These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Comparative genomics and evolution of regulons of the LacI-family transcription factors  

PubMed Central

DNA-binding transcription factors (TFs) are essential components of transcriptional regulatory networks in bacteria. LacI-family TFs (LacI-TFs) are broadly distributed among certain lineages of bacteria. The majority of characterized LacI-TFs sense sugar effectors and regulate carbohydrate utilization genes. The comparative genomics approaches enable in silico identification of TF-binding sites and regulon reconstruction. To study the function and evolution of LacI-TFs, we performed genomics-based reconstruction and comparative analysis of their regulons. For over 1300 LacI-TFs from over 270 bacterial genomes, we predicted their cognate DNA-binding motifs and identified target genes. Using the genome context and metabolic subsystem analyses of reconstructed regulons, we tentatively assigned functional roles and predicted candidate effectors for 78 and 67% of the analyzed LacI-TFs, respectively. Nearly 90% of the studied LacI-TFs are local regulators of sugar utilization pathways, whereas the remaining 125 global regulators control large and diverse sets of metabolic genes. The global LacI-TFs include the previously known regulators CcpA in Firmicutes, FruR in Enterobacteria, and PurR in Gammaproteobacteria, as well as the three novel regulators—GluR, GapR, and PckR—that are predicted to control the central carbohydrate metabolism in three lineages of Alphaproteobacteria. Phylogenetic analysis of regulators combined with the reconstructed regulons provides a model of evolutionary diversification of the LacI protein family. The obtained genomic collection of in silico reconstructed LacI-TF regulons in bacteria is available in the RegPrecise database (http://regprecise.lbl.gov). It provides a framework for future structural and functional classification of the LacI protein family and identification of molecular determinants of the DNA and ligand specificity. The inferred regulons can be also used for functional gene annotation and reconstruction of sugar catabolic networks in diverse bacterial lineages. PMID:24966856

Ravcheev, Dmitry A.; Khoroshkin, Matvei S.; Laikova, Olga N.; Tsoy, Olga V.; Sernova, Natalia V.; Petrova, Svetlana A.; Rakhmaninova, Aleksandra B.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.

2014-01-01

2

Tolerance of deregulated G1/S transcription depends on critical G1/S regulon genes to prevent catastrophic genome instability.  

PubMed

Expression of a G1/S regulon of genes that are required for DNA replication is a ubiquitous mechanism for controlling cell proliferation; moreover, the pathological deregulated expression of E2F-regulated G1/S genes is found in every type of cancer. Cellular tolerance of deregulated G1/S transcription is surprising because this regulon includes many dosage-sensitive proteins. Here, we used the fission yeast Schizosaccharomyces pombe to investigate this issue. We report that deregulating the MBF G1/S regulon by eliminating the Nrm1 corepressor increases replication errors. Homology-directed repair proteins, including MBF-regulated Ctp1(CtIP), are essential to prevent catastrophic genome instability. Surprisingly, the normally inconsequential MBF-regulated S-phase cyclin Cig2 also becomes essential in the absence of Nrm1. This requirement was traced to cyclin-dependent kinase inhibition of the MBF-regulated Cdc18(Cdc6) replication origin-licensing factor. Collectively, these results establish that, although deregulation of G1/S transcription is well tolerated by cells, nonessential G1/S target genes become crucial for preventing catastrophic genome instability. PMID:25533348

Caetano, Catia; Limbo, Oliver; Farmer, Sarah; Klier, Steffi; Dovey, Claire; Russell, Paul; de Bruin, Robertus Antonius Maria

2014-12-24

3

The Cryptosporidium parvum ApiAP2 gene family: insights into the evolution of apicomplexan AP2 regulatory systems  

PubMed Central

We provide the first comprehensive analysis of any transcription factor family in Cryptosporidium, a basal-branching apicomplexan that is the second leading cause of infant diarrhea globally. AP2 domain-containing proteins have evolved to be the major regulatory family in the phylum to the exclusion of canonical regulators. We show that apicomplexan and perkinsid AP2 domains cluster distinctly from other chromalveolate AP2s. Protein-binding specificity assays of C. parvum AP2 domains combined with motif conservation upstream of co-regulated gene clusters allowed the construction of putative AP2 regulons across the in vitro life cycle. Orthologous Apicomplexan AP2 (ApiAP2) expression has been rearranged relative to the malaria parasite P. falciparum, suggesting ApiAP2 network rewiring during evolution. C. hominis orthologs of putative C. parvum ApiAP2 proteins and target genes show greater than average variation. C. parvum AP2 domains display reduced binding diversity relative to P. falciparum, with multiple domains binding the 5?-TGCAT-3?, 5?-CACACA-3? and G-box motifs (5?-G[T/C]GGGG-3?). Many overrepresented motifs in C. parvum upstream regions are not AP2 binding motifs. We propose that C. parvum is less reliant on ApiAP2 regulators in part because it utilizes E2F/DP1 transcription factors. C. parvum may provide clues to the ancestral state of apicomplexan transcriptional regulation, pre-AP2 domination. PMID:24957599

Oberstaller, Jenna; Pumpalova, Yoanna; Schieler, Ariel; Llinás, Manuel; Kissinger, Jessica C.

2014-01-01

4

Global Phenotypic Analysis and Transcriptional Profiling Defines the Weak Acid Stress Response Regulon in Saccharomyces cerevisiae  

PubMed Central

Weak organic acids such as sorbate are potent fungistatic agents used in food preservation, but their intracellular targets are poorly understood. We thus searched for potential target genes and signaling components in the yeast genome using contemporary genome-wide functional assays as well as DNA microarray profiling. Phenotypic screening of the EUROSCARF collection revealed the existence of numerous sorbate-sensitive strains. Sorbate hypersensitivity was detected in mutants of the shikimate biosynthesis pathway, strains lacking the PDR12 efflux pump or WAR1, a transcription factor mediating stress induction of PDR12. Using DNA microarrays, we also analyzed the genome-wide response to acute sorbate stress, allowing for the identification of more than 100 genes rapidly induced by weak acid stress. Moreover, a novel War1p- and Msn2p/4p-independent regulon that includes HSP30 was identified. Although induction of the majority of sorbate-induced genes required Msn2p/4p, weak acid tolerance was unaffected by a lack of Msn2p/4p. Ectopic expression of PDR12 from the GAL1-10 promoter fully restored sorbate resistance in a strain lacking War1p, demonstrating that PDR12 is the major target of War1p under sorbic acid stress. Interestingly, comparison of microarray data with results from the phenotypic screening revealed that PDR12 remained as the only gene, which is both stress inducible and required for weak acid resistance. Our results suggest that combining functional assays with transcriptome profiling allows for the identification of key components in large datasets such as those generated by global microarray analysis. PMID:14617816

Schüller, Christoph; Mamnun, Yasmine M.; Mollapour, Mehdi; Krapf, Gerd; Schuster, Michael; Bauer, Bettina E.; Piper, Peter W.; Kuchler, Karl

2004-01-01

5

Genome-Wide Transcriptional Profiles during Temperature and Oxidative Stress Reveal Coordinated Expression Patterns and Overlapping Regulons in Rice  

PubMed Central

Genome wide transcriptional changes by cold stress, heat stress and oxidative stress in rice seedlings were analyzed. Heat stress resulted in predominant changes in transcripts of heat shock protein and heat shock transcription factor genes, as well as genes associated with synthesis of scavengers of reactive oxygen species and genes that control the level of sugars, metabolites and auxins. Cold stress treatment caused differential expression of transcripts of various transcription factors including desiccation response element binding proteins and different kinases. Transcripts of genes that are part of calcium signaling, reactive oxygen scavenging and diverse metabolic reactions were differentially expressed during cold stress. Oxidative stress induced by hydrogen peroxide treatment, resulted in significant up-regulation in transcript levels of genes related to redox homeostasis and down-regulation of transporter proteins. ROS homeostasis appeared to play central role in response to temperature extremes. The key transcription factors that may underlie the concerted transcriptional changes of specific components in various signal transduction networks involved are highlighted. Co-ordinated expression pattern and promoter architectures based analysis (promoter models and overrepresented transcription factor binding sites) suggested potential regulons involved in stress responses. A considerable overlap was noted at the level of transcription as well as in regulatory modules of differentially expressed genes. PMID:22815860

Mittal, Dheeraj; Madhyastha, Dinesh A.; Grover, Anil

2012-01-01

6

Construction and validation of a first-generation Bordetella bronchiseptica long-oligonucleotide microarray by transcriptional profiling the Bvg regulon  

PubMed Central

Background Bordetella bronchiseptica is a bacterial respiratory pathogen that infects a broad range of mammals, causing chronic and often subclinical infections. Gene expression in Bordetella is regulated by a two-component sensory transduction system, BvgAS, which controls the expression of a spectrum of phenotypic phases transitioning between a virulent (Bvg+) phase and a non-virulent (Bvg-) phase. Results Based on the genomic sequence and using the freely available software ArrayOligoSelector, a long oligonucleotide B. bronchiseptica microarray was designed and assembled. This long-oligonucleotide microarray was subsequently tested and validated by comparing changes in the global expression profiles between B. bronchiseptica RB50 and its Bvg- phase-locked derivative, RB54. Data from this microarray analysis revealed 1,668 Bvg-regulated genes, which greatly expands the BvgAS regulon defined in previous reports. For previously reported Bvg-regulated transcripts, the gene expression data presented here is congruent with prior findings. Additionally, quantitative real-time PCR data provided an independent verification of the microarray expression values. Conclusion The results presented here provide a comprehensive, genome-wide portrait of transcripts encompassing the BvgAS regulon, while also providing data validating the long-oligonucleotide microarray described here for studying gene expression in Bordetella bronchiseptica. PMID:17617915

Nicholson, Tracy L

2007-01-01

7

The Streptococcus pneumoniae cia Regulon: CiaR Target Sites and Transcription Profile Analysis  

Microsoft Academic Search

The ciaR-ciaH system is one of 13 two-component signal-transducing systems of the human pathogen Streptococcus pneumoniae. Mutations in the histidine protein kinase CiaH confer increased resistance to beta-lactam antibiotics and interfere with the development of genetic competence. In order to identify the genes controlled by the cia system, the cia regulon, DNA fragments targeted by the response regulator CiaR were

Thorsten Mascher; Dorothea Zahner; Michelle Merai; Nadege Balmelle; Antoine B. de Saizieu; Regine Hakenbeck

2003-01-01

8

Transcription factor family-based reconstruction of singleton regulons and study of the Crp/Fnr, ArsR, and GntR families in Desulfovibrionales genomes.  

PubMed

Accurate detection of transcriptional regulatory elements is essential for high-quality genome annotation, metabolic reconstruction, and modeling of regulatory networks. We developed a computational approach for reconstruction of regulons operated by transcription factors (TFs) from large protein families and applied this novel approach to three TF families in 10 Desulfovibrionales genomes. Phylogenetic analyses of 125 regulators from the ArsR, Crp/Fnr, and GntR families revealed that 65% of these regulators (termed reference TFs) are well conserved in Desulfovibrionales, while the remaining 35% of regulators (termed singleton TFs) are species specific and show a mosaic distribution. For regulon reconstruction in the group of singleton TFs, the standard orthology-based approach was inefficient, and thus, we developed a novel approach based on the simultaneous study of all homologous TFs from the same family in a group of genomes. As a result, we identified binding for 21 singleton TFs and for all reference TFs in all three analyzed families. Within each TF family we observed structural similarities between DNA-binding motifs of different reference and singleton TFs. The collection of reconstructed regulons is available at the RegPrecise database (http://regprecise.lbl.gov/RegPrecise/Desulfovibrionales.jsp). PMID:23086211

Kazakov, Alexey E; Rodionov, Dmitry A; Price, Morgan N; Arkin, Adam P; Dubchak, Inna; Novichkov, Pavel S

2013-01-01

9

The signal for glucose repression of the lactose-galactose regulon is amplified through subtle modulation of transcription of the Kluyveromyces lactis Kl-GAL4 activator gene.  

PubMed Central

Induction of the lactose-galactose regulon is strongly repressed by glucose in some but not all strains of Kluyveromyces lactis. We show here that in strongly repressed strains, two to three times less Kl-GAL4 mRNA is synthesized and that expression of structural genes in the regulon such as LAC4, the structural gene for beta-galactosidase, is down regulated 40-fold or more. Comparative analysis of strains having a strong or weak repression phenotype revealed a two-base difference in the promoter of the Kl-GAL4 (also called LAC9) positive regulatory gene. This two-base difference is responsible for the strong versus the weak repression phenotype. The two base changes are symmetrically located in a DNA sequence having partial twofold rotational symmetry (14 of 21 bases). We hypothesize that this region functions as a sensitive regulatory switch, an upstream repressor sequence (URS). According to our model, the presence of glucose in the culture medium signals, by an unidentified pathway, a repressor protein to bind the URS. Binding reduces transcription of the Kl-GAL4 gene so that the concentration of the Kl-GAL4 protein falls below the level needed for induction of LAC4 and other genes in the regulon. For strains showing weak glucose repression, we hypothesize that the two base changes in the URS reduce repressor binding so that the regulon is not repressed. Our results illustrate an important principle of genetic regulation: a small (2- to 3-fold) change in the concentration of a regulatory protein can produce a large (40-fold or greater) change in expression of structural genes. This mechanism of signal amplification could play a role in many biological phenomena that require regulated transcription. Images PMID:1569929

Kuzhandaivelu, N; Jones, W K; Martin, A K; Dickson, R C

1992-01-01

10

Structural Basis of the Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA  

Microsoft Academic Search

The multifunctional Escherichia coli proline utilization A (PutA) flavoprotein functions both as a membrane-associated proline catabolic enzyme and as a transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put-regulatory region, determined a crystal structure of the PutA ribbon–helix–helix domain (PutA52, a polypeptide corresponding to

Yuzhen Zhou; John D. Larson; Christopher A. Bottoms; Emilia C. Arturo; Michael T. Henzl; Jermaine L. Jenkins; Jay C. Nix; Donald F. Becker; John J. Tanner

2008-01-01

11

Post-transcriptional regulons coordinate the initiation and resolution of inflammation.  

PubMed

Transcriptional control mechanisms chart the course of the inflammatory response by synthesizing mRNAs encoding proteins that promote or inhibit inflammation. Because these mRNAs can be long-lived, turning off their synthesis does not rapidly stop or change the direction of inflammation. Post-transcriptional mechanisms that modify mRNA stability and/or translation provide more rapid and flexible control of this process and are particularly important in coordinating the initiation and resolution of inflammation. Here, I review the surprising variety of post-transcriptional control mechanisms that regulate the initiation and resolution of inflammation and discuss how these mechanisms are integrated to coordinate this essential process. PMID:20029446

Anderson, Paul

2010-01-01

12

Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA  

PubMed Central

Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5?-GTTGCA-3?, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of ?1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

2009-01-01

13

Determination in vivo of the direction of transcription of structural genes in the fructose regulon of Escherichia coli K12  

SciTech Connect

The direction of transcription of specific components of the fructose phosphotransferase system, the fruA, fruK, and fruB genes, was determined in vivo by plasmid Fts114 lac. Transcription from each of these genes was shown to run in the same direction, counterclockwise with respect to the E. coli chromosomal map. 8 refs., 1 fig.

Dobrynina, O.Yu.; Bol`shakova, T.N.; Umyarov, A.M.; Gershanovich, V.N. [Gamaleya Scientific Research Institute of Epidemiology and Microbiology, Moscow (Russian Federation)

1995-02-01

14

Glutathione is required for maximal transcription of the cobalamin biosynthetic and 1,2-propanediol utilization (cob/pdu) regulon and for the catabolism of ethanolamine, 1,2-propanediol, and propionate in Salmonella typhimurium LT2.  

PubMed Central

Transcription of the cob/pdu regulon of Salmonella typhimurium is activated by the PocR regulatory protein in response to 1,2-propanediol (1,2-PDL) in the environment. Nutritional analysis and DNA sequencing confirmed that a strain defective in expression of the cob/pdu regulon in response to 1,2-PDL lacked a functional gshA gene. gshA encodes gamma-glutamylcysteine synthetase (L-glutamate:L-cysteine gamma-ligase [ADP forming]; EC 6.3.2.2), the enzyme that catalyzes the first step in the synthesis of glutathione (GSH). The DNA sequence of gshA was partially determined, and the location of gshA in the chromosome was established by two-factor crosses. P22 cotransduction of gshA with nearby markers showed 21% linkage to srl and 1% linkage to hyd; srl was 9% cotransducible with hyd. In light of these data, the gene order gshA srl hyd is suggested. The level of reduced thiols in the gshA strain was 87% lower than the levels measured in the wild-type strain in both aerobically and anaerobically grown cells. 1,2-PDL-dependent transcription of cob/pdu was studied by using M. Casadaban's Mu-lacZ fusions. In aerobically grown cells, transcription of a cbi-lacZ fusion (the cbi genes are the subset of cob genes that encode functions needed for the synthesis of the corrin ring) was 4-fold lower and transcription of a pdu-lacZ fusion was 10-fold lower in a gshA mutant than in the wild-type strain. Expression of the cob/pdu regulon in response to 1,2-PDL was restored when GSH was included in the medium. In anaerobically grown cells, cbi-lacZ transcription was only 0.4-fold lower than in the gshA+ strain; pdu-lacZ transcription was reduced only by 0.34-fold, despite the lower thiol levels in the mutant. cobA-lacZ transcription was used as negative control of gene whose transcription is not controlled by the PocR/1,2-PDL system; under both conditions, cobA transcription remained unaffected. The gshA mutant strain was unable to utilize 1,2-PDL, ethanolamine, or propionate as a carbon and energy source. The defect in ethanolamine utilization appears to be at the level of ethanolamine ammonia-lyase activity, not at the transcriptional level. Possible roles for GSH in ethanolamine, 1,2-PDL, and propionate catabolism are proposed and discussed. PMID:7559326

Rondon, M R; Kazmierczak, R; Escalante-Semerena, J C

1995-01-01

15

Genome Scale Identification of Regulons  

SciTech Connect

The DNA sequences of organisms are becoming available at an increasing rate and the biological information derived from the genome sequence data has been proven to be very useful in improving our understanding of cellular regulatory patterns. Detection of transcription factor binding sites in the promoter regions of genes helps to identify the potential regulons of transcriptional regulators, and this information can be used to establish the regulatory networks of organisms. In this study, we apply a motif pattern searching technique to detect the possible DNA binding sites in the intergenic upstream sequences of the genes of a bacterium, Rhodobacter sphaeroides, to investigate the interplay between the three known transcription factors. In contrast to PpsR and FnrL, we find that the PrrA acts as a global regulator in controlling the gene transcription in the R. sphaeroides organism.

Mao, Linyong; Resat, Haluk

2004-06-22

16

Introduction Toxoplasma gondii and other apicomplexans (Plasmodium,  

E-print Network

) are highly polarized parasites that share distinct morphological features (Chobotar and Scholtyseck, 1982 apical end of the apicomplexans contains several unique organelles (rhoptries, micronemes and conoid cells, they rapidly die. Apicomplexans also differentiate to gametes that undergo fusion to generate

Morrissette, Naomi

17

Identification of DNA sequences recognized by VirF, the transcriptional activator of the Yersinia yop regulon.  

PubMed Central

Pathogenic bacteria of the genus Yersinia harbor a 70-kb plasmid required for virulence. The plasmid-encoded virulence proteins of yersiniae are positively regulated at the transcriptional level by the product of the virF gene, the key activator of the system. virF encodes a DNA-binding protein related to the AraC family of transcriptional activators. The VirF protein from Yersinia enterocolitica is a 30-kDa protein that forms dimers in vitro and that specifically binds to the promoter region of VirF-regulated genes. In this work, we determined the sequences of eight VirF-binding sites from four different genes, by DNase I or hydroxyl radical footprinting. The protected regions, about 40 bases long, were aligned, and a number of conserved residues were identified. A 13-bp sequence resembling TTTTaGYcTtTat (in which nucleotides conserved in > or = 60% of the sequences are in uppercase letters and y indicates C or T) appeared, either isolated or as an inverted repeat in each of the eight sites. Images PMID:8021169

Wattiau, P; Cornelis, G R

1994-01-01

18

Quantitative and Qualitative Stem Rust Resistance Factors in Barley Are Associated with Transcriptional Suppression of Defense Regulons  

PubMed Central

Stem rust (Puccinia graminis f. sp. tritici; Pgt) is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99) is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known source of qualitative resistance to this aggressive Pgt race. Segregation for resistance observed on seedlings of the Q21861 × SM89010 (QSM) doubled-haploid (DH) population was found to be predominantly qualitative, with little of the remaining variance explained by loci other than Rpg-TTKSK. In contrast, analysis of adult QSM DH plants infected by field inoculum of Pgt race TTKSK in Njoro, Kenya, revealed several additional quantitative trait loci that contribute to resistance. To molecularly characterize these loci, Barley1 GeneChips were used to measure the expression of 22,792 genes in the QSM population after inoculation with Pgt race TTKSK or mock-inoculation. Comparison of expression Quantitative Trait Loci (eQTL) between treatments revealed an inoculation-dependent expression polymorphism implicating Actin depolymerizing factor3 (within the Rpg-TTKSK locus) as a candidate susceptibility gene. In parallel, we identified a chromosome 2H trans-eQTL hotspot that co-segregates with an enhancer of Rpg-TTKSK-mediated, adult plant resistance discovered through the Njoro field trials. Our genome-wide eQTL studies demonstrate that transcript accumulation of 25% of barley genes is altered following challenge by Pgt race TTKSK, but that few of these genes are regulated by the qualitative Rpg-TTKSK on chromosome 5H. It is instead the chromosome 2H trans-eQTL hotspot that orchestrates the largest inoculation-specific responses, where enhanced resistance is associated with transcriptional suppression of hundreds of genes scattered throughout the genome. Hence, the present study associates the early suppression of genes expressed in this host–pathogen interaction with enhancement of R-gene mediated resistance. PMID:21829384

Moscou, Matthew J.; Lauter, Nick; Steffenson, Brian; Wise, Roger P.

2011-01-01

19

Probing key DNA contacts in AraR-mediated transcriptional repression of the Bacillus subtilis arabinose regulon  

PubMed Central

In the absence of arabinose, the AraR transcription factor represses the expression of genes involved in the utilization of arabinose, xylose and galactose in Bacillus subtilis. AraR exhibits a chimeric organization: the N-terminal DNA-binding region belongs to the GntR family and the C-terminal effector-binding domain is homologous to the GalR/LacI family. Here, the AraR–DNA-binding interactions were characterized in vivo and in vitro. The effect of residue substitutions in the AraR N-terminal domain and of base-pair exchanges into an AraR–DNA-binding operator site were examined by assaying for AraR-mediated regulatory activity in vivo and DNA-binding activity in vitro. The results showed that residues K4, R45 and Q61, located in or near the winged-helix DNA-binding motif, were the most critical amino acids required for AraR function. In addition, the analysis of the various mutations in an AraR palindromic operator sequence indicated that bases G9, A11 and T16 are crucial for AraR binding. Moreover, an AraR mutant M34T was isolated that partially suppressed the effect of mutations in the regulatory cis-elements. Together, these findings extend the knowledge on the nature of AraR nucleoprotein complexes and provide insight into the mechanism that underlies the mode of action of AraR and its orthologues. PMID:17617643

Franco, Irina Saraiva; Mota, Luís Jaime; Soares, Cláudio Manuel; de Sá-Nogueira, Isabel

2007-01-01

20

Control of Enzyme IIscr and Sucrose-6-Phosphate Hydrolase Activities in Streptococcus mutans by Transcriptional Repressor ScrR Binding to the cis-Active Determinants of the scr Regulon  

PubMed Central

In Streptococcus mutans, enzyme IIscr and sucrose-6-phosphate hydrolase are two important enzymes in the transport and metabolism of dietary sucrose. The scr regulon of S. mutans is composed of three genes, scrA and scrB, which code for enzyme IIscr and sucrose-6-phosphate hydrolase, respectively, and scrR, which codes for a GalR-LacI-type transcription regulator. It was previously shown that expression of both scrA and scrB is similarly induced by sucrose. Mutation in the scrR gene resulted in increased expression of scrB relative to that in the wild-type strain. In this study, we employed DNA mobility shift and DNase I protection assays with a purified ScrR-histidine tag fusion protein to examine the DNA binding properties of ScrR to the promoter regions of the scrA and scrB genes. The results showed that ScrR bound specifically to the promoter regions of both scrA and scrB. Two regions with high affinity for ScrR in the promoter sequences of the scrA and scrB genes were identified by DNase I protection assays. One, OC, which includes a 20-bp imperfect inverted-repeat sequence, is located between the two promoters, and the other, OB, is located within the scrB promoter region containing a 37-bp imperfect direct-repeat sequence. Mutations of OB and OC resulted in constitutive transcription and expression of both the scrA and scrB genes. Our results indicated that S. mutans coordinates the activities of enzyme IIscr and sucrose-6-phosphate hydrolase by transcriptional repressor ScrR binding to the promoter regions of the scr regulon. PMID:13129950

Wang, Bing; Kuramitsu, Howard K.

2003-01-01

21

Evolution of apicomplexan secretory organelles  

PubMed Central

The alveolate superphylum includes many free-living and parasitic organisms, which are united by the presence of alveolar sacs lying proximal to the plasma membrane, providing cell structure. All species comprising the apicomplexan group of alveolates are parasites and have adapted to the unique requirements of the parasitic lifestyle. Here the evolution of apicomplexan secretory organelles that are involved in the critical process of egress from one cell and invasion of another is explored. The variations within the Apicomplexa and how these relate to species-specific biology will be discussed. In addition, recent studies have identified specific calcium-sensitive molecules that coordinate the various events and regulate the release of these secretory organelles within apicomplexan parasites. Some aspects of this machinery are conserved outside the Apicomplexa, and are beginning to elucidate the conserved nature of the machinery. Briefly, the relationship of this secretion machinery within the Apicomplexa will be discussed, compared with free-living and predatory alveolates, and how these might have evolved from a common ancestor. PMID:23068912

Gubbels, Marc-Jan; Duraisingh, Manoj T.

2013-01-01

22

Jumbled Genomes: Missing Apicomplexan Synteny  

PubMed Central

Whole-genome comparisons provide insight into genome evolution by informing on gene repertoires, gene gains/losses, and genome organization. Most of our knowledge about eukaryotic genome evolution is derived from studies of multicellular model organisms. The eukaryotic phylum Apicomplexa contains obligate intracellular protist parasites responsible for a wide range of human and veterinary diseases (e.g., malaria, toxoplasmosis, and theileriosis). We have developed an in silico protein-encoding gene based pipeline to investigate synteny across 12 apicomplexan species from six genera. Genome rearrangement between lineages is extensive. Syntenic regions (conserved gene content and order) are rare between lineages and appear to be totally absent across the phylum, with no group of three genes found on the same chromosome and in the same order within 25 kb up- and downstream of any orthologous genes. Conserved synteny between major lineages is limited to small regions in Plasmodium and Theileria/Babesia species, and within these conserved regions, there are a number of proteins putatively targeted to organelles. The observed overall lack of synteny is surprising considering the divergence times and the apparent absence of transposable elements (TEs) within any of the species examined. TEs are ubiquitous in all other groups of eukaryotes studied to date and have been shown to be involved in genomic rearrangements. It appears that there are different criteria governing genome evolution within the Apicomplexa relative to other well-studied unicellular and multicellular eukaryotes. PMID:21504890

DeBarry, Jeremy D.; Kissinger, Jessica C.

2011-01-01

23

Genetic complementation in apicomplexan parasites  

PubMed Central

A robust forward genetic model for Apicomplexa could greatly enhance functional analysis of genes in these important protozoan pathogens. We have developed and successfully tested a genetic complementation strategy based on genomic insertion in Toxoplasma gondii. Adapting recombination cloning to genomic DNA, we show that complementing sequences can be shuttled between parasite genome and bacterial plasmid, providing an efficient tool for the recovery and functional assessment of candidate genes. We show complementation, gene cloning, and biological verification with a mutant parasite lacking hypoxanthine-xanthine-guanine phosphoribosyltransferase and a T. gondii cDNA library. We also explored the utility of this approach to clone genes based on function from other apicomplexan parasites using Toxoplasma as a surrogate. A heterologous library containing Cryptosporidium parvum genomic DNA was generated, and we identified a C. parvum gene coding for inosine 5-monophosphate-dehydrogenase (IMPDH). Interestingly, phylogenetic analysis demonstrates a clear eubacterial origin of this gene and strongly suggests its lateral transfer from ?-proteobacteria. The prokaryotic origin of this enzyme might make it a promising target for therapeutics directed against Cryptosporidium. PMID:11959921

Striepen, Boris; White, Michael W.; Li, Catherine; Guerini, Michael N.; Malik, S.-Banoo; Logsdon, John M.; Liu, Chang; Abrahamsen, Mitchell S.

2002-01-01

24

Protein Palmitoylation and Pathogenesis in Apicomplexan Parasites  

PubMed Central

Apicomplexan parasites comprise a broad variety of protozoan parasites, including Toxoplasma gondii, Plasmodium, Eimeria, and Cryptosporidium species. Being intracellular parasites, the success in establishing pathogenesis relies in their ability to infect a host-cell and replicate within it. Protein palmitoylation is known to affect many aspects of cell biology. Furthermore, palmitoylation has recently been shown to affect important processes in T. gondii such as replication, invasion, and gliding. Thus, this paper focuses on the importance of protein palmitoylation in the pathogenesis of apicomplexan parasites. PMID:23093847

Corvi, Maria Martha; Alonso, Andres Mariano; Caballero, Marina Cecilia

2012-01-01

25

Direct Quantitative Transcript Analysis of the agr Regulon of Staphylococcus aureus during Human Infection in Comparison to the Expression Profile In Vitro  

Microsoft Academic Search

Bacteria possess a repertoire of distinct regulatory systems promoting survival in disparate environments. Under in vitro conditions it was demonstrated for the human pathogen Staphylococcus aureus that the expres- sion of most virulence factors is coordinated by the global regulator agr. To monitor bacterial gene regulation in the host, we developed a method for direct transcript analysis from clinical specimens.

CHRISTIANE GOERKE; SILVIA CAMPANA; MANFRED G. BAYER; GERD DORING; KONRAD BOTZENHART; CHRISTIANE WOLZ

2000-01-01

26

Oxidative Stress Control by Apicomplexan Parasites  

PubMed Central

Apicomplexan parasites cause infectious diseases that are either a severe public health problem or an economic burden. In this paper we will shed light on how oxidative stress can influence the host-pathogen relationship by focusing on three major diseases: babesiosis, coccidiosis, and toxoplasmosis. PMID:25722976

Izui, Natália M.; Schettert, Isolmar; Liebau, Eva

2015-01-01

27

Horizontal gene transfer of epigenetic machinery and evolution of parasitism in the malaria parasite Plasmodium falciparum and other apicomplexans  

PubMed Central

Background The acquisition of complex transcriptional regulatory abilities and epigenetic machinery facilitated the transition of the ancestor of apicomplexans from a free-living organism to an obligate parasite. The ability to control sophisticated gene expression patterns enabled these ancient organisms to evolve several differentiated forms, invade multiple hosts and evade host immunity. How these abilities were acquired remains an outstanding question in protistan biology. Results In this work, we study SET domain bearing genes that are implicated in mediating immune evasion, invasion and cytoadhesion pathways of modern apicomplexans, including malaria parasites. We provide the first conclusive evidence of a horizontal gene transfer of a Histone H4 Lysine 20 (H4K20) modifier, Set8, from an animal host to the ancestor of apicomplexans. Set8 is known to contribute to the coordinated expression of genes involved in immune evasion in modern apicomplexans. We also show the likely transfer of a H3K36 methyltransferase (Ashr3 from plants), possibly derived from algal endosymbionts. These transfers appear to date to the transition from free-living organisms to parasitism and coincide with the proposed horizontal acquisition of cytoadhesion domains, the O-glycosyltransferase that modifies these domains, and the primary family of transcription factors found in apicomplexan parasites. Notably, phylogenetic support for these conclusions is robust and the genes clearly are dissimilar to SET sequences found in the closely related parasite Perkinsus marinus, and in ciliates, the nearest free-living organisms with complete genome sequences available. Conclusions Animal and plant sources of epigenetic machinery provide new insights into the evolution of parasitism in apicomplexans. Along with the horizontal transfer of cytoadhesive domains, O-linked glycosylation and key transcription factors, the acquisition of SET domain methyltransferases marks a key transitional event in the evolution to parasitism in this important protozoan lineage. PMID:23398820

2013-01-01

28

Regulon inference without arbitrary thresholds: three levels of sensitivity  

SciTech Connect

Reconstruction of transcriptional regulatory networks is one of the major challenges facing the bioinformatics community in view of constantly growing number of complete genomes. The comparative genomics approach has been successfully used for the analysis of the transcriptional regulation of many metabolic systems in various bacteria taxa. The key step in this approach is given a position weight matrix, find an optimal threshold for the search of potential binding sites in genomes. In our previous work we proposed an approach for automatic selection of TFBS score threshold coupled with inference of regulon content. In this study we developed two modifications of this approach providing two additional levels of sensitivity.

Dubchak, Pavel Novichkov, Elena Stavrovskaya, Dmitry Rodionov, Andrey Mironov, Inna; Rodionov, Dmitry; Mironov, Andrey; Dubchak, Inna; Novichkov, P.S.

2010-11-15

29

Sex allocation and population structure in apicomplexan (protozoa) parasites  

E-print Network

Sex allocation and population structure in apicomplexan (protozoa) parasites Stuart A. West* , Todd allocation theory across parasitic protozoa in the phylum Apicomplexa. This cosmopolitan phylum consists attention, the population structure of parasitic protozoa species, and in particular estimates of sel

West, Stuart

30

Tracking Transmission of Apicomplexan Symbionts in Diverse Caribbean Corals  

PubMed Central

Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are consistent with those of other scleractinian coral symbionts. While this study furthers knowledge regarding these symbionts, numerous questions remain to be addressed, particularly in regard to the specific interaction(s) between these apicomplexans and their hosts. PMID:24260438

Kirk, Nathan L.; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W.; Fogarty, Nicole D.; Santos, Scott R.

2013-01-01

31

Tracking transmission of apicomplexan symbionts in diverse Caribbean corals.  

PubMed

Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are consistent with those of other scleractinian coral symbionts. While this study furthers knowledge regarding these symbionts, numerous questions remain to be addressed, particularly in regard to the specific interaction(s) between these apicomplexans and their hosts. PMID:24260438

Kirk, Nathan L; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W; Fogarty, Nicole D; Santos, Scott R

2013-01-01

32

N-Acetylgalactosamine Utilization Pathway and Regulon in Proteobacteria  

PubMed Central

We used a comparative genomics approach to reconstruct the N-acetyl-d-galactosamine (GalNAc) and galactosamine (GalN) utilization pathways and transcriptional regulons in Proteobacteria. The reconstructed GalNAc/GalN utilization pathways include multiple novel genes with specific functional roles. Most of the pathway variations were attributed to the amino sugar transport, phosphorylation, and deacetylation steps, whereas the downstream catabolic enzymes in the pathway were largely conserved. The predicted GalNAc kinase AgaK, the novel variant of GalNAc-6-phosphate deacetylase AgaAII and the GalN-6-phosphate deaminase AgaS from Shewanella sp. ANA-3 were validated in vitro using individual enzymatic assays and reconstitution of the three-step pathway. By using genetic techniques, we confirmed that AgaS but not AgaI functions as the main GalN-6-P deaminase in the GalNAc/GalN utilization pathway in Escherichia coli. Regulons controlled by AgaR repressors were reconstructed by bioinformatics in most proteobacterial genomes encoding GalNAc pathways. Candidate AgaR-binding motifs share a common sequence with consensus CTTTC that was found in multiple copies and arrangements in regulatory regions of aga genes. This study provides comprehensive insights into the common and distinctive features of the GalNAc/GalN catabolism and its regulation in diverse Proteobacteria. PMID:22711537

Leyn, Semen A.; Gao, Fang; Yang, Chen; Rodionov, Dmitry A.

2012-01-01

33

Characterization of the YdeO Regulon in Escherichia coli  

PubMed Central

Enterobacteria are able to survive under stressful conditions within animals, such as acidic conditions in the stomach, bile salts during transfer to the intestine and anaerobic conditions within the intestine. The glutamate-dependent (GAD) system plays a major role in acid resistance in Escherichia coli, and expression of the GAD system is controlled by the regulatory cascade consisting of EvgAS > YdeO > GadE. To understand the YdeO regulon in vivo, we used ChIP-chip to interrogate the E. coli genome for candidate YdeO binding sites. All of the seven operons identified by ChIP-chip as being potentially regulated by YdeO were confirmed as being under the direct control of YdeO using RT-qPCR, EMSA, DNaseI-footprinting and reporter assays. Within this YdeO regulon, we identified four stress-response transcription factors, DctR, NhaR, GadE, and GadW and enzymes for anaerobic respiration. Both GadE and GadW are involved in regulation of the GAD system and NhaR is an activator for the sodium/proton antiporter gene. In conjunction with co-transcribed Slp, DctR is involved in protection against metabolic endoproducts under acidic conditions. Taken all together, we suggest that YdeO is a key regulator of E. coli survival in both acidic and anaerobic conditions. PMID:25375160

Yamanaka, Yuki; Oshima, Taku; Ishihama, Akira; Yamamoto, Kaneyoshi

2014-01-01

34

Characterization of the YdeO regulon in Escherichia coli.  

PubMed

Enterobacteria are able to survive under stressful conditions within animals, such as acidic conditions in the stomach, bile salts during transfer to the intestine and anaerobic conditions within the intestine. The glutamate-dependent (GAD) system plays a major role in acid resistance in Escherichia coli, and expression of the GAD system is controlled by the regulatory cascade consisting of EvgAS > YdeO > GadE. To understand the YdeO regulon in vivo, we used ChIP-chip to interrogate the E. coli genome for candidate YdeO binding sites. All of the seven operons identified by ChIP-chip as being potentially regulated by YdeO were confirmed as being under the direct control of YdeO using RT-qPCR, EMSA, DNaseI-footprinting and reporter assays. Within this YdeO regulon, we identified four stress-response transcription factors, DctR, NhaR, GadE, and GadW and enzymes for anaerobic respiration. Both GadE and GadW are involved in regulation of the GAD system and NhaR is an activator for the sodium/proton antiporter gene. In conjunction with co-transcribed Slp, DctR is involved in protection against metabolic endoproducts under acidic conditions. Taken all together, we suggest that YdeO is a key regulator of E. coli survival in both acidic and anaerobic conditions. PMID:25375160

Yamanaka, Yuki; Oshima, Taku; Ishihama, Akira; Yamamoto, Kaneyoshi

2014-01-01

35

Environmental distribution of coral-associated relatives of apicomplexan parasites  

PubMed Central

A lineage of plastid-bearing eukaryotic microbes that is closely related to apicomplexan parasites was recently found in a specific association with coral reefs (apicomplexan-related lineage-V, or ARL-V). Here, we address the possible nature of this association using plastid ‘contamination' in fine-scale bacterial sequence surveys. In a transect between corals and associated macroalgae, ARL-V is specifically associated with the coral, in contrast to all microalgal types (including diatoms, haptophytes, pelagophytes and photosynthetic apicomplexan relatives, Chromera and Vitrella), which are associated with macroalgae. ARL-V is associated with at least 20 species of symbiotic corals through extended time periods and large geographic distances. It is significantly enriched in healthy coral tissue and shallow reef depths. Altogether, the evidence points to a specific relationship between ARL-V and corals, and is suggestive of symbiosis, perhaps based on photosynthesis. PMID:23151646

Janouškovec, Jan; Horák, Aleš; Barott, Katie L; Rohwer, Forest L; Keeling, Patrick J

2013-01-01

36

Phylogeny and evolution of apicoplasts and apicomplexan parasites.  

PubMed

The phylum Apicomplexa includes many parasitic genera of medical and veterinary importance including Plasmodium (causative agent of malaria), Toxoplasma (toxoplasmosis), and Babesia (babesiosis). Most of the apicomplexan parasites possess a unique, essential organelle, the apicoplast, which is a plastid without photosynthetic ability. Although the apicoplast is considered to have evolved through secondary endosymbiosis of a red alga into the common ancestral cell of apicomplexans, its evolutionary history has been under debate until recently. The apicoplast has a genome around 30-40kb in length. Repertoire and arrangement of the apicoplast genome-encoded genes differ among apicomplexan genera, although within the genus Plasmodium these are almost conserved. Genes in the apicoplast genome may be useful markers for Plasmodium phylogeny, because these are single copy (except for the inverted repeat region) and may have more phylogenetic signal than the mitochondrial genome that have been most commonly used for Plasmodium phylogeny. This review describes recent studies concerning the evolutionary origin of the apicoplast, presents evolutionary comparison of the primary structures of apicoplast genomes from apicomplexan parasites, and summarizes recent findings of malaria phylogeny based on apicoplast genome-encoded genes. PMID:25451217

Arisue, Nobuko; Hashimoto, Tetsuo

2015-06-01

37

Fatty Acid Biosynthesis as a Drug Target in Apicomplexan Parasites  

Microsoft Academic Search

Apicomplexan parasitic diseases impose devastating impacts on much of the world's population. The increasing prevalence of drug resistant parasites and the growing number of immuno-compromised individuals are exacerbating the problem to the point that the need for novel, inexpensive drugs is greater now than ever. Discovery of a prokaryotic, Type II fatty acid synthesis (FAS) pathway asso- ciated with the

C. D. Goodman; G. I. McFadden

2007-01-01

38

iRegulon: From a Gene List to a Gene Regulatory Network Using Large Motif and Track Collections  

PubMed Central

Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from http://iregulon.aertslab.org. PMID:25058159

Imrichová, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein

2014-01-01

39

The cyclic-AMP receptor protein (CRP) regulon in Aggregatibacter actinomycetemcomitans includes leukotoxin  

PubMed Central

The cyclic-AMP receptor protein (CRP) acts as a global regulatory protein among bacteria. Here, the CRP regulon has been defined in Aggregatibacter actinomycetemcomitans using microarray analysis of A. actinomycetemcomitans strain JP2 wild type cells compared to an isogenic crp deletion mutant. Genes whose expression levels changed at least 2-fold with p ? 0.05 were considered significant. Of the 300 genes identified as being CRP-regulated, 139 were CRP-activated, including leukotoxin, with the remaining being CRP-repressed. The 300 genes represent 14.2% of ORFs probed which is significantly higher than what has been reported for CRP regulons in other bacteria. If the CRP-regulated genes are put into 17 functional classes, all 17 categories had at least 1 CRP-regulated gene. Several functional categories, mainly transport and binding proteins and energy metabolism proteins, were disproportionately represented in the CRP-regulated subset of genes relative to their overall representation in the genome. This is similar to the patterns seen in other bacteria. Finally, quantitative RT-PCR was used to show that the leukotoxin RNA levels were repressed 16-fold in the CRP mutant indicating that CRP activates leukotoxin transcription. However, this regulation appears to be acting through another regulatory protein since the leukotoxin promoter, unlike ~129 other promoters of CRP-regulated genes, does not have a match to the consensus CRP binding site. Several candidate genes for this intermediary transcription factor have been identified in the CRP-regulon. PMID:21575705

Feuerbacher, Leigh A.; Burgum, Alex; Kolodrubetz, David

2011-01-01

40

The BaeSR regulon is involved in defense against zinc toxicity in E. coli.  

PubMed

Intracellular zinc homeostasis is regulated by an extensive network of transporters, ligands and transcription factors. The zinc detoxification functions of three transporters and a periplasmic protein regulated by the BaeSR two-component system were explored in this work by evaluating the effect of single gene knockouts in the BaeSR regulon on the cell growth rate, free zinc, total zinc and total copper after zinc shock. Two exporters, MdtABC and MdtD, and the periplasmic protein, Spy, are involved in zinc detoxification based on the growth defects at high cell density and increases in free (>1000-fold) and total zinc/copper (>2-fold) that were observed in the single knockout strains upon exposure to zinc. These proteins complement the ATP-driven zinc export mediated by ZntA in E. coli to limit zinc toxicity. These results highlight the functions of the BaeSR regulon in metal homeostasis. PMID:23446818

Wang, Da; Fierke, Carol A

2013-04-01

41

Targeting Purine and Pyrimidine Metabolism in Human Apicomplexan Parasites  

PubMed Central

Synthesis de novo, acquisition by salvage and interconversion of purines and pyrimidines represent the fundamental requirements for their eventual assembly into nucleic acids as nucleotides and the deployment of their derivatives in other biochemical pathways. A small number of drugs targeted to nucleotide metabolism, by virtue of their effect on folate biosynthesis and recycling, have been successfully used against apicomplexan parasites such as Plasmodium and Toxoplasma for many years, although resistance is now a major problem in the prevention and treatment of malaria. Many targets not involving folate metabolism have also been explored at the experimental level. However, the unravelling of the genome sequences of these eukaryotic unicellular organisms, together with increasingly sophisticated molecular analyses, opens up possibilities of introducing new drugs that could interfere with these processes. This review examines the status of established drugs of this type and the potential for further exploiting the vulnerability of apicomplexan human pathogens to inhibition of this key area of metabolism. PMID:17266529

Hyde, John E.

2009-01-01

42

Apicomplexan parasites of red foxes ( Vulpes vulpes ) in northeastern Poland  

Microsoft Academic Search

Molecular detection of apicomplexan parasites in splenic samples of red foxes collected from northeastern Poland was conducted\\u000a by PCR amplification of a fragment of the 18S rRNA spanning the V4 gene region of Apicomplexa. Positive PCR products were\\u000a further analysed by restriction fragment length polymorphism (RFLP) and sequencing to identify species. One hundred and eleven\\u000a red foxes (Vulpes vulpes) were

Grzegorz Karbowiak; Viktória Majláthová; Joanna Hapunik; Branislav Pet’ko; Irena Wita

2010-01-01

43

Prevalence of encysted apicomplexans in muscles of raptors  

Microsoft Academic Search

An acid–pepsin digestion technique was used to examine portions of breast muscle and heart from raptors for encysted protozoans. Apicomplexan zoites were present in 52 (45.6%) of the 114 samples examined: 11 of 12 (91.7%) red-shouldered hawks (Buteo lineatus), 20 of 34 (58.8%) red-tailed hawks (Buteo jamaicensis), two of seven (28.6%) Cooper's hawks (Accipiter cooperi), three of four (75%) sharp-shinned

David S Lindsay; Byron L Blagburn

1999-01-01

44

A Novel Candidate Vaccine for Cytauxzoonosis Inferred from Comparative Apicomplexan Genomics  

PubMed Central

Cytauxzoonosis is an emerging infectious disease of domestic cats (Felis catus) caused by the apicomplexan protozoan parasite Cytauxzoon felis. The growing epidemic, with its high morbidity and mortality points to the need for a protective vaccine against cytauxzoonosis. Unfortunately, the causative agent has yet to be cultured continuously in vitro, rendering traditional vaccine development approaches beyond reach. Here we report the use of comparative genomics to computationally and experimentally interpret the C. felis genome to identify a novel candidate vaccine antigen for cytauxzoonosis. As a starting point we sequenced, assembled, and annotated the C. felis genome and the proteins it encodes. Whole genome alignment revealed considerable conserved synteny with other apicomplexans. In particular, alignments with the bovine parasite Theileria parva revealed that a C. felis gene, cf76, is syntenic to p67 (the leading vaccine candidate for bovine theileriosis), despite a lack of significant sequence similarity. Recombinant subdomains of cf76 were challenged with survivor-cat antiserum and found to be highly seroreactive. Comparison of eleven geographically diverse samples from the south-central and southeastern USA demonstrated 91–100% amino acid sequence identity across cf76, including a high level of conservation in an immunogenic 226 amino acid (24 kDa) carboxyl terminal domain. Using in situ hybridization, transcription of cf76 was documented in the schizogenous stage of parasite replication, the life stage that is believed to be the most important for development of a protective immune response. Collectively, these data point to identification of the first potential vaccine candidate antigen for cytauxzoonosis. Further, our bioinformatic approach emphasizes the use of comparative genomics as an accelerated path to developing vaccines against experimentally intractable pathogens. PMID:23977000

Tarigo, Jaime L.; Scholl, Elizabeth H.; Bird, David McK.; Brown, Corrie C.; Cohn, Leah A.; Dean, Gregg A.; Levy, Michael G.; Doolan, Denise L.; Trieu, Angela; Nordone, Shila K.; Felgner, Philip L.; Vigil, Adam; Birkenheuer, Adam J.

2013-01-01

45

Evolution of a Bacterial Regulon Controlling Virulence Homeostasis  

E-print Network

Evolution of a Bacterial Regulon Controlling Virulence and Mg2+ Homeostasis J. Christian Perez1,2¤a governs virulence and Mg2+ homeostasis in several bacterial species. We establish that the ancestral Pho Regulon Controlling Virulence and Mg2+ Homeostasis. PLoS Genet 5(3): e1000428. doi:10.1371/journal

Granada, Universidad de

46

Genomic Reconstruction of the Transcriptional Regulatory Network in Bacillus subtilis  

PubMed Central

The adaptation of microorganisms to their environment is controlled by complex transcriptional regulatory networks (TRNs), which are still only partially understood even for model species. Genome scale annotation of regulatory features of genes and TRN reconstruction are challenging tasks of microbial genomics. We used the knowledge-driven comparative-genomics approach implemented in the RegPredict Web server to infer TRN in the model Gram-positive bacterium Bacillus subtilis and 10 related Bacillales species. For transcription factor (TF) regulons, we combined the available information from the DBTBS database and the literature with bioinformatics tools, allowing inference of TF binding sites (TFBSs), comparative analysis of the genomic context of predicted TFBSs, functional assignment of target genes, and effector prediction. For RNA regulons, we used known RNA regulatory motifs collected in the Rfam database to scan genomes and analyze the genomic context of new RNA sites. The inferred TRN in B. subtilis comprises regulons for 129 TFs and 24 regulatory RNA families. First, we analyzed 66 TF regulons with previously known TFBSs in B. subtilis and projected them to other Bacillales genomes, resulting in refinement of TFBS motifs and identification of novel regulon members. Second, we inferred motifs and described regulons for 28 experimentally studied TFs with previously unknown TFBSs. Third, we discovered novel motifs and reconstructed regulons for 36 previously uncharacterized TFs. The inferred collection of regulons is available in the RegPrecise database (http://regprecise.lbl.gov/) and can be used in genetic experiments, metabolic modeling, and evolutionary analysis. PMID:23504016

Leyn, Semen A.; Kazanov, Marat D.; Sernova, Natalia V.; Ermakova, Ekaterina O.; Novichkov, Pavel S.

2013-01-01

47

Haemophilus influenzae OxyR: Characterization of Its Regulation, Regulon and Role in Fitness  

PubMed Central

To prevent damage by reactive oxygen species, many bacteria have evolved rapid detection and response systems, including the OxyR regulon. The OxyR system detects reactive oxygen and coordinates the expression of numerous defensive antioxidants. In many bacterial species the coordinated OxyR-regulated response is crucial for in vivo survival. Regulation of the OxyR regulon of Haemophilus influenzae was examined in vitro, and significant variation in the regulated genes of the OxyR regulon among strains of H. influenzae was observed. Quantitative PCR studies demonstrated a role for the OxyR-regulated peroxiredoxin/glutaredoxin as a mediator of the OxyR response, and also indicated OxyR self-regulation through a negative feedback loop. Analysis of transcript levels in H. influenzae samples derived from an animal model of otitis media demonstrated that the members of the OxyR regulon were actively upregulated within the chinchilla middle ear. H. influenzae mutants lacking the oxyR gene exhibited increased sensitivity to challenge with various peroxides. The impact of mutations in oxyR was assessed in various animal models of H. influenzae disease. In paired comparisons with the corresponding wild-type strains, the oxyR mutants were unaffected in both the chinchilla model of otitis media and an infant model of bacteremia. However, in weanling rats the oxyR mutant was significantly impaired compared to the wild-type strain. In contrast, in all three animal models when infected with a mixture of equal numbers of both wild-type and mutant strains the mutant strain was significantly out competed by the wild-type strain. These findings clearly establish a crucial role for OxyR in bacterial fitness. PMID:23226321

Whitby, Paul W.; Morton, Daniel J.; VanWagoner, Timothy M.; Seale, Thomas W.; Cole, Brett K.; Mussa, Huda J.; McGhee, Phillip A.; Bauer, Chee Yoon S.; Springer, Jennifer M.; Stull, Terrence L.

2012-01-01

48

The Mutualist Laccaria bicolor Expresses a Core Gene Regulon During the Colonization of Diverse Host Plants and a Variable Regulon to Counteract Host-Specific Defenses.  

PubMed

The coordinated transcriptomic responses of both mutualistic ectomycorrhizal (ECM) fungi and their hosts during the establishment of symbiosis are not well-understood. This study characterizes the transcriptomic alterations of the ECM fungus Laccaria bicolor during different colonization stages on two hosts (Populus trichocarpa and Pseudotsuga menziesii) and compares this to the transcriptomic variations of P. trichocarpa across the same timepoints. A large number of L. bicolor genes (?8,000) were significantly regulated at the transcriptional level in at least one stage of colonization. From our data, we identify 1,249 genes that we hypothesize is the 'core' gene regulon necessary for the mutualistic interaction between L. bicolor and its host plants. We further identify a group of 1,210 genes that are regulated in a host-specific manner. This variable regulon encodes a number of genes coding for proteases and xenobiotic efflux transporters that we hypothesize act to counter chemical-based defenses simultaneously activated at the transcriptomic level in P. trichocarpa. The transcriptional response of the host plant P. trichocarpa consisted of differential waves of gene regulation related to signaling perception and transduction, defense response, and the induction of nutrient transfer in P. trichocarpa tissues. This study, therefore, gives fresh insight into the shifting transcriptomic landscape in both the colonizing fungus and its host and the different strategies employed by both partners in orchestrating a mutualistic interaction. PMID:25338146

Plett, Jonathan M; Tisserant, Emilie; Brun, Annick; Morin, Emmanuel; Grigoriev, Igor V; Kuo, Alan; Martin, Francis; Kohler, Annegret

2015-03-01

49

Activation of the latent PlcR regulon in Bacillus anthracis.  

PubMed

Many genes in Bacillus cereus and Bacillus thuringiensis are under the control of the transcriptional regulator PlcR and its regulatory peptide, PapR. In Bacillus anthracis, the causative agent of anthrax, PlcR is inactivated by truncation, and consequently genes having PlcR binding sites are expressed at very low levels when compared with B. cereus. We found that activation of the PlcR regulon in B. anthracis by expression of a PlcR-PapR fusion protein does not alter sporulation in strains containing the virulence plasmid pXO1 and thereby the global regulator AtxA. Using comparative 2D gel electrophoresis, we showed that activation of the PlcR regulon in B. anthracis leads to upregulation of many proteins found in the secretome of B. cereus, including phospholipases and proteases, such as the putative protease BA1995. Transcriptional analysis demonstrated expression of BA1995 to be dependent on PlcR-PapR, even though the putative PlcR recognition site of the BA1995 gene does not exactly match the PlcR consensus sequence, explaining why this protein had escaped recognition as belonging to the PlcR regulon. Additionally, while transcription of major PlcR-dependent haemolysins, sphingomyelinase and anthrolysin O is enhanced in response to PlcR activation in B. anthracis, only anthrolysin O contributes significantly to lysis of human erythrocytes. In contrast, the toxicity of bacterial culture supernatants from a PlcR-positive strain towards murine macrophages occurred independently of anthrolysin O expression in vitro and in vivo. PMID:20688829

Sastalla, Inka; Maltese, Lauren M; Pomerantseva, Olga M; Pomerantsev, Andrei P; Keane-Myers, Andrea; Leppla, Stephen H

2010-10-01

50

Evidence classification of high-throughput protocols and confidence integration in RegulonDB  

PubMed Central

RegulonDB provides curated information on the transcriptional regulatory network of Escherichia coli and contains both experimental data and computationally predicted objects. To account for the heterogeneity of these data, we introduced in version 6.0, a two-tier rating system for the strength of evidence, classifying evidence as either ‘weak’ or ‘strong’ (Gama-Castro,S., Jimenez-Jacinto,V., Peralta-Gil,M. et al. RegulonDB (Version 6.0): gene regulation model of Escherichia Coli K-12 beyond transcription, active (experimental) annotated promoters and textpresso navigation. Nucleic Acids Res., 2008;36:D120–D124.). We now add to our classification scheme the classification of high-throughput evidence, including chromatin immunoprecipitation (ChIP) and RNA-seq technologies. To integrate these data into RegulonDB, we present two strategies for the evaluation of confidence, statistical validation and independent cross-validation. Statistical validation involves verification of ChIP data for transcription factor-binding sites, using tools for motif discovery and quality assessment of the discovered matrices. Independent cross-validation combines independent evidence with the intention to mutually exclude false positives. Both statistical validation and cross-validation allow to upgrade subsets of data that are supported by weak evidence to a higher confidence level. Likewise, cross-validation of strong confidence data extends our two-tier rating system to a three-tier system by introducing a third confidence score ‘confirmed’. Database URL: http://regulondb.ccg.unam.mx/ PMID:23327937

Weiss, Verena; Medina-Rivera, Alejandra; Huerta, Araceli M.; Santos-Zavaleta, Alberto; Salgado, Heladia; Morett, Enrique; Collado-Vides, Julio

2013-01-01

51

Genome Sequence of Babesia bovis and Comparative Analysis of Apicomplexan Hemoprotozoa  

Microsoft Academic Search

Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related apicomplexan hemoprotozoa Theileria parva and Plasmodium falciparum. At 8.2 Mbp, the B. bovis genome is similar in size

Kelly A. Brayton; Audrey O. T. Lau; David R. Herndon; Linda Hannick; Lowell S. Kappmeyer; Shawn J. Berens; Shelby L. Bidwell; Wendy C. Brown; Jonathan Crabtree; Doug Fadrosh; Tamara Feldblum; Heather A. Forberger; Brian J. Haas; Jeanne M. Howell; Hoda Khouri; Hean Koo; David J. Mann; Junzo Norimine; Ian T. Paulsen; Diana Radune; Qinghu Ren; Roger K. Smith Jr; Carlos E. Suarez; Owen White; Jennifer R. Wortman; Donald P. Knowles Jr; Terry F. McElwain; Vishvanath M. Nene

2007-01-01

52

Conservation of a Gliding Motility and Cell Invasion Machinery in Apicomplexan Parasites  

Microsoft Academic Search

Most Apicomplexan parasites, including the human pathogens Plasmodium , Toxoplasma , and Cryptosporidium , actively invade host cells and display gliding motility, both actions powered by parasite mi- crofilaments. In Plasmodium sporozoites, thrombo- spondin-related anonymous protein (TRAP), a mem- ber of a group of Apicomplexan transmembrane proteins that have common adhesion domains, is neces- sary for gliding motility and infection

Stefan Kappe; Thomas Bruderer; Soren Gantt; Hisashi Fujioka; Victor Nussenzweig; Robert Ménard

1999-01-01

53

The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis  

Microsoft Academic Search

Class I heat-inducible genes in Bacillus subtilis consist of the heptacistronic dnaK and the bicistronic groE operon and form the CIRCE regulon. Both operons are negatively regulated at the level of transcription by the HrcA repressor interacting with its operator, the CIRCE element. Here, we demonstrate that the DnaK chaperone machine is not involved in the regulation of HrcA and

Axel Mogk; Georg Homuth; Christian Scholz; Lana Kim; Franz X. Schmid; Wolfgang Schumann

1997-01-01

54

Prevalence of encysted apicomplexans in muscles of raptors.  

PubMed

An acid-pepsin digestion technique was used to examine portions of breast muscle and heart from raptors for encysted protozoans. Apicomplexan zoites were present in 52 (45.6%) of the 114 samples examined: 11 of 12 (91.7%) red-shouldered hawks (Buteo lineatus), 20 of 34 (58.8%) red-tailed hawks (Buteo jamaicensis), two of seven (28.6%) Cooper's hawks (Accipiter cooperi), three of four (75%) sharp-shinned hawks (Accipiter striatus), one (100%) Mississippi kites (Ictinia misisippiensis), one of two (50%) American kestrels (Falco sparverius), one bald eagle (Haliaeetus leucocephalus), one of two (50%) golden eagles (Aquila chrysaetos), one of three (33%) turkey vultures (Cathartes aura), two of three (66.7%) black vultures (Coragyps atratus), three of six (50%) great-horned owls (Bubo virginianus), five of 15 (33.3%) barred owls (Strix varia), and one of 12 (8.3%) screech owls (Asio otus). Encysted protozoans were not observed in digests of tissues from three broad-winged hawks (Buteo platypterus), four ospreys (Pandion haliaetus), and five barn owls (Tyto alba). Apicomplexan cysts resembling Sarcocystis species were observed in tissue sections of muscles from 28 (37.8%) of 74 raptors. PMID:9950339

Lindsay, D S; Blagburn, B L

1999-01-28

55

An NAD(P)H-Nicotine Blue Oxidoreductase Is Part of the Nicotine Regulon and May Protect Arthrobacter nicotinovorans from Oxidative Stress during Nicotine Catabolism  

Microsoft Academic Search

An NAD(P)H-nicotine blue (quinone) oxidoreductase was discovered as a member of the nicotine catabolic pathway of Arthrobacter nicotinovorans. Transcriptional analysis and electromobility shift assays showed that the enzyme gene was expressed in a nicotine-dependent manner under the control of the transcriptional activator PmfR and thus was part of the nicotine regulon of A. nicotinovorans. The flavin mononucleotide-containing enzyme uses NADH

Marius Mihasan; Calin-Bogdan Chiribau; Thorsten Friedrich; Vlad Artenie; Roderich Brandsch

2007-01-01

56

The yeast iron regulon is induced upon cobalt stress and crucial for cobalt tolerance.  

PubMed

To identify yeast genes involved in cobalt detoxification, we performed RNA expression profiling experiments and followed changes in gene activity upon cobalt stress on a genome-wide scale. We found that cobalt stress specifically results in an immediate and dramatic induction of genes involved in iron uptake. This response is dependent on the Aft1 protein, a transcriptional factor known to regulate a set of genes involved in iron uptake and homeostasis (iron regulon). Like iron starvation, cobalt stress induces accumulation of the Aft1 protein in the nucleus to activate transcription of its target genes. Cells lacking the AFT1 gene (aft1) are hypersensitive to cobalt as well as to other transition metals, whereas expression of the dominant AFT1-1(up) allele, which results in up-regulation of AFT1-controlled genes, confers resistance. Cobalt resistance correlates with an increase in intracellular iron in AFT1-1(up) cells, and sensitivity of aft1 cells is associated with a lack of iron accumulation. Furthermore, elevated iron levels in the growth medium suppress the cobalt sensitivity of the aft1 mutant cells, even though they increase cellular cobalt. Results presented indicate that yeast cells acquire cobalt tolerance by activating the Aft1p-dependent iron regulon and thereby increasing intracellular iron levels. PMID:12176980

Stadler, Jochen A; Schweyen, Rudolf J

2002-10-18

57

Antimicrobial Peptides Activate the Rcs Regulon through the Outer Membrane Lipoprotein RcsF?  

PubMed Central

Salmonella enterica species are exposed to envelope stresses due to their environmental and infectious lifestyles. Such stresses include amphipathic cationic antimicrobial peptides (CAMPs), and resistance to these peptides is an important property for microbial virulence for animals. Bacterial mechanisms used to sense and respond to CAMP-induced envelope stress include the RcsFCDB phosphorelay, which contributes to survival from polymyxin B exposure. The Rcs phosphorelay includes two inner membrane (IM) proteins, RcsC and RcsD; the response regulator RcsB; the accessory coregulator RcsA; and an outer membrane bound lipoprotein, RcsF. Transcriptional activation of the Rcs regulon occurred within minutes of exposure to CAMP and during the first detectable signs of CAMP-induced membrane disorder. Rcs transcriptional activation by CAMPs required RcsF and preservation of its two internal disulfide linkages. The rerouting of RcsF to the inner membrane or its synthesis as an unanchored periplasmic protein resulted in constitutive activation of the Rcs regulon and RcsCD-dependent phosphorylation. These findings suggest that RcsFCDB activation in response to CAMP-induced membrane disorder is a result of a change in structure or availability of RcsF to the IM signaling constituents of the Rcs phosphorelay. PMID:20675476

Farris, Carol; Sanowar, Sarah; Bader, Martin W.; Pfuetzner, Richard; Miller, Samuel I.

2010-01-01

58

Transcription  

NSDL National Science Digital Library

A detailed depiction of transcription, the first stage of protein synthesis. This is the second in a series of three animations on protein synthesis. To begin at the beginning, go to Protein Synthesis - A general overview.

59

A comparison of the low temperature transcriptomes and CBF regulons of three plant species that differ in freezing tolerance: Solanum commersonii, Solanum tuberosum, and Arabidopsis thaliana  

PubMed Central

Solanum commersonii and Solanum tuberosum are closely related plant species that differ in their abilities to cold acclimate; whereas S. commersonii increases in freezing tolerance in response to low temperature, S. tuberosum does not. In Arabidopsis thaliana, cold-regulated genes have been shown to contribute to freezing tolerance, including those that comprise the CBF regulon, genes that are controlled by the CBF transcription factors. The low temperature transcriptomes and CBF regulons of S. commersonii and S. tuberosum were therefore compared to determine whether there might be differences that contribute to their differences in ability to cold acclimate. The results indicated that both plants alter gene expression in response to low temperature to similar degrees with similar kinetics and that both plants have CBF regulons composed of hundreds of genes. However, there were considerable differences in the sets of genes that comprised the low temperature transcriptomes and CBF regulons of the two species. Thus differences in cold regulatory programmes may contribute to the differences in freezing tolerance of these two species. However, 53 groups of putative orthologous genes that are cold-regulated in S. commersonii, S. tuberosum, and A. thaliana were identified. Given that the evolutionary distance between the two Solanum species and A. thaliana is 112–156 million years, it seems likely that these conserved cold-regulated genes—many of which encode transcription factors and proteins of unknown function—have fundamental roles in plant growth and development at low temperature. PMID:21511909

Pino, María-Teresa; Jekni?, Zoran; Zou, Cheng; Shiu, Shin-Han; Chen, Tony H. H.; Thomashow, Michael F.

2011-01-01

60

Genome Sequence of Babesia bovis and Comparative Analysis of Apicomplexan Hemoprotozoa  

PubMed Central

Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related apicomplexan hemoprotozoa Theileria parva and Plasmodium falciparum. At 8.2 Mbp, the B. bovis genome is similar in size to that of Theileria spp. Structural features of the B. bovis and T. parva genomes are remarkably similar, and extensive synteny is present despite several chromosomal rearrangements. In contrast, B. bovis and P. falciparum, which have similar clinical and pathological features, have major differences in genome size, chromosome number, and gene complement. Chromosomal synteny with P. falciparum is limited to microregions. The B. bovis genome sequence has allowed wide scale analyses of the polymorphic variant erythrocyte surface antigen protein (ves1 gene) family that, similar to the P. falciparum var genes, is postulated to play a role in cytoadhesion, sequestration, and immune evasion. The ?150 ves1 genes are found in clusters that are distributed throughout each chromosome, with an increased concentration adjacent to a physical gap on chromosome 1 that contains multiple ves1-like sequences. ves1 clusters are frequently linked to a novel family of variant genes termed smorfs that may themselves contribute to immune evasion, may play a role in variant erythrocyte surface antigen protein biology, or both. Initial expression analysis of ves1 and smorf genes indicates coincident transcription of multiple variants. B. bovis displays a limited metabolic potential, with numerous missing pathways, including two pathways previously described for the P. falciparum apicoplast. This reduced metabolic potential is reflected in the B. bovis apicoplast, which appears to have fewer nuclear genes targeted to it than other apicoplast containing organisms. Finally, comparative analyses have identified several novel vaccine candidates including a positional homolog of p67 and SPAG-1, Theileria sporozoite antigens targeted for vaccine development. The genome sequence provides a greater understanding of B. bovis metabolism and potential avenues for drug therapies and vaccine development. PMID:17953480

Brayton, Kelly A; Lau, Audrey O. T; Herndon, David R; Hannick, Linda; Kappmeyer, Lowell S; Berens, Shawn J; Bidwell, Shelby L; Brown, Wendy C; Crabtree, Jonathan; Fadrosh, Doug; Feldblum, Tamara; Forberger, Heather A; Haas, Brian J; Howell, Jeanne M; Khouri, Hoda; Koo, Hean; Mann, David J; Norimine, Junzo; Paulsen, Ian T; Radune, Diana; Ren, Qinghu; Smith, Roger K; Suarez, Carlos E; White, Owen; Wortman, Jennifer R; Knowles, Donald P; McElwain, Terry F; Nene, Vishvanath M

2007-01-01

61

Comparative Genomics of Transcriptional Regulation of Methionine Metabolism in Proteobacteria  

PubMed Central

Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ?200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria. PMID:25411846

Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.

2014-01-01

62

Structural and Mechanistic Basis of Zinc Regulation Across the E. coli Zur Regulon  

PubMed Central

Commensal microbes, whether they are beneficial or pathogenic, are sensitive to host processes that starve or swamp the prokaryote with large fluctuations in local zinc concentration. To understand how microorganisms coordinate a dynamic response to changes in zinc availability at the molecular level, we evaluated the molecular mechanism of the zinc-sensing zinc uptake regulator (Zur) protein at each of the known Zur-regulated genes in Escherichia coli. We solved the structure of zinc-loaded Zur bound to the PznuABC promoter and show that this metalloregulatory protein represses gene expression by a highly cooperative binding of two adjacent dimers to essentially encircle the core element of each of the Zur-regulated promoters. Cooperativity in these protein-DNA interactions requires a pair of asymmetric salt bridges between Arg52 and Asp49? that connect otherwise independent dimers. Analysis of the protein-DNA interface led to the discovery of a new member of the Zur-regulon: pliG. We demonstrate this gene is directly regulated by Zur in a zinc responsive manner. The pliG promoter forms stable complexes with either one or two Zur dimers with significantly less protein-DNA cooperativity than observed at other Zur regulon promoters. Comparison of the in vitro Zur-DNA binding affinity at each of four Zur-regulon promoters reveals ca. 10,000-fold variation Zur-DNA binding constants. The degree of Zur repression observed in vivo by comparison of transcript copy number in wild-type and ?zur strains parallels this trend spanning a 100-fold difference. We conclude that the number of ferric uptake regulator (Fur)-family dimers that bind within any given promoter varies significantly and that the thermodynamic profile of the Zur-DNA interactions directly correlates with the physiological response at different promoters. PMID:25369000

Gilston, Benjamin A.; Wang, Suning; Marcus, Mason D.; Canalizo-Hernández, Mónica A.; Swindell, Elden P.; Xue, Yi; Mondragón, Alfonso; O'Halloran, Thomas V.

2014-01-01

63

Divergence of the SigB regulon and pathogenesis of the Bacillus cereus sensu lato group  

PubMed Central

Background The Bacillus cereus sensu lato group currently includes seven species (B. cereus, B. anthracis, B. mycoides, B. pseudomycoides, B. thuringiensis, B. weihenstephanensis and B. cytotoxicus) that recent phylogenetic and phylogenomic analyses suggest are likely a single species, despite their varied phenotypes. Although horizontal gene transfer and insertion-deletion events are clearly important for promoting divergence among these genomes, recent studies have demonstrated that a major basis for phenotypic diversity in these organisms may be differential regulation of the highly similar gene content shared by these organisms. To explore this hypothesis, we used an in silico approach to evaluate the relationship of pathogenic potential and the divergence of the SigB-dependent general stress response within the B. cereus sensu lato group, since SigB has been demonstrated to support pathogenesis in Bacillus, Listeria and Staphylococcus species. Results During the divergence of these organisms from a common “SigB-less” ancestor, the placement of SigB promoters at varied locations in the B. cereus sensu lato genomes predict alternative structures for the SigB regulon in different organisms. Predicted promoter changes suggesting differential transcriptional control of a common gene pool predominate over evidence of indels or horizontal gene transfer for explaining SigB regulon divergence. Conclusions Four lineages of the SigB regulon have arisen that encompass different gene contents and suggest different strategies for supporting pathogenesis. This is consistent with the hypothesis that divergence within the B. cereus sensu lato group rests in part on alternative strategies for regulation of a common gene pool. PMID:23088190

2012-01-01

64

RpfF-dependent regulon of Xylella fastidiosa.  

PubMed

ABSTRACT Xylella fastidiosa regulates traits important to both virulence of grape as well as colonization of sharpshooter vectors via its production of a fatty acid signal molecule known as DSF whose production is dependent on rpfF. Although X. fastidiosa rpfF mutants exhibit increased virulence to plants, they are unable to be spread from plant to plant by insect vectors. To gain more insight into the traits that contribute to these processes, a whole-genome Agilent DNA microarray for this species was developed and used to determine the RpfF-dependent regulon by transcriptional profiling. In total, 446 protein coding genes whose expression was significantly different between the wild type and an rpfF mutant (false discovery rate < 0.05) were identified when cells were grown in PW liquid medium. Among them, 165 genes were downregulated in the rpfF mutant compared with the wild-type strain whereas 281 genes were over-expressed. RpfF function was required for regulation of 11 regulatory and ? factors, including rpfE, yybA, PD1177, glnB, rpfG, PD0954, PD0199, PD2050, colR, rpoH, and rpoD. In general, RpfF is required for regulation of genes involved in attachment and biofilm formation, enhancing expression of hemagglutinin genes hxfA and hxfB, and suppressing most type IV pili and gum genes. A large number of other RpfF-dependent genes that might contribute to virulence or insect colonization were also identified such as those encoding hemolysin and colicin V, as well as genes with unknown functions. PMID:22877314

Wang, Nian; Li, Jian-Liang; Lindow, Steven E

2012-11-01

65

A Novel Bipartite Centrosome Coordinates the Apicomplexan Cell Cycle  

PubMed Central

Apicomplexan parasites can change fundamental features of cell division during their life cycles, suspending cytokinesis when needed and changing proliferative scale in different hosts and tissues. The structural and molecular basis for this remarkable cell cycle flexibility is not fully understood, although the centrosome serves a key role in determining when and how much replication will occur. Here we describe the discovery of multiple replicating core complexes with distinct protein composition and function in the centrosome of Toxoplasma gondii. An outer core complex distal from the nucleus contains the TgCentrin1/TgSfi1 protein pair, along with the cartwheel protein TgSas-6 and a novel Aurora-related kinase, while an inner core closely aligned with the unique spindle pole (centrocone) holds distant orthologs of the CEP250/C-Nap protein family. This outer/inner spatial relationship of centrosome cores is maintained throughout the cell cycle. When in metaphase, the duplicated cores align to opposite sides of the kinetochores in a linear array. As parasites transition into S phase, the cores sequentially duplicate, outer core first and inner core second, ensuring that each daughter parasite inherits one copy of each type of centrosome core. A key serine/threonine kinase distantly related to the MAPK family is localized to the centrosome, where it restricts core duplication to once per cycle and ensures the proper formation of new daughter parasites. Genetic analysis of the outer core in a temperature-sensitive mutant demonstrated this core functions primarily in cytokinesis. An inhibition of ts-TgSfi1 function at high temperature caused the loss of outer cores and a severe block to budding, while at the same time the inner core amplified along with the unique spindle pole, indicating the inner core and spindle pole are independent and co-regulated. The discovery of a novel bipartite organization in the parasite centrosome that segregates the functions of karyokinesis and cytokinesis provides an explanation for how cell cycle flexibility is achieved in apicomplexan life cycles. PMID:25734885

Suvorova, Elena S.; Francia, Maria; Striepen, Boris; White, Michael W.

2015-01-01

66

A novel bipartite centrosome coordinates the apicomplexan cell cycle.  

PubMed

Apicomplexan parasites can change fundamental features of cell division during their life cycles, suspending cytokinesis when needed and changing proliferative scale in different hosts and tissues. The structural and molecular basis for this remarkable cell cycle flexibility is not fully understood, although the centrosome serves a key role in determining when and how much replication will occur. Here we describe the discovery of multiple replicating core complexes with distinct protein composition and function in the centrosome of Toxoplasma gondii. An outer core complex distal from the nucleus contains the TgCentrin1/TgSfi1 protein pair, along with the cartwheel protein TgSas-6 and a novel Aurora-related kinase, while an inner core closely aligned with the unique spindle pole (centrocone) holds distant orthologs of the CEP250/C-Nap protein family. This outer/inner spatial relationship of centrosome cores is maintained throughout the cell cycle. When in metaphase, the duplicated cores align to opposite sides of the kinetochores in a linear array. As parasites transition into S phase, the cores sequentially duplicate, outer core first and inner core second, ensuring that each daughter parasite inherits one copy of each type of centrosome core. A key serine/threonine kinase distantly related to the MAPK family is localized to the centrosome, where it restricts core duplication to once per cycle and ensures the proper formation of new daughter parasites. Genetic analysis of the outer core in a temperature-sensitive mutant demonstrated this core functions primarily in cytokinesis. An inhibition of ts-TgSfi1 function at high temperature caused the loss of outer cores and a severe block to budding, while at the same time the inner core amplified along with the unique spindle pole, indicating the inner core and spindle pole are independent and co-regulated. The discovery of a novel bipartite organization in the parasite centrosome that segregates the functions of karyokinesis and cytokinesis provides an explanation for how cell cycle flexibility is achieved in apicomplexan life cycles. PMID:25734885

Suvorova, Elena S; Francia, Maria; Striepen, Boris; White, Michael W

2015-03-01

67

Comparative genomics and functional analysis of rhamnose catabolic pathways and regulons in bacteria.  

PubMed

L-rhamnose (L-Rha) is a deoxy-hexose sugar commonly found in nature. L-Rha catabolic pathways were previously characterized in various bacteria including Escherichia coli. Nevertheless, homology searches failed to recognize all the genes for the complete L-Rha utilization pathways in diverse microbial species involved in biomass decomposition. Moreover, the regulatory mechanisms of L-Rha catabolism have remained unclear in most species. A comparative genomics approach was used to reconstruct the L-Rha catabolic pathways and transcriptional regulons in the phyla Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Thermotogae. The reconstructed pathways include multiple novel enzymes and transporters involved in the utilization of L-Rha and L-Rha-containing polymers. Large-scale regulon inference using bioinformatics revealed remarkable variations in transcriptional regulators for L-Rha utilization genes among bacteria. A novel bifunctional enzyme, L-rhamnulose-phosphate aldolase (RhaE) fused to L-lactaldehyde dehydrogenase (RhaW), which is not homologous to previously characterized L-Rha catabolic enzymes, was identified in diverse bacteria including Chloroflexi, Bacilli, and Alphaproteobacteria. By using in vitro biochemical assays we validated both enzymatic activities of the purified recombinant RhaEW proteins from Chloroflexus aurantiacus and Bacillus subtilis. Another novel enzyme of the L-Rha catabolism, L-lactaldehyde reductase (RhaZ), was identified in Gammaproteobacteria and experimentally validated by in vitro enzymatic assays using the recombinant protein from Salmonella typhimurium. C. aurantiacus induced transcription of the predicted L-Rha utilization genes when L-Rha was present in the growth medium and consumed L-Rha from the medium. This study provided comprehensive insights to L-Rha catabolism and its regulation in diverse Bacteria. PMID:24391637

Rodionova, Irina A; Li, Xiaoqing; Thiel, Vera; Stolyar, Sergey; Stanton, Krista; Fredrickson, James K; Bryant, Donald A; Osterman, Andrei L; Best, Aaron A; Rodionov, Dmitry A

2013-01-01

68

Comparative genomics and functional analysis of rhamnose catabolic pathways and regulons in bacteria  

PubMed Central

L-rhamnose (L-Rha) is a deoxy-hexose sugar commonly found in nature. L-Rha catabolic pathways were previously characterized in various bacteria including Escherichia coli. Nevertheless, homology searches failed to recognize all the genes for the complete L-Rha utilization pathways in diverse microbial species involved in biomass decomposition. Moreover, the regulatory mechanisms of L-Rha catabolism have remained unclear in most species. A comparative genomics approach was used to reconstruct the L-Rha catabolic pathways and transcriptional regulons in the phyla Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Thermotogae. The reconstructed pathways include multiple novel enzymes and transporters involved in the utilization of L-Rha and L-Rha-containing polymers. Large-scale regulon inference using bioinformatics revealed remarkable variations in transcriptional regulators for L-Rha utilization genes among bacteria. A novel bifunctional enzyme, L-rhamnulose-phosphate aldolase (RhaE) fused to L-lactaldehyde dehydrogenase (RhaW), which is not homologous to previously characterized L-Rha catabolic enzymes, was identified in diverse bacteria including Chloroflexi, Bacilli, and Alphaproteobacteria. By using in vitro biochemical assays we validated both enzymatic activities of the purified recombinant RhaEW proteins from Chloroflexus aurantiacus and Bacillus subtilis. Another novel enzyme of the L-Rha catabolism, L-lactaldehyde reductase (RhaZ), was identified in Gammaproteobacteria and experimentally validated by in vitro enzymatic assays using the recombinant protein from Salmonella typhimurium. C. aurantiacus induced transcription of the predicted L-Rha utilization genes when L-Rha was present in the growth medium and consumed L-Rha from the medium. This study provided comprehensive insights to L-Rha catabolism and its regulation in diverse Bacteria. PMID:24391637

Rodionova, Irina A.; Li, Xiaoqing; Thiel, Vera; Stolyar, Sergey; Stanton, Krista; Fredrickson, James K.; Bryant, Donald A.; Osterman, Andrei L.; Best, Aaron A.; Rodionov, Dmitry A.

2013-01-01

69

Identification of the MBF1 heat-response regulon of Arabidopsis thaliana  

PubMed Central

SUMMARY Brief periods of heat stress of even a few days can have a detrimental effect on yield production worldwide causing devastating economical and sociological impacts. Here we report on the identification of a new heat-response regulon in plants controlled by the multiprotein bridging factor 1c (MBF1c) protein of Arabidopsis thaliana. Members of the highly conserved MBF1 protein family function as non DNA-binding transcriptional co-activators involved in regulating metabolic and development pathways in different organisms from yeast to humans. Nonetheless, our studies suggest that MBF1c from Arabidopsis functions as a transcriptional regulator which binds DNA and controls the expression of 36 different transcripts during heat stress, including the important transcriptional regulator DRE-binding protein 2A (DREB2A), two heat shock transcription factors (HSFs), and several zinc finger proteins. We further identify CTAGA as a putative response element for MBF1c, demonstrate that the DNA-binding domain of MBF1c has a dominant-negative effect on heat tolerance when constitutively expressed in plants, and show that constitutive expression of MBF1c in soybean enhances yield production in plants grown under controlled growth conditions without causing adverse effects on growth. Our findings could have a significant impact on improving heat tolerance and yield of different crops subjected to heat stress. PMID:21457365

Suzuki, Nobuhiro; Sejima, Hiroe; Tam, Rachel; Schlauch, Karen; Mittler, Ron

2015-01-01

70

A chemical potentiator of copper-accumulation used to investigate the iron-regulons of Saccharomyces cerevisiae  

PubMed Central

The extreme resistance of Saccharomyces cerevisiae to copper is overcome by 2-(6-benzyl-2-pyridyl)quinazoline (BPQ), providing a chemical-biology tool which has been exploited in two lines of discovery. First, BPQ is shown to form a red (BPQ)2Cu(I) complex and promote Ctr1-independent copper-accumulation in whole cells and in mitochondria isolated from treated cells. Multiple phenotypes, including loss of aconitase activity, are consistent with copper-BPQ mediated damage to mitochondrial iron–sulphur clusters. Thus, a biochemical basis of copper-toxicity in S. cerevisiae is analogous to other organisms. Second, iron regulons controlled by Aft1/2, Cth2 and Yap5 that respond to mitochondrial iron–sulphur cluster status are modulated by copper-BPQ causing iron hyper-accumulation via upregulated iron-import. Comparison of copper-BPQ treated, untreated and copper-only treated wild-type and fra2? by RNA-seq has uncovered a new candidate Aft1 target-gene (LSO1) and paralogous non-target (LSO2), plus nine putative Cth2 target-transcripts. Two lines of evidence confirm that Fra2 dominates basal repression of the Aft1/2 regulons in iron-replete cultures. Fra2-independent control of these regulons is also observed but CTH2 itself appears to be atypically Fra2-dependent. However, control of Cth2-target transcripts which is independent of CTH2 transcript abundance or of Fra2, is also quantified. Use of copper-BPQ supports a substantial contribution of metabolite repression to iron-regulation. PMID:24895027

Foster, Andrew W; Dainty, Samantha J; Patterson, Carl J; Pohl, Ehmke; Blackburn, Hannah; Wilson, Clare; Hess, Corinna R; Rutherford, Julian C; Quaranta, Laura; Corran, Andy; Robinson, Nigel J

2014-01-01

71

Genetic Analysis of the AdnA Regulon in Pseudomonas fluorescens: Nonessential Role of Flagella in Adhesion to Sand and Biofilm Formation  

Microsoft Academic Search

Received 23 May 2002\\/Accepted 9 October 2002 AdnA is a transcription factor in Pseudomonas fluorescens that affects flagellar synthesis, biofilm formation, and sand adhesion. To identify the AdnA regulon, we used a promoterless Tn5-lacZ element to study the phenotypes of insertion mutants in the presence and absence of AdnA. Of 12,000 insertions, we identified seven different putative open reading frames

Eduardo A. Robleto; Inmaculada Lopez-Hernandez; Mark W. Silby; Stuart B. Levy

2003-01-01

72

Ubiquitous associations and a peak fall prevalence between apicomplexan symbionts and reef corals in Florida and the Bahamas  

NASA Astrophysics Data System (ADS)

Although apicomplexans are a widely recognized and important parasitic group, little is known about those associated with invertebrates, such as reef-building scleractinian corals. To resolve the potential impact of apicomplexans on coral health, it is first necessary to further describe this group of putative parasites and determine their prevalence among host species. Here, it was hypothesized that apicomplexan prevalence would vary seasonally, similar to what occurs in other marine apicomplexans as well as some coral symbionts. To test this, Caribbean scleractinian species Porites astreoides, Montastraea (= Orbicella) annularis, M. (= O.) faveolata, and Siderastrea siderea were sampled seasonally from two reefs each in the Florida Keys and the Bahamas for 9- and 5.5-year periods, respectively. Utilizing a PCR-based screening assay, apicomplexan DNA was detected from most Floridian (80.1 %: n = 555/693) and Bahamian (90.7 %: n = 311/343) coral tissue samples collected over these multi-year periods. Furthermore, apicomplexan DNA was detected from nearly all (98.7 %: n = 78/79) single polyps sampled at multiple locations within six M. faveolata colonies, indicating little to no intracolonial variation in the screening assay. Mixed-model logistic regression was utilized to determine the effects of season, host species, and reef on apicomplexan prevalence. The model identified a significant seasonal effect, with the highest apicomplexan prevalence occurring during fall. There also was a large effect of host species, with apicomplexan prevalence significantly lower among S. siderea colonies relative to the other species. While reef did not have a significant effect in the full model, there was a significant difference in apicomplexan prevalence between Floridian and Bahamian reefs for S. siderea, implying regional differences in this host species. Despite seasonal and species-specific differences in prevalence, apicomplexans are ubiquitous constituents of these particular scleractinian coral species from Florida and the Bahamas.

Kirk, N. L.; Thornhill, D. J.; Kemp, D. W.; Fitt, W. K.; Santos, S. R.

2013-09-01

73

The Gac Regulon of Pseudomonas fluorescens SBW25  

Technology Transfer Automated Retrieval System (TEKTRAN)

Transcriptome analysis of Pseudomonas fluorescens SBW25 showed that 702 genes were differentially regulated (FC>4, P<0.0001) in a gacS::Tn5 mutant, with 300 and 402 genes up- and down-regulated, respectively. Similar to the Gac-regulon of four other Pseudomonas species, genes involved in motility, b...

74

Modulation of toxin production by the flagellar regulon in Clostridium difficile.  

PubMed

We show in this study that toxin production in Clostridium difficile is altered in cells which can no longer form flagellar filaments. The impact of inactivation of fliC, CD0240, fliF, fliG, fliM, and flhB-fliR flagellar genes upon toxin levels in culture supernatants was assessed using cell-based cytotoxicity assay, proteomics, immunoassay, and immunoblotting approaches. Each of these showed that toxin levels in supernatants were significantly increased in a fliC mutant compared to that in the C. difficile 630 parent strain. In contrast, the toxin levels in supernatants secreted from other flagellar mutants were significantly reduced compared with that in the parental C. difficile 630 strain. Transcriptional analysis of the pathogenicity locus genes (tcdR, tcdB, tcdE, and tcdA) revealed a significant increase of all four genes in the fliC mutant strain, while transcription of all four genes was significantly reduced in fliM, fliF, fliG, and flhB-fliR mutants. These results demonstrate that toxin transcription in C. difficile is modulated by the flagellar regulon. More significantly, mutant strains showed a corresponding change in virulence compared to the 630 parent strain when tested in a hamster model of C. difficile infection. This is the first demonstration of differential flagellum-related transcriptional regulation of toxin production in C. difficile and provides evidence for elaborate regulatory networks for virulence genes in C. difficile. PMID:22851750

Aubry, Annie; Hussack, Greg; Chen, Wangxue; KuoLee, Rhonda; Twine, Susan M; Fulton, Kelly M; Foote, Simon; Carrillo, Catherine D; Tanha, Jamshid; Logan, Susan M

2012-10-01

75

The Iron Stimulon and Fur Regulon of Geobacter sulfurreducens and Their Role in Energy Metabolism  

PubMed Central

Iron plays a critical role in the physiology of Geobacter species. It serves as both an essential component for proteins and cofactors and an electron acceptor during anaerobic respiration. Here, we investigated the iron stimulon and ferric uptake regulator (Fur) regulon of Geobacter sulfurreducens to examine the coordination between uptake of Fe(II) and the reduction of Fe(III) at the transcriptional level. Gene expression studies across a variety of different iron concentrations in both the wild type and a ?fur mutant strain were used to determine the iron stimulon. The stimulon consists of a broad range of gene products, ranging from iron-utilizing to central metabolism and iron reduction proteins. Integration of gene expression and chromatin immunoprecipitation (ChIP) data sets assisted in the identification of the Fur transcriptional regulatory network and Fur's role as a regulator of the iron stimulon. Additional physiological and transcriptional analyses of G. sulfurreducens grown with various Fe(II) concentrations revealed the depth of Fur's involvement in energy metabolism and the existence of redundancy within the iron-regulatory network represented by IdeR, an alternative iron transcriptional regulator. These characteristics enable G. sulfurreducens to thrive in environments with fluctuating iron concentrations by providing it with a robust mechanism to maintain tight and deliberate control over intracellular iron homeostasis. PMID:24584254

Embree, Mallory; Qiu, Yu; Shieu, Wendy; Nagarajan, Harish; O'Neil, Regina; Lovley, Derek

2014-01-01

76

The iron stimulon and fur regulon of Geobacter sulfurreducens and their role in energy metabolism.  

PubMed

Iron plays a critical role in the physiology of Geobacter species. It serves as both an essential component for proteins and cofactors and an electron acceptor during anaerobic respiration. Here, we investigated the iron stimulon and ferric uptake regulator (Fur) regulon of Geobacter sulfurreducens to examine the coordination between uptake of Fe(II) and the reduction of Fe(III) at the transcriptional level. Gene expression studies across a variety of different iron concentrations in both the wild type and a ?fur mutant strain were used to determine the iron stimulon. The stimulon consists of a broad range of gene products, ranging from iron-utilizing to central metabolism and iron reduction proteins. Integration of gene expression and chromatin immunoprecipitation (ChIP) data sets assisted in the identification of the Fur transcriptional regulatory network and Fur's role as a regulator of the iron stimulon. Additional physiological and transcriptional analyses of G. sulfurreducens grown with various Fe(II) concentrations revealed the depth of Fur's involvement in energy metabolism and the existence of redundancy within the iron-regulatory network represented by IdeR, an alternative iron transcriptional regulator. These characteristics enable G. sulfurreducens to thrive in environments with fluctuating iron concentrations by providing it with a robust mechanism to maintain tight and deliberate control over intracellular iron homeostasis. PMID:24584254

Embree, Mallory; Qiu, Yu; Shieu, Wendy; Nagarajan, Harish; O'Neil, Regina; Lovley, Derek; Zengler, Karsten

2014-05-01

77

Modulation of Toxin Production by the Flagellar Regulon in Clostridium difficile  

PubMed Central

We show in this study that toxin production in Clostridium difficile is altered in cells which can no longer form flagellar filaments. The impact of inactivation of fliC, CD0240, fliF, fliG, fliM, and flhB-fliR flagellar genes upon toxin levels in culture supernatants was assessed using cell-based cytotoxicity assay, proteomics, immunoassay, and immunoblotting approaches. Each of these showed that toxin levels in supernatants were significantly increased in a fliC mutant compared to that in the C. difficile 630 parent strain. In contrast, the toxin levels in supernatants secreted from other flagellar mutants were significantly reduced compared with that in the parental C. difficile 630 strain. Transcriptional analysis of the pathogenicity locus genes (tcdR, tcdB, tcdE, and tcdA) revealed a significant increase of all four genes in the fliC mutant strain, while transcription of all four genes was significantly reduced in fliM, fliF, fliG, and flhB-fliR mutants. These results demonstrate that toxin transcription in C. difficile is modulated by the flagellar regulon. More significantly, mutant strains showed a corresponding change in virulence compared to the 630 parent strain when tested in a hamster model of C. difficile infection. This is the first demonstration of differential flagellum-related transcriptional regulation of toxin production in C. difficile and provides evidence for elaborate regulatory networks for virulence genes in C. difficile. PMID:22851750

Aubry, Annie; Hussack, Greg; Chen, Wangxue; KuoLee, Rhonda; Twine, Susan M.; Fulton, Kelly M.; Foote, Simon; Carrillo, Catherine D.; Tanha, Jamshid

2012-01-01

78

The HU Regulon Is Composed of Genes Responding to Anaerobiosis, Acid Stress, High Osmolarity and SOS Induction  

PubMed Central

Background The Escherichia coli heterodimeric HU protein is a small DNA-bending protein associated with the bacterial nucleoid. It can introduce negative supercoils into closed circular DNA in the presence of topoisomerase I. Cells lacking HU grow very poorly and display many phenotypes. Methodology/Principal Findings We analyzed the transcription profile of every Escherichia coli gene in the absence of one or both HU subunits. This genome-wide in silico transcriptomic approach, performed in parallel with in vivo genetic experimentation, defined the HU regulon. This large regulon, which comprises 8% of the genome, is composed of four biologically relevant gene classes whose regulation responds to anaerobiosis, acid stress, high osmolarity, and SOS induction. Conclusions/Significance The regulation a large number of genes encoding enzymes involved in energy metabolism and catabolism pathways by HU explains the highly pleiotropic phenotype of HU-deficient cells. The uniform chromosomal distribution of the many operons regulated by HU strongly suggests that the transcriptional and nucleoid architectural functions of HU constitute two aspects of a unique protein-DNA interaction mechanism. PMID:19194530

Oberto, Jacques; Nabti, Sabrina; Jooste, Valérie; Mignot, Hervé; Rouviere-Yaniv, Josette

2009-01-01

79

Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry.  

PubMed

We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 ?M exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB. PMID:24861620

Jha, Ramesh K; Kern, Theresa L; Fox, David T; M Strauss, Charlie E

2014-07-01

80

Streptococcus mutans NADH Oxidase Lies at the Intersection of Overlapping Regulons Controlled by Oxygen and NAD+ Levels  

PubMed Central

NADH oxidase (Nox, encoded by nox) is a flavin-containing enzyme used by the oral pathogen Streptococcus mutans to reduce diatomic oxygen to water while oxidizing NADH to NAD+. The critical nature of Nox is 2-fold: it serves to regenerate NAD+, a carbon cycle metabolite, and to reduce intracellular oxygen, preventing formation of destructive reactive oxygen species (ROS). As oxygen and NAD+ have been shown to modulate the activity of the global transcription factors Spx and Rex, respectively, Nox is potentially poised at a critical junction of two stress regulons. In this study, microarray data showed that either addition of oxygen or loss of nox resulted in altered expression of genes involved in energy metabolism and transport and the upregulation of genes encoding ROS-metabolizing enzymes. Loss of nox also resulted in upregulation of several genes encoding transcription factors and signaling molecules, including the redox-sensing regulator gene rex. Characterization of the nox promoter revealed that nox was regulated by oxygen, through SpxA, and by Rex. These data suggest a regulatory loop in which the roles of nox in reduction of oxygen and regeneration of NAD+ affect the activity levels of Spx and Rex, respectively, and their regulons, which control several genes, including nox, crucial to growth of S. mutans under conditions of oxidative stress. PMID:24682329

Baker, J. L.; Derr, A. M.; Karuppaiah, K.; MacGilvray, M. E.; Kajfasz, J. K.; Faustoferri, R. C.; Rivera-Ramos, I.; Bitoun, J. P.; Lemos, J. A.; Wen, Z. T.

2014-01-01

81

Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry  

PubMed Central

We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 ?M exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB. PMID:24861620

Jha, Ramesh K.; Kern, Theresa L.; Fox, David T.; M. Strauss, Charlie E.

2014-01-01

82

Evolution of Chloroplast Transcript Processing in Plasmodium and Its Chromerid Algal Relatives  

PubMed Central

It is well understood that apicomplexan parasites, such as the malaria pathogen Plasmodium, are descended from free-living algae, and maintain a vestigial chloroplast that has secondarily lost all genes of photosynthetic function. Recently, two fully photosynthetic relatives of parasitic apicomplexans have been identified, the ‘chromerid’ algae Chromera velia and Vitrella brassicaformis, which retain photosynthesis genes within their chloroplasts. Elucidating the processes governing gene expression in chromerid chloroplasts might provide valuable insights into the origins of parasitism in the apicomplexans. We have characterised chloroplast transcript processing pathways in C. velia, V. brassicaformis and P. falciparum with a focus on the addition of an unusual, 3? poly(U) tail. We demonstrate that poly(U) tails in chromerids are preferentially added to transcripts that encode proteins that are directly involved in photosynthetic electron transfer, over transcripts for proteins that are not involved in photosynthesis. To our knowledge, this represents the first chloroplast transcript processing pathway to be associated with a particular functional category of genes. In contrast, Plasmodium chloroplast transcripts are not polyuridylylated. We additionally present evidence that poly(U) tail addition in chromerids is involved in the alternative processing of polycistronic precursors covering multiple photosynthesis genes, and appears to be associated with high levels of transcript abundance. We propose that changes to the chloroplast transcript processing machinery were an important step in the loss of photosynthesis in ancestors of parasitic apicomplexans. PMID:24453981

Dorrell, Richard G.; Drew, James; Nisbet, R. Ellen R.; Howe, Christopher J.

2014-01-01

83

Genome Sequence of Babesia bovis and Camparative Analysis of Apicomplexan Hemoprotozoa  

Technology Transfer Automated Retrieval System (TEKTRAN)

Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related...

84

Fatty acid and sterol metabolism: potential antimicrobial targets in apicomplexan and trypanosomatid parasitic protozoa  

Microsoft Academic Search

Current treatments for diseases caused by apicomplexan and trypanosomatid parasites are inadequate due to toxicity, the development of drug resistance and an inability to eliminate all life cycle stages of these parasites from the host. New therapeutics agents are urgently required. It has recently been demonstrated that type II fatty acid biosynthesis occurs in the plastid of Plasmodium falciparum and

C. W. Roberts; R. McLeod; D. W. Rice; M. Ginger; M. L. Chance; L. J. Goad

2003-01-01

85

Forward Genetic Analysis of the Apicomplexan Cell Division Cycle in Toxoplasma gondii  

Microsoft Academic Search

Apicomplexa are obligate intracellular pathogens that have fine-tuned their proliferative strategies to match a large variety of host cells. A critical aspect of this adaptation is a flexible cell cycle that remains poorly understood at the mechanistic level. Here we describe a forward genetic dissection of the apicomplexan cell cycle using the Toxoplasma model. By high-throughput screening, we have isolated

Marc-Jan Gubbels; Margaret Lehmann; Mani Muthalagi; Maria E Jerome; Carrie F Brooks; Tomasz Szatanek; Jayme Flynn; Ben Parrot; Josh Radke; Boris Striepen; Michael W White

2008-01-01

86

The identification of a sequence related to apicomplexan enolase from Sarcocystis neurona  

Microsoft Academic Search

Equine protozoal myeloencephalitis (EPM) is a neurological disease caused by Sarcocystis neurona, an apicomplexan parasite. S. neurona is also associated with EPM-like diseases in marine and small mammals. The mechanisms of transmission and ability to infect a wide host range remain obscure; therefore, characterization of essential proteins may provide evolutionary information allowing the development of novel chemotherapeutics that target non-mammalian

A. P. Wilson; J. J. Thelen; J. Lakritz; C. R. Brown; A. E. Marsh

2004-01-01

87

Prediction and overview of the RpoN-regulon in closely related species of the Rhizobiales  

PubMed Central

Background In the rhizobia, a group of symbiotic Gram-negative soil bacteria, RpoN (?54, ?N, NtrA) is best known as the sigma factor enabling transcription of the nitrogen fixation genes. Recent reports, however, demonstrate the involvement of RpoN in other symbiotic functions, although no large-scale effort has yet been undertaken to unravel the RpoN-regulon in rhizobia. We screened two complete rhizobial genomes (Mesorhizobium loti, Sinorhizobium meliloti) and four symbiotic regions (Rhizobium etli, Rhizobium sp. NGR234, Bradyrhizobium japonicum, M. loti) for the presence of the highly conserved RpoN-binding sites. A comparison was also made with two closely related non-symbiotic members of the Rhizobiales (Agrobacterium tumefaciens, Brucella melitensis). Results A highly specific weight-matrix-based screening method was applied to predict members of the RpoN-regulon, which were stored in a highly annotated and manually curated dataset. Possible enhancer-binding proteins (EBPs) controlling the expression of RpoN-dependent genes were predicted with a profile hidden Markov model. Conclusions The methodology used to predict RpoN-binding sites proved highly effective as nearly all known RpoN-controlled genes were identified. In addition, many new RpoN-dependent functions were found. The dependency of several of these diverse functions on RpoN seems species-specific. Around 30% of the identified genes are hypothetical. Rhizobia appear to have recruited RpoN for symbiotic processes, whereas the role of RpoN in A. tumefaciens and B. melitensis remains largely to be elucidated. All species screened possess at least one uncharacterized EBP as well as the usual ones. Lastly, RpoN could significantly broaden its working range by direct interfering with the binding of regulatory proteins to the promoter DNA. PMID:12537565

Dombrecht, Bruno; Marchal, Kathleen; Vanderleyden, Jos; Michiels, Jan

2002-01-01

88

Genome wide analysis of the complete GlnR nitrogen-response regulon in Mycobacterium smegmatis  

PubMed Central

Background Nitrogen is an essential element for bacterial growth and an important component of biological macromolecules. Consequently, responding to nitrogen limitation is critical for bacterial survival and involves the interplay of signalling pathways and transcriptional regulation of nitrogen assimilation and scavenging genes. In the soil dwelling saprophyte Mycobacterium smegmatis the OmpR-type response regulator GlnR is thought to mediate the transcriptomic response to nitrogen limitation. However, to date only ten genes have been shown to be in the GlnR regulon, a vastly reduced number compared to other organisms. Results We investigated the role of GlnR in the nitrogen limitation response and determined the entire GlnR regulon, by combining expression profiling of M. smegmatis wild type and glnR deletion mutant, with GlnR-specific chromatin immunoprecipitation and high throughput sequencing. We identify 53 GlnR binding sites during nitrogen limitation that control the expression of over 100 genes, demonstrating that GlnR is the regulator controlling the assimilation and utilisation of nitrogen. We also determine a consensus GlnR binding motif and identify key residues within the motif that are required for specific GlnR binding. Conclusions We have demonstrated that GlnR is the global nitrogen response regulator in M. smegmatis, directly regulating the expression of more than 100 genes. GlnR controls key nitrogen stress survival processes including primary nitrogen metabolism pathways, the ability to utilise nitrate and urea as alternative nitrogen sources, and the potential to use cellular components to provide a source of ammonium. These studies further our understanding of how mycobacteria survive nutrient limiting conditions. PMID:23642041

2013-01-01

89

Selective inhibition of yeast regulons by daunorubicin: A transcriptome-wide analysis  

PubMed Central

Background The antitumor drug daunorubicin exerts some of its cytotoxic effects by binding to DNA and inhibiting the transcription of different genes. We analysed this effect in vivo at the transcriptome level using the budding yeast Saccharomyces cerevisiae as a model and sublethal (IC40) concentrations of the drug to minimise general toxic effects. Results Daunorubicin affected a minor proportion (14%) of the yeast transcriptome, increasing the expression of 195 genes and reducing expression of 280 genes. Daunorubicin down-regulated genes included essentially all genes involved in the glycolytic pathway, the tricarboxylic acid cycle and alcohol metabolism, whereas transcription of ribosomal protein genes was not affected or even slightly increased. This pattern is consistent with a specific inhibition of glucose usage in treated cells, with only minor effects on proliferation or other basic cell functions. Analysis of promoters of down-regulated genes showed that they belong to a limited number of transcriptional regulatory units (regulons). Consistently, data mining showed that daunorubicin-induced changes in expression patterns were similar to those observed in yeast strains deleted for some transcription factors functionally related to the glycolysis and/or the cAMP regulatory pathway, which appeared to be particularly sensitive to daunorubicin. Conclusion The effects of daunorubicin treatment on the yeast transcriptome are consistent with a model in which this drug impairs binding of different transcription factors by competing for their DNA binding sequences, therefore limiting their effectiveness and affecting the corresponding regulatory networks. This proposed mechanism might have broad therapeutic implications against cancer cells growing under hypoxic conditions. PMID:18667070

Rojas, Marta; Casado, Marta; Portugal, José; Piña, Benjamin

2008-01-01

90

Transcriptome-based analysis of the Pantoea stewartii quorum-sensing regulon and identification of EsaR direct targets.  

PubMed

Pantoea stewartii subsp. stewartii is a proteobacterium that causes Stewart's wilt disease in corn plants. The bacteria form a biofilm in the xylem of infected plants and produce capsule that blocks water transport, eventually causing wilt. At low cell densities, the quorum-sensing (QS) regulatory protein EsaR is known to directly repress expression of esaR itself as well as the genes for the capsular synthesis operon transcription regulator, rcsA, and a 2,5-diketogluconate reductase, dkgA. It simultaneously directly activates expression of genes for a putative small RNA, esaS, the glycerol utilization operon, glpFKX, and another transcriptional regulator, lrhA. At high bacterial cell densities, all of this regulation is relieved when EsaR binds an acylated homoserine lactone signal, which is synthesized constitutively over growth. QS-dependent gene expression is critical for the establishment of disease in the plant. However, the identity of the full set of genes controlled by EsaR/QS is unknown. A proteomic approach previously identified around 30 proteins in the QS regulon. In this study, a whole-transcriptome, next-generation sequencing analysis of rRNA-depleted RNA from QS-proficient and -deficient P. stewartii strains was performed to identify additional targets of EsaR. EsaR-dependent transcriptional regulation of a subset of differentially expressed genes was confirmed by quantitative reverse transcription-PCR (qRT-PCR). Electrophoretic mobility shift assays demonstrated that EsaR directly bound 10 newly identified target promoters. Overall, the QS regulon of P. stewartii orchestrates three major physiological responses: capsule and cell envelope biosynthesis, surface motility and adhesion, and stress response. PMID:25015891

Ramachandran, Revathy; Burke, Alison Kernell; Cormier, Guy; Jensen, Roderick V; Stevens, Ann M

2014-09-01

91

Transcriptome-Based Analysis of the Pantoea stewartii Quorum-Sensing Regulon and Identification of EsaR Direct Targets  

PubMed Central

Pantoea stewartii subsp. stewartii is a proteobacterium that causes Stewart's wilt disease in corn plants. The bacteria form a biofilm in the xylem of infected plants and produce capsule that blocks water transport, eventually causing wilt. At low cell densities, the quorum-sensing (QS) regulatory protein EsaR is known to directly repress expression of esaR itself as well as the genes for the capsular synthesis operon transcription regulator, rcsA, and a 2,5-diketogluconate reductase, dkgA. It simultaneously directly activates expression of genes for a putative small RNA, esaS, the glycerol utilization operon, glpFKX, and another transcriptional regulator, lrhA. At high bacterial cell densities, all of this regulation is relieved when EsaR binds an acylated homoserine lactone signal, which is synthesized constitutively over growth. QS-dependent gene expression is critical for the establishment of disease in the plant. However, the identity of the full set of genes controlled by EsaR/QS is unknown. A proteomic approach previously identified around 30 proteins in the QS regulon. In this study, a whole-transcriptome, next-generation sequencing analysis of rRNA-depleted RNA from QS-proficient and -deficient P. stewartii strains was performed to identify additional targets of EsaR. EsaR-dependent transcriptional regulation of a subset of differentially expressed genes was confirmed by quantitative reverse transcription-PCR (qRT-PCR). Electrophoretic mobility shift assays demonstrated that EsaR directly bound 10 newly identified target promoters. Overall, the QS regulon of P. stewartii orchestrates three major physiological responses: capsule and cell envelope biosynthesis, surface motility and adhesion, and stress response. PMID:25015891

Ramachandran, Revathy; Burke, Alison Kernell; Cormier, Guy; Jensen, Roderick V.

2014-01-01

92

Effects of Enrichment on Expression of Key Nutrient Regulons in Extremophiles in Hydrothermal Springs at Yellowstone National Park  

NASA Astrophysics Data System (ADS)

To cope with nutrient limitation, micro-organisms have evolved diverse means to increase acquisition of nutrients such as ammonium, nitrate, and phosphate and trace metals when they become limiting. These strategies typically involve production of compound-specific transporters (i.e., ammonium transporters) or extracellular enzymes (i.e., alkaline phosphatase). Genes that encode these proteins are often under the control of shared regulatory proteins called regulons. Regulons of genes for N, P, or Fe metabolism ultimately affect the transport of vital nutrients into and out of cells and thus help organisms deal with nutrient limitation. Regulons for N, P, and Fe have been found and studied ex situ for model organisms under various nutrient-limiting conditions but are relatively unstudied in the field, especially in hydrothermal systems. The aim of this study was to characterize transcription patterns of genes for N, P, and Fe processing under experimental nutrient enrichment in a complex microbial community from an alkaline hot spring located in Yellowstone National Park. Microbial mat samples and hot spring water were placed in bottles, subjected to a fully factorial manipulation of N (125 ?M N as ammonium nitrate), phosphorus (7.8 ?M P as sodium phosphate), and Fe (7.8 x 10-2 ?M Fe as ferric citrate), and incubated overnight at in situ temperatures. Following incubation, hot spring water was filtered and preserved for nutrient analyses and biomass subsamples were snap-frozen for molecular analysis. Chemical analysis showed a total removal of NH4 and PO4 from the water in all treatments. NO3 decreased slightly in most treatments (control, +N, +P, +Fe, +PFe, and +NPFe) but increased in the others (+NFe and +NP). Interestingly, Fe concentrations were lower in amended samples (+Fe, +NFe, +PFe, and +NPFe) than in unamended samples (control, +N, +P, +NP). To assess the transcriptional responses, primers were designed to target genes controlled by the ferric uptake regulator (Fur), phosphate-responsive signal transduction pathway (Pho), and the nitrogen transcriptional regulator TnrA. These genes-glnA, nrgAB, narB, yusV, asnRS, gltA, pstS, tagA, and phoA- have been successfully sequenced in our microbial mat community. Gene expression work is currently underway to determine if transcription of these genes is altered under single nutrient limitation and/or co-limitation, thus reflecting the results seen in the water chemistry data.

Knowlton, M.; Elser, J. J.; Poret-peterson, A. T.

2011-12-01

93

RNA regulons in Hox 5' UTRs confer ribosome specificity to gene regulation.  

PubMed

Emerging evidence suggests that the ribosome has a regulatory function in directing how the genome is translated in time and space. However, how this regulation is encoded in the messenger RNA sequence remains largely unknown. Here we uncover unique RNA regulons embedded in homeobox (Hox) 5' untranslated regions (UTRs) that confer ribosome-mediated control of gene expression. These structured RNA elements, resembling viral internal ribosome entry sites (IRESs), are found in subsets of Hox mRNAs. They facilitate ribosome recruitment and require the ribosomal protein RPL38 for their activity. Despite numerous layers of Hox gene regulation, these IRES elements are essential for converting Hox transcripts into proteins to pattern the mammalian body plan. This specialized mode of IRES-dependent translation is enabled by an additional regulatory element that we term the translation inhibitory element (TIE), which blocks cap-dependent translation of transcripts. Together, these data uncover a new paradigm for ribosome-mediated control of gene expression and organismal development. PMID:25409156

Xue, Shifeng; Tian, Siqi; Fujii, Kotaro; Kladwang, Wipapat; Das, Rhiju; Barna, Maria

2015-01-01

94

Role of the mar-sox-rob Regulon in Regulating Outer Membrane Porin Expression?†  

PubMed Central

Multiple factors control the expression of the outer membrane porins OmpF and OmpC in Escherichia coli. In this work, we investigated the role of the mar-sox-rob regulon in regulating outer membrane porin expression in response to salicylate. We provide both genetic and physiological evidence that MarA and Rob can independently activate micF transcription in response to salicylate, leading to reduced OmpF expression. MarA was also found to repress OmpF expression through a MicF-independent pathway. In the case of OmpC, we found that its transcription was moderately increased in response to salicylate. However, this increase was independent of MarA and Rob. Finally, we found that the reduction in OmpF expression in a tolC mutant is due primarily to Rob. Collectively, this work further clarifies the coordinated role of MarA and Rob in regulating the expression of the outer membrane porins. PMID:21398557

Chubiz, Lon M.; Rao, Christopher V.

2011-01-01

95

Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii  

PubMed Central

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

2013-01-01

96

Pondering the puzzle of PML (promyelocytic leukemia) nuclear bodies: Can we fit the pieces together using an RNA regulon?  

PubMed Central

Summary The promyelocytic leukemia protein PML and its associated nuclear bodies are hot topics of investigation. This interest arises for multiple reasons including the tight link between the integrity of PML nuclear bodies and several disease states and the impact of the PML protein and PML nuclear bodies on proliferation, apoptosis and viral infection. Unfortunately, an understanding of the molecular underpinnings of PML nuclear body function remains elusive. Here, a general overview of the PML field is provided and is extended to discuss whether some of the basic tenets of “PML-ology” are still valid. For instance, recent findings suggest that some components of PML nuclear bodies form bodies in the absence of the PML protein. Also, a new model for PML nuclear body function is proposed which provides a unifying framework for its effects on diverse biochemical pathways such as Akt signaling and the p53-Mdm2 axis. In this model, the PML protein acts as an inhibitor of gene expression post-transcriptionally via inhibiting a network node in the eIF4E RNA regulon. An example is given for how the PML RNA regulon model provided the basis for the development of a new anti-cancer strategy being tested in the clinic. PMID:18616965

Borden, Katherine L.B.

2008-01-01

97

The CBF1-dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp.  

PubMed

The meristematic tissues of temperate woody perennials must acclimate to freezing temperatures to survive the winter and resume growth the following year. To determine whether the C-repeat binding factor (CBF) family of transcription factors contributing to this process in annual herbaceous species also functions in woody perennials, we investigated the changes in phenotype and transcript profile of transgenic Populus constitutively expressing CBF1 from Arabidopsis (AtCBF1). Ectopic expression of AtCBF1 was sufficient to significantly increase the freezing tolerance of non-acclimated leaves and stems relative to wild-type plants. cDNA microarray experiments identified genes up-regulated by ectopic AtCBF1 expression in Populus, demonstrated a strong conservation of the CBF regulon between Populus and Arabidopsis and identified differences between leaf and stem regulons. We studied the induction kinetics and tissue specificity of four CBF paralogues identified from the Populus balsamifera subsp. trichocarpa genome sequence (PtCBFs). All four PtCBFs are cold-inducible in leaves, but only PtCBF1 and PtCBF3 show significant induction in stems. Our results suggest that the central role played by the CBF family of transcriptional activators in cold acclimation of Arabidopsis has been maintained in Populus. However, the differential expression of the PtCBFs and differing clusters of CBF-responsive genes in annual (leaf) and perennial (stem) tissues suggest that the perennial-driven evolution of winter dormancy may have given rise to specific roles for these 'master-switches' in the different annual and perennial tissues of woody species. PMID:17080948

Benedict, Catherine; Skinner, Jeffrey S; Meng, Rengong; Chang, Yongjian; Bhalerao, Rishikesh; Huner, Norman P A; Finn, Chad E; Chen, Tony H H; Hurry, Vaughan

2006-07-01

98

Genetic characterization of the HrpL regulon of the fire blight pathogen Erwinia amylovora reveals novel virulence factors.  

PubMed

The bacterial pathogen Erwinia amylovora is the causal agent of fire blight, an economically significant disease of apple and pear. Disease initiation by E. amylovora requires the translocation of effector proteins into host cells via the hypersensitive response and pathogenicity (hrp) type III secretion system (T3SS). The alternative sigma factor HrpL positively regulates the transcription of structural and translocated components of the T3SS via hrp promoter elements. To characterize genome-wide HrpL-dependent gene expression in E. amylovora Ea1189, wild-type and Ea1189?hrpL strains were cultured in hrp-inducing minimal medium, and total RNA was compared using a custom microarray designed to represent the annotated genes of E. amylovora ATCC 49946. The results revealed 24 genes differentially regulated in Ea1189?hrpL relative to Ea1189 with fold-change expression ratios greater than 1.5; of these, 19 genes exhibited decreased transcript abundance and five genes showed increased transcript abundance relative to Ea1189. To expand our understanding of the HrpL regulon and to elucidate direct versus indirect HrpL-mediated effects on gene expression, the genome of E. amylovora ATCC 49946 was examined in silico using a hidden Markov model assembled from known Erwinia spp. hrp promoters. This technique identified 15 putative type III novel hrp promoters, seven of which were validated with quantitative polymerase chain reaction based on expression analyses. It was found that HrpL-regulated genes encode all known components of the hrp T3SS, as well as five putative type III effectors. Eight genes displayed apparent indirect HrpL regulation, suggesting that the HrpL regulon is connected to downstream signalling networks. The construction of deletion mutants of three novel HrpL-regulated genes resulted in the identification of additional virulence factors as well as mutants displaying abnormal motility and biofilm phenotypes. PMID:21831138

McNally, R Ryan; Toth, Ian K; Cock, Peter J A; Pritchard, Leighton; Hedley, Pete E; Morris, Jenny A; Zhao, Youfu; Sundin, George W

2012-02-01

99

Identification of the Alternative Sigma Factor SigX Regulon and Its Implications for Pseudomonas aeruginosa Pathogenicity  

PubMed Central

Pseudomonas aeruginosa is distinguished by its broad metabolic diversity and its remarkable capability for adaptation, which relies on a large collection of transcriptional regulators and alternative sigma (?) factors. The largest group of alternative ? factors is that of the extracytoplasmic function (ECF) ? factors, which control key transduction pathways for maintenance of envelope homeostasis in response to external stress and cell growth. In addition, there are specific roles of alternative ? factors in regulating the expression of virulence and virulence-associated genes. Here, we analyzed a deletion mutant of the ECF ? factor SigX and applied mRNA profiling to define the SigX-dependent regulon in P. aeruginosa in response to low-osmolarity-medium conditions. Furthermore, the combination of transcriptional data with chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) led to the identification of the DNA binding motif of SigX. Genome-wide mapping of SigX-binding regions revealed enrichment of downstream genes involved in fatty acid biosynthesis, type III secretion, swarming and cyclic di-GMP (c-di-GMP) signaling. In accordance, a sigX deletion mutant exhibited altered fatty acid composition of the cell membrane, reduced cytotoxicity, impaired swarming activity, elevated c-di-GMP levels, and increased biofilm formation. In conclusion, a combination of ChIP-seq with transcriptional profiling and bioinformatic approaches to define consensus DNA binding sequences proved to be effective for the elucidation of the regulon of the alternative ? factor SigX, revealing its role in complex virulence-associated phenotypes in P. aeruginosa. PMID:24187091

Blanka, Andrea; Schulz, Sebastian; Eckweiler, Denitsa; Franke, Raimo; Bielecka, Agata; Nicolai, Tanja; Casilag, Fiordiligie; Düvel, Juliane; Abraham, Wolf-Rainer; Kaever, Volkhard

2013-01-01

100

Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium  

SciTech Connect

Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond (Toronto); (WU-MED)

2010-09-21

101

ApiDB: integrated resources for the apicomplexan bioinformatics resource center  

PubMed Central

ApiDB () represents a unified entry point for the NIH-funded Apicomplexan Bioinformatics Resource Center (BRC) that integrates numerous database resources and multiple data types. The phylum Apicomplexa comprises numerous veterinary and medically important parasitic protozoa including human pathogenic species of the genera Cryptosporidium, Plasmodium and Toxoplasma. ApiDB serves not only as a database in its own right, but as a single web-based point of entry that unifies access to three major existing individual organism databases (, and CryptoDB.org), and integrates these databases with data available from additional sources. Through the ApiDB site, users may pose queries and search all available apicomplexan data and tools, or they may visit individual component organism databases. PMID:17098930

Aurrecoechea, Cristina; Heiges, Mark; Wang, Haiming; Wang, Zhiming; Fischer, Steve; Rhodes, Philippa; Miller, John; Kraemer, Eileen; Stoeckert, Christian J.; Roos, David S.; Kissinger, Jessica C.

2007-01-01

102

Virulence regulons of enterotoxigenic Escherichia coli.  

PubMed

Enterotoxigenic Escherichia coli is frequently associated with travelers' diarrhea and is a leading cause of infant and childhood mortality in developing countries. Disease is dependent upon the orchestrated expression of enterotoxins, flexible adhesive pili, and other virulence factors. Both the heat-labile (LT) and heat-stable (ST-H) enterotoxins are regulated at the level of transcription by cAMP-receptor protein which represses the expression of LT while activating expression of ST-H. The expression of many different serotypes of adhesive pili is regulated by Rns, a member of the AraC family that represents a subgroup of conserved virulence regulators from several enteric pathogens. These Rns-like regulators recognize similar DNA binding sites, and a compiled sequence logo suggests they may bind DNA through both major and minor groove interactions. These regulators are also tempting targets for novel therapeutics because they play pivotal roles during infection. To that end, high-throughput screens have begun to identify compounds that inhibit the activity of these regulators, predominately by interfering with DNA binding. PMID:24203442

Munson, George P

2013-12-01

103

Several recent studies suggest that transcriptional rewiring similar  

E-print Network

: Saccharomyces cerevisiae versus Kluyveromyces lactis. FEMS Yeast Res. 5, 1115­1128. 3. Hittinger, C.T., Rokas, A of Saccharomyces cerevisiae. Microbiol. Rev. 51, 458­476. 6. Bhat, P.J., and Murthy, T.V. (2001). Transcriptional control of the GAL/MEL regulon of yeast Saccharomyces cerevisiae: mechanism of galactose- mediated signal

Hespos, Susan J.

104

Evolutionarily Divergent, Unstable Filamentous Actin Is Essential for Gliding Motility in Apicomplexan Parasites  

PubMed Central

Apicomplexan parasites rely on a novel form of actin-based motility called gliding, which depends on parasite actin polymerization, to migrate through their hosts and invade cells. However, parasite actins are divergent both in sequence and function and only form short, unstable filaments in contrast to the stability of conventional actin filaments. The molecular basis for parasite actin filament instability and its relationship to gliding motility remain unresolved. We demonstrate that recombinant Toxoplasma (TgACTI) and Plasmodium (PfACTI and PfACTII) actins polymerized into very short filaments in vitro but were induced to form long, stable filaments by addition of equimolar levels of phalloidin. Parasite actins contain a conserved phalloidin-binding site as determined by molecular modeling and computational docking, yet vary in several residues that are predicted to impact filament stability. In particular, two residues were identified that form intermolecular contacts between different protomers in conventional actin filaments and these residues showed non-conservative differences in apicomplexan parasites. Substitution of divergent residues found in TgACTI with those from mammalian actin resulted in formation of longer, more stable filaments in vitro. Expression of these stabilized actins in T. gondii increased sensitivity to the actin-stabilizing compound jasplakinolide and disrupted normal gliding motility in the absence of treatment. These results identify the molecular basis for short, dynamic filaments in apicomplexan parasites and demonstrate that inherent instability of parasite actin filaments is a critical adaptation for gliding motility. PMID:21998582

Skillman, Kristen M.; Diraviyam, Karthikeyan; Khan, Asis; Tang, Keliang; Sept, David; Sibley, L. David

2011-01-01

105

Characterization and analysis of the Burkholderia pseudomallei BsaN virulence regulon  

PubMed Central

Background Burkholderia pseudomallei is a facultative intracellular pathogen and the causative agent of melioidosis. A conserved type III secretion system (T3SS3) and type VI secretion system (T6SS1) are critical for intracellular survival and growth. The T3SS3 and T6SS1 genes are coordinately and hierarchically regulated by a TetR-type regulator, BspR. A central transcriptional regulator of the BspR regulatory cascade, BsaN, activates a subset of T3SS3 and T6SS1 loci. Results To elucidate the scope of the BsaN regulon, we used RNAseq analysis to compare the transcriptomes of wild-type B. pseudomallei KHW and a bsaN deletion mutant. The 60 genes positively-regulated by BsaN include those that we had previously identified in addition to a polyketide biosynthesis locus and genes involved in amino acid biosynthesis. BsaN was also found to repress the transcription of 51 genes including flagellar motility loci and those encoding components of the T3SS3 apparatus. Using a promoter-lacZ fusion assay in E. coli, we show that BsaN together with the chaperone BicA directly control the expression of the T3SS3 translocon, effector and associated regulatory genes that are organized into at least five operons (BPSS1516-BPSS1552). Using a mutagenesis approach, a consensus regulatory motif in the promoter regions of BsaN-regulated genes was shown to be essential for transcriptional activation. Conclusions BsaN/BicA functions as a central regulator of key virulence clusters in B. pseudomallei within a more extensive network of genetic regulation. We propose that BsaN/BicA controls a gene expression program that facilitates the adaption and intracellular survival of the pathogen within eukaryotic hosts. PMID:25085508

2014-01-01

106

Mechanisms Coordinating ELAV/Hu mRNA Regulons  

PubMed Central

The 5’ and 3’ untranslated regions (UTRs) of messenger RNAs (mRNAs) function as platforms that can determine the fate of each mRNA individually and in aggregate. Multiple mRNAs that encode proteins that are functionally related often interact with RNA-binding proteins (RBPs) and noncoding RNAs (ncRNAs) that coordinate their expression in time and space as RNA regulons within the ribonucleoprotein (RNP) infrastructure we term the ribonome. Recent ribonomic methods have emerged that can determine which mRNAs are bound and regulated by RBPs and ncRNAs, some of which act in combination to determine global outcomes. ELAV/Hu proteins bind to AU-rich elements (ARE) in mRNAs and regulate their stability from splicing to translation, and the ubiquitous HuR protein has been implicated in cancerous cell growth. Recent work is focused on mechanistic models of how ELAV/Hu proteins increase mRNA stability and translation by repressing microRNAs (miRs) and the RNA induced silencing complex (RISC) via ARE-based ribonucleosomes that may affect global functions of mRNA regulons. PMID:23312841

Simone, Laura E.; Keene, Jack D.

2013-01-01

107

The Rip1 Protease of Mycobacterium tuberculosis Controls the SigD Regulon  

PubMed Central

Regulated intramembrane proteolysis of membrane-embedded substrates by site-2 proteases (S2Ps) is a widespread mechanism of transmembrane signal transduction in bacteria and bacterial pathogens. We previously demonstrated that the Mycobacterium tuberculosis S2P Rip1 is required for full virulence in the mouse model of infection. Rip1 controls transcription in part through proteolysis of three transmembrane anti-sigma factors, anti-SigK, -L, and -M, but there are also Rip1-dependent, SigKLM-independent pathways. To determine the contribution of the sigma factors K, L, and M to the ?rip1 attenuation phenotype, we constructed an M. tuberculosis ?sigK? sigL ?sigM mutant and found that this strain fails to recapitulate the marked attenuation of ?rip1 in mice. In a search for additional pathways controlled by Rip1, we demonstrated that the SigD regulon is positively regulated by the Rip1 pathway. Rip1 cleavage of transmembrane anti-SigD is required for expression of SigD target genes. In the absence of Rip1, proteolytic maturation of RsdA is impaired. These findings identify RsdA/SigD as a fourth arm of the branched pathway controlled by Rip1 in M. tuberculosis. PMID:24816608

Schneider, Jessica S.; Sklar, Joseph G.

2014-01-01

108

PTS Phosphorylation of Mga Modulates Regulon Expression and Virulence in the Group A Streptococcus  

PubMed Central

SUMMARY The ability of a bacterial pathogen to monitor available carbon sources in host tissues provides a clear fitness advantage. In the group A streptococcus (GAS), the virulence regulator Mga contains homology to phosphotransferase system (PTS) regulatory domains (PRDs) found in sugar operon regulators. Here we show that Mga was phosphorylated in vitro by the PTS components EI/HPr at conserved PRD histidines. A ?ptsI (EI-deficient) GAS mutant exhibited decreased Mga activity. However, PTS-mediated phosphorylation inhibited Mga-dependent transcription of emm in vitro. Using alanine (unphosphorylated) and aspartate (phosphomimetic) mutations of PRD histidines, we establish that a doubly phosphorylated PRD1 phosphomimetic (D/DMga4) is completely inactive in vivo, shutting down expression of the Mga regulon. Although D/DMga4 is still able to bind DNA in vitro, homo-multimerization of Mga is disrupted and the protein is unable to activate trancription. PTS- mediated regulation of Mga activity appears to be important for pathogenesis, as bacteria expressing either nonphosphorylated (A/A) or phosphomimetic (D/D) PRD1 Mga mutants were attenuated in a model of GAS invasive skin disease. Thus, PTS-mediated phosphorylation of Mga may allow the bacteria to modulate virulence gene expression in response to carbohydrate status. Furthermore, PRD-containing virulence regulators (PCVRs) appear to be widespread in Gram-positive pathogens. PMID:23651410

Hondorp, Elise R.; Hou, Sherry C.; Hause, Lara L.; Gera, Kanika; Lee, Ching-En; McIver, Kevin S.

2013-01-01

109

Identification of the sigmaE regulon of Salmonella enterica serovar Typhimurium.  

PubMed

The extracytoplasmic function sigma factor, sigma(E), has been shown to play a critical role in virulence of Salmonella enterica serovar Typhimurium (S. Typhimurium). The previously optimized two-plasmid system has been used to identify S. Typhimurium promoters recognized by RNA polymerase containing sigma(E). This method allowed identification of 34 sigma(E)-dependent promoters that direct expression of 62 genes in S. Typhimurium, 23 of which (including several specific for S. Typhimurium) have not been identified previously to be dependent upon sigma(E) in Escherichia coli. The promoters were confirmed in S. Typhimurium and transcriptional start points of the promoters were determined by S1-nuclease mapping. All the promoters contained sequences highly similar to the consensus sequence of sigma(E)-dependent promoters. The identified genes belonging to the S. Typhimurium sigma(E)-regulon encode proteins involved in primary metabolism, DNA repair systems and outer-membrane biogenesis, and regulatory proteins, periplasmic proteases and folding factors, proposed lipoproteins, and inner- and outer-membrane proteins with unknown functions. Several of these sigma(E)-dependent genes have been shown to play a role in virulence of S. Typhimurium. PMID:16622052

Skovierova, Henrieta; Rowley, Gary; Rezuchova, Bronislava; Homerova, Dagmar; Lewis, Claire; Roberts, Mark; Kormanec, Jan

2006-05-01

110

Cysteine-to-alanine replacements in the Escherichia coli SoxR protein and the role of the (2Fe2S) centers in transcriptional activation  

Microsoft Academic Search

The Escherichia coli soxRS regulon activates oxidative stress and antibiotic resistance genes in two transcrip- tional stages. SoxR protein becomes activated in cells exposed to excess superoxide or nitric oxide and then stimulates transcription of the soxS gene, whose product in turn activates . 10 regulon promoters. Purified SoxR protein is a homodimer containing a pair of (2Fe-2S) centers essential

Terence M. Bradley; Elena Hidalgo; Veronica Leautaud; Huangen Ding; Bruce Demple

111

Characterization of the oxygen-responsive NreABC regulon of Staphylococcus aureus.  

PubMed

Here, we investigate the functionality of the oxygen-responsive nitrogen regulation system NreABC in the human pathogen Staphylococcus aureus and evaluate its role in anaerobic gene regulation and virulence factor expression. Deletion of nreABC resulted in severe impairment of dissimilatory nitrate and nitrite reduction and led to a small-colony phenotype in the presence of nitrate during anaerobic growth. For characterization of the NreABC regulon, comparative DNA microarray and proteomic analyses between the wild type and nreABC mutant were performed under anoxic conditions in the absence and presence of nitrate. A reduced expression of virulence factors was not observed in the mutant. However, both the transcription of genes involved in nitrate and nitrite reduction and the accumulation of corresponding proteins were highly decreased in the nreABC mutant, which was unable to utilize nitrate as a respiratory oxidant and, hence, was forced to use fermentative pathways. These data were corroborated by the quantification of the extracellular metabolites lactate and acetate. Using an Escherichia coli-compatible two-plasmid system, the activation of the promoters of the nitrate and nitrite reductase operons and of the putative nitrate/nitrite transporter gene narK by NreBC was confirmed. Overall, our data indicate that NreABC is very likely a specific regulation system that is essential for the transcriptional activation of genes involved in dissimilatory reduction and transport of nitrate and nitrite. The study underscores the importance of NreABC as a fitness factor for S. aureus in anoxic environments. PMID:18820014

Schlag, Steffen; Fuchs, Stephan; Nerz, Christiane; Gaupp, Rosmarie; Engelmann, Susanne; Liebeke, Manuel; Lalk, Michael; Hecker, Michael; Götz, Friedrich

2008-12-01

112

Genome-Wide Analysis of the Salmonella Fis Regulon and Its Regulatory Mechanism on Pathogenicity Islands  

PubMed Central

Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica. PMID:23717649

Wang, Quan; Wang, Lei

2013-01-01

113

Characterization of the Oxygen-Responsive NreABC Regulon of Staphylococcus aureus? †  

PubMed Central

Here, we investigate the functionality of the oxygen-responsive nitrogen regulation system NreABC in the human pathogen Staphylococcus aureus and evaluate its role in anaerobic gene regulation and virulence factor expression. Deletion of nreABC resulted in severe impairment of dissimilatory nitrate and nitrite reduction and led to a small-colony phenotype in the presence of nitrate during anaerobic growth. For characterization of the NreABC regulon, comparative DNA microarray and proteomic analyses between the wild type and nreABC mutant were performed under anoxic conditions in the absence and presence of nitrate. A reduced expression of virulence factors was not observed in the mutant. However, both the transcription of genes involved in nitrate and nitrite reduction and the accumulation of corresponding proteins were highly decreased in the nreABC mutant, which was unable to utilize nitrate as a respiratory oxidant and, hence, was forced to use fermentative pathways. These data were corroborated by the quantification of the extracellular metabolites lactate and acetate. Using an Escherichia coli-compatible two-plasmid system, the activation of the promoters of the nitrate and nitrite reductase operons and of the putative nitrate/nitrite transporter gene narK by NreBC was confirmed. Overall, our data indicate that NreABC is very likely a specific regulation system that is essential for the transcriptional activation of genes involved in dissimilatory reduction and transport of nitrate and nitrite. The study underscores the importance of NreABC as a fitness factor for S. aureus in anoxic environments. PMID:18820014

Schlag, Steffen; Fuchs, Stephan; Nerz, Christiane; Gaupp, Rosmarie; Engelmann, Susanne; Liebeke, Manuel; Lalk, Michael; Hecker, Michael; Götz, Friedrich

2008-01-01

114

RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach  

SciTech Connect

RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at http://regpredict.lbl.gov.

Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna

2010-05-26

115

Global Analysis of the HrpL Regulon in the Plant Pathogen Pseudomonas syringae pv. tomato DC3000 Reveals New Regulon Members with Diverse Functions  

PubMed Central

The type III secretion system (T3SS) is required for virulence in the gram-negative plant pathogen Pseudomonas syringae pv. tomato DC3000. The alternative sigma factor HrpL directly regulates expression of T3SS genes via a promoter sequence, often designated as the “hrp promoter.” Although the HrpL regulon has been extensively investigated in DC3000, it is not known whether additional regulon members remain to be found. To systematically search for HrpL-regulated genes, we used chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-Seq) and bulk mRNA sequencing (RNA-Seq) to identify HrpL-binding sites and likely hrp promoters. The analysis recovered 73 sites of interest, including 20 sites that represent new hrp promoters. The new promoters lie upstream of a diverse set of genes encoding potential regulators, enzymes and hypothetical proteins. PSPTO_5633 is the only new HrpL regulon member that is potentially an effector and is now designated HopBM1. Deletions in several other new regulon members, including PSPTO_5633, PSPTO_0371, PSPTO_2130, PSPTO_2691, PSPTO_2696, PSPTO_3331, and PSPTO_5240, in either DC3000 or ?hopQ1-1 backgrounds, do not affect the hypersensitive response or in planta growth of the resulting strains. Many new HrpL regulon members appear to be unrelated to the T3SS, and orthologs for some of these can be identified in numerous non-pathogenic bacteria. With the identification of 20 new hrp promoters, the list of HrpL regulon members is approaching saturation and most likely includes all DC3000 effectors. PMID:25170934

Lam, Hanh N.; Chakravarthy, Suma; Wei, Hai-Lei; BuiNguyen, HoangChuong; Stodghill, Paul V.; Collmer, Alan; Swingle, Bryan M.; Cartinhour, Samuel W.

2014-01-01

116

The Global Transcriptional Response of Bacillus subtilis to Peroxide Stress Is Coordinated by Three Transcription Factors  

Microsoft Academic Search

Bacillus subtilis exhibits a complex adaptive response to low levels of peroxides. We used global transcrip- tional profiling to monitor the magnitude and kinetics of changes in the mRNA population after exposure to either hydrogen peroxide (H2O2 )o rtert-butyl peroxide (t-buOOH). The peroxide stimulons could be largely accounted for by three regulons controlled by the PerR, B, and OhrR transcription

John D. Helmann; Ming Fang Winston Wu; Ahmed Gaballa; Phil A. Kobel; Maud M. Morshedi; Paul Fawcett; Chris Paddon

2003-01-01

117

The Fur regulon in anaerobically grown Salmonella enterica sv. Typhimurium: identification of new Fur targets  

PubMed Central

Background The Ferric uptake regulator (Fur) is a transcriptional regulator that controls iron homeostasis in bacteria. Although the regulatory role of Fur in Escherichia coli is well characterized, most of the studies were conducted under routine culture conditions, i.e., in ambient oxygen concentration. To reveal potentially novel aspects of the Fur regulon in Salmonella enterica serovar Typhimurium under oxygen conditions similar to that encountered in the host, we compared the transcriptional profiles of the virulent wild-type strain (ATCC 14028s) and its isogenic ?fur strain under anaerobic conditions. Results Microarray analysis of anaerobically grown ?fur S. Typhimurium identified 298 differentially expressed genes. Expression of several genes controlled by Fnr and NsrR appeared to be also dependent on Fur. Furthermore, Fur was required for the activity of the cytoplasmic superoxide disumutases (MnSOD and FeSOD). The regulation of FeSOD gene, sodB, occurred via small RNAs (i.e., the ryhB homologs, rfrA and rfrB) with the aid of the RNA chaperone Hfq. The transcription of sodA was increased in ?fur; however, the enzyme was inactive due to the incorporation of iron instead of manganese in SodA. Additionally, in ?fur, the expression of the gene coding for the ferritin-like protein (ftnB) was down-regulated, while the transcription of the gene coding for the nitric oxide (NO·) detoxifying flavohemoglobin (hmpA) was up-regulated. The promoters of ftnB and hmpA do not contain recognized Fur binding motifs, which indicated their probable indirect regulation by Fur. However, Fur activation of ftnB was independent of Fnr. In addition, the expression of the gene coding for the histone-like protein, H-NS (hns) was increased in ?fur. This may explain the observed down-regulation of the tdc operon, responsible for the anaerobic degradation of threonine, and ftnB in ?fur. Conclusions This study determined that Fur is a positive factor in ftnB regulation, while serving to repress the expression of hmpA. Furthermore, Fur is required for the proper expression and activation of the antioxidant enzymes, FeSOD and MnSOD. Finally, this work identified twenty-six new targets of Fur regulation, and demonstrates that H-NS repressed genes are down-regulated in ?fur. PMID:22017966

2011-01-01

118

A Conserved Apicomplexan Microneme Protein Contributes to Toxoplasma gondii Invasion and Virulence  

PubMed Central

The obligate intracellular parasite Toxoplasma gondii critically relies on host cell invasion during infection. Proteins secreted from the apical micronemes are central components for host cell recognition, invasion, egress, and virulence. Although previous work established that the sporozoite protein with an altered thrombospondin repeat (SPATR) is a micronemal protein conserved in other apicomplexan parasites, including Plasmodium, Neospora, and Eimeria, no genetic evidence of its contribution to invasion has been reported. SPATR contains a predicted epidermal growth factor domain and two thrombospondin type 1 repeats, implying a role in host cell recognition. In this study, we assess the contribution of T. gondii SPATR (TgSPATR) to T. gondii invasion by genetically ablating it and restoring its expression by genetic complementation. ?spatr parasites were ?50% reduced in invasion compared to parental strains, a defect that was reversed in the complemented strain. In mouse virulence assays, ?spatr parasites were significantly attenuated, with ?20% of mice surviving infection. Given the conservation of this protein among the Apicomplexa, we assessed whether the Plasmodium falciparum SPATR ortholog (PfSPATR) could complement the absence of the TgSPATR. Although PfSPATR showed correct micronemal localization, it did not reverse the invasion deficiency of ?spatr parasites, because of an apparent failure in secretion. Overall, the results suggest that TgSPATR contributes to invasion and virulence, findings that have implications for the many genera and life stages of apicomplexans that express SPATR. PMID:25092910

Huynh, My-Hang; Boulanger, Martin J.

2014-01-01

119

A conserved apicomplexan microneme protein contributes to Toxoplasma gondii invasion and virulence.  

PubMed

The obligate intracellular parasite Toxoplasma gondii critically relies on host cell invasion during infection. Proteins secreted from the apical micronemes are central components for host cell recognition, invasion, egress, and virulence. Although previous work established that the sporozoite protein with an altered thrombospondin repeat (SPATR) is a micronemal protein conserved in other apicomplexan parasites, including Plasmodium, Neospora, and Eimeria, no genetic evidence of its contribution to invasion has been reported. SPATR contains a predicted epidermal growth factor domain and two thrombospondin type 1 repeats, implying a role in host cell recognition. In this study, we assess the contribution of T. gondii SPATR (TgSPATR) to T. gondii invasion by genetically ablating it and restoring its expression by genetic complementation. ?spatr parasites were ~50% reduced in invasion compared to parental strains, a defect that was reversed in the complemented strain. In mouse virulence assays, ?spatr parasites were significantly attenuated, with ~20% of mice surviving infection. Given the conservation of this protein among the Apicomplexa, we assessed whether the Plasmodium falciparum SPATR ortholog (PfSPATR) could complement the absence of the TgSPATR. Although PfSPATR showed correct micronemal localization, it did not reverse the invasion deficiency of ?spatr parasites, because of an apparent failure in secretion. Overall, the results suggest that TgSPATR contributes to invasion and virulence, findings that have implications for the many genera and life stages of apicomplexans that express SPATR. PMID:25092910

Huynh, My-Hang; Boulanger, Martin J; Carruthers, Vern B

2014-10-01

120

An atomic-resolution view of neofunctionalization in the evolution of apicomplexan lactate dehydrogenases  

PubMed Central

Malate and lactate dehydrogenases (MDH and LDH) are homologous, core metabolic enzymes that share a fold and catalytic mechanism yet possess strict specificity for their substrates. In the Apicomplexa, convergent evolution of an unusual LDH from MDH produced a difference in specificity exceeding 12 orders of magnitude. The mechanisms responsible for this extraordinary functional shift are currently unknown. Using ancestral protein resurrection, we find that specificity evolved in apicomplexan LDHs by classic neofunctionalization characterized by long-range epistasis, a promiscuous intermediate, and few gain-of-function mutations of large effect. In canonical MDHs and LDHs, a single residue in the active-site loop governs substrate specificity: Arg102 in MDHs and Gln102 in LDHs. During the evolution of the apicomplexan LDH, however, specificity switched via an insertion that shifted the position and identity of this ‘specificity residue’ to Trp107f. Residues far from the active site also determine specificity, as shown by the crystal structures of three ancestral proteins bracketing the key duplication event. This work provides an unprecedented atomic-resolution view of evolutionary trajectories creating a nascent enzymatic function. DOI: http://dx.doi.org/10.7554/eLife.02304.001 PMID:24966208

Boucher, Jeffrey I; Jacobowitz, Joseph R; Beckett, Brian C; Classen, Scott; Theobald, Douglas L

2014-01-01

121

The identification of a sequence related to apicomplexan enolase from Sarcocystis neurona.  

PubMed

Equine protozoal myeloencephalitis (EPM) is a neurological disease caused by Sarcocystis neurona, an apicomplexan parasite. S. neurona is also associated with EPM-like diseases in marine and small mammals. The mechanisms of transmission and ability to infect a wide host range remain obscure; therefore, characterization of essential proteins may provide evolutionary information allowing the development of novel chemotherapeutics that target non-mammalian biochemical pathways. In the current study, two-dimensional electrophoresis and matrix-assisted laser desorption ionization-time of flight (MALDI-ToF) mass spectrometry were combined to characterize and identify an enolase protein from S. neurona based on peptide homology to the Toxoplasma gondii protein. Enolase is thought to be a vestigial, non-photosynthetic protein resulting from an evolutionary endosymbiosis event of an apicomplexan ancestor with green algae. Enolase has also been suggested to play a role in parasite stage conversion for T. gondii. Characterization of this protein in S. neurona and comparison to other protozoans indicate a biochemical similarity of S. neurona enolase to other tissue-cyst forming coccidians that cause encephalitis. PMID:15549383

Wilson, A P; Thelen, J J; Lakritz, J; Brown, C R; Marsh, A E

2004-11-01

122

Technical Considerations in using DNA Microarrays to Define Regulons  

PubMed Central

Transcription is the major regulatory target of gene expression in bacteria, and is controlled by many regulatory proteins and RNAs. Microarrays are a powerful tool to study the regulation of transcription on a genomic scale. Here we describe the use of transcription profiling and ChIP-chip to study transcriptional regulation in bacteria. Transcription profiling determines the outcome of regulatory events whereas ChIP-chip identifies the protein-DNA interactions that determine these events. Together they can provide detailed information on transcriptional regulatory systems. PMID:18955146

Rhodius, Virgil A.; Wade, Joseph T.

2009-01-01

123

Inference of the Transcriptional Regulatory Network in Staphylococcus aureus by Integration of Experimental and Genomics-Based Evidence?†  

PubMed Central

Transcriptional regulatory networks are fine-tuned systems that help microorganisms respond to changes in the environment and cell physiological state. We applied the comparative genomics approach implemented in the RegPredict Web server combined with SEED subsystem analysis and available information on known regulatory interactions for regulatory network reconstruction for the human pathogen Staphylococcus aureus and six related species from the family Staphylococcaceae. The resulting reference set of 46 transcription factor regulons contains more than 1,900 binding sites and 2,800 target genes involved in the central metabolism of carbohydrates, amino acids, and fatty acids; respiration; the stress response; metal homeostasis; drug and metal resistance; and virulence. The inferred regulatory network in S. aureus includes ?320 regulatory interactions between 46 transcription factors and ?550 candidate target genes comprising 20% of its genome. We predicted ?170 novel interactions and 24 novel regulons for the control of the central metabolic pathways in S. aureus. The reconstructed regulons are largely variable in the Staphylococcaceae: only 20% of S. aureus regulatory interactions are conserved across all studied genomes. We used a large-scale gene expression data set for S. aureus to assess relationships between the inferred regulons and gene expression patterns. The predicted reference set of regulons is captured within the Staphylococcus collection in the RegPrecise database (http://regprecise.lbl.gov). PMID:21531804

Ravcheev, Dmitry A.; Best, Aaron A.; Tintle, Nathan; DeJongh, Matthew; Osterman, Andrei L.; Novichkov, Pavel S.; Rodionov, Dmitry A.

2011-01-01

124

Malaria, which is caused by the apicomplexan pro-tist, Plasmodium, is the major re-emerging disease  

E-print Network

Malaria, which is caused by the apicomplexan pro- tist, Plasmodium, is the major re and it is espe- cially lethal for children. To make this topically ap- preciated, the Malaria Foundation International (http://www.malaria.org/) stated that "The malaria epidemic is like loading up seven Boeing 747

Simpson, Larry

125

Recruitment of a duplicated primary metabolism gene into the nicotine biosynthesis regulon in tobacco.  

PubMed

Gene duplication is a powerful source of phenotypic diversity in plants, but the molecular mechanisms that generate new functions in duplicated genes are not fully documented. Here, we analyzed how duplicated genes encoding quinolinate phosphoribosyltransferase (QPT), an enzyme involved in the synthesis of nicotinamide adenine dinucleotide (NAD) and the pyridine moiety of nicotine, are regulated by the jasmonate-responsive transcriptional factor ERF189 that functions critically for nicotine biosynthesis in tobacco (Nicotiana tabacum). The tobacco genome contains duplicated QPT genes; QPT1 is expressed at a constitutive basal level, whereas QPT2 is regulated coordinately with other structural genes involved in nicotine biosynthesis, in terms of tissue specificity, jasmonate induction, and regulation by ERF189. The binding-site specificity of ERF189 was defined as 5'-(A/C)GC(A/C)(A/C)NCC-3' by using a characterized tobacco putrescine N-methyltransferase promoter, and was then used to search for potential binding sites in the QPT promoters. Assays involving in vitro DNA binding, transient transactivation, and transgenic hairy roots revealed that the QPT2 promoter contains three functional ERF189-binding sites, which individually confer incremental ERF189-mediated activation to the promoter. The QPT1 promoter is not bound and regulated by ERF189. These results indicate that one copy of the duplicated QPT genes was recruited to a tobacco alkaloid regulon by evolving multiple target cis-regulatory elements of ERF189 in its promoter, to cope with an increased metabolic demand for pyridine precursors during active alkaloid biosynthesis. PMID:21605206

Shoji, Tsubasa; Hashimoto, Takashi

2011-09-01

126

RNA-Seq Analysis Reveals a Six-Gene SoxR Regulon in Streptomyces coelicolor  

PubMed Central

The redox-regulated transcription factor SoxR is conserved in diverse bacteria, but emerging studies suggest that this protein plays distinct physiological roles in different bacteria. SoxR regulates a global oxidative stress response (involving >100 genes) against exogenous redox-cycling drugs in Escherichia coli and related enterics. In the antibiotic producers Streptomyces coelicolor and Pseudomonas aeruginosa, however, SoxR regulates a smaller number of genes that encode membrane transporters and proteins with homology to antibiotic-tailoring enzymes. In both S. coelicolor and P. aeruginosa, SoxR-regulated genes are expressed in stationary phase during the production of endogenously-produced redox-active antibiotics. These observations suggest that SoxR evolved to sense endogenous secondary metabolites and activate machinery to process and transport them in antibiotic-producing bacteria. Previous bioinformatics analysis that searched the genome for SoxR-binding sites in putative promoters defined a five-gene SoxR regulon in S. coelicolor including an ABC transporter, two oxidoreductases, a monooxygenase and an epimerase/dehydratase. Since this in silico screen may have missed potential SoxR-targets, we conducted a whole genome transcriptome comparison of wild type S. coelicolor and a soxR-deficient mutant in stationary phase using RNA-Seq. Our analysis revealed a sixth SoxR-regulated gene in S. coelicolor that encodes a putative quinone oxidoreductase. Knowledge of the full complement of genes regulated by SoxR will facilitate studies to elucidate the function of this regulatory molecule in antibiotic producers. PMID:25162599

Naseer, Nawar; Shapiro, Joshua A.; Chander, Monica

2014-01-01

127

Transfer activation of SXT/R391 integrative and conjugative elements: unraveling the SetCD regulon  

PubMed Central

Integrative and conjugative elements (ICEs) of the SXT/R391 family have been recognized as key drivers of antibiotic resistance dissemination in the seventh-pandemic lineage of Vibrio cholerae. SXT/R391 ICEs propagate by conjugation and integrate site-specifically into the chromosome of a wide range of environmental and clinical Gammaproteobacteria. SXT/R391 ICEs bear setC and setD, two conserved genes coding for a transcriptional activator complex that is essential for activation of conjugative transfer. We used chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) to characterize the SetCD regulon of three representative members of the SXT/R391 family. We also identified the DNA sequences bound by SetCD in MGIVflInd1, a mobilizable genomic island phylogenetically unrelated to SXT/R391 ICEs that hijacks the conjugative machinery of these ICEs to drive its own transfer. SetCD was found to bind a 19-bp sequence that is consistently located near the promoter ?35 element of SetCD-activated genes, a position typical of class II transcriptional activators. Furthermore, we refined our understanding of the regulation of excision from and integration into the chromosome for SXT/R391 ICEs and demonstrated that de novo expression of SetCD is crucial to allow integration of the incoming ICE DNA into a naive host following conjugative transfer. PMID:25662215

Poulin-Laprade, Dominic; Matteau, Dominick; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Burrus, Vincent

2015-01-01

128

Transfer activation of SXT/R391 integrative and conjugative elements: unraveling the SetCD regulon.  

PubMed

Integrative and conjugative elements (ICEs) of the SXT/R391 family have been recognized as key drivers of antibiotic resistance dissemination in the seventh-pandemic lineage of Vibrio cholerae. SXT/R391 ICEs propagate by conjugation and integrate site-specifically into the chromosome of a wide range of environmental and clinical Gammaproteobacteria. SXT/R391 ICEs bear setC and setD, two conserved genes coding for a transcriptional activator complex that is essential for activation of conjugative transfer. We used chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) to characterize the SetCD regulon of three representative members of the SXT/R391 family. We also identified the DNA sequences bound by SetCD in MGIVflInd1, a mobilizable genomic island phylogenetically unrelated to SXT/R391 ICEs that hijacks the conjugative machinery of these ICEs to drive its own transfer. SetCD was found to bind a 19-bp sequence that is consistently located near the promoter -35 element of SetCD-activated genes, a position typical of class II transcriptional activators. Furthermore, we refined our understanding of the regulation of excision from and integration into the chromosome for SXT/R391 ICEs and demonstrated that de novo expression of SetCD is crucial to allow integration of the incoming ICE DNA into a naive host following conjugative transfer. PMID:25662215

Poulin-Laprade, Dominic; Matteau, Dominick; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Burrus, Vincent

2015-02-27

129

Variable Suites of Non-effector Genes Are Co-regulated in the Type III Secretion Virulence Regulon across the Pseudomonas syringae Phylogeny  

PubMed Central

Pseudomonas syringae is a phylogenetically diverse species of Gram-negative bacterial plant pathogens responsible for crop diseases around the world. The HrpL sigma factor drives expression of the major P. syringae virulence regulon. HrpL controls expression of the genes encoding the structural and functional components of the type III secretion system (T3SS) and the type three secreted effector proteins (T3E) that are collectively essential for virulence. HrpL also regulates expression of an under-explored suite of non-type III effector genes (non-T3E), including toxin production systems and operons not previously associated with virulence. We implemented and refined genome-wide transcriptional analysis methods using cDNA-derived high-throughput sequencing (RNA-seq) data to characterize the HrpL regulon from six isolates of P. syringae spanning the diversity of the species. Our transcriptomes, mapped onto both complete and draft genomes, significantly extend earlier studies. We confirmed HrpL-regulation for a majority of previously defined T3E genes in these six strains. We identified two new T3E families from P. syringae pv. oryzae 1_6, a strain within the relatively underexplored phylogenetic Multi-Locus Sequence Typing (MLST) group IV. The HrpL regulons varied among strains in gene number and content across both their T3E and non-T3E gene suites. Strains within MLST group II consistently express the lowest number of HrpL-regulated genes. We identified events leading to recruitment into, and loss from, the HrpL regulon. These included gene gain and loss, and loss of HrpL regulation caused by group-specific cis element mutations in otherwise conserved genes. Novel non-T3E HrpL-regulated genes include an operon that we show is required for full virulence of P. syringae pv. phaseolicola 1448A on French bean. We highlight the power of integrating genomic, transcriptomic, and phylogenetic information to drive concise functional experimentation and to derive better insight into the evolution of virulence across an evolutionarily diverse pathogen species. PMID:24391493

Mucyn, Tatiana S.; Yourstone, Scott; Lind, Abigail L.; Biswas, Surojit; Nishimura, Marc T.; Baltrus, David A.; Cumbie, Jason S.; Chang, Jeff H.; Jones, Corbin D.; Dangl, Jeffery L.; Grant, Sarah R.

2014-01-01

130

The Rsm regulon of plant growth-promoting Pseudomonas fluorescens?SS101: role of small RNAs in regulation of lipopeptide biosynthesis.  

PubMed

The rhizobacterium Pseudomonas fluorescens?SS101 inhibits growth of oomycete and fungal pathogens, and induces resistance in plants against pathogens and insects. To unravel regulatory pathways of secondary metabolite production in SS101, we conducted a genome-wide search for sRNAs and performed transcriptomic analyses to identify genes associated with the Rsm (repressor of secondary metabolites) regulon. In silico analysis led to the identification of 16 putative sRNAs in the SS101 genome. In frame deletion of the sRNAs rsmY and rsmZ showed that the Rsm system regulates the biosynthesis of the lipopeptide massetolide A and involves the two repressor proteins RsmA and RsmE, with the LuxR-type transcriptional regulator MassAR as their most likely target. Transcriptome analyses of the rsmYZ mutant further revealed that genes associated with iron acquisition, motility and chemotaxis were significantly upregulated, whereas genes of the type VI secretion system were downregulated. Comparative transcriptomic analyses showed that most, but not all, of the genes controlled by RsmY/RsmZ are also controlled by the GacS/GacA two-component system. We conclude that the Rsm regulon of P.?fluorescens?SS101 plays a critical role in the regulation of lipopeptide biosynthesis and controls the expression of other genes involved in motility, competition and survival in the plant rhizosphere. PMID:25488342

Song, Chunxu; van der Voort, Menno; van de Mortel, Judith; Hassan, Karl A; Elbourne, Liam D H; Paulsen, Ian T; Loper, Joyce E; Raaijmakers, Jos M

2015-03-01

131

Investigation of the malE Promoter and MalR, a Positive Regulator of the Maltose Regulon, for an Improved Expression System in Sulfolobus acidocaldarius  

PubMed Central

In this study, the regulator MalR (Saci_1161) of the TrmB family from Sulfolobus acidocaldarius was identified and was shown to be involved in transcriptional control of the maltose regulon (Saci_1660 to Saci_1666), including the ABC transporter (malEFGK), ?-amylase (amyA), and ?-glycosidase (malA). The ?malR deletion mutant exhibited a significantly decreased growth rate on maltose and dextrin but not on sucrose. The expression of the genes organized in the maltose regulon was induced only in the presence of MalR and maltose in the growth medium, indicating that MalR, in contrast to its TrmB and TrmB-like homologues, is an activator of the maltose gene cluster. Electrophoretic mobility shift assays revealed that the binding of MalR to malE was independent of sugars. Here we report the identification of the archaeal maltose regulator protein MalR, which acts as an activator and controls the expression of genes involved in maltose transport and metabolic conversion in S. acidocaldarius, and its use for improvement of the S. acidocaldarius expression system under the control of an optimized maltose binding protein (malE) promoter by promoter mutagenesis. PMID:24271181

Wagner, Michaela; Wagner, Alexander; Ma, Xiaoqing; Kort, Julia Christin; Ghosh, Abhrajyoti; Rauch, Bernadette; Siebers, Bettina

2014-01-01

132

Investigation of the malE promoter and MalR, a positive regulator of the maltose regulon, for an improved expression system in Sulfolobus acidocaldarius.  

PubMed

In this study, the regulator MalR (Saci_1161) of the TrmB family from Sulfolobus acidocaldarius was identified and was shown to be involved in transcriptional control of the maltose regulon (Saci_1660 to Saci_1666), including the ABC transporter (malEFGK), ?-amylase (amyA), and ?-glycosidase (malA). The ?malR deletion mutant exhibited a significantly decreased growth rate on maltose and dextrin but not on sucrose. The expression of the genes organized in the maltose regulon was induced only in the presence of MalR and maltose in the growth medium, indicating that MalR, in contrast to its TrmB and TrmB-like homologues, is an activator of the maltose gene cluster. Electrophoretic mobility shift assays revealed that the binding of MalR to malE was independent of sugars. Here we report the identification of the archaeal maltose regulator protein MalR, which acts as an activator and controls the expression of genes involved in maltose transport and metabolic conversion in S. acidocaldarius, and its use for improvement of the S. acidocaldarius expression system under the control of an optimized maltose binding protein (malE) promoter by promoter mutagenesis. PMID:24271181

Wagner, Michaela; Wagner, Alexander; Ma, Xiaoqing; Kort, Julia Christin; Ghosh, Abhrajyoti; Rauch, Bernadette; Siebers, Bettina; Albers, Sonja-Verena

2014-02-01

133

The Rsm regulon of plant growth-promoting Pseudomonas fluorescens SS101: role of small RNAs in regulation of lipopeptide biosynthesis  

PubMed Central

The rhizobacterium Pseudomonas fluorescens?SS101 inhibits growth of oomycete and fungal pathogens, and induces resistance in plants against pathogens and insects. To unravel regulatory pathways of secondary metabolite production in SS101, we conducted a genome-wide search for sRNAs and performed transcriptomic analyses to identify genes associated with the Rsm (repressor of secondary metabolites) regulon. In silico analysis led to the identification of 16 putative sRNAs in the SS101 genome. In frame deletion of the sRNAs rsmY and rsmZ showed that the Rsm system regulates the biosynthesis of the lipopeptide massetolide A and involves the two repressor proteins RsmA and RsmE, with the LuxR-type transcriptional regulator MassAR as their most likely target. Transcriptome analyses of the rsmYZ mutant further revealed that genes associated with iron acquisition, motility and chemotaxis were significantly upregulated, whereas genes of the type VI secretion system were downregulated. Comparative transcriptomic analyses showed that most, but not all, of the genes controlled by RsmY/RsmZ are also controlled by the GacS/GacA two-component system. We conclude that the Rsm regulon of P.?fluorescens?SS101 plays a critical role in the regulation of lipopeptide biosynthesis and controls the expression of other genes involved in motility, competition and survival in the plant rhizosphere. PMID:25488342

Song, Chunxu; van der Voort, Menno; van de Mortel, Judith; Hassan, Karl A; Elbourne, Liam D H; Paulsen, Ian T; Loper, Joyce E; Raaijmakers, Jos M

2015-01-01

134

Proteomic analysis of the quorum-sensing regulon in Pantoea stewartii and identification of direct targets of EsaR.  

PubMed

The proteobacterium Pantoea stewartii subsp. stewartii causes Stewart's wilt disease in maize when it colonizes the xylem and secretes large amounts of stewartan, an exopolysaccharide. The success of disease pathogenesis lies in the timing of bacterial virulence factor expression through the different stages of infection. Regulation is achieved through a quorum-sensing (QS) system consisting of the acyl-homoserine lactone (AHL) synthase, EsaI, and the transcription regulator EsaR. At low cell densities, EsaR represses transcription of itself and of rcsA, an activator of the stewartan biosynthesis operon; it also activates esaS, which encodes a small RNA (sRNA). Repression or activation ceases at high cell densities when EsaI synthesizes sufficient levels of the AHL ligand N-3-oxo-hexanoyl-L-homoserine lactone to bind and inactivate EsaR. This study aims to identify other genes activated or repressed by EsaR during the QS response. Proteomic analysis identified a QS regulon of more than 30 proteins. Electrophoretic mobility shift assays of promoters of genes encoding differentially expressed proteins distinguished direct targets of EsaR from indirect targets. Additional quantitative reverse transcription-PCR (qRT-PCR) and DNA footprinting analysis established that EsaR directly regulates the promoters of dkgA, glpF, and lrhA. The proteins encoded by dkgA, glpF, and lrhA are a 2,5-diketogluconate reductase, glycerol facilitator, and transcriptional regulator of chemotaxis and motility, respectively, indicating a more global QS response in P. stewartii than previously recognized. PMID:23913428

Ramachandran, Revathy; Stevens, Ann M

2013-10-01

135

Analysis of the ArcA regulon in anaerobically grown Salmonella enterica sv. Typhimurium  

PubMed Central

Background Salmonella enterica serovar Typhimurium (S. Typhimurium) is a Gram-negative pathogen that must successfully adapt to the broad fluctuations in the concentration of dissolved dioxygen encountered in the host. In Escherichia coli, ArcA (Aerobic Respiratory Control) helps the cells to sense and respond to the presence of dioxygen. The global role of ArcA in E. coli is well characterized; however, little is known about its role in anaerobically grown S. Typhimurium. Results We compared the transcriptional profiles of the virulent wild-type (WT) strain (ATCC 14028s) and its isogenic arcA mutant grown under anaerobic conditions. We found that ArcA directly or indirectly regulates 392 genes (8.5% of the genome); of these, 138 genes are poorly characterized. Regulation by ArcA in S. Typhimurium is similar, but distinct from that in E. coli. Thus, genes/operons involved in core metabolic pathways (e.g., succinyl-CoA, fatty acid degradation, cytochrome oxidase complexes, flagellar biosynthesis, motility, and chemotaxis) were regulated similarly in the two organisms. However, genes/operons present in both organisms, but regulated differently by ArcA in S. Typhimurium included those coding for ethanolamine utilization, lactate transport and metabolism, and succinate dehydrogenases. Salmonella-specific genes/operons regulated by ArcA included those required for propanediol utilization, flagellar genes (mcpAC, cheV), Gifsy-1 prophage genes, and three SPI-3 genes (mgtBC, slsA, STM3784). In agreement with our microarray data, the arcA mutant was non-motile, lacked flagella, and was as virulent in mice as the WT. Additionally, we identified a set of 120 genes whose regulation was shared with the anaerobic redox regulator, Fnr. Conclusion(s) We have identified the ArcA regulon in anaerobically grown S. Typhimurium. Our results demonstrated that in S. Typhimurium, ArcA serves as a transcriptional regulator coordinating cellular metabolism, flagella biosynthesis, and motility. Furthermore, ArcA and Fnr share in the regulation of 120 S. Typhimurium genes. PMID:21418628

2011-01-01

136

Genomic reconstruction of transcriptional regulatory networks in lactic acid bacteria  

PubMed Central

Background Genome scale annotation of regulatory interactions and reconstruction of regulatory networks are the crucial problems in bacterial genomics. The Lactobacillales order of bacteria collates various microorganisms having a large economic impact, including both human and animal pathogens and strains used in the food industry. Nonetheless, no systematic genome-wide analysis of transcriptional regulation has been previously made for this taxonomic group. Results A comparative genomics approach was used for reconstruction of transcriptional regulatory networks in 30 selected genomes of lactic acid bacteria. The inferred networks comprise regulons for 102 orthologous transcription factors (TFs), including 47 novel regulons for previously uncharacterized TFs. Numerous differences between regulatory networks of the Streptococcaceae and Lactobacillaceae groups were described on several levels. The two groups are characterized by substantially different sets of TFs encoded in their genomes. Content of the inferred regulons and structure of their cognate TF binding motifs differ for many orthologous TFs between the two groups. Multiple cases of non-orthologous displacements of TFs that control specific metabolic pathways were reported. Conclusions The reconstructed regulatory networks substantially expand the existing knowledge of transcriptional regulation in lactic acid bacteria. In each of 30 studied genomes the obtained regulatory network contains on average 36 TFs and 250 target genes that are mostly involved in carbohydrate metabolism, stress response, metal homeostasis and amino acids biosynthesis. The inferred networks can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. All reconstructed regulons are captured within the Streptococcaceae and Lactobacillaceae collections in the RegPrecise database (http://regprecise.lbl.gov). PMID:23398941

2013-01-01

137

Characterization of the RelBbu Regulon in Borrelia burgdorferi Reveals Modulation of Glycerol Metabolism by (p)ppGpp  

PubMed Central

The bacterial stringent response is triggered by deficiencies of available nutrients and other environmental stresses. It is mediated by 5'-triphosphate-guanosine-3'-diphosphate and 5'-diphosphate-guanosine-3'-diphosphate (collectively (p)ppGpp) and generates global changes in gene expression and metabolism that enable bacteria to adapt to and survive these challenges. Borrelia burgdorferi encounters multiple stressors in its cycling between ticks and mammals that could trigger the stringent response. We have previously shown that the B. burgdorferi stringent response is mediated by a single enzyme, RelBbu, with both (p)ppGpp synthase and hydrolase activities, and that a B. burgdorferi 297 relBbu null deletion mutant was defective in adapting to stationary phase, incapable of down-regulating synthesis of rRNA and could not infect mice. We have now used this deletion mutant and microarray analysis to identify genes comprising the rel regulon in B. burgdorferi cultured at 34°C, and found that transcription of genes involved in glycerol metabolism is induced by relBbu. Culture of the wild type parental strain, the relBbu deletion mutant and its complemented derivative at 34°C and 25°C in media containing glucose or glycerol as principal carbon sources revealed a growth defect in the mutant, most evident at the lower temperature. Transcriptional analysis of the glp operon for glycerol uptake and metabolism in these three strains confirmed that relBbu was necessary and sufficient to increase transcription of this operon in the presence of glycerol at both temperatures. These results confirm and extend previous findings regarding the stringent response in B. burgdorferi. They also demonstrate that the stringent response regulates glycerol metabolism in this organism and is likely crucial for its optimal growth in ticks. PMID:25688856

Bugrysheva, Julia V.; Pappas, Christopher J.; Terekhova, Darya A.; Iyer, Radha; Godfrey, Henry P.; Schwartz, Ira; Cabello, Felipe C.

2015-01-01

138

The MetJ regulon in gammaproteobacteria determined by comparative genomics methods  

PubMed Central

Background Whole-genome sequencing of bacteria has proceeded at an exponential pace but annotation validation has lagged behind. For instance, the MetJ regulon, which controls methionine biosynthesis and transport, has been studied almost exclusively in E. coli and Salmonella, but homologs of MetJ exist in a variety of other species. These include some that are pathogenic (e.g. Yersinia) and some that are important for environmental remediation (e.g. Shewanella) but many of which have not been extensively characterized in the literature. Results We have determined the likely composition of the MetJ regulon in all species which have MetJ homologs using bioinformatics techniques. We show that the core genes known from E. coli are consistently regulated in other species, and we identify previously unknown members of the regulon. These include the cobalamin transporter, btuB; all the genes involved in the methionine salvage pathway; as well as several enzymes and transporters of unknown specificity. Conclusions The MetJ regulon is present and functional in five orders of gammaproteobacteria: Enterobacteriales, Pasteurellales, Vibrionales, Aeromonadales and Alteromonadales. New regulatory activity for MetJ was identified in the genomic data and verified experimentally. This strategy should be applicable for the elucidation of regulatory pathways in other systems by using the extensive sequencing data currently being generated. PMID:22082356

2011-01-01

139

Posttranscriptional regulons coordinate the initiation and resolution of inflammation  

Microsoft Academic Search

Transcriptional control mechanisms chart the course of the inflammatory response by synthesizing mRNAs encoding proteins that promote or inhibit inflammation. Because these mRNAs can be long-lived, turning off their synthesis does not rapidly stop or change the direction of inflammation. Post-transcriptional mechanisms that modify mRNA stability and\\/or translation provide more rapid and flexible control of this process and are particularly

Paul Anderson

2010-01-01

140

The Copper-Responsive RicR Regulon Contributes to Mycobacterium tuberculosis Virulence  

PubMed Central

ABSTRACT As with most life on Earth, the transition metal copper (Cu) is essential for the viability of the human pathogen Mycobacterium tuberculosis. However, infected hosts can also use Cu to control microbial growth. Several Cu-responsive pathways are present in M. tuberculosis, including the regulated in copper repressor (RicR) regulon, which is unique to pathogenic mycobacteria. In this work, we describe the contribution of each RicR-regulated gene to Cu resistance in vitro and to virulence in animals. We found that the deletion or disruption of individual RicR-regulated genes had no impact on virulence in mice, although several mutants had Cu hypersensitivity. In contrast, a mutant unable to activate the RicR regulon was not only highly susceptible to Cu but also attenuated in mice. Thus, these data suggest that several genes of the RicR regulon are required simultaneously to combat Cu toxicity in vivo or that this regulon is also important for resistance against Cu-independent mechanisms of host defense. IMPORTANCE Mycobacterium tuberculosis is the causative agent of tuberculosis, killing millions of people every year. Therefore, understanding the biology of M. tuberculosis is crucial for the development of new therapies to treat this devastating disease. Our studies reveal that although host-supplied Cu can suppress bacterial growth, M. tuberculosis has a unique pathway, the RicR regulon, to defend against Cu toxicity. These findings suggest that Cu homeostasis pathways in both the host and the pathogen could be exploited for the treatment of tuberculosis. PMID:24549843

Shi, Xiaoshan; Festa, Richard A.; Ioerger, Thomas R.; Butler-Wu, Susan; Sacchettini, James C.; Darwin, K. Heran; Samanovic, Marie I.

2014-01-01

141

Global Analysis of Apicomplexan Protein S-Acyl Transferases Reveals an Enzyme Essential for Invasion  

PubMed Central

The advent of techniques to study palmitoylation on a whole proteome scale has revealed that it is an important reversible modification that plays a role in regulating multiple biological processes. Palmitoylation can control the affinity of a protein for lipid membranes, which allows it to impact protein trafficking, stability, folding, signalling and interactions. The publication of the palmitome of the schizont stage of Plasmodium falciparum implicated a role for palmitoylation in host cell invasion, protein export and organelle biogenesis. However, nothing is known so far about the repertoire of protein S-acyl transferases (PATs) that catalyse this modification in Apicomplexa. We undertook a comprehensive analysis of the repertoire of Asp-His-His-Cys cysteine-rich domain (DHHC-CRD) PAT family in Toxoplasma gondii and Plasmodium berghei by assessing their localization and essentiality. Unlike functional redundancies reported in other eukaryotes, some apicomplexan-specific DHHCs are essential for parasite growth, and several are targeted to organelles unique to this phylum. Of particular interest is DHHC7, which localizes to rhoptry organelles in all parasites tested, including the major human pathogen P. falciparum. TgDHHC7 interferes with the localization of the rhoptry palmitoylated protein TgARO and affects the apical positioning of the rhoptry organelles. This PAT has a major impact on T. gondii host cell invasion, but not on the parasite’s ability to egress. PMID:23638681

Frénal, Karine; Tay, Chwen L; Mueller, Christina; Bushell, Ellen S; Jia, Yonggen; Graindorge, Arnault; Billker, Oliver; Rayner, Julian C; Soldati-Favre, Dominique

2013-01-01

142

Transfection of live, tick derived sporozoites of the protozoan Apicomplexan parasite Theileria parva.  

PubMed

Theileria parva is an important veterinary protozoan causing the tick-borne disease East Coast fever. Transfection of Theileria parasites will facilitate the investigation of many aspects of this apicomplexan infection and its unique host-parasite interaction. The pathogen has the extraordinary capacity of transforming B and T cells into clonally dividing cancerous cell lines in a reversible way. Sequence data of the entire T. parva genome are available and in vitro infected cell lines can easily be generated, thereby eliminating the use of animals in the evaluation of the evolution of the transfected sporozoites. Here we report, for the first time, on experiments towards successful transient transfection of T. parva sporozoites, making use of a new generation transfection device. Plasmid DNA containing the strong EF-1? promoter and an Azami Green reporter gene were integrated by nucleofection into freshly purified T. parva sporozoites. Expression of Azami Green was detected with a fluorescence microscope and confirmed by counter staining with a monoclonal directed against a sporozoite protein. Despite the fact that transfection efficiencies are still low, this is the first step towards a stable infection method of T. parva parasites. In the long run, transfected parasites might become an alternative way to induce immunity without clinical signs. PMID:25660425

De Goeyse, Ine; Jansen, Famke; Madder, Maxime; Hayashida, Kyoko; Berkvens, Dirk; Dobbelaere, Dirk; Geysen, Dirk

2015-03-15

143

Extensive Genotypic Diversity in a Recombining Population of the Apicomplexan Parasite Theileria parva  

PubMed Central

We evaluated sexual recombination in the apicomplexan parasite Theileria parva using genome-wide marker analysis of haploid sporozoite populations obtained from infected Rhipicephalus appendiculatus ticks. Analysis of 231 parasite clones derived by in vitro infection of bovine lymphocytes revealed 48 distinct combinations of 64 polymorphic marker loci. One genotype accounted for more than 75% of the clones, and the population was highly inbred with respect to this. The occurrence of frequent recombination was evident from reassortment of contiguous markers in blocks, with some recombination occurring within blocks. Analysis of four polymorphic loci encoding antigens targeted by protective cytotoxic-T-lymphocyte responses confirmed that these loci reassort, both within and between chromosomes, suggesting that recombination may influence immune recognition. Marker analysis of a panel of 142 clones derived from the population after an additional passage through a calf and the same tick colony revealed 18 genotypes, with the original dominant genotype accounting for 75% of the population and a higher level of inbreeding with respect to it in the remaining clones. Selected marker analysis of genomic DNA from these stabilates and the two preceding generations of the isolate, each derived from distinct tick colonies, revealed shifts in population structure with each generation, suggesting that the tick vector may impose nonrandom selective pressure on the parasite. PMID:16988220

Katzer, Frank; Ngugi, Daniel; Oura, Chris; Bishop, Richard P.; Taracha, Evans L. N.; Walker, Alan R.; McKeever, Declan J.

2006-01-01

144

Subcellular localization of acetyl-CoA carboxylase in the apicomplexan parasite Toxoplasma gondii  

PubMed Central

Apicomplexan parasites such as Toxoplasma gondii contain a primitive plastid, the apicoplast, whose genome consists of a 35-kb circular DNA related to the plastid DNA of plants. Plants synthesize fatty acids in their plastids. The first committed step in fatty acid synthesis is catalyzed by acetyl-CoA carboxylase (ACC). This enzyme is encoded in the nucleus, synthesized in the cytosol, and transported into the plastid. In the present work, two genes encoding ACC from T. gondii were cloned and the gene structure was determined. Both ORFs encode multidomain proteins, each with an N-terminal extension, compared with the cytosolic ACCs from plants. The N-terminal extension of one isozyme, ACC1, was shown to target green fluorescent protein to the apicoplast of T. gondii. In addition, the apicoplast contains a biotinylated protein, consistent with the assertion that ACC1 is localized there. The second ACC in T. gondii appears to be cytosolic. T. gondii mitochondria also contain a biotinylated protein, probably pyruvate carboxylase. These results confirm the essential nature of the apicoplast and explain the inhibition of parasite growth in cultured cells by herbicides targeting ACC. PMID:11226307

Jelenska, J.; Crawford, M. J.; Harb, O. S.; Zuther, E.; Haselkorn, R.; Roos, D. S.; Gornicki, P.

2001-01-01

145

Lipid Synthesis in Protozoan Parasites: a Comparison Between Kinetoplastids and Apicomplexans  

PubMed Central

Lipid metabolism is of crucial importance for pathogens. Lipids serve as cellular building blocks, signalling molecules, energy stores, posttranslational modifiers, and pathogenesis factors. Parasites rely on a complex system of uptake and synthesis mechanisms to satisfy their lipid needs. The parameters of this system change dramatically as the parasite transits through the various stages of its life cycle. Here we discuss the tremendous recent advances that have been made in the understanding of the synthesis and uptake pathways for fatty acids and phospholipids in apicomplexan and kinetoplastid parasites, including Plasmodium, Toxoplasma, Cryptosporidium, Trypanosoma and Leishmania. Lipid synthesis differs in significant ways between parasites from both phyla and the human host. Parasites have acquired novel pathways through endosymbiosis, as in the case of the apicoplast, have dramatically reshaped substrate and product profiles, and have evolved specialized lipids to interact with or manipulate the host. These differences potentially provide opportunities for drug development. We outline the lipid pathways for key species in detail as they progress through the developmental cycle and highlight those that are of particular importance to the biology of the pathogens and/or are the most promising targets for parasite-specific treatment. PMID:23827884

Ramakrishnan, Srinivasan; Serricchio, Mauro; Striepen, Boris; Bütikofer, Peter

2013-01-01

146

Multiple determinants for selective inhibition of apicomplexan calcium-dependent protein kinase CDPK1  

PubMed Central

Diseases caused by the apicomplexan protozoans Toxoplasma gondii and Cryptosporidium parvum are a major health concern. The life cycle of these parasites is regulated by a family of calcium-dependent protein kinases (CDPKs) that have no direct homologs in the human host. Fortuitously, CDPK1 from both parasites contains a rare glycine gatekeeper residue adjacent to the ATP-binding pocket. This has allowed creation of a series of C3-substituted pyrazolopyrimidine compounds that are potent inhibitors selective for CDPK1 over a panel of human kinases. Here we demonstrate that selectivity is further enhanced by modification of the scaffold at the C1 position. The explanation for this unexpected result is provided by crystal structures of the inhibitors bound to CDPK1 and the human kinase c-SRC. Furthermore, the insight gained from these studies was applied to transform an alternative ATP-competitive scaffold lacking potency and selectivity for CDPK1 into a low nanomolar inhibitor of this enzyme with no activity against SRC. PMID:22369268

Larson, Eric T.; Ojo, Kayode K.; Murphy, Ryan C.; Johnson, Steven M.; Zhang, Zhongsheng; Kim, Jessica E.; Leibly, David J.; Fox, Anna M. W.; Reid, Molly C.; Dale, Edward J.; Perera, B. Gayani K.; Kim, Jae; Hewitt, Stephen N.; Hol, Wim G. J.; Verlinde, Christophe L. M. J.; Fan, Erkang; Van Voorhis, Wesley C.; Maly, Dustin J.; Merritt, Ethan A.

2012-01-01

147

Control site location and transcriptional regulation in Escherichia coli.  

PubMed Central

The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993

Collado-Vides, J; Magasanik, B; Gralla, J D

1991-01-01

148

Involvement and necessity of the Cpx regulon in the event of aberrant ?-barrel outer membrane protein assembly  

PubMed Central

Summary The Cpx and ?E regulons help maintain outer membrane integrity; the Cpx pathway monitors the biogenesis of cell surface structures, such as pili, while the ?E pathway monitors the biogenesis of ?-barrel outer membrane proteins (OMPs). In this study we revealed the importance of the Cpx regulon in the event of ?-barrel OMP mis-assembly, by utilizing mutants expressing either a defective ?-barrel OMP assembly machinery (Bam) or assembly defective ?-barrel OMPs. Analysis of specific mRNAs showed that ?cpxR bam double mutants failed to induce degP expression beyond the wild type level, despite activation of the ?E pathway. The synthetic conditional lethal phenotype of ?cpxR in mutant Bam or ?-barrel OMP backgrounds was reversed by wild type DegP expressed from a heterologous plasmid promoter. Consistent with the involvement of the Cpx regulon in the event of aberrant ?-barrel OMP assembly, the expression of cpxP, the archetypal member of the cpx regulon, was upregulated in defective Bam backgrounds or in cells expressing a single assembly-defective ?-barrel OMP species. Together, these results showed that both the Cpx and ?E regulons are required to reduce envelope stress caused by aberrant ?-barrel OMP assembly, with the Cpx regulon principally contributing by controlling degP expression. PMID:20487295

Gerken, Henri; Leiser, Owen P.; Bennion, Drew; Misra, Rajeev

2010-01-01

149

Involvement and necessity of the Cpx regulon in the event of aberrant beta-barrel outer membrane protein assembly.  

PubMed

The Cpx and sigma(E) regulons help maintain outer membrane integrity; the Cpx pathway monitors the biogenesis of cell surface structures, such as pili, while the sigma(E) pathway monitors the biogenesis of beta-barrel outer membrane proteins (OMPs). In this study we revealed the importance of the Cpx regulon in the event of beta-barrel OMP mis-assembly, by utilizing mutants expressing either a defective beta-barrel OMP assembly machinery (Bam) or assembly defective beta-barrel OMPs. Analysis of specific mRNAs showed that Delta cpxR bam double mutants failed to induce degP expression beyond the wild type level, despite activation of the sigma(E) pathway. The synthetic conditional lethal phenotype of Delta cpxR in mutant Bam or beta-barrel OMP backgrounds was reversed by wild type DegP expressed from a heterologous plasmid promoter. Consistent with the involvement of the Cpx regulon in the event of aberrant beta-barrel OMP assembly, the expression of cpxP, the archetypal member of the cpx regulon, was upregulated in defective Bam backgrounds or in cells expressing a single assembly-defective beta-barrel OMP species. Together, these results showed that both the Cpx and sigma(E) regulons are required to reduce envelope stress caused by aberrant beta-barrel OMP assembly, with the Cpx regulon principally contributing by controlling degP expression. PMID:20487295

Gerken, Henri; Leiser, Owen P; Bennion, Drew; Misra, Rajeev

2010-02-01

150

Microarray-Based Analysis of the Staphylococcus aureus  B Regulon  

Microsoft Academic Search

Microarray-based analysis of the transcriptional profiles of the genetically distinct Staphylococcus aureus strains COL, GP268, and Newman indicate that a total of 251 open reading frames (ORFs) are influenced by B activity. While B was found to positively control 198 genes by a factor of >2 in at least two of the three genetic lineages analyzed, 53 ORFs were repressed

Markus Bischoff; Paul Dunman; Jan Kormanec; Daphne Macapagal; Ellen Murphy; William Mounts; Brigitte Berger-Bachi; Steven Projan

2004-01-01

151

Transcriptomic Profiling of Yersinia pseudotuberculosis Reveals Reprogramming of the Crp Regulon by Temperature and Uncovers Crp as a Master Regulator of Small RNAs  

PubMed Central

One hallmark of pathogenic yersiniae is their ability to rapidly adjust their life-style and pathogenesis upon host entry. In order to capture the range, magnitude and complexity of the underlying gene control mechanisms we used comparative RNA-seq-based transcriptomic profiling of the enteric pathogen Y. pseudotuberculosis under environmental and infection-relevant conditions. We identified 1151 individual transcription start sites, multiple riboswitch-like RNA elements, and a global set of antisense RNAs and previously unrecognized trans-acting RNAs. Taking advantage of these data, we revealed a temperature-induced and growth phase-dependent reprogramming of a large set of catabolic/energy production genes and uncovered the existence of a thermo-regulated ‘acetate switch’, which appear to prime the bacteria for growth in the digestive tract. To elucidate the regulatory architecture linking nutritional status to virulence we also refined the CRP regulon. We identified a massive remodelling of the CRP-controlled network in response to temperature and discovered CRP as a transcriptional master regulator of numerous conserved and newly identified non-coding RNAs which participate in this process. This finding highlights a novel level of complexity of the regulatory network in which the concerted action of transcriptional regulators and multiple non-coding RNAs under control of CRP adjusts the control of Yersinia fitness and virulence to the requirements of their environmental and virulent life-styles. PMID:25816203

Nuss, Aaron M.; Heroven, Ann Kathrin; Waldmann, Barbara; Reinkensmeier, Jan; Jarek, Michael; Beckstette, Michael; Dersch, Petra

2015-01-01

152

Induction of the Pho Regulon Suppresses the Growth Defect of an Escherichia coli sgrS Mutant, Connecting Phosphate Metabolism to the Glucose-Phosphate Stress Response  

PubMed Central

Some bacteria experience stress when glucose-6-phosphate or analogues like ?-methyl glucoside-6-phosphate (?MG6P) accumulate in the cell. In Escherichia coli, the small SgrS RNA is vital to recovery from glucose-phosphate stress; the growth of sgrS mutants is strongly inhibited by ?MG. SgrS helps to restore growth in part through inhibiting translation of the ptsG mRNA, which encodes the major glucose transporter EIICBGlc. While the regulatory mechanism of SgrS has been characterized, little is known about how glucose-phosphate stress connects to other aspects of cell physiology. In the present study, we discovered that mutation of pitA, which encodes the low-affinity transporter of inorganic phosphate, partially suppresses the ?MG growth defect of an sgrS mutant. Induction of the stress response was also reduced in the sgrS pitA mutant compared to its sgrS parent. Microarray analysis suggested that expression of phosphate (Pho) regulon genes is increased in the sgrS pitA mutant compared to the sgrS parent. Consistent with this, we found increased PhoA (alkaline phosphatase) activity in the sgrS pitA mutant compared to the sgrS strain. Further, direct induction of the Pho regulon (in a pitA+ background) also resulted in partial suppression of the sgrS growth defect. The suppression was reversed when Pho induction was prevented by mutation of phoB, which encodes the Pho transcriptional activator. Deletion of individual Pho structural genes in suppressed strains did not identify a single gene responsible for suppression. Altogether, this work describes one of the first studies of glucose-phosphate stress physiology and suggests a novel connection of carbon and phosphate metabolism. PMID:22427626

Richards, Gregory R.

2012-01-01

153

Mitochondrial genome of Babesia orientalis, apicomplexan parasite of water buffalo (Bubalus babalis, Linnaeus, 1758) endemic in China  

PubMed Central

Background Apicomplexan parasites of the genus Babesia, Theileria and Plasmodium are very closely related organisms. Interestingly, their mitochondrial (mt) genomes are highly divergent. Among Babesia, Babesia orientalis is a new species recently identified and specifically epidemic to the southern part of China, causing severe disease to water buffalo. However, no information on the mt genome of B. orientalis was available. Methods Four pairs of primers were designed based on the full genome sequence of B. orientalis (unpublished data) and by aligning reported mt genomes of B. bovis, B. bigemina, and T. parva. The entire mt genome was amplified by four sets of PCR. The obtained mt genome was annotated by aligning with published apicomplexan mt genomes and Artemis software v11. Phylogenetic analysis was performed by using cox1 and cob amino acid sequences. Results The complete mt genome of B. orientalis (Wuhan strain) was sequenced and characterized. The entire mt genome is 5996 bp in length with a linear form, containing three protein-coding genes including cytochrome c oxidase I (cox1), cytochrome b (cob) and cytochrome c oxidase III (cox3) and six rRNA large subunit gene fragments. The gene arrangement in B. orientalis mt genome is similar to those of B. bovis, B. gibsoni and Theileria parva, but different from those of T. orientalis, T. equi and Plasmodium falciparum. Comparative analysis indicated that cox1 and cob genes were more conserved than cox3. Phylogenetic analysis based on amino acid sequences of cox1, cob and cox1 + cob, respectively, revealed that B. orientalis fell into Babesia clade with the closest relationship to B. bovis. Conclusions The availability of the entire mt genome sequences of B. orientalis provides valuable information for future phylogenetic, population genetics and molecular epidemiological studies of apicomplexan parasites. PMID:24580772

2014-01-01

154

Inorganic Polyphosphate in Escherichia coli: the Phosphate Regulon and the Stringent Response  

Microsoft Academic Search

Escherichia coli transiently accumulates large amounts of inorganic polyphosphate (polyP), up to 20 mM in phosphate residues (Pi), in media deficient in both Pi and amino acids. This transient accumulation is preceded by the appearance of nucleotides ppGpp and pppGpp, generated in response to nutritional stresses. Mutants which lack PhoB, the response regulator of the phosphate regulon, do not accumulate

NARAYANA N. RAO; SHENGJIANG LIU; ARTHUR KORNBERG

1998-01-01

155

Identification of the CRE1 Cellulolytic Regulon in Neurospora crassa  

Microsoft Academic Search

BackgroundIn filamentous ascomycete fungi, the utilization of alternate carbon sources is influenced by the zinc finger transcription factor CreA\\/CRE-1, which encodes a carbon catabolite repressor protein homologous to Mig1 from Saccharomyces cerevisiae. In Neurospora crassa, deletion of cre-1 results in increased secretion of amylase and ?-galactosidase.Methodology\\/Principal FindingsHere we show that a strain carrying a deletion of cre-1 has increased cellulolytic

Jianping Sun; N. Louise Glass; Robert Alan Arkowitz

2011-01-01

156

Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus  

SciTech Connect

Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. Despite the growing number of genome-scale gene expression studies, our abilities to convert the results of these studies into accurate regulatory annotations and to project them from model to other organisms are extremely limited. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. However, even orthologous regulators with conserved DNA-binding motifs may control substantially different gene sets, revealing striking differences in regulatory strategies between the Shewanella spp. and E. coli. Multiple examples of regulatory network rewiring include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), and numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. NagR for N-acetylglucosamine catabolism and PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp).

Rodionov, Dmitry A.; Novichkov, Pavel; Stavrovskaya, Elena D.; Rodionova, Irina A.; Li, Xiaoqing; Kazanov, Marat D.; Ravcheev, Dmitry A.; Gerasimova, Anna V.; Kazakov, Alexey E.; Kovaleva, Galina Y.; Permina, Elizabeth A.; Laikova, Olga N.; Overbeek, Ross; Romine, Margaret F.; Fredrickson, Jim K.; Arkin, Adam P.; Dubchak, Inna; Osterman, Andrei L.; Gelfand, Mikhail S.

2011-06-15

157

Three chymotrypsin genes are members of the AdpA regulon in the A-factor regulatory cascade in Streptomyces griseus.  

PubMed

AdpA is a key transcriptional activator in the A-factor regulatory cascade in Streptomyces griseus, activating a number of genes required for secondary metabolism and morphological differentiation. Of the five chymotrypsin-type serine protease genes, sprA, sprB, and sprD were transcribed in response to AdpA, showing that these protease genes are members of the AdpA regulon. These proteases were predicted to play the same physiological role, since these protease genes were transcribed in a similar time course during growth and the matured enzymes showed high end-to-end similarity to one another. AdpA bound two sites upstream of the sprA promoter approximately at positions -375 and -50 with respect to the transcriptional start point of sprA. Mutational analysis of the AdpA-binding sites showed that both AdpA-binding sites were essential for transcriptional activation. AdpA bound a single site at position -50 in front of the sprB promoter and greatly enhanced the transcription of sprB. The AdpA-binding site at position -40 was essential for transcription of sprD, although there was an additional AdpA-binding site at position -180. Most chymotrypsin activity excreted by S. griseus was attributed to SprA and SprB, because mutant deltasprAB, having a deletion in both sprA and sprB, lost almost all chymotrypsin activity, as did mutant deltaadpA. Even the double mutant deltasprAB and triple mutant deltasprABD grew normally and developed aerial hyphae and spores over the same time course as the wild-type strain. PMID:16159767

Tomono, Ayami; Tsai, Yisan; Ohnishi, Yasuo; Horinouchi, Sueharu

2005-09-01

158

Three Chymotrypsin Genes Are Members of the AdpA Regulon in the A-Factor Regulatory Cascade in Streptomyces griseus  

PubMed Central

AdpA is a key transcriptional activator in the A-factor regulatory cascade in Streptomyces griseus, activating a number of genes required for secondary metabolism and morphological differentiation. Of the five chymotrypsin-type serine protease genes, sprA, sprB, and sprD were transcribed in response to AdpA, showing that these protease genes are members of the AdpA regulon. These proteases were predicted to play the same physiological role, since these protease genes were transcribed in a similar time course during growth and the matured enzymes showed high end-to-end similarity to one another. AdpA bound two sites upstream of the sprA promoter approximately at positions ?375 and ?50 with respect to the transcriptional start point of sprA. Mutational analysis of the AdpA-binding sites showed that both AdpA-binding sites were essential for transcriptional activation. AdpA bound a single site at position ?50 in front of the sprB promoter and greatly enhanced the transcription of sprB. The AdpA-binding site at position ?40 was essential for transcription of sprD, although there was an additional AdpA-binding site at position ?180. Most chymotrypsin activity excreted by S. griseus was attributed to SprA and SprB, because mutant ?sprAB, having a deletion in both sprA and sprB, lost almost all chymotrypsin activity, as did mutant ?adpA. Even the double mutant ?sprAB and triple mutant ?sprABD grew normally and developed aerial hyphae and spores over the same time course as the wild-type strain. PMID:16159767

Tomono, Ayami; Tsai, Yisan; Ohnishi, Yasuo; Horinouchi, Sueharu

2005-01-01

159

Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks  

SciTech Connect

Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the result, we demonstrate considerable interconnection between various nitrogen-oxides-responsive regulatory systems for the denitrification and NO detoxification genes and evolutionary plasticity of this transcriptional network.

Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.; Alm, EricJ.; Gelfand, Mikhail S.

2005-09-01

160

Evidence of tRNA cleavage in apicomplexan parasites: half-tRNAs as new potential regulatory molecules of Toxoplasma gondii and Plasmodium berghei  

Technology Transfer Automated Retrieval System (TEKTRAN)

Several lines of evidence demonstrated that organisms ranging from bacteria to higher animals possess a regulated endonucleolytic cleavage pathway producing half-tRNA fragments. In the present study, we investigated the occurrence of this phenomenon in two distantly related apicomplexan parasites, T...

161

DB-AT: a 2015 update to the Full-parasites database brings a multitude of new transcriptomic data for apicomplexan parasites  

PubMed Central

The previous release of our Full-parasites database (http://fullmal.hgc.jp/) brought enhanced functionality, an expanded full-length cDNA content, and new RNA-Seq datasets from several important apicomplexan parasites. The 2015 update witnesses the major shift in the databases content with focus on diverse transcriptomes of the apicomplexan parasites. The content of the database was substantially enriched with transcriptome information for new apicomplexan parasites. The latest version covers a total of 17 species, with addition of our newly generated RNA-Seq data of a total of 909 150 388 tags. Moreover, we have generated and included two novel and unique datasets, which represent diverse nature of transcriptomes in individual parasites in vivo and in vitro. One is the data collected from 116 Indonesian patients infected with Plasmodium falciparum. The other is a series of transcriptome data collected from a total of 38 single cells of P. falciparum cultured in vitro. We believe that with the recent advances our database becomes an even better resource and a unique platform in the analysis of apicomplexan parasites and their interaction with their hosts. To adequately reflect the recent modifications and the current content we have changed the database name to DB-AT—DataBase of Apicomplexa Transcriptomes. PMID:25414358

J?kalski, Marcin; Wakaguri, Hiroyuki; Kischka, Tabea G.; Nishikawa, Yoshifumi; Kawazu, Shin-ichiro; Matsubayashi, Makoto; Kawahara, Fumiya; Tsuji, Naotoshi; Cao, Shinuo; Sunaga, Fujiko; Xuan, Xuenan; Okubo, Kazuhiro; Igarashi, Ikuo; Tuda, Josef; Mongan, Arthur E.; Eshita, Yuki; Maeda, Ryuichiro; Maka?owski, Wojciech; Suzuki, Yutaka; Yamagishi, Junya

2015-01-01

162

Global Regulatory Impact of ClpP Protease of Staphylococcus aureus on Regulons Involved in Virulence, Oxidative Stress Response, Autolysis, and DNA Repair†  

PubMed Central

Staphylococcus aureus is an important pathogen, causing a wide range of infections including sepsis, wound infections, pneumonia, and catheter-related infections. In several pathogens ClpP proteases were identified by in vivo expression technologies to be important for virulence. Clp proteolytic complexes are responsible for adaptation to multiple stresses by degrading accumulated and misfolded proteins. In this report clpP, encoding the proteolytic subunit of the ATP-dependent Clp protease, was deleted, and gene expression of ?clpP was determined by global transcriptional analysis using DNA-microarray technology. The transcriptional profile reveals a strong regulatory impact of ClpP on the expression of genes encoding proteins that are involved in the pathogenicity of S. aureus and adaptation of the pathogen to several stresses. Expression of the agr system and agr-dependent extracellular virulence factors was diminished. Moreover, the loss of clpP leads to a complete transcriptional derepression of genes of the CtsR- and HrcA-controlled heat shock regulon and a partial derepression of genes involved in oxidative stress response, metal homeostasis, and SOS DNA repair controlled by PerR, Fur, MntR, and LexA. The levels of transcription of genes encoding proteins involved in adaptation to anaerobic conditions potentially regulated by an Fnr-like regulator were decreased. Furthermore, the expression of genes whose products are involved in autolysis was deregulated, leading to enhanced autolysis in the mutant. Our results indicate a strong impact of ClpP proteolytic activity on virulence, stress response, and physiology in S. aureus. PMID:16885446

Michel, Antje; Agerer, Franziska; Hauck, Christof R.; Herrmann, Mathias; Ullrich, Joachim; Hacker, Jörg; Ohlsen, Knut

2006-01-01

163

Strain-dependent diversity in the Pseudomonas aeruginosa quorum-sensing regulon.  

PubMed

Quorum sensing allows bacteria to sense and respond to changes in population density. Acyl-homoserine lactones serve as quorum-sensing signals for many Proteobacteria, and acyl-homoserine lactone signaling is known to control cooperative activities. Quorum-controlled activities vary from one species to another. Quorum-sensing controls a constellation of genes in the opportunistic pathogen Pseudomonas aeruginosa, which thrives in a number of habitats ranging from soil and water to animal hosts. We hypothesized that there would be significant variation in quorum-sensing regulons among strains of P. aeruginosa isolated from different habitats and that differences in the quorum-sensing regulons might reveal insights about the ecology of P. aeruginosa. As a test of our hypothesis we used RNA-seq to identify quorum-controlled genes in seven P. aeruginosa isolates of diverse origins. Although our approach certainly overlooks some quorum-sensing-regulated genes we found a shared set of genes, i.e., a core quorum-controlled gene set, and we identified distinct, strain-variable sets of quorum-controlled genes, i.e., accessory genes. Some quorum-controlled genes in some strains were not present in the genomes of other strains. We detected a correlation between traits encoded by some genes in the strain-variable subsets of the quorum regulons and the ecology of the isolates. These findings indicate a role for quorum sensing in extension of the range of habitats in which a species can thrive. This study also provides a framework for understanding the molecular mechanisms by which quorum-sensing systems operate, the evolutionary pressures by which they are maintained, and their importance in disparate ecological contexts. PMID:22988113

Chugani, Sudha; Kim, Byoung Sik; Phattarasukol, Somsak; Brittnacher, Mitchell J; Choi, Sang Ho; Harwood, Caroline S; Greenberg, E Peter

2012-10-01

164

BCKDH: The Missing Link in Apicomplexan Mitochondrial Metabolism Is Required for Full Virulence of Toxoplasma gondii and Plasmodium berghei  

PubMed Central

While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens. PMID:25032958

Oppenheim, Rebecca D.; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P.; Billker, Oliver; McConville, Malcolm J.; Soldati-Favre, Dominique

2014-01-01

165

Toxoplasma gondii Rhoptry Discharge Correlates with Activation of the Early Growth Response 2 Host Cell Transcription Factor ?  

PubMed Central

Toxoplasma gondii is a ubiquitous apicomplexan parasite that can cause severe disease in fetuses and immune-compromised patients. Rhoptries, micronemes, and dense granules, which are secretory organelles unique to Toxoplasma and other apicomplexan parasites, play critical roles in parasite growth and virulence. To understand how these organelles modulate infected host cells, we sought to identify host cell transcription factors triggered by their release. Early growth response 2 (EGR2) is a host cell transcription factor that is rapidly upregulated and activated in Toxoplasma-infected cells but not in cells infected with the closely related apicomplexan parasite Neospora caninum. EGR2 upregulation occurred only when live parasites were in direct contact with the host cell and not from exposure to cell extracts that contain dense granule or micronemal proteins. When microneme-mediated attachment was blocked by pretreating parasites with a calcium chelator, EGR2 expression was significantly reduced. In contrast, when host cells were infected with parasites in the presence of cytochalasin D, which allows rhoptry secretion but prevents parasite invasion, EGR2 was activated. Finally, we demonstrate that Toxoplasma activation of host p38 mitogen-activated protein kinase is necessary but not sufficient for EGR2 activation. Collectively, these data indicate that EGR2 is specifically upregulated by a parasite-derived secreted factor that is most likely a resident rhoptry protein. PMID:18678671

Phelps, Eric D.; Sweeney, Kristin R.; Blader, Ira J.

2008-01-01

166

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.  

PubMed

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans. PMID:3325779

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

167

Deep Sequencing Analysis of Small Noncoding RNA and mRNA Targets of the Global PostTranscriptional Regulator, Hfq  

Microsoft Academic Search

Recent advances in high-throughput pyrosequencing (HTPS) technology now allow a thorough analysis of RNA bound to cellular proteins, and, therefore, of post-transcriptional regulons. We used HTPS to discover the Salmonella RNAs that are targeted by the common bacterial Sm-like protein, Hfq. Initial transcriptomic analysis revealed that Hfq controls the expression of almost a fifth of all Salmonella genes, including several

Alexandra Sittka; Sacha Lucchini; Kai Papenfort; Cynthia M. Sharma; Katarzyna Rolle; Tim T. Binnewies; Jay C. D. Hinton; Jörg Vogel

2008-01-01

168

Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.  

PubMed

Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn?HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite. PMID:24923662

Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K

2014-09-01

169

External-pH-dependent expression of the maltose regulon and ompF gene in Escherichia coli is affected by the level of glycerol kinase, encoded by glpK.  

PubMed

The expression of the maltose system in Escherichia coli is regulated at both transcriptional and translational levels by the pH of the growth medium (pHo). With glycerol as the carbon source, transcription of malT, encoding the transcriptional activator of the maltose regulon, is weaker in acidic medium than in alkaline medium. malT transcription became high, regardless of the pHo, when glycerol-3-phosphate or succinate was used as the carbon source. Conversely, malT expression was low, regardless of the pHo, when maltose was used as the carbon source. The increase in malT transcription, associated with the pHo, requires the presence of glycerol in the growth medium and the expression of the glycerol kinase (GlpK). Changes in the level of glpK transcription had a great effect on malT transcription. Indeed, a glpFKX promoter-down mutation has been isolated, and in the presence of this mutation, malT expression was increased. When glpK was expressed from a high-copy-number plasmid, the glpK-dependent reduced expression of the maltose system became effective regardless of the pHo. Analysis of this repression showed that a malTp1 malTp10 promoter, which is independent of the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex, was no longer repressed by glpFKX amplification. Thus, GlpK-dependent repression of the maltose system requires the cAMP-CRP complex. We propose that the pHo may affect a complex interplay between GlpK, the phosphotransferase-mediated uptake of glucose, and the adenylate cyclase. PMID:11544231

Chagneau, C; Heyde, M; Alonso, S; Portalier, R; Laloi, P

2001-10-01

170

Probing the ArcA regulon under aerobic/ROS conditions in Salmonella enterica serovar Typhimurium  

PubMed Central

Background Hydrogen peroxide (H2O2) is a reactive oxygen species (ROS), which is part of the oxidative burst encountered upon internalization of Salmonella enterica serovar Typhimurium (S. Typhimurium) by phagocytic cells. It has previously been established that, the ArcAB two-component system plays a critical role in ROS resistance, but the genes regulated by the system remained undetermined to date. We therefore investigated the ArcA regulon in aerobically growing S. Typhimurium before and after exposure to H2O2 by querying gene expression and other physiological changes in wild type and ?arcA strains. Results In the ?arcA strain, expression of 292 genes showed direct or indirect regulation by ArcA in response to H2O2, of which 141were also regulated in aerobiosis, but in the opposite direction. Gene set enrichment analysis (GSEA) of the expression data from WT and ?arcA strains, revealed that, in response to H2O2 challenge in aerobically grown cells, ArcA down regulated multiple PEP-PTS and ABC transporters, while up regulating genes involved in glutathione and glycerolipid metabolism and nucleotide transport. Further biochemical analysis guided by GSEA results showed that deletion of arcA during aerobic growth lead to increased reactive oxygen species (ROS) production which was concomitant with an increased NADH/NAD+ ratio. In absence of ArcA under aerobic conditions, H2O2 exposure resulted in lower levels of glutathione reductase activity, leading to a decreased GSH (reduced glutathione)/GSSG (oxidized glutathione) ratio. Conclusion The ArcA regulon was defined in 2 conditions, aerobic growth and the combination of peroxide treatment and aerobic growth in S. Typhimurium. ArcA coordinates a response that involves multiple aspects of the carbon flux through central metabolism, which ultimately modulates the reducing potential of the cell. PMID:24044554

2013-01-01

171

Xylan Utilization Regulon in Xanthomonas citri pv. citri Strain 306: Gene Expression and Utilization of Oligoxylosides.  

PubMed

Xanthomonas citri pv. citri strain 306 (Xcc306), a causative agent of citrus canker, produces endoxylanases that catalyze the depolymerization of cell wall-associated xylans. In the sequenced genomes of all plant-pathogenic xanthomonads, genes encoding xylanolytic enzymes are clustered in three adjacent operons. In Xcc306, these consecutive operons contain genes encoding the glycoside hydrolase family 10 (GH10) endoxylanases Xyn10A and Xyn10C, the agu67 gene, encoding a GH67 ?-glucuronidase (Agu67), the xyn43E gene, encoding a putative GH43 ?-l-arabinofuranosidase, and the xyn43F gene, encoding a putative ?-xylosidase. Recombinant Xyn10A and Xyn10C convert polymeric 4-O-methylglucuronoxylan (MeGXn) to oligoxylosides methylglucuronoxylotriose (MeGX3), xylotriose (X3), and xylobiose (X2). Xcc306 completely utilizes MeGXn predigested with Xyn10A or Xyn10C but shows little utilization of MeGXn. Xcc306 with a deletion in the gene encoding ?-glucuronidase (Xcc306 ?agu67) will not utilize MeGX3 for growth, demonstrating the role of Agu67 in the complete utilization of GH10-digested MeGXn. Preferential growth on oligoxylosides compared to growth on polymeric MeGXn indicates that GH10 xylanases, either secreted by Xcc306 in planta or produced by the plant host, generate oligoxylosides that are processed by Xyn10 xylanases and Agu67 residing in the periplasm. Coordinate induction by oligoxylosides of xyn10, agu67, cirA, the tonB receptor, and other genes within these three operons indicates that they constitute a regulon that is responsive to the oligoxylosides generated by the action of Xcc306 GH10 xylanases on MeGXn. The combined expression of genes in this regulon may allow scavenging of oligoxylosides derived from cell wall deconstruction, thereby contributing to the tissue colonization and/or survival of Xcc306 and, ultimately, to plant disease. PMID:25595763

Chow, V; Shantharaj, D; Guo, Y; Nong, G; Minsavage, G V; Jones, J B; Preston, J F

2015-03-15

172

Defining potentially conserved RNA regulons of homologous zinc-finger RNA-binding proteins  

PubMed Central

Background Glucose inhibition of gluconeogenic growth suppressor 2 protein (Gis2p) and zinc-finger protein 9 (ZNF9) are conserved yeast and human zinc-finger proteins. The function of yeast Gis2p is unknown, but human ZNF9 has been reported to bind nucleic acids, and mutations in the ZNF9 gene cause the neuromuscular disease myotonic dystrophy type 2. To explore the impact of these proteins on RNA regulation, we undertook a systematic analysis of the RNA targets and of the global implications for gene expression. Results Hundreds of mRNAs were associated with Gis2p, mainly coding for RNA processing factors, chromatin modifiers and GTPases. Target mRNAs contained stretches of G(A/U)(A/U) trinucleotide repeats located in coding sequences, which are sufficient for binding to both Gis2p and ZNF9, thus implying strong structural conservation. Predicted ZNF9 targets belong to the same functional categories as seen in yeast, indicating functional conservation, which is further supported by complementation of the large cell-size phenotype of gis2 mutants with ZNF9. We further applied a matched-sample proteome-transcriptome analysis suggesting that Gis2p differentially coordinates expression of RNA regulons, primarily by reducing mRNA and protein levels of genes required for ribosome assembly and by selectively up-regulating protein levels of myosins. Conclusions This integrated systematic exploration of RNA targets for homologous RNA-binding proteins indicates an unexpectedly high conservation of the RNA-binding properties and of potential targets, thus predicting conserved RNA regulons. We also predict regulation of muscle-specific genes by ZNF9, adding a potential link to the myotonic dystrophy related phenotypes seen in ZNF9 mouse models. PMID:21232131

2011-01-01

173

Transcriptional response of Escherichia coli to external copper.  

PubMed

Transcriptional response of Escherichia coli upon exposure to external copper was studied using DNA microarray and in vivo and in vitro transcription assays. Transcription of three hitherto-identified copper-responsive genes, copA (copper efflux transporter), cueO (multicopper oxidase) and cusC (tripartite copper pump component) became maximum at 5 min after addition of copper sulphate, and thereafter decreased to the preshift levels within 30 min. Microarray analysis at 5 min after addition of copper indicated that a total of at least 29 genes including these three known genes were markedly and specifically affected (28 upregulated and one downregulated). Transcription of the divergent operons, cusCFB and cusRS, was found to be activated by CusR, which bound to a CusR box between the cusC and cusR promoters. Except for this site, the CusR box was not identified in the entire E. coli genome. On the other hand, transcription of copA and cueO was found to be activated by another copper-responsive factor CueR, which bound to a conserved inverted repeat sequence, CueR box. A total of 197 CueR boxes were identified on the E. coli genome, including the CueR box associated with the moa operon for molybdenum cofactor synthesis. At least 10 copper-induced genes were found to be under the control of CpxAR two-component system, indicating that copper is one of the signals for activation of the CpxAR system. In addition, transcription of yedWV, a putative two-component system, was activated by copper in CusR-dependent manner. Taken together we conclude that the copper-responsive genes are organized into a hierarchy of the regulation network, forming at least four regulons, i.e. CueR, CusR, CpxR and YedW regulons. These copper-responsive regulons appear to sense and respond to different concentrations of external copper. PMID:15773991

Yamamoto, Kaneyoshi; Ishihama, Akira

2005-04-01

174

Studying Gene Expression: Database Searches and Promoter Fusions to Investigate Transcriptional Regulation in Bacteria†  

PubMed Central

A laboratory project was designed to illustrate how to search biological databases and utilize the information provided by these resources to investigate transcriptional regulation in Escherichia coli. The students searched several databases (NCBI Genomes, RegulonDB and EcoCyc) to learn about gene function, regulation, and the organization of transcriptional units. A fluorometer and GFP promoter fusions were used to obtain fluorescence data and measure changes in transcriptional activity. The class designed and performed experiments to investigate the regulation of genes necessary for biosynthesis of amino acids and how expression is affected by environmental signals and transcriptional regulators. Assessment data showed that this activity enhanced students’ knowledge of databases, reporter genes and transcriptional regulation. PMID:23653697

Martinez-Vaz, Betsy M.; Makarevitch, Irina; Stensland, Shane

2010-01-01

175

Commitment to a cellular transition precedes genome-wide transcriptional change  

PubMed Central

In budding yeast, commitment to cell division corresponds to activating the positive feedback loop of G1 cyclins controlled by the transcription factors SBF and MBF. This pair of transcription factors has over 200 targets, implying that cell cycle commitment coincides with genome-wide changes in transcription. Here, we find that genes within this regulon have a well-defined distribution of transcriptional activation times. Combinatorial use of SBF and MBF results in a logical OR function for gene expression and partially explains activation timing. Activation of G1 cyclin expression precedes the activation of the bulk of the G1/S regulon ensuring that commitment to cell division occurs before large-scale changes in transcription. Furthermore, we find similar positive feedback-first regulation in the yeasts S. bayanus and S. cerevisiae, as well as human cells. The widespread use of the feedback-first motif in eukaryotic cell cycle control, implemented by non-orthologous proteins, suggests its frequent deployment at cellular transitions. PMID:21855792

Eser, Umut; Falleur-Fettig, Melody; Johnson, Amy; Skotheim, Jan M.

2011-01-01

176

Fecundity reduction in the second gonotrophic cycle of Culex pipiens infected with the apicomplexan blood parasite, Hepatozoon sipedon.  

PubMed

Fecundity reduction is a well-recognized phenomenon of parasite infection in insects. Reduced production of eggs might increase longevity of a host and release nutrients to both host and parasite that would otherwise be used for oogenesis. The objective of this study was to assess effects on fecundity caused by Hepatozoon sipedon, an apicomplexan blood parasite of snakes, in its invertebrate host, the mosquito Culex pipiens. In the first gonotrophic cycle, the mean number of eggs laid by mosquitoes infected with H. sipedon did not differ significantly from those laid by uninfected mosquitoes. However, in the second gonotrophic cycle infected mosquitoes laid significantly fewer eggs than did uninfected mosquitoes, and fecundity was reduced by 100% in mosquitoes with parasite burdens of more than 60 oocysts. There was a significant negative correlation between parasite burden, or the number of oocysts, and the number of eggs produced in the second gonotrophic cycle. Significantly fewer viable larvae hatched from eggs laid by infected compared to uninfected mosquitoes in the second gonotrophic cycle. These data indicate that fecundity reduction occurs in this system, although the physiological mechanisms driving this phenotype are not yet known. PMID:24650105

Ferguson, Laura V; Smith, Todd G

2014-08-01

177

Purification and molecular characterization of cGMP-dependent protein kinase from Apicomplexan parasites. A novel chemotherapeutic target.  

PubMed

The trisubstituted pyrrole 4-[2-(4-fluorophenyl)-5-(1-methylpiperidine-4-yl)-1H-pyrrol-3-yl]pyridine (Compound 1) inhibits the growth of Eimeria spp. both in vitro and in vivo. The molecular target of Compound 1 was identified as cGMP-dependent protein kinase (PKG) using a tritiated analogue to purify a approximately 120-kDa protein from lysates of Eimeria tenella. This represents the first example of a protozoal PKG. Cloning of PKG from several Apicomplexan parasites has identified a parasite signature sequence of nearly 300 amino acids that is not found in mammalian or Drosophila PKG and which contains an additional, third cGMP-binding site. Nucleotide cofactor regulation of parasite PKG is remarkably different from mammalian enzymes. The activity of both native and recombinant E. tenella PKG is stimulated 1000-fold by cGMP, with significant cooperativity. Two isoforms of the parasite enzyme are expressed from a single copy gene. NH(2)-terminal sequence of the soluble isoform of PKG is consistent with alternative translation initiation within the open reading frame of the enzyme. A larger, membrane-associated isoform corresponds to the deduced full-length protein sequence. Compound 1 is a potent inhibitor of both soluble and membrane-associated isoforms of native PKG, as well as recombinant enzyme, with an IC(50) of <1 nm. PMID:11834729

Gurnett, Anne M; Liberator, Paul A; Dulski, Paula M; Salowe, Scott P; Donald, Robert G K; Anderson, Jennifer W; Wiltsie, Judyann; Diaz, Carmen A; Harris, Georgiana; Chang, Ben; Darkin-Rattray, Sandra J; Nare, Bakela; Crumley, Tami; Blum, Penny Sue; Misura, Andrew S; Tamas, Tamas; Sardana, Mohinder K; Yuan, Jeffrey; Biftu, Tesfaye; Schmatz, Dennis M

2002-05-01

178

Bacillus subtilis functional genomics: genome-wide analysis of the DegS-DegU regulon by transcriptomics and proteomics  

Microsoft Academic Search

The DegS-DegU two-component regulatory system of Bacillus subtilis controls various processes that characterize the transition from the exponential to the stationary growth phase, including the induction of extracellular degradative enzymes, expression of late competence genes and down-regulation of the CD regulon. The degU32(Hy) mutation stabilizes the phosphorylated form of DegU (DegU-P), resulting in overproduction of several extracellular degradative enzymes. In

U. Mäder; H. Antelmann; T. Buder; M. Dahl; M. Hecker; G. Homuth

2002-01-01

179

Binding motifs in bacterial gene promoters modulate transcriptional effects of global regulators CRP and ArcA  

SciTech Connect

Bacterial gene regulation involves transcription factors (TF) that bind to DNA recognition sequences in operon promoters. These recognition sequences, many of which are palindromic, are known as regulatory elements or transcription factor binding sites (TFBS). Some TFs are global regulators that can modulate the expression of hundreds of genes. In this study we examine global regulator half-sites, where a half-site, which we shall call a binding motif (BM), is one half of a palindromic TFBS. We explore the hypothesis that the number of BMs plays an important role in transcriptional regulation, examining empirical data from transcriptional profiling of the CRP and ArcA regulons. We compare the power of BM counts and of full TFBS characteristics to predict induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full TFBS quality or location.

Leuze, Mike; Karpinets, Tatiana V.; Syed, Mustafa H.; Beliaev, Alex S.; Uberbacher, Edward

2012-05-30

180

Model of transcriptional activation by MarA in Escherichia coli.  

PubMed

The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond. PMID:20019803

Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G

2009-12-01

181

Model of transcriptional activation by MarA in escherichia coli  

SciTech Connect

The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

Wall, Michael E [Los Alamos National Laboratory; Rosner, Judah L [NATIONAL INSTITUTE OF HEALTH; Martin, Robert G [NATIONAL INSTITUTE OF HEALTH

2009-01-01

182

A cell-cell signaling peptide activates the PlcR virulence regulon in bacteria of the Bacillus cereus group.  

PubMed

PlcR is a pleiotropic regulator that activates the expression of genes encoding various virulence factors, such as phospholipases C, proteases and hemolysins, in Bacillus thuringiensis and Bacillus cereus. Here we show that the activation mechanism is under the control of a small peptide: PapR. The papR gene belongs to the PlcR regulon and is located 70 bp downstream from plcR. It encodes a 48-amino-acid peptide. Disruption of the papR gene abolished expression of the PlcR regulon, resulting in a large decrease in hemolysis and virulence in insect larvae. We demonstrated that the PapR polypeptide was secreted, then reimported via the oligopeptide permease Opp. Once inside the cell, a processed form of PapR, presumably a pentapeptide, activated the PlcR regulon by allowing PlcR to bind to its DNA target. This activating mechanism was found to be strain specific, with this specificity determined by the first residue of the penta peptide. PMID:12198157

Slamti, Leyla; Lereclus, Didier

2002-09-01

183

Construction and validation of a first-generation long-oligonulceotide microarray by transcriptional of the Bordetella bronchiseptica Bvg regulon  

Technology Transfer Automated Retrieval System (TEKTRAN)

Background: Bordetella bronchiseptica is a bacterial respiratory pathogen that infects a broad range of mammals, causing chronic and often subclinical infections. Gene expression in Bordetella is regulated by a two-component sensory transduction system, BvgAS, which controls the expression of a spec...

184

RegTransBase – a database of regulatory sequences and interactions based on literature: a resource for investigating transcriptional regulation in prokaryotes  

PubMed Central

Background Due to the constantly growing number of sequenced microbial genomes, comparative genomics has been playing a major role in the investigation of regulatory interactions in bacteria. Regulon inference mostly remains a field of semi-manual examination since absence of a knowledgebase and informatics platform for automated and systematic investigation restricts opportunities for computational prediction. Additionally, confirming computationally inferred regulons by experimental data is critically important. Description RegTransBase is an open-access platform with a user-friendly web interface publicly available at http://regtransbase.lbl.gov. It consists of two databases – a manually collected hierarchical regulatory interactions database based on more than 7000 scientific papers which can serve as a knowledgebase for verification of predictions, and a large set of curated by experts transcription factor binding sites used in regulon inference by a variety of tools. RegTransBase captures the knowledge from published scientific literature using controlled vocabularies and contains various types of experimental data, such as: the activation or repression of transcription by an identified direct regulator; determination of the transcriptional regulatory function of a protein (or RNA) directly binding to DNA or RNA; mapping of binding sites for a regulatory protein; characterization of regulatory mutations. Analysis of the data collected from literature resulted in the creation of Putative Regulons from Experimental Data that are also available in RegTransBase. Conclusions RegTransBase is a powerful user-friendly platform for the investigation of regulation in prokaryotes. It uses a collection of validated regulatory sequences that can be easily extracted and used to infer regulatory interactions by comparative genomics techniques thus assisting researchers in the interpretation of transcriptional regulation data. PMID:23547897

2013-01-01

185

Mobilization of Processed, Membrane-Tethered SPT23 Transcription Factor by CDC48 UFD1\\/NPL4, a Ubiquitin-Selective Chaperone  

Microsoft Academic Search

The OLE pathway of yeast regulates the level of the ER-bound enzyme ?9-fatty acid desaturase OLE1, thereby controlling membrane fluidity. A central component of this regulon is the transcription factor SPT23, a homolog of mammalian NF-?B. SPT23 is synthesized as an inactive, ER membrane-anchored precursor that is activated by regulated ubiquitin\\/proteasome-dependent processing (RUP). We now show that SPT23 dimerizes prior

Michael Rape; Thorsten Hoppe; Ingo Gorr; Marian Kalocay; Holger Richly; Stefan Jentsch

2001-01-01

186

Divergence of the mitochondrial genome structure in the apicomplexan parasites, Babesia and Theileria.  

PubMed

Mitochondrial (mt) genomes from diverse phylogenetic groups vary considerably in size, structure, and organization. The genus Plasmodium, causative agent of malaria, of the phylum Apicomplexa, has the smallest mt genome in the form of a circular and/or tandemly repeated linear element of 6 kb, encoding only three protein genes (cox1, cox3, and cob). The closely related genera Babesia and Theileria also have small mt genomes (6.6 kb) that are monomeric linear with an organization distinct from Plasmodium. To elucidate the structural divergence and evolution of mt genomes between Babesia/Theileria and Plasmodium, we determined five new sequences from Babesia bigemina, B. caballi, B. gibsoni, Theileria orientalis, and T. equi. Together with previously reported sequences of B. bovis, T. annulata, and T. parva, all eight Babesia and Theileria mt genomes are linear molecules with terminal inverted repeats (TIRs) on both ends containing three protein-coding genes (cox1, cox3, and cob) and six large subunit (LSU) ribosomal RNA (rRNA) gene fragments. The organization and transcriptional direction of protein-coding genes and the rRNA gene fragments were completely conserved in the four Babesia species. In contrast, notable variation occurred in the four Theileria species. Although the genome structures of T. annulata and T. parva were nearly identical to those of Babesia, an inversion in the 3-kb central region was found in T. orientalis. Moreover, the T. equi mt genome is the largest (8.2 kb) and most divergent with unusually long TIR sequences, in which cox3 and two LSU rRNA gene fragments are located. The T. equi mt genome showed little synteny to the other species. These results suggest that the Theileria mt genome is highly diverse with lineage-specific evolution in two Theileria species: genome inversion in T. orientalis and gene-embedded long TIR in T. equi. PMID:20034997

Hikosaka, Kenji; Watanabe, Yoh-Ichi; Tsuji, Naotoshi; Kita, Kiyoshi; Kishine, Hiroe; Arisue, Nobuko; Palacpac, Nirianne Marie Q; Kawazu, Shin-Ichiro; Sawai, Hiromi; Horii, Toshihiro; Igarashi, Ikuo; Tanabe, Kazuyuki

2010-05-01

187

Combined Amplicon Pyrosequencing Assays Reveal Presence of the Apicomplexan “type-N” (cf. Gemmocystis cylindrus) and Chromera velia on the Great Barrier Reef, Australia  

PubMed Central

Background The coral is predominantly composed of the metabolically dependent coral host and the photosynthetic dinoflagellate Symbiodinium sp. The system as a whole interacts with symbiotic eukaryotes, bacteria and viruses. Gemmocystiscylindrus (cf. “type-N” symbiont) belonging to the obligatory parasitic phylum Apicomplexa (Alveolata) is ubiquitous in the Caribbean coral, but its presence in the Great Barrier Reef coral has yet to be documented. Approaches allowing identification of the healthy community from the pathogenic or saprobic organisms are needed for sustainable coral reef monitoring. Methods & Principal Findings We investigated the diversity of eukaryotes associated with a common reef-building corals from the southern Great Barrier Reef. We used three tag encoded 454 amplicon pyrosequencing assays targeting eukaryote small-subunit rRNA gene to demonstrate the presence of the apicomplexan type-N and a photosynthetic sister species to Apicomplexa - Chromeravelia. Amplicon pyrosequencing revealed presence of the small-subunit rRNA genes of known eukaryotic pathogens (Cryptosporidium and Cryptococcus). We therefore conducted bacterial tag encoded amplicon pyrosequencing assay for small-subunit rRNA gene to support effluent exposure of the coral. Bacteria of faecal origin (Enterobacteriales) formed 41% of total sequences in contrast to 0-2% of the coral-associated bacterial communities with and without C. velia, respectively. Significance This is the first time apicomplexan type-N has been detected in the Great Barrier Reef. Eukaryote tag encoded amplicon pyrosequencing assays demonstrate presence of apicomplexan type-N and C. Velia in total coral DNA. The data highlight the need for combined approaches for eukaryotic diversity studies coupled with bacterial community assessment to achieve a more realistic goals of defining the holobiont community and assessing coral disease. With increasing evidence of Apicomplexa in coral reef environments, it is important not only to understand the evolution of these organisms but also identify their potential as pathogens. PMID:24098768

Šlapeta, Jan; Linares, Marjorie C.

2013-01-01

188

Investigation of the Staphylococcus aureus GraSR Regulon Reveals Novel Links to Virulence, Stress Response and Cell Wall Signal Transduction Pathways  

PubMed Central

The GraS/GraR two-component system has been shown to control cationic antimicrobial peptide (CAMP) resistance in the major human pathogen Staphylococcus aureus. We demonstrated that graX, also involved in CAMP resistance and cotranscribed with graRS, encodes a regulatory cofactor of the GraSR signaling pathway, effectively constituting a three-component system. We identified a highly conserved ten base pair palindromic sequence (5? ACAAA TTTGT 3?) located upstream from GraR-regulated genes (mprF and the dlt and vraFG operons), which we show to be essential for transcriptional regulation by GraR and induction in response to CAMPs, suggesting it is the likely GraR binding site. Genome-based predictions and transcriptome analysis revealed several novel GraR target genes. We also found that the GraSR TCS is required for growth of S. aureus at high temperatures and resistance to oxidative stress. The GraSR system has previously been shown to play a role in S. aureus pathogenesis and we have uncovered previously unsuspected links with the AgrCA peptide quorum-sensing system controlling virulence gene expression. We also show that the GraSR TCS controls stress reponse and cell wall metabolism signal transduction pathways, sharing an extensive overlap with the WalKR regulon. This is the first report showing a role for the GraSR TCS in high temperature and oxidative stress survival and linking this system to stress response, cell wall and pathogenesis control pathways. PMID:21765893

Falord, Mélanie; Mäder, Ulrike; Hiron, Aurélia; Débarbouillé, Michel; Msadek, Tarek

2011-01-01

189

Deep sequencing analyses expands the Pseudomonas aeruginosa AmpR regulon to include small RNA-mediated regulation of iron acquisition, heat shock and oxidative stress response.  

PubMed

Pathogenicity of Pseudomonas aeruginosa, a major cause of many acute and chronic human infections, is determined by tightly regulated expression of multiple virulence factors. Quorum sensing (QS) controls expression of many of these pathogenic determinants. Previous microarray studies have shown that the AmpC ?-lactamase regulator AmpR, a member of the LysR family of transcription factors, also controls non-?-lactam resistance and multiple virulence mechanisms. Using RNA-Seq and complementary assays, this study further expands the AmpR regulon to include diverse processes such as oxidative stress, heat shock and iron uptake. Importantly, AmpR affects many of these phenotypes, in part, by regulating expression of non-coding RNAs such as rgP32, asRgsA, asPrrF1 and rgRsmZ. AmpR positively regulates expression of the major QS regulators LasR, RhlR and MvfR, and genes of the Pseudomonas quinolone system. Chromatin immunoprecipitation (ChIP)-Seq and ChIP-quantitative real-time polymerase chain reaction studies show that AmpR binds to the ampC promoter both in the absence and presence of ?-lactams. In addition, AmpR directly binds the lasR promoter, encoding the QS master regulator. Comparison of the AmpR-binding sequences from the transcriptome and ChIP-Seq analyses identified an AT-rich consensus-binding motif. This study further attests to the role of AmpR in regulating virulence and physiological processes in P. aeruginosa. PMID:24157832

Balasubramanian, Deepak; Kumari, Hansi; Jaric, Melita; Fernandez, Mitch; Turner, Keith H; Dove, Simon L; Narasimhan, Giri; Lory, Stephen; Mathee, Kalai

2014-01-01

190

Genome-Wide Identification of Transcription Start Sites, Promoters and Transcription Factor Binding Sites in E. coli  

PubMed Central

Despite almost 40 years of molecular genetics research in Escherichia coli a major fraction of its Transcription Start Sites (TSSs) are still unknown, limiting therefore our understanding of the regulatory circuits that control gene expression in this model organism. RegulonDB (http://regulondb.ccg.unam.mx/) is aimed at integrating the genetic regulatory network of E. coli K12 as an entirely bioinformatic project up till now. In this work, we extended its aims by generating experimental data at a genome scale on TSSs, promoters and regulatory regions. We implemented a modified 5? RACE protocol and an unbiased High Throughput Pyrosequencing Strategy (HTPS) that allowed us to map more than 1700 TSSs with high precision. From this collection, about 230 corresponded to previously reported TSSs, which helped us to benchmark both our methodologies and the accuracy of the previous mapping experiments. The other ca 1500 TSSs mapped belong to about 1000 different genes, many of them with no assigned function. We identified promoter sequences and type of ? factors that control the expression of about 80% of these genes. As expected, the housekeeping ?70 was the most common type of promoter, followed by ?38. The majority of the putative TSSs were located between 20 to 40 nucleotides from the translational start site. Putative regulatory binding sites for transcription factors were detected upstream of many TSSs. For a few transcripts, riboswitches and small RNAs were found. Several genes also had additional TSSs within the coding region. Unexpectedly, the HTPS experiments revealed extensive antisense transcription, probably for regulatory functions. The new information in RegulonDB, now with more than 2400 experimentally determined TSSs, strengthens the accuracy of promoter prediction, operon structure, and regulatory networks and provides valuable new information that will facilitate the understanding from a global perspective the complex and intricate regulatory network that operates in E. coli. PMID:19838305

Mendoza-Vargas, Alfredo; Olvera, Leticia; Olvera, Maricela; Grande, Ricardo; Vega-Alvarado, Leticia; Taboada, Blanca; Jimenez-Jacinto, Verónica; Salgado, Heladia; Juárez, Katy; Contreras-Moreira, Bruno; Huerta, Araceli M.; Collado-Vides, Julio; Morett, Enrique

2009-01-01

191

Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility.  

PubMed

In Salmonella enterica, an activated Rcs signalling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes -fliPQR- located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signalling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

Wang, Qingfeng; Harshey, Rasika M

2009-10-01

192

Transcriptional regulation of the carbohydrate utilization network in Thermotoga maritima  

PubMed Central

Hyperthermophilic bacteria from the Thermotogales lineage can produce hydrogen by fermenting a wide range of carbohydrates. Previous experimental studies identified a large fraction of genes committed to carbohydrate degradation and utilization in the model bacterium Thermotoga maritima. Knowledge of these genes enabled comprehensive reconstruction of biochemical pathways comprising the carbohydrate utilization network. However, transcriptional factors (TFs) and regulatory mechanisms driving this network remained largely unknown. Here, we used an integrated approach based on comparative analysis of genomic and transcriptomic data for the reconstruction of the carbohydrate utilization regulatory networks in 11 Thermotogales genomes. We identified DNA-binding motifs and regulons for 19 orthologous TFs in the Thermotogales. The inferred regulatory network in T. maritima contains 181 genes encoding TFs, sugar catabolic enzymes and ABC-family transporters. In contrast to many previously described bacteria, a transcriptional regulation strategy of Thermotoga does not employ global regulatory factors. The reconstructed regulatory network in T. maritima was validated by gene expression profiling on a panel of mono- and disaccharides and by in vitro DNA-binding assays. The observed upregulation of genes involved in catabolism of pectin, trehalose, cellobiose, arabinose, rhamnose, xylose, glucose, galactose, and ribose showed a strong correlation with the UxaR, TreR, BglR, CelR, AraR, RhaR, XylR, GluR, GalR, and RbsR regulons. Ultimately, this study elucidated the transcriptional regulatory network and mechanisms controlling expression of carbohydrate utilization genes in T. maritima. In addition to improving the functional annotations of associated transporters and catabolic enzymes, this research provides novel insights into the evolution of regulatory networks in Thermotogales. PMID:23986752

Rodionov, Dmitry A.; Rodionova, Irina A.; Li, Xiaoqing; Ravcheev, Dmitry A.; Tarasova, Yekaterina; Portnoy, Vasiliy A.; Zengler, Karsten; Osterman, Andrei L.

2013-01-01

193

Transcriptional regulation of the carbohydrate utilization network in Thermotoga maritima.  

PubMed

Hyperthermophilic bacteria from the Thermotogales lineage can produce hydrogen by fermenting a wide range of carbohydrates. Previous experimental studies identified a large fraction of genes committed to carbohydrate degradation and utilization in the model bacterium Thermotoga maritima. Knowledge of these genes enabled comprehensive reconstruction of biochemical pathways comprising the carbohydrate utilization network. However, transcriptional factors (TFs) and regulatory mechanisms driving this network remained largely unknown. Here, we used an integrated approach based on comparative analysis of genomic and transcriptomic data for the reconstruction of the carbohydrate utilization regulatory networks in 11 Thermotogales genomes. We identified DNA-binding motifs and regulons for 19 orthologous TFs in the Thermotogales. The inferred regulatory network in T. maritima contains 181 genes encoding TFs, sugar catabolic enzymes and ABC-family transporters. In contrast to many previously described bacteria, a transcriptional regulation strategy of Thermotoga does not employ global regulatory factors. The reconstructed regulatory network in T. maritima was validated by gene expression profiling on a panel of mono- and disaccharides and by in vitro DNA-binding assays. The observed upregulation of genes involved in catabolism of pectin, trehalose, cellobiose, arabinose, rhamnose, xylose, glucose, galactose, and ribose showed a strong correlation with the UxaR, TreR, BglR, CelR, AraR, RhaR, XylR, GluR, GalR, and RbsR regulons. Ultimately, this study elucidated the transcriptional regulatory network and mechanisms controlling expression of carbohydrate utilization genes in T. maritima. In addition to improving the functional annotations of associated transporters and catabolic enzymes, this research provides novel insights into the evolution of regulatory networks in Thermotogales. PMID:23986752

Rodionov, Dmitry A; Rodionova, Irina A; Li, Xiaoqing; Ravcheev, Dmitry A; Tarasova, Yekaterina; Portnoy, Vasiliy A; Zengler, Karsten; Osterman, Andrei L

2013-01-01

194

Toward understanding transcriptional regulatory networks in abiotic stress responses and tolerance in rice  

PubMed Central

Abiotic stress causes loss of crop production. Under abiotic stress conditions, expression of many genes is induced, and their products have important roles in stress responses and tolerance. Progress has been made in understanding the biological roles of regulons in abiotic stress responses in rice. A number of transcription factors (TFs) regulate stress-responsive gene expression. OsDREB1s and OsDREB2s were identified as abiotic-stress responsive TFs that belong to the AP2/ERF family. Similar to Arabidopsis, these DREB regulons were most likely not involved in the abscisic acid (ABA) pathway. OsAREBs such as OsAREB1 were identified as key components in ABA-dependent transcriptional networks in rice. OsNAC/SNACs including OsNAC6 were characterized as factors that regulate expression of genes important for abiotic stress responses in rice. Here, we review on the rice abiotic-stress responses mediated by transcriptional networks, with the main focus on TFs that function in abiotic stress responses and confer stress tolerance in rice. PMID:24764506

2012-01-01

195

Architecture of the vir regulons of group A streptococci parallels opacity factor phenotype and M protein class.  

PubMed Central

Group A streptococci have traditionally been categorized into two broad groups based on the presence or absence of serum opacity factor (OF). Recent studies show that these two groups vary in a number of properties in addition to the OF phenotype, including sequence variations in the constant region of the antiphagocytic M protein genes, the presence or absence of immunoglobulin G Fc receptor proteins, and the presence or absence of multiple M protein-like genes situated in a tandem array. The M protein genes (emm) in OF- streptococcal strains are known to be part of a regulon of virulence-related genes controlled by the trans-acting positive regulatory gene, virR, situated just upstream of emm. In OF+ strains, however, the region adjacent to virR is occupied by an M protein-related, type IIa immunoglobulin G Fc receptor gene (fcrA), and the relative position of emm has not been determined. To further define the vir regulon in OF+ streptococci, we used the polymerase chain reaction to show that fcrA49 is situated immediately upstream of emm49 in the OF+ type 49 strain CS101. This result shows for the first time the separate identity and genetic linkage of these two genes in the vir regulon of an OF+ group A streptococcal strain and confirms our previous hypothesis that emm49 exists as the central gene in a trio of emm-like genes. Additionally, using DNA hybridizations, we found considerable sequence divergence between OF- and OF+ group A streptococci in virR and in the noncoding sequences between virR and the emm or fcrA expression site. We found, however, a high degree of sequence conservation in this region within each of the two groups of strains. Images PMID:1385809

Haanes, E J; Heath, D G; Cleary, P P

1992-01-01

196

Septal Localization of the Mycobacterium tuberculosis MtrB Sensor Kinase Promotes MtrA Regulon Expression*  

PubMed Central

The mechanisms responsible for activation of the MtrAB two-component regulatory signal transduction system, which includes sensor kinase MtrB and response regulator MtrA, are unknown. Here, we show that an MtrB-GFP fusion protein localized to the cell membrane, the septa, and the poles in Mycobacterium tuberculosis and Mycobacterium smegmatis. This localization was independent of MtrB phosphorylation status but dependent upon the assembly of FtsZ, the initiator of cell division. The M. smegmatis mtrB mutant was filamentous, defective for cell division, and contained lysozyme-sensitive cell walls. The mtrB phenotype was complemented by either production of MtrB protein competent for phosphorylation or overproduction of MtrAY102C and MtrAD13A mutant proteins exhibiting altered phosphorylation potential, indicating that either MtrB phosphorylation or MtrB independent expression of MtrA regulon genes, including those involved in cell wall processing, are necessary for regulated cell division. In partial support of this observation, we found that the essential cell wall hydrolase ripA is an MtrA target and that the expression of bona fide MtrA targets ripA, fbpB, and dnaA were compromised in the mtrB mutant and partially rescued upon MtrAY102C and MtrAD13A overproduction. MtrB septal assembly was compromised upon FtsZ depletion and exposure of cells to mitomycin C, a DNA damaging agent, which interferes with FtsZ ring assembly. Expression of MtrA targets was also compromised under the above conditions, indicating that MtrB septal localization and MtrA regulon expression are linked. We propose that MtrB septal association is a necessary feature of MtrB activation that promotes MtrA phosphorylation and MtrA regulon expression. PMID:22610443

Plocinska, Renata; Purushotham, Gorla; Sarva, Krishna; Vadrevu, Indumathi S.; Pandeeti, Emmanuel V. P.; Arora, Naresh; Plocinski, Przemyslaw; Madiraju, Murty V.; Rajagopalan, Malini

2012-01-01

197

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.  

PubMed

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

Zhu, Y; Lin, E C

1988-05-01

198

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.  

PubMed Central

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

Zhu, Y; Lin, E C

1988-01-01

199

Global analysis of photosynthesis transcriptional regulatory networks.  

PubMed

Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ?34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ?FnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

Imam, Saheed; Noguera, Daniel R; Donohue, Timothy J

2014-12-01

200

Global Analysis of Photosynthesis Transcriptional Regulatory Networks  

PubMed Central

Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ?34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ?FnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.

2014-01-01

201

Identification and characterization of transcription networks in environmentally significant species  

SciTech Connect

Understanding the regulation of gene expression, transcription regulation in particular, is one of the grand challenges of molecular biology. Transcription regulation is arguably the most important foundation of cellular function, since it exerts the most fundamental control of the abundance of virtually all of a cell's functional macromolecules. Nevertheless, this process, perhaps because of its difficulty, has been the subject of only a limited number of genomic level analyses. We have undertaken bioinformatics projects to address this issue by developing (1) a cross-species comparison method (i.e. phylogenetic footprinting) for the identification of transcription factor binding sites, (2) a Bayesian clustering method to identify regulons, (3) an improved scanning algorithm that uses a position weight matrix and several related species sequence data to locate transcription factor binding sites, and (4) a method to predict cognate binding sites for transcription factors of unknown specificity. These bioinformatics methods were developed using the model proteobacterium Escherichia coli, with further applications to the genomes of environmentally significant microbes (Rhodopseudomonas palustris, Shewanella oneidensis) in later years of the grant.

Lawrence, Charles E.; McCue, Lee Ann

2005-11-30

202

Ascorbic acid-dependent gene expression in Streptococcus pneumoniae and the activator function of the transcriptional regulator UlaR2  

PubMed Central

In this study, we have explored the impact of ascorbic acid on the transcriptome of Streptococcus pneumoniae D39. The expression of several genes and operons, including the ula operon (which has been previously shown to be involved in ascorbic acid utilization), the AdcR regulon (which has been previously shown to be involved in zinc transport and virulence) and a PTS operon (which we denote here as ula2 operon) were altered in the presence of ascorbic acid. The ula2 operon consists of five genes, including the transcriptional activator ulaR2. Our ?-galactosidase assay data and transcriptome comparison of the ulaR2 mutant with the wild-type demonstrated that the transcriptional activator UlaR2 in the presence of ascorbic acid activates the expression of the ula2 operon. We further predict a 16-bp regulatory site (5?-ATATTGTGCTCAAATA-3?) for UlaR2 in the Pula2. Furthermore, we have explored the effect of ascorbic acid on the expression of the AdcR regulon. Our ICP-MS analysis showed that addition of ascorbic acid to the medium causes zinc starvation in the cell which leads to the activation of the AdcR regulon. PMID:25717320

Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P.

2015-01-01

203

Two Calcium-Dependent Protein Kinases from Chlamydomonas reinhardtii are transcriptionally regulated by nutrient starvation  

PubMed Central

We report here, the transcriptional regulation of 2 Calcium Dependent Protein Kinases in response to nutrient starvation of Chlamydomonas reinhardtii vegetative cells. The CDPK proteins, CDPK1 and CDPK3; share 53% identity among themselves, a maximum of 57% and 52% to higher plants respectively and 42% to apicomplexan protozoans. We expressed a CDPK1-GFP fusion protein in the C. reinhardtii vegetative cells and showed its distribution both in the cell body and the membrane-matrix fraction of the flagella. The fusion protein exhibits mobility shift in the presence of Ca2+, confirming its Ca2+-binding properties. To the best of our knowledge, this is the first report of transcriptional regulation of CDPKs from a unicellular chlorophyte in response to nutrient starvation namely acetate (A), phosphorus (P), and nitrogen (N). PMID:24514873

Motiwalla, Mustafa J; Sequeira, Marilyn P; D'Souza, Jacinta S

2014-01-01

204

Use of a promiscuous, constitutively-active bacterial enhancer-binding protein to define the Sigma54 (RpoN) regulon of Salmonella Typhimurium LT2  

Technology Transfer Automated Retrieval System (TEKTRAN)

Background: Sigma54, or RpoN, is an alternative s factor found widely in eubacteria. A significant complication in analysis of the global sigma54 regulon in a bacterium is that the sigma54 RNA polymerase holoenzyme requires interaction with an active bacterial enhancer-binding protein (bEBP) to init...

205

Post-translational control of the Streptomyces lividans ClgR regulon by ClpP Audrey Bellier, Myriam Gominet and Philippe Mazodier*  

E-print Network

1 Post-translational control of the Streptomyces lividans ClgR regulon by ClpP Audrey Bellier and Lon proteases, degradation, ClgR activator, Streptomyces, differentiation * For correspondence.28564-0 #12;2 SUMMARY In Streptomyces, the clpP genes are organized as two bicistronic operons, clpP1P2

Boyer, Edmond

206

Elucidating the regulon of multidrug resistance regulator RarA in Klebsiella pneumoniae.  

PubMed

RarA is an AraC-type regulator in Klebsiella pneumoniae, which, when overexpressed, confers a low-level multidrug-resistant (MDR) phenotype linked to the upregulation of both the acrAB and oqxAB efflux genes. Increased rarA expression has also been shown to be integral in the development of tigecycline resistance in the absence of ramA in K. pneumoniae. Given its phenotypic role in MDR, microarray analyses were performed to determine the RarA regulon. Transcriptome analysis was undertaken using strains Ecl8?rarA/pACrarA-2 (rarA-expressing construct) and Ecl8?rarA/pACYC184 (vector-only control) using bespoke microarray slides consisting of probes derived from the genomic sequences of K. pneumoniae MGH 78578 (NC_009648.1) and Kp342 (NC_011283.1). Our results show that rarA overexpression resulted in the differential expression of 66 genes (42 upregulated and 24 downregulated). Under the COG (clusters of orthologous groups) functional classification, the majority of affected genes belonged to the category of cell envelope biogenesis and posttranslational modification, along with genes encoding the previously uncharacterized transport proteins (e.g., KPN_03141, sdaCB, and leuE) and the porin OmpF. However, genes associated with energy production and conversion and amino acid transport/metabolism (e.g., nuoA, narJ, and proWX) were found to be downregulated. Biolog phenotype analyses demonstrated that rarA overexpression confers enhanced growth of the overexpresser in the presence of several antibiotic classes (i.e., beta-lactams and fluoroquinolones), the antifungal/antiprotozoal compound clioquinol, disinfectants (8-hydroxyquinoline), protein synthesis inhibitors (i.e., minocycline and puromycin), membrane biogenesis agents (polymyxin B and amitriptyline), DNA synthesis (furaltadone), and the cytokinesis inhibitor (sanguinarine). Both our transcriptome and phenotypic microarray data support and extend the role of RarA in the MDR phenotype of K. pneumoniae. PMID:23318802

De Majumdar, Shyamasree; Veleba, Mark; Finn, Sarah; Fanning, Séamus; Schneiders, Thamarai

2013-04-01

207

Transcription factories  

PubMed Central

There is considerable evidence that transcription does not occur homogeneously or diffusely throughout the nucleus, but rather at a number of specialized, discrete sites termed transcription factories. The factories are composed of ~4–30 RNA polymerase molecules, and are associated with many other molecules involved in transcriptional activation and mRNA processing. Some data suggest that the polymerase molecules within a factory remain stationary relative to the transcribed DNA, which is thought to be reeled through the factory site. There is also some evidence that transcription factories could help organize chromatin and nuclear structure, contributing to both the formation of chromatin loops and the clustering of active and co-regulated genes. PMID:23109938

Rieder, Dietmar; Trajanoski, Zlatko; McNally, James G.

2012-01-01

208

A Horizontally Acquired Transcription Factor Coordinates Salmonella Adaptations to Host Microenvironments  

PubMed Central

ABSTRACT The transcription factors HilA and SsrB activate expression of two type III secretion systems (T3SSs) and cognate effectors that reprogram host cell functions to benefit infecting Salmonella in the host. These transcription factors, the secretion systems, and the effectors are all encoded by horizontally acquired genes. Using quantitative proteomics, we quantified the abundance of 2,149 proteins from hilA or ssrB Salmonella in vitro. Our results suggest that the HilA regulon does not extend significantly beyond proteins known to be involved in direct interactions with intestinal epithelium. On the other hand, SsrB influences the expression of a diverse range of proteins, many of which are ancestral to the acquisition of ssrB. In addition to the known regulon of T3SS-related proteins, we show that, through SodCI and bacterioferritin, SsrB controls resistance to reactive oxygen species and that SsrB down-regulates flagella and motility. This indicates that SsrB-controlled proteins not only redirect host cell membrane traffic to establish a supportive niche within host cells but also have adapted to the chemistry and physical constraints of that niche. PMID:25249283

Rogers, Lindsay D.; Sanderson, Kristy L.; Gouw, Joost W.; Hartland, Elizabeth L.; Foster, Leonard J.

2014-01-01

209

Effects of triclocarban on the transcription of estrogen, androgen and aryl hydrocarbon receptor responsive genes in human breast cancer cells.  

PubMed

Triclocarban (TCC) is an antimicrobial agent that is used in detergents, soaps and other personal hygiene products. Similarly to triclosan the widespread use of TCC has raised concerns about its endocrine potential. In luciferase-based reporter assays TCC has been shown to enhance estrogenic and androgenic activities following cellular coexposure with estrogen or dihydrotestosterone, respectively. The present study demonstrates that although coexposure with TCC enhances the estrogenic and androgenic readout of luciferase-based reporter cell lines such as HeLa9908 and MDA-kb2, it fails to act as a xenoandrogen on transcriptional level, nor does it induce cell proliferation in the estrogen sensitive E-screen. In addition TCC did not alter the expression of estrogen responsive genes in human mammary carcinoma MCF-7 cells exposed to 17?-estradiol, bisphenol A, butylparaben or genistein. However, TCC was shown to interfere with the regulon of the aryl hydrocarbon receptor (AhR) as TCC showed a costimulatory effect on transcription of CYP1A1 and CYP1B1, effectively lowering the transcriptional threshold for both genes in the presence of estrogens. It thus seems, that while the induction of the respective luciferase reporter assays by TCC is an unspecific false positive signal caused by luciferase stabilisation, TCC has the potential to interfere with the regulatory crosstalk of the estrogen receptor (ER) and the AhR regulon. PMID:23524099

Tarnow, Patrick; Tralau, Tewes; Hunecke, Danele; Luch, Andreas

2013-08-01

210

Dual feedback loops in the GAL regulon suppress cellular heterogeneity in yeast.  

PubMed

Transcriptional noise is known to be an important cause of cellular heterogeneity and phenotypic variation. The extent to which molecular interaction networks may have evolved to either filter or exploit transcriptional noise is a much debated question. The yeast genetic network regulating galactose metabolism involves two proteins, Gal3p and Gal80p, that feed back positively and negatively, respectively, on GAL gene expression. Using kinetic modeling and experimental validation, we demonstrate that these feedback interactions together are important for (i) controlling the cell-to-cell variability of GAL gene expression and (ii) ensuring that cells rapidly switch to an induced state for galactose uptake. PMID:16936734

Ramsey, Stephen A; Smith, Jennifer J; Orrell, David; Marelli, Marcello; Petersen, Timothy W; de Atauri, Pedro; Bolouri, Hamid; Aitchison, John D

2006-09-01

211

Deciphering the Regulon of Streptomyces coelicolor AbrC3, a Positive Response Regulator of Antibiotic Production  

PubMed Central

The atypical two-component system (TCS) AbrC1/C2/C3 (encoded by SCO4598, SCO4597, and SCO4596), comprising two histidine kinases (HKs) and a response regulator (RR), is crucial for antibiotic production in Streptomyces coelicolor and for morphological differentiation under certain nutritional conditions. In this study, we demonstrate that deletion of the RR-encoding gene, abrC3 (SCO4596), results in a dramatic decrease in actinorhodin (ACT) and undecylprodiginine (RED) production and delays morphological development. In contrast, the overexpression of abrC3 in the parent strain leads to a 33% increase in ACT production in liquid medium. Transcriptomic analysis and chromatin immunoprecipitation with microarray technology (ChIP-chip) analysis of the ?abrC3 mutant and the parent strain revealed that AbrC3 directly controls ACT production by binding to the actII-ORF4 promoter region; this was independently verified by in vitro DNA-binding assays. This binding is dependent on the sequence 5?-GAASGSGRMS-3?. In contrast, the regulation of RED production is not due to direct binding of AbrC3 to either the redZ or redD promoter region. This study also revealed other members of the AbrC3 regulon: AbrC3 is a positive autoregulator which also binds to the promoter regions of SCO0736, bdtA (SCO3328), absR1 (SCO6992), and SCO6809. The direct targets share the 10-base consensus binding sequence and may be responsible for some of the phenotypes of the ?abrC3 mutant. The identification of the AbrC3 regulon as part of the complex regulatory network governing antibiotic production widens our knowledge regarding TCS involvement in control of antibiotic synthesis and may contribute to the rational design of new hyperproducer host strains through genetic manipulation of such systems. PMID:24509929

Rico, Sergio; Santamaría, Ramón I.; Yepes, Ana; Rodríguez, Héctor; Laing, Emma; Bucca, Giselda; Smith, Colin P.

2014-01-01

212

Characterization of the Fur regulon in Pseudomonas syringae pv. tomato DC3000  

Technology Transfer Automated Retrieval System (TEKTRAN)

The plant pathogen Pseudomonas syringae pv. tomato DC3000 is found in a wide variety of environments and as a result must monitor and respond to various environmental signals. In previous studies, we investigated the transcriptional response of DC3000 to iron, an essential element for bacterial grow...

213

Deep Sequencing Analysis of Small Noncoding RNA and mRNA Targets of the Global Post-Transcriptional Regulator, Hfq  

PubMed Central

Recent advances in high-throughput pyrosequencing (HTPS) technology now allow a thorough analysis of RNA bound to cellular proteins, and, therefore, of post-transcriptional regulons. We used HTPS to discover the Salmonella RNAs that are targeted by the common bacterial Sm-like protein, Hfq. Initial transcriptomic analysis revealed that Hfq controls the expression of almost a fifth of all Salmonella genes, including several horizontally acquired pathogenicity islands (SPI-1, -2, -4, -5), two sigma factor regulons, and the flagellar gene cascade. Subsequent HTPS analysis of 350,000 cDNAs, derived from RNA co-immunoprecipitation (coIP) with epitope-tagged Hfq or control coIP, identified 727 mRNAs that are Hfq-bound in vivo. The cDNA analysis discovered new, small noncoding RNAs (sRNAs) and more than doubled the number of sRNAs known to be expressed in Salmonella to 64; about half of these are associated with Hfq. Our analysis explained aspects of the pleiotropic effects of Hfq loss-of-function. Specifically, we found that the mRNAs of hilD (master regulator of the SPI-1 invasion genes) and flhDC (flagellar master regulator) were bound by Hfq. We predicted that defective SPI-1 secretion and flagellar phenotypes of the hfq mutant would be rescued by overexpression of HilD and FlhDC, and we proved this to be correct. The combination of epitope-tagging and HTPS of immunoprecipitated RNA detected the expression of many intergenic chromosomal regions of Salmonella. Our approach overcomes the limited availability of high-density microarrays that have impeded expression-based sRNA discovery in microorganisms. We present a generic strategy that is ideal for the systems-level analysis of the post-transcriptional regulons of RNA-binding proteins and for sRNA discovery in a wide range of bacteria. PMID:18725932

Sittka, Alexandra; Lucchini, Sacha; Papenfort, Kai; Sharma, Cynthia M.; Rolle, Katarzyna; Binnewies, Tim T.; Hinton, Jay C. D.; Vogel, Jörg

2008-01-01

214

Dehydrogenase GRD1 represents a novel component of the cellulase regulon in Trichoderma reesei (Hypocrea jecorina).  

PubMed

Trichoderma reesei (Hypocrea jecorina) is nowadays the most important industrial producer of cellulase and hemicellulase enzymes, which are used for pretreatment of cellulosic biomass for biofuel production. In this study, we introduce a novel component, GRD1 (glucose-ribitol dehydrogenase 1), which shows enzymatic activity on cellobiose and positively influences cellulase gene transcription, expression, and extracellular endo-1,4-?-D-glucanase activity. grd1 is differentially transcribed upon growth on cellulose and the induction of cellulase gene expression by sophorose. The transcription of grd1 is coregulated with that of cel7a (cbh1) under inducing conditions. GRD1 is further involved in carbon source utilization on several carbon sources, such as those involved in lactose and D-galactose catabolism, in several cases in a light-dependent manner. We conclude that GRD1 represents a novel enhancer of cellulase gene expression, which by coregulation with the major cellulase may act via optimization of inducing mechanisms. PMID:21602376

Schuster, André; Kubicek, Christian P; Schmoll, Monika

2011-07-01

215

Role of the Fur Regulon in Iron Transport in Bacillus subtilis  

Microsoft Academic Search

The Bacillus subtilis ferric uptake regulator (Fur) protein mediates the iron-dependent repression of at least 20 operons encoding 40 genes. We investigated the physiological roles of Fur-regulated genes by the con- struction of null mutations in 14 transcription units known or predicted to function in siderophore biosynthesis or iron uptake. We demonstrate that ywbLMN, encoding an elemental iron uptake system

Juliane Ollinger; Kyung-Bok Song; Haike Antelmann; Michael Hecker; John D. Helmann

2006-01-01

216

Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress  

PubMed Central

Background Organisms of the genus Clostridium are Gram-positive endospore formers of great importance to the carbon cycle, human normo- and pathophysiology, but also in biofuel and biorefinery applications. Exposure of Clostridium organisms to chemical and in particular toxic metabolite stress is ubiquitous in both natural (such as in the human microbiome) and engineered environments, engaging both the general stress response as well as specialized programs. Yet, despite its fundamental and applied significance, it remains largely unexplored at the systems level. Results We generated a total of 96 individual sets of microarray data examining the transcriptional changes in C. acetobutylicum, a model Clostridium organism, in response to three levels of chemical stress from the native metabolites, butanol and butyrate. We identified 164 significantly differentially expressed transcriptional regulators and detailed the cellular programs associated with general and stressor-specific responses, many previously unexplored. Pattern-based, comparative genomic analyses enabled us, for the first time, to construct a detailed picture of the genetic circuitry underlying the stress response. Notably, a list of the regulons and DNA binding motifs of the stress-related transcription factors were identified: two heat-shock response regulators, HrcA and CtsR; the SOS response regulator LexA; the redox sensor Rex; and the peroxide sensor PerR. Moreover, several transcriptional regulators controlling stress-responsive amino acid and purine metabolism and their regulons were also identified, including ArgR (arginine biosynthesis and catabolism regulator), HisR (histidine biosynthesis regulator), CymR (cysteine metabolism repressor) and PurR (purine metabolism repressor). Conclusions Using an exceptionally large set of temporal transcriptional data and regulon analyses, we successfully built a STRING-based stress response network model integrating important players for the general and specialized metabolite stress response in C. acetobutylicum. Since the majority of the transcription factors and their target genes are highly conserved in other organisms of the Clostridium genus, this network would be largely applicable to other Clostridium organisms. The network informs the molecular basis of Clostridium responses to toxic metabolites in natural ecosystems and the microbiome, and will facilitate the construction of genome-scale models with added regulatory-network dimensions to guide the development of tolerant strains. PMID:24196194

2013-01-01

217

Aminopeptidase N1 (EtAPN1), an M1 Metalloprotease of the Apicomplexan Parasite Eimeria tenella, Participates in Parasite Development  

PubMed Central

Aminopeptidases N are metalloproteases of the M1 family that have been reported in numerous apicomplexan parasites, including Plasmodium, Toxoplasma, Cryptosporidium, and Eimeria. While investigating the potency of aminopeptidases as therapeutic targets against coccidiosis, one of the most important avian diseases caused by the genus Eimeria, we identified and characterized Eimeria tenella aminopeptidase N1 (EtAPN1). Its inhibition by bestatin and amastatin, as well as its reactivation by divalent ions, is typical of zinc-dependent metalloproteases. EtAPN1 shared a similar sequence, three-dimensional structure, and substrate specificity and similar kinetic parameters with A-M1 from Plasmodium falciparum (PfA-M1), a validated target in the treatment of malaria. EtAPN1 is synthesized as a 120-kDa precursor and cleaved into 96-, 68-, and 38-kDa forms during sporulation. Further, immunolocalization assays revealed that, similar to PfA-M1, EtAPN1 is present during the intracellular life cycle stages in both the parasite cytoplasm and the parasite nucleus. The present results support the hypothesis of a conserved role between the two aminopeptidases, and we suggest that EtAPN1 might be a valuable target for anticoccidiosis drugs. PMID:24839124

Gras, Simon; Byzia, Anna; Gilbert, Florence B.; McGowan, Sheena; Drag, Marcin; Niepceron, Alisson; Lecaille, Fabien; Lalmanach, Gilles; Brossier, Fabien

2014-01-01

218

Identification and characterization of Toxoplasma?SIP, a conserved apicomplexan cytoskeleton protein involved in maintaining the shape, motility and virulence of the parasite.  

PubMed

Apicomplexa possess a complex pellicle that is composed of a plasma membrane and a closely apposed inner membrane complex (IMC) that serves as a support for the actin-myosin motor required for motility and host cell invasion. The IMC consists of longitudinal plates of flattened vesicles, fused together and lined on the cytoplasmic side by a subpellicular network of intermediate filament-like proteins. The spatial organization of the IMC has been well described by electron microscopy, but its composition and molecular organization is largely unknown. Here, we identify a novel protein of the IMC cytoskeletal network in Toxoplasma gondii, called TgSIP, and conserved among apicomplexan parasites. To finely pinpoint the localization of TgSIP, we used structured illumination super-resolution microscopy and revealed that it likely decorates the transverse sutures of the plates and the basal end of the IMC. This suggests that TgSIP might contribute to the organization or physical connection among the different components of the IMC. We generated a T.gondii?SIP deletion mutant and showed that parasites lacking TgSIP are significantly shorter than wild-type parasites and show defects in gliding motility, invasion and reduced infectivity in mice. PMID:25088010

Lentini, Gaelle; Kong-Hap, Marie; El Hajj, Hiba; Francia, Maria; Claudet, Cyrille; Striepen, Boris; Dubremetz, Jean-François; Lebrun, Maryse

2015-01-01

219

Cellular identity of a novel small subunit rDNA sequence clade of apicomplexans: description of the marine parasite Rhytidocystis polygordiae n. sp. (host: Polygordius sp., Polychaeta).  

PubMed

A new species of Rhytidocystis (Apicomplexa) is characterized from North American waters of the Atlantic Ocean using electron microscopy and phylogenetic analyses of small subunit (SSU) rDNA sequences. Rhytidocystis polygordiae n. sp. is a parasite of the polychaete Polygordius sp. and becomes the fourth described species within this genus. The trophozoites of R. polygordiae were relatively small oblong cells (L=35-55 microm; W=20-25 microm) and distinctive in possessing subterminal indentations at both ends of the cell. The surface of the trophozoites had six to eight longitudinal series of small transverse folds and several micropores arranged in short linear rows. The trophozoites of R. polygordiae were positioned beneath the brush border of the intestinal epithelium but appeared to reside between the epithelial cells within the extracellular matrix rather than within the cells. The trophozoites possessed a uniform distribution of paraglycogen granules, putative apicoplasts, mitochondria with tubular cristae, and a centrally positioned nucleus. The trophozoites were non-motile and lacked a mucron and an apical complex. Intracellular sporozoites of R. polygordiae had a conoid, a few rhoptries, micronemes, dense granules, and a posteriorly positioned nucleus. Phylogenies inferred from SSU rDNA sequences demonstrated a close relationship between R. polygordiae and the poorly known parasite reported from the hemolymph of the giant clam Tridacna crocea. The rhytidocystid clade diverged early in the apicomplexan radiation and showed a weak affinity to a clade consisting of cryptosporidian parasites, monocystids, and neogregarines. PMID:16872296

Leander, Brian S; Ramey, Patricia A

2006-01-01

220

Molecular assessment of apicomplexan parasites in the snake Psammophis from North Africa: do multiple parasite lineages reflect the final vertebrate host diet?  

PubMed

The Apicomplexa are intracellular pathogens of animals, with the Coccidia being the largest group. Among these are the hemogregarines, which include some of the most common hemoparasites found in reptiles. Several studies have reported a possible pattern of prey-predator transmission for some of these parasites. Snakes from the Mediterranean region have been found to be parasitized with Hepatozoon spp. similar to those in lacertids and gekkonids, supporting the prey-predator transmission hypothesis. Here we analyzed specimens of the saurophagous genus Psammophis from North Africa, an ecologically different region. Through molecular analysis of tissue samples we detected 3 different apicomplexan parasites: Caryospora, Sarcocystis, and Hepatozoon. Caryospora was detected in a Forskål's sand snake Psammophis schokari from Algeria, constituting the first time these parasites have been detected from a tissue sample through molecular screening. The obtained Sarcocystis phylogeny does not reflect the relationships of their final hosts, with the parasites identified from snakes forming at least 3 unrelated groups, indicating that it is still premature to predict definitive host based on the phylogeny of these parasites. Three unrelated lineages of Hepatozoon parasites were identified in Psammophis, each closely related to lineages previously identified from different lizard groups, on which these snakes feed. This once again indicates that diet might be a key element in transmission, at least for Hepatozoon species of saurophagous snakes. PMID:23537006

Tomé, Beatriz; Maia, João P M C; Harris, D James

2013-10-01

221

Genome-Wide Analysis of the Pho Regulon in a pstCA Mutant of Citrobacter rodentium  

PubMed Central

The phosphate-specific transport operon, pstSCAB-phoU, of Gram-negative bacteria is an essential part of the Pho regulon. Its key roles are to encode a high-affinity inorganic phosphate transport system and to prevent activation of PhoB in phosphate-rich environments. In general, mutations in pstSCAB-phoU lead to the constitutive expression of the Pho regulon. Previously, we constructed a pstCA deletion mutant of Citrobacter rodentium and found it to be attenuated for virulence in mice, its natural host. This attenuation was dependent on PhoB or PhoB-regulated gene(s) because a phoB mutation restored virulence for mice to the pstCA mutant. To investigate how downstream genes may contribute to the virulence of C. rodentium, we used microarray analysis to investigate global gene expression of C. rodentium strain ICC169 and its isogenic pstCA mutant when grown in phosphate-rich medium. Overall 323 genes of the pstCA mutant were differentially expressed by at least 1.5-fold compared to the wild-type C. rodentium. Of these 145 were up-regulated and 178 were down-regulated. Differentially expressed genes included some involved in phosphate homoeostasis, cellular metabolism and protein metabolism. A large number of genes involved in stress responses and of unknown function were also differentially expressed, as were some virulence-associated genes. Up-regulated virulence-associated genes in the pstCA mutant included that for DegP, a serine protease, which appeared to be directly regulated by PhoB. Down-regulated genes included those for the production of the urease, flagella, NleG8 (a type III-secreted protein) and the tad focus (which encodes type IVb pili in Yersinia enterocolitica). Infection studies using C57/BL6 mice showed that DegP and NleG8 play a role in bacterial virulence. Overall, our study provides evidence that Pho is a global regulator of gene expression in C. rodentium and indicates the presence of at least two previously unrecognized virulence determinants of C. rodentium, namely, DegP and NleG8. PMID:23226353

Cheng, Catherine; Wakefield, Matthew J.; Yang, Ji; Tauschek, Marija; Robins-Browne, Roy M.

2012-01-01

222

Molecular Characterization of the Mg2+Responsive PhoP-PhoQ Regulon in Salmonella enterica  

Microsoft Academic Search

Mg2 modulation of the expression of the PhoP-activated genes, no consensus sequence common to all of them could be detected in their promoter regions. We have investigated the transcriptional regulation and the interaction of the response regulator PhoP with the promoter regions of the PhoP-activated loci phoPQ, mgtA, slyB, pmrD, pcgL, phoN, pagC, and mgtCB. A direct repeat of the

Sergio Lejona; Andres Aguirre; María Laura Cabeza; Eleonora García Vescovi; Fernando C. Soncini

2003-01-01

223

Posttranscriptional Activation of the Transcriptional Activator Rob by Dipyridyl in Escherichia coli  

PubMed Central

The transcriptional activator Rob consists of an N-terminal domain (NTD) of 120 amino acids responsible for DNA binding and promoter activation and a C-terminal domain (CTD) of 169 amino acids of unknown function. Although several thousand molecules of Rob are normally present per Escherichia coli cell, they activate promoters of the rob regulon poorly. We report here that in cells treated with either 2,2"- or 4,4"-dipyridyl (the latter is not a metal chelator), Rob-mediated transcription of various rob regulon promoters was increased substantially. A small, growth-phase-dependent effect of dipyridyl on the rob promoter was observed. However, dipyridyl enhanced Rob's activity even when rob was regulated by a heterologous (lac) promoter showing that the action of dipyridyl is mainly posttranscriptional. Mutants lacking from 30 to 166 of the C-terminal amino acids of Rob had basal levels of activity similar to that of wild-type cells, but dipyridyl treatment did not enhance this activity. Thus, the CTD is not an inhibitor of Rob but is required for activation of Rob by dipyridyl. In contrast to its relatively low activity in vivo, Rob binding to cognate DNA and activation of transcription in vitro is similar to that of MarA, which has a homologous NTD but no CTD. In vitro nuclear magnetic resonance studies demonstrated that 2,2"-dipyridyl binds to Rob but not to the CTD-truncated Rob or to MarA, suggesting that the effect of dipyridyl on Rob is direct. Thus, it appears that Rob can be converted from a low activity state to a high-activity state by a CTD-mediated mechanism in vivo or by purification in vitro. PMID:11844771

Rosner, Judah L.; Dangi, Bindi; Gronenborn, Angela M.; Martin, Robert G.

2002-01-01

224

Elucidation of the RamA Regulon in Klebsiella pneumoniae Reveals a Role in LPS Regulation  

PubMed Central

Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P.; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J.; Bengoechea, José; Gally, David L.; Fanning, Séamus; Elborn, Joseph S.; Schneiders, Thamarai

2015-01-01

225

RegR virulence regulon of rabbit-specific enteropathogenic Escherichia coli strain E22.  

PubMed

AraC-like regulators play a key role in the expression of virulence factors in enteric pathogens, such as enteropathogenic Escherichia coli (EPEC), enterotoxigenic E. coli, enteroaggregative E. coli, and Citrobacter rodentium. Bioinformatic analysis of the genome of rabbit-specific EPEC (REPEC) strain E22 (O103:H2) revealed the presence of a gene encoding an AraC-like regulatory protein, RegR, which shares 71% identity to the global virulence regulator, RegA, of C. rodentium. Microarray analysis demonstrated that RegR exerts 25- to 400-fold activation on transcription of several genes encoding putative virulence-associated factors, including a fimbrial operon (SEF14), a serine protease, and an autotransporter adhesin. These observations were confirmed by proteomic analysis of secreted and heat-extracted surface-associated proteins. The mechanism of RegR-mediated activation was investigated by using its most highly upregulated gene target, sefA. Transcriptional analyses and electrophoretic mobility shift assays showed that RegR activates the expression of sefA by binding to a region upstream of the sefA promoter, thereby relieving gene silencing by the global regulatory protein H-NS. Moreover, RegR was found to contribute significantly to virulence in a rabbit infection experiment. Taken together, our findings indicate that RegR controls the expression of a series of accessory adhesins that significantly enhance the virulence of REPEC strain E22. PMID:23340312

Srikhanta, Yogitha N; Hocking, Dianna M; Praszkier, Judyta; Wakefield, Matthew J; Robins-Browne, Roy M; Yang, Ji; Tauschek, Marija

2013-04-01

226

Elucidation of the RamA regulon in Klebsiella pneumoniae reveals a role in LPS regulation.  

PubMed

Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J; Bengoechea, José; Gally, David L; Fanning, Séamus; Elborn, Joseph S; Schneiders, Thamarai

2015-01-01

227

Survival of enterohemorrhagic Escherichia coli in the presence of Acanthamoeba castellanii and its dependence on Pho regulon  

PubMed Central

Enterohemorrhagic Escherichia coli (EHEC) are involved in outbreaks of food-borne illness and transmitted to humans through bovine products or water contaminated by cattle feces. Microbial interaction is one of the strategies used by pathogenic bacteria to survive in the environment. Among protozoa, the free-living amoebae are known to host and protect several water-borne pathogens. In this study, the interaction between EHEC and the predacious protozoa Acanthamoeba castellanii was investigated. Using monoculture and cocultures, growth of both organisms was estimated for 3 weeks by total and viable cell counts. The numbers of EHEC were significantly higher when cultured with amoebae than without, and less EHEC shifted into a viable but nonculturable state in the presence of amoebae. Using several mutants, we observed that the Pho regulon is required for EHEC growth when cocultured with amoebae. In contrast, the Shiga toxins (Stx) were not involved in this association phenotype. Cocultures monitored by electron microscopy revealed a loss of the regular rod shape of EHEC and the secretion of multilamellar vesicles by the amoebae, which did not contain bacteria. As the interaction between A. castellanii and EHEC appears beneficial for bacterial growth, this supports a potential role for protozoa in promoting the persistence of EHEC in the environment. PMID:23233434

Chekabab, Samuel Mohammed; Daigle, France; Charette, Steve J; Dozois, Charles M; Harel, Josée

2012-01-01

228

Members of a novel protein family containing microneme adhesive repeat domains act as sialic acid-binding lectins during host cell invasion by apicomplexan parasites.  

PubMed

Numerous intracellular pathogens exploit cell surface glycoconjugates for host cell recognition and entry. Unlike bacteria and viruses, Toxoplasma gondii and other parasites of the phylum Apicomplexa actively invade host cells, and this process critically depends on adhesins (microneme proteins) released onto the parasite surface from intracellular organelles called micronemes (MIC). The microneme adhesive repeat (MAR) domain of T. gondii MIC1 (TgMIC1) recognizes sialic acid (Sia), a key determinant on the host cell surface for invasion by this pathogen. By complementation and invasion assays, we demonstrate that TgMIC1 is one important player in Sia-dependent invasion and that another novel Sia-binding lectin, designated TgMIC13, is also involved. Using BLAST searches, we identify a family of MAR-containing proteins in enteroparasitic coccidians, a subclass of apicomplexans, including T. gondii, suggesting that all these parasites exploit sialylated glycoconjugates on host cells as determinants for enteric invasion. Furthermore, this protein family might provide a basis for the broad host cell range observed for coccidians that form tissue cysts during chronic infection. Carbohydrate microarray analyses, corroborated by structural considerations, show that TgMIC13, TgMIC1, and its homologue Neospora caninum MIC1 (NcMIC1) share a preference for alpha2-3- over alpha2-6-linked sialyl-N-acetyllactosamine sequences. However, the three lectins also display differences in binding preferences. Intense binding of TgMIC13 to alpha2-9-linked disialyl sequence reported on embryonal cells and relatively strong binding to 4-O-acetylated-Sia found on gut epithelium and binding of NcMIC1 to 6'sulfo-sialyl Lewis(x) might have implications for tissue tropism. PMID:19901027

Friedrich, Nikolas; Santos, Joana M; Liu, Yan; Palma, Angelina S; Leon, Ester; Saouros, Savvas; Kiso, Makoto; Blackman, Michael J; Matthews, Stephen; Feizi, Ten; Soldati-Favre, Dominique

2010-01-15

229

Improving the gene structure annotation of the apicomplexan parasite Neospora caninum fulfils a vital requirement towards an in silico-derived vaccine.  

PubMed

Neospora caninum is an apicomplexan parasite which can cause abortion in cattle, instigating major economic burden. Vaccination has been proposed as the most cost-effective control measure to alleviate this burden. Consequently the overriding aspiration for N. caninum research is the identification and subsequent evaluation of vaccine candidates in animal models. To save time, cost and effort, it is now feasible to use an in silico approach for vaccine candidate prediction. Precise protein sequences, derived from the correct open reading frame, are paramount and arguably the most important factor determining the success or failure of this approach. The challenge is that publicly available N. caninum sequences are mostly derived from gene predictions. Annotated inaccuracies can lead to erroneously predicted vaccine candidates by bioinformatics programs. This study evaluates the current N. caninum annotation for potential inaccuracies. Comparisons with annotation from a closely related pathogen, Toxoplasma gondii, are also made to distinguish patterns of inconsistency. More importantly, a mRNA sequencing (RNA-Seq) experiment is used to validate the annotation. Potential discrepancies originating from a questionable start codon context and exon boundaries were identified in 1943 protein coding sequences. We conclude, where experimental data were available, that the majority of N. caninum gene sequences were reliably predicted. Nevertheless, almost 28% of genes were identified as questionable. Given the limitations of RNA-Seq, the intention of this study was not to replace the existing annotation but to support or oppose particular aspects of it. Ideally, many studies aimed at improving the annotation are required to build a consensus. We believe this study, in providing a new resource on gene structure and annotation, is a worthy contributor to this endeavour. PMID:25747726

Goodswen, Stephen J; Barratt, Joel L N; Kennedy, Paul J; Ellis, John T

2015-04-01

230

Analysis of the Pseudomonas aeruginosa Regulon Controlled by the Sensor Kinase KinB and Sigma Factor RpoN  

PubMed Central

Alginate overproduction by Pseudomonas aeruginosa, also known as mucoidy, is associated with chronic endobronchial infections in cystic fibrosis. Alginate biosynthesis is initiated by the extracytoplasmic function sigma factor (?22; AlgU/AlgT). In the wild-type (wt) nonmucoid strains, such as PAO1, AlgU is sequestered to the cytoplasmic membrane by the anti-sigma factor MucA that inhibits alginate production. One mechanism underlying the conversion to mucoidy is mutation of mucA. However, the mucoid conversion can occur in wt mucA strains via the degradation of MucA by activated intramembrane proteases AlgW and/or MucP. Previously, we reported that the deletion of the sensor kinase KinB in PAO1 induces an AlgW-dependent proteolysis of MucA, resulting in alginate overproduction. This type of mucoid induction requires the alternate sigma factor RpoN (?54). To determine the RpoN-dependent KinB regulon, microarray and proteomic analyses were performed on a mucoid kinB mutant and an isogenic nonmucoid kinB rpoN double mutant. In the kinB mutant of PAO1, RpoN controlled the expression of approximately 20% of the genome. In addition to alginate biosynthetic and regulatory genes, KinB and RpoN also control a large number of genes including those involved in carbohydrate metabolism, quorum sensing, iron regulation, rhamnolipid production, and motility. In an acute pneumonia murine infection model, BALB/c mice exhibited increased survival when challenged with the kinB mutant relative to survival with PAO1 challenge. Together, these data strongly suggest that KinB regulates virulence factors important for the development of acute pneumonia and conversion to mucoidy. PMID:22210761

Damron, F. Heath; Owings, Joshua P.; Okkotsu, Yuta; Varga, John J.; Schurr, Jill R.; Goldberg, Joanna B.; Schurr, Michael J.

2012-01-01

231

Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363?  

PubMed Central

Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363?ccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric ?35 sequence at an average position of ?56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative ?35 and ?10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical ?10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism. PMID:17028270

Zomer, Aldert L.; Buist, Girbe; Larsen, Rasmus; Kok, Jan; Kuipers, Oscar P.

2007-01-01

232

A class of genes in the HER2 regulon that is poised for transcription in breast cancer cell lines and expressed in human breast tumors  

PubMed Central

HER2-positive breast cancer accounts for 25% of all cases and has a poor prognosis. Although progress has been made in understanding signal transduction, little is known of how HER2 achieves gene regulation. We performed whole genome expression analysis on a HER2+ and HER2? breast cancer cell lines and compared these results to expression in 812 primary tumors stratified by their HER2 expression level. Chip-on-chip with anti-RNA polymerase II was compared among breast cancer cell lines to identify genes that are potentially activated by HER2. The expression levels of these HER2-dependent POL II binding genes were determined for the 812 HER2+/? breast cancer tissues. Genes differentially expressed between HER2+/? cell lines were generally regulated in the same direction as in breast cancer tissues. We identified genes that had POLII binding in HER2+ cell lines, but without significant gene expression. Of 737 such genes “poised” for expression in cell lines, 113 genes were significantly differentially expressed in breast tumors in a HER2-dependent manner. Pathway analysis of these 113 genes revealed that a large group of genes were associated with stem cell and progenitor cell control as indicated by networks centered on NANOG, SOX2, OCT3/4. HER2 directs POL II binding to a large number of genes in breast cancer cells. A “poised” class of genes in HER2+ cell lines with POLII binding and low RNA expression but is differentially expressed in primary tumors, strongly suggests a role of the microenvironment and further suggests a role for stem cells proliferation in HER2-regulated breast cancer tissue. PMID:25428913

Rahmatpanah, Farah B.; Jia, Zhenyu; Chen, Xin; Char, Jessica E.; Men, Bozhao; Franke, Anna-Clara; Jones, Frank E.; McClelland, Michael; Mercola, Dan

2015-01-01

233

Functional Analysis of 14 Genes That Constitute the Purine Catabolic Pathway in Bacillus subtilis and Evidence for a Novel Regulon Controlled by the PucR Transcription Activator  

Microsoft Academic Search

The soil bacterium Bacillus subtilis has developed a highly controlled system for the utilization of a diverse array of low-molecular-weight compounds as a nitrogen source when the preferred nitrogen sources, e.g., glutamate plus ammonia, are exhausted. We have identified such a system for the utilization of purines as nitrogen source in B. subtilis. Based on growth studies of strains with

ANNA C. SCHULTZ; PER NYGAARD; HANS H. SAXILD

2001-01-01

234

Pho regulon promoter-mediated transcription of the key pathway gene aroG Fbr improves the performance of an l -phenylalanine-producing Escherichia coli strain  

Microsoft Academic Search

DAHP synthase (EC 4.1.2.15) is one of the key enzymes involved in aromatic amino acid biosynthesis in Escherichia coli. An approximately twofold decrease in DAHP synthase activity level was detected in the late growth phase of the l-phenylalanine (Phe)-producing E. coli strain, in which this enzyme encoded by aroG4 is resistant to feedback inhibition. An additional copy of aroG4 that

Vera G. Doroshenko; Irina S. Tsyrenzhapova; Alexander A. Krylov; Evgeniya M. Kiseleva; Vladimir Yu. Ermishev; Svetlana M. Kazakova; Irina V. Biryukova; Sergey V. Mashko

2010-01-01

235

Characterization of the Pseudomonas aeruginosa metalloendopeptidase, Mep72, a member of the Vfr regulon  

PubMed Central

Background Pseudomonas aeruginosa Vfr (the virulence factor regulator) enhances P. aeruginosa virulence by positively regulating the expression of numerous virulence genes. A previous microarray analysis identified numerous genes positively regulated by Vfr in strain PAK, including the yet uncharacterized PA2782 and PA2783. Results In this study, we report the detailed characterization of PA2783 in the P. aeruginosa strain PAO1. RT-PCR analysis confirmed that PA2782-PA2783 constitute an operon. A mutation in vfr significantly reduced the expression of both genes. The predicted protein encoded by PA2783 contains a typical leader peptide at its amino terminus end as well as metalloendopeptidase and carbohydrate binding motifs at its amino terminus and carboxy terminus regions, respectively. An in-frame PA2783::phoA fusion encoded a hybrid protein that was exported to the periplasmic space of Escherichia coli and P. aeruginosa. In PAO1, the proteolytic activity of the PA2783-encoded protein was masked by other P. aeruginosa extracellular proteases but an E. coli strain carrying a PA2783 recombinant plasmid produced considerable proteolytic activity. The outer membrane fraction of an E. coli strain in which PA2783 was overexpressed contained specific endopeptidase activity. In the presence of cAMP, purified recombinant Vfr (rVfr) bound to a 98-bp fragment within the PA2782-PA2783 upstream region that carries a putative Vfr consensus sequence. Through a series of electrophoretic mobility shift assays, we localized rVfr binding to a 33-bp fragment that contains part of the Vfr consensus sequence and a 5-bp imperfect (3/5) inverted repeat at its 3? and 5? ends (TGGCG-N22-CGCTG). Deletion of either repeat eliminated Vfr binding. Conclusions PA2782 and PA2783 constitute an operon whose transcription is positively regulated by Vfr. The expression of PA2783 throughout the growth cycle of P. aeruginosa follows a unique pattern. PA2783 codes for a secreted metalloendopeptidase, which we named Mep72. Mep72, which has metalloendopeptidase and carbohydrate-binding domains, produced proteolytic and endopeptidase activities in E. coli. Vfr directly regulates the expression of the PA2782-mep72 operon by binding to its upstream region. However, unlike other Vfr-targeted genes, Vfr binding does not require an intact Vfr consensus binding sequence. PMID:24279383

2013-01-01

236

Comparative proteomics using 2-D gel electrophoresis and mass spectrometry as tools to dissect stimulons and regulons in bacteria with sequenced or partially sequenced genomes  

PubMed Central

We propose two-dimensional gel electrophoresis (2-DE) and mass spectrometry to define the protein components of regulons and stimulons in bacteria, including those organisms where genome sequencing is still in progress. The basic 2-DE protocol allows high resolution and reproducibility and enables the direct comparison of hundreds or even thousands of proteins simultaneously. To identify proteins that comprise stimulons and regulons, peptide mass fingerprint (PMF) with matrix-assisted laser desorption ionization/time-of-flight mass spectrometry (MALDI-TOF-MS) analysis is the first option and, if results from this tool are insufficient, complementary data obtained with electrospray ionization tandem-MS (ESI-MS/MS) may permit successful protein identification. ESI-MS/MS and MALDI-TOF-MS provide complementary data sets, and so a more comprehensive coverage of a proteome can be obtained using both techniques with the same sample, especially when few sequenced proteins of a particular organism exist or genome sequencing is still in progress. PMID:16145578

Hernández, Magdalena; Martínez-Batallar, Gabriel; Contreras, Sandra; del Carmen Vargas, María; Mora, Jaime

2005-01-01

237

A Bayesian Change point model for differential gene expression patterns of the DosR regulon of Mycobacterium tuberculosis  

E-print Network

Abstract Background Low oxygen availability has been shown previously to stimulate M. tuberculosis to establish non-replicative persistence in vitro. The two component sensor/regulator dosRS is a major mediator in the transcriptional response of M...

Zhang, Yi; Hatch, Kim A; Wernisch, Lorenz; Bacon, Joanna

2008-02-22

238

Comparative physiological and transcriptional analysis of weak organic acid stress in Bacillus subtilis.  

PubMed

The advent of 'omics' techniques bears significant potential for the assessment of the microbiological stability of foods. This requires the integration of molecular data with their implication for cellular physiology. Here we performed a comparative physiological and transcriptional analysis of Bacillus subtilis stressed with three different weak organic acids: the commonly used food preservatives sorbic- and acetic-acid, plus the well-known uncoupler carbonyl cyanide-m-chlorophenyl hydrazone (CCCP). The concentration of each compound needed to cause a similar reduction of the growth rate negatively correlated with their membrane solubility, and positively with the concentration of undissociated acid. Intracellular acidification was demonstrated by expressing a pH-sensitive GFP derivative. The largest drop in intracellular pH was observed in CCCP-stressed cells and was accompanied by the transcriptional induction of the general stress response (GSR) and SigM regulon, responses known to be induced by acidification. The GSR was induced by acetate, but not by sorbate in mildly-stressed cells. Microarray analysis further revealed that all three acids activate transcriptional programs normally seen upon nutrient limitation and cause diverse responses indicative of an adaptation of the cell envelope. Based on the responses observed and the utilized pH measurements, the inhibitory effect of sorbic acid seems to be more focused on the cell membrane than that of acetic acid or CCCP. PMID:25481064

Ter Beek, Alexander; Wijman, Janneke G E; Zakrzewska, Anna; Orij, Rick; Smits, Gertien J; Brul, Stanley

2015-02-01

239

Transcription Pharmaceutical Company  

E-print Network

Transcription Pharmacy CDC Pharmaceutical Company Pharmacy Benefits Manager Analytics ICU thedatamap.org #12;Transcription Pharmacy CDC Pharmaceutical Company Pharmacy Benefits Manager Analytics Management Researcher Consulting Physician Health IT Other Government Federal Trade Commission You

Oliva, Aude

240

Selective Genomic Targeting by FRA-2/FOSL2 Transcription Factor  

PubMed Central

FRA-2/FOSL2 is a basic region-leucine zipper motif transcription factor that is widely expressed in mammalian tissues. The functional repertoire of this factor is unclear, partly due to a lack of knowledge of genomic sequences that are targeted. Here, we identified novel, functional FRA-2 targets across the genome through expression profile analysis in a knockdown transgenic rat. In this model, a nocturnal rhythm of pineal gland FRA-2 is suppressed by a genetically encoded, dominant negative mutant protein. Bioinformatic analysis of validated sets of FRA-2-regulated and -nonregulated genes revealed that the FRA-2 regulon is limited by genomic target selection rules that, in general, transcend core cis-sequence identity. However, one variant AP-1-related (AP-1R) sequence was common to a subset of regulated genes. The functional activity and protein binding partners of a candidate AP-1R sequence were determined for a novel FRA-2-repressed gene, Rgs4. FRA-2 protein preferentially associated with a proximal Rgs4 AP-1R sequence as demonstrated by ex vivo ChIP and in vitro EMSA analysis; moreover, transcriptional repression was blocked by mutation of the AP-1R sequence, whereas mutation of an upstream consensus AP-1 family sequence did not affect Rgs4 expression. Nocturnal changes in protein complexes at the Rgs4 AP-1R sequence are associated with FRA-2-dependent dismissal of the co-activator, CBP; this provides a mechanistic basis for Rgs4 gene repression. These studies have also provided functional insight into selective genomic targeting by FRA-2, highlighting discordance between predicted and actual targets. Future studies should address FRA-2-Rgs4 interactions in other systems, including the brain, where FRA-2 function is poorly understood. PMID:21367864

Davies, Jeff S.; Klein, David C.; Carter, David A.

2011-01-01

241

The TyrR Transcription Factor Regulates the Divergent akr-ipdC Operons of Enterobacter cloacae UW5  

PubMed Central

The TyrR transcription factor regulates genes involved in the uptake and biosynthesis of aromatic amino acids in Enterobacteriaceae. Genes may be positively or negatively regulated depending on the presence or absence of each aromatic amino acid, all three of which function as cofactors for TyrR. In this report we detail the transcriptional control of two divergently transcribed genes, akr and ipdC, by TyrR, elucidated by promoter fusion expression assays and electrophoretic mobility shift assays to assess protein-DNA interactions. Expression of both genes was shown to be controlled by TyrR via interactions with two TyrR boxes located within the akr-ipdC intergenic region. Expression of ipdC required TyrR bound to the proximal strong box, and is strongly induced by phenylalanine, and to a lesser extent by tryptophan and tyrosine. Down-regulation of akr was reliant on interactions with the weak box, and may also require a second, as yet unidentified protein for further repression. Tyrosine enhanced repression of akr. Electrophoretic mobility shift assays demonstrated that TyrR interacts with both the strong and weak boxes, and that binding of the weak box in vitro requires an intact adjacent strong box. While the strong box shows a high degree of conservation with the TyrR binding site consensus sequence, the weak box has atypical spacing of the two half sites comprising the palindromic arms. Site-directed mutagenesis demonstrated sequence-specific interaction between TyrR and the weak box. This is the first report of TyrR-controlled expression of two divergent protein-coding genes, transcribed from independent promoters. Moreover, the identification of a predicted aldo-keto reductase as a member of the TyrR regulon further extends the function of the TyrR regulon. PMID:25811953

Coulson, Thomas J. D.; Patten, Cheryl L.

2015-01-01

242

Control of Proteobacterial Central Carbon Metabolism by the HexR Transcriptional Regulator. A Case Study in Shewanella oneidensis  

SciTech Connect

Bacteria exploit multiple mechanisms for controlling central carbon metabolism (CCM). Thus, a bioinformatic analysis together with some experimental data implicated HexR transcriptional factor as a global CCM regulator in some lineages of Gammaproteobacteria operating as a functional replacement of Cra regulator characteristic of Enterobacteriales. In this study we combined a large-scale comparative genomic reconstruction of HexRcontrolled regulons in 87 species of Proteobacteria with the detailed experimental analysis of HexR regulatory network in Shewanella oneidensis model system. Although nearly all of the HexR-controlled genes are associated with CCM, remarkable variations were revealed in the scale (from 1-2 target operons in Enterobacteriales up to 20 operons in Aeromonadales) and gene content of HexR regulons between 11 compared lineages. A predicted 17-bp pseudo-palindrome with a consensus tTGTAATwwwATTACa, was confirmed as HexR-binding motif for 15 target operons (comprising 30 genes) by in vitro binding assays. The negative effect of the key CCM intermediate, 2-keto-3-deoxy-6- phosphogluconate, on the DNA-regulator complex formation was verified. A dual mode of HexR action on various target promoters, repression of genes involved in catabolic pathways and activation of gluconeogenic genes, was for the first time predicted by the bioinformatc analysis and experimentally verified by changed gene expression pattern in S. oneidensis AhexR mutant. Phenotypic profiling revealed the inability of this mutant to grow on lactate or pyruvate as a single carbon source. A comparative metabolic flux analysis of wild-type and mutant strains of S. oneidensis using 13Clactate labeling and GC-MS analysis confirmed the hypothesized HexR role as a master regulator of gluconeogenic flux from pyruvate via the transcriptional activation of phosphoenolpyruvate synthase (PpsA).

Leyn, Semen; Li, Xiaoqing; Zheng, Qijing; Novichkov, Pavel; Reed, Samantha B.; Romine, Margaret F.; Fredrickson, Jim K.; Yang, Chen; Osterman, Andrei L.; Rodionov, Dmitry A.

2011-08-17

243

Interplay between network structures, regulatory modes and sensing mechanisms of transcription factors in the transcriptional regulatory network of E. coli  

PubMed Central

Though the bacterial transcription regulation apparatus is distinct in terms of several structural and functional features from its eukaryotic counterpart, the gross structure of the transcription regulatory network (TRN) is believed to be similar in both superkingdoms. Here, we explore the fine structure of the bacterial TRN and the underlying “co-regulatory network (CRN)” to show that despite the superficial similarities to eukaryotic networks, the bacterial networks display entirely different organizational principles. In particular unlike in eukaryotes, the hubs of bacterial networks are both global regulators and integrators of diverse disparate transcriptional responses. These and other organizational differences might correlate with the fundamental differences in gene and promoter organization in the two superkingdoms, especially the presence of operons and regulons in bacteria. Further we explored to find the interplay, if any, between network structures, mode of regulatory interactions and signal sensing of TFs in shaping up the bacterial transcriptional regulatory responses. For this purpose, we first classified TFs according to their regulatory mode (activator, repressor or dual regulator) and sensory mechanism (one-component systems responding to internal or external signals, TFs from 2-component systems and chromosomal structure modifying TFs) in the bacterial model organism E. coli and then we studied the overall evolutionary optimization of network structures. The incorporation of TFs in different hierarchical elements of the TRN appears to involve on a multi-dimensional selection process depending on regulatory and sensory modes of TFs in motifs, co-regulatory associations between TFs of different functional classes and transcript half-lives. As result it appears to have generated circuits that allow intricately regulated physiological state changes. We identified the biological significance of most of these optimizations, which can be further used as the basis to explore similar controls in other bacteria. We also show that, though on the larger evolutionary scale, unrelated TFs have evolved to become hubs, within lineages like ?-proteobacteria there is strong tendency to retain hubs, as well as certain higher-order network modules that have emerged through lineage specific paralog duplications. PMID:17706247

Balaji, S.; Babu, M. Madan; Aravind, L.

2007-01-01

244

HIV-1 Reverse Transcription  

PubMed Central

Reverse transcription and integration are the defining features of the Retroviridae; the common name “retrovirus” derives from the fact that these viruses use a virally encoded enzyme, reverse transcriptase (RT), to convert their RNA genomes into DNA. Reverse transcription is an essential step in retroviral replication. This article presents an overview of reverse transcription, briefly describes the structure and function of RT, provides an introduction to some of the cellular and viral factors that can affect reverse transcription, and discusses fidelity and recombination, two processes in which reverse transcription plays an important role. In keeping with the theme of the collection, the emphasis is on HIV-1 and HIV-1 RT. PMID:23028129

Hu, Wei-Shau; Hughes, Stephen H.

2012-01-01

245

Actinobacillus pleuropneumoniae two-component system QseB/QseC regulates the transcription of PilM, an important determinant of bacterial adherence and virulence.  

PubMed

QseB/QseC is one of the five predicted two-component systems (TCSs) in Actinobacillus pleuropneumoniae. To understand the roles of this TCS in A. pleuropneumoniae, a markerless gene-deletion mutant ?qseBC was constructed. Differentially expressed (DE) genes in ?qseBC were filtered by microarray analysis. A total of 44 DE genes were found to be regulated by QseB/QseC system. The transcriptional profile of A. pleuropneumoniae ?qseBC was compared with that of ?luxS and catecholamine (CA) stimulations, 13 genes regulated by QseB/QseC were found also regulated by LuxS, and 3 Qse-regulons were co-regulated by CA stimulations, respectively. Binding of QseB to the promoters of three regulons (pilM, glpK and hugZ), which were co-regulated by QseB/QseC and LuxS, was evaluated by electrophoretic mobility-shift assay. Results indicated that pilM was directly regulated by phosphorylated-QseB. Then the pilM deletion mutant ?pilM was constructed and characterized. Data presented here revealed that adherence ability of ?pilM to St. Jude porcine lung cells was significantly decreased, and ?pilM exhibited reduced virulence in pigs, suggesting PilM contributes to the process of A. pleuropneumoniae infection. PMID:25796134

Liu, Jinlin; Hu, Linlin; Xu, Zhuofei; Tan, Chen; Yuan, Fangyan; Fu, Shulin; Cheng, Hui; Chen, Huanchun; Bei, Weicheng

2015-05-15

246

The CBF1-dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp  

Microsoft Academic Search

The meristematic tissues of temperate woody perennials must acclimate to freezing temperatures to survive the win- ter and resume growth the following year. To determine whether the C-repeat binding factor (CBF) family of tran- scription factors contributing to this process in annual her- baceous species also functions in woody perennials, we investigated the changes in phenotype and transcript profile of

CATHERINE BENEDICT; JEFFREY S. SKINNER; RENGONG MENG; YONGJIAN CHANG; RISHIKESH BHALERAO; NORMAN P. A. HUNER; CHAD E. FINN; TONY H. H. CHEN; VAUGHAN HURRY

2006-01-01

247

Activity of the Rhodopseudomonas palustris p-Coumaroyl-Homoserine Lactone-Responsive Transcription Factor RpaR ? †  

PubMed Central

The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His6-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon. PMID:21378182

Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D.; Castle, John C.; Raymond, Christopher K.; Lappala, Colin R.; Schaefer, Amy L.; Harwood, Caroline S.; Greenberg, E. Peter

2011-01-01

248

Genome-Scale Co-Expression Network Comparison across Escherichia coli and Salmonella enterica Serovar Typhimurium Reveals Significant Conservation at the Regulon Level of Local Regulators Despite Their Dissimilar Lifestyles  

PubMed Central

Availability of genome-wide gene expression datasets provides the opportunity to study gene expression across different organisms under a plethora of experimental conditions. In our previous work, we developed an algorithm called COMODO (COnserved MODules across Organisms) that identifies conserved expression modules between two species. In the present study, we expanded COMODO to detect the co-expression conservation across three organisms by adapting the statistics behind it. We applied COMODO to study expression conservation/divergence between Escherichia coli, Salmonella enterica, and Bacillus subtilis. We observed that some parts of the regulatory interaction networks were conserved between E. coli and S. enterica especially in the regulon of local regulators. However, such conservation was not observed between the regulatory interaction networks of B. subtilis and the two other species. We found co-expression conservation on a number of genes involved in quorum sensing, but almost no conservation for genes involved in pathogenicity across E. coli and S. enterica which could partially explain their different lifestyles. We concluded that despite their different lifestyles, no significant rewiring have occurred at the level of local regulons involved for instance, and notable conservation can be detected in signaling pathways and stress sensing in the phylogenetically close species S. enterica and E. coli. Moreover, conservation of local regulons seems to depend on the evolutionary time of divergence across species disappearing at larger distances as shown by the comparison with B. subtilis. Global regulons follow a different trend and show major rewiring even at the limited evolutionary distance that separates E. coli and S. enterica. PMID:25101984

Zarrineh, Peyman; Sánchez-Rodríguez, Aminael; Hosseinkhan, Nazanin; Narimani, Zahra; Marchal, Kathleen; Masoudi-Nejad, Ali

2014-01-01

249

DNA microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: an approach to comprehensive analysis of B.subtilis two-component regulatory systems  

Microsoft Academic Search

We have analyzed the regulons of the Bacillus subtilis two-component regulators DegU, ComA and PhoP by using whole genome DNA microarrays. For these experiments we took the strategy that the response regulator genes were cloned downstream of an isopropyl-?-D-thiogalactopyranoside-inducible promoter on a multicopy plasmid and expressed in disruptants of the cognate sensor kinase genes, degS, comP and phoR, respectively. The

Mitsuo Ogura; Hirotake Yamaguchi; Ken-ichi Yoshida; Yasutaro Fujita; Teruo Tanaka

2001-01-01

250

The HU Regulon Is Composed of Genes Responding to Anaerobiosis, Acid Stress, High Osmolarity and SOS Induction  

Microsoft Academic Search

BackgroundThe Escherichia coli heterodimeric HU protein is a small DNA-bending protein associated with the bacterial nucleoid. It can introduce negative supercoils into closed circular DNA in the presence of topoisomerase I. Cells lacking HU grow very poorly and display many phenotypes.Methodology\\/Principal FindingsWe analyzed the transcription profile of every Escherichia coli gene in the absence of one or both HU subunits.

Jacques Oberto; Sabrina Nabti; Valérie Jooste; Hervé Mignot; Josette Rouviere-Yaniv; Axel Imhof

2009-01-01

251

Non-canonical CRP sites control competence regulons in Escherichia coli and many other g-proteobacteria  

Microsoft Academic Search

Escherichia coli's cAMP receptor protein (CRP), the archetypal bacterial transcription factor, regulates over a hundred promoters by binding 22 bp symmetrical sites with the consensus core half-site TGTGA. However, Haemophilus influenzae has two types of CRP sites, one like E.coli's and one with the core sequence TGCGA that regulates genes required for DNA uptake (natural competence). Only the latter 'CRP-S'

Andrew D. S. Cameron; Rosemary J. Redfield

2006-01-01

252

Genomic Expression Program Involving the Haa1p-Regulon in Saccharomyces cerevisiae Response to Acetic Acid  

PubMed Central

Abstract The alterations occurring in yeast genomic expression during early response to acetic acid and the involvement of the transcription factor Haa1p in this transcriptional reprogramming are described in this study. Haa1p was found to regulate, directly or indirectly, the transcription of approximately 80% of the acetic acid-activated genes, suggesting that Haa1p is the main player in the control of yeast response to this weak acid. The genes identified in this work as being activated in response to acetic acid in a Haa1p-dependent manner include protein kinases, multidrug resistance transporters, proteins involved in lipid metabolism, in nucleic acid processing, and proteins of unknown function. Among these genes, the expression of SAP30 and HRK1 provided the strongest protective effect toward acetic acid. SAP30 encode a subunit of a histone deacetylase complex and HRK1 encode a protein kinase belonging to a family of protein kinases dedicated to the regulation of plasma membrane transporters activity. The deletion of the HRK1 gene was found to lead to the increase of the accumulation of labeled acetic acid into acid-stressed yeast cells, suggesting that the role of both HAA1 and HRK1 in providing protection against acetic acid is, at least partially, related with their involvement in the reduction of intracellular acetate concentration. PMID:20955010

Becker, Jorg D.; Sá-Correia, Isabel

2010-01-01

253

WRKY transcription factors  

PubMed Central

WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

Bakshi, Madhunita; Oelmüller, Ralf

2014-01-01

254

Functional diversification of ROK-family transcriptional regulators of sugar catabolism in the Thermotogae phylum.  

PubMed

Large and functionally heterogeneous families of transcription factors have complex evolutionary histories. What shapes specificities toward effectors and DNA sites in paralogous regulators is a fundamental question in biology. Bacteria from the deep-branching lineage Thermotogae possess multiple paralogs of the repressor, open reading frame, kinase (ROK) family regulators that are characterized by carbohydrate-sensing domains shared with sugar kinases. We applied an integrated genomic approach to study functions and specificities of regulators from this family. A comparative analysis of 11 Thermotogae genomes revealed novel mechanisms of transcriptional regulation of the sugar utilization networks, DNA-binding motifs and specific functions. Reconstructed regulons for seven groups of ROK regulators were validated by DNA-binding assays using purified recombinant proteins from the model bacterium Thermotoga maritima. All tested regulators demonstrated specific binding to their predicted cognate DNA sites, and this binding was inhibited by specific effectors, mono- or disaccharides from their respective sugar catabolic pathways. By comparing ligand-binding domains of regulators with structurally characterized kinases from the ROK family, we elucidated signature amino acid residues determining sugar-ligand regulator specificity. Observed correlations between signature residues and the sugar-ligand specificities provide the framework for structure functional classification of the entire ROK family. PMID:23209028

Kazanov, Marat D; Li, Xiaoqing; Gelfand, Mikhail S; Osterman, Andrei L; Rodionov, Dmitry A

2013-01-01

255

The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis  

PubMed Central

Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: ?E, ?K, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The ?E factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the ?E regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of ?K. Next, ?K activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by ?K while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

2004-01-01

256

Developmental Cell Transcriptional Control  

E-print Network

, proendocardial cells migrate and line up along the intestinal portal to form a single endocardial tube (Flamme etDevelopmental Cell Review Transcriptional Control of Endothelial Cell Development Sarah De Val1.black@ucsf.edu DOI 10.1016/j.devcel.2009.01.014 The transcription factors that regulate endothelial cell development

257

The LysR-Type Transcriptional Regulator LeuO Controls Expression of Several Genes in Salmonella enterica Serovar Typhi? †  

PubMed Central

LeuO is a LysR-type transcriptional regulator that has been implicated in the bacterial stringent response and in the virulence of Salmonella. A genomic analysis with Salmonella enterica serovar Typhi revealed that LeuO is a positive regulator of OmpS1, OmpS2, AssT, and STY3070. In contrast, LeuO down-regulated the expression of OmpX, Tpx, and STY1978. Transcriptional fusions supported the positive and negative LeuO regulation. Expression of ompS1, assT, and STY3070 was induced in an hns mutant, consistent with the notion that H-NS represses these genes; transcriptional activity was lower for tpx and STY1978 in an hns background, suggesting that this global regulatory protein has a positive effect. In contrast, ompS2 and ompX expression appeared to be H-NS independent. LeuO specifically bound to the 5? intergenic regions of ompS2, assT, STY3070, ompX, and tpx, while it was not observed to bind to the promoter region of STY1978, suggesting that LeuO regulates in direct and indirect ways. In this work, a novel set of genes belonging to the LeuO regulon are described; interestingly, these genes are involved in a variety of biological processes, suggesting that LeuO is a global regulator in Salmonella. PMID:18156266

Hernández-Lucas, I.; Gallego-Hernández, A. L.; Encarnación, S.; Fernández-Mora, M.; Martínez-Batallar, A. G.; Salgado, H.; Oropeza, R.; Calva, E.

2008-01-01

258

The LysR-type transcriptional regulator LeuO controls expression of several genes in Salmonella enterica serovar Typhi.  

PubMed

LeuO is a LysR-type transcriptional regulator that has been implicated in the bacterial stringent response and in the virulence of Salmonella. A genomic analysis with Salmonella enterica serovar Typhi revealed that LeuO is a positive regulator of OmpS1, OmpS2, AssT, and STY3070. In contrast, LeuO down-regulated the expression of OmpX, Tpx, and STY1978. Transcriptional fusions supported the positive and negative LeuO regulation. Expression of ompS1, assT, and STY3070 was induced in an hns mutant, consistent with the notion that H-NS represses these genes; transcriptional activity was lower for tpx and STY1978 in an hns background, suggesting that this global regulatory protein has a positive effect. In contrast, ompS2 and ompX expression appeared to be H-NS independent. LeuO specifically bound to the 5' intergenic regions of ompS2, assT, STY3070, ompX, and tpx, while it was not observed to bind to the promoter region of STY1978, suggesting that LeuO regulates in direct and indirect ways. In this work, a novel set of genes belonging to the LeuO regulon are described; interestingly, these genes are involved in a variety of biological processes, suggesting that LeuO is a global regulator in Salmonella. PMID:18156266

Hernández-Lucas, I; Gallego-Hernández, A L; Encarnación, S; Fernández-Mora, M; Martínez-Batallar, A G; Salgado, H; Oropeza, R; Calva, E

2008-03-01

259

Global transcriptional response of Caulobacter crescentus to iron availability  

PubMed Central

Background In the alpha subclass of proteobacteria iron homeostasis is controlled by diverse iron responsive regulators. Caulobacter crescentus, an important freshwater ?-proteobacterium, uses the ferric uptake repressor (Fur) for such purpose. However, the impact of the iron availability on the C. crescentus transcriptome and an overall perspective of the regulatory networks involved remain unknown. Results In this work we report the identification of iron-responsive and Fur-regulated genes in C. crescentus using microarray-based global transcriptional analyses. We identified 42 genes that were strongly upregulated both by mutation of fur and by iron limitation condition. Among them, there are genes involved in iron uptake (four TonB-dependent receptor gene clusters, and feoAB), riboflavin biosynthesis and genes encoding hypothetical proteins. Most of these genes are associated with predicted Fur binding sites, implicating them as direct targets of Fur-mediated repression. These data were validated by ?-galactosidase and EMSA assays for two operons encoding putative transporters. The role of Fur as a positive regulator is also evident, given that 27 genes were downregulated both by mutation of fur and under low-iron condition. As expected, this group includes many genes involved in energy metabolism, mostly iron-using enzymes. Surprisingly, included in this group are also TonB-dependent receptors genes and the genes fixK, fixT and ftrB encoding an oxygen signaling network required for growth during hypoxia. Bioinformatics analyses suggest that positive regulation by Fur is mainly indirect. In addition to the Fur modulon, iron limitation altered expression of 113 more genes, including induction of genes involved in Fe-S cluster assembly, oxidative stress and heat shock response, as well as repression of genes implicated in amino acid metabolism, chemotaxis and motility. Conclusions Using a global transcriptional approach, we determined the C. crescentus iron stimulon. Many but not all of iron responsive genes were directly or indirectly controlled by Fur. The iron limitation stimulon overlaps with other regulatory systems, such as the RpoH and FixK regulons. Altogether, our results showed that adaptation of C. crescentus to iron limitation not only involves increasing the transcription of iron-acquisition systems and decreasing the production of iron-using proteins, but also includes novel genes and regulatory mechanisms. PMID:23941329

2013-01-01

260

Decoding transcriptional regulatory interactions  

NASA Astrophysics Data System (ADS)

Transcription factor proteins control the temporal and spatial expression of genes by binding specific regulatory elements, or motifs, in DNA. Mapping a transcription factor to its motif is an important step towards defining the structure of transcriptional regulatory networks and understanding their dynamics. The information to map a transcription factor to its DNA binding specificity is in principle contained in the protein sequence. Nevertheless, methods that map directly from protein sequence to target DNA sequence have been lacking, and generation of regulatory maps has required experimental data. Here we describe a purely computational method for predicting transcription factor binding. The method calculates the free energy of binding between a transcription factor and possible target DNA sequences using thermodynamic integration. Approximations of additivity (each DNA basepair contributes independently to the binding energy) and linear response (the DNA-protein and DNA-solvent couplings are linear in an effective reaction coordinate representing the basepair character at a specific position) make the computations feasible and can be verified by more detailed simulations. Results obtained for MAT- ?2, a yeast homeodomain transcription factor, are in good agreement with known results. This method promises to provide a general, computationally feasible route from a genome sequence to a gene regulatory network.

Angela Liu, L.; Bader, Joel S.

2006-12-01

261

ASTP Onboard Voice Transcription  

NASA Technical Reports Server (NTRS)

The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

1975-01-01

262

Transcription technology today.  

PubMed

A fascination with telecommunications and technology has enabled this author and her corporate information systems department to achieve system integration and simple functionality in a comprehensive and diverse medical transcription unit. PMID:10119098

Godinho, R A

1992-07-01

263

Inference of Expanded Lrp-Like Feast/Famine Transcription Factor Targets in a Non-Model Organism Using Protein Structure-Based Prediction  

PubMed Central

Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer. PMID:25255272

Ashworth, Justin; Plaisier, Christopher L.; Lo, Fang Yin; Reiss, David J.; Baliga, Nitin S.

2014-01-01

264

TRANSCRIPTION DESTABILIZES TRIPLET REPEATS  

PubMed Central

Triplet repeat expansion is the molecular basis for several human diseases. Intensive studies using systems in bacteria, yeast, flies, mammalian cells, and mice have provided important insights into the molecular processes that are responsible for mediating repeat instability. The age-dependent, ongoing repeat instability in somatic tissues, especially in terminally differentiated neurons, strongly suggests a robust role for pathways that are independent of DNA replication. Several genetic studies have indicated that transcription can play a critical role in repeat instability, potentially providing a basis for the instability observed in neurons. Transcription-induced repeat instability can be modulated by several DNA repair proteins, including those involved in mismatch repair (MMR) and transcription-coupled nucleotide excision repair (TC-NER). Though the mechanism is unclear, it is likely that transcription facilitates the formation of repeat-specific secondary structures, which act as intermediates to trigger DNA repair, eventually leading to changes in the length of the repeat tract. In addition, other processes associated with transcription can also modulate repeat instability, as shown in a variety of different systems. Overall, the mechanisms underlying repeat instability in humans are unexpectedly complicated. Because repeat-disease genes are widely expressed, transcription undoubtedly contributes to the repeat instability observed in many diseases, but it may be especially important in nondividing cells. Transcription-induced instability is likely to involve an extensive interplay not only of the core transcription machinery and DNA repair proteins, but also of proteins involved in chromatin remodeling, regulation of supercoiling, and removal of stalled RNA polymerases, as well as local DNA sequence effects. PMID:18973172

Lin, Yunfu; Hubert, Leroy; Wilson, John H.

2013-01-01

265

New members of the Escherichia coli sigmaE regulon identified by a two-plasmid system.  

PubMed

A previously established method, based on a two-plasmid system, was used to identify promoters recognized by RNA polymerase containing the extracytoplasmic stress response sigma factor sigmaE in Escherichia coli. In addition to previously identified rpoE-dependent promoters, 11 new promoters potentially directing the expression of 15 genes were identified that were active only after over-expression of rpoE. The promoters were confirmed and transcriptional start points of the promoters were determined by primer extension analysis and S1-nuclease mapping. All the promoters contained sequences similar to the consensus sequence of rpoE-dependent promoters. The new rpoE-dependent promoters governed expression of genes encoding proteins involved in primary metabolism (fusA, tufA, recR), phospholipid and lipopolysaccharide biosynthesis (psd, lpxP), signal transduction (sixA), proposed inner or outer membrane proteins (bacA, sbmA, smpA, yeaY), and proteins with unknown function (ybaB, yaiW, yiiS, yiiT, yfeY). PMID:12900013

Rezuchova, Bronislava; Miticka, Henrieta; Homerova, Dagmar; Roberts, Mark; Kormanec, Jan

2003-08-01

266

Transcriptional Profiling of Nitrogen Fixation and the Role of NifA in the Diazotrophic Endophyte Azoarcus sp. Strain BH72  

PubMed Central

Background The model endophyte Azoarcus sp. strain BH72 is known to contribute fixed nitrogen to its host Kallar grass and also expresses nitrogenase genes endophytically in rice seedlings. Availability of nitrogen is a signal regulating the transcription of nitrogenase genes. Therefore, we analysed global transcription in response to differences in the nitrogen source. Methodology/Principal Findings A DNA microarray, comprising 70-mer oligonucleotides representing 3989 open reading frames of the genome of strain BH72, was used for transcriptome studies. Transcription profiles of cells grown microaerobically on N2 versus ammonium were compared. Expression of 7.2% of the genes was significantly up-regulated, and 5.8% down-regulated upon N2 fixation, respectively. A parallel genome-wide prediction of ?54-type promoter elements mapped to the upstream region of 38 sequences of which 36 were modulated under the N2 response. In addition to modulation of genes related to N2 fixation, the expressions of gene clusters that might be related to plant-microbe interaction and of several transcription factors were significantly enhanced. While comparing under N2-fixation conditions the transcriptome of wild type with a nifLA? insertion mutant, NifA being the essential transcriptional activator for nif genes, 24.5% of the genome was found to be affected in expression. A genome-wide prediction of 29 NifA binding sequences matched to 25 of the target genes whose expression was differential during microarray analysis, some of which were putatively negatively regulated by NifA. For selected genes, differential expression was corroborated by real time RT-PCR studies. Conclusion/Significance Our data suggest that life under conditions of nitrogen fixation is an important part of the lifestyle of strain BH72 in roots, as a wide range of genes far beyond the nif regulon is modulated. Moreover, the NifA regulon in strain BH72 appears to encompass a wider range of cellular functions beyond the regulation of nif genes. PMID:24516534

Sarkar, Abhijit; Reinhold-Hurek, Barbara

2014-01-01

267

Molecular analysis of two ScrR repressors and of a ScrR-FruR hybrid repressor for sucrose and D-fructose specific regulons from enteric bacteria.  

PubMed

The scr regulon of pUR400 and the chromosomally encoded scr regulon of Klebsiella pneumoniae KAY2026 are both negatively controlled by a specific repressor (ScrR). As deduced from the nucleotide sequences, both scrR genes encode polypeptides of 334 residues (85.5% identical base pairs, 91.3% identical amino acids), containing an N-terminal helix-turn-helix motif. Comparison with other regulatory proteins revealed 30.6% identical amino acids to FruR, 27.0% to Lacl and 28.1% to GalR. Six scrRs super-repressor mutations define the inducer-binding domain. The scr operator sequences were identified by in vivo titration tests of the sucrose repressor and by in vitro electrophoretic mobility shift assays. D-fructose, an intracellular product of sucrose transport and hydrolysis, and D-fructose 1-phosphate were shown to be molecular inducers of both scr regulons. An active ScrR-FruR hybrid repressor protein was constructed with the N-terminal part of the sucrose repressor of K. pneumoniae and the C-terminal part of the fructose repressor of Salmonella typhimurium LT2. Gel retardation assays showed that the hybrid protein bound to scr-specific operators, and that D-fructose 1-phosphate, the inducer for FruR, was the only inducer. In vivo, neither the operators of the fru operon nor of the pps operon, the natural targets for FruR, were recognized, but the scr operators were. These data and the data obtained from the super-repressor alleles confirm previous models on the binding of repressors of the Lacl family to their operators. PMID:8412665

Jahreis, K; Lengeler, J W

1993-07-01

268

Characterization of the RpoN regulon reveals differential regulation of T6SS and new flagellar operons in Vibrio cholerae O37 strain V52  

PubMed Central

The alternative sigma factor RpoN is an essential colonization factor of Vibrio cholerae and controls important cellular functions including motility and type VI secretion (T6SS). The RpoN regulon has yet to be clearly defined in T6SS-active V. cholerae isolates, which use T6SS to target both bacterial competitors and eukaryotic cells. We hypothesize that T6SS-dependent secreted effectors are co-regulated by RpoN. To systemically identify RpoN-controlled genes, we used chromatin immunoprecipitation coupled with sequencing (ChIP-Seq) and transcriptome analysis (RNA-Seq) to determine RpoN-binding sites and RpoN-controlled gene expression. There were 68 RpoN-binding sites and 82 operons positively controlled by RpoN, among which 37 operons had ChIP-identified binding sites. A consensus RpoN-binding motif was identified with a highly conserved thymine (?14) and an AT-rich region in the middle between the hallmark RpoN-recognized motif GG(?24)/GC(?12). There were seven new RpoN-dependent promoters in the flagellar regions. We identified a small RNA, flaX, downstream of the major flagellin gene flaA. Mutation of flaX substantially reduced motility. In contrast to previous results, we report that RpoN positively regulates the expression of hcp operons and vgrG3 that encode T6SS secreted proteins but has no effect on the expression of the main T6SS cluster encoding sheath and other structural components. PMID:22723378

Dong, Tao G.; Mekalanos, John J.

2012-01-01

269

RegPrecise web services interface: programmatic access to the transcriptional regulatory interactions in bacteria reconstructed by comparative genomics  

PubMed Central

Web services application programming interface (API) was developed to provide a programmatic access to the regulatory interactions accumulated in the RegPrecise database (http://regprecise.lbl.gov), a core resource on transcriptional regulation for the microbial domain of the Department of Energy (DOE) Systems Biology Knowledgebase. RegPrecise captures and visualize regulogs, sets of genes controlled by orthologous regulators in several closely related bacterial genomes, that were reconstructed by comparative genomics. The current release of RegPrecise 2.0 includes >1400 regulogs controlled either by protein transcription factors or by conserved ribonucleic acid regulatory motifs in >250 genomes from 24 taxonomic groups of bacteria. The reference regulons accumulated in RegPrecise can serve as a basis for automatic annotation of regulatory interactions in newly sequenced genomes. The developed API provides an efficient access to the RegPrecise data by a comprehensive set of 14 web service resources. The RegPrecise web services API is freely accessible at http://regprecise.lbl.gov/RegPrecise/services.jsp with no login requirements. PMID:22700702

Novichkov, Pavel S.; Brettin, Thomas S.; Novichkova, Elena S.; Dehal, Paramvir S.; Arkin, Adam P.; Dubchak, Inna; Rodionov, Dmitry A.

2012-01-01

270

The novel transcriptional regulator SA1804 Is involved in mediating the invasion and cytotoxicity of Staphylococcus aureus  

PubMed Central

The two-component regulatory system, SaeRS, controls expression of important virulence factors, including toxins and invasins, which contribute to the pathogenicity of Staphylococcus aureus. Previously, we conducted a transcriptomics study for identification of SaeRS regulon and found that inactivation of SaeRS dramatically enhances the transcription of a novel transcriptional regulator (SA1804). This led us to question whether SA1804 is involved in bacterial pathogenicity by regulating the expression of virulence factors. To address this question, we created sa1804, saeRS, and sa1804/saeRS double deletion mutants in a USA300 community-acquired MRSA strain, 923, and determined their impact on the pathogenicity. The deletion of sa1804 dramatically increased the cytotoxicity and enhanced the capacity of bacteria to invade into the epithelial cells (A549), whereas the deletion of saeRS eliminated the cytotoxicity and abolished the bacterial ability to invade into the epithelial cells. Moreover, the double deletions of sa1804 and saeRS appeared a similar phenotype with the saeRS null mutation. Furthermore, we determined the regulatory mechanism of SA1804 using qPCR and gel-shift approaches. Our data indicate that the novel virulence repressor SA1804 is dependent on the regulation of SaeRS. This study sheds light on the regulatory mechanism of virulence factors and allows for us further elucidate the molecular pathogenesis of S. aureus.

Yang, Junshu; Liang, Xudong; Ji, Yinduo

2015-01-01

271

An iron-sulfur center essential for transcriptional activation by the redox-sensing SoxR protein.  

PubMed Central

The soxRS oxidative stress regulon of Escherichia coli is triggered by superoxide (O2.-) generating agents or by nitric oxide through two consecutive steps of gene activation. SoxR protein has been proposed as the redox sensing gene activator that triggers this cascade of gene expression. We have now characterized two forms of SoxR: Fe-SoxR contained non-heme iron (up to 1.6 atoms per monomer); apo-SoxR was devoid of Fe or other metals. The spectroscopic properties of Fe-SoxR indicated that it contains a redox active iron-sulfur (FeS) cluster that is oxidized upon extraction from E. coli. Fe-SoxR and apo-SoxR bound the in vivo target, the soxS promoter, with equal affinities and protected the same region from DNase I in vitro. However, only Fe-SoxR stimulated transcription initiation at soxS in vitro > 100-fold, similar to the activation of soxS expression in vivo. This stimulation occurred at a step after the binding of RNAP and indicates a conformational effect of oxidized Fe-SoxR on the soxS promoter. The variable redox state of the SoxR FeS cluster may thus be employed in vivo to modulate the transcriptional activity of this protein in response to specific types of oxidative stress. Images PMID:8306957

Hidalgo, E; Demple, B

1994-01-01

272

A large family of antivirulence regulators modulates the effects of transcriptional activators in Gram-negative pathogenic bacteria.  

PubMed

We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44-100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family. PMID:24875828

Santiago, Araceli E; Ruiz-Perez, Fernando; Jo, Noah Y; Vijayakumar, Vidhya; Gong, Mei Q; Nataro, James P

2014-05-01

273

The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis  

PubMed Central

Efg1 (a member of the APSES family) is an important regulator of hyphal growth and of the white-to-opaque transition in Candida albicans and very closely related species. We show that in Candida parapsilosis?Efg1 is a major regulator of a different morphological switch at the colony level, from a concentric to smooth morphology. The rate of switching is at least 20-fold increased in an efg1 knockout relative to wild type. Efg1 deletion strains also have reduced biofilm formation, attenuated virulence in an insect model, and increased sensitivity to SDS and caspofungin. Biofilm reduction is more dramatic in in vitro than in in vivo models. An Efg1 paralogue (Efh1) is restricted to Candida species, and does not regulate concentric-smooth phenotype switching, biofilm formation or stress response. We used ChIP-seq to identify the Efg1 regulon. A total of 931 promoter regions bound by Efg1 are highly enriched for transcription factors and regulatory proteins. Efg1 also binds to its own promoter, and negatively regulates its expression. Efg1 targets are enriched in binding sites for 93 additional transcription factors, including Ndt80. Our analysis suggests that Efg1 has an ancient role as regulator of development in fungi, and is central to several regulatory networks. PMID:23895281

Connolly, Leona A; Riccombeni, Alessandro; Grózer, Zsuzsana; Holland, Linda M; Lynch, Denise B; Andes, David R; Gácser, Attila; Butler, Geraldine

2013-01-01

274

[Transcriptional coactivator SAYP can suppress transcription in heterochromatin].  

PubMed

The new transcriptional coactivator SAYP binds at many sites to transcriptionally active chromatin of polytene chromosomes, colocalizes with RNA polymerase II, and coactivates transcription. On the other hand, SAYP is present in heterochromatic regions of chromosome IV and in the chromocenter and suppresses transcription of transgenes located in heterochromatin. The conserved SAY domain of SAYP is involved in transcription activation, while its PHD domains are responsible for gene silencing in heterochromatin. Thus, SAYP plays a dual role in regulating transcription in euchromatic and heterochromatic regions. PMID:16161622

Nikolenko, Iu V; Shidlovski?, Iu V; Lebedeva, L A; Krasnov, A N; Georgieva, S G; Nabirochkina, E N

2005-08-01

275

Characterisation of a putative AraC transcriptional regulator from Mycobacterium smegmatis  

PubMed Central

Summary MSMEG_0307 is annotated as a transcriptional regulator belonging to the AraC protein family and is located adjacent to the arylamine N-acetyltransferase (nat) gene in Mycobacterium smegmatis, in a gene cluster, conserved in most environmental mycobacterial species. In order to elucidate the function of the AraC protein from the nat operon in M. smegmatis, two conserved palindromic DNA motifs were identified using bioinformatics and tested for protein binding using electrophoretic mobility shift assays with a recombinant form of the AraC protein. We identified the formation of a DNA:AraC protein complex with one of the motifs as well as the presence of this motif in 20 loci across the whole genome of M. smegmatis, supporting the existence of an AraC controlled regulon. To characterise the effects of AraC in the regulation of the nat operon genes, as well as to gain further insight into its function, we generated a ?araC mutant strain where the araC gene was replaced by a hygromycin resistance marker. The level of expression of the nat and MSMEG_0308 genes was down-regulated in the ?araC strain when compared to the wild type strain indicating an activator effect of the AraC protein on the expression of the nat operon genes. PMID:25443504

Evangelopoulos, Dimitrios; Gupta, Antima; Lack, Nathan A.; Maitra, Arundhati; ten Bokum, Annemieke M.C.; Kendall, Sharon; Sim, Edith; Bhakta, Sanjib

2014-01-01

276

Improved predictions of transcription factor binding sites using physicochemical features of DNA.  

PubMed

Typical approaches for predicting transcription factor binding sites (TFBSs) involve use of a position-specific weight matrix (PWM) to statistically characterize the sequences of the known sites. Recently, an alternative physicochemical approach, called SiteSleuth, was proposed. In this approach, a linear support vector machine (SVM) classifier is trained to distinguish TFBSs from background sequences based on local chemical and structural features of DNA. SiteSleuth appears to generally perform better than PWM-based methods. Here, we improve the SiteSleuth approach by considering both new physicochemical features and algorithmic modifications. New features are derived from Gibbs energies of amino acid-DNA interactions and hydroxyl radical cleavage profiles of DNA. Algorithmic modifications consist of inclusion of a feature selection step, use of a nonlinear kernel in the SVM classifier, and use of a consensus-based post-processing step for predictions. We also considered SVM classification based on letter features alone to distinguish performance gains from use of SVM-based models versus use of physicochemical features. The accuracy of each of the variant methods considered was assessed by cross validation using data available in the RegulonDB database for 54 Escherichia coli TFs, as well as by experimental validation using published ChIP-chip data available for Fis and Lrp. PMID:22923524

Maienschein-Cline, Mark; Dinner, Aaron R; Hlavacek, William S; Mu, Fangping

2012-12-01

277

The Transcription Factor Encyclopedia  

PubMed Central

Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

2012-01-01

278

The transcription factor encyclopedia.  

PubMed

Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

2012-01-01

279

Transcriptional Profiling of ParA and ParB Mutants in Actively Dividing Cells of an Opportunistic Human Pathogen Pseudomonas aeruginosa  

PubMed Central

Accurate chromosome segregation to progeny cells is a fundamental process ensuring proper inheritance of genetic material. In bacteria with simple cell cycle, chromosome segregation follows replication initiation since duplicated oriC domains start segregating to opposite halves of the cell soon after they are made. ParA and ParB proteins together with specific DNA sequences are parts of the segregation machinery. ParA and ParB proteins in Pseudomonas aeruginosa are important for optimal growth, nucleoid segregation, cell division and motility. Comparative transcriptome analysis of parAnull and parBnull mutants versus parental P. aeruginosa PAO1161 strain demonstrated global changes in gene expression pattern in logarithmically growing planktonic cultures. The set of genes similarly affected in both mutant strains is designated Par regulon and comprises 536 genes. The Par regulon includes genes controlled by two sigma factors (RpoN and PvdS) as well as known and putative transcriptional regulators. In the absence of Par proteins, a large number of genes from RpoS regulon is induced, reflecting the need for slowing down the cell growth rate and decelerating the metabolic processes. Changes in the expression profiles of genes involved in c-di-GMP turnover point out the role of this effector in such signal transmission. Microarray data for chosen genes were confirmed by RT-qPCR analysis. The promoter regions of selected genes were cloned upstream of the promoter-less lacZ gene and analyzed in the heterologous host E. coli?lac. Regulation by ParA and ParB of P. aeruginosa was confirmed for some of the tested promoters. Our data demonstrate that ParA and ParB besides their role in accurate chromosome segregation may act as modulators of genes expression. Directly or indirectly, Par proteins are part of the wider regulatory network in P. aeruginosa linking the process of chromosome segregation with the cell growth, division and motility. PMID:24498062

Bartosik, Aneta A.; Glabski, Krzysztof; Jecz, Paulina; Mikulska, Sylwia; Fogtman, Anna; Koblowska, Marta; Jagura-Burdzy, Grazyna

2014-01-01

280

Mapping Yeast Transcriptional Networks  

PubMed Central

The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms. PMID:24018767

Hughes, Timothy R.; de Boer, Carl G.

2013-01-01

281

Mechanisms of transcriptional memory  

Microsoft Academic Search

How can the same gene remember that it is 'off' in one cell lineage and 'on' in another? Studies of how homeotic genes are regulated in Drosophila melanogaster have uncovered a transcriptional maintenance system, encoded by the Polycomb and trithorax group genes, that preserves expression patterns across development. Here we try to formulate a broad framework for the types of

Nicole J. Francis; Robert E. Kingston

2001-01-01

282

Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638  

PubMed Central

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ?rcsB mutant was affected in its plant growth promoting ability. PMID:25607953

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

2015-01-01

283

Copper homeostasis-related genes in three separate transcriptional units regulated by CsoR in Corynebacterium glutamicum.  

PubMed

In Corynebacterium glutamicum R, CsoR acts as a transcriptional repressor not only of the cognate copA-csoR operon but also of the copZ1-copB-cgR_0126 operon. It is predicted that copA and copB encode P-type ATPases for copper efflux and copZ1 encodes a metallochaperone. Here, a CsoR-binding motif was found upstream of another copZ-like gene, copZ2, and the in vitro binding of the CsoR protein to its promoter was confirmed. The monocistronic copZ2 transcript was upregulated by excess copper in a CsoR-dependent manner. Among the extended CsoR regulon, deletion of copA, but not of copB, copZ1, or copZ2, resulted in decreased resistance to copper, indicating a major role of the CopA copper exporter in the multilayered systems for copper homeostasis. A redundant role of copZ1 and copZ2 in copper resistance was also indicated by double deletion of these genes. The copper-dependent activation of the copA, copZ1, and copZ2 promoters was confirmed by lacZ reporter assays, consistent with the coordinated derepression of the three transcriptional units. The copZ1 promoter activity showed the highest responsiveness to copper and was also induced by excess zinc and nickel. Furthermore, zinc-inducible expression observed for the CsoR-regulated genes was independent of Zur, recently found to uniquely act as a transcriptional repressor of zinc efflux genes. These results implied complicated cross talk between homeostasis of multiple transition metals. PMID:25592736

Teramoto, Haruhiko; Yukawa, Hideaki; Inui, Masayuki

2015-04-01

284

Transcriptional responses to sucrose mimic the plant-associated life style of the plant growth promoting endophyte Enterobacter sp. 638.  

PubMed

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g., flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ?rcsB mutant was affected in its plant growth promoting ability. PMID:25607953

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

2015-01-01

285

The Salmonella Spi1 Virulence Regulatory Protein HilD Directly Activates Transcription of the Flagellar Master Operon flhDC  

PubMed Central

Infection of intestinal epithelial cells is dependent on the Salmonella enterica serovar Typhimurium pathogenicity island 1 (Spi1)-encoded type III injectisome system and flagellar motility. Thus, the expression of virulence and flagellar genes is subject to tight regulatory control mechanisms in order to ensure the correct spatiotemporal production of the respective gene products. In this work, we reveal a new level of cross-regulation between the Spi1 and flagellar regulatory systems. Transposon mutagenesis identified a class of mutants that prevented flhDC autorepression by overexpressing HilD. HilD, HilC, RtsA, and HilA comprise a positive regulatory circuit for the expression of the Spi1 genes. Here, we report a novel transcriptional cross talk between the Spi1 and flagellar regulons where HilD transcriptionally activates flhDC gene expression by binding to nucleotides ?68 to ?24 upstream from the P5 transcriptional start site. We additionally show that, in contrast to the results of a previous report, HilA does not affect flagellar gene expression. Finally, we discuss a model of the cross-regulation network between Spi1 and the flagellar system and propose a regulatory mechanism via the Spi1 master regulator HilD that would prime flagellar genes for rapid reactivation during host infection. PMID:24488311

Singer, Hanna M.; Kühne, Caroline; Deditius, Julia A.

2014-01-01

286

Screening of transcription factors with transcriptional initiation activity.  

PubMed

A majority of mammalian promoters are associated with CpG islands. CpG island promoters frequently lack common core promoter elements, such as the TATA box, and often have dispersed transcription start sites. The mechanism through which CpG island promoters are transcriptionally initiated remains unclear. We speculate that some transcription factors can direct transcription initiation by themselves. To test this hypothesis, we screened a variety of transcription factors to see whether they could initiate transcription. Most transcription factors, including specificity protein 1 (Sp1) and nuclear factor Y (NF-Y), showed little transcriptional initiation activity. However, nuclear respiratory factor 1 (NRF-1), the basic helix-loop-helix/leucine zipper (bHLH/ZIP) family of proteins and the E-twenty six (Ets) family of proteins had strong transcriptional activity. We further demonstrated that these transcription factors initiate dispersed transcription. Our studies provide perspectives to the mechanism of transcription initiation from CpG island promoters. PMID:23933270

Zhang, Lang; Yu, Haoyue; Wang, Pan; Ding, Qingyang; Wang, Zhao

2013-11-15

287

Tailoring the Models of Transcription  

PubMed Central

Molecular biology is a rapidly evolving field that has led to the development of increasingly sophisticated technologies to improve our capacity to study cellular processes in much finer detail. Transcription is the first step in protein expression and the major point of regulation of the components that determine the characteristics, fate and functions of cells. The study of transcriptional regulation has been greatly facilitated by the development of reporter genes and transcription factor expression vectors, which have become versatile tools for manipulating promoters, as well as transcription factors in order to examine their function. The understanding of promoter complexity and transcription factor structure offers an insight into the mechanisms of transcriptional control and their impact on cell behaviour. This review focuses on some of the many applications of molecular cut-and-paste tools for the manipulation of promoters and transcription factors leading to the understanding of crucial aspects of transcriptional regulation. PMID:23567272

Pance, Alena

2013-01-01

288

The DeoR-type transcriptional regulator SugR acts as a repressor for genes encoding the phosphoenolpyruvate:sugar phosphotransferase system (PTS) in Corynebacterium glutamicum  

PubMed Central

Background The major uptake system responsible for the transport of fructose, glucose, and sucrose in Corynebacterium glutamicum ATCC 13032 is the phosphoenolpyruvate:sugar phosphotransferase system (PTS). The genes encoding PTS components, namely ptsI, ptsH, and ptsF belong to the fructose-PTS gene cluster, whereas ptsG and ptsS are located in two separate regions of the C. glutamicum genome. Due to the localization within and adjacent to the fructose-PTS gene cluster, two genes coding for DeoR-type transcriptional regulators, cg2118 and sugR, are putative candidates involved in the transcriptional regulation of the fructose-PTS cluster genes. Results Four transcripts of the extended fructose-PTS gene cluster that comprise the genes sugR-cg2116, ptsI, cg2118-fruK-ptsF, and ptsH, respectively, were characterized. In addition, it was shown that transcription of the fructose-PTS gene cluster is enhanced during growth on glucose or fructose when compared to acetate. Subsequently, the two genes sugR and cg2118 encoding for DeoR-type regulators were mutated and PTS gene transcription was found to be strongly enhanced in the presence of acetate only in the sugR deletion mutant. The SugR regulon was further characterized by microarray hybridizations using the sugR mutant and its parental strain, revealing that also the PTS genes ptsG and ptsS belong to this regulon. Binding of purified SugR repressor protein to a 21 bp sequence identified the SugR binding site as an AC-rich motif. The two experimentally identified SugR binding sites in the fructose-PTS gene cluster are located within or downstream of the mapped promoters, typical for transcriptional repressors. Effector studies using electrophoretic mobility shift assays (EMSA) revealed the fructose PTS-specific metabolite fructose-1-phosphate (F-1-P) as a highly efficient, negative effector of the SugR repressor, acting in the micromolar range. Beside F-1-P, other sugar-phosphates like fructose-1,6-bisphosphate (F-1,6-P) and glucose-6-phosphate (G-6-P) also negatively affect SugR-binding, but in millimolar concentrations. Conclusion In C. glutamicum ATCC 13032 the DeoR-type regulator SugR acts as a pleiotropic transcriptional repressor of all described PTS genes. Thus, in contrast to most DeoR-type repressors described, SugR is able to act also on the transcription of the distantly located genes ptsG and ptsS of C. glutamicum. Transcriptional repression of the fructose-PTS gene cluster is observed during growth on acetate and transcription is derepressed in the presence of the PTS sugars glucose and fructose. This derepression of the fructose-PTS gene cluster is mainly modulated by the negative effector F-1-P, but reduced sensitivity to the other effectors, F-1,6-P or G-6-P might cause differential transcriptional regulation of genes of the general part of the PTS (ptsI, ptsH) and associated genes encoding sugar-specific functions (ptsF, ptsG, ptsS). PMID:18005413

Gaigalat, Lars; Schlüter, Jan-Philip; Hartmann, Michelle; Mormann, Sascha; Tauch, Andreas; Pühler, Alfred; Kalinowski, Jörn

2007-01-01

289

Divergent transcription is associated with promoters of transcriptional regulators  

PubMed Central

Background Divergent transcription is a wide-spread phenomenon in mammals. For instance, short bidirectional transcripts are a hallmark of active promoters, while longer transcripts can be detected antisense from active genes in conditions where the RNA degradation machinery is inhibited. Moreover, many described long non-coding RNAs (lncRNAs) are transcribed antisense from coding gene promoters. However, the general significance of divergent lncRNA/mRNA gene pair transcription is still poorly understood. Here, we used strand-specific RNA-seq with high sequencing depth to thoroughly identify antisense transcripts from coding gene promoters in primary mouse tissues. Results We found that a substantial fraction of coding-gene promoters sustain divergent transcription of long non-coding RNA (lncRNA)/mRNA gene pairs. Strikingly, upstream antisense transcription is significantly associated with genes related to transcriptional regulation and development. Their promoters share several characteristics with those of transcriptional developmental genes, including very large CpG islands, high degree of conservation and epigenetic regulation in ES cells. In-depth analysis revealed a unique GC skew profile at these promoter regions, while the associated coding genes were found to have large first exons, two genomic features that might enforce bidirectional transcription. Finally, genes associated with antisense transcription harbor specific H3K79me2 epigenetic marking and RNA polymerase II enrichment profiles linked to an intensified rate of early transcriptional elongation. Conclusions We concluded that promoters of a class of transcription regulators are characterized by a specialized transcriptional control mechanism, which is directly coupled to relaxed bidirectional transcription. PMID:24365181

2013-01-01

290

Quantitative Analysis of Transcript Accumulation  

E-print Network

Quantitative Analysis of Transcript Accumulation from Genes Duplicated by Polyploidy Using c to evaluate polyploid gene expression, but the methods most commonly used for transcript analysis--namely, RNA techniques such as cDNA-AFLP (7,8) can provide high- resolution transcript analysis with wide genome coverage

Wendel, Jonathan F.

291

New Family of Tungstate-Responsive Transcriptional Regulators in Sulfate-Reducing Bacteria  

PubMed Central

The trace elements molybdenum and tungsten are essential components of cofactors of many metalloenzymes. However, in sulfate-reducing bacteria, high concentrations of molybdate and tungstate oxyanions inhibit growth, thus requiring the tight regulation of their homeostasis. By a combination of bioinformatic and experimental techniques, we identified a novel regulator family, tungstate-responsive regulator (TunR), controlling the homeostasis of tungstate and molybdate in sulfate-reducing deltaproteobacteria. The effector-sensing domains of these regulators are similar to those of the known molybdate-responsive regulator ModE, while their DNA-binding domains are homologous to XerC/XerD site-specific recombinases. Using a comparative genomics approach, we identified DNA motifs and reconstructed regulons for 40 TunR family members. Positional analysis of TunR sites and putative promoters allowed us to classify most TunR proteins into two groups: (i) activators of modABC genes encoding a high-affinity molybdenum and tungsten transporting system and (ii) repressors of genes for toluene sulfonate uptake (TSUP) family transporters. The activation of modA and modBC genes by TunR in Desulfovibrio vulgaris Hildenborough was confirmed in vivo, and we discovered that the activation was diminished in the presence of tungstate. A predicted 30-bp TunR-binding motif was confirmed by in vitro binding assays. A novel TunR family of bacterial transcriptional factors controls tungstate and molybdate homeostasis in sulfate-reducing deltaproteobacteria. We proposed that TunR proteins participate in protection of the cells from the inhibition by these oxyanions. To our knowledge, this is a unique case of a family of bacterial transcriptional factors evolved from site-specific recombinases. PMID:23913324

Rajeev, Lara; Luning, Eric G.; Zane, Grant M.; Siddartha, Kavya; Rodionov, Dmitry A.; Dubchak, Inna; Arkin, Adam P.; Wall, Judy D.; Mukhopadhyay, Aindrila

2013-01-01

292

Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution  

PubMed Central

In most eukaryotes, including the majority of fungi, expression of sterol biosynthesis genes is regulated by Sterol-Regulatory Element Binding Proteins (SREBPs), which are basic helix-loop-helix transcription activators. However, in yeasts such as Saccharomyces cerevisiae and Candida albicans sterol synthesis is instead regulated by Upc2, an unrelated transcription factor with a Gal4-type zinc finger. The SREBPs in S. cerevisiae (Hms1) and C. albicans (Cph2) have lost a domain, are not major regulators of sterol synthesis, and instead regulate filamentous growth. We report here that rewiring of the sterol regulon, with Upc2 taking over from SREBP, likely occurred in the common ancestor of all Saccharomycotina. Yarrowia lipolytica, a deep-branching species, is the only genome known to contain intact and full-length orthologs of both SREBP (Sre1) and Upc2. Deleting YlUPC2, but not YlSRE1, confers susceptibility to azole drugs. Sterol levels are significantly reduced in the YlUPC2 deletion. RNA-seq analysis shows that hypoxic regulation of sterol synthesis genes in Y. lipolytica is predominantly mediated by Upc2. However, YlSre1 still retains a role in hypoxic regulation; growth of Y. lipolytica in hypoxic conditions is reduced in a Ylupc2 deletion and is abolished in a Ylsre1/Ylupc2 double deletion, and YlSre1 regulates sterol gene expression during hypoxia adaptation. We show that YlSRE1, and to a lesser extent YlUPC2, are required for switching from yeast to filamentous growth in hypoxia. Sre1 appears to have an ancestral role in the regulation of filamentation, which became decoupled from its role in sterol gene regulation by the arrival of Upc2 in the Saccharomycotina. PMID:24453983

Maguire, Sarah L.; Wang, Can; Holland, Linda M.; Brunel, François; Neuvéglise, Cécile; Nicaud, Jean-Marc; Zavrel, Martin; White, Theodore C.; Wolfe, Kenneth H.; Butler, Geraldine

2014-01-01

293

Mechanisms of transcriptional memory.  

PubMed

How can the same gene remember that it is 'off' in one cell lineage and 'on' in another? Studies of how homeotic genes are regulated in Drosophila melanogaster have uncovered a transcriptional maintenance system, encoded by the Polycomb and trithorax group genes, that preserves expression patterns across development. Here we try to formulate a broad framework for the types of molecular mechanism used by the Polycomb and trithorax proteins. PMID:11389465

Francis, N J; Kingston, R E

2001-06-01

294

The NifA-RpoN regulon of Mesorhizobium loti strain R7A and its symbiotic activation by a novel Lacl/GalR-family regulator  

SciTech Connect

Mesorhizobium loti is the microsymbiont of Lotus species, including the model legume L. japonicus. M. loti differs from other rhizobia in that it contains two copies of the key nitrogen fixation regulatory gene nifA, nifA1 and nifA2, both of which are located on the symbiosis island ICEMlSymR7A. M. loti R7A also contains two rpoN genes, rpoN1 located on the chromosome outside of ICEMlSymR7A and rpoN2 that is located on ICEMlSymR7A. The aims of the current work were to establish how nifA expression was activated in M. loti and to characterise the NifA-RpoN regulon. The nifA2 and rpoN2 genes were essential for nitrogen fixation whereas nifA1 and rpoN1 were dispensable. Expression of nifA2 was activated, possibly in response to an inositol derivative, by a novel regulator of the LacI/GalR family encoded by the fixV gene located upstream of nifA2. Other than the well-characterized nif/fix genes, most NifA2-regulated genes were not required for nitrogen fixation although they were strongly expressed in nodules. The NifA-regulated nifZ and fixU genes, along with nifQ which was not NifA-regulated, were required in M. loti for a fully effective symbiosis although they are not present in some other rhizobia. The NifA-regulated gene msi158 that encodes a porin was also required for a fully effective symbiosis. Several metabolic genes that lacked NifA-regulated promoters were strongly expressed in nodules in a NifA2-dependent manner but again mutants did not have an overt symbiotic phenotype. In summary, many genes encoded on ICEMlSymR7A were strongly expressed in nodules but not free-living rhizobia, but were not essential for symbiotic nitrogen fixation. It seems likely that some of these genes have functional homologues elsewhere in the genome and that bacteroid metabolism may be sufficiently plastic to adapt to loss of certain enzymatic functions.

Sullivan, John T. [University of Otago, Dunedin, New Zealand] [University of Otago, Dunedin, New Zealand; Brown, Steven D [ORNL] [ORNL; Ronson, Professor Clive William [University of Otago, Dunedin, New Zealand] [University of Otago, Dunedin, New Zealand

2013-01-01

295

Control of Transcriptional Elongation  

PubMed Central

Elongation is becoming increasingly recognized as a critically controlled step in transcriptional regulation. While traditional genetic and biochemical studies have identified major players of transcriptional elongation, our understanding of the importance and roles of these factors is evolving rapidly through the recent advances in genome-wide and single-molecule technologies. Here we focus on how elongation can modulate the transcriptional outcome through the rate-liming step of RNA polymerase II pausing near promoters, and how the participating factors were identified. Among the factors we describe are NELF and DSIF, the pausing factors, and P-TEFb, the key player in pause release. We also describe non-exclusive models for how pausing is achieved by making use of high resolution genome-wide mapping of paused Pol II relative to promoter elements and the first nucleosome. We also discuss Pol II elongation through the bodies of genes and the roles of FACT and Spt6, the factors that allow Pol II to move through nucleosomes. PMID:24050178

Kwak, Hojoong; Lis, John T.

2014-01-01

296

Transcriptional profiling of a Staphylococcus aureus clinical isolate and its isogenic agr and sarA mutants reveals global differences in comparison to the laboratory strain RN6390.  

PubMed

The production of Staphylococcus aureus virulence factors is under the control of complex regulatory circuits. Most studies aimed at defining these regulatory networks have focused on derivatives of the strain NCTC 8325, most notably RN6390. However, all NCTC 8325 derivatives, including RN6390, possess an 11 bp deletion in rsbU. This deletion renders NCTC 8325 derivatives naturally sigma-factor-B deficient. Recent studies have shown that RN6390 is also deficient, in comparison to clinical isolates, with respect to biofilm formation, a process which is important for both pathogenesis and antimicrobial resistance. Based on these considerations, the authors carried out genome-scale transcriptional profiling, comparing RN6390 with the virulent rsbU-positive clinical isolate UAMS-1. The results revealed significant genome-wide differences in expression patterns between RN6390 and UAMS-1, and suggested that the overall transcriptional profile of UAMS-1 is geared toward expression of factors that promote colonization and biofilm formation. In contrast, the transcriptional profile of RN6390 was heavily influenced by RNAIII expression, resulting in a phenotype characterized by increased production of exoproteins, and decreased capacity to form a biofilm. The greater influence of agr in RN6390 relative to UAMS-1 was also evident when the transcriptional profile of UAMS-1 was compared with that of its isogenic sarA and agr mutants. Specifically, the results indicate that, in contrast to NCTC 8325 derivatives, agr plays a limited role in overall regulation of gene expression in UAMS-1, when compared with sarA. Furthermore, by defining the sarA regulon in a biofilm-positive clinical isolate, and comparing the results with transcriptional profiling experiments defining biofilm-associated gene expression patterns in the same strain, the authors identified a sarA-regulated operon (alsSD) that is also induced in biofilms, and demonstrated that mutation of alsSD results in reduced capacity to form a biofilm. PMID:17005987

Cassat, James; Dunman, Paul M; Murphy, Ellen; Projan, Steven J; Beenken, Karen E; Palm, Katherine J; Yang, Soo-Jin; Rice, Kelly C; Bayles, Kenneth W; Smeltzer, Mark S

2006-10-01

297

Natural antisense transcripts.  

PubMed

Recent years have seen the increasing understanding of the crucial role of RNA in the functioning of the eukaryotic genome. These discoveries, fueled by the achievements of the FANTOM, and later GENCODE and ENCODE consortia, led to the recognition of the important regulatory roles of natural antisense transcripts (NATs) arising from what was previously thought to be 'junk DNA'. Roughly defined as non-coding regulatory RNA transcribed from the opposite strand of a coding gene locus, NATs are proving to be a heterogeneous group with high potential for therapeutic application. Here, we attempt to summarize the rapidly growing knowledge about this important non-coding RNA subclass. PMID:24838284

Khorkova, Olga; Myers, Amanda J; Hsiao, Jane; Wahlestedt, Claes

2014-09-15

298

Transients in chloroplast gene transcription  

SciTech Connect

Transcriptional regulation of chloroplast genes is demonstrated by Quantitative Polymerase Chain Reaction (qPCR). These genes encode apoproteins of the reaction centres of photosystem I and photosystem II. Their transcription is regulated by changes in wavelength of light selectively absorbed by photosystem I and photosystem II, and therefore by the redox state of an electron carrier located between the two photosystems. Chloroplast transcriptional redox regulation is shown to have greater amplitude, and the kinetics of transcriptional changes are more complex, than suggested by previous experiments using only DNA probes in Northern blot experiments. Redox effects on chloroplast transcription appear to be superimposed on an endogenous rhythm of mRNA abundance. The functional significance of these transients in chloroplast gene transcription is discussed.

Puthiyaveetil, Sujith [School of Biological and Chemical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom); Allen, John F. [School of Biological and Chemical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom)], E-mail: j.f.allen@qmul.ac.uk

2008-04-18

299

Transcriptional Regulation: a Genomic Overview  

PubMed Central

The availability of the Arabidopsis thaliana genome sequence allows a comprehensive analysis of transcriptional regulation in plants using novel genomic approaches and methodologies. Such a genomic view of transcription first necessitates the compilation of lists of elements. Transcription factors are the most numerous of the different types of proteins involved in transcription in eukaryotes, and the Arabidopsis genome codes for more than 1,500 of them, or approximately 6% of its total number of genes. A genome-wide comparison of transcription factors across the three eukaryotic kingdoms reveals the evolutionary generation of diversity in the components of the regulatory machinery of transcription. However, as illustrated by Arabidopsis, transcription in plants follows similar basic principles and logic to those in animals and fungi. A global view and understanding of transcription at a cellular and organismal level requires the characterization of the Arabidopsis transcriptome and promoterome, as well as of the interactome, the localizome, and the phenome of the proteins involved in transcription. PMID:22303220

Riechmann, José Luis

2002-01-01

300

Initiation of HIV Reverse Transcription  

PubMed Central

Reverse transcription of retroviral genomes into double stranded DNA is a key event for viral replication. The very first stage of HIV reverse transcription, the initiation step, involves viral and cellular partners that are selectively packaged into the viral particle, leading to an RNA/protein complex with very specific structural and functional features, some of which being, in the case of HIV-1, linked to particular isolates. Recent understanding of the tight spatio-temporal regulation of reverse transcription and its importance for viral infectivity further points toward reverse transcription and potentially its initiation step as an important drug target. PMID:21994608

Isel, Catherine; Ehresmann, Chantal; Marquet, Roland

2010-01-01

301

Trypanosome MKT1 and the RNA-binding protein ZC3H11: interactions and potential roles in post-transcriptional regulatory networks  

PubMed Central

The trypanosome zinc finger protein ZC3H11 binds to AU-rich elements in mRNAs. It is essential for survival of the mammalian-infective bloodstream form, where it stabilizes several mRNAs including some encoding chaperones, and is also required for stabilization of chaperone mRNAs during the heat-shock response in the vector-infective procyclic form. When ZC3H11 was artificially ‘tethered’ to a reporter mRNA in bloodstream forms it increased reporter expression. We here show that ZC3H11 interacts with trypanosome MKT1 and PBP1, and that domains required for both interactions are necessary for function in the bloodstream-form tethering assay. PBP1 interacts with MKT1, LSM12 and poly(A) binding protein, and localizes to granules during parasite starvation. All of these proteins are essential for bloodstream-form trypanosome survival and increase gene expression in the tethering assay. MKT1 is cytosolic and polysome associated. Using a yeast two-hybrid screen and tandem affinity purification we found that trypanosome MKT1 interacts with multiple RNA-binding proteins and other potential RNA regulators, placing it at the centre of a post-transcriptional regulatory network. A consensus interaction sequence, H(E/D/N/Q)PY, was identified. Recruitment of MKT1-containing regulatory complexes to mRNAs via sequence-specific mRNA-binding proteins could thus control several different post-transcriptional regulons. PMID:24470144

Singh, Aditi; Minia, Igor; Droll, Dorothea; Fadda, Abeer; Clayton, Christine; Erben, Esteban

2014-01-01

302

Identification of a DNA-binding site for the transcription factor Haa1, required for Saccharomyces cerevisiae response to acetic acid stress  

PubMed Central

The transcription factor Haa1 is the main player in reprogramming yeast genomic expression in response to acetic acid stress. Mapping of the promoter region of one of the Haa1-activated genes, TPO3, allowed the identification of an acetic acid responsive element (ACRE) to which Haa1 binds in vivo. The in silico analysis of the promoter regions of the genes of the Haa1-regulon led to the identification of an Haa1-responsive element (HRE) 5?-GNN(G/C)(A/C)(A/G)G(A/G/C)G-3?. Using surface plasmon resonance experiments and electrophoretic mobility shift assays it is demonstrated that Haa1 interacts with high affinity (KD of 2?nM) with the HRE motif present in the ACRE region of TPO3 promoter. No significant interaction was found between Haa1 and HRE motifs having adenine nucleotides at positions 6 and 8 (KD of 396 and 6780?nM, respectively) suggesting that Haa1p does not recognize these motifs in vivo. A lower affinity of Haa1 toward HRE motifs having mutations in the guanine nucleotides at position 7 and 9 (KD of 21 and 119?nM, respectively) was also observed. Altogether, the results obtained indicate that the minimal functional binding site of Haa1 is 5?-(G/C)(A/C)GG(G/C)G-3?. The Haa1-dependent transcriptional regulatory network active in yeast response to acetic acid stress is proposed. PMID:21586585

Mira, Nuno P.; Henriques, Sílvia F.; Keller, Greg; Teixeira, Miguel C.; Matos, Rute G.; Arraiano, Cecília M.; Winge, Dennis R.; Sá-Correia, Isabel

2011-01-01

303

Transcriptional profiling of Bordetella pertussis reveals requirement of RNA chaperone Hfq for Type III secretion system functionality.  

PubMed

Bordetella pertussis, the causative agent of human whooping cough (pertussis) produces a complex array of virulence factors in order to establish efficient infection in the host. The RNA chaperone Hfq and small regulatory RNAs are key players in posttranscriptional regulation in bacteria and have been shown to play an essential role in virulence of a broad spectrum of bacterial pathogens. This study represents the first attempt to characterize the Hfq regulon of the human pathogen B. pertussis under laboratory conditions as well as upon passage in the host and indicates that loss of Hfq has a profound effect on gene expression in B. pertussis. Comparative transcriptional profiling revealed that Hfq is required for expression of several virulence factors in B. pertussis cells including the Type III secretion system (T3SS). In striking contrast to the wt strain, T3SS did not become operational in the hfq mutant passaged either through mice or macrophages thereby proving that Hfq is required for the functionality of the B. pertussis T3SS. Likewise, expression of virulence factors vag8 and tcfA encoding autotransporter and tracheal colonization factor, respectively, was strongly reduced in the hfq mutant. Importantly, for the first time we demonstrate that B. pertussis T3SS can be activated upon contact with macrophage cells in vitro. PMID:25674816

Bibova, Ilona; Hot, David; Keidel, Kristina; Amman, Fabian; Slupek, Stephanie; Cerny, Ondrej; Gross, Roy; Vecerek, Branislav

2015-02-01

304

Isolation of fusions between the lac genes and several genes of the exu regulon: Analysis of their regulation, determination of the transcription direction of the uxaC-uxaA operon, in Escherichia coli K-12  

Microsoft Academic Search

Gene fusions between the lac structural genes and different genes of the hexuronate system were isolated by the two methods described by Casadaban (1976, 1979). Mud (Aprlac) mutants which have the lac genes fused to te regulatory region of exuT, uxaC, uxaA and uxaB genes were constructed. Separately, the lac genes carried by a ?plac-Mu hybrid phage were placed into

Nicole Hugouvieux-Cotte-Pattat; Janine Robert-Baudouy

1981-01-01

305

Dual Regulation of the Bacillus subtilis Regulon Comprising the lmrAB and yxaGH Operons and yxaF Gene by Two Transcriptional Repressors, LmrA and YxaF, in Response to Flavonoids  

Microsoft Academic Search

Bacillus subtilis LmrA is known to be a repressor that regulates the lmrAB and yxaGH operons; lmrB and yxaG encode a multidrug resistance pump and quercetin 2,3-dioxygenase, respectively. DNase I footprinting analysis revealed that LmrA and YxaF, which are paralogous to each other, bind specifically to almost the same cis sequences, LmrA\\/YxaF boxes, located in the promoter regions of the

Kazutake Hirooka; Satoshi Kunikane; Hiroshi Matsuoka; Ken-Ichi Yoshida; Kanako Kumamoto; Shigeo Tojo; Yasutaro Fujita

2007-01-01

306

Transcription Analysis of the Bacillus subtilis PucR Regulon and Identification of a cis-Acting Sequence Required for PucR-Regulated Expression of Genes Involved in Purine Catabolism  

Microsoft Academic Search

The PucR protein of Bacillus subtilis has previously been suggested to regulate the expression of 15 genes, pucABCDE, pucFG, pucH, pucI, pucJKLM, pucR, and gde, all of which encode proteins involved in purine catabolism. When cells are grown under nitrogen-limiting conditions, the expression of these genes is induced and intermediary compounds of the purine catabolic pathway affect this expression. By

Lars Beier; Per Nygaard; Hanne Jarmer; Hans H. Saxild

2002-01-01

307

Transcription in archaea: preparation of Methanocaldococcus jannaschii transcription machinery.  

PubMed

Archaeal RNA polymerase and general transcription factors are more closely related to those of eukaryotes than of bacteria. As such the study of transcription of archaea is important both in terms of examination of the evolution of the transcriptional machinery and as a simplified tool for eukaryotic transcription. In particular, the hyperthermophilic Methanocaldococcus jannaschii provides us with a fully recombinant RNA polymerase system allowing for much more detailed in vitro examination of the roles of different components during the transcription cycle than otherwise possible. The individual subunits of M. jannaschii enzyme are easily expressed and purified from heterologous expression systems. Forming functional RNA polymerase involves simply combining the different subunits under denaturing conditions and slowly removing the denaturant. PMID:25665571

Smollett, Katherine; Blombach, Fabian; Werner, Finn

2015-01-01

308

Genetic complementation in apicomplexan parasites Boris Striepen  

E-print Network

Plasmodium (malaria), Toxoplasma (AIDS-related enceph- alitis), Cryptosporidium, and Cyclospora (severe enteritis) as well as many parasites of substantial veterinary importance (Eimeria, Theileria, Sarcocystis

Logsdon Jr., John M.,

309

Glucocorticoid-regulated Transcription Factors  

Microsoft Academic Search

Glucocorticoids are the most effective antiinflammatory drugs used in the treatment of asthma. They act by binding to a specific receptor (GR) that, upon activation, translocates to the nucleus and either increases (transactivates) or decreases (transrepresses) gene expression. Inhibition of pro-inflammatory transcription factors such as activator protein (AP)-1, signal transducers and activators of transcription (STATs), nuclear factor of activated T

I. M. Adcock

2001-01-01

310

Antisense Transcription in the Mammalian Transcriptome  

Microsoft Academic Search

Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts

S. Katayama; Y. Tomaru; T. Kasukawa; K. Waki; M. Nakanishi; M. Nakamura; H. Nishida; C. C. Yap; M. Suzuki; J. Kawai; H. Suzuki; P. Carninci; Y. Hayashizaki; C. Wells; M. Frith; T. Ravasi; K. C. Pang; J. Hallinan; J. Mattick; D. A. Hume; L. Lipovich; S. Batalov; P. G. Engström; Y. Mizuno; M. A. Faghihi; A. Sandelin; A. M. Chalk; S. Mottagui-Tabar; Z. Liang; B. Lenhard; C. Wahlestedt

2005-01-01

311

The Transcriptional Activator LdtR from ‘Candidatus Liberibacter asiaticus’ Mediates Osmotic Stress Tolerance  

PubMed Central

The causal agent of Huanglongbing disease, ‘Candidatus Liberibacter asiaticus’, is a non-culturable, gram negative, phloem-limited ?-proteobacterium. Current methods to control the spread of this disease are still limited to the removal and destruction of infected trees. In this study, we identified and characterized a regulon from ‘Ca. L. asiaticus’ involved in cell wall remodeling, that contains a member of the MarR family of transcriptional regulators (ldtR), and a predicted L,D-transpeptidase (ldtP). In Sinorhizobium meliloti, mutation of ldtR resulted in morphological changes (shortened rod-type phenotype) and reduced tolerance to osmotic stress. A biochemical approach was taken to identify small molecules that modulate LdtR activity. The LdtR ligands identified by thermal shift assays were validated using DNA binding methods. The biological impact of LdtR inactivation by the small molecules was then examined in Sinorhizobium meliloti and Liberibacter crescens, where a shortened-rod phenotype was induced by growth in presence of the ligands. A new method was also developed to examine the effects of small molecules on the viability of ‘Ca. Liberibacter asiaticus’, using shoots from HLB-infected orange trees. Decreased expression of ldtRLas and ldtPLas was observed in samples taken from HLB-infected shoots after 6 h of incubation with the LdtR ligands. These results provide strong proof of concept for the use of small molecules that target LdtR, as a potential treatment option for Huanglongbing disease. PMID:24763829

Bojilova, Lora; Sarnegrim, Amanda; Tamayo, Cheila; Potts, Anastasia H.; Teplitski, Max; Folimonova, Svetlana Y.; Gonzalez, Claudio F.; Lorca, Graciela L.

2014-01-01

312

Transcription of Trypanosoma brucei maxicircles  

SciTech Connect

Trypanosoma brucei is a protozoan parasite which developmentally regulates mitochondrial activity. In the mammal T. brucei produces ATP entirely by glycolysis while cytochrome mediated respiration resumes in the life-stage in the midgut of the insect vector. Using quantitative S1 nuclease protection assays two types of regulation of the steady state levels of the mitochondrial transcripts were found. Transcription of cytochrome b, cytochrome oxidase, and the rRNA genes is repressed in early bloodstream developmental stages, undergoes dramatic activation in later bloodstream stages, and finally a lesser activation in the insect developmental stage. Transcription of NADH dehydrogenase genes, however, is unregulated. Mitochondrial transcripts with a 5' triphosphate terminus, representing the site of transcription initiation, were capped using guanylyl transferase. The in vitro capped RNA hybridized to only one of eight mitochondrial restriction fragments on a Southern blot, however, hybridization of Southern blots with RNA from ..cap alpha..-/sup 32/P-UTP pulsed mitochondria labelled all restriction fragments equally. These results suggest that each DNA strand has a single promoter which directs the transcription of a full-length RNA which is subsequently processed. Different mitochondrial genes, despite being expressed on the same precursor RNA molecule, are independently regulated by both transcription initiation and RNA processing.

Michelotti, E.F.; Hajduk, S.L.

1987-05-01

313

A transcript perspective on evolution.  

PubMed

Alternative splicing is now recognized as a major mechanism for transcriptome and proteome diversity in higher eukaryotes, yet its evolution is poorly understood. Most studies focus on the evolution of exons and introns at the gene level, while only few consider the evolution of transcripts. In this paper, we present a framework for transcript phylogenies where ancestral transcripts evolve along the gene tree by gains, losses, and mutation. We demonstrate the usefulness of our method on a set of 805 genes and two different topics. First, we improve a method for transcriptome reconstruction from ESTs (ASPic), then we study the evolution of function in transcripts. The use of transcript phylogenies allows us to double the precision of ASPic, whereas results on the functional study reveal that conserved transcripts are more likely to share protein domains than functional sites. These studies validate our framework for the study of evolution in large collections of organisms from the perspective of transcripts; for this purpose, we developed and provide a new tool, TrEvoR. PMID:24407299

Christinat, Yann; Moret, Bernard M E

2013-01-01

314

Physiological and Transcriptional Responses to High Concentrations of Lactic Acid in Anaerobic Chemostat Cultures of Saccharomyces cerevisiae?  

PubMed Central

Based on the high acid tolerance and the simple nutritional requirements of Saccharomyces cerevisiae, engineered strains of this yeast are considered biocatalysts for industrial production of high-purity undissociated lactic acid. However, high concentrations of lactic acid are toxic to S. cerevisiae, thus limiting its growth and product formation. Physiological and transcriptional responses to high concentrations of lactic acid were studied in anaerobic, glucose-limited chemostat cultures grown at different pH values and lactic acid concentrations, resulting in a 50% decrease in the biomass yield. At pH 5, the yield decrease was caused mostly by osmotically induced glycerol production and not by the classic weak-acid action, as was observed at pH 3. Cultures grown at pH 5 with 900 mM lactic acid revealed an upregulation of many genes involved in iron homeostasis, indicating that iron chelation occurred at high concentrations of dissociated lactic acid. Chemostat cultivation at pH 3 with 500 mM lactate, resulting in lower anion concentrations, showed an alleviation of this iron homeostasis response. Six of the 10 known targets of the transcriptional regulator Haa1p were strongly upregulated in lactate-challenged cultures at pH 3 but showed only moderate induction by high lactate concentrations at pH 5. Moreover, the haa1? mutant exhibited a growth defect at high lactic acid concentrations at pH 3. These results indicate that iron homeostasis plays a major role in the response of S. cerevisiae to high lactate concentrations, whereas the Haa1p regulon is involved primarily in the response to high concentrations of undissociated lactic acid. PMID:18676708

Abbott, Derek A.; Suir, Erwin; van Maris, Antonius J. A.; Pronk, Jack T.

2008-01-01

315

Transcriptional control of adipocyte formation  

PubMed Central

A detailed understanding of the processes governing adipose tissue formation will be instrumental in combating the obesity epidemic. Much progress has been made in the last two decades in defining transcriptional events controlling the differentiation of mesenchymal stem cells into adipocytes. A complex network of transcription factors and cell-cycle regulators, in concert with specific transcriptional coactivators and corepressors, respond to extracellular stimuli to activate or repress adipocyte differentiation. This review summarizes advances in this field, which constitute a framework for potential antiobesity strategies. PMID:17011499

Farmer, Stephen R.

2007-01-01

316

The grammar of transcriptional regulation.  

PubMed

Eukaryotes employ combinatorial strategies to generate a variety of expression patterns from a relatively small set of regulatory DNA elements. As in any other language, deciphering the mapping between DNA and expression requires an understanding of the set of rules that govern basic principles in transcriptional regulation, the functional elements involved, and the ways in which they combine to orchestrate a transcriptional output. Here, we review the current understanding of various grammatical rules, including the effect on expression of the number of transcription factor binding sites, their location, orientation, affinity and activity; co-association with different factors; and intrinsic nucleosome organization. We review different methods that are used to study the grammar of transcription regulation, highlight gaps in current understanding, and discuss how recent technological advances may be utilized to bridge them. PMID:24390306

Weingarten-Gabbay, Shira; Segal, Eran

2014-06-01

317

Analysis of transcriptional regulatory circuitry  

E-print Network

The research in this thesis has focused on the analysis of data from two types of microarray technologies with the goal of improving understanding of transcriptional regulatory circuitry in yeast. These microarray technologies, ...

Rinaldi, Nicola J., 1974-

2004-01-01

318

Glucocorticoids: Effects on Gene Transcription  

Microsoft Academic Search

The major antiinflammatory effects of glucocorticoids appear to be due largely to interaction between the activated glucocorticoid receptor and transcription factors, notably nuclear factor- B( NF-B) and activator protein-1, that mediate the expression of inflamma- tory genes. NF-B switches on inflammatory genes via a process involving recruitment of transcriptional coactivator proteins and changes in chromatin modifications such as histone acetylation.

Ian M. Adcock; Kaz Ito; Peter J. Barnes

2004-01-01

319

Transcriptional Regulation by P53  

PubMed Central

Inactivation of p53 is critical for the formation of most tumors. Illumination of the key function(s) of p53 protein in protecting cells from becoming cancerous is therefore a worthy goal. Arguably p53’s most important function is to act as a transcription factor that directly regulates perhaps several hundred of the cell’s RNA polymerase II (RNAP II)-transcribed genes, and indirectly regulates thousands of others. Indeed p53 is the most well studied mammalian transcription factor. The p53 tetramer binds to its response element where it can recruit diverse transcriptional coregulators such as histone modifying enzymes, chromatin remodeling factors, subunits of the mediator complex, and components of general transcription machinery and preinitiation complex (PIC) to modulate RNAPII activity at target loci (Laptenko and Prives 2006). The p53 transcriptional program is regulated in a stimulus-specific fashion (Murray-Zmijewski et al. 2008; Vousden and Prives 2009), whereby distinct subsets of p53 target genes are induced in response to different p53-activating agents, likely allowing cells to tailor their response to different types of stress. How p53 is able to discriminate between these different loci is the subject of intense research. Here, we describe key aspects of the fundamentals of p53-mediated transcriptional regulation and target gene promoter selectivity. PMID:20679336

Beckerman, Rachel; Prives, Carol

2010-01-01

320

Ordering Tax Transcripts A. Online Request  

E-print Network

Ordering Tax Transcripts A. Online Request Go to: www.irs.gov In the "Online Services" section, select "Order a Tax Return or Account Transcript". Click "Order a Transcript" Provide tax filer's SSN "Return Transcript" and the appropriate year in "Tax Year" field. If successfully linked, tax filers can

Wagner, Diane

321

Listeria monocytogenes grown at 7° C shows reduced acid survival and an altered transcriptional response to acid shock compared to L. monocytogenes grown at 37° C.  

PubMed

Survival of the food-borne pathogen Listeria monocytogenes in acidic environments (e.g., in the human stomach) is vital to its transmission. Refrigerated, ready-to-eat foods have been sources of listeriosis outbreaks. The purpose of this study was to determine whether growth at a low temperature (i.e., 7°C) affects L. monocytogenes survival or gene transcription after exposure to a simulated gastric environment (i.e., acid shock at 37°C). L. monocytogenes cells grown at 7°C were less resistant to artificial gastric fluid (AGF) or acidified brain heart infusion broth (ABHI) than bacteria grown at higher temperatures (i.e., 30°C or 37°C). For L. monocytogenes grown at 7°C, stationary-phase cells were more resistant to ABHI than log-phase cells, indicating that both temperature and growth phase affect acid survival. Microarray transcriptomic analysis revealed that the number and functional categories of genes differentially expressed after acid shock differed according to both growth temperature and growth phase. The acid response of L. monocytogenes grown to log phase at 37°C involved stress-related transcriptional regulators (i.e., ?(B), ?(H), CtsR, and HrcA), some of which have been implicated in adaptation to the intracellular environment. In contrast, for bacteria grown at 7°C to stationary phase, acid exposure did not result in differential expression of the stress regulons examined. However, two large operons encoding bacteriophage-like proteins were induced, suggesting lysogenic prophage induction. The adaptive transcriptional response observed in 37°C-grown cells was largely absent in 7°C-grown cells, suggesting that temperatures commonly encountered during food storage and distribution affect the ability of L. monocytogenes to survive gastric passage and ultimately cause disease. PMID:22447604

Ivy, R A; Wiedmann, M; Boor, K J

2012-06-01

322

Proteomic methodologies to study transcription factor function  

PubMed Central

Transcription factors regulate transcription by binding to regulatory regions of genes including the promoter. Few of the transcription factors are well characterized and few promoters have been described in detail. New methods have been developed to improve both transcription factor and promoter characterization, some of which are discussed here. Trapping methodology applicable to both individual transcription factors and intact transcription complexes are described, as well as 2-dimensional gel electrophoresis, Southwestern blotting, and basic liquid chromatography/tandem mass spectrometry methodology. These methods have proved useful in the study of transcriptional regulation. PMID:21938635

Jarrett, Harry W.

2012-01-01

323

Transcription factors, chromatin and cancer.  

PubMed

Transcription factors, chromatin and chromatin-modifying enzymes are key components in a complex network through which the genome interacts with its environment. For many transcription factors, binding motifs are found adjacent to the promoter regions of a large proportion of genes, requiring mechanisms that confer binding specificity in any given cell type. These include association of the factor with other proteins and packaging of DNA, as chromatin, at the binding sequence so as to inhibit or facilitate binding. Recent evidence suggests that specific post-translational modifications of the histones packaging promoter DNA can help guide transcription factors to selected sites. The enzymes that put such modifications in place are dependent on metabolic components (e.g. acetyl CoA, S-adenosyl methionine) and susceptible to inhibition or activation by environmental factors. Local patterns of histone modification can be altered or maintained through direct interaction between the transcription factor and histone modifying enzymes. The functional consequences of transcription factor binding are also dependent on protein modifying enzymes, particularly those that alter lysine methylation at selected residues. Remarkably, the role of these enzymes is not limited to promoter-proximal events, but can be linked to changes in the intranuclear location of target genes. In this review we describe results that begin to define how transcription factors, chromatin and environmental variables interact and how these interactions are subverted in cancer. We focus on the nuclear receptor family of transcription factors, where binding of ligands such as steroid hormones and dietary derived factors provides an extra level of environmental input. PMID:18804550

Thorne, James L; Campbell, Moray J; Turner, Bryan M

2009-01-01

324

Phylogenetic and Transcription Analysis of Chrysanthemum WRKY Transcription Factors  

PubMed Central

WRKY transcription factors are known to function in a number of plant processes. Here we have characterized 15 WRKY family genes of the important ornamental species chrysanthemum (Chrysanthemum morifolium). A total of 15 distinct sequences were isolated; initially internal fragments were amplified based on transcriptomic sequence, and then the full length cDNAs were obtained using RACE (rapid amplification of cDNA ends) PCR. The transcription of these 15 genes in response to a variety of phytohormone treatments and both biotic and abiotic stresses was characterized. Some of the genes behaved as would be predicted based on their homology with Arabidopsis thaliana WRKY genes, but others showed divergent behavior. PMID:25196345

Song, Aiping; Li, Peiling; Jiang, Jiafu; Chen, Sumei; Li, Huiyun; Zeng, Jun; Shao, Yafeng; Zhu, Lu; Zhang, Zhaohe; Chen, Fadi

2014-01-01

325

Creating small transcription activating RNAs.  

PubMed

We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

Chappell, James; Takahashi, Melissa K; Lucks, Julius B

2015-03-01

326

[Transcriptional control of ciliary genes].  

PubMed

Cilia are found in many eukaryotic species and share a common microtubule architecture that can nonetheless show very diverse features within one animal. The genesis of cilia and their diversity require the expression of different specific genes. At least two classes of transcription factors are involved in ciliogenesis: the RFX family, essential for the assembly of most cilia and the FOXJ1 transcription factors that are key regulators of motile cilia assembly. These two different families of transcription factors have both specific and common target genes and they can also cooperate for the formation of cilia. In collaboration with cell type specific factors, they also contribute to the specialisation of cilia. As a consequence, the identification of RFX and FOXJ1 target genes has emerged as an efficient strategy to identify novel ciliary genes, and in particular genes potentially implicated in ciliopathies. PMID:25388578

Vieillard, Jennifer; Jerber, Julie; Durand, Bénédicte

2014-11-01

327

KpnEF, a New Member of the Klebsiella pneumoniae Cell Envelope Stress Response Regulon, Is an SMR-Type Efflux Pump Involved in Broad-Spectrum Antimicrobial Resistance  

PubMed Central

Klebsiella pneumoniae has been frequently associated with nosocomial infections. Efflux systems are ubiquitous transporters that also function in drug resistance. Genome analysis of K. pneumoniae strain NTUH-K2044 revealed the presence of ?15 putative drug efflux systems. We discuss here for the first time the characterization of a putative SMR-type efflux pump, an ebrAB homolog (denoted here as kpnEF) with respect to Klebsiella physiology and the multidrug-resistant phenotype. Analysis of hypermucoviscosity revealed direct involvement of kpnEF in capsule synthesis. The ?kpnEF mutant displayed higher sensitivity to hyperosmotic (?2.8-fold) and high bile (?4.0-fold) concentrations. Mutation in kpnEF resulted in increased susceptibility to cefepime, ceftriaxone, colistin, erythromycin, rifampin, tetracycline, and streptomycin; mutated strains changed from being resistant to being susceptible, and the resistance was restored upon complementation. The ?kpnEF mutant displayed enhanced sensitivity toward structurally related compounds such as sodium dodecyl sulfate, deoxycholate, and dyes, including clinically relevant disinfectants such as benzalkonium chloride, chlorhexidine, and triclosan. The prevalence of kpnEF in clinical strains broadens the diversity of antibiotic resistance in K. pneumoniae. Experimental evidence of CpxR binding to the efflux pump promoter and quantification of its expression in a cpxAR mutant background demonstrated kpnEF to be a member of the Cpx regulon. This study helps to elucidate the unprecedented biological functions of the SMR-type efflux pump in Klebsiella spp. PMID:23836167

Rajamohan, Govindan

2013-01-01

328

KpnEF, a new member of the Klebsiella pneumoniae cell envelope stress response regulon, is an SMR-type efflux pump involved in broad-spectrum antimicrobial resistance.  

PubMed

Klebsiella pneumoniae has been frequently associated with nosocomial infections. Efflux systems are ubiquitous transporters that also function in drug resistance. Genome analysis of K. pneumoniae strain NTUH-K2044 revealed the presence of ?15 putative drug efflux systems. We discuss here for the first time the characterization of a putative SMR-type efflux pump, an ebrAB homolog (denoted here as kpnEF) with respect to Klebsiella physiology and the multidrug-resistant phenotype. Analysis of hypermucoviscosity revealed direct involvement of kpnEF in capsule synthesis. The ?kpnEF mutant displayed higher sensitivity to hyperosmotic (?2.8-fold) and high bile (?4.0-fold) concentrations. Mutation in kpnEF resulted in increased susceptibility to cefepime, ceftriaxone, colistin, erythromycin, rifampin, tetracycline, and streptomycin; mutated strains changed from being resistant to being susceptible, and the resistance was restored upon complementation. The ?kpnEF mutant displayed enhanced sensitivity toward structurally related compounds such as sodium dodecyl sulfate, deoxycholate, and dyes, including clinically relevant disinfectants such as benzalkonium chloride, chlorhexidine, and triclosan. The prevalence of kpnEF in clinical strains broadens the diversity of antibiotic resistance in K. pneumoniae. Experimental evidence of CpxR binding to the efflux pump promoter and quantification of its expression in a cpxAR mutant background demonstrated kpnEF to be a member of the Cpx regulon. This study helps to elucidate the unprecedented biological functions of the SMR-type efflux pump in Klebsiella spp. PMID:23836167

Srinivasan, Vijaya Bharathi; Rajamohan, Govindan

2013-09-01

329

Protein Modifications in Transcription Elongation  

PubMed Central

Posttranslational modifications (PTMs) of proteins play essential roles in regulating signaling, protein-protein modifications and subcellular localization. In this review, we focus on posttranslational modification of histones and RNA polymerase II (RNAPII) and their roles in gene transcription. A survey of the basic features of PTMs is provided followed by a more detailed account of how PTMs on histones and RNAPII regulate transcription in the model organism Saccharomyces cerevisiae. We emphasize the interconnections between histone and RNAPII PTMs and speculate upon the larger role PTMs have in regulating protein function in the cell. PMID:18718879

Fuchs, Stephen M.; Laribee, R. Nicholas; Strahl, Brian D.

2008-01-01

330

Evolution of Eukaryotic Transcription Circuits  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. The gradual modification of transcription circuits over evolutionary time scales is an important source of the diversity of life. Over the past decade, studies in animals have shown how seemingly small molecular changes in gene regulation can have large effects on morphology and physiology and how selective pressures can act on these changes. More recently, genome-wide studies, particularly those in single-cell yeasts, have uncovered evidence of extensive transcriptional rewiring, indicating that even closely related organisms regulate their genes using markedly different circuitries.

Brian B. Tuch (University of California; Department of Biochemistry and Biophysics and Department of Microbiology and Immunology)

2008-03-28

331

Transcription factor-based biosensor  

DOEpatents

The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

2013-10-08

332

Transcriptional networks in plant immunity.  

PubMed

932 I. 932 II. 933 III. 934 IV. 938 V. 941 943 References 943 SUMMARY: Next to numerous abiotic stresses, plants are constantly exposed to a variety of pathogens within their environment. Thus, their ability to survive and prosper during the course of evolution was strongly dependent on adapting efficient strategies to perceive and to respond to such potential threats. It is therefore not surprising that modern plants have a highly sophisticated immune repertoire consisting of diverse signal perception and intracellular signaling pathways. This signaling network is intricate and deeply interconnected, probably reflecting the diverse lifestyles and infection strategies used by the multitude of invading phytopathogens. Moreover it allows signal communication between developmental and defense programs thereby ensuring that plant growth and fitness are not significantly retarded. How plants integrate and prioritize the incoming signals and how this information is transduced to enable appropriate immune responses is currently a major research area. An important finding has been that pathogen-triggered cellular responses involve massive transcriptional reprogramming within the host. Additional key observations emerging from such studies are that transcription factors (TFs) are often sites of signal convergence and that signal-regulated TFs act in concert with other context-specific TFs and transcriptional co-regulators to establish sensory transcription regulatory networks required for plant immunity. PMID:25623163

Tsuda, Kenichi; Somssich, Imre E

2015-05-01

333

Automatic Transcription of Piano Music  

Microsoft Academic Search

A hidden Markov model approach to piano music transcription is presented. The main difficulty in applying traditional HMM tech- niques is the large number of chord hypotheses that must be consid- ered. We address this problem by using a trained likelihood model to generate reasonable hypotheses for each frame and construct the search graph out of these hypotheses. Results are

Christopher Raphael

2002-01-01

334

Transcriptional abnormalities in Huntington disease  

Microsoft Academic Search

Huntington disease (HD) is caused by a CAG repeat expansion that is translated into an abnormally long polyglutamine (polyQ) tract in the huntingtin protein. The precise mechanisms leading to neurodegeneration in HD have not been fully elucidated, but alterations in gene transcription could well be involved because the activities of several nuclear proteins are compromised by the polyQ mutation. Recent

Katharine L. Sugars; David C. Rubinsztein

2003-01-01

335

TRANSCRIPTIONAL RESPONSES TO INTERMITTENT HYPOXIA  

PubMed Central

Recurrent apneas are characterized by transient repetitive cessations of breathing (two breaths duration or longer) resulting in periodic decreases in arterial blood PO2 or chronic intermittent hypoxia (IH). Patients with recurrent apneas and experimental animals exposed to chronic IH exhibit cardio-respiratory morbidities. The purpose of this article is to highlight the current information on the transcriptional mechanisms associated with chronic IH. Studies on rodents and cell cultures have shown that IH activates a variety of transcription factors including the hypoxia-inducible factor-1 (HIF-1), c-fos (immediate early gene), nuclear factor of activated T-Cells (NFAT), and nuclear factor kB (NF-kB). The signaling pathways associated with transcriptional activation associated with IH differ from continuous hypoxia (CH). Compared to same duration and intensity of CH, IH is more potent in activating HIF-1 and c-fos and also results in long-lasting accumulation of HIF-1? and c-fos mRNA, a phenomenon that was not seen with CH. IH-evoked transcriptional activation by HIF-1, c-fos as well as the resulting activator protein-1 (AP-1) requires reactive oxygen species (ROS)-mediated signaling and involves complex feed-forward interactions between HIF-1 and ROS. Chronic IH evoked cardio-respiratory responses are absent in Hif-1a+/? mice, and hypertension elicited by chronic IH is absent in mice lacking NFAT3c. These studies indicate that cardio-respiratory responses to chronic IH depend on complex interactions between various transcription factors resulting in alterations in several down stream genes and their protein products. PMID:18692603

Nanduri, Jayasri; Yuan, Guoxiang; Kumar, Ganesh K.; Semenza, Gregg L.; Prabhakar, Nanduri R.

2012-01-01

336

Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing  

SciTech Connect

The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

1994-09-01

337

A Synthetic Biology Framework for Programming Eukaryotic Transcription Functions  

E-print Network

Eukaryotic transcription factors (TFs) perform complex and combinatorial functions within transcriptional networks. Here, we present a synthetic framework for systematically constructing eukaryotic transcription functions ...

Khalil, Ahmad S.

338

Transcriptional programs: Modelling higher order structure in transcriptional control  

E-print Network

is described in [1]; higher eukaryotes are known to use CRMs to integrate cellular signalling information [2]; the development of the anterior pituitary gland is reg- ulated by combinatorial actions of specific activating and restricting factors [3] which... MM: Transcriptional enhancers: Intelli- gent enhanceosomes or exible billboards? J Cell Biochem 2005, 94(5):890-898. 3. Simmons DM, Voss JW, Ingraham HA, Holloway JM, Broide RS, Rosenfeld MG, Swanson LW: Pituitary cell phenotypes involve cell...

Reid, John E; Ott, Sascha; Wernisch, Lorenz

2009-07-16

339

Identification of a p-Coumarate Degradation Regulon in Rhodopseudomonas palustris by Xpression, an Integrated Tool for Prokaryotic RNA-Seq Data Processing  

PubMed Central

High-throughput sequencing of cDNA prepared from RNA, an approach known as RNA-seq, is coming into increasing use as a method for transcriptome analysis. Despite its many advantages, widespread adoption of the technique has been hampered by a lack of easy-to-use, integrated, open-source tools for analyzing the nucleotide sequence data that are generated. Here we describe Xpression, an integrated tool for processing prokaryotic RNA-seq data. The tool is easy to use and is fully automated. It performs all essential processing tasks, including nucleotide sequence extraction, alignment, quantification, normalization, and visualization. Importantly, Xpression processes multiplexed and strand-specific nucleotide sequence data. It extracts and trims specific sequences from files and separately quantifies sense and antisense reads in the final results. Outputs from the tool can also be conveniently used in downstream analysis. In this paper, we show the utility of Xpression to process strand-specific RNA-seq data to identify genes regulated by CouR, a transcription factor that controls p-coumarate degradation by the bacterium Rhodopseudomonas palustris. PMID:22798355

Phattarasukol, Somsak; Radey, Matthew C.; Lappala, Colin R.; Oda, Yasuhiro; Hirakawa, Hidetada; Brittnacher, Mitchell J.

2012-01-01

340

The Transcriptional Landscape of the Mammalian Genome  

Microsoft Academic Search

This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins.

P. Carninci; T. Kasukawa; S. Katayama; J. Gough; M. C. Frith; N. Maeda; R. Oyama; T. Ravasi; B. Lenhard; C. Wells; R. Kodzius; K. Shimokawa; V. B. Bajic; S. E. Brenner; S. Batalov; A. R. R. Forrest; M. Zavolan; M. J. Davis; L. G. Wilming; V. Aidinis; J. E. Allen; A. Ambesi-Impiombato; R. Apweiler; R. N. Aturaliya; T. L. Bailey; M. Bansal; L. Baxter; K. W. Beisel; T. Bersano; H. Bono; A. M. Chalk; K. P. Chiu; V. Choudhary; A. Christoffels; D. R. Clutterbuck; M. L. Crowe; E. Dalla; B. P. Dalrymple; B. de Bono; G. Della Gatta; D. di Bernardo; T. Down; P. Engstrom; T. Fagiolini; G. Faulkner; C. F. Fletcher; T. Fukushima; M. Furuno; S. Futaki; M. Gariboldi; P. Georgii-Hemming; T. R. Gingeras; T. Gojobori; R. E. Green; S. Gustincich; M. Harbers; Y. Hayashi; T. K. Hensch; N. Hirokawa; D. Hill; L. Huminiecki; M. Iacono; K. Ikeo; A. Iwama; T. Ishikawa; M. Jakt; A. Kanapin; M. Katoh; Y. Kawasawa; J. Kelso; H. Kitamura; H. Kitano; G. Kollias; S. P. T. Krishnan; A. Kruger; S. K. Kummerfeld; I. V. Kurochkin; L. F. Lareau; D. Lazarevic; L. Lipovich; J. Liu; S. Liuni; S. McWilliam; M. Madan Babu; M. Madera; L. Marchionni; H. Matsuda; S. Matsuzawa; H. Miki; F. Mignone; S. Miyake; K. Morris; S. Mottagui-Tabar; N. Mulder; N. Nakano; H. Nakauchi; P. Ng; R. Nilsson; S. Nishiguchi; S. Nishikawa; F. Nori; O. Ohara; Y. Okazaki; V. Orlando; K. C. Pang; W. J. Pavan; G. Pavesi; G. Pesole; N. Petrovsky; S. Piazza; J. Reed; J. F. Reid; B. Z. Ring; M. Ringwald; B. Rost; Y. Ruan; S. L. Salzberg; A. Sandelin; C. Schneider; C. Schönbach; K. Sekiguchi; C. A. M. Semple; S. Seno; L. Sessa; Y. Sheng; Y. Shibata; H. Shimada; K. Shimada; D. Silva; B. Sinclair; S. Sperling; E. Stupka; K. Sugiura; R. Sultana; Y. Takenaka; K. Taki; K. Tammoja; S. L. Tan; S. Tang; M. S. Taylor; J. Tegner; S. A. Teichmann; H. R. Ueda; E. van Nimwegen; R. Verardo; C. L. Wei; K. Yagi; H. Yamanishi; E. Zabarovsky; S. Zhu; A. Zimmer; W. Hide; C. Bult; S. M. Grimmond; R. D. Teasdale; E. T. Liu; V. Brusic; J. Quackenbush; C. Wahlestedt; J. S. Mattick; D. A. Hume; C. Kai; D. Sasaki; Y. Tomaru; S. Fukuda; M. Kanamori-Katayama; M. Suzuki; J. Aoki; T. Arakawa; J. Iida; K. Imamura; M. Itoh; T. Kato; H. Kawaji; N. Kawagashira; T. Kawashima; M. Kojima; S. Kondo; H. Konno; K. Nakano; N. Ninomiya; T. Nishio; M. Okada; C. Plessy; K. Shibata; T. Shiraki; S. Suzuki; M. Tagami; K. Waki; A. Watahiki; Y. Okamura-Oho; H. Suzuki

2005-01-01

341

Transcription factors modulate c-Fos transcriptional bursts.  

PubMed

Transcription is a stochastic process occurring mostly in episodic bursts. Although the local chromatin environment is known to influence the bursting behavior on long timescales, the impact of transcription factors (TFs)--especially in rapidly inducible systems--is largely unknown. Using fluorescence in situ hybridization and computational models, we quantified the transcriptional activity of the proto-oncogene c-Fos with single mRNA accuracy at individual endogenous alleles. We showed that, during MAPK induction, the TF concentration modulates the burst frequency of c-Fos, whereas other bursting parameters remain mostly unchanged. By using synthetic TFs with TALE DNA-binding domains, we systematically altered different aspects of these bursts. Specifically, we linked the polymerase initiation frequency to the strength of the transactivation domain and the burst duration to the TF lifetime on the promoter. Our results show how TFs and promoter binding domains collectively act to regulate different bursting parameters, offering a vast, evolutionarily tunable regulatory range for individual genes. PMID:24981864

Senecal, Adrien; Munsky, Brian; Proux, Florence; Ly, Nathalie; Braye, Floriane E; Zimmer, Christophe; Mueller, Florian; Darzacq, Xavier

2014-07-10

342

Electronic Transcripts: Past, Present, and Future  

ERIC Educational Resources Information Center

Electronic transcripts are no longer a concept awaiting definition. They are here to stay. Although paper transcripts remain the standard--at least in terms of volume--an ever-increasing number and eventual majority of students and alumni will expect if not require electronic transcripts. College registrars and admissions officers' obligation to…

Harris, Sarah; Hannah, Andrew; Stones, Dave; Morley, Robert

2011-01-01

343

Oracle Analysis of Sparse Automatic Music Transcription  

E-print Network

Oracle Analysis of Sparse Automatic Music Transcription Ken O'Hanlon , Hidehisa Nagano , and Mark, and further analysis of the system is given by considering an oracle transcription, derived from the ground squares analysis, an oracle transcription can be derived by decomposing the signal at each point in time

Plumbley, Mark

344

Transcriptional Control in the Segmentation Gene Network  

E-print Network

that computational methods are a powerful complement to experimental approaches in the analysis of transcriptionTranscriptional Control in the Segmentation Gene Network of Drosophila Mark D. Schroeder1 of maternal and zygotic factors that generate, by transcriptional (cross-) regulation, expression patterns

Siggia, Eric

345

Transcriptional Regulation and its Misregulation in Disease  

PubMed Central

The gene expression programs that establish and maintain specific cell states in humans are controlled by thousands of transcription factors, cofactors and chromatin regulators. Misregulation of these gene expression programs can cause a broad range of diseases. Here we review recent advances in our understanding of transcriptional regulation and discuss how these have provided new insights into transcriptional misregulation in disease. PMID:23498934

Lee, Tong Ihn; Young, Richard A.

2013-01-01

346

The significance of alternative transcripts for Caenorhabditis elegans transcription factor genes, based on expression pattern analysis  

PubMed Central

Background Sequence-specific DNA-binding proteins, with their paramount importance in the regulation of expression of the genetic material, are encoded by approximately 5% of the genes in an animal’s genome. But it is unclear to what extent alternative transcripts from these genes may further increase the complexity of the transcription factor complement. Results Of the 938 potential C. elegans transcription factor genes, 197 were annotated in WormBase as encoding at least two distinct isoforms. Evaluation of prior evidence identified, with different levels of confidence, 50 genes with alternative transcript starts, 23 with alternative transcript ends, 35 with alternative splicing and 34 with alternative transcripts generated by a combination of mechanisms, leaving 55 that were discounted. Expression patterns were determined for transcripts for a sample of 29 transcription factor genes, concentrating on those with alternative transcript starts for which the evidence was strongest. Seamless fosmid recombineering was used to generate reporter gene fusions with minimal modification to assay expression of specific transcripts while maintaining the broad genomic DNA context and alternative transcript production. Alternative transcription factor gene transcripts were typically expressed with identical or substantially overlapping distributions rather than in distinct domains. Conclusions Increasingly sensitive sequencing technologies will reveal rare transcripts but many of these are clearly non-productive. The majority of the transcription factor gene alternative transcripts that are productive may represent tolerable noise rather than encoding functionally distinct isoforms. PMID:23586691

2013-01-01

347

Nascent transcript-binding protein of the pea chloroplast transcriptionally active chromosome  

Microsoft Academic Search

This study describes the nascent RNA-binding protein of the pea chloroplast transcriptional complex. The protein has been identified by photoaffinity labelling of the transcriptionally active chromosome (TAC) which utilizes the endogenous plastid DNA as template. UV irradiation of lysed chloroplast or the isolated TAC under conditions optimized for transcription photocross-links nascent radiolabelled transcripts (up to 250 nucleotides in length) to

Sujata Lakhani; Navin C. Khanna; Krishna K. Tewari

1993-01-01

348

Transcription by RNA polymerase II: initiator-directed formation of transcription-competent complexes  

Microsoft Academic Search

Studies of transcription by RNA polymer- ase II have revealed two promoter elements, the TATA motif and the initiator (Inr), capable of directing specific transcription initiation. Although binding to the TATA motif by one of the components of the transcription machinery has been shown to be the initial recognition step in transcription complex formation, many promoters that lack a traditional

LISA WEIS; DANNY REINBERG

1992-01-01

349

Transcriptional regulation of wound inflammation.  

PubMed

The attraction and activation of immune cells is an important response of the skin to injury and allows an efficient defense against invading pathogens. In addition, immune cells fulfill various functions that are important for the repair process. An exaggerated inflammatory response, however, is a hallmark of chronic, non-healing wounds. Therefore, it is essential to strictly control and coordinate the levels and activities of various immune cells in normal and wounded skin. Recent studies provided insight into the molecular mechanisms underlying the inflammatory response after wounding, and various transcriptional regulators involved in this process have been identified. This review summarizes our current knowledge on the function of different transcription factors in wound repair, with particular emphasis on proteins with a documented role in the control of wound inflammation. PMID:24556599

Haertel, Eric; Werner, Sabine; Schäfer, Matthias

2014-08-01

350

Subventricular Zone Microglia Transcriptional Networks  

PubMed Central

Microglia play an important role in inflammatory diseases of the central nervous system. There is evidence of microglial diversity with distinct phenotypes exhibiting either neuroprotection and repair or neurotoxicity. However the precise molecular mechanisms underlying this diversity are still unknown. Using a model of experimental autoimmune encephalomyelitis (EAE) we performed transcriptional profiling of isolated subventricular zone microglia from the acute and chronic disease phases of EAE. We found that microglia exhibit disease phase specific gene expression signatures, that correspond to unique gene ontology functions and genomic networks. Our data demonstrate for the first time, distinct transcriptional networks of microglia activation in vivo, that suggests a role as mediators of injury or repair. PMID:21074605

Starossom, Sarah C.; Imitola, Jaime; Wang, Yue; Cao, Li; Khoury, Samia J.

2010-01-01

351

Papillomavirus transcripts and posttranscriptional regulation.  

PubMed

Papillomavirus gene expression is strictly linked to the differentiation state of the infected cell and is highly regulated at the level of transcription and RNA processing. All papillomaviruses make extensive use of alternative mRNA polyadenylation and splicing to control gene expression. This chapter contains a compilation of all known alternatively spliced papillomavirus mRNAs and it summarizes our current knowledge of viral RNA elements, and viral and cellular factors that control papillomavirus mRNA processing. PMID:23706315

Schwartz, Stefan

2013-10-01

352

Transcriptional Control of Hepatocyte Differentiation  

Microsoft Academic Search

\\u000a The unique gene expression that defines the hepatocyte conforms to a set of general regulatory principles. The genome encodes\\u000a the programs of mature gene expression and of the preceding developmental stages. Transcription factors execute these programs\\u000a by binding to specific DNA sequence motifs grouped together as promoters and enhancers. Expression of each gene therefore\\u000a reflects the synergistic integration of separate

Joseph Locker

353

Transcriptional Mechanisms Underlying Lymphocyte Tolerance  

Microsoft Academic Search

In lymphocytes, integration of Ca2+ and other signaling pathways results in productive activation, while unopposed Ca2+ signaling leads to tolerance or anergy. We show that the Ca2+-regulated transcription factor NFAT has an integral role in both aspects of lymphocyte function. Ca2+\\/calcineurin signaling induces a limited set of anergy-associated genes, distinct from genes induced in the productive immune response; these genes

Fernando Macián; Francisco Garc??a-Cózar; Sin-Hyeog Im; Heidi F. Horton; Michael C. Byrne; Anjana Rao

2002-01-01

354

Transcription factors IIS and IIF enhance transcription efficiency by differentially modifying RNA polymerase pausing dynamics  

PubMed Central

Transcription factors IIS (TFIIS) and IIF (TFIIF) are known to stimulate transcription elongation. Here, we use a single-molecule transcription elongation assay to study the effects of both factors. We find that these transcription factors enhance overall transcription elongation by reducing the lifetime of transcriptional pauses and that TFIIF also decreases the probability of pause entry. Furthermore, we observe that both factors enhance the processivity of RNA polymerase II through the nucleosomal barrier. The effects of TFIIS and TFIIF are quantitatively described using the linear Brownian ratchet kinetic model for transcription elongation and the backtracking model for transcriptional pauses, modified to account for the effects of the transcription factors. Our findings help elucidate the molecular mechanisms by which transcription factors modulate gene expression. PMID:24550488

Ishibashi, Toyotaka; Dangkulwanich, Manchuta; Coello, Yves; Lionberger, Troy A.; Lubkowska, Lucyna; Ponticelli, Alfred S.; Kashlev, Mikhail; Bustamante, Carlos

2014-01-01

355

Activation of the Cpx regulon destabilizes the F plasmid transfer activator, TraJ, via the HslVU protease in Escherichia coli.  

PubMed

The Escherichia coli CpxAR two-component signal transduction system senses and responds to extracytoplasmic stress. The cpxA101* allele was previously found to reduce F plasmid conjugation by post-transcriptional inactivation of the positive activator TraJ. Microarray analysis revealed upregulation of the protease-chaperone pair, HslVU, which was shown to degrade TraJ in an E. coli C600 cpxA101* background. Double mutants of cpxA101* and hslV or hslU restored TraJ and F conjugation to wild-type levels. The constitutive overexpression of nlpE, an outer membrane lipoprotein that induces the Cpx stress response, also led to HslVU-mediated degradation of TraJ and repression of F transfer. However, Cpx-mediated TraJ degradation appears to be growth phase-dependent, as induction of nlpE in mid-log phase cells did not appreciably alter TraJ levels. Further, His6-TraJ was sensitive to HslVU degradation in vitro only when it was purified from cells overexpressing nlpE. Thus, TraJ appears to become resistant to HslVU during normal growth, with this resistance mapping to the F transfer region. Extracytoplasmic stress prevents this modification of TraJ, leaving it susceptible to HslVU. Thus, the CpxAR stress response indirectly controls the synthesis of the F mating apparatus, a complex transenvelope type IV secretion system, by degrading TraJ. PMID:18069965

Lau-Wong, Isabella C; Locke, Troy; Ellison, Michael J; Raivio, Tracy L; Frost, Laura S

2008-02-01

356

The RpoT Regulon of Pseudomonas putida DOT-T1E and Its Role in Stress Endurance against Solvents?  

PubMed Central

Pseudomonas putida encodes 20 extracytoplasmic sigma factors (ECFs). In this study, we show that one of these ECFs, known as ECF-Pp12 (PP3006), plays a role in tolerance of toluene and other organic solvents. Based on this finding, we have called the gene that encodes this new ECF rpoT. The rpoT gene forms an operon with the preceding gene and with the gene located downstream. The translated gene product of the open reading frame PP3005 is an inner membrane protein, whereas the PP3007 protein is periplasmic. A nonpolar ?rpoT mutant was generated by homologous recombination, and survival of the mutant was tested under various stress conditions. The mutant strain was hypersensitive to toluene and other solvents but just as tolerant as the wild type of stress imposed by heat, antibiotics, NaCl, paraquat, sodium dodecyl sulfate, H2O2, and benzoate. In the ?rpoT mutant background, expression of around 50 transcriptional units was affected: 31 cistrons were upregulated, and 23 cistrons were downregulated. This indicates that about 1% of all P. putida genes are under the direct or indirect influence of RpoT. The rpoT gene controls the expression of a number of membrane proteins, including components of the respiratory chains, porins, transporters, and multidrug efflux pumps. Hypersensitivity of the P. putida RpoT-deficient mutant to organic solvents can be attributed to the fact that in the ?rpoT strain, expression of the toluene efflux pump ttgGHI genes is severalfold lower than in the parental strain. PMID:17071759

Duque, Estrella; Rodríguez-Herva, José-Juan; de la Torre, Jesús; Domínguez-Cuevas, Patricia; Muñoz-Rojas, Jesús; Ramos, Juan-Luis

2007-01-01

357

Evaluation of the potential of alkylresorcinols as superoxide anion scavengers and sox-regulon modulators using nitroblue tetrazolium and bioluminescent cell-based assays.  

PubMed

The antioxidant activities of five alkylresorcinol (AR) homologs with alkyl chains of 1, 3, 5 6 and 12 carbon atoms were studied using molecular and cellular assays for superoxide anions ([Formula: see text]). The effect of ARs as superoxide anion scavengers was assessed using the photochemical reaction of spontaneous photo-reduced flavin re-oxidation. In this system, ARs reaction with [Formula: see text] produced dye derivatives, as C6- and C12-AR prevented the [Formula: see text]-induced conversion of nitroblue tetrazolium into formazan in AR-containing mixtures. The influence of ARs on soxS gene expression and bacterial cell viability was studied with the luminescent Escherichia coli K12 MG1655 psoxS'::luxCDABE-Amp(R) strain, showing low basal light emission. This increased significantly during paraquatinduced oxidative stress as a consequence of the simultaneous transcription of soxS-gene and lux-gene fusion. ARs with alkyl chains containing 5-12 carbon atoms at concentrations of 0.1-1.0 ?M weakly induced soxS-gene expression, whereas 1-10 mM repressed it. This respectively increased or decreased the bacterial cell resistance to [Formula: see text]-related oxidative stress. AR derivatives lost their protective activity from reactions with superoxide anions, which required increased soxS gene expression for cell viability. These results show the dual nature of ARs, which possess direct antioxidant properties and the ability to indirectly regulate the activity of cellular antioxidative defense mechanisms. PMID:25481248

Gryazeva, Irina V; Davydova, Olga K; Deryabin, Dmitrii G

2014-12-01

358

Transcriptional Profile of Mycobacterium tuberculosis Replicating in Type II Alveolar Epithelial Cells  

PubMed Central

Mycobacterium tuberculosis (M. tb) infection is initiated by the few bacilli inhaled into the alveolus. Studies in lungs of aerosol-infected mice provided evidence for extensive replication of M. tb in non-migrating, non-antigen-presenting cells in the alveoli during the first 2–3 weeks post-infection. Alveoli are lined by type II and type I alveolar epithelial cells (AEC) which outnumber alveolar macrophages by several hundred-fold. M. tb DNA and viable M. tb have been demonstrated in AEC and other non-macrophage cells of the kidney, liver, and spleen in autopsied tissues from latently-infected subjects from TB-endemic regions indicating systemic bacterial dissemination during primary infection. M. tb have also been demonstrated to replicate rapidly in A549 cells (type II AEC line) and acquire increased invasiveness for endothelial cells. Together, these results suggest that AEC could provide an important niche for bacterial expansion and development of a phenotype that promotes dissemination during primary infection. In the current studies, we have compared the transcriptional profile of M. tb replicating intracellularly in A549 cells to that of M. tb replicating in laboratory broth, by microarray analysis. Genes significantly upregulated during intracellular residence were consistent with an active, replicative, metabolic, and aerobic state, as were genes for tryptophan synthesis and for increased virulence (ESAT-6, and ESAT-6-like genes, esxH, esxJ, esxK, esxP, and esxW). In contrast, significant downregulation of the DevR (DosR) regulon and several hypoxia-induced genes was observed. Stress response genes were either not differentially expressed or were downregulated with the exception of the heat shock response and those induced by low pH. The intra-type II AEC M. tb transcriptome strongly suggests that AEC could provide a safe haven in which M. tb can expand dramatically and disseminate from the lung prior to the elicitation of adaptive immune responses. PMID:25844539

Peng, Zhengyu; Laal, Suman

2015-01-01

359

University of Toronto Transcript Policy See also University Guidelines on Academic Transcript Notations; University Assessment and Grading Practices  

E-print Network

of Toronto Transcript Policy See also University Guidelines on Academic Transcript Notations; University required to interpret the transcript. Scope University of Toronto consolidated transcripts are limited; University of Toronto Transcript Policy Access to Official Transcripts Subject to a fee, students may request

Boonstra, Rudy

360

Regulating Inducible Transcription Through Controlled Localization  

NSDL National Science Digital Library

Inducible transcription factors are key targets of many signaling pathways. Transcription of target genes by inducible transcription factors is regulated by numerous mechanisms that affect access to and affinity for target genes, interaction with coactivators, or transcriptional activity itself. Because of cytoplasmic sequestration, a subset of transcription factors are maintained inactive in unstimulated cells until the proper inducing stimulus is provided. The mechanism of cytoplasmic sequestration was originally thought to involve the masking of nuclear localization signals (NLSs) on transcription factors. However, recent reports suggest that such a static model of cytoplasmic retention is perhaps far too simple, and that these inducible transcription factors instead constantly shuttle between the cytoplasm and the nucleus. Furthermore, it has been shown that the sequestration of inducible transcription factors can be accomplished through multiple mechanisms in addition to masking of the NLSs. In this review, we discuss a few signaling pathways that illustrate mechanisms of controlling the localization of inducible transcription factors and provide a more encompassing model to explain how inducible transcription factors may be regulated by cytoplasmic sequestration.

Elizabeth C. Ziegler (Yale University School of Medicine; Section of Immunobiology and Department of Molecular Biophysics and Biochemistry REV)

2005-05-17

361

TRANSCRIPTION: Histones Face the FACT  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Given the "beads-on-a-string" nature of chromatin, scientists have long pondered how the large RNA polymerase II complex accesses the DNA during transcription. In his Perspective, Svejstrup discusses new work from three groups (Belotserkovskaya et al., Kaplan et al., and Saunders et al.) revealing that two elongation factors, Spt6 and FACT, are responsible for displacing histone proteins ahead of the polymerase and redepositing them on the DNA in its wake.

Jesper Q. Svejstrup (Cancer Research, London Research Institute, Clare Hall Laboratories; )

2003-08-22

362

Transcriptional targets in adipocyte biology  

PubMed Central

The global burden of metabolic disease demands that we develop new therapeutic strategies. Many of these approaches may center on manipulating the behavior of adipocytes, which contribute directly and indirectly to a host of disease processes including obesity and type 2 diabetes. One way to achieve this goal will be to alter key transcriptional pathways in fat cells, such as those regulating glucose uptake, lipid handling, or adipokine secretion. In this review we look at what is known about how adipocytes govern their physiology at the gene expression level, and we discuss novel ways that we can accelerate our understanding of this area. PMID:19534570

Rosen, Evan; Eguchi, Jun; Xu, Zhao

2010-01-01

363

Transcriptional factors, Mafs and their biological roles  

PubMed Central

The Maf family of transcription factors is characterized by a typical bZip structure; these transcription factors act as important regulators of the development and differentiation of many organs and tissues, including the kidney. The Maf family consists of two subgroups that are characterized according to their structure: large Maf transcription factors and small Maf transcription factors. The large Maf subgroup consists of four proteins, designated as MAFA, MAFB, c-MAF and neural retina-specific leucine zipper. In particular, MAFA is a distinct molecule that has been attracting the attention of researchers because it acts as a strong transactivator of insulin, suggesting that Maf transcription factors are likely to be involved in systemic energy homeostasis. In this review, we focused on the regulation of glucose/energy balance by Maf transcription factors in various organs. PMID:25685288

Tsuchiya, Mariko; Misaka, Ryoichi; Nitta, Kosaku; Tsuchiya, Ken

2015-01-01

364

Transcriptional control of plant defence responses.  

PubMed

Mounting of efficient plant defence responses depends on the ability to trigger a rapid defence reaction after recognition of the invading microbe. Activation of plant resistance is achieved by modulation of the activity of multiple transcriptional regulators, both DNA-binding transcription factors and their regulatory proteins, that are able to reprogram transcription in the plant cell towards the activation of defence signalling. Here we provide an overview of recent developments on the transcriptional control of plant defence responses and discuss defence-related hormone signalling, the role of WRKY transcription factors during the regulation of plant responses to pathogens, nuclear functions of plant immune receptor proteins, as well as varied ways by which microbial effectors subvert plant transcriptional reprogramming to promote disease. PMID:24840291

Buscaill, Pierre; Rivas, Susana

2014-08-01

365

Gene transcription and electromagnetic fields  

SciTech Connect

Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

Henderson, A.S.

1992-01-01

366

Genetic determinants of neuroglobin transcription  

PubMed Central

Neuroglobin (NGB) is a neuron specific vertebrate globin shown to protect against hypoxia, ischemia, oxidative stress and the toxic effects of Amyloid-beta. Following on our and others' results highlighting the importance of NGB expression in disease we searched for genetic determinants of its expression. We found that a microRNA expressed with the NGB transcript shows significant target enrichments in the angiogenesis pathway and the Alzheimer disease / presenilin pathway. Using reporter constructs we identified potential promoter/enhancer elements between the transcription start site and 1142 bp upstream. Using 184 post mortem temporal lobe samples we replicated the reported negative effect of age, and after genotyping tagging SNPs we found one (rs981471) showing a significant correlation with the gene’s expression and another (rs8014408) showing an interaction with age, the rare C allele being correlated with higher expression and faster decline. The two SNPs are towards the 3' end of NGB within the same LD block, 52 Kb apart and modestly correlated (r2 = 0.5). Next generation sequencing of the same 184 temporal lobe samples and 79 confirmed AD patients across the entire gene region (including >12 Kb on the 3’ and 5’ flank) revealed limited coding variation, suggesting purifying selection of NGB, but did not identify regulatory or disease associated rare variants. A dinucleotide repeat in intron 1 with extensive evidence of functionality showed interesting but inconclusive results, as it was not amenable to further molecular analysis. PMID:24362753

Wang, R; Halper-Stromberg, E; Szymanski-Pierce, M; Bassett, SS; Avramopoulos, D

2014-01-01

367

Computational inference of transcriptional regulatory networks from expression proling and transcription  

E-print Network

and promoter sequence analysis. CARRIE uses sources of data to identify the transcription factors (TFsComputational inference of transcriptional regulatory networks from expression pro®ling and transcription factor binding site identi®cation Peter M. Haverty1 , Ulla Hansen1,2 and Zhiping Weng1,3,* 1

Babu, M. Madan

368

The role of ETS transcription factors in transcription and development of mouse preimplantation embryos  

Microsoft Academic Search

Embryonic transcription is a crucial process for the creation of new life. To clarify the mechanism of embryonic transcription, we investigated the expression and function of the erythroblast transformation specific (ETS) domain containing transcription factors (TFs) during preimplantation development in mice. The expression levels of several ETS TFs, i.e., etsrp71, elf3, and spic, increased after fertilization and remained at a

Shun-ichiro Kageyama; Honglin Liu; Masao Nagata; Fugaku Aoki

2006-01-01

369

Balanced Branching in Transcription Termination  

NASA Technical Reports Server (NTRS)

The theory of stochastic transcription termination based on free-energy competition requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle but many troubling inconsistencies, most notably anomalous memory effects. These suggest that termination has a deterministic component and may conceivably be not stochastic at all. We find that a key experiment by Wilson and von Hippel allegedly refuting deterministic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

Harrington, K. J.; Laughlin, R. B.; Liang, S.

2001-01-01

370

A Discriminative Model for Polyphonic Piano Transcription  

Microsoft Academic Search

In this paper we present a discriminative model for polyphonic piano transcription. Support Vector Machines trained on spectral features are used to classify frame-level note instances. The classier outputs are tem- porally constrained via hidden Markov models, and the proposed system is used to transcribe both synthesized and real piano recordings. A frame- level transcription accuracy of 68% was achieved

Graham E. Poliner; Daniel P. W. Ellis

2006-01-01

371

A Discriminative Model for Polyphonic Piano Transcription  

E-print Network

A Discriminative Model for Polyphonic Piano Transcription Graham E. Poliner and Daniel P.W. Ellis,dpwe}@ee.columbia.edu June 17, 2006 Abstract In this paper we present a discriminative model for polyphonic piano system is used to transcribe both synthesized and real piano recordings. A frame- level transcription

Ellis, Dan

372

39 CFR 957.19 - Transcript.  

Code of Federal Regulations, 2013 CFR

...payment of a reasonable price therefor. Copies of parts of the official record other than the transcript may be obtained from the librarian of the Postal Service or the Recorder. (b) Changes in the official transcript may be made only when they...

2013-07-01

373

39 CFR 957.19 - Transcript.  

Code of Federal Regulations, 2014 CFR

...payment of a reasonable price therefor. Copies of parts of the official record other than the transcript may be obtained from the librarian of the Postal Service or the Recorder. (b) Changes in the official transcript may be made only when they...

2014-07-01

374

39 CFR 957.19 - Transcript.  

Code of Federal Regulations, 2012 CFR

...payment of a reasonable price therefor. Copies of parts of the official record other than the transcript may be obtained from the librarian of the Postal Service or the Recorder. (b) Changes in the official transcript may be made only when they...

2012-07-01

375

39 CFR 957.19 - Transcript.  

Code of Federal Regulations, 2011 CFR

...payment of a reasonable price therefor. Copies of parts of the official record other than the transcript may be obtained from the librarian of the Postal Service or the Recorder. (b) Changes in the official transcript may be made only when they...

2011-07-01

376

Transcript mapping for historic handwritten document images  

Microsoft Academic Search

There is a large number of scanned historical documents that need to be indexed for archival and retrieval purposes. A visual word spotting scheme that would serve these purposes is a challenging task even when the transcription of the document image is available. We propose a framework for mapping each word in the transcript to the associated word image in

Catalin I. Tomai; Bin Zhang; Venu Govindaraju

2002-01-01

377

Conserved economics of transcription termination in eubacteria  

Microsoft Academic Search

A secondary structure in the nascent RNA followed by a trail of U residues is believed to be necessary and sufficient to terminate transcription. Such structures represent an extremely economical mechanism of transcription termination since they function in the absence of any additional protein factors. We have developed a new algorithm, GeSTer, to identify putative terminators and analysed all available

Shyam Unniraman; Ranjana Prakash; Valakunja Nagaraja

2002-01-01

378

39 CFR 957.19 - Transcript.  

Code of Federal Regulations, 2010 CFR

...payment of a reasonable price therefor. Copies of parts of the official record other than the transcript may be obtained from the librarian of the Postal Service or the Recorder. (b) Changes in the official transcript may be made only when they...

2010-07-01

379

Mechanism of Transcriptional Bursting in Bacteria  

E-print Network

that positive supercoiling buildup on a DNA seg- ment by transcription slows down transcription elongation, with the Fano factor (variance divided by the mean of a given distribution) larger than one. This indicates factor. Rather, it must originate from a fundamental and general mechanism pertinent to the chromosomal

Xie, Xiaoliang Sunney

380

The many HATs of transcription coactivators  

Microsoft Academic Search

Histone acetylation is closely linked to gene transcription. The identification of histone acetyltransferases (HATs) and the large multiprotein complexes in which they reside has yielded important insights into how these enzymes regulate transcription. The demonstration that HAT complexes interact with sequence-specific activator proteins illustrates how these complexes target specific genes. In addition to histones, some HATs can acetylate non-histone proteins

Christine E Brown; Thomas Lechner; LeAnn Howe; Jerry L Workman

2000-01-01

381

Regulation of endochondral ossification by transcription factors.  

PubMed

Endochondral ossification is very unique and complex biological event which is associated with skeletal development and tissue partnering. Genetic studies and gene-targeting approaches identified several transcription factors that play important roles in endochondral ossification. These transcription factors sequentially and harmoniously regulate each step of endochondral ossification, and consequently maintain the spatio-temporal control of the program. Importantly, these transcription factors form large protein complex to control chromatin remodeling, histone modification, transcription and splicing steps during endochondral ossification. It is also important to understand how these transcription factors regulate expression of their target genes. Biochemical and molecular cloning techniques largely contributed to identification of the components of the transcriptional complex and the target genes. Most recently, importance of endoplasmic reticulum (ER) stress in endochondral ossification has been reported. A transcription factor, BBF2H7, functions as an ER stress sensor in chondrocytes through regulation of appropriate secretion of chondrogenic matrices. We would like to discuss how the transcription factors regulate endochondral ossification. PMID:22652803

Nishimura, Riko; Hata, Kenji; Ono, Koichiro; Amano, Katsuhiko; Takigawa, Yoko; Wakabayashi, Makoto; Takashima, Rikako; Yoneda, Toshiyuki

2012-01-01

382

MCB Chapter 11 Post-Transcriptional Controls  

E-print Network

- RNA Copy sequence for Tat #12;13 Eukaryotic RNA -pol II transcription termination HIV example of attenuation valid for Phe, His, Ile, Leu & Val #12;9 Rho-dependent termination sites are present in some-loop is requested) #12;12 Transcription of HIV genome is regulated by an anti-termination mechanism Figure 11

Linial, Michal

383

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA)  

E-print Network

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA) M. Schmidt, S.Fitt, C. Scott and M name in each other language. This paper details the standards identified for phonetic transcription for the development of this multi­language pronunciation dictionary are discussed, including aspects such as phonetic

Edinburgh, University of

384

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA)  

E-print Network

PHONETIC TRANSCRIPTION STANDARDS FOR EUROPEAN NAMES (ONOMASTICA) M. Schmidt, S.Fitt, C. Scott and M name in each other language.This paper details the standards identified for phonetic transcription for the development of this multi-language pronunciation dictionary are discussed, including aspects such as phonetic

Edinburgh, University of

385

Protein Synthesis: Transcription/Translation Overview  

NSDL National Science Digital Library

This animation shows the transcription process of RNA within the plant cell. Single stranded RNA moves out of the cell where it is translated into proteins. This is the first in a series of three animations on protein synthesis. The other two animations are Transcription and Translation.

386

Evolutionary Dynamics of Prokaryotic Transcriptional Regulatory Networks  

E-print Network

Evolutionary Dynamics of Prokaryotic Transcriptional Regulatory Networks M. Madan Babu1,2 *, Sarah 175 prokaryotic genomes, and predict components of the regulatory networks for these organisms. We responding to specific signals. We show that prokaryotic transcriptional regulatory networks have evolved

Babu, M. Madan

387

Combinatorial Regulation in Yeast Transcription Networks  

NASA Astrophysics Data System (ADS)

Yeast has evolved a complex network to regulate its transcriptional program in response to changes in environment. It is quite common that in response to an external stimulus, several transcription factors will be activated and they work in combinations to control different subsets of genes in the genome. We are interested in how the promoters of genes are designed to integrate signals from multiple transcription factors and what are the functional and evolutionary constraints. To answer how, we have developed a number of computational algorithms to systematically map the binding sites and target genes of transcription factors using sequence and gene expression data. To analyze the functional constraints, we have employed mechanistic models to study the dynamic behavior of genes regulated by multiple factors. We have also developed methods to trace the evolution of transcriptional networks via comparative analysis of multiple species.

Li, Hao

2006-03-01

388

The Transcriptional Control of Lymphatic Vascular Development  

NSDL National Science Digital Library

More than 100 years ago, Florence Sabin suggested that lymphatic vessels develop by sprouting from preexisting blood vessels, but it is only over the past decade that the molecular mechanisms underpinning lymphatic vascular development have begun to be elucidated. Genetic manipulations in mice have identified a transcriptional hub comprised of Prox1, CoupTFII, and Sox18 that is essential for lymphatic endothelial cell fate specification. Recent work has identified a number of additional transcription factors that regulate later stages of lymphatic vessel differentiation and maturation. This review highlights recent advances in our understanding of the transcriptional control of lymphatic vascular development and reflects on efforts to better understand the activities of transcriptional networks during this discrete developmental process. Finally, we highlight the transcription factors associated with human lymphatic vascular disorders, demonstrating the importance of understanding how the activity of these key molecules is regulated, with a view toward the development of innovative therapeutic avenues.

Mathias Francois (University of Queensland)

2011-06-01

389

The virulence gene activator ToxT from Vibrio cholerae is a member of the AraC family of transcriptional activators.  

PubMed Central

Virulence gene expression in Vibrio cholerae is postulated to involve ToxR-dependent activation of the toxT gene followed by ToxT activation of virulence genes, including several of those involved in biogenesis of the toxin-coregulated pilus. ToxR is a transmembrane, DNA-binding protein which is a member of the OmpR subclass of two-component activator systems in bacteria. Data presented in this report demonstrate that ToxT is similar to the AraC family of transcriptional activators identified in a variety of gram-negative bacteria. The toxT open reading frame begins approximately 200 nucleotides from the end of the tcpF gene, which is part of a cluster of genes responsible for production of the toxin-coregulated pilus. Accumulation of toxT specific mRNA is ToxR dependent and is modulated by environmental conditions that modulate expression of the regulon. Within the intergenic region between tcpF and toxT is a potential stem-loop structure of an unusual nature which may play a role in regulating expression of toxT mRNA. Experiments with tcpF and toxT cloned behind a strong, constitutive promoter suggest that the two genes can be cotranscribed, but Northern (RNA) blot analysis of V. cholerae suggests that if they are, steady-state levels of their messages may be controlled by a posttranscriptional mechanism. Possible mechanisms for ToxR-dependent expression of toxT are discussed. Images PMID:1400247

Higgins, D E; Nazareno, E; DiRita, V J

1992-01-01

390

WhiB7, an Fe-S-dependent Transcription Factor That Activates Species-specific Repertoires of Drug Resistance Determinants in Actinobacteria*  

PubMed Central

WhiB-like (Wbl) proteins are well known for their diverse roles in actinobacterial morphogenesis, cell division, virulence, primary and secondary metabolism, and intrinsic antibiotic resistance. Gene disruption experiments showed that three different Actinobacteria (Mycobacterium smegmatis, Streptomyces lividans, and Rhodococcus jostii) each exhibited a different whiB7-dependent resistance profile. Heterologous expression of whiB7 genes showed these resistance profiles reflected the host's repertoire of endogenous whiB7-dependent genes. Transcriptional activation of two resistance genes in the whiB7 regulon, tap (a multidrug transporter) and erm(37) (a ribosomal methyltransferase), required interaction of WhiB7 with their promoters. Furthermore, heterologous expression of tap genes isolated from Mycobacterium species demonstrated that divergencies in drug specificity of homologous structural proteins contribute to the variation of WhiB7-dependent drug resistance. WhiB7 has a specific tryptophan/glycine-rich region and four conserved cysteine residues; it also has a peptide sequence (AT-hook) at its C terminus that binds AT-rich DNA sequence motifs upstream of the promoters it activates. Targeted mutagenesis showed that these motifs were required to provide antibiotic resistance in vivo. Anaerobically purified WhiB7 from S. lividans was dimeric and contained 2.1 ± 0.3 and 2.2 ± 0.3 mol of iron and sulfur, respectively, per protomer (consistent with the presence of a 2Fe-2S cluster). However, the properties of the dimer's absorption spectrum were most consistent with the presence of an oxygen-labile 4Fe-4S cluster, suggesting 50% occupancy. These data provide the first insights into WhiB7 iron-sulfur clusters as they exist in vivo, a major unresolved issue in studies of Wbl proteins. PMID:24126912

Ramón-García, Santiago; Ng, Carol; Jensen, Pernille R.; Dosanjh, Manisha; Burian, Jan; Morris, Rowan P.; Folcher, Marc; Eltis, Lindsay D.; Grzesiek, Stephan; Nguyen, Liem; Thompson, Charles J.

2013-01-01

391

A Non-Classical LysR-Type Transcriptional Regulator PA2206 Is Required for an Effective Oxidative Stress Response in Pseudomonas aeruginosa  

PubMed Central

LysR-type transcriptional regulators (LTTRs) are emerging as key circuit components in regulating microbial stress responses and are implicated in modulating oxidative stress in the human opportunistic pathogen Pseudomonas aeruginosa. The oxidative stress response encapsulates several strategies to overcome the deleterious effects of reactive oxygen species. However, many of the regulatory components and associated molecular mechanisms underpinning this key adaptive response remain to be characterised. Comparative analysis of publically available transcriptomic datasets led to the identification of a novel LTTR, PA2206, whose expression was altered in response to a range of host signals in addition to oxidative stress. PA2206 was found to be required for tolerance to H2O2 in vitro and lethality in vivo in the Zebrafish embryo model of infection. Transcriptomic analysis in the presence of H2O2 showed that PA2206 altered the expression of 58 genes, including a large repertoire of oxidative stress and iron responsive genes, independent of the master regulator of oxidative stress, OxyR. Contrary to the classic mechanism of LysR regulation, PA2206 did not autoregulate its own expression and did not influence expression of adjacent or divergently transcribed genes. The PA2214-15 operon was identified as a direct target of PA2206 with truncated promoter fragments revealing binding to the 5?-ATTGCCTGGGGTTAT-3? LysR box adjacent to the predicted ?35 region. PA2206 also interacted with the pvdS promoter suggesting a global dimension to the PA2206 regulon, and suggests PA2206 is an important regulatory component of P. aeruginosa adaptation during oxidative stress. PMID:23382903

Mooij, Marlies J.; O'Gara, Fergal

2013-01-01

392

Defining the Plasticity of Transcription Factor Binding Sites by Deconstructing DNA Consensus Sequences: The PhoP-Binding Sites among Gamma/Enterobacteria  

PubMed Central

Transcriptional regulators recognize specific DNA sequences. Because these sequences are embedded in the background of genomic DNA, it is hard to identify the key cis-regulatory elements that determine disparate patterns of gene expression. The detection of the intra- and inter-species differences among these sequences is crucial for understanding the molecular basis of both differential gene expression and evolution. Here, we address this problem by investigating the target promoters controlled by the DNA-binding PhoP protein, which governs virulence and Mg2+ homeostasis in several bacterial species. PhoP is particularly interesting; it is highly conserved in different gamma/enterobacteria, regulating not only ancestral genes but also governing the expression of dozens of horizontally acquired genes that differ from species to species. Our approach consists of decomposing the DNA binding site sequences for a given regulator into families of motifs (i.e., termed submotifs) using a machine learning method inspired by the “Divide & Conquer” strategy. By partitioning a motif into sub-patterns, computational advantages for classification were produced, resulting in the discovery of new members of a regulon, and alleviating the problem of distinguishing functional sites in chromatin immunoprecipitation and DNA microarray genome-wide analysis. Moreover, we found that certain partitions were useful in revealing biological properties of binding site sequences, including modular gains and losses of PhoP binding sites through evolutionary turnover events, as well as conservation in distant species. The high conservation of PhoP submotifs within gamma/enterobacteria, as well as the regulatory protein that recognizes them, suggests that the major cause of divergence between related species is not due to the binding sites, as was previously suggested for other regulators. Instead, the divergence may be attributed to the fast evolution of orthologous target genes and/or the promoter architectures resulting from the interaction of those binding sites with the RNA polymerase. PMID:20661307

Harari, Oscar; Park, Sun-Yang; Huang, Henry; Groisman, Eduardo A.; Zwir, Igor

2010-01-01

393

Unsupervised Language Model Adaptation for Mandarin Broadcast Conversation Transcription  

E-print Network

Unsupervised Language Model Adaptation for Mandarin Broadcast Conversation Transcription David Mrva on a new task of Mandarin broadcast conversation transcription. It was found that N-gram adaptation yields recognition, language model adaptation, Mandarin, broadcast conversation transcription 1. Introduction

Cambridge, University of

394

Evolution of transcription networks in response to temporal fluctuations  

E-print Network

Evolution of transcription networks in response to temporal fluctuations Journal: Evolution, Evolution & Marine Biology Keywords: Population Genetics, Epistasis, Genetic Networks, Transcription Evolution: For Review Only #12;EVOLUTION OF TRANSCRIPTION NETWORKS IN RESPONSE TO TEMPORAL FLUCTUATIONS

Hespanha, João Pedro

395

Transcriptional control of flavonoid biosynthesis  

PubMed Central

Flavonoids are plant secondary polyphenolic metabolites and fulfil many vital biological functions, offering a valuable metabolic and genetic model for studying transcriptional control of gene expression. Arabidopsis thaliana mainly accumulates 3 types of flavonoids, including flavonols, anthocyanins, and proanthocyanidins (PAs). Flavonoid biosynthesis involves a multitude of well-characterized enzymatic and regulatory proteins. Three R2R3-MYB proteins (MYB11, MYB12, and MYB111) control flavonol biosynthesis via activating the early biosynthetic steps, whereas the production of anthocyanins and PAs requires the MYB-bHLH-WD40 (MBW) complex to activate the late biosynthetic genes. Additional regulators of flavonoid biosynthesis have recently come to light, which interact with R2R3-MYBs or bHLHs to organize or disrupt the formation of the MBW complex, leading to enhanced or compromised flavonoid production. This mini-review gives an overview of how these novel players modulate flavonoid metabolism and thus plant developmental processes and further proposes a fine-tuning mechanism to complete the complex regulatory network controlling flavonoid biosynthesis. PMID:24393776

Li, Shutian

2014-01-01

396

Purification & Characterization of Transcription Factors  

PubMed Central

Transcription factors (TFs) are essential for the expression of all proteins, including those involved in human health and disease. However, TFs are resistant to proteomic characterization because they are frequently masked by more abundant proteins due to the limited dynamic range of capillary liquid chromatography-tandem mass spectrometry and protein database searching. Purification methods, particularly strategies that exploit the high affinity of TFs for DNA response elements on gene promoters, can enrich TFs prior to proteomic analysis to improve dynamic range and penetrance of the TF proteome. For example, trapping of TF complexes specific for particular response elements has been achieved by recovering the element DNA-protein complex on solid supports. Additional methods for improving dynamic range include two- and three-dimensional gel electrophoresis incorporating electrophoretic mobility shift assays and Southwestern blotting for detection. Here we review methods for TF purification and characterization. We fully expect that future investigations will apply these and other methods to illuminate this important but challenging proteome. PMID:23832591

Nagore, LI; Nadeau, RJ; Guo, Q; Jadhav, YLA; Jarrett, HW; Haskins, WE

2013-01-01

397

Balanced Branching in Transcription Termination  

NASA Technical Reports Server (NTRS)

The theory of stochastic transcription termination based on free-energy competition [von Hippel, P. H. & Yager, T. D. (1992) Science 255,809-812 and van Hippel, P. H. & Yager, T. D. (1991) Proc. Natl. Acad. Sci. USA 88, 2307-2311] requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this balancing should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle, but do find many troubling Inconsistencies, most notably, anomalous memory effects. These effects suggest that termination has a deterministic component and may conceivably not be stochastic at all. We find that a key experiment by Wilson and von Hippel [Wilson, K. S. & von Hippel, P. H. (1994) J. Mol. Biol. 244,36-51] thought to demonstrate stochastic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

Harrington, K. J.; Laughlin, R. B.; Liang, S.

2000-01-01

398

Transcriptional regulation of tenascin genes.  

PubMed

Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an "oncofetal" protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias

2015-01-01

399

Extraction of transcript diversity from scientific literature.  

PubMed

Transcript diversity generated by alternative splicing and associated mechanisms contributes heavily to the functional complexity of biological systems. The numerous examples of the mechanisms and functional implications of these events are scattered throughout the scientific literature. Thus, it is crucial to have a tool that can automatically extract the relevant facts and collect them in a knowledge base that can aid the interpretation of data from high-throughput methods. We have developed and applied a composite text-mining method for extracting information on transcript diversity from the entire MEDLINE database in order to create a database of genes with alternative transcripts. It contains information on tissue specificity, number of isoforms, causative mechanisms, functional implications, and experimental methods used for detection. We have mined this resource to identify 959 instances of tissue-specific splicing. Our results in combination with those from EST-based methods suggest that alternative splicing is the preferred mechanism for generating transcript diversity in the nervous system. We provide new annotations for 1,860 genes with the potential for generating transcript diversity. We assign the MeSH term "alternative splicing" to 1,536 additional abstracts in the MEDLINE database and suggest new MeSH terms for other events. We have successfully extracted information about transcript diversity and semiautomatically generated a database, LSAT, that can provide a quantitative understanding of the mechanisms behind tissue-specific gene expression. LSAT (Literature Support for Alternative Transcripts) is publicly available at http://www.bork.embl.de/LSAT/. PMID:16103899

Shah, Parantu K; Jensen, Lars J; Boué, Stéphanie; Bork, Peer

2005-06-01

400