulation of reverse transcription and its importance for viral infectivity further points toward reverse transcription and potentially its initiation step as an important drug target. PMID:21994608

Isel, Catherine; Ehresmann, Chantal; Marquet, Roland

2010-01-01

268

The NifA-RpoN Regulon of Mesorhizobium loti Strain R7A and Its Symbiotic Activation by a Novel LacI/GalR-Family Regulator  

PubMed Central

Mesorhizobium loti is the microsymbiont of Lotus species, including the model legume L. japonicus. M. loti differs from other rhizobia in that it contains two copies of the key nitrogen fixation regulatory gene nifA, nifA1 and nifA2, both of which are located on the symbiosis island ICEMlSymR7A. M. loti R7A also contains two rpoN genes, rpoN1 located on the chromosome outside of ICEMlSymR7A and rpoN2 that is located on ICEMlSymR7A. The aims of the current work were to establish how nifA expression was activated in M. loti and to characterise the NifA-RpoN regulon. The nifA2 and rpoN2 genes were essential for nitrogen fixation whereas nifA1 and rpoN1 were dispensable. Expression of nifA2 was activated, possibly in response to an inositol derivative, by a novel regulator of the LacI/GalR family encoded by the fixV gene located upstream of nifA2. Other than the well-characterized nif/fix genes, most NifA2-regulated genes were not required for nitrogen fixation although they were strongly expressed in nodules. The NifA-regulated nifZ and fixU genes, along with nifQ which was not NifA-regulated, were required in M. loti for a fully effective symbiosis although they are not present in some other rhizobia. The NifA-regulated gene msi158 that encodes a porin was also required for a fully effective symbiosis. Several metabolic genes that lacked NifA-regulated promoters were strongly expressed in nodules in a NifA2-dependent manner but again mutants did not have an overt symbiotic phenotype. In summary, many genes encoded on ICEMlSymR7A were strongly expressed in nodules but not free-living rhizobia, but were not essential for symbiotic nitrogen fixation. It seems likely that some of these genes have functional homologues elsewhere in the genome and that bacteroid metabolism may be sufficiently plastic to adapt to loss of certain enzymatic functions. PMID:23308282

Sullivan, John T.; Brown, Steven D.; Ronson, Clive W.

2013-01-01

269

The NifA-RpoN regulon of Mesorhizobium loti strain R7A and its symbiotic activation by a novel Lacl/GalR-family regulator  

SciTech Connect

Mesorhizobium loti is the microsymbiont of Lotus species, including the model legume L. japonicus. M. loti differs from other rhizobia in that it contains two copies of the key nitrogen fixation regulatory gene nifA, nifA1 and nifA2, both of which are located on the symbiosis island ICEMlSymR7A. M. loti R7A also contains two rpoN genes, rpoN1 located on the chromosome outside of ICEMlSymR7A and rpoN2 that is located on ICEMlSymR7A. The aims of the current work were to establish how nifA expression was activated in M. loti and to characterise the NifA-RpoN regulon. The nifA2 and rpoN2 genes were essential for nitrogen fixation whereas nifA1 and rpoN1 were dispensable. Expression of nifA2 was activated, possibly in response to an inositol derivative, by a novel regulator of the LacI/GalR family encoded by the fixV gene located upstream of nifA2. Other than the well-characterized nif/fix genes, most NifA2-regulated genes were not required for nitrogen fixation although they were strongly expressed in nodules. The NifA-regulated nifZ and fixU genes, along with nifQ which was not NifA-regulated, were required in M. loti for a fully effective symbiosis although they are not present in some other rhizobia. The NifA-regulated gene msi158 that encodes a porin was also required for a fully effective symbiosis. Several metabolic genes that lacked NifA-regulated promoters were strongly expressed in nodules in a NifA2-dependent manner but again mutants did not have an overt symbiotic phenotype. In summary, many genes encoded on ICEMlSymR7A were strongly expressed in nodules but not free-living rhizobia, but were not essential for symbiotic nitrogen fixation. It seems likely that some of these genes have functional homologues elsewhere in the genome and that bacteroid metabolism may be sufficiently plastic to adapt to loss of certain enzymatic functions.

Sullivan, John T. [University of Otago, Dunedin, New Zealand] [University of Otago, Dunedin, New Zealand; Brown, Steven D [ORNL] [ORNL; Ronson, Professor Clive William [University of Otago, Dunedin, New Zealand] [University of Otago, Dunedin, New Zealand

2013-01-01

270

Output Targets and Transcriptional Regulation by a Cyclic Dimeric GMP-Responsive Circuit in the Vibrio parahaemolyticus Scr Network  

PubMed Central

The Vibrio parahaemolyticus Scr system modulates decisions pertinent to surface colonization by affecting the cellular level of cyclic dimeric GMP (c-di-GMP). In this work, we explore the scope and mechanism of this regulation. Transcriptome comparison of ?scrABC and wild-type strains revealed expression differences with respect to ?100 genes. Elevated c-di-GMP repressed genes in the surface-sensing regulon, including those encoding the lateral flagellar and type III secretion systems and N-acetylglucosamine-binding protein GpbA while inducing genes encoding other cell surface molecules and capsular polysaccharide. The transcription of a few regulatory genes was also affected, and the role of one was characterized. Mutations in cpsQ suppressed the sticky phenotype of scr mutants. cpsQ encodes one of four V. parahaemolyticus homologs in the CsgD/VpsT family, members of which have been implicated in c-di-GMP signaling. Here, we demonstrate that CpsQ is a c-di-GMP-binding protein. By using a combination of mutant and reporter analyses, CpsQ was found to be the direct, positive regulator of cpsA transcription. This c-di-GMP-responsive regulatory circuit could be reconstituted in Escherichia coli, where a low level of this nucleotide diminished the stability of CpsQ. The molecular interplay of additional known cps regulators was defined by establishing that CpsS, another CsgD family member, repressed cpsR, and the transcription factor CpsR activated cpsQ. Thus, we are developing a connectivity map of the Scr decision-making network with respect to its wiring and output strategies for colonizing surfaces and interaction with hosts; in doing so, we have isolated and reproduced a c-di-GMP-sensitive regulatory module in the circuit. PMID:22194449

Ferreira, Rosana B. R.; Chodur, Daniel M.; Antunes, Luis Caetano M.; Trimble, Michael J.

2012-01-01

271

Output targets and transcriptional regulation by a cyclic dimeric GMP-responsive circuit in the Vibrio parahaemolyticus Scr network.  

PubMed

The Vibrio parahaemolyticus Scr system modulates decisions pertinent to surface colonization by affecting the cellular level of cyclic dimeric GMP (c-di-GMP). In this work, we explore the scope and mechanism of this regulation. Transcriptome comparison of ?scrABC and wild-type strains revealed expression differences with respect to ?100 genes. Elevated c-di-GMP repressed genes in the surface-sensing regulon, including those encoding the lateral flagellar and type III secretion systems and N-acetylglucosamine-binding protein GpbA while inducing genes encoding other cell surface molecules and capsular polysaccharide. The transcription of a few regulatory genes was also affected, and the role of one was characterized. Mutations in cpsQ suppressed the sticky phenotype of scr mutants. cpsQ encodes one of four V. parahaemolyticus homologs in the CsgD/VpsT family, members of which have been implicated in c-di-GMP signaling. Here, we demonstrate that CpsQ is a c-di-GMP-binding protein. By using a combination of mutant and reporter analyses, CpsQ was found to be the direct, positive regulator of cpsA transcription. This c-di-GMP-responsive regulatory circuit could be reconstituted in Escherichia coli, where a low level of this nucleotide diminished the stability of CpsQ. The molecular interplay of additional known cps regulators was defined by establishing that CpsS, another CsgD family member, repressed cpsR, and the transcription factor CpsR activated cpsQ. Thus, we are developing a connectivity map of the Scr decision-making network with respect to its wiring and output strategies for colonizing surfaces and interaction with hosts; in doing so, we have isolated and reproduced a c-di-GMP-sensitive regulatory module in the circuit. PMID:22194449

Ferreira, Rosana B R; Chodur, Daniel M; Antunes, Luis Caetano M; Trimble, Michael J; McCarter, Linda L

2012-03-01

272

Transcriptional and post-transcriptional profile of human chromosome 21  

PubMed Central

Recent studies have demonstrated extensive transcriptional activity across the human genome, a substantial fraction of which is not associated with any functional annotation. However, very little is known regarding the post-transcriptional processes that operate within the different classes of RNA molecules. To characterize the post-transcriptional properties of expressed sequences from human chromosome 21 (HSA21), we separated RNA molecules from three cell lines (GM06990, HeLa S3, and SK-N-AS) according to their ribosome content by sucrose gradient fractionation. Polyribosomal-associated RNA and total RNA were subsequently hybridized to genomic tiling arrays. We found that ?50% of the transcriptional signals were located outside of annotated exons and were considered as TARs (transcriptionally active regions). Although TARs were observed among polysome-associated RNAs, RT-PCR and RACE experiments revealed that ?40% were likely to represent nonspecific cross-hybridization artifacts. Bioinformatics discrimination of TARs according to conservation and sequence complexity allowed us to identify a set of high-confidence TARs. This set of TARs was significantly depleted in the polysomes, suggesting that it was not likely to be involved in translation. Analysis of polysome representation of RefSeq exons showed that at least 15% of RefSeq transcripts undergo significant post-transcriptional regulation in at least two of the three cell lines tested. Among the regulated transcripts, enrichment analysis revealed an over-representation of genes involved in Alzheimer's disease (AD), including APP and the BACE1 protease that cleaves APP to produce the pathogenic beta 42 peptide. We demonstrate that the combination of RNA fractionation and tiling arrays is a powerful method to assess the transcriptional and post-transcriptional properties of genomic regions. PMID:19581486

Nikolaev, Sergey I.; Deutsch, Samuel; Genolet, Raphael; Borel, Christelle; Parand, Leila; Ucla, Catherine; Schütz, Frederic; Duriaux Sail, Genevieve; Dupré, Yann; Jaquier-Gubler, Pascale; Araud, Tanguy; Conne, Beatrice; Descombes, Patrick; Vassalli, Jean-Dominique; Curran, Joseph; Antonarakis, Stylianos E.

2009-01-01

273

Transcriptional and post-transcriptional profile of human chromosome 21.  

PubMed

Recent studies have demonstrated extensive transcriptional activity across the human genome, a substantial fraction of which is not associated with any functional annotation. However, very little is known regarding the post-transcriptional processes that operate within the different classes of RNA molecules. To characterize the post-transcriptional properties of expressed sequences from human chromosome 21 (HSA21), we separated RNA molecules from three cell lines (GM06990, HeLa S3, and SK-N-AS) according to their ribosome content by sucrose gradient fractionation. Polyribosomal-associated RNA and total RNA were subsequently hybridized to genomic tiling arrays. We found that approximately 50% of the transcriptional signals were located outside of annotated exons and were considered as TARs (transcriptionally active regions). Although TARs were observed among polysome-associated RNAs, RT-PCR and RACE experiments revealed that approximately 40% were likely to represent nonspecific cross-hybridization artifacts. Bioinformatics discrimination of TARs according to conservation and sequence complexity allowed us to identify a set of high-confidence TARs. This set of TARs was significantly depleted in the polysomes, suggesting that it was not likely to be involved in translation. Analysis of polysome representation of RefSeq exons showed that at least 15% of RefSeq transcripts undergo significant post-transcriptional regulation in at least two of the three cell lines tested. Among the regulated transcripts, enrichment analysis revealed an over-representation of genes involved in Alzheimer's disease (AD), including APP and the BACE1 protease that cleaves APP to produce the pathogenic beta 42 peptide. We demonstrate that the combination of RNA fractionation and tiling arrays is a powerful method to assess the transcriptional and post-transcriptional properties of genomic regions. PMID:19581486

Nikolaev, Sergey I; Deutsch, Samuel; Genolet, Raphael; Borel, Christelle; Parand, Leila; Ucla, Catherine; Schütz, Frederic; Duriaux Sail, Genevieve; Dupré, Yann; Jaquier-Gubler, Pascale; Araud, Tanguy; Conne, Beatrice; Descombes, Patrick; Vassalli, Jean-Dominique; Curran, Joseph; Antonarakis, Stylianos E

2009-08-01

274

Breaking barriers to transcription elongation  

Microsoft Academic Search

Hundreds of protein factors participate in transcription and its regulation in eukaryotes. Many of these proteins regulate specific genes by targeting upstream promoter regions, whereas a smaller but mechanistically diverse set of factors functions at most genes during RNA polymerase II (Pol II) elongation. These elongation factors can affect mRNA production at particular stages and in different ways during transcription.

Abbie Saunders; Leighton J. Core; John T. Lis

2006-01-01

275

Antisense Transcription in the Mammalian Transcriptome  

Microsoft Academic Search

Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts

S. Katayama; Y. Tomaru; T. Kasukawa; K. Waki; M. Nakanishi; M. Nakamura; H. Nishida; C. C. Yap; M. Suzuki; J. Kawai; H. Suzuki; P. Carninci; Y. Hayashizaki; C. Wells; M. Frith; T. Ravasi; K. C. Pang; J. Hallinan; J. Mattick; D. A. Hume; L. Lipovich; S. Batalov; P. G. Engström; Y. Mizuno; M. A. Faghihi; A. Sandelin; A. M. Chalk; S. Mottagui-Tabar; Z. Liang; B. Lenhard; C. Wahlestedt

2005-01-01

276

Transcriptional regulation during Drosophila spermatogenesis  

PubMed Central

Drosophila spermatogenesis has become a paradigmatic system for the study of mechanisms that regulate adult stem cell maintenance, proliferation and differentiation. The dramatic cellular differentiation process from germline stem cell (GSC) to mature sperm is accompanied by dynamic changes in gene expression, which are regulated at transcriptional, post-transcriptional (including translational) and post-translational levels. Post-transcriptional regulation has been proposed as a unique feature of germ cells. However, recent studies have provided new insights into transcriptional regulation during Drosophila spermatogenesis. Both signaling pathways and epigenetic mechanisms act to orchestrate the transcriptional regulation of distinct genes at different germ cell differentiation stages. Many of the regulatory pathways that control male gamete differentiation in Drosophila are conserved in mammals. Therefore, studies using Drosophila spermatogenesis will provide insight into the molecular mechanisms that regulate mammalian germ cell differentiation pathways. PMID:23087835

Lim, Cindy; Tarayrah, Lama; Chen, Xin

2012-01-01

277

Transcriptional control of cancer metastasis  

PubMed Central

Transcriptional regulation is an essential component of tumor progression and metastasis. During cancer progression, dysregulation of oncogenic or tumor suppressive transcription factors, as well as master cell fate regulators and tumor microenvironment-induced factors, collectively influence multiple steps of the metastasis cascade, including local invasion, dissemination, and eventual colonization of the tumor to distant organs. Furthermore, epigenetic alterations in tumor cells, including DNA methylation, as well as activation or suppression of histone deacetylases (HDACs), histone acetyltransferases (HATs), and other chromatin modifying enzymes can further distort the transcriptional network to influence metastasis. We focus here on recent research advances in transcriptional control of metastasis and highlight the therapeutic potential of targeting such transcriptional regulatory networks. PMID:23838335

Ell, Brian; Kang, Yibin

2013-01-01

278

Trypanosome MKT1 and the RNA-binding protein ZC3H11: interactions and potential roles in post-transcriptional regulatory networks  

PubMed Central

The trypanosome zinc finger protein ZC3H11 binds to AU-rich elements in mRNAs. It is essential for survival of the mammalian-infective bloodstream form, where it stabilizes several mRNAs including some encoding chaperones, and is also required for stabilization of chaperone mRNAs during the heat-shock response in the vector-infective procyclic form. When ZC3H11 was artificially ‘tethered’ to a reporter mRNA in bloodstream forms it increased reporter expression. We here show that ZC3H11 interacts with trypanosome MKT1 and PBP1, and that domains required for both interactions are necessary for function in the bloodstream-form tethering assay. PBP1 interacts with MKT1, LSM12 and poly(A) binding protein, and localizes to granules during parasite starvation. All of these proteins are essential for bloodstream-form trypanosome survival and increase gene expression in the tethering assay. MKT1 is cytosolic and polysome associated. Using a yeast two-hybrid screen and tandem affinity purification we found that trypanosome MKT1 interacts with multiple RNA-binding proteins and other potential RNA regulators, placing it at the centre of a post-transcriptional regulatory network. A consensus interaction sequence, H(E/D/N/Q)PY, was identified. Recruitment of MKT1-containing regulatory complexes to mRNAs via sequence-specific mRNA-binding proteins could thus control several different post-transcriptional regulons. PMID:24470144

Singh, Aditi; Minia, Igor; Droll, Dorothea; Fadda, Abeer; Clayton, Christine; Erben, Esteban

2014-01-01

279

Reinitiation enhances reliable transcriptional responses in eukaryotes.  

PubMed

Gene transcription is a noisy process carried out by the transcription machinery recruited to the promoter. Noise reduction is a fundamental requirement for reliable transcriptional responses which in turn are crucial for signal transduction. Compared with the relatively simple transcription initiation in prokaryotes, eukaryotic transcription is more complex partially owing to its additional reinitiation mechanism. By theoretical analysis, we showed that reinitiation reduces noise in eukaryotic transcription independent of the transcription level. Besides, a higher reinitiation rate enables a stable scaffold complex an advantage in noise reduction. Finally, we showed that the coupling between scaffold formation and transcription can further reduce transcription noise independent of the transcription level. Furthermore, compared with the reinitiation mechanism, the noise reduction effect of the coupling can be of more significance in the case that the transcription level is low and the intrinsic noise dominates. Our results uncover a mechanistic route which eukaryotes may use to facilitate a more reliable response in the noisy transcription process. PMID:24850905

Liu, Bo; Yuan, Zhanjiang; Aihara, Kazuyuki; Chen, Luonan

2014-08-01

280

Transcript elongation factors: shaping transcriptomes after transcript initiation.  

PubMed

Elongation is a dynamic and highly regulated step of eukaryotic gene transcription. A variety of transcript elongation factors (TEFs), including modulators of RNA polymerase II (RNAPII) activity, histone chaperones, and histone modifiers, have been characterized from plants. These factors control the efficiency of transcript elongation of subsets of genes in the chromatin context and thus contribute to tuning gene expression programs. We review here how genetic and biochemical analyses, primarily in Arabidopsis thaliana, have advanced our understanding of how TEFs adjust plant gene transcription. These studies have revealed that TEFs regulate plant growth and development by modulating diverse processes including hormone signaling, circadian clock, pathogen defense, responses to light, and developmental transitions. PMID:25131948

Van Lijsebettens, Mieke; Grasser, Klaus D

2014-11-01

281

Nitrogen control of the nif regulon in Klebsiella pneumoniae: involvement of the ntrA gene and analogies between ntrC and nifA.  

PubMed Central

The ntrC and nifA gene products of Klebsiella pneumoniae are transcriptional activators involved in general nitrogen control and nif-specific regulation, respectively. Multicopy plasmids expressing either ntrC or nifA from a foreign promoter were used to study the relationship between these two genes and ntrA. The nifA product substituted for ntrC product in activation of a number of genes including nifLA, hutUH and genes for arginine and proline utilisation. NtrC could not substitute for nifA in transcriptional activation of the nifHDKY operon. In ntrA- strains, neither the ntrC nor the nifA product functioned to activate transcription of nif promoters. In vitro transcription/translation studies with plasmid clones demonstrated similar levels of expression of ntrC and nifA in ntr+ and ntrA- S-30 extracts. Hence, lack of activator function in an ntrA mutant indicates that both the ntrC and nifA products require a functional ntrA for activity. When expressed from foreign promoters, both the ntrC and nifA products were active in conditions which would normally repress nif expression. Hence, the ntrA product was apparently not limiting in these conditions. Images Fig. 1. Fig. 2. PMID:11894906

Merrick, M J

1983-01-01

282

Unsupervised Transcription of Historical Documents  

E-print Network

Tesseract) #12;Unknown Fonts #12;Unknown Fonts long s glyph #12;Wandering Baseline Transcription% relative error re- duction over Google's open source Tesseract sys- tem, and giving a 31% relative error

California at Irvine, University of

283

Analysis of transcriptional regulatory circuitry  

E-print Network

The research in this thesis has focused on the analysis of data from two types of microarray technologies with the goal of improving understanding of transcriptional regulatory circuitry in yeast. These microarray technologies, ...

Rinaldi, Nicola J., 1974-

2004-01-01

284

The transcriptional activator LdtR from 'Candidatus Liberibacter asiaticus' mediates osmotic stress tolerance.  

PubMed

The causal agent of Huanglongbing disease, 'Candidatus Liberibacter asiaticus', is a non-culturable, gram negative, phloem-limited ?-proteobacterium. Current methods to control the spread of this disease are still limited to the removal and destruction of infected trees. In this study, we identified and characterized a regulon from 'Ca. L. asiaticus' involved in cell wall remodeling, that contains a member of the MarR family of transcriptional regulators (ldtR), and a predicted L,D-transpeptidase (ldtP). In Sinorhizobium meliloti, mutation of ldtR resulted in morphological changes (shortened rod-type phenotype) and reduced tolerance to osmotic stress. A biochemical approach was taken to identify small molecules that modulate LdtR activity. The LdtR ligands identified by thermal shift assays were validated using DNA binding methods. The biological impact of LdtR inactivation by the small molecules was then examined in Sinorhizobium meliloti and Liberibacter crescens, where a shortened-rod phenotype was induced by growth in presence of the ligands. A new method was also developed to examine the effects of small molecules on the viability of 'Ca. Liberibacter asiaticus', using shoots from HLB-infected orange trees. Decreased expression of ldtRLas and ldtPLas was observed in samples taken from HLB-infected shoots after 6 h of incubation with the LdtR ligands. These results provide strong proof of concept for the use of small molecules that target LdtR, as a potential treatment option for Huanglongbing disease. PMID:24763829

Pagliai, Fernando A; Gardner, Christopher L; Bojilova, Lora; Sarnegrim, Amanda; Tamayo, Cheila; Potts, Anastasia H; Teplitski, Max; Folimonova, Svetlana Y; Gonzalez, Claudio F; Lorca, Graciela L

2014-04-01

285

Physiological and Transcriptional Responses to High Concentrations of Lactic Acid in Anaerobic Chemostat Cultures of Saccharomyces cerevisiae?  

PubMed Central

Based on the high acid tolerance and the simple nutritional requirements of Saccharomyces cerevisiae, engineered strains of this yeast are considered biocatalysts for industrial production of high-purity undissociated lactic acid. However, high concentrations of lactic acid are toxic to S. cerevisiae, thus limiting its growth and product formation. Physiological and transcriptional responses to high concentrations of lactic acid were studied in anaerobic, glucose-limited chemostat cultures grown at different pH values and lactic acid concentrations, resulting in a 50% decrease in the biomass yield. At pH 5, the yield decrease was caused mostly by osmotically induced glycerol production and not by the classic weak-acid action, as was observed at pH 3. Cultures grown at pH 5 with 900 mM lactic acid revealed an upregulation of many genes involved in iron homeostasis, indicating that iron chelation occurred at high concentrations of dissociated lactic acid. Chemostat cultivation at pH 3 with 500 mM lactate, resulting in lower anion concentrations, showed an alleviation of this iron homeostasis response. Six of the 10 known targets of the transcriptional regulator Haa1p were strongly upregulated in lactate-challenged cultures at pH 3 but showed only moderate induction by high lactate concentrations at pH 5. Moreover, the haa1? mutant exhibited a growth defect at high lactic acid concentrations at pH 3. These results indicate that iron homeostasis plays a major role in the response of S. cerevisiae to high lactate concentrations, whereas the Haa1p regulon is involved primarily in the response to high concentrations of undissociated lactic acid. PMID:18676708

Abbott, Derek A.; Suir, Erwin; van Maris, Antonius J. A.; Pronk, Jack T.

2008-01-01

286

Coupled Transcription and Translation Within Nuclei of  

E-print Network

Coupled Transcription and Translation Within Nuclei of Mammalian Cells Francisco J. Iborra,1 Dean A. Jackson,2 Peter R. Cook1 * It is widely assumed that the vital processes of transcription and translation as transcription "factories." Some of this nuclear translation also depends on concurrent transcription by RNA

Bedwell, David M.

287

Transcriptional Signatures in Huntington's Disease  

PubMed Central

While selective neuronal death has been an influential theme in Huntington's disease (HD), there is now a preponderance of evidence that significant neuronal dysfunction precedes frank neuronal death. The best evidence for neuronal dysfunction is the observation that gene expression is altered in HD brain, suggesting that transcriptional dysregulation is a central mechanism. Studies of altered gene expression began with careful observations of post-mortem human HD brain and subsequently were accelerated by the development of transgenic mouse models. The application of DNA microarray technology has spurred tremendous progress with respect to the altered transcriptional processes that occur in HD, through gene expression studies of both transgenic mouse models as well as cellular models of HD. Gene expression profiles are remarkably comparable across these models, bolstering the idea that transcriptional signatures reflect an essential feature of disease pathogenesis. Finally, gene expression studies have been applied to human HD, thus not only validating the approach of using model systems, but also solidifying the idea that altered transcription is a key mechanism in HD pathogenesis. In the future, gene expression profiling will be used as a readout in clinical trials aimed at correcting transcriptional dysregulation in Huntington's disease. PMID:17467140

2007-01-01

288

Creating small transcription activating RNAs.  

PubMed

We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

Chappell, James; Takahashi, Melissa K; Lucks, Julius B

2015-03-01

289

Nucleosome dynamics define transcriptional enhancers.  

PubMed

Chromatin plays a central role in eukaryotic gene regulation. We performed genome-wide mapping of epigenetically marked nucleosomes to determine their position both near transcription start sites and at distal regulatory elements, including enhancers. In prostate cancer cells, where androgen receptor binds primarily to enhancers, we found that androgen treatment dismisses a central nucleosome present at androgen receptor binding sites that is flanked by a pair of marked nucleosomes. A new quantitative model built on the behavior of such nucleosome pairs correctly identified regions bound by the regulators of the immediate androgen response, including androgen receptor and FOXA1. More importantly, this model also correctly predicted previously unidentified binding sites for other transcription factors present after prolonged androgen stimulation, including OCT1 and NKX3-1. Therefore, quantitative modeling of enhancer structure provides a powerful predictive method to infer the identity of transcription factors involved in cellular responses to specific stimuli. PMID:20208536

He, Housheng Hansen; Meyer, Clifford A; Shin, Hyunjin; Bailey, Shannon T; Wei, Gang; Wang, Qianben; Zhang, Yong; Xu, Kexin; Ni, Min; Lupien, Mathieu; Mieczkowski, Piotr; Lieb, Jason D; Zhao, Keji; Brown, Myles; Liu, X Shirley

2010-04-01

290

Chromatin and Transcription in Yeast  

PubMed Central

Understanding the mechanisms by which chromatin structure controls eukaryotic transcription has been an intense area of investigation for the past 25 years. Many of the key discoveries that created the foundation for this field came from studies of Saccharomyces cerevisiae, including the discovery of the role of chromatin in transcriptional silencing, as well as the discovery of chromatin-remodeling factors and histone modification activities. Since that time, studies in yeast have continued to contribute in leading ways. This review article summarizes the large body of yeast studies in this field. PMID:22345607

Rando, Oliver J.; Winston, Fred

2012-01-01

291

Evolution of Eukaryotic Transcription Circuits  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. The gradual modification of transcription circuits over evolutionary time scales is an important source of the diversity of life. Over the past decade, studies in animals have shown how seemingly small molecular changes in gene regulation can have large effects on morphology and physiology and how selective pressures can act on these changes. More recently, genome-wide studies, particularly those in single-cell yeasts, have uncovered evidence of extensive transcriptional rewiring, indicating that even closely related organisms regulate their genes using markedly different circuitries.

Brian B. Tuch (University of California; Department of Biochemistry and Biophysics and Department of Microbiology and Immunology)

2008-03-28

292

Spatio-Temporal Dynamics of Yeast Mitochondrial Biogenesis: Transcriptional and Post-Transcriptional  

E-print Network

Spatio-Temporal Dynamics of Yeast Mitochondrial Biogenesis: Transcriptional and Post that unknown genes from this module code for important elements of mitochondrial biogenesis is supported-transcriptional processes in mitochondrial biogenesis, highlighting close connections between nuclear transcription

Boyer, Edmond

293

The transcriptional landscape of the deep-sea bacterium Photobacterium profundum in both a toxR mutant and its parental strain  

PubMed Central

Background The deep-sea bacterium Photobacterium profundum is an established model for studying high pressure adaptation. In this paper we analyse the parental strain DB110 and the toxR mutant TW30 by massively parallel cDNA sequencing (RNA-seq). ToxR is a transmembrane DNA-binding protein first discovered in Vibrio cholerae, where it regulates a considerable number of genes involved in environmental adaptation and virulence. In P. profundum the abundance and activity of this protein is influenced by hydrostatic pressure and its role is related to the regulation of genes in a pressure-dependent manner. Results To better characterize the ToxR regulon, we compared the expression profiles of wt and toxR strains in response to pressure changes. Our results revealed a complex expression pattern with a group of 22 genes having expression profiles similar to OmpH that is an outer membrane protein transcribed in response to high hydrostatic pressure. Moreover, RNA-seq allowed a deep characterization of the transcriptional landscape that led to the identification of 460 putative small RNA genes and the detection of 298 protein-coding genes previously unknown. We were also able to perform a genome-wide prediction of operon structure, transcription start and termination sites, revealing an unexpected high number of genes (992) with large 5?-UTRs, long enough to harbour cis-regulatory RNA structures, suggesting a correlation between intergenic region size and UTR length. Conclusion This work led to a better understanding of high-pressure response in P. profundum. Furthermore, the high-resolution RNA-seq analysis revealed several unexpected features about transcriptional landscape and general mechanisms of controlling bacterial gene expression. PMID:23107454

2012-01-01

294

ChIP analysis unravels an exceptionally wide distribution of DNA binding sites for the NtcA transcription factor in a heterocyst-forming cyanobacterium  

PubMed Central

Background The CRP-family transcription factor NtcA, universally found in cyanobacteria, was initially discovered as a regulator operating N control. It responds to the N regime signaled by the internal 2-oxoglutarate levels, an indicator of the C to N balance of the cells. Canonical NtcA-activated promoters bear an NtcA-consensus binding site (GTAN8TAC) centered at about 41.5 nucleotides upstream from the transcription start point. In strains of the Anabaena/Nostoc genera NtcA is pivotal for the differentiation of heterocysts in response to N stress. Results In this study, we have used chromatin immunoprecipitation followed by high-throughput sequencing to identify the whole catalog of NtcA-binding sites in cells of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. PCC 7120 three hours after the withdrawal of combined N. NtcA has been found to bind to 2,424 DNA regions in the genome of Anabaena, which have been ascribed to 2,153 genes. Interestingly, only a small proportion of those genes are involved in N assimilation and metabolism, and 65% of the binding regions were located intragenically. Conclusions The distribution of NtcA-binding sites identified here reveals the largest bacterial regulon described to date. Our results show that NtcA has a much wider role in the physiology of the cell than it has been previously thought, acting both as a global transcriptional regulator and possibly also as a factor influencing the superstructure of the chromosome (and plasmids). PMID:24417914

2014-01-01

295

Transcription factor-based biosensor  

SciTech Connect

The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

2013-10-08

296

The Ornibactin Biosynthesis and Transport Genes of Burkholderia cenocepacia Are Regulated by an Extracytoplasmic Function ? Factor Which Is a Part of the Fur Regulon  

PubMed Central

Burkholderia cenocepacia mutants that fail to produce the siderophore ornibactin were obtained following mutagenesis with mini-Tn5Tp. These mutants were shown to be growth restricted under conditions of iron depletion. In eight of the mutants, the transposon had integrated into one of two genes, orbI and orbJ, encoding nonribosomal peptide synthetases. In the other mutant, the transposon had inserted into an open reading frame, orbS, located upstream from orbI. The polypeptide product of orbS exhibits a high degree of similarity to the Pseudomonas aeruginosa extracytoplasmic function (ECF) ? factor PvdS but possesses an N-terminal extension of approximately 29 amino acids that is not present in PvdS. Three predicted OrbS-dependent promoters were identified within the ornibactin gene cluster, based on their similarity to PvdS-dependent promoters. The iron-regulated activity of these promoters was shown to require OrbS. Transcription of the orbS gene was found to be under the control of an iron-regulated ?70-dependent promoter. This promoter, but not the OrbS-dependent promoters, was shown to be a target for repression by the global regulator Fur. Our results demonstrate that production of ornibactin by B. cenocepacia in response to iron starvation requires transcription of an operon that is dependent on the Fur-regulated ECF ? factor gene orbS. A mechanism is also proposed for the biosynthesis of ornibactin. PMID:16672617

Agnoli, Kirsty; Lowe, Carolyn A.; Farmer, Kate L.; Husnain, Seyyed I.; Thomas, Mark S.

2006-01-01

297

The Cu regulon of the human fungal pathogen Cryptococcus neoformans H99: Cuf1 activates distinct genes in response to both Cu excess and deficiency  

PubMed Central

Summary Cryptococcus neoformans is a human fungal pathogen that is the causative agent of cryptococcosis and fatal meningitis in immuno-compromised hosts. Recent studies suggest that copper (Cu) acquisition plays an important role in C. neoformans virulence, as mutants that lack Cuf1, which activates the Ctr4 high affinity Cu importer, are hypo-virulent in mouse models. To understand the constellation of Cu-responsive genes in C. neoformans and how their expression might contribute to virulence, we determined the transcript profile of C. neoformans in response to elevated Cu or Cu deficiency. We identified two metallothionein genes (CMT1 and CMT2), encoding cysteine-rich Cu binding and detoxifying proteins, whose expression is dramatically elevated in response to excess Cu. We identified a new C. neoformans Cu transporter, CnCtr1, that is induced by Cu deficiency and is distinct from CnCtr4 and which shows significant phylogenetic relationship to Ctr1 from other fungi. Surprisingly, in contrast to other fungal, we found that induction of CnCTR1 and CnCTR4 expression under Cu limitation, and CMT1 and CMT2 in response to Cu excess, are dependent on the CnCuf1 Cu metalloregulatory transcription factor. These studies set the stage for the evaluation of the specific Cuf1 target genes required for virulence in C. neoformans. PMID:21819456

Ding, Chen; Yin, Jun; Tovar, Edgar Mauricio Medina; Fitzpatrick, David A.; Higgins, Desmond G.; Thiele, Dennis J.

2013-01-01

298

Connections between Alternative Transcription and Alternative Splicing in Mammals  

E-print Network

The majority of mammalian genes produce multiple transcripts resulting from alternative splicing (AS) and/or alternative transcription initiation (ATI) and alternative transcription termination (ATT). Comparative analysis ...

Spiridonov, Alexey Nikolaevich

299

A Synthetic Biology Framework for Programming Eukaryotic Transcription Functions  

E-print Network

Eukaryotic transcription factors (TFs) perform complex and combinatorial functions within transcriptional networks. Here, we present a synthetic framework for systematically constructing eukaryotic transcription functions ...

Khalil, Ahmad S.

300

EMI Independent Study Program Transcript Request Form  

E-print Network

EMI Independent Study Program Transcript Request Form A transcript of your Independent Study course Mail your request to: National Emergency Training Center EMI Independent Study Program OR Fax to: (301

Shyu, Mei-Ling

301

c-Myc regulates transcriptional pause release  

E-print Network

Recruitment of the RNA polymerase II (Pol II) transcription initiation apparatus to promoters by specific DNA-binding transcription factors is well recognized as a key regulatory step in gene expression. We report here ...

Rahl, Peter B.

302

The Transcriptional Landscape of the Mammalian Genome  

Microsoft Academic Search

This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins.

P. Carninci; T. Kasukawa; S. Katayama; J. Gough; M. C. Frith; N. Maeda; R. Oyama; T. Ravasi; B. Lenhard; C. Wells; R. Kodzius; K. Shimokawa; V. B. Bajic; S. E. Brenner; S. Batalov; A. R. R. Forrest; M. Zavolan; M. J. Davis; L. G. Wilming; V. Aidinis; J. E. Allen; A. Ambesi-Impiombato; R. Apweiler; R. N. Aturaliya; T. L. Bailey; M. Bansal; L. Baxter; K. W. Beisel; T. Bersano; H. Bono; A. M. Chalk; K. P. Chiu; V. Choudhary; A. Christoffels; D. R. Clutterbuck; M. L. Crowe; E. Dalla; B. P. Dalrymple; B. de Bono; G. Della Gatta; D. di Bernardo; T. Down; P. Engstrom; T. Fagiolini; G. Faulkner; C. F. Fletcher; T. Fukushima; M. Furuno; S. Futaki; M. Gariboldi; P. Georgii-Hemming; T. R. Gingeras; T. Gojobori; R. E. Green; S. Gustincich; M. Harbers; Y. Hayashi; T. K. Hensch; N. Hirokawa; D. Hill; L. Huminiecki; M. Iacono; K. Ikeo; A. Iwama; T. Ishikawa; M. Jakt; A. Kanapin; M. Katoh; Y. Kawasawa; J. Kelso; H. Kitamura; H. Kitano; G. Kollias; S. P. T. Krishnan; A. Kruger; S. K. Kummerfeld; I. V. Kurochkin; L. F. Lareau; D. Lazarevic; L. Lipovich; J. Liu; S. Liuni; S. McWilliam; M. Madan Babu; M. Madera; L. Marchionni; H. Matsuda; S. Matsuzawa; H. Miki; F. Mignone; S. Miyake; K. Morris; S. Mottagui-Tabar; N. Mulder; N. Nakano; H. Nakauchi; P. Ng; R. Nilsson; S. Nishiguchi; S. Nishikawa; F. Nori; O. Ohara; Y. Okazaki; V. Orlando; K. C. Pang; W. J. Pavan; G. Pavesi; G. Pesole; N. Petrovsky; S. Piazza; J. Reed; J. F. Reid; B. Z. Ring; M. Ringwald; B. Rost; Y. Ruan; S. L. Salzberg; A. Sandelin; C. Schneider; C. Schönbach; K. Sekiguchi; C. A. M. Semple; S. Seno; L. Sessa; Y. Sheng; Y. Shibata; H. Shimada; K. Shimada; D. Silva; B. Sinclair; S. Sperling; E. Stupka; K. Sugiura; R. Sultana; Y. Takenaka; K. Taki; K. Tammoja; S. L. Tan; S. Tang; M. S. Taylor; J. Tegner; S. A. Teichmann; H. R. Ueda; E. van Nimwegen; R. Verardo; C. L. Wei; K. Yagi; H. Yamanishi; E. Zabarovsky; S. Zhu; A. Zimmer; W. Hide; C. Bult; S. M. Grimmond; R. D. Teasdale; E. T. Liu; V. Brusic; J. Quackenbush; C. Wahlestedt; J. S. Mattick; D. A. Hume; C. Kai; D. Sasaki; Y. Tomaru; S. Fukuda; M. Kanamori-Katayama; M. Suzuki; J. Aoki; T. Arakawa; J. Iida; K. Imamura; M. Itoh; T. Kato; H. Kawaji; N. Kawagashira; T. Kawashima; M. Kojima; S. Kondo; H. Konno; K. Nakano; N. Ninomiya; T. Nishio; M. Okada; C. Plessy; K. Shibata; T. Shiraki; S. Suzuki; M. Tagami; K. Waki; A. Watahiki; Y. Okamura-Oho; H. Suzuki

2005-01-01

303

A unified model for yeast transcript definition.  

PubMed

Identifying genes in the genomic context is central to a cell's ability to interpret the genome. Yet, in general, the signals used to define eukaryotic genes are poorly described. Here, we derived simple classifiers that identify where transcription will initiate and terminate using nucleic acid sequence features detectable by the yeast cell, which we integrate into a Unified Model (UM) that models transcription as a whole. The cis-elements that denote where transcription initiates function primarily through nucleosome depletion, and, using a synthetic promoter system, we show that most of these elements are sufficient to initiate transcription in vivo. Hrp1 binding sites are the major characteristic of terminators; these binding sites are often clustered in terminator regions and can terminate transcription bidirectionally. The UM predicts global transcript structure by modeling transcription of the genome using a hidden Markov model whose emissions are the outputs of the initiation and termination classifiers. We validated the novel predictions of the UM with available RNA-seq data and tested it further by directly comparing the transcript structure predicted by the model to the transcription generated by the cell for synthetic DNA segments of random design. We show that the UM identifies transcription start sites more accurately than the initiation classifier alone, indicating that the relative arrangement of promoter and terminator elements influences their function. Our model presents a concrete description of how the cell defines transcript units, explains the existence of nongenic transcripts, and provides insight into genome evolution. PMID:24170600

de Boer, Carl G; van Bakel, Harm; Tsui, Kyle; Li, Joyce; Morris, Quaid D; Nislow, Corey; Greenblatt, Jack F; Hughes, Timothy R

2014-01-01

304

Super-Enhancer Transcription Converges on AID.  

PubMed

AID mis-targeting is poorly understood but contributes significantly to B cell genome instability. Two new papers in Cell reveal that AID mistargeting occurs primarily in gene bodies within a nuclear microenvironment characterized by high levels of transcriptional activity, interconnected transcriptional regulatory elements, and overlapping sense and antisense (convergent) transcription. PMID:25525869

Alinikula, Jukka; Schatz, David G

2014-12-18

305

A unified model for yeast transcript definition  

PubMed Central

Identifying genes in the genomic context is central to a cell's ability to interpret the genome. Yet, in general, the signals used to define eukaryotic genes are poorly described. Here, we derived simple classifiers that identify where transcription will initiate and terminate using nucleic acid sequence features detectable by the yeast cell, which we integrate into a Unified Model (UM) that models transcription as a whole. The cis-elements that denote where transcription initiates function primarily through nucleosome depletion, and, using a synthetic promoter system, we show that most of these elements are sufficient to initiate transcription in vivo. Hrp1 binding sites are the major characteristic of terminators; these binding sites are often clustered in terminator regions and can terminate transcription bidirectionally. The UM predicts global transcript structure by modeling transcription of the genome using a hidden Markov model whose emissions are the outputs of the initiation and termination classifiers. We validated the novel predictions of the UM with available RNA-seq data and tested it further by directly comparing the transcript structure predicted by the model to the transcription generated by the cell for synthetic DNA segments of random design. We show that the UM identifies transcription start sites more accurately than the initiation classifier alone, indicating that the relative arrangement of promoter and terminator elements influences their function. Our model presents a concrete description of how the cell defines transcript units, explains the existence of nongenic transcripts, and provides insight into genome evolution. PMID:24170600

de Boer, Carl G.; van Bakel, Harm; Tsui, Kyle; Li, Joyce; Morris, Quaid D.; Nislow, Corey; Greenblatt, Jack F.; Hughes, Timothy R.

2014-01-01

306

Electronic Transcripts: Past, Present, and Future  

ERIC Educational Resources Information Center

Electronic transcripts are no longer a concept awaiting definition. They are here to stay. Although paper transcripts remain the standard--at least in terms of volume--an ever-increasing number and eventual majority of students and alumni will expect if not require electronic transcripts. College registrars and admissions officers' obligation to…

Harris, Sarah; Hannah, Andrew; Stones, Dave; Morley, Robert

2011-01-01

307

Online Transcript Request Questions and Answers  

E-print Network

. This will update you on the status. Q. I am a Tufts Alumnus. Can I order my transcript online? A. This new system log out of SIS Online or lose my connection before entering my payment information? A. If your paymentOnline Transcript Request Questions and Answers Q. How can I order an official transcript online? A

Tufts University

308

How to Enter "Transcript/Diploma/  

E-print Network

How to Enter "Transcript/Diploma/ Certificate Mailing" Address in Python #12;Python Home Page) #12;Add Address · Click on "Add Address" #12;Transcript/Diploma/ Certificate Mailing Address · Select "Transcript/Diploma/Certificate Mailing" from drop-down menu #12;Example · Enter fields and click "submit

309

Regulatory interactions between quorum-sensing, auxin, cytokinin, and the Hrp regulon in relation to gall formation and epiphytic fitness of Pantoea agglomerans pv. gypsophilae.  

PubMed

Gall formation by Pantoea agglomerans pv. gypsophilae is controlled by hrp/hrc genes, phytohormones, and the quorum-sensing (QS) regulatory system. The interactions between these three components were investigated. Disruption of the QS genes pagI and pagR and deletion of both substantially reduced the transcription levels of the hrp regulatory genes hrpXY, hrpS, and hrpL, as determined by quantitative reverse-transcriptase polymerase chain reaction. Expression of hrpL in planta was inhibited by addition of 20 microM or higher concentrations of the QS signal C(4)-HSL. The pagR and hrpL mutants caused an equivalent reduction of 1.3 orders in bacterial multiplication on bean leaves, suggesting possible mediation of the QS effect on epiphytic fitness of P. agglomerans pv. gypsophilae by the hrp regulatory system. indole-3-acetic acid (IAA) and cytokinin significantly affected the expression of the QS and hrp regulatory genes. Transcription of pagI, pagR, hrpL, and hrpS in planta was substantially reduced in iaaH mutant (disrupted in IAA biosynthesis via the indole-3-acetamide pathway) and etz mutant (disrupted in cytokinin biosynthesis). In contrast, the ipdC mutant (disrupted in IAA biosynthesis via the indole-3-pyruvate pathway) substantially increased expression of pagI, pagR, hrpL, and hrpS. Results presented suggest the involvement of IAA and cytokinins in regulation of the QS system and hrp regulatory genes. PMID:19522567

Chalupowicz, Laura; Barash, Isaac; Panijel, Mary; Sessa, Guido; Manulis-Sasson, Shulamit

2009-07-01

310

VraT/YvqF Is Required for Methicillin Resistance and Activation of the VraSR Regulon in Staphylococcus aureus  

PubMed Central

Staphylococcus aureus infections caused by strains that are resistant to all forms of penicillin, so-called methicillin-resistant S. aureus (MRSA) strains, have become common. One strategy to counter MRSA infections is to use compounds that resensitize MRSA to methicillin. S. aureus responds to diverse classes of cell wall-inhibitory antibiotics, like methicillin, using the two-component regulatory system VraSR (vra) to up- or downregulate a set of genes (the cell wall stimulon) that presumably facilitates resistance to these antibiotics. Accordingly, VraS and VraR mutations decrease resistance to methicillin, vancomycin, and daptomycin cell wall antimicrobials. vraS and vraR are encoded together on a transcript downstream of two other genes, which we call vraU and vraT (previously called yvqF). By producing nonpolar deletions in vraU and vraT in a USA300 MRSA clinical isolate, we demonstrate that vraT is essential for optimal expression of methicillin resistance in vitro, whereas vraU is not required for this phenotype. The deletion of vraT also improved the outcomes of oxacillin therapy in mouse models of lung and skin infection. Since vraT expressed in trans did not complement a vra operon deletion, we conclude that VraT does not inactivate the antimicrobial. Genome-wide transcriptional microarray experiments reveal that VraT facilitates resistance by playing a necessary regulatory role in the VraSR-mediated cell wall stimulon. Our data prove that VraTSR comprise a novel three-component regulatory system required to facilitate resistance to cell wall agents in S. aureus. We also provide the first in vivo proof of principle for using VraT as a sole target to resensitize MRSA to ?-lactams. PMID:23070169

Yin, Shouhui; Jo, Dae Sun; Montgomery, Christopher P.; Daum, Robert S.

2013-01-01

311

KpnEF, a New Member of the Klebsiella pneumoniae Cell Envelope Stress Response Regulon, Is an SMR-Type Efflux Pump Involved in Broad-Spectrum Antimicrobial Resistance  

PubMed Central

Klebsiella pneumoniae has been frequently associated with nosocomial infections. Efflux systems are ubiquitous transporters that also function in drug resistance. Genome analysis of K. pneumoniae strain NTUH-K2044 revealed the presence of ?15 putative drug efflux systems. We discuss here for the first time the characterization of a putative SMR-type efflux pump, an ebrAB homolog (denoted here as kpnEF) with respect to Klebsiella physiology and the multidrug-resistant phenotype. Analysis of hypermucoviscosity revealed direct involvement of kpnEF in capsule synthesis. The ?kpnEF mutant displayed higher sensitivity to hyperosmotic (?2.8-fold) and high bile (?4.0-fold) concentrations. Mutation in kpnEF resulted in increased susceptibility to cefepime, ceftriaxone, colistin, erythromycin, rifampin, tetracycline, and streptomycin; mutated strains changed from being resistant to being susceptible, and the resistance was restored upon complementation. The ?kpnEF mutant displayed enhanced sensitivity toward structurally related compounds such as sodium dodecyl sulfate, deoxycholate, and dyes, including clinically relevant disinfectants such as benzalkonium chloride, chlorhexidine, and triclosan. The prevalence of kpnEF in clinical strains broadens the diversity of antibiotic resistance in K. pneumoniae. Experimental evidence of CpxR binding to the efflux pump promoter and quantification of its expression in a cpxAR mutant background demonstrated kpnEF to be a member of the Cpx regulon. This study helps to elucidate the unprecedented biological functions of the SMR-type efflux pump in Klebsiella spp. PMID:23836167

Rajamohan, Govindan

2013-01-01

312

KpnEF, a new member of the Klebsiella pneumoniae cell envelope stress response regulon, is an SMR-type efflux pump involved in broad-spectrum antimicrobial resistance.  

PubMed

Klebsiella pneumoniae has been frequently associated with nosocomial infections. Efflux systems are ubiquitous transporters that also function in drug resistance. Genome analysis of K. pneumoniae strain NTUH-K2044 revealed the presence of ?15 putative drug efflux systems. We discuss here for the first time the characterization of a putative SMR-type efflux pump, an ebrAB homolog (denoted here as kpnEF) with respect to Klebsiella physiology and the multidrug-resistant phenotype. Analysis of hypermucoviscosity revealed direct involvement of kpnEF in capsule synthesis. The ?kpnEF mutant displayed higher sensitivity to hyperosmotic (?2.8-fold) and high bile (?4.0-fold) concentrations. Mutation in kpnEF resulted in increased susceptibility to cefepime, ceftriaxone, colistin, erythromycin, rifampin, tetracycline, and streptomycin; mutated strains changed from being resistant to being susceptible, and the resistance was restored upon complementation. The ?kpnEF mutant displayed enhanced sensitivity toward structurally related compounds such as sodium dodecyl sulfate, deoxycholate, and dyes, including clinically relevant disinfectants such as benzalkonium chloride, chlorhexidine, and triclosan. The prevalence of kpnEF in clinical strains broadens the diversity of antibiotic resistance in K. pneumoniae. Experimental evidence of CpxR binding to the efflux pump promoter and quantification of its expression in a cpxAR mutant background demonstrated kpnEF to be a member of the Cpx regulon. This study helps to elucidate the unprecedented biological functions of the SMR-type efflux pump in Klebsiella spp. PMID:23836167

Srinivasan, Vijaya Bharathi; Rajamohan, Govindan

2013-09-01

313

Two functions of the C-terminal domain of Escherichia coli Rob: mediating “sequestration-dispersal” as a novel off-on switch for regulating Rob’s activity as a transcription activator and preventing degradation of Rob by Lon protease  

PubMed Central

In Escherichia coli, Rob activates transcription of the SoxRS/MarA/Rob regulon. Previous work revealed that Rob resides in 3–4 immunostainable foci, that dipyridyl and bile salts are inducers of its activity, and that inducers bind to Rob’s C-terminal domain (CTD). We propose that sequestration inactivates Rob by blocking its access to the transcriptional machinery and that inducers activate Rob by mediating its dispersal, allowing interaction with RNA polymerase. To test “sequestration-dispersal” as a new mechanism for regulating the activity of transcriptional activators, we fused Rob’s CTD to SoxS and used indirect immunofluorescence microscopy to determine the effect of inducers on SoxS-Rob’s cellular localization. Unlike native SoxS, which is uniformly distributed throughout the cell, SoxS-Rob is sequestered without inducer, but is rapidly dispersed when cells are treated with inducer. In this manner, Rob’s CTD serves as an anti-sigma factor in regulating the co-sigma factor-like activity of SoxS when fused to it. Rob’s CTD also protects its N-terminus from Lon protease, since Lon’s normally rapid degradation of SoxS is blocked in the chimera. Accordingly, Rob’s CTD has novel regulatory properties that can be bestowed on another E. coli protein. PMID:19289129

Griffith, Kevin L.; Fitzpatrick, M. Megan; Keen, Edward F.

2009-01-01

314

Effects of elongation delay in transcription dynamics.  

PubMed

In the transcription process, elongation delay is induced by the movement of RNA polymerases (RNAP) along the DNA sequence, and can result in changes in the transcription dynamics. This paper studies the transcription dynamics that involved the elongation delay and effects of cell division and DNA replication. The stochastic process of gene expression is modeled with delay chemical master equation with periodic coefficients, and is studied numerically through the stochastic simulation algorithm with delay. We show that the average transcription level approaches to a periodic dynamics over cell cycles at homeostasis, and the elongation delay can reduce the transcription level and increase the transcription noise. Moreover, the transcription elongation can induce bimodal distribution of mRNA levels that can be measured by the techniques of flow cytometry. PMID:25365608

Zhang, Xuan; Jin, Huiqin; Yang, Zhuoqin; Lei, Jinzhi

2014-12-01

315

Regulating Inducible Transcription Through Controlled Localization  

NSDL National Science Digital Library

Inducible transcription factors are key targets of many signaling pathways. Transcription of target genes by inducible transcription factors is regulated by numerous mechanisms that affect access to and affinity for target genes, interaction with coactivators, or transcriptional activity itself. Because of cytoplasmic sequestration, a subset of transcription factors are maintained inactive in unstimulated cells until the proper inducing stimulus is provided. The mechanism of cytoplasmic sequestration was originally thought to involve the masking of nuclear localization signals (NLSs) on transcription factors. However, recent reports suggest that such a static model of cytoplasmic retention is perhaps far too simple, and that these inducible transcription factors instead constantly shuttle between the cytoplasm and the nucleus. Furthermore, it has been shown that the sequestration of inducible transcription factors can be accomplished through multiple mechanisms in addition to masking of the NLSs. In this review, we discuss a few signaling pathways that illustrate mechanisms of controlling the localization of inducible transcription factors and provide a more encompassing model to explain how inducible transcription factors may be regulated by cytoplasmic sequestration.

Elizabeth C. Ziegler (Yale University School of Medicine; Section of Immunobiology and Department of Molecular Biophysics and Biochemistry REV)

2005-05-17

316

Individual and Combined Roles of the Master Regulators AphA and LuxR in Control of the Vibrio harveyi Quorum-Sensing Regulon  

PubMed Central

Bacteria use a chemical communication process called quorum sensing to control transitions between individual and group behaviors. In the Vibrio harveyi quorum-sensing circuit, two master transcription factors, AphA and LuxR, coordinate the quorum-sensing response. Here we show that AphA regulates 167 genes, LuxR regulates 625 genes, and they coregulate 77 genes. LuxR strongly controls genes at both low cell density and high cell density, suggesting that it is the major quorum-sensing regulator. In contrast, AphA is absent at high cell density and acts to fine-tune quorum-sensing gene expression at low cell density. We examined two loci as case studies of coregulation by AphA and LuxR. First, AphA and LuxR directly regulate expression of the genes encoding the quorum-regulatory small RNAs Qrr2, Qrr3, and Qrr4, the consequence of which is a specifically timed transition between the individual and the group life-styles. Second, AphA and LuxR repress type III secretion system genes but at different times and to different extents. The consequence of this regulation is that type III secretion is restricted to a peak at mid-cell density. Thus, the asymmetric production of AphA and LuxR coupled with differences in their strengths and timing of target gene regulation generate a precise temporal pattern of gene expression. PMID:23204455

van Kessel, Julia C.; Rutherford, Steven T.; Shao, Yi; Utria, Alan F.

2013-01-01

317

Structures of the Porphyromonas gingivalis OxyR regulatory domain explain differences in expression of the OxyR regulon in Escherichia coli and P. gingivalis  

PubMed Central

OxyR transcriptionally regulates Escherichia coli oxidative stress response genes through a reversibly reducible cysteine disulfide biosensor of cellular redox status. Structural changes induced by redox changes in these cysteines are conformationally transmitted to the dimer subunit interfaces, which alters dimer and tetramer interactions with DNA. In contrast to E. coli OxyR regulatory-domain structures, crystal structures of Porphyromonas gingivalis OxyR regulatory domains show minimal differences in dimer configuration on changes in cysteine disulfide redox status. This locked configuration of the P. gingivalis OxyR regulatory-domain dimer closely resembles the oxidized (activating) form of the E. coli OxyR regulatory-domain dimer. It correlates with the observed constitutive activation of some oxidative stress genes in P. gingivalis and is attributable to a single amino-acid insertion in P. gingivalis OxyR relative to E. coli OxyR. Modelling of full-length P. gingivalis, E. coli and Neisseria meningitidis OxyR–DNA complexes predicts different modes of DNA binding for the reduced and oxidized forms of each. PMID:24100327

Svintradze, David V.; Peterson, Darrell L.; Collazo-Santiago, Evys A.; Lewis, Janina P.; Wright, H. Tonie

2013-01-01

318

Identification of a p-Coumarate Degradation Regulon in Rhodopseudomonas palustris by Xpression, an Integrated Tool for Prokaryotic RNA-Seq Data Processing  

PubMed Central

High-throughput sequencing of cDNA prepared from RNA, an approach known as RNA-seq, is coming into increasing use as a method for transcriptome analysis. Despite its many advantages, widespread adoption of the technique has been hampered by a lack of easy-to-use, integrated, open-source tools for analyzing the nucleotide sequence data that are generated. Here we describe Xpression, an integrated tool for processing prokaryotic RNA-seq data. The tool is easy to use and is fully automated. It performs all essential processing tasks, including nucleotide sequence extraction, alignment, quantification, normalization, and visualization. Importantly, Xpression processes multiplexed and strand-specific nucleotide sequence data. It extracts and trims specific sequences from files and separately quantifies sense and antisense reads in the final results. Outputs from the tool can also be conveniently used in downstream analysis. In this paper, we show the utility of Xpression to process strand-specific RNA-seq data to identify genes regulated by CouR, a transcription factor that controls p-coumarate degradation by the bacterium Rhodopseudomonas palustris. PMID:22798355

Phattarasukol, Somsak; Radey, Matthew C.; Lappala, Colin R.; Oda, Yasuhiro; Hirakawa, Hidetada; Brittnacher, Mitchell J.

2012-01-01

319

Tuning the auxin transcriptional response.  

PubMed

How does auxin provoke such a diverse array of responses? This long-standing question is further complicated by a remarkably short nuclear auxin signalling pathway. To crack the auxin code, several potential sources of specificity need to be evaluated. These include: specificity of interactions among the core auxin response components, specificity resulting from higher order complex dynamics, and specificity in interactions with global factors controlling protein turnover and transcriptional repression. Here, we review recent progress towards characterizing and quantifying these interactions and highlight key gaps that remain. PMID:23630231

Pierre-Jerome, Edith; Moss, Britney L; Nemhauser, Jennifer L

2013-06-01

320

c-Myc regulates transcriptional pause release  

PubMed Central

Recruitment of the RNA Polymerase II (Pol II) transcription initiation apparatus to promoters by specific DNA binding transcription factors is well recognized as a key regulatory step in gene expression. We report here that promoter-proximal pausing is a general feature of transcription by Pol II in mammalian cells, and thus an additional step where regulation of gene expression occurs. This suggests that some transcription factors recruit the transcription apparatus to promoters, while others effect promoter-proximal pause release. Indeed, we find that the transcription factor c-Myc, a key regulator of cellular proliferation, plays a major role in Pol II pause release rather than Pol II recruitment at its target genes. We discuss the implications of these results for the role of c-Myc amplification in human cancer. PMID:20434984

Rahl, Peter B.; Lin, Charles Y.; Seila, Amy C.; Flynn, Ryan A.; McCuine, Scott; Burge, Christopher B.; Sharp, Phillip A.; Young, Richard A.

2010-01-01

321

Transcriptional factors, Mafs and their biological roles  

PubMed Central

The Maf family of transcription factors is characterized by a typical bZip structure; these transcription factors act as important regulators of the development and differentiation of many organs and tissues, including the kidney. The Maf family consists of two subgroups that are characterized according to their structure: large Maf transcription factors and small Maf transcription factors. The large Maf subgroup consists of four proteins, designated as MAFA, MAFB, c-MAF and neural retina-specific leucine zipper. In particular, MAFA is a distinct molecule that has been attracting the attention of researchers because it acts as a strong transactivator of insulin, suggesting that Maf transcription factors are likely to be involved in systemic energy homeostasis. In this review, we focused on the regulation of glucose/energy balance by Maf transcription factors in various organs.

Tsuchiya, Mariko; Misaka, Ryoichi; Nitta, Kosaku; Tsuchiya, Ken

2015-01-01

322

Transcriptional factors, Mafs and their biological roles.  

PubMed

The Maf family of transcription factors is characterized by a typical bZip structure; these transcription factors act as important regulators of the development and differentiation of many organs and tissues, including the kidney. The Maf family consists of two subgroups that are characterized according to their structure: large Maf transcription factors and small Maf transcription factors. The large Maf subgroup consists of four proteins, designated as MAFA, MAFB, c-MAF and neural retina-specific leucine zipper. In particular, MAFA is a distinct molecule that has been attracting the attention of researchers because it acts as a strong transactivator of insulin, suggesting that Maf transcription factors are likely to be involved in systemic energy homeostasis. In this review, we focused on the regulation of glucose/energy balance by Maf transcription factors in various organs. PMID:25685288

Tsuchiya, Mariko; Misaka, Ryoichi; Nitta, Kosaku; Tsuchiya, Ken

2015-02-15

323

Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum  

PubMed Central

Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have overcome the stress condition. Here we propose a model of the regulation of oxidative and heat stress response including redox homeostasis by SigH, RshA and the thioredoxin system. PMID:22943411

2012-01-01

324

Evaluation of the potential of alkylresorcinols as superoxide anion scavengers and sox-regulon modulators using nitroblue tetrazolium and bioluminescent cell-based assays.  

PubMed

The antioxidant activities of five alkylresorcinol (AR) homologs with alkyl chains of 1, 3, 5 6 and 12 carbon atoms were studied using molecular and cellular assays for superoxide anions ([Formula: see text]). The effect of ARs as superoxide anion scavengers was assessed using the photochemical reaction of spontaneous photo-reduced flavin re-oxidation. In this system, ARs reaction with [Formula: see text] produced dye derivatives, as C6- and C12-AR prevented the [Formula: see text]-induced conversion of nitroblue tetrazolium into formazan in AR-containing mixtures. The influence of ARs on soxS gene expression and bacterial cell viability was studied with the luminescent Escherichia coli K12 MG1655 psoxS'::luxCDABE-Amp(R) strain, showing low basal light emission. This increased significantly during paraquatinduced oxidative stress as a consequence of the simultaneous transcription of soxS-gene and lux-gene fusion. ARs with alkyl chains containing 5-12 carbon atoms at concentrations of 0.1-1.0 ?M weakly induced soxS-gene expression, whereas 1-10 mM repressed it. This respectively increased or decreased the bacterial cell resistance to [Formula: see text]-related oxidative stress. AR derivatives lost their protective activity from reactions with superoxide anions, which required increased soxS gene expression for cell viability. These results show the dual nature of ARs, which possess direct antioxidant properties and the ability to indirectly regulate the activity of cellular antioxidative defense mechanisms. PMID:25481248

Gryazeva, Irina V; Davydova, Olga K; Deryabin, Dmitrii G

2014-12-01

325

What are natural antisense transcripts good for?  

PubMed Central

NATs (natural antisense transcripts) are important regulators of eukaryotic gene expression. Interference between the expression of protein-coding sense transcripts and the corresponding NAT is well documented. In the present review, we focus on an additional, higher-order role of NATs that is currently emerging. The recent discovery of endogenous siRNAs (short interfering RNAs), as well as NAT-induced transcriptional gene silencing, are key to the proposed novel function of NATs. PMID:20659019

Werner, Andreas; Swan, Daniel

2014-01-01

326

Transcriptional profiling of Dictyostelium with RNA sequencing  

PubMed Central

Summary Transcriptional profiling methods have been utilized in the analysis of various biological processes in Dictyostelium. Recent advances in high-throughput sequencing have increased the resolution and the dynamic range of transcriptional profiling. Here we describe the utility of RNA-sequencing with the Illumina technology for production of transcriptional profiles. We also describe methods for data mapping and storage as well as common and specialized tools for data analysis, both online and offline. PMID:23494306

Miranda, Edward Roshan; Rot, Gregor; Toplak, Marko; Santhanam, Balaji; Curk, Tomaz; Shaulsky, Gad; Zupan, Blaz

2014-01-01

327

Driving transcriptional regulators in melanoma metastasis.  

PubMed

The progression of melanoma toward the metastatic phenotype occurs in a defined stepwise manner. While many molecular changes take place early in melanoma development, progression toward the malignant phenotype, most notably during the transition from the radial growth phase (RGP) to the vertical growth phase (VGP) involves deregulated expression of several transcription factors. For example, the switch from RGP to VGP is associated with the loss of the transcription factor AP2? and gain of transcriptional activity of cAMP-responsive element binding protein. Together with the upregulation of microphthalmia-associated transcription factor, activating transcription factor 2, nuclear factor kappa B, and other transcription factors, these changes lead to dysregulated expression or function of important cellular adhesion molecules, matrix degrading enzymes, survival factors, as well as other factors leading to metastatic melanoma. Additionally, recent evidence suggests that microRNAs and RNA editing machinery influence the expression of transcription factors or are regulated themselves by transcription factors. Many of the downstream signaling molecules regulated by transcription factors, such as protease activated receptor-1, interleukin-8, and MCAM/MUC18 represent new treatment prospects. PMID:22684365

Mobley, Aaron K; Braeuer, Russell R; Kamiya, Takafumi; Shoshan, Einav; Bar-Eli, Menashe

2012-12-01

328

Counting on co-transcriptional splicing  

PubMed Central

Splicing is the removal of intron sequences from pre-mRNA by the spliceosome. Researchers working in multiple model organisms – notably yeast, insects and mammalian cells – have shown that pre-mRNA can be spliced during the process of transcription (i.e. co-transcriptionally), as well as after transcription termination (i.e. post-transcriptionally). Co-transcriptional splicing does not assume that transcription and splicing machineries are mechanistically coupled, yet it raises this possibility. Early studies were based on a limited number of genes, which were often chosen because of their experimental accessibility. Since 2010, eight studies have used global datasets as counting tools, in order to quantify co-transcriptional intron removal. The consensus view, based on four organisms, is that the majority of splicing events take place co-transcriptionally in most cells and tissues. Here, we discuss the nature of the various global datasets and how bioinformatic analyses were conducted. Considering the broad differences in experimental approach and analysis, the level of agreement on the prevalence of co-transcriptional splicing is remarkable. PMID:23638305

2013-01-01

329

Cotranscriptionally Formed DNA:RNA Hybrids Mediate Transcription Elongation Impairment and Transcription-Associated Recombination  

Microsoft Academic Search

Genetic instability, a phenomenon relevant for developmentally regulated processes, cancer, and inherited disorders, can be induced by transcription. However, the mechanisms of transcription-associated genetic instability are not yet understood. Analysis of S. cerevisiae mutants of THO\\/TREX, a conserved eukaryotic protein complex functioning at the interface of transcription and mRNA metabolism, has provided evidence that transcription elongation impairment can cause hyperrecombination.

Pablo Huertas; Andrés Aguilera

2003-01-01

330

Dual role of the PhoP approximately P response regulator: Bacillus amyloliquefaciens FZB45 phytase gene transcription is directed by positive and negative interactions with the phyC promoter.  

PubMed

Several Bacillus strains secrete phytase, an enzyme catalyzing dephosphorylation of myo-inositol hexakisphosphate (phytate). We identified the phyC (phytase) gene from environmental Bacillus amyloliquefaciens FZB45 as a member of the phosphate starvation-inducible PhoPR regulon. In vivo and in vitro assays revealed that PhoP approximately P is essential for phyC transcription. The transcriptional start site was identified downstream of a sigmaA-like promoter region located 27 bp upstream of the probable translation ATG start codon. Inspection of the phyC promoter sequence revealed an unusual structure. The -35 and -10 regions are separated by a window of 21 bp. A pair of tandemly repeated PhoP TT(T/A/C)ACA binding boxes was located within and upstream of the -35 consensus promoter region. A single PhoP box was found within the -10 consensus promoter region. DNase I footprinting experiments performed with isolated PhoP confirmed that PhoP approximately P binds at two sites overlapping with the phyC -35 and -10 consensus promoter region. While binding of dimeric PhoP approximately P at -35 is essential for activation of the phyC promoter, binding of PhoP approximately P at -10 suppresses promoter activity. A sixfold enhancement of phyC gene expression was registered after T:G substitution of nucleotide -13 (mutant MUT13), which eliminates PhoP binding at the single PhoP box without impairing the -10 consensus sequence. Moreover, MUT13 also expressed phyC during phosphate-replete growth, suggesting that the repressing effect due to binding of PhoP approximately P at -10 was abolished. A model is presented in which transcription initiation of phyC is positively and negatively affected by the actual concentration of the PhoP approximately P response regulator. PMID:16980498

Makarewicz, Oliwia; Dubrac, Sarah; Msadek, Tarek; Borriss, Rainer

2006-10-01

331

Dual Role of the PhoP?P Response Regulator: Bacillus amyloliquefaciens FZB45 Phytase Gene Transcription Is Directed by Positive and Negative Interactions with the phyC Promoter†  

PubMed Central

Several Bacillus strains secrete phytase, an enzyme catalyzing dephosphorylation of myo-inositol hexakisphosphate (phytate). We identified the phyC (phytase) gene from environmental Bacillus amyloliquefaciens FZB45 as a member of the phosphate starvation-inducible PhoPR regulon. In vivo and in vitro assays revealed that PhoP?P is essential for phyC transcription. The transcriptional start site was identified downstream of a ?A-like promoter region located 27 bp upstream of the probable translation ATG start codon. Inspection of the phyC promoter sequence revealed an unusual structure. The ?35 and ?10 regions are separated by a window of 21 bp. A pair of tandemly repeated PhoP TT(T/A/C)ACA binding boxes was located within and upstream of the ?35 consensus promoter region. A single PhoP box was found within the ?10 consensus promoter region. DNase I footprinting experiments performed with isolated PhoP confirmed that PhoP?P binds at two sites overlapping with the phyC ?35 and ?10 consensus promoter region. While binding of dimeric PhoP?P at ?35 is essential for activation of the phyC promoter, binding of PhoP?P at ?10 suppresses promoter activity. A sixfold enhancement of phyC gene expression was registered after T:G substitution of nucleotide ?13 (mutant MUT13), which eliminates PhoP binding at the single PhoP box without impairing the ?10 consensus sequence. Moreover, MUT13 also expressed phyC during phosphate-replete growth, suggesting that the repressing effect due to binding of PhoP?P at ?10 was abolished. A model is presented in which transcription initiation of phyC is positively and negatively affected by the actual concentration of the PhoP?P response regulator. PMID:16980498

Makarewicz, Oliwia; Dubrac, Sarah; Msadek, Tarek; Borriss, Rainer

2006-01-01

332

Metabolic Regulation of IMD2 Transcription and an Unusual DNA Element That Generates Short Transcripts  

Microsoft Academic Search

Transcriptional regulation of IMD2 in yeast (Saccharomyces cerevisiae) is governed by the concentration of intracellular guanine nucleotide pools. The mechanism by which pool size is measured and transduced to the transcriptional apparatus is unknown. Here we show that DNA sequences surrounding the IMD2 initiation site constitute a repressive element (RE) involved in guanine regulation that contains a novel transcription- blocking

Katarzyna A. Kopcewicz; Thomas W. O'Rourke; Daniel Reines

2007-01-01

333

Balanced Branching in Transcription Termination  

NASA Technical Reports Server (NTRS)

The theory of stochastic transcription termination based on free-energy competition requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle but many troubling inconsistencies, most notably anomalous memory effects. These suggest that term ination has a deterministic component and may conceivably be not stochastic at all. We find that a key experiment by Wilson and von Hippel allegedly refuting deterministic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

Harrington, K. J.; Laughlin, R. B.; Liang, S.

2000-01-01

334

Balanced Branching in Transcription Termination  

E-print Network

The theory of stochastic transcription termination based on free-energy competition requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle but many troubling inconsistencies, most notably anomalous memory effects. These suggest that termination has a deterministic component and may conceivably be not stochastic at all. We find that a key experiment by Wilson and von Hippel allegedly refuting deterministic termination was an incorrectly analyzed regulatory effect of Mg2+ binding.

K. J. Harrington; R. B. Laughlin; S. Liang

2000-09-13

335

Team Tune-Up: Examining Team Transcripts  

ERIC Educational Resources Information Center

This article presents a worksheet that can be used to examine documentation of team meetings in light of goals the team has established. Materials for this worksheet include copies of team transcripts, yellow and pink highlighters, and pencils. Directions for examining team transcripts are presented.

Journal of Staff Development, 2010

2010-01-01

336

The transcriptional and signalling networks of pluripotency  

Microsoft Academic Search

Pluripotency and self-renewal are the hallmarks of embryonic stem cells. This state is maintained by a network of transcription factors and is influenced by specific signalling pathways. Current evidence indicates that multiple pluripotent states can exist in vitro. Here we review the recent advances in studying the transcriptional regulatory networks that define pluripotency, and elaborate on how manipulation of signalling

Huck-Hui Ng; M. Azim Surani

2011-01-01

337

Evolutionary Dynamics of Prokaryotic Transcriptional Regulatory Networks  

E-print Network

Evolutionary Dynamics of Prokaryotic Transcriptional Regulatory Networks M. Madan Babu1,2 *, Sarah 175 prokaryotic genomes, and predict components of the regulatory networks for these organisms. We responding to specific signals. We show that prokaryotic transcriptional regulatory networks have evolved

Babu, M. Madan

338

Transcriptional mapping in Chilo iridescent virus infections  

Microsoft Academic Search

Summary. Chilo iridescent virus (CIV) belongs to the family Iridoviridae, which are icosahedral cytoplasmic DNA viruses with large, linear, and circularly permuted genomes. Previous studies on infected-cell-specific polypeptides suggested temporal regulation of CIV gene expression. Recently, we demonstrated three temporal classes at the transcriptional level, in CIV infections of a spruce budworm cell line. We also demonstrated a transcriptional cascade

S. M. D’Costa; H. J. Yao; S. L. Bilimoria

2004-01-01

339

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA)  

E-print Network

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA) M. Schmidt, S.Fitt, C. Scott and M name in each other language.This paper details the standards identified for phonetic transcription for the development of this multi-language pronunciation dictionary are discussed, including aspects such as phonetic

Edinburgh, University of

340

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA)  

E-print Network

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA) M. Schmidt, S.Fitt, C. Scott and M name in each other language. This paper details the standards identified for phonetic transcription for the development of this multi­language pronunciation dictionary are discussed, including aspects such as phonetic

Edinburgh, University of

341

Fluctuations, Pauses, and Backtracking in DNA Transcription  

Microsoft Academic Search

Transcription is a vital stage in the process of gene expression and a major contributor to fluctuations in gene expression levels for which it is typically modeled as a single-step process with Poisson statistics. However, recent single molecule experiments raise questions about the validity of such a simple single-step picture. We present a molecular multistep model of transcription elongation that

Margaritis Voliotis; Netta Cohen; Carmen Molina-París; Tanniemola B. Liverpool

2008-01-01

342

Transcriptional activation by the tyrosine repressor protein  

Microsoft Academic Search

The TyrR protein of Escherichia coli is a dimeric ? 70-specific transcription factor containing 513 amino acid residues per subunit. It is of particular interest for several reasons. First, it bears a high degree of structural identity to a large and functionally diverse group of prokaryotic transcription factors (the NtrC superfamily), most of which are specific for ?54 promoters. Second,

Qing Bai

1998-01-01

343

RESEARCH ARTICLE Early Asymmetries in Maternal Transcript  

E-print Network

* The localization of maternal mRNAs during oogenesis plays a central role in axial specification in some insects in the localization of transcripts during oogenesis. Transcripts of the gene T.c.pangolin co-localize with the CMN at the time of their anterior localization during oogenesis and their anterior localization is dis- rupted

Averof, Michalis

344

A Bayesian Search for Transcriptional Motifs  

Microsoft Academic Search

Identifying transcription factor (TF) binding sites (TFBSs) is an important step towards understanding transcriptional regulation. A common approach is to use gaplessly aligned, experimentally supported TFBSs for a particular TF, and algorithmically search for more occurrences of the same TFBSs. The largest publicly available databases of TF binding specificities contain models which are represented as position weight matrices (PWM). There

Andrew K. Miller; Cristin G. Print; Poul M. F. Nielsen; Edmund J. Crampin; Diego di Bernardo

2010-01-01

345

Protein Synthesis: Transcription/Translation Overview  

NSDL National Science Digital Library

This animation shows the transcription process of RNA within the plant cell. Single stranded RNA moves out of the cell where it is translated into proteins. This is the first in a series of three animations on protein synthesis. The other two animations are Transcription and Translation.

346

Robustness of transcriptional regulatory program influences gene expression variability  

Microsoft Academic Search

BACKGROUND: Most genes are not affected when any transcription factor (TF) is knocked out, indicating that they have robust transcriptional regulatory program. Yet the mechanism underlying robust transcriptional regulatory program is less clear. RESULTS: Here, we studied the cause and effect of robust transcriptional regulatory program. We found that cooperative TFs in the robust transcriptional regulatory program regulate their common

Zhiming Dai; Xianhua Dai; Qian Xiang; Jihua Feng

2009-01-01

347

Transcription Factor Pathways and Congenital Heart Disease  

PubMed Central

Congenital heart disease is a major cause of morbidity and mortality throughout life. Mutations in numerous transcription factors have been identified in patients and families with some of the most common forms of cardiac malformations and arrhythmias. This review discusses factor pathways known to be important for normal heart development and how abnormalities in these pathways have been linked to morphological and functional forms of congenital heart defects. A comprehensive, current list of known transcription factor mutations associated with congenital heart disease is provided, but the review focuses primarily on three key transcription factors, Nkx2-5, GATA4, and Tbx5, and their known biochemical and genetic partners. By understanding the interaction partners, transcriptional targets, and upstream activators of these core cardiac transcription factors, additional information about normal heart formation and further insight into genes and pathways affected in congenital heart disease should result. PMID:22449847

McCulley, David J.; Black, Brian L.

2013-01-01

348

Chromosomal contact permits transcription between coregulated genes.  

PubMed

Transcription of coregulated genes occurs in the context of long-range chromosomal contacts that form multigene complexes. Such contacts and transcription are lost in knockout studies of transcription factors and structural chromatin proteins. To ask whether chromosomal contacts are required for cotranscription in multigene complexes, we devised a strategy using TALENs to cleave and disrupt gene loops in a well-characterized multigene complex. Monitoring this disruption using RNA FISH and immunofluorescence microscopy revealed that perturbing the site of contact had a direct effect on transcription of other interacting genes. Unexpectedly, this effect on cotranscription was hierarchical, with dominant and subordinate members of the multigene complex engaged in both intra- and interchromosomal contact. This observation reveals the profound influence of these chromosomal contacts on the transcription of coregulated genes in a multigene complex. PMID:24243018

Fanucchi, Stephanie; Shibayama, Youtaro; Burd, Shaun; Weinberg, Marc S; Mhlanga, Musa M

2013-10-24

349

Yeast Gal4: a transcriptional paradigm revisited  

PubMed Central

During the past two decades, the yeast Gal4 protein has been used as a model for studying transcriptional activation in eukaryotes. Many of the properties of transcriptional regulation first demonstrated for Gal4 have since been shown to be reiterated in the function of several other eukaryotic transcriptional regulators. Technological advances based on the transcriptional properties of this factor—such as the two-hybrid technology and Gal4-inducible systems for controlled gene expression—have had far-reaching influences in fields beyond transcription. In this review, we provide an updated account of Gal4 function, including data from new technologies that have been recently applied to the study of the GAL network. PMID:16670683

Traven, Ana; Jelicic, Branka; Sopta, Mary

2006-01-01

350

Gene expression in plant mitochondria: transcriptional and post-transcriptional control.  

PubMed Central

The informational content of the mitochondrial genome in plants is, although small, essential for each cell. Gene expression in these organelles involves a number of distinct transcriptional and post-transcriptional steps. The complex post-transcriptional processes of plant mitochondria such as 5' and 3' RNA processing, intron splicing, RNA editing and controlled RNA stability extensively modify individual steady-state RNA levels and influence the mRNA quantities available for translation. In this overview of the processes in mitochondrial gene expression, we focus on confirmed and potential sites of regulatory interference and discuss the evolutionary origins of the transcriptional and post-transcriptional processes. PMID:12594926

Binder, Stefan; Brennicke, Axel

2003-01-01

351

Inhibition of the electron transport strongly affects transcription and transcript levels in Arabidopsis mitochondria.  

PubMed

Mitochondrial transcription rate and RNA steady-state levels were examined in shoots of Arabidopsis seedlings. The shoots were treated with inhibitors of complex III and IV of the cytochrome pathway (CP) and with an inhibitor of the alternative oxidase (AOX) of the mitochondrial electron transport chain. The inhibition of AOX and CP complexes III and IV affected transcription and transcript levels in different ways. CP and AOX inhibitors had opposite effects. Our data support the idea that the redox state of the electron transport chain is involved in the regulation of mitochondrial gene expression at transcriptional and post-transcriptional levels. PMID:24699356

Zubo, Yan O; Potapova, Tatyana V; Yamburenko, Maria V; Tarasenko, Vladislav I; Konstantinov, Yuri M; Börner, Thomas

2014-11-01

352

Evolution of transcription networks in response to temporal fluctuations  

E-print Network

Evolution of transcription networks in response to temporal fluctuations Journal: Evolution, Evolution & Marine Biology Keywords: Population Genetics, Epistasis, Genetic Networks, Transcription Evolution: For Review Only #12;EVOLUTION OF TRANSCRIPTION NETWORKS IN RESPONSE TO TEMPORAL FLUCTUATIONS

Hespanha, João Pedro

353

Post-translational protein modification as a tool for transcription  

E-print Network

Minireview Post-translational protein modification as a tool for transcription reprogramming Author, phosphorylation, plant immunity, post- translational modification, proteasome, S-nitrosylation, transcription activator. Summary Precise modulation of transcription plays a vital role in both development

Spoel, Steven

354

Medical transcription services: the use of independent contractors  

E-print Network

Medical transcription is the act of transferring a patient's medical history and treatment from oral to written form. Medical transcription services focus on providing medical transcription to a variety of medical specialists. At this time...

Reyna, Cara Joanne

2013-02-22

355

Transcriptional control of flavonoid biosynthesis  

PubMed Central

Flavonoids are plant secondary polyphenolic metabolites and fulfil many vital biological functions, offering a valuable metabolic and genetic model for studying transcriptional control of gene expression. Arabidopsis thaliana mainly accumulates 3 types of flavonoids, including flavonols, anthocyanins, and proanthocyanidins (PAs). Flavonoid biosynthesis involves a multitude of well-characterized enzymatic and regulatory proteins. Three R2R3-MYB proteins (MYB11, MYB12, and MYB111) control flavonol biosynthesis via activating the early biosynthetic steps, whereas the production of anthocyanins and PAs requires the MYB-bHLH-WD40 (MBW) complex to activate the late biosynthetic genes. Additional regulators of flavonoid biosynthesis have recently come to light, which interact with R2R3-MYBs or bHLHs to organize or disrupt the formation of the MBW complex, leading to enhanced or compromised flavonoid production. This mini-review gives an overview of how these novel players modulate flavonoid metabolism and thus plant developmental processes and further proposes a fine-tuning mechanism to complete the complex regulatory network controlling flavonoid biosynthesis. PMID:24393776

Li, Shutian

2014-01-01

356

Nucleosomes accelerate transcription factor dissociation  

PubMed Central

Transcription factors (TF) bind DNA-target sites within promoters to activate gene expression. TFs target their DNA-recognition sequences with high specificity by binding with resident times of up to hours in vitro. However, in vivo TFs can exchange on the order of seconds. The factors that regulate TF dynamics in vivo and increase dissociation rates by orders of magnitude are not known. We investigated TF binding and dissociation dynamics at their recognition sequence within duplex DNA, single nucleosomes and short nucleosome arrays with single molecule total internal reflection fluorescence (smTIRF) microscopy. We find that the rate of TF dissociation from its site within either nucleosomes or nucleosome arrays is increased by 1000-fold relative to duplex DNA. Our results suggest that TF binding within chromatin could be responsible for the dramatic increase in TF exchange in vivo. Furthermore, these studies demonstrate that nucleosomes regulate DNA–protein interactions not only by preventing DNA–protein binding but by dramatically increasing the dissociation rate of protein complexes from their DNA-binding sites. PMID:24353316

Luo, Yi; North, Justin A.; Rose, Sean D.; Poirier, Michael G.

2014-01-01

357

Balanced Branching in Transcription Termination  

NASA Technical Reports Server (NTRS)

The theory of stochastic transcription termination based on free-energy competition [von Hippel, P. H. & Yager, T. D. (1992) Science 255,809-812 and van Hippel, P. H. & Yager, T. D. (1991) Proc. Natl. Acad. Sci. USA 88, 2307-2311] requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this balancing should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle, but do find many troubling Inconsistencies, most notably, anomalous memory effects. These effects suggest that termination has a deterministic component and may conceivably not be stochastic at all. We find that a key experiment by Wilson and von Hippel [Wilson, K. S. & von Hippel, P. H. (1994) J. Mol. Biol. 244,36-51] thought to demonstrate stochastic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

Harrington, K. J.; Laughlin, R. B.; Liang, S.

2000-01-01

358

Natural antisense transcripts of Trifolium repens dehydrins.  

PubMed

The recently described complex nature of some dehydrin-coding sequences in Trifolium repens could explain the considerable variability among transcripts originating from a single gene.1 For some of the sequences the existence of natural antisense transcripts (NAT s), which could form sense-antisense (SAS) pairs, was predicted. The present study demonstrates that cis-natural antisense transcripts of 2 dehydrin types (YnKn and YnSKn) accumulate in white clover plants subjected to treatments with polyethylene glycol (PEG), abscisic acid (ABA), and high salt concentration. The isolated YnKn cis-NAT s mapped to sequence site enriched in alternative start codons. Some of the sense-antisense pairs exhibited inverse expression with differing profiles which depended on the applied stress. A natural antisense transcript coding for an ABC F family protein (a trans-NAT ) which shares short sequence homology with YnSKn dehydrin was identified in plants subjected to salt stress. Forthcoming experiments will evaluate the impact of NAT s on transcript abundances, elucidating the role of transcriptional and post-transcriptional interferences in the regulation of dehydrin levels under various abiotic stresses. PMID:24390012

Vaseva, Irina I; Feller, Urs

2013-01-01

359

Natural antisense transcripts of Trifolium repens dehydrins  

PubMed Central

The recently described complex nature of some dehydrin-coding sequences in Trifolium repens could explain the considerable variability among transcripts originating from a single gene.1 For some of the sequences the existence of natural antisense transcripts (NATs), which could form sense-antisense (SAS) pairs, was predicted. The present study demonstrates that cis-natural antisense transcripts of 2 dehydrin types (YnKn and YnSKn) accumulate in white clover plants subjected to treatments with polyethylene glycol (PEG), abscisic acid (ABA), and high salt concentration. The isolated YnKn cis-NATs mapped to sequence site enriched in alternative start codons. Some of the sense-antisense pairs exhibited inverse expression with differing profiles which depended on the applied stress. A natural antisense transcript coding for an ABC F family protein (a trans-NAT) which shares short sequence homology with YnSKn dehydrin was identified in plants subjected to salt stress. Forthcoming experiments will evaluate the impact of NATs on transcript abundances, elucidating the role of transcriptional and post-transcriptional interferences in the regulation of dehydrin levels under various abiotic stresses. PMID:24390012

Vaseva, Irina I; Feller, Urs

2013-01-01

360

Transcriptional regulation of hepatic stellate cell activation  

PubMed Central

The hepatic stellate cell (HSC) is now well established as the key cellular element involved in the development of hepatic fibrosis and because of this there is considerable interest in establishing the molecular events that trigger and perpetuate HSC activation. HSC activation at the level of gene transcription requires the coordinated activity of several key transcriptional regulators of the HSC genome. The considerable advances that have been made in the past five years into the mechanisms by which specific families of transcription factors regulate the profibrogenic characteristics of the activated HSC are reviewed. PMID:12010897

Mann, D A; Smart, D E

2002-01-01

361

Accessorizing the human mitochondrial transcription machinery  

PubMed Central

The human genome comprises large chromosomes in the nucleus and mitochondrial DNA (mtDNA) housed in the dynamic mitochondrial network. Human cells contain up to thousands of copies of the double-stranded, circular mtDNA molecule that encodes essential subunits of the oxidative phosphorylation complexes and the rRNAs and tRNAs needed to translate these in the organelle matrix. Transcription of human mtDNA is directed by a single-subunit RNA polymerase, POLRMT, which requires two primary transcription factors, TFB2M and TFAM, to achieve basal regulation of the system. Here we review recent advances in understanding the structure and function of the primary human transcription machinery and the other factors that facilitate steps in transcription beyond initiation and provide more intricate control over the system. PMID:23632312

Bestwick, Megan L.; Shadel, Gerald S.

2013-01-01

362

Engineering transcription-based digital logic devices  

E-print Network

The goal of Synthetic Biology is to engineer systems from biological parts. One class of systems are those whose purpose is to process information. My work seeks to build transcription-based devices for use in combinational ...

Shetty, Reshma P.

2005-10-20

363

Transcriptional regulatory code of a eukaryotic genome  

NASA Astrophysics Data System (ADS)

DNA-binding transcriptional regulators interpret the genome's regulatory code by binding to specific sequences to induce or repress gene expression. Comparative genomics has recently been used to identify potential cis-regulatory sequences within the yeast genome on the basis of phylogenetic conservation, but this information alone does not reveal if or when transcriptional regulators occupy these binding sites. We have constructed an initial map of yeast's transcriptional regulatory code by identifying the sequence elements that are bound by regulators under various conditions and that are conserved among Saccharomyces species. The organization of regulatory elements in promoters and the environment-dependent use of these elements by regulators are discussed. We find that environment-specific use of regulatory elements predicts mechanistic models for the function of a large population of yeast's transcriptional regulators.

Harbison, Christopher T.; Gordon, D. Benjamin; Lee, Tong Ihn; Rinaldi, Nicola J.; Macisaac, Kenzie D.; Danford, Timothy W.; Hannett, Nancy M.; Tagne, Jean-Bosco; Reynolds, David B.; Yoo, Jane; Jennings, Ezra G.; Zeitlinger, Julia; Pokholok, Dmitry K.; Kellis, Manolis; Rolfe, P. Alex; Takusagawa, Ken T.; Lander, Eric S.; Gifford, David K.; Fraenkel, Ernest; Young, Richard A.

2004-09-01

364

Transcriptional Regulatory Networks in Saccharomyces cerevisiae  

NASA Astrophysics Data System (ADS)

We have determined how most of the transcriptional regulators encoded in the eukaryote Saccharomyces cerevisiae associate with genes across the genome in living cells. Just as maps of metabolic networks describe the potential pathways that may be used by a cell to accomplish metabolic processes, this network of regulator-gene interactions describes potential pathways yeast cells can use to regulate global gene expression programs. We use this information to identify network motifs, the simplest units of network architecture, and demonstrate that an automated process can use motifs to assemble a transcriptional regulatory network structure. Our results reveal that eukaryotic cellular functions are highly connected through networks of transcriptional regulators that regulate other transcriptional regulators.

Lee, Tong Ihn; Rinaldi, Nicola J.; Robert, François; Odom, Duncan T.; Bar-Joseph, Ziv; Gerber, Georg K.; Hannett, Nancy M.; Harbison, Christopher T.; Thompson, Craig M.; Simon, Itamar; Zeitlinger, Julia; Jennings, Ezra G.; Murray, Heather L.; Gordon, D. Benjamin; Ren, Bing; Wyrick, John J.; Tagne, Jean-Bosco; Volkert, Thomas L.; Fraenkel, Ernest; Gifford, David K.; Young, Richard A.

2002-10-01

365

A Gauss pseudospectral transcription for optimal control  

E-print Network

A pseudospectral method for solving nonlinear optimal control problems is proposed in this thesis. The method is a direct transcription that transcribes the continuous optimal control problem into a discrete nonlinear ...

Benson, David, 1978-

2005-01-01

366

The functions of natural antisense transcripts  

PubMed Central

NATs (natural antisense transcripts) are widespread in eukaryotic genomes. Experimental evidence indicates that sense and antisense transcripts interact, suggesting a role for NATs in the regulation of gene expression. On the other hand, the transcription of a gene locus in both orientations and RNA hybrid formation can also lead to transcriptional interference, trigger an immune response or induce gene silencing. Tissue-specific expression of NATs and the compartmentalization of cells ensure that the regulatory impact of NATs prevails. Consequently, NATs are now acknowledged as important modulators of gene expression. New mechanisms of action and important biological roles of NATs keep emerging, making regulatory RNAs an exciting and quickly moving area of research. PMID:23829529

Wight, Megan; Werner, Andreas

2014-01-01

367

Regulation of Transcription by Long Noncoding RNAs  

PubMed Central

Over the past decade there has been a greater understanding of genomic complexity in eukaryotes ushered in by the immense technological advances in high-throughput sequencing of DNA and its corresponding RNA transcripts. This has resulted in the realization that beyond protein-coding genes, there are a large number of transcripts that do not encode for proteins and, therefore, may perform their function through RNA sequences and/or through secondary and tertiary structural determinants. This review is focused on the latest findings on a class of noncoding RNAs that are relatively large (>200 nucleotides), display nuclear localization, and use different strategies to regulate transcription. These are exciting times for discovering the biological scope and the mechanism of action for these RNA molecules, which have roles in dosage compensation, imprinting, enhancer function, and transcriptional regulation, with a great impact on development and disease. PMID:25251851

Bonasio, Roberto; Shiekhattar, Ramin

2014-01-01

368

Transcriptional FIdelity of RNA Polymerase II  

E-print Network

misreadings in which transcription errors, particularly insertions that cause frameshifts, have been implicated in age related diseases such as Alzheimer's. The preliminary results of this research have shown that this in vivo fidelity assay provides a valid...

O'Brien, Erin L.

2010-07-14

369

Single-molecule analysis of transcription factor binding at transcription sites in live cells.  

PubMed

Although numerous live-cell measurements have shown that transcription factors (TFs) bind chromatin transiently, no measurements of transient binding have been reported at the endogenous response elements (REs) where transcription is normally induced. Here we show that at endogenous REs the transcriptionally productive specific binding of two TFs, p53 and the glucocorticoid receptor (GR), is transient. We also find that the transient residence times of GR at endogenous REs are roughly comparable to those at an artificial, multi-copy array of gene regulatory sites, supporting the use of multi-copy arrays for live-cell analysis of transcription. Finally, we find that at any moment only a small fraction of TF molecules are engaged in transcriptionally productive binding at endogenous REs. The small fraction of bound factors provides one explanation for gene bursting and it also indicates that REs may often be unoccupied, resulting in partial responses to transcriptional signals. PMID:25034201

Morisaki, Tatsuya; Müller, Waltraud G; Golob, Nicole; Mazza, Davide; McNally, James G

2014-01-01

370

Single molecule analysis of transcription factor binding at transcription sites in live cells  

PubMed Central

Although numerous live-cell measurements have shown that transcription factors bind chromatin transiently, no measurements of transient binding have been reported at the endogenous response elements (REs) where transcription is normally induced. Here we show that at endogenous REs, the transcriptionally productive specific binding of p53 and of the glucocorticoid receptor (GR) is transient. We also find residence times roughly comparable to that of endogenous GR REs at an artificial, multi-copy array of gene regulatory sites, supporting the use of multi-copy arrays for live-cell analysis of transcription. Finally, we find that at any moment only a small fraction of TF molecules are engaged in transcriptionally productive binding at endogenous REs. The small fraction of bound factors provides one explanation for gene bursting and it also indicates that REs may often be unoccupied, resulting in partial responses to transcriptional signals. PMID:25034201

Morisaki, Tatsuya; Müller, Waltraud G.; Golob, Nicole; Mazza, Davide; McNally, James G.

2014-01-01

371

Identification of a transcript release activity acting on ternary transcription complexes containing murine RNA polymerase I.  

PubMed Central

Termination of mammalian ribosomal gene transcription by RNA polymerase I (Pol I) requires binding of the nucleolar factor TTF-I (transcription termination factor for Pol I) to specific rDNA terminator elements. We have used recombinant murine TTF-I in an immobilized tailed template assay to analyze individual steps of the termination reaction. We demonstrate that, besides the TTF-I-DNA complex which stops elongating Pol I, an additional activity is required to release both the nascent transcript and Pol I from the template. Moreover, transcript release, but not TTF-I-directed pausing, depends on upstream sequences directly flanking the terminator element. Together, complete termination of Pol I transcription requires TTF-I bound to the terminator DNA, a stretch of thymidine residues upstream of the TTF-I-mediated pause site and an activity which releases the RNA transcript and Pol I from the DNA template. PMID:9009277

Mason, S W; Sander, E E; Grummt, I

1997-01-01

372

Common themes in translational and transcriptional regulation.  

PubMed

How transcription and translation initiation complexes are assembled and regulated has been the subject of research for many years. New information on the translation initiation complex has revealed similarities between its organization and regulation with that of the transcription initiation complex. Here, we will summarize these similarities in order to set up a framework for future integration of results from each of these areas. PMID:9204702

Sachs, A B; Buratowski, S

1997-06-01

373

Transcriptional Regulation of Heart Valve Progenitor Cells  

Microsoft Academic Search

The development and normal function of the heart valves requires complex interactions among signaling molecules, transcription\\u000a factors and structural proteins that are tightly regulated in time and space. Here we review the roles of critical transcription\\u000a factors that are required for specific aspects of normal valve development. The early progenitors of the heart valves are\\u000a localized in endocardial cushions that

Santanu Chakraborty; Michelle D. Combs; Katherine E. Yutzey

2010-01-01

374

Unfolding the Bridge between Transcription and Translation  

PubMed Central

Transcription antiterminator RfaH alternates between closed (inactive) and open (activated) conformation. In this issue of Cell, Burmann et al. show that opening is accompanied by dramatic all-? to all-? refolding of its C-terminal domain. Each of the folds has a distinct function: all-?-fold acts as a specificity determinant, directing RfaH to a small subset of operons, whereas the all-?-fold recruits ribosome, thereby coupling RfaH-stimulated transcription to translation. PMID:22817886

Svetlov, Vladimir; Nudler, Evgeny

2013-01-01

375

Transcriptional control of epidermal specification and differentiation  

PubMed Central

Recent experiments reveal the role of transcription factors in integrating upstream signals to execute specification and differentiation of epidermal cells. Based on the skin phenotype observed with misregulation of transcription factors such as p63, c-Myc, RelA, pRb, Klf4 and others, their function in controlling proliferation and differentiation is dissected. Understanding the pathways regulated by these factors and their coordinate interactions remains a challenge for the future. PMID:15380238

Dai, Xing; Segre, Julia A

2010-01-01

376

Aft2, a Novel Transcription Regulator, Is Required for Iron Metabolism, Oxidative Stress, Surface Adhesion and Hyphal Development in Candida albicans  

PubMed Central

Morphological transition and iron metabolism are closely relevant to Candida albicans pathogenicity and virulence. In our previous study, we demonstrated that C. albicans Aft2 plays an important role in ferric reductase activity and virulence. Here, we further explored the roles of C. albicans Aft2 in numerous cellular processes. We found that C. albicans Aft2 exhibited an important role in iron metabolism through bi-directional regulation effects on iron-regulon expression. Deletion of AFT2 reduced cellular iron accumulation under iron-deficient conditions. Furthermore, both reactive oxygen species (ROS) generation and superoxide dismutase (SOD) activity were remarkably increased in the aft2?/? mutant, which were thought to be responsible for the defective responses to oxidative stress. However, we found that over-expression of C. albicans AFT2 under the regulation of the strong PGK1 promoter could not effectively rescue Saccharomyces cerevisiae aft1? mutant defects in some cellular processes, such as cell-wall assembly, ion homeostasis and alkaline resistance, suggesting a possibility that C. albicans Aft2 weakened its functional role of regulating some cellular metabolism during the evolutionary process. Interestingly, deletion of AFT2 in C. albicans increased cell surface hydrophobicity, cell flocculation and the ability of adhesion to polystyrene surfaces. In addition, our results also revealed that C. albicans Aft2 played a dual role in regulating hypha-specific genes under solid and liquid hyphal inducing conditions. Deletion of AFT2 caused an impaired invasive growth in solid medium, but an increased filamentous aggregation and growth in liquid conditions. Moreover, iron deficiency and environmental cues induced nuclear import of Aft2, providing additional evidence for the roles of Aft2 in transcriptional regulation. PMID:23626810

Xu, Ning; Cheng, Xinxin; Yu, Qilin; Qian, Kefan; Ding, Xiaohui; Liu, Ruming; Zhang, Biao; Xing, Laijun; Li, Mingchun

2013-01-01

377

WhiB7, an Fe-S-dependent transcription factor that activates species-specific repertoires of drug resistance determinants in actinobacteria.  

PubMed

WhiB-like (Wbl) proteins are well known for their diverse roles in actinobacterial morphogenesis, cell division, virulence, primary and secondary metabolism, and intrinsic antibiotic resistance. Gene disruption experiments showed that three different Actinobacteria (Mycobacterium smegmatis, Streptomyces lividans, and Rhodococcus jostii) each exhibited a different whiB7-dependent resistance profile. Heterologous expression of whiB7 genes showed these resistance profiles reflected the host's repertoire of endogenous whiB7-dependent genes. Transcriptional activation of two resistance genes in the whiB7 regulon, tap (a multidrug transporter) and erm(37) (a ribosomal methyltransferase), required interaction of WhiB7 with their promoters. Furthermore, heterologous expression of tap genes isolated from Mycobacterium species demonstrated that divergencies in drug specificity of homologous structural proteins contribute to the variation of WhiB7-dependent drug resistance. WhiB7 has a specific tryptophan/glycine-rich region and four conserved cysteine residues; it also has a peptide sequence (AT-hook) at its C terminus that binds AT-rich DNA sequence motifs upstream of the promoters it activates. Targeted mutagenesis showed that these motifs were required to provide antibiotic resistance in vivo. Anaerobically purified WhiB7 from S. lividans was dimeric and contained 2.1 ± 0.3 and 2.2 ± 0.3 mol of iron and sulfur, respectively, per protomer (consistent with the presence of a 2Fe-2S cluster). However, the properties of the dimer's absorption spectrum were most consistent with the presence of an oxygen-labile 4Fe-4S cluster, suggesting 50% occupancy. These data provide the first insights into WhiB7 iron-sulfur clusters as they exist in vivo, a major unresolved issue in studies of Wbl proteins. PMID:24126912

Ramón-García, Santiago; Ng, Carol; Jensen, Pernille R; Dosanjh, Manisha; Burian, Jan; Morris, Rowan P; Folcher, Marc; Eltis, Lindsay D; Grzesiek, Stephan; Nguyen, Liem; Thompson, Charles J

2013-11-29

378

A Non-Classical LysR-Type Transcriptional Regulator PA2206 Is Required for an Effective Oxidative Stress Response in Pseudomonas aeruginosa  

PubMed Central

LysR-type transcriptional regulators (LTTRs) are emerging as key circuit components in regulating microbial stress responses and are implicated in modulating oxidative stress in the human opportunistic pathogen Pseudomonas aeruginosa. The oxidative stress response encapsulates several strategies to overcome the deleterious effects of reactive oxygen species. However, many of the regulatory components and associated molecular mechanisms underpinning this key adaptive response remain to be characterised. Comparative analysis of publically available transcriptomic datasets led to the identification of a novel LTTR, PA2206, whose expression was altered in response to a range of host signals in addition to oxidative stress. PA2206 was found to be required for tolerance to H2O2 in vitro and lethality in vivo in the Zebrafish embryo model of infection. Transcriptomic analysis in the presence of H2O2 showed that PA2206 altered the expression of 58 genes, including a large repertoire of oxidative stress and iron responsive genes, independent of the master regulator of oxidative stress, OxyR. Contrary to the classic mechanism of LysR regulation, PA2206 did not autoregulate its own expression and did not influence expression of adjacent or divergently transcribed genes. The PA2214-15 operon was identified as a direct target of PA2206 with truncated promoter fragments revealing binding to the 5?-ATTGCCTGGGGTTAT-3? LysR box adjacent to the predicted ?35 region. PA2206 also interacted with the pvdS promoter suggesting a global dimension to the PA2206 regulon, and suggests PA2206 is an important regulatory component of P. aeruginosa adaptation during oxidative stress. PMID:23382903

Mooij, Marlies J.; O'Gara, Fergal

2013-01-01

379

Transcriptional analysis of human zeta globin genes.  

PubMed Central

The human embryonic alpha-like globin gene (zeta) and a closely linked pseudogene (psi zeta) are located on chromosome 16. The psi zeta gene has a nonsense mutation in exon 1 but has identical promoter sequence and RNA processing sites to the zeta gene, raising the possibility that both psi zeta and zeta are transcriptionally active. We have studied transcription of the human zeta and psi zeta genes in a number of systems to examine their cell type specificity and enhancer requirement. (i) Cloned zeta and psi zeta genes transfected into human HeLa or monkey Cos7 tissue culture cells show no transcriptional activity. The presence of an SV40 enhancer does not activate the zeta promoter except at low levels when in very close proximity (less than 50 bp from the CCAAT box). (ii) In contrast to other tissue-specific genes tested to date, both zeta and psi zeta gene promoters initiate transcription efficiently when micro-injected into Xenopus oocyte nuclei. We suggest that embryonic-specific factors in the oocyte may permit efficient zeta gene transcription. Furthermore, the zeta promoter sequence from - 111 to + 38 bp is sufficient for transcription in this system. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6745241

Proudfoot, N J; Rutherford, T R; Partington, G A

1984-01-01

380

Drosophila Sal and Salr are transcriptional repressors.  

PubMed

The SALL (Spalt-like) family of zinc-finger transcription factors is conserved in metazoans. In Drosophila Sal (Spalt) and Salr (Spalt-related) control the expression of genes involved in wing and central nervous system development, including cell adhesion and cytoskeletal proteins. In humans, SALL mutations associate with congenital disorders such as the Townes-Brocks and Okihiro syndromes. Human and Drosophila SALL proteins are modified by SUMO (small ubiquitin-related modifier), which influences their subnuclear localization. In the present study, we have analysed the transcriptional activity of Drosophila Sall proteins in cultured cells. We show that both Sal and Salr act as transcriptional repressors in Drosophila cells where they repress transcription through an AT-rich sequence. Furthermore, using the UAS/Gal4 heterologous system, Drosophila Sal and Salr repress transcription in human cells. Under our experimental conditions, only in the case of Salr is the repression activity dependent on the HDAC (histone deacetylase) complex. This complex might interact with the C-terminal zinc fingers of Salr. We describe the differential subcellular localizations of Sal and Salr fragments and identify their repression domains. Surprisingly, both repressors also contain transcription activation domains. In addition, under our experimental conditions SUMOylation has differential effects on Sal and Salr repressor activity. Phylogenetic comparison between nematodes, insects and vertebrates identifies conserved peptide sequences that are presumably critical for SALL protein function. PMID:21689070

Sánchez, Jonatan; Talamillo, Ana; González, Monika; Sánchez-Pulido, Luis; Jiménez, Silvia; Pirone, Lucia; Sutherland, James D; Barrio, Rosa

2011-09-15

381

Transcriptional proofreading in dense RNA polymerase traffic  

NASA Astrophysics Data System (ADS)

The correction of errors during transcription involves the diffusive backward translocation (backtracking) of RNA polymerases (RNAPs) on the DNA. A trailing RNAP on the same template can interfere with backtracking as it progressively restricts the space that is available for backward translocation and thereby ratchets the backtracked RNAP forward. We analyze the resulting negative impact on proofreading theoretically using a driven lattice gas model of transcription under conditions of dense RNAP traffic. The fraction of errors that are corrected is calculated exactly for the case of a single RNAP; for multi-RNAP transcription, we use simulations and an analytical approximation and find a decrease with increasing traffic density. Moreover, we ask how the parameters of the system have to be set to keep down the impact of the interference of a trailing RNAP. Our analysis uncovers a surprisingly simple picture of the design of the error correction system: its efficiency is essentially determined by the rate for the initial backtracking step, while the value of the cleavage rate ensures that the correction mechanism remains efficient at high transcription rates. Finally, we argue that our analysis can also be applied to cases with transcription-translation coupling where the leading ribosome on the transcript assumes the role of the trailing RNAP.

Sahoo, Mamata; Klumpp, Stefan

2011-12-01

382

Overlapping pathways dictate termination of RNA polymerase II transcription  

Microsoft Academic Search

While it has long been appreciated that regulation of transcription initiation is vital to sustain dynamic gene expression, recent findings suggest that the control of transcription termination is equally important. Besides serving to avoid interference with downstream genes, transcription termination is a crucial determinant for the fate of the newly synthesized transcript through its intimate coupling to RNA 3?-end formation.

Søren Lykke-Andersen; Torben Heick Jensen

2007-01-01

383

Widespread anti-sense transcription in apple is correlated with siRNA production and indicates a large potential for transcriptional and/or post-transcriptional control.  

PubMed

Characterizing the transcriptome of eukaryotic organisms is essential for studying gene regulation and its impact on phenotype. The realization that anti-sense (AS) and noncoding RNA transcription is pervasive in many genomes has emphasized our limited understanding of gene transcription and post-transcriptional regulation. Numerous mechanisms including convergent transcription, anti-correlated expression of sense and AS transcripts, and RNAi remain ill-defined. Here, we have combined microarray analysis and high-throughput sequencing of small RNAs (sRNAs) to unravel the complexity of transcriptional and potential post-transcriptional regulation in eight organs of apple (Malus × domestica). The percentage of AS transcript expression is higher than that identified in annual plants such as rice and Arabidopsis thaliana. Furthermore, we show that a majority of AS transcripts are transcribed beyond 3'UTR regions, and may cover a significant portion of the predicted sense transcripts. Finally we demonstrate at a genome-wide scale that anti-sense transcript expression is correlated with the presence of both short (21-23 nt) and long (> 30 nt) siRNAs, and that the sRNA coverage depth varies with the level of AS transcript expression. Our study provides a new insight on the functional role of anti-sense transcripts at the genome-wide level, and a new basis for the understanding of sRNA biogenesis in plants. PMID:24690119

Celton, Jean-Marc; Gaillard, Sylvain; Bruneau, Maryline; Pelletier, Sandra; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Navarro, Lionel; Laurens, François; Renou, Jean-Pierre

2014-07-01

384

Beyond Transcription Factors: The Role of Chromatin Modifying Enzymes in Regulating Transcription Required for Memory  

ERIC Educational Resources Information Center

One of the alluring aspects of examining chromatin modifications in the role of modulating transcription required for long-term memory processes is that these modifications may provide transient and potentially stable epigenetic marks in the service of activating and/or maintaining transcriptional processes. These, in turn, may ultimately…

Barrett, Ruth M.; Wood, Marcelo A.

2008-01-01

385

Computational inference of transcriptional regulatory networks from expression profiling and transcription factor binding site identification  

Microsoft Academic Search

We have developed a computational method for transcriptional regulatory network inference, CARRIE (Computational Ascertainment of Regu- latory Relationships Inferred from Expression), which combines microarray and promoter sequence analysis. CARRIE uses sources of data to identify the transcription factors (TFs) that regulate gene expression changes in response to a stimulus and generates testable hypotheses about the regulatory network connecting these TFs

Peter M. Haverty; Ulla Hansen; Zhiping Weng

2004-01-01

386

Tobacco Transcription Factors: Novel Insights into Transcriptional Regulation in the Solanaceae1[C][W][OA  

E-print Network

Tobacco Transcription Factors: Novel Insights into Transcriptional Regulation in the Solanaceae1[C and Communication (T.W.L.), University of Virginia, Charlottesville, Virginia 22908 Tobacco (Nicotiana tabacum performed an in silico analysis of 1.15 million gene-space sequence reads from the tobacco nuclear genome

Timko, Michael

387

High School Transcript Programs Application (These transcript programs are NOT open to NCAA athletes.)  

E-print Network

High School Transcript Programs Application (These transcript programs are NOT open to NCAA:____________________________________________________ If you heard about our program in another way, please specify: High School Information: Have you ever attended high school (grades 9-12) previously? yes no If yes, in which were you enrolled? Public School

Olsen Jr., Dan R.

388

Automatic audio and manual transcripts alignment, time-code transfer and selection of exact transcripts  

E-print Network

Automatic audio and manual transcripts alignment, time-code transfer and selection of exact focuses on automatic processing of sibling resources of audio and written documents, such as available in audio archives or for parliament debates: written texts are close but not exact audio transcripts

Boula de Mareüil, Philippe

389

The evolution of transcriptional regulation in eukaryotes  

NASA Technical Reports Server (NTRS)

Gene expression is central to the genotype-phenotype relationship in all organisms, and it is an important component of the genetic basis for evolutionary change in diverse aspects of phenotype. However, the evolution of transcriptional regulation remains understudied and poorly understood. Here we review the evolutionary dynamics of promoter, or cis-regulatory, sequences and the evolutionary mechanisms that shape them. Existing evidence indicates that populations harbor extensive genetic variation in promoter sequences, that a substantial fraction of this variation has consequences for both biochemical and organismal phenotype, and that some of this functional variation is sorted by selection. As with protein-coding sequences, rates and patterns of promoter sequence evolution differ considerably among loci and among clades for reasons that are not well understood. Studying the evolution of transcriptional regulation poses empirical and conceptual challenges beyond those typically encountered in analyses of coding sequence evolution: promoter organization is much less regular than that of coding sequences, and sequences required for the transcription of each locus reside at multiple other loci in the genome. Because of the strong context-dependence of transcriptional regulation, sequence inspection alone provides limited information about promoter function. Understanding the functional consequences of sequence differences among promoters generally requires biochemical and in vivo functional assays. Despite these challenges, important insights have already been gained into the evolution of transcriptional regulation, and the pace of discovery is accelerating.

Wray, Gregory A.; Hahn, Matthew W.; Abouheif, Ehab; Balhoff, James P.; Pizer, Margaret; Rockman, Matthew V.; Romano, Laura A.

2003-01-01

390

Transcriptional repression: conserved and evolved features  

PubMed Central

Regulation of gene expression by transcriptional repression represents an ancient and conserved mechanism that manifests itself in diverse forms. Here we summarize conserved pathways for transcriptional repression prevalent throughout all forms of life, as well as indirect mechanisms that appear to have originated in eukaryotes, consistent with their unique chromatin environment. The direct interactions between transcriptional repressors and core machinery in bacteria and archaea are sufficient to generate a sophisticated suite of mechanisms that provide flexible control. These direct interactions contrast with the activity of corepressors, which provide an additional regulatory control in eukaryotes. Their modulation of chromatin structure represents an indirect pathway to downregulate transcription, and their diversity and modulation provides additional complexity suited to the requirements of elaborate eukaryotic repression patterns. New findings indicate that corepressors are not necessarily restricted to generating a single stereotypic output, but can rather exhibit diverse functional responses depending on the context in which they are recruited, providing a hitherto unsuspected additional source of diversity in transcriptional control. Mechanisms within eukaryotes appear to be highly conserved, with novel aspects chiefly represented by addition of lineage- specific corepressor scaffolds that provide additional opportunities for recruiting the same core machinery. PMID:20833321

Payankaulam, Sandhya; Li, Li M.; Arnosti, David N.

2010-01-01

391

Mapping of Digitaria streak virus transcripts reveals different RNA species from the same transcription unit.  

PubMed Central

All, except 19 [corrected] bp, of the Digitaria streak virus (DSV) genome is transcribed. Two RNA transcripts (1+ and 2+) are encoded by the virion DNA strand and up to five (1- to 5-) by the complementary DNA strand [corrected]. Detailed mapping of these RNAs has revealed evidence for splicing in one species (RNA 4-), which together with its more abundant unspliced counterpart (RNA 2-) could synthesize both a 30.5 and 41 kd polypeptide from the same transcription unit. This extensive overlapping of spliced and unspliced RNAs could indicate that the initiation and splicing of transcripts is temporally regulated. At least one transcript (RNA 1-) may have a non-translational role. Transcription of the DSV genome shows similarities to some animal DNA viruses, particularly the papovaviruses. Images PMID:2472960

Accotto, G P; Donson, J; Mullineaux, P M

1989-01-01

392

Transcription-generated torsional stress destabilizes nucleosomes  

PubMed Central

As RNA Polymerase II (Pol II) transcribes a gene, it encounters an array of well-ordered nucleosomes. How it traverses through this array in vivo remains unresolved. One model proposes that torsional stress generated during transcription destabilizes nucleosomes ahead of Pol II. Here, we describe a method for high resolution mapping of underwound DNA using next-generation sequencing, and show that torsion is correlated with gene expression in Drosophila melanogaster cells. Accumulation of torsional stress, through topoisomerase inhibition, results in increased. Pol II at transcription start sites. Whereas Topo I inhibition results in increased nascent RNA transcripts, Topo II inhibition shows little change. Despite the different effects on Pol II elongation, topoisomerase inhibition results in increased nucleosome turnover and salt solubility within gene bodies, suggesting that the elongation-independent effects of torsional stress on nucleosome dynamics contributes to the destabilization of nucleosomes. PMID:24317489

Teves, Sheila S.; Henikoff, Steven

2013-01-01

393

Transcriptional Regulatory Elements in Fungal Secondary Metabolism  

PubMed Central

Filamentous fungi produce a variety of secondary metabolites of diverse beneficial and detrimental activities to humankind. The genes encoding the enzymatic machinery required to make these metabolites are typically clustered in fungal genomes. There is considerable evidence that secondary metabolite gene regulation is, in part, by transcriptional control through hierarchical levels of transcriptional regulatory elements involved in secondary metabolite cluster regulation. Identification of secondary metabolism regulatory elements could potentially provide a means of increasing production of beneficial metabolites, decreasing production of detrimental metabolites, aid in the identification of ‘silent’ natural products and also contribute to a broader understanding of molecular mechanisms by which secondary metabolites are produced. This review summarizes regulation of secondary metabolism associated on transcriptional regulatory elements from a broad view as well as tremendous advances in discovery of cryptic or novel secondary metabolites by genomic mining in the basis of this knowledge. PMID:21717315

Yin, Wenbing; Keller, Nancy P.

2013-01-01

394

Transcription of telomere repeats in protozoa.  

PubMed Central

The telomerically located variant cell surface glycoprotein (VSG) gene expression sites of the protozoan parasite Trypanosoma brucei are transcribed by an unusual alpha-amanitin resistant RNA polymerase. We show that the telomere GGGTTA repeats located at the chromosome ends of T. brucei and the related protozoan T. equiperdum are also transcribed by alpha-amanitin resistant RNA polymerases. This transcription predominantly proceeds unidirectionally towards the end of the chromosome, in both bloodstream and insect form trypanosomes and results in the generation of heterogeneously sized steady state RNA. We postulate that telomere repeat transcription results from readthrough downstream of telomeric genes. Telomere repeat transcription was found in all seven protozoan species tested, but was alpha-amanitin resistant only in trypanosome species which exhibited antigenic variation. The data indicate that in some trypanosome species a subset of telomeres is transcribed by a different type of RNA polymerase. Images PMID:2511008

Rudenko, G; Van der Ploeg, L H

1989-01-01

395

Z-DNA in transcriptionally active chromosomes.  

PubMed Central

Due to the striking correlation between the distribution of transcriptionally active subdivisions of the polytene chromosomes and Z-DNA, we have addressed the question of whether the Z-DNA configuration exists in native, transcriptionally active chromosomes of Drosophila hydei prepared without interference by procedures known to induce the B to Z conformation. Our experiments indicate that Z-DNA forms are present in a specific set of sites on the native chromosomes. They occur on interbands and other subdivisions of dispersed DNA, but there is no correlation between the amount of Z-DNA detected and DNA compaction. The results suggest, moreover, that Z-DNA forms are restricted to specific genes, because various subdivisions induced to transcription in puffs show different patterns of Z-DNA. We show, in addition, that removal of chromosomal proteins by proteinase K has a strong influence on the level of anti-Z-DNA reactivity. Images PMID:3470742

Lancillotti, F; Lopez, M C; Arias, P; Alonso, C

1987-01-01

396

Altered transcription in yeast expressing expanded polyglutamine  

PubMed Central

Expanded polyglutamine tracts are responsible for at least eight fatal neurodegenerative diseases. In mouse models, proteins with expanded polyglutamine cause transcriptional dysregulation before onset of symptoms, suggesting that this dysregulation may be an early event in polyglutamine pathogenesis. Transcriptional dysregulation and cellular toxicity may be due to interaction between expanded polyglutamine and the histone acetyltransferase CREB-binding protein. To determine whether polyglutamine-mediated transcriptional dysregulation occurs in yeast, we expressed polyglutamine tracts in Saccharomyces cerevisiae. Gene expression profiles were determined for strains expressing either a cytoplasmic or nuclear protein with 23 or 75 glutamines, and these profiles were compared to existing profiles of mutant yeast strains. Transcriptional induction of genes encoding chaperones and heat-shock factors was caused by expression of expanded polyglutamine in either the nucleus or cytoplasm. Transcriptional repression was most prominent in yeast expressing nuclear expanded polyglutamine and was similar to profiles of yeast strains deleted for components of the histone acetyltransferase complex Spt/Ada/Gcn5 acetyltransferase (SAGA). The promoter from one affected gene (PHO84) was repressed by expanded polyglutamine in a reporter gene assay, and this effect was mitigated by the histone deacetylase inhibitor, Trichostatin A. Consistent with an effect on SAGA, nuclear expanded polyglutamine enhanced the toxicity of a deletion in the SAGA component SPT3. Thus, an early component of polyglutamine toxicity, transcriptional dysregulation, is conserved in yeast and is pharmacologically antagonized by a histone deacetylase inhibitor. These results suggest a therapeutic approach for treatment of polyglutamine diseases and provide the potential for yeast-based screens for agents that reverse polyglutamine toxicity. PMID:11687606

Hughes, Robert E.; Lo, Russell S.; Davis, Colleen; Strand, Andrew D.; Neal, Cassandra L.; Olson, James M.; Fields, Stanley

2001-01-01

397

Sex allocation and population structure in apicomplexan (protozoa) parasites.  

PubMed Central

Establishing the selfing, rate of parasites is important for studies in clinical and epidemiological medicine as well as evolutionary biology Sex allocation theory offers a relatively cheap and easy way to estimate selfing rates in natural parasite populations. Local mate competition (LMC) theory predicts that the optimal sex ratio (r*; defined as proportion males) is related to the selfing rate (s) by the equation r* = (1-s)/2. In this paper, we generalize the application of sex allocation theory across parasitic protozoa in the phylum Apicomplexa. This cosmopolitan phylum consists entirely of parasites, and includes a number of species of medical and veterinary importance. We suggest that LMC theory should apply to eimeriorin intestinal parasites. As predicted, data from 13 eimeriorin species showed a female-biased sex ratio, with the sex ratios suggesting high levels of selfing (0.8-1.0). Importantly, our estimate of the selfing rate in one of these species, Toxoplasma gondii, is in agreement with previous genetic analyses. In contrast, we predict that LMC theory will not apply to the groups in which syzygy occurs (adeleorins, gregarines and piroplasms). Syzygy occurs when a single male gametocyte and a single female gametocyte pair together physically or in close proximity, just prior to fertilization. As predicted, data from four adeleorin species showed sex ratios not significantly different from 0.5. PMID:10714880

West, S A; Smith, T G; Read, A F

2000-01-01

398

Requesting a Tax Return Transcript A tax return transcript is the formatted record of a tax return filed with the IRS. The IRS makes tax return transcripts  

E-print Network

Requesting a Tax Return Transcript A tax return transcript is the formatted record of a tax return filed with the IRS. The IRS makes tax return transcripts available to individuals that request it free applications to confirm information provided. A school may request a student's or parents' Tax Return

Kostic, Milivoje M.

399

Transcription factors for dental stem cell differentiation.  

PubMed

Dental stem cells are excellent for oral and craniofacial tissue engineering. A profound knowledge about molecular processes in dental stem cells is necessary to create treatment approaches in oral medicine. Transcription factors regulate gene expression and provide decisive information for cellular functions. In recent years, the authors have investigated transcriptomes in dental stem cells before and after osteogenic differentiation. The present paper reports on the potential role of selected transcription factors, including ZBTB16, TP53, and SP1, in dental stem cell differentiation. This review discusses putative molecular processes in dental stem cells and summarizes the current knowledge. PMID:24278957

Viale-Bouroncle, Sandra; Felthaus, Oliver; Schmalz, Gottfried; Reichert, Torsten E; Morsczeck, Christian

2013-01-01

400

HIV transcription is induced with cell killing  

SciTech Connect

In this report, we demonstrate that this induction of HIV-LTR transcription occurs when stably transfected HeLa cells are exposed to agents which mediate cell killing, such as UV radiation, electroporation of sucrose buffer, prolonged heating, and low and high pH. Cells cultured following UV exposure demonstrated a peak in CAT expression that is evident in viable (but not necessarily cell division-competent) cells 24 h after exposure; this inductive response continued until at least 72 h after exposure. HIV-LTR induction was dose-dependent, and the amount of CAT transcription induced was correlated with the amount of cell killing that occurred in the culture.

Woloschak, G.E.; Schreck, S.; Chang-Liu, Chin-Mei [Argonne National Lab., IL (United States); Panozzo, J.; Libertin, C.R. [Loyola Univ. Medical Center, Maywood, IL (United States)

1993-11-01