Science.gov

Sample records for apicomplexan transcriptional regulons

  1. Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota

    PubMed Central

    Leyn, Semen A.; Rodionova, Irina A.; Li, Xiaoqing

    2015-01-01

    ABSTRACT Autotrophic microorganisms are able to utilize carbon dioxide as their only carbon source, or, alternatively, many of them can grow heterotrophically on organics. Different variants of autotrophic pathways have been identified in various lineages of the phylum Crenarchaeota. Aerobic members of the order Sulfolobales utilize the hydroxypropionate-hydroxybutyrate cycle (HHC) to fix inorganic carbon, whereas anaerobic Thermoproteales use the dicarboxylate-hydroxybutyrate cycle (DHC). Knowledge of transcriptional regulation of autotrophic pathways in Archaea is limited. We applied a comparative genomics approach to predict novel autotrophic regulons in the Crenarchaeota. We report identification of two novel DNA motifs associated with the autotrophic pathway genes in the Sulfolobales (HHC box) and Thermoproteales (DHC box). Based on genome context evidence, the HHC box regulon was attributed to a novel transcription factor from the TrmB family named HhcR. Orthologs of HhcR are present in all Sulfolobales genomes but were not found in other lineages. A predicted HHC box regulatory motif was confirmed by in vitro binding assays with the recombinant HhcR protein from Metallosphaera yellowstonensis. For the DHC box regulon, we assigned a different potential regulator, named DhcR, which is restricted to the order Thermoproteales. DhcR in Thermoproteus neutrophilus (Tneu_0751) was previously identified as a DNA-binding protein with high affinity for the promoter regions of two autotrophic operons. The global HhcR and DhcR regulons reconstructed by comparative genomics were reconciled with available omics data in Metallosphaera and Thermoproteus spp. The identified regulons constitute two novel mechanisms for transcriptional control of autotrophic pathways in the Crenarchaeota. IMPORTANCE Little is known about transcriptional regulation of carbon dioxide fixation pathways in Archaea. We previously applied the comparative genomics approach for reconstruction of Dtx

  2. Regulons of global transcription factors in Corynebacterium glutamicum.

    PubMed

    Toyoda, Koichi; Inui, Masayuki

    2016-01-01

    Corynebacterium glutamicum, a high GC content gram-positive soil bacterium in Actinobacteria, has been used for the industrial production of amino acids and engineered to produce various compounds, including polymer building blocks and biofuels. Since its genome sequence was first published, its versatile metabolic pathways and their genetic components and regulatory mechanisms have been extensively studied. Previous studies on transcriptional factors, including two-component systems and σ factors, in the bacterium have revealed transcriptional regulatory links among the metabolic pathways and those among the stress response systems, forming a complex transcriptional regulatory network. The regulatory links are based on knowledge of the transcription factors, such as their target genes (regulons), DNA sequence motifs for recognition, and effector molecules controlling their activities, all of which are fundamental for understanding their physiological functions. Recent advances in chromatin immunoprecipitation (ChIP)-based genome-wide analyses provide an opportunity to comprehensively identify the transcription factor regulon, composed of its direct target genes, and its precise consensus binding motif. A common feature among the regulon constituents may provide clues to identify an effector molecule targeting the factor. In this mini-review, we summarize the current knowledge of the regulons of the C. glutamicum transcription factors that have been analyzed via ChIP-based technologies. The regulons consisting of direct target genes revealed new physiological roles of the transcription factors and new regulatory interactions, contributing to refinement and expansion of the transcriptional regulatory network and the development of guidelines and genetic tools for metabolic engineering of C. glutamicum. PMID:26496920

  3. Post-transcriptional RNA Regulons Affecting Cell Cycle and Proliferation

    PubMed Central

    Blackinton, Jeff G.

    2014-01-01

    The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

  4. Maltose-Dependent Transcriptional Regulation of the mal Regulon by MalR in Streptococcus pneumoniae

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Kuipers, Oscar P.

    2015-01-01

    The maltose regulon (mal regulon) has previously been shown to consist of the mal gene cluster (malMP, malXCD and malAR operons) in Streptococcus pneumoniae. In this study, we have further elucidated the complete mal regulon in S. pneumoniae D39 using microarray analyses and β-galactosidase assays. In addition to the mal gene cluster, the complete mal regulon of S. pneumoniae D39 consists of a pullulanase (PulA), a glucosidase (DexB), a glucokinase (RokB), a PTS component (PtsG) and an amylase (AmyA2). Our microarray studies and β-galactosidase assays further showed that the LacI-family transcriptional regulator MalR represses the expression of the mal regulon in the absence of maltose. Furthermore, the role of the pleiotropic transcriptional regulator CcpA in the regulation of the mal regulon in the presence of maltose was explored. Our microarray analysis with a ΔccpA strain showed that CcpA only represses the expression of the malXCD operon and the pulA gene in the presence of maltose. Hence, we extend the mal regulon now consisting of pulA, dexB, rokB, ptsG and amyA2 in addition to malMP, malXCD and malAR operons. PMID:26030923

  5. Maltose-Dependent Transcriptional Regulation of the mal Regulon by MalR in Streptococcus pneumoniae.

    PubMed

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Kuipers, Oscar P

    2015-01-01

    The maltose regulon (mal regulon) has previously been shown to consist of the mal gene cluster (malMP, malXCD and malAR operons) in Streptococcus pneumoniae. In this study, we have further elucidated the complete mal regulon in S. pneumoniae D39 using microarray analyses and β-galactosidase assays. In addition to the mal gene cluster, the complete mal regulon of S. pneumoniae D39 consists of a pullulanase (PulA), a glucosidase (DexB), a glucokinase (RokB), a PTS component (PtsG) and an amylase (AmyA2). Our microarray studies and β-galactosidase assays further showed that the LacI-family transcriptional regulator MalR represses the expression of the mal regulon in the absence of maltose. Furthermore, the role of the pleiotropic transcriptional regulator CcpA in the regulation of the mal regulon in the presence of maltose was explored. Our microarray analysis with a ΔccpA strain showed that CcpA only represses the expression of the malXCD operon and the pulA gene in the presence of maltose. Hence, we extend the mal regulon now consisting of pulA, dexB, rokB, ptsG and amyA2 in addition to malMP, malXCD and malAR operons. PMID:26030923

  6. Reconstruction of the Core and Extended Regulons of Global Transcription Factors

    PubMed Central

    Dufour, Yann S.; Kiley, Patricia J.; Donohue, Timothy J.

    2010-01-01

    The processes underlying the evolution of regulatory networks are unclear. To address this question, we used a comparative genomics approach that takes advantage of the large number of sequenced bacterial genomes to predict conserved and variable members of transcriptional regulatory networks across phylogenetically related organisms. Specifically, we developed a computational method to predict the conserved regulons of transcription factors across α-proteobacteria. We focused on the CRP/FNR super-family of transcription factors because it contains several well-characterized members, such as FNR, FixK, and DNR. While FNR, FixK, and DNR are each proposed to regulate different aspects of anaerobic metabolism, they are predicted to recognize very similar DNA target sequences, and they occur in various combinations among individual α-proteobacterial species. In this study, the composition of the respective FNR, FixK, or DNR conserved regulons across 87 α-proteobacterial species was predicted by comparing the phylogenetic profiles of the regulators with the profiles of putative target genes. The utility of our predictions was evaluated by experimentally characterizing the FnrL regulon (a FNR-type regulator) in the α-proteobacterium Rhodobacter sphaeroides. Our results show that this approach correctly predicted many regulon members, provided new insights into the biological functions of the respective regulons for these regulators, and suggested models for the evolution of the corresponding transcriptional networks. Our findings also predict that, at least for the FNR-type regulators, there is a core set of target genes conserved across many species. In addition, the members of the so-called extended regulons for the FNR-type regulators vary even among closely related species, possibly reflecting species-specific adaptation to environmental and other factors. The comparative genomics approach we developed is readily applicable to other regulatory networks. PMID

  7. Comparative genomics and evolution of regulons of the LacI-family transcription factors

    PubMed Central

    Ravcheev, Dmitry A.; Khoroshkin, Matvei S.; Laikova, Olga N.; Tsoy, Olga V.; Sernova, Natalia V.; Petrova, Svetlana A.; Rakhmaninova, Aleksandra B.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.

    2014-01-01

    DNA-binding transcription factors (TFs) are essential components of transcriptional regulatory networks in bacteria. LacI-family TFs (LacI-TFs) are broadly distributed among certain lineages of bacteria. The majority of characterized LacI-TFs sense sugar effectors and regulate carbohydrate utilization genes. The comparative genomics approaches enable in silico identification of TF-binding sites and regulon reconstruction. To study the function and evolution of LacI-TFs, we performed genomics-based reconstruction and comparative analysis of their regulons. For over 1300 LacI-TFs from over 270 bacterial genomes, we predicted their cognate DNA-binding motifs and identified target genes. Using the genome context and metabolic subsystem analyses of reconstructed regulons, we tentatively assigned functional roles and predicted candidate effectors for 78 and 67% of the analyzed LacI-TFs, respectively. Nearly 90% of the studied LacI-TFs are local regulators of sugar utilization pathways, whereas the remaining 125 global regulators control large and diverse sets of metabolic genes. The global LacI-TFs include the previously known regulators CcpA in Firmicutes, FruR in Enterobacteria, and PurR in Gammaproteobacteria, as well as the three novel regulators—GluR, GapR, and PckR—that are predicted to control the central carbohydrate metabolism in three lineages of Alphaproteobacteria. Phylogenetic analysis of regulators combined with the reconstructed regulons provides a model of evolutionary diversification of the LacI protein family. The obtained genomic collection of in silico reconstructed LacI-TF regulons in bacteria is available in the RegPrecise database (http://regprecise.lbl.gov). It provides a framework for future structural and functional classification of the LacI protein family and identification of molecular determinants of the DNA and ligand specificity. The inferred regulons can be also used for functional gene annotation and reconstruction of sugar catabolic

  8. Comparative genomics and evolution of regulons of the LacI-family transcription factors.

    PubMed

    Ravcheev, Dmitry A; Khoroshkin, Matvei S; Laikova, Olga N; Tsoy, Olga V; Sernova, Natalia V; Petrova, Svetlana A; Rakhmaninova, Aleksandra B; Novichkov, Pavel S; Gelfand, Mikhail S; Rodionov, Dmitry A

    2014-01-01

    DNA-binding transcription factors (TFs) are essential components of transcriptional regulatory networks in bacteria. LacI-family TFs (LacI-TFs) are broadly distributed among certain lineages of bacteria. The majority of characterized LacI-TFs sense sugar effectors and regulate carbohydrate utilization genes. The comparative genomics approaches enable in silico identification of TF-binding sites and regulon reconstruction. To study the function and evolution of LacI-TFs, we performed genomics-based reconstruction and comparative analysis of their regulons. For over 1300 LacI-TFs from over 270 bacterial genomes, we predicted their cognate DNA-binding motifs and identified target genes. Using the genome context and metabolic subsystem analyses of reconstructed regulons, we tentatively assigned functional roles and predicted candidate effectors for 78 and 67% of the analyzed LacI-TFs, respectively. Nearly 90% of the studied LacI-TFs are local regulators of sugar utilization pathways, whereas the remaining 125 global regulators control large and diverse sets of metabolic genes. The global LacI-TFs include the previously known regulators CcpA in Firmicutes, FruR in Enterobacteria, and PurR in Gammaproteobacteria, as well as the three novel regulators-GluR, GapR, and PckR-that are predicted to control the central carbohydrate metabolism in three lineages of Alphaproteobacteria. Phylogenetic analysis of regulators combined with the reconstructed regulons provides a model of evolutionary diversification of the LacI protein family. The obtained genomic collection of in silico reconstructed LacI-TF regulons in bacteria is available in the RegPrecise database (http://regprecise.lbl.gov). It provides a framework for future structural and functional classification of the LacI protein family and identification of molecular determinants of the DNA and ligand specificity. The inferred regulons can be also used for functional gene annotation and reconstruction of sugar catabolic

  9. Transcriptional and functional analysis of the Neisseria gonorrhoeae fur regulon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To ensure survival in the host, bacteria have evolved strategies to acquire the essential element iron. In Neisseria gonorrhoeae, the ferric uptake regulator senses intracellular iron stores and acting as a repressor, directly regulates transcription of iron-responsive genes by binding to a conserve...

  10. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

    PubMed Central

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

  11. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes.

    PubMed

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5'→3', 3' →5' or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically.Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm. PMID:27515825

  12. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.

    PubMed

    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio

    2016-02-01

    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms. PMID:26194054

  13. The MazF-regulon: a toolbox for the post-transcriptional stress response in Escherichia coli.

    PubMed

    Sauert, Martina; Wolfinger, Michael T; Vesper, Oliver; Müller, Christian; Byrgazov, Konstantin; Moll, Isabella

    2016-08-19

    Flexible adaptation to environmental stress is vital for bacteria. An energy-efficient post-transcriptional stress response mechanism in Escherichia coli is governed by the toxin MazF. After stress-induced activation the endoribonuclease MazF processes a distinct subset of transcripts as well as the 16S ribosomal RNA in the context of mature ribosomes. As these 'stress-ribosomes' are specific for the MazF-processed mRNAs, the translational program is changed. To identify this 'MazF-regulon' we employed Poly-seq (polysome fractionation coupled with RNA-seq analysis) and analyzed alterations introduced into the transcriptome and translatome after mazF overexpression. Unexpectedly, our results reveal that the corresponding protein products are involved in all cellular processes and do not particularly contribute to the general stress response. Moreover, our findings suggest that translational reprogramming serves as a fast-track reaction to harsh stress and highlight the so far underestimated significance of selective translation as a global regulatory mechanism in gene expression. Considering the reported implication of toxin-antitoxin (TA) systems in persistence, our results indicate that MazF acts as a prime effector during harsh stress that potentially introduces translational heterogeneity within a bacterial population thereby stimulating persister cell formation. PMID:26908653

  14. Transcription factor family-based reconstruction of singleton regulons and study of the Crp/Fnr, ArsR, and GntR families in Desulfovibrionales genomes.

    PubMed

    Kazakov, Alexey E; Rodionov, Dmitry A; Price, Morgan N; Arkin, Adam P; Dubchak, Inna; Novichkov, Pavel S

    2013-01-01

    Accurate detection of transcriptional regulatory elements is essential for high-quality genome annotation, metabolic reconstruction, and modeling of regulatory networks. We developed a computational approach for reconstruction of regulons operated by transcription factors (TFs) from large protein families and applied this novel approach to three TF families in 10 Desulfovibrionales genomes. Phylogenetic analyses of 125 regulators from the ArsR, Crp/Fnr, and GntR families revealed that 65% of these regulators (termed reference TFs) are well conserved in Desulfovibrionales, while the remaining 35% of regulators (termed singleton TFs) are species specific and show a mosaic distribution. For regulon reconstruction in the group of singleton TFs, the standard orthology-based approach was inefficient, and thus, we developed a novel approach based on the simultaneous study of all homologous TFs from the same family in a group of genomes. As a result, we identified binding for 21 singleton TFs and for all reference TFs in all three analyzed families. Within each TF family we observed structural similarities between DNA-binding motifs of different reference and singleton TFs. The collection of reconstructed regulons is available at the RegPrecise database (http://regprecise.lbl.gov/RegPrecise/Desulfovibrionales.jsp). PMID:23086211

  15. Transcription Factor Family-Based Reconstruction of Singleton Regulons and Study of the Crp/Fnr, ArsR, and GntR Families in Desulfovibrionales Genomes

    PubMed Central

    Rodionov, Dmitry A.; Price, Morgan N.; Arkin, Adam P.; Dubchak, Inna

    2013-01-01

    Accurate detection of transcriptional regulatory elements is essential for high-quality genome annotation, metabolic reconstruction, and modeling of regulatory networks. We developed a computational approach for reconstruction of regulons operated by transcription factors (TFs) from large protein families and applied this novel approach to three TF families in 10 Desulfovibrionales genomes. Phylogenetic analyses of 125 regulators from the ArsR, Crp/Fnr, and GntR families revealed that 65% of these regulators (termed reference TFs) are well conserved in Desulfovibrionales, while the remaining 35% of regulators (termed singleton TFs) are species specific and show a mosaic distribution. For regulon reconstruction in the group of singleton TFs, the standard orthology-based approach was inefficient, and thus, we developed a novel approach based on the simultaneous study of all homologous TFs from the same family in a group of genomes. As a result, we identified binding for 21 singleton TFs and for all reference TFs in all three analyzed families. Within each TF family we observed structural similarities between DNA-binding motifs of different reference and singleton TFs. The collection of reconstructed regulons is available at the RegPrecise database (http://regprecise.lbl.gov/RegPrecise/Desulfovibrionales.jsp). PMID:23086211

  16. Transcriptional response of Corynebacterium glutamicum ATCC 13032 to hydrogen peroxide stress and characterization of the OxyR regulon.

    PubMed

    Milse, Johanna; Petri, Kathrin; Rückert, Christian; Kalinowski, Jörn

    2014-11-20

    The aerobic soil bacterium Corynebacterium glutamicum ATCC 13032 has a remarkable natural resistance to hydrogen peroxide. A major player in hydrogen peroxide defense is the LysR type transcriptional regulator OxyR, homologs of which are present in a wide range of bacteria. In this study, the global transcriptional response of C. glutamicum to oxidative stress induced by hydrogen peroxide was examined using whole genome DNA microarrays, demonstrating the dynamic reaction of the regulatory networks. Deletion of oxyR resulted in an increased resistance of the C. glutamicum mutant to hydrogen peroxide. By performing DNA microarray hybridizations and RT-qPCR, differentially expressed genes were detected in the mutant. The direct control by OxyR was verified by electrophoretic mobility shift assays for 12 target regions. The results demonstrated that OxyR in C. glutamicum acts as a transcriptional repressor under non-stress conditions for a total of 23 genes. The regulated genes encode proteins related to oxidative stress response (e.g. katA), iron homeostasis (e.g. dps) and sulfur metabolism (e.g. suf cluster). Besides the regulator of the suf cluster, SufR, OxyR regulated the gene cg1695 encoding a putative transcriptional regulator, indicating the role of OxyR as a master regulator in defense against oxidative stress. Using a modified DNase footprint approach, the OxyR-binding sites in five target promoter regions, katA, cydA, hemH, dps and cg1292, were localized and in each upstream region at least two overlapping binding sites were found. The DNA regions protected by the OxyR protein are about 56bp in length and do not have evident sequence similarities. Still, by giving an insight in the H2O2 stimulon and extending the OxyR regulon this study considerably contributes to the understanding of the response of C. glutamicum to hydrogen peroxide-mediated oxidative stress. PMID:25107507

  17. Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

    PubMed Central

    Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

    2009-01-01

    Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

  18. RegulonDB version 7.0: transcriptional regulation of Escherichia coli K-12 integrated within genetic sensory response units (Gensor Units)

    PubMed Central

    Gama-Castro, Socorro; Salgado, Heladia; Peralta-Gil, Martin; Santos-Zavaleta, Alberto; Muñiz-Rascado, Luis; Solano-Lira, Hilda; Jimenez-Jacinto, Verónica; Weiss, Verena; García-Sotelo, Jair S.; López-Fuentes, Alejandra; Porrón-Sotelo, Liliana; Alquicira-Hernández, Shirley; Medina-Rivera, Alejandra; Martínez-Flores, Irma; Alquicira-Hernández, Kevin; Martínez-Adame, Ruth; Bonavides-Martínez, César; Miranda-Ríos, Juan; Huerta, Araceli M.; Mendoza-Vargas, Alfredo; Collado-Torres, Leonardo; Taboada, Blanca; Vega-Alvarado, Leticia; Olvera, Maricela; Olvera, Leticia; Grande, Ricardo; Morett, Enrique; Collado-Vides, Julio

    2011-01-01

    RegulonDB (http://regulondb.ccg.unam.mx/) is the primary reference database of the best-known regulatory network of any free-living organism, that of Escherichia coli K-12. The major conceptual change since 3 years ago is an expanded biological context so that transcriptional regulation is now part of a unit that initiates with the signal and continues with the signal transduction to the core of regulation, modifying expression of the affected target genes responsible for the response. We call these genetic sensory response units, or Gensor Units. We have initiated their high-level curation, with graphic maps and superreactions with links to other databases. Additional connectivity uses expandable submaps. RegulonDB has summaries for every transcription factor (TF) and TF-binding sites with internal symmetry. Several DNA-binding motifs and their sizes have been redefined and relocated. In addition to data from the literature, we have incorporated our own information on transcription start sites (TSSs) and transcriptional units (TUs), obtained by using high-throughput whole-genome sequencing technologies. A new portable drawing tool for genomic features is also now available, as well as new ways to download the data, including web services, files for several relational database manager systems and text files including BioPAX format. PMID:21051347

  19. Streptococcus mutans copes with heat stress by multiple transcriptional regulons modulating virulence and energy metabolism

    PubMed Central

    Liu, Chengcheng; Niu, Yulong; Zhou, Xuedong; Zheng, Xin; Wang, Shida; Guo, Qiang; Li, Yuqing; Li, Mingyun; Li, Jiyao; Yang, Yi; Ding, Yi; Lamont, Richard J.; Xu, Xin

    2015-01-01

    Dental caries is closely associated with the virulence of Streptococcus mutans. The virulence expression of S. mutans is linked to its stress adaptation to the changes in the oral environment. In this work we used whole-genome microarrays to profile the dynamic transcriptomic responses of S. mutans during physiological heat stress. In addition, we evaluated the phenotypic changes, including, eDNA release, initial biofilm formation, extracellular polysaccharides generation, acid production/acid tolerance, and ATP turnover of S. mutans during heat stress. There were distinct patterns observed in the way that S. mutans responded to heat stress that included 66 transcription factors for the expression of functional genes being differentially expressed. Especially, response regulators of two component systems (TCSs), the repressors of heat shock proteins and regulators involved in sugar transporting and metabolism co-ordinated to enhance the cell’s survival and energy generation against heat stress in S. mutans. PMID:26251057

  20. The cellular growth rate controls overall mRNA turnover, and modulates either transcription or degradation rates of particular gene regulons

    PubMed Central

    García-Martínez, José; Delgado-Ramos, Lidia; Ayala, Guillermo; Pelechano, Vicent; Medina, Daniel A.; Carrasco, Fany; González, Ramón; Andrés-León, Eduardo; Steinmetz, Lars; Warringer, Jonas; Chávez, Sebastián; Pérez-Ortín, José E.

    2016-01-01

    We analyzed 80 different genomic experiments, and found a positive correlation between both RNA polymerase II transcription and mRNA degradation with growth rates in yeast. Thus, in spite of the marked variation in mRNA turnover, the total mRNA concentration remained approximately constant. Some genes, however, regulated their mRNA concentration by uncoupling mRNA stability from the transcription rate. Ribosome-related genes modulated their transcription rates to increase mRNA levels under fast growth. In contrast, mitochondria-related and stress-induced genes lowered mRNA levels by reducing mRNA stability or the transcription rate, respectively. We also detected these regulations within the heterogeneity of a wild-type cell population growing in optimal conditions. The transcriptomic analysis of sorted microcolonies confirmed that the growth rate dictates alternative expression programs by modulating transcription and mRNA decay. The regulation of overall mRNA turnover keeps a constant ratio between mRNA decay and the dilution of [mRNA] caused by cellular growth. This regulation minimizes the indiscriminate transmission of mRNAs from mother to daughter cells, and favors the response capacity of the latter to physiological signals and environmental changes. We also conclude that, by uncoupling mRNA synthesis from decay, cells control the mRNA abundance of those gene regulons that characterize fast and slow growth. PMID:26717982

  1. The cellular growth rate controls overall mRNA turnover, and modulates either transcription or degradation rates of particular gene regulons.

    PubMed

    García-Martínez, José; Delgado-Ramos, Lidia; Ayala, Guillermo; Pelechano, Vicent; Medina, Daniel A; Carrasco, Fany; González, Ramón; Andrés-León, Eduardo; Steinmetz, Lars; Warringer, Jonas; Chávez, Sebastián; Pérez-Ortín, José E

    2016-05-01

    We analyzed 80 different genomic experiments, and found a positive correlation between both RNA polymerase II transcription and mRNA degradation with growth rates in yeast. Thus, in spite of the marked variation in mRNA turnover, the total mRNA concentration remained approximately constant. Some genes, however, regulated their mRNA concentration by uncoupling mRNA stability from the transcription rate. Ribosome-related genes modulated their transcription rates to increase mRNA levels under fast growth. In contrast, mitochondria-related and stress-induced genes lowered mRNA levels by reducing mRNA stability or the transcription rate, respectively. We also detected these regulations within the heterogeneity of a wild-type cell population growing in optimal conditions. The transcriptomic analysis of sorted microcolonies confirmed that the growth rate dictates alternative expression programs by modulating transcription and mRNA decay.The regulation of overall mRNA turnover keeps a constant ratio between mRNA decay and the dilution of [mRNA] caused by cellular growth. This regulation minimizes the indiscriminate transmission of mRNAs from mother to daughter cells, and favors the response capacity of the latter to physiological signals and environmental changes. We also conclude that, by uncoupling mRNA synthesis from decay, cells control the mRNA abundance of those gene regulons that characterize fast and slow growth. PMID:26717982

  2. Cytoskeleton-Dependent Transport as a Potential Target for Interfering with Post-transcriptional HuR mRNA Regulons.

    PubMed

    Eberhardt, Wolfgang; Badawi, Amel; Biyanee, Abhiruchi; Pfeilschifter, Josef

    2016-01-01

    The ubiquitous mRNA binding protein human antigen R (HuR), a member of the embryonal lethal abnormal vision protein family has a critical impact on the post-transcriptional control of AU-rich element bearing mRNA regulons implied in inflammation, senescence, and carcinogenesis. HuR in addition to mRNA stability can affect many other aspects of mRNA processing including splicing, polyadenylation, translation, modulation of miRNA repression, and intracellular mRNA trafficking. Since many of the identified HuR mRNA targets ("HuR mRNA regulons") encode tumor-related proteins, HuR is not only discussed as an useful biomarker but also as promising therapeutic target for treatment of various human cancers. HuR which is most abundantly localized in the nucleus is translocated to the cytoplasm which is fundamental for most of the described HuR functions on target mRNAs. Accordingly, an elevation in cytoplasmic HuR was found in many tumors and correlated with a high grade of malignancy and a poor prognosis of patients. Therefore, direct interference with the intracellular trafficking of HuR offers an attractive approach to intervene with pathologically deregulated HuR functions. Data from several laboratories implicate that the integrity of the cytoskeleton is critical for HuR-mediated intracellular mRNA localization and translation. This review will particularly focus on drugs which have proven a direct inhibitory effect on HuR translocation. Based on the results from those studies, we will also discuss on the principle value of targeting cytoskeleton-dependent transport of HuR by natural or synthetic inhibitors as a potential therapeutic avenue for interfering with dysregulated post-transcriptional HuR mRNA regulons and related tumor cell functions. In spite of that, interfering with cytoplasmic HuR transport could highlight a so far underestimated action of microtubule inhibitors clinically used for cancer chemotherapy. PMID:27582706

  3. Genome-wide profiling of Hfq-binding RNAs uncovers extensive post-transcriptional rewiring of major stress response and symbiotic regulons in Sinorhizobium meliloti

    PubMed Central

    Torres-Quesada, Omar; Reinkensmeier, Jan; Schlüter, Jan-Philip; Robledo, Marta; Peregrina, Alexandra; Giegerich, Robert; Toro, Nicolás; Becker, Anke; Jiménez-Zurdo, Jose I

    2014-01-01

    The RNA chaperone Hfq is a global post-transcriptional regulator in bacteria. Here, we used RNAseq to analyze RNA populations from the legume symbiont Sinorhizobium meliloti that were co-immunoprecipitated (CoIP-RNA) with a FLAG-tagged Hfq in five growth/stress conditions. Hfq-bound transcripts (1315) were largely identified in stressed bacteria and derived from small RNAs (sRNAs), both trans-encoded (6.4%) and antisense (asRNAs; 6.3%), and mRNAs (86%). Pull-down with Hfq recovered a small proportion of annotated S. meliloti sRNAs (14% of trans-sRNAs and 2% of asRNAs) suggesting a discrete impact of this protein in sRNA pathways. Nonetheless, Hfq selectively stabilized CoIP-enriched sRNAs, anticipating that these interactions are functionally significant. Transcription of 26 Hfq-bound sRNAs was predicted to occur from promoters recognized by the major stress σ factors σE2 or σH1/2. Recovery rates of sRNAs in each of the CoIP–RNA libraries suggest a large impact of Hfq-assisted riboregulation in S. meliloti osmoadaptation. Hfq directly targeted 18% of the predicted S. meliloti mRNAs, which encode functionally diverse proteins involved in transport and metabolism, σE2-dependent stress responses, quorum sensing, flagella biosynthesis, ribosome, and membrane assembly or symbiotic nitrogen fixation. Canonical targeting of the 5′ regions of two of the ABC transporter mRNAs by the homologous Hfq-binding AbcR1 and AbcR2 sRNAs leading to inhibition of protein synthesis was confirmed in vivo. We therefore provide a comprehensive resource for the systems-level deciphering of hitherto unexplored S. meliloti stress and symbiotic post-transcriptional regulons and the identification of Hfq-dependent sRNA–mRNA regulatory pairs. PMID:24786641

  4. Genome-wide profiling of Hfq-binding RNAs uncovers extensive post-transcriptional rewiring of major stress response and symbiotic regulons in Sinorhizobium meliloti.

    PubMed

    Torres-Quesada, Omar; Reinkensmeier, Jan; Schlüter, Jan-Philip; Robledo, Marta; Peregrina, Alexandra; Giegerich, Robert; Toro, Nicolás; Becker, Anke; Jiménez-Zurdo, Jose I

    2014-01-01

    The RNA chaperone Hfq is a global post-transcriptional regulator in bacteria. Here, we used RNAseq to analyze RNA populations from the legume symbiont Sinorhizobium meliloti that were co-immunoprecipitated (CoIP-RNA) with a FLAG-tagged Hfq in five growth/stress conditions. Hfq-bound transcripts (1315) were largely identified in stressed bacteria and derived from small RNAs (sRNAs), both trans-encoded (6.4%) and antisense (asRNAs; 6.3%), and mRNAs (86%). Pull-down with Hfq recovered a small proportion of annotated S. meliloti sRNAs (14% of trans-sRNAs and 2% of asRNAs) suggesting a discrete impact of this protein in sRNA pathways. Nonetheless, Hfq selectively stabilized CoIP-enriched sRNAs, anticipating that these interactions are functionally significant. Transcription of 26 Hfq-bound sRNAs was predicted to occur from promoters recognized by the major stress σ factors σ(E2) or σ(H1/2). Recovery rates of sRNAs in each of the CoIP-RNA libraries suggest a large impact of Hfq-assisted riboregulation in S. meliloti osmoadaptation. Hfq directly targeted 18% of the predicted S. meliloti mRNAs, which encode functionally diverse proteins involved in transport and metabolism, σ(E2)-dependent stress responses, quorum sensing, flagella biosynthesis, ribosome, and membrane assembly or symbiotic nitrogen fixation. Canonical targeting of the 5' regions of two of the ABC transporter mRNAs by the homologous Hfq-binding AbcR1 and AbcR2 sRNAs leading to inhibition of protein synthesis was confirmed in vivo. We therefore provide a comprehensive resource for the systems-level deciphering of hitherto unexplored S. meliloti stress and symbiotic post-transcriptional regulons and the identification of Hfq-dependent sRNA-mRNA regulatory pairs. PMID:24786641

  5. Cytoskeleton-Dependent Transport as a Potential Target for Interfering with Post-transcriptional HuR mRNA Regulons

    PubMed Central

    Eberhardt, Wolfgang; Badawi, Amel; Biyanee, Abhiruchi; Pfeilschifter, Josef

    2016-01-01

    The ubiquitous mRNA binding protein human antigen R (HuR), a member of the embryonal lethal abnormal vision protein family has a critical impact on the post-transcriptional control of AU-rich element bearing mRNA regulons implied in inflammation, senescence, and carcinogenesis. HuR in addition to mRNA stability can affect many other aspects of mRNA processing including splicing, polyadenylation, translation, modulation of miRNA repression, and intracellular mRNA trafficking. Since many of the identified HuR mRNA targets (“HuR mRNA regulons”) encode tumor-related proteins, HuR is not only discussed as an useful biomarker but also as promising therapeutic target for treatment of various human cancers. HuR which is most abundantly localized in the nucleus is translocated to the cytoplasm which is fundamental for most of the described HuR functions on target mRNAs. Accordingly, an elevation in cytoplasmic HuR was found in many tumors and correlated with a high grade of malignancy and a poor prognosis of patients. Therefore, direct interference with the intracellular trafficking of HuR offers an attractive approach to intervene with pathologically deregulated HuR functions. Data from several laboratories implicate that the integrity of the cytoskeleton is critical for HuR-mediated intracellular mRNA localization and translation. This review will particularly focus on drugs which have proven a direct inhibitory effect on HuR translocation. Based on the results from those studies, we will also discuss on the principle value of targeting cytoskeleton-dependent transport of HuR by natural or synthetic inhibitors as a potential therapeutic avenue for interfering with dysregulated post-transcriptional HuR mRNA regulons and related tumor cell functions. In spite of that, interfering with cytoplasmic HuR transport could highlight a so far underestimated action of microtubule inhibitors clinically used for cancer chemotherapy. PMID:27582706

  6. Comprehensive Definition of the SigH Regulon of Mycobacterium tuberculosis Reveals Transcriptional Control of Diverse Stress Responses.

    PubMed

    Sharp, Jared D; Singh, Atul K; Park, Sang Tae; Lyubetskaya, Anna; Peterson, Matthew W; Gomes, Antonio L C; Potluri, Lakshmi-Prasad; Raman, Sahadevan; Galagan, James E; Husson, Robert N

    2016-01-01

    Expression of SigH, one of 12 Mycobacterium tuberculosis alternative sigma factors, is induced by heat, oxidative and nitric oxide stresses. SigH activation has been shown to increase expression of several genes, including genes involved in maintaining redox equilibrium and in protein degradation. However, few of these are known to be directly regulated by SigH. The goal of this project is to comprehensively define the Mycobacterium tuberculosis genes and operons that are directly controlled by SigH in order to gain insight into the role of SigH in regulating M. tuberculosis physiology. We used ChIP-Seq to identify in vivo SigH binding sites throughout the M. tuberculosis genome, followed by quantification of SigH-dependent expression of genes linked to these sites and identification of SigH-regulated promoters. We identified 69 SigH binding sites, which are located both in intergenic regions and within annotated coding sequences in the annotated M. tuberculosis genome. 41 binding sites were linked to genes that showed greater expression following heat stress in a SigH-dependent manner. We identified several genes not previously known to be regulated by SigH, including genes involved in DNA repair, cysteine biosynthesis, translation, and genes of unknown function. Experimental and computational analysis of SigH-regulated promoter sequences within these binding sites identified strong consensus -35 and -10 promoter sequences, but with tolerance for non-consensus bases at specific positions. This comprehensive identification and validation of SigH-regulated genes demonstrates an extended SigH regulon that controls an unexpectedly broad range of stress response functions. PMID:27003599

  7. Negative transcriptional regulation of a positive regulator: the expression of malT, encoding the transcriptional activator of the maltose regulon of Escherichia coli, is negatively controlled by Mlc.

    PubMed

    Decker, K; Plumbridge, J; Boos, W

    1998-01-01

    The maltose regulon consists of 10 genes encoding a multicomponent and binding protein-dependent ABC transporter for maltose and maltodextrins as well as enzymes necessary for the degradation of these sugars. MalT, the transcriptional activator of the system, is necessary for the transcription of all mal genes. MalK, the energy-transducing subunit of the transport system, acts phenotypically as repressor, particularly when overproduced. We isolated an insertion mutation that strongly reduced the repressing effect of overproduced MalK. The affected gene was sequenced and identified as mlc, a known gene encoding a protein of unknown function with homology to the Escherichia coli NagC protein. The loss of Mlc function led to a threefold increase in malT expression, and the presence of mlc on a multicopy plasmid reduced malT expression. By DNasel protection assay, we found that Mlc protected a DNA region comprising positions +1 to +23 of the malT transcriptional start point. Using a mlc-lacZ fusion in a mlc and mlc+ background, we found that Mlc represses its own expression. As Mlc also regulates another operon (manXYZ, see pages 369-379 of this issue), it may very well constitute a new global regulator of carbohydrate utilization. PMID:9484893

  8. Pho regulon promoter-mediated transcription of the key pathway gene aroGFbr improves the performance of an L-phenylalanine-producing Escherichia coli strain.

    PubMed

    Doroshenko, Vera G; Tsyrenzhapova, Irina S; Krylov, Alexander A; Kiseleva, Evgeniya M; Ermishev, Vladimir Yu; Kazakova, Svetlana M; Biryukova, Irina V; Mashko, Sergey V

    2010-12-01

    DAHP synthase (EC 4.1.2.15) is one of the key enzymes involved in aromatic amino acid biosynthesis in Escherichia coli. An approximately twofold decrease in DAHP synthase activity level was detected in the late growth phase of the L-phenylalanine (Phe)-producing E. coli strain, in which this enzyme encoded by aroG4 is resistant to feedback inhibition. An additional copy of aroG4 that is controlled by promoters of E. coli phoA or pstS genes was integrated into the chromosome of the Phe producer. The choice of promoter was based on the detected activation of the Pho regulon that occurs in response to the depletion of soluble inorganic orthophosphate (P(i)) in the medium, provided that the optical density of the Phe-producing culture did not exceed 70% of its maximum value. Pho-mediated aroG4 transcription increased both the accumulation of Phe and the level of DAHP synthase activity in the late stage of batch cultivation on glucose in P(i)-limited conditions. Disruption of rpoS led to the improved performance of a P(phoA)-aroG4 strain. The pstS promoter that is recognized by the σ(70)/σ(S)-associated core RNA polymerase resulted in the stable maintenance of DAHP synthase activity during long-drawn fed-batch cultivation of the RpoS(+) strain carrying the P(pstS)-aroG4. PMID:20730534

  9. Quantitative and qualitative stem rust resistance factors in barley are associated with transcriptional suppression of defense regulons.

    PubMed

    Moscou, Matthew J; Lauter, Nick; Steffenson, Brian; Wise, Roger P

    2011-07-01

    Stem rust (Puccinia graminis f. sp. tritici; Pgt) is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99) is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known source of qualitative resistance to this aggressive Pgt race. Segregation for resistance observed on seedlings of the Q21861 × SM89010 (QSM) doubled-haploid (DH) population was found to be predominantly qualitative, with little of the remaining variance explained by loci other than Rpg-TTKSK. In contrast, analysis of adult QSM DH plants infected by field inoculum of Pgt race TTKSK in Njoro, Kenya, revealed several additional quantitative trait loci that contribute to resistance. To molecularly characterize these loci, Barley1 GeneChips were used to measure the expression of 22,792 genes in the QSM population after inoculation with Pgt race TTKSK or mock-inoculation. Comparison of expression Quantitative Trait Loci (eQTL) between treatments revealed an inoculation-dependent expression polymorphism implicating Actin depolymerizing factor3 (within the Rpg-TTKSK locus) as a candidate susceptibility gene. In parallel, we identified a chromosome 2H trans-eQTL hotspot that co-segregates with an enhancer of Rpg-TTKSK-mediated, adult plant resistance discovered through the Njoro field trials. Our genome-wide eQTL studies demonstrate that transcript accumulation of 25% of barley genes is altered following challenge by Pgt race TTKSK, but that few of these genes are regulated by the qualitative Rpg-TTKSK on chromosome 5H. It is instead the chromosome 2H trans-eQTL hotspot that orchestrates the largest inoculation-specific responses, where enhanced resistance is associated with transcriptional suppression of hundreds of genes scattered throughout the genome. Hence, the present study associates the early suppression of genes expressed in this host-pathogen interaction with enhancement

  10. Characterization of a cAMP responsive transcription factor, Cmr (Rv1675c), in TB complex mycobacteria reveals overlap with the DosR (DevR) dormancy regulon.

    PubMed

    Ranganathan, Sridevi; Bai, Guangchun; Lyubetskaya, Anna; Knapp, Gwendowlyn S; Peterson, Matthew W; Gazdik, Michaela; C Gomes, Antonio L; Galagan, James E; McDonough, Kathleen A

    2016-01-01

    Mycobacterium tuberculosis (Mtb) Cmr (Rv1675c) is a CRP/FNR family transcription factor known to be responsive to cAMP levels and during macrophage infections. However, Cmr's DNA binding properties, cellular targets and overall role in tuberculosis (TB) complex bacteria have not been characterized. In this study, we used experimental and computational approaches to characterize Cmr's DNA binding properties and identify a putative regulon. Cmr binds a 16-bp palindromic site that includes four highly conserved nucleotides that are required for DNA binding. A total of 368 binding sites, distributed in clusters among ~200 binding regions throughout the Mycobacterium bovis BCG genome, were identified using ChIP-seq. One of the most enriched Cmr binding sites was located upstream of the cmr promoter, and we demonstrated that expression of cmr is autoregulated. cAMP affected Cmr binding at a subset of DNA loci in vivo and in vitro, including multiple sites adjacent to members of the DosR (DevR) dormancy regulon. Our findings of cooperative binding of Cmr to these DNA regions and the regulation by Cmr of the DosR-regulated virulence gene Rv2623 demonstrate the complexity of Cmr-mediated gene regulation and suggest a role for Cmr in the biology of persistent TB infection. PMID:26358810

  11. Characterization of a cAMP responsive transcription factor, Cmr (Rv1675c), in TB complex mycobacteria reveals overlap with the DosR (DevR) dormancy regulon

    PubMed Central

    Ranganathan, Sridevi; Bai, Guangchun; Lyubetskaya, Anna; Knapp, Gwendowlyn S.; Peterson, Matthew W.; Gazdik, Michaela; C. Gomes, Antonio L.; Galagan, James E.; McDonough, Kathleen A.

    2016-01-01

    Mycobacterium tuberculosis (Mtb) Cmr (Rv1675c) is a CRP/FNR family transcription factor known to be responsive to cAMP levels and during macrophage infections. However, Cmr's DNA binding properties, cellular targets and overall role in tuberculosis (TB) complex bacteria have not been characterized. In this study, we used experimental and computational approaches to characterize Cmr's DNA binding properties and identify a putative regulon. Cmr binds a 16-bp palindromic site that includes four highly conserved nucleotides that are required for DNA binding. A total of 368 binding sites, distributed in clusters among ∼200 binding regions throughout the Mycobacterium bovis BCG genome, were identified using ChIP-seq. One of the most enriched Cmr binding sites was located upstream of the cmr promoter, and we demonstrated that expression of cmr is autoregulated. cAMP affected Cmr binding at a subset of DNA loci in vivo and in vitro, including multiple sites adjacent to members of the DosR (DevR) dormancy regulon. Our findings of cooperative binding of Cmr to these DNA regions and the regulation by Cmr of the DosR-regulated virulence gene Rv2623 demonstrate the complexity of Cmr-mediated gene regulation and suggest a role for Cmr in the biology of persistent TB infection. PMID:26358810

  12. Genome-Wide Chromatin Immunoprecipitation Sequencing Analysis Shows that WhiB Is a Transcription Factor That Cocontrols Its Regulon with WhiA To Initiate Developmental Cell Division in Streptomyces

    PubMed Central

    Chandra, Govind; Bibb, Maureen J.; Findlay, Kim C.; Buttner, Mark J.

    2016-01-01

    ABSTRACT WhiB is the founding member of a family of proteins (the WhiB-like [Wbl] family) that carry a [4Fe-4S] iron-sulfur cluster and play key roles in diverse aspects of the biology of actinomycetes, including pathogenesis, antibiotic resistance, and the control of development. In Streptomyces, WhiB is essential for the process of developmentally controlled cell division that leads to sporulation. The biochemical function of Wbl proteins has been controversial; here, we set out to determine unambiguously if WhiB functions as a transcription factor using chromatin immunoprecipitation sequencing (ChIP-seq) in Streptomyces venezuelae. In the first demonstration of in vivo genome-wide Wbl binding, we showed that WhiB regulates the expression of key genes required for sporulation by binding upstream of ~240 transcription units. Strikingly, the WhiB regulon is identical to the previously characterized WhiA regulon, providing an explanation for the identical phenotypes of whiA and whiB mutants. Using ChIP-seq, we demonstrated that in vivo DNA binding by WhiA depends on WhiB and vice versa, showing that WhiA and WhiB function cooperatively to control expression of a common set of WhiAB target genes. Finally, we show that mutation of the cysteine residues that coordinate the [4Fe-4S] cluster in WhiB prevents DNA binding by both WhiB and WhiA in vivo. PMID:27094333

  13. PePPER: a webserver for prediction of prokaryote promoter elements and regulons

    PubMed Central

    2012-01-01

    Background Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison algorithms are currently available for identifying transcription factor binding sites (TFBSs) and their accompanying TFs and regulon members. Results We here extend the current databases of TFs, TFBSs and regulons with our knowledge on Lactococcus lactis and developed a webserver for prediction, mining and visualization of prokaryote promoter elements and regulons via a novel concept. This new approach includes an all-in-one method of data mining for TFs, TFBSs, promoters, and regulons for any bacterial genome via a user-friendly webserver. We demonstrate the power of this method by mining WalRK regulons in Lactococci and Streptococci and, vice versa, use L. lactis regulon data (CodY) to mine closely related species. Conclusions The PePPER webserver offers, besides the all-in-one analysis method, a toolbox for mining for regulons, promoters and TFBSs and accommodates a new L. lactis regulon database in addition to already existing regulon data. Identification of putative regulons and full annotation of intergenic regions in any bacterial genome on the basis of existing knowledge on a related organism can now be performed by biologists and it can be done for a wide range of regulons. On the basis of the PePPER output, biologist can design experiments to further verify the existence and extent of the proposed regulons. The PePPER webserver is freely accessible at http://pepper.molgenrug.nl. PMID:22747501

  14. Jumbled genomes: missing Apicomplexan synteny.

    PubMed

    DeBarry, Jeremy D; Kissinger, Jessica C

    2011-10-01

    Whole-genome comparisons provide insight into genome evolution by informing on gene repertoires, gene gains/losses, and genome organization. Most of our knowledge about eukaryotic genome evolution is derived from studies of multicellular model organisms. The eukaryotic phylum Apicomplexa contains obligate intracellular protist parasites responsible for a wide range of human and veterinary diseases (e.g., malaria, toxoplasmosis, and theileriosis). We have developed an in silico protein-encoding gene based pipeline to investigate synteny across 12 apicomplexan species from six genera. Genome rearrangement between lineages is extensive. Syntenic regions (conserved gene content and order) are rare between lineages and appear to be totally absent across the phylum, with no group of three genes found on the same chromosome and in the same order within 25 kb up- and downstream of any orthologous genes. Conserved synteny between major lineages is limited to small regions in Plasmodium and Theileria/Babesia species, and within these conserved regions, there are a number of proteins putatively targeted to organelles. The observed overall lack of synteny is surprising considering the divergence times and the apparent absence of transposable elements (TEs) within any of the species examined. TEs are ubiquitous in all other groups of eukaryotes studied to date and have been shown to be involved in genomic rearrangements. It appears that there are different criteria governing genome evolution within the Apicomplexa relative to other well-studied unicellular and multicellular eukaryotes. PMID:21504890

  15. The dual transcriptional regulator CysR in Corynebacterium glutamicum ATCC 13032 controls a subset of genes of the McbR regulon in response to the availability of sulphide acceptor molecules

    PubMed Central

    Rückert, Christian; Milse, Johanna; Albersmeier, Andreas; Koch, Daniel J; Pühler, Alfred; Kalinowski, Jörn

    2008-01-01

    Background Regulation of sulphur metabolism in Corynebacterium glutamicum ATCC 13032 has been studied intensively in the last few years, due to its industrial as well as scientific importance. Previously, the gene cg0156 was shown to belong to the regulon of McbR, a global transcriptional repressor of sulphur metabolism in C. glutamicum. This gene encodes a putative ROK-type regulator, a paralogue of the activator of sulphonate utilisation, SsuR. Therefore, it is an interesting candidate for study to further the understanding of the regulation of sulphur metabolism in C. glutamicum. Results Deletion of cg0156, now designated cysR, results in the inability of the mutant to utilise sulphate and aliphatic sulphonates. DNA microarray hybridisations revealed 49 genes with significantly increased and 48 with decreased transcript levels in presence of the native CysR compared to a cysR deletion mutant. Among the genes positively controlled by CysR were the gene cluster involved in sulphate reduction, fpr2 cysIXHDNYZ, and ssuR. Gel retardation experiments demonstrated that binding of CysR to DNA depends in vitro on the presence of either O-acetyl-L-serine or O-acetyl-L-homoserine. Mapping of the transcription start points of five transcription units helped to identify a 10 bp inverted repeat as the possible CysR binding site. Subsequent in vivo tests proved this motif to be necessary for CysR-dependent transcriptional regulation. Conclusion CysR acts as the functional analogue of the unrelated LysR-type regulator CysB from Escherichia coli, controlling sulphide production in response to acceptor availability. In both bacteria, gene duplication events seem to have taken place which resulted in the evolution of dedicated regulators for the control of sulphonate utilisation. The striking convergent evolution of network topology indicates the strong selective pressure to control the metabolism of the essential but often toxic sulphur-containing (bio-)molecules. PMID:18854009

  16. GlnR-Mediated Regulation of ectABCD Transcription Expands the Role of the GlnR Regulon to Osmotic Stress Management

    PubMed Central

    Shao, ZhiHui; Deng, WanXin; Li, ShiYuan; He, JuanMei; Ren, ShuangXi; Huang, WeiRen; Lu, YinHua; Zhao, GuoPing

    2015-01-01

    ABSTRACT Ectoine and hydroxyectoine are excellent compatible solutes for bacteria to deal with environmental osmotic stress and temperature damages. The biosynthesis cluster of ectoine and hydroxyectoine is widespread among microorganisms, and its expression is activated by high salinity and temperature changes. So far, little is known about the mechanism of the regulation of the transcription of ect genes and only two MarR family regulators (EctR1 in methylobacteria and the EctR1-related regulator CosR in Vibrio cholerae) have been found to negatively regulate the expression of ect genes. Here, we characterize GlnR, the global regulator for nitrogen metabolism in actinomycetes, as a negative regulator for the transcription of ectoine/hydroxyectoine biosynthetic genes (ect operon) in Streptomyces coelicolor. The physiological role of this transcriptional repression by GlnR is proposed to protect the intracellular glutamate pool, which acts as a key nitrogen donor for both the nitrogen metabolism and the ectoine/hydroxyectoine biosynthesis. IMPORTANCE High salinity is deleterious, and cells must evolve sophisticated mechanisms to cope with this osmotic stress. Although production of ectoine and hydroxyectoine is one of the most frequently adopted strategies, the in-depth mechanism of regulation of their biosynthesis is less understood. So far, only two MarR family negative regulators, EctR1 and CosR, have been identified in methylobacteria and Vibrio, respectively. Here, our work demonstrates that GlnR, the global regulator for nitrogen metabolism, is a negative transcriptional regulator for ect genes in Streptomyces coelicolor. Moreover, a close relationship is found between nitrogen metabolism and osmotic resistance, and GlnR-mediated regulation of ect transcription is proposed to protect the intracellular glutamate pool. Meanwhile, the work reveals the multiple roles of GlnR in bacterial physiology. PMID:26170409

  17. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses

    PubMed Central

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin

    2016-01-01

    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria. PMID:26975728

  18. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses.

    PubMed

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin

    2016-01-01

    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria. PMID:26975728

  19. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses

    NASA Astrophysics Data System (ADS)

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin

    2016-03-01

    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria.

  20. Oxidative Stress Control by Apicomplexan Parasites

    PubMed Central

    Izui, Natália M.; Schettert, Isolmar; Liebau, Eva

    2015-01-01

    Apicomplexan parasites cause infectious diseases that are either a severe public health problem or an economic burden. In this paper we will shed light on how oxidative stress can influence the host-pathogen relationship by focusing on three major diseases: babesiosis, coccidiosis, and toxoplasmosis. PMID:25722976

  1. Functional modules of sigma factor regulons guarantee adaptability and evolvability

    PubMed Central

    Binder, Sebastian C.; Eckweiler, Denitsa; Schulz, Sebastian; Bielecka, Agata; Nicolai, Tanja; Franke, Raimo; Häussler, Susanne; Meyer-Hermann, Michael

    2016-01-01

    The focus of modern molecular biology turns from assigning functions to individual genes towards understanding the expression and regulation of complex sets of molecules. Here, we provide evidence that alternative sigma factor regulons in the pathogen Pseudomonas aeruginosa largely represent insulated functional modules which provide a critical level of biological organization involved in general adaptation and survival processes. Analysis of the operational state of the sigma factor network revealed that transcription factors functionally couple the sigma factor regulons and significantly modulate the transcription levels in the face of challenging environments. The threshold quality of newly evolved transcription factors was reached faster and more robustly in in silico testing when the structural organization of sigma factor networks was taken into account. These results indicate that the modular structures of alternative sigma factor regulons provide P. aeruginosa with a robust framework to function adequately in its environment and at the same time facilitate evolutionary change. Our data support the view that widespread modularity guarantees robustness of biological networks and is a key driver of evolvability. PMID:26915971

  2. Functional modules of sigma factor regulons guarantee adaptability and evolvability.

    PubMed

    Binder, Sebastian C; Eckweiler, Denitsa; Schulz, Sebastian; Bielecka, Agata; Nicolai, Tanja; Franke, Raimo; Häussler, Susanne; Meyer-Hermann, Michael

    2016-01-01

    The focus of modern molecular biology turns from assigning functions to individual genes towards understanding the expression and regulation of complex sets of molecules. Here, we provide evidence that alternative sigma factor regulons in the pathogen Pseudomonas aeruginosa largely represent insulated functional modules which provide a critical level of biological organization involved in general adaptation and survival processes. Analysis of the operational state of the sigma factor network revealed that transcription factors functionally couple the sigma factor regulons and significantly modulate the transcription levels in the face of challenging environments. The threshold quality of newly evolved transcription factors was reached faster and more robustly in in silico testing when the structural organization of sigma factor networks was taken into account. These results indicate that the modular structures of alternative sigma factor regulons provide P. aeruginosa with a robust framework to function adequately in its environment and at the same time facilitate evolutionary change. Our data support the view that widespread modularity guarantees robustness of biological networks and is a key driver of evolvability. PMID:26915971

  3. Functional modules of sigma factor regulons guarantee adaptability and evolvability

    NASA Astrophysics Data System (ADS)

    Binder, Sebastian C.; Eckweiler, Denitsa; Schulz, Sebastian; Bielecka, Agata; Nicolai, Tanja; Franke, Raimo; Häussler, Susanne; Meyer-Hermann, Michael

    2016-02-01

    The focus of modern molecular biology turns from assigning functions to individual genes towards understanding the expression and regulation of complex sets of molecules. Here, we provide evidence that alternative sigma factor regulons in the pathogen Pseudomonas aeruginosa largely represent insulated functional modules which provide a critical level of biological organization involved in general adaptation and survival processes. Analysis of the operational state of the sigma factor network revealed that transcription factors functionally couple the sigma factor regulons and significantly modulate the transcription levels in the face of challenging environments. The threshold quality of newly evolved transcription factors was reached faster and more robustly in in silico testing when the structural organization of sigma factor networks was taken into account. These results indicate that the modular structures of alternative sigma factor regulons provide P. aeruginosa with a robust framework to function adequately in its environment and at the same time facilitate evolutionary change. Our data support the view that widespread modularity guarantees robustness of biological networks and is a key driver of evolvability.

  4. Regulon inference without arbitrary thresholds: three levels of sensitivity

    SciTech Connect

    Dubchak, Pavel Novichkov, Elena Stavrovskaya, Dmitry Rodionov, Andrey Mironov, Inna; Rodionov, Dmitry; Mironov, Andrey; Dubchak, Inna; Novichkov, P.S.

    2010-11-15

    Reconstruction of transcriptional regulatory networks is one of the major challenges facing the bioinformatics community in view of constantly growing number of complete genomes. The comparative genomics approach has been successfully used for the analysis of the transcriptional regulation of many metabolic systems in various bacteria taxa. The key step in this approach is given a position weight matrix, find an optimal threshold for the search of potential binding sites in genomes. In our previous work we proposed an approach for automatic selection of TFBS score threshold coupled with inference of regulon content. In this study we developed two modifications of this approach providing two additional levels of sensitivity.

  5. The response of Bacillus licheniformis to heat and ethanol stress and the role of the SigB regulon.

    PubMed

    Voigt, Birgit; Schroeter, Rebecca; Jürgen, Britta; Albrecht, Dirk; Evers, Stefan; Bongaerts, Johannes; Maurer, Karl-Heinz; Schweder, Thomas; Hecker, Michael

    2013-07-01

    The heat and ethanol stress response of Bacillus licheniformis DSM13 was analyzed at the transcriptional and/or translational level. During heat shock, regulons known to be heat-induced in Bacillus subtilis 168 are upregulated in B. licheniformis, such as the HrcA, SigB, CtsR, and CssRS regulon. Upregulation of the SigY regulon and of genes controlled by other extracytoplasmic function (ECF) sigma factors indicates a cell-wall stress triggered by the heat shock. Furthermore, tryptophan synthesis enzymes were upregulated in heat stressed cells as well as regulons involved in usage of alternative carbon and nitrogen sources. Ethanol stress led to an induction of the SigB, HrcA, and CtsR regulons. As indicated by the upregulation of a SigM-dependent protein, ethanol also triggered a cell wall stress. To characterize the SigB regulon of B. licheniformis, we analyzed the heat stress response of a sigB mutant. It is shown that the B. licheniformis SigB regulon comprises additional genes, some of which do not exist in B. subtilis, such as BLi03885, encoding a hypothetical protein, the Na/solute symporter gene BLi02212, the arginase homolog-encoding gene BLi00198 and mcrA, encoding a protein with endonuclease activity. PMID:23592518

  6. The Fnr Regulon of Bacillus subtilis†

    PubMed Central

    Reents, Heike; Münch, Richard; Dammeyer, Thorben; Jahn, Dieter; Härtig, Elisabeth

    2006-01-01

    The Bacillus subtilis transcriptional regulator Fnr is an integral part of the regulatory cascade required for the adaptation of the bacterium to low oxygen tension. The B. subtilis Fnr regulon was defined via transcriptomic analysis in combination with bioinformatic-based binding site prediction. Four distinct groups of Fnr-dependent genes were observed. Group 1 genes (narKfnr, narGHJI, and arfM) are generally induced by Fnr under anaerobic conditions. All corresponding promoters contain an essential Fnr-binding site centered −41.5/−40.5 bp upstream of the transcriptional start point, suggesting their induction by direct Fnr interaction. Group 2 genes (alsSD, ldh lctP, ywcJ, and cydABCD) are characterized by anaerobic repression in the presence of nitrate. Mutational analysis of the Fnr-binding sites found in three of the corresponding promoters excluded their function in Fnr-mediated repression. Genetic evidence showing that group 2 genes are anaerobically repressed by nitrate reductase formation was accumulated. A possible role of the redox regulator YdiH in the regulation of group 2 genes was initially investigated. Group 3 genes are characterized by their Fnr-dependent activation in the presence of nitrate and the lack of an Fnr-binding site in their promoters. The analysis of Group 3 gene transcription (ykuNOP and ydbN) indicated that Fnr induces nitrate reductase production, which leads to the formation of the regulatory compound nitrite from nitrate. Finally, the group 4 operon acoABCL, lacking an Fnr-binding site, requires Fnr-dependent nitrate reductase formation for its general anaerobic induction. A regulatory model for the observed complex Fnr-mediated gene expression was deduced. PMID:16428414

  7. DISTILLER: a data integration framework to reveal condition dependency of complex regulons in Escherichia coli

    PubMed Central

    Lemmens, Karen; De Bie, Tijl; Dhollander, Thomas; De Keersmaecker, Sigrid C; Thijs, Inge M; Schoofs, Geert; De Weerdt, Ami; De Moor, Bart; Vanderleyden, Jos; Collado-Vides, Julio; Engelen, Kristof; Marchal, Kathleen

    2009-01-01

    We present DISTILLER, a data integration framework for the inference of transcriptional module networks. Experimental validation of predicted targets for the well-studied fumarate nitrate reductase regulator showed the effectiveness of our approach in Escherichia coli. In addition, the condition dependency and modularity of the inferred transcriptional network was studied. Surprisingly, the level of regulatory complexity seemed lower than that which would be expected from RegulonDB, indicating that complex regulatory programs tend to decrease the degree of modularity. PMID:19265557

  8. Recent advances in understanding apicomplexan parasites.

    PubMed

    Seeber, Frank; Steinfelder, Svenja

    2016-01-01

    Intracellular single-celled parasites belonging to the large phylum Apicomplexa are amongst the most prevalent and morbidity-causing pathogens worldwide. In this review, we highlight a few of the many recent advances in the field that helped to clarify some important aspects of their fascinating biology and interaction with their hosts. Plasmodium falciparum causes malaria, and thus the recent emergence of resistance against the currently used drug combinations based on artemisinin has been of major interest for the scientific community. It resulted in great advances in understanding the resistance mechanisms that can hopefully be translated into altered future drug regimens. Apicomplexa are also experts in host cell manipulation and immune evasion. Toxoplasma gondii and Theileria sp., besides Plasmodium sp., are species that secrete effector molecules into the host cell to reach this aim. The underlying molecular mechanisms for how these proteins are trafficked to the host cytosol ( T. gondii and Plasmodium) and how a secreted protein can immortalize the host cell ( Theileria sp.) have been illuminated recently. Moreover, how such secreted proteins affect the host innate immune responses against T. gondii and the liver stages of Plasmodium has also been unraveled at the genetic and molecular level, leading to unexpected insights. Methodological advances in metabolomics and molecular biology have been instrumental to solving some fundamental puzzles of mitochondrial carbon metabolism in Apicomplexa. Also, for the first time, the generation of stably transfected Cryptosporidium parasites was achieved, which opens up a wide variety of experimental possibilities for this understudied, important apicomplexan pathogen. PMID:27347391

  9. Recent advances in understanding apicomplexan parasites

    PubMed Central

    Seeber, Frank; Steinfelder, Svenja

    2016-01-01

    Intracellular single-celled parasites belonging to the large phylum Apicomplexa are amongst the most prevalent and morbidity-causing pathogens worldwide. In this review, we highlight a few of the many recent advances in the field that helped to clarify some important aspects of their fascinating biology and interaction with their hosts. Plasmodium falciparum causes malaria, and thus the recent emergence of resistance against the currently used drug combinations based on artemisinin has been of major interest for the scientific community. It resulted in great advances in understanding the resistance mechanisms that can hopefully be translated into altered future drug regimens. Apicomplexa are also experts in host cell manipulation and immune evasion. Toxoplasma gondii and Theileria sp., besides Plasmodium sp., are species that secrete effector molecules into the host cell to reach this aim. The underlying molecular mechanisms for how these proteins are trafficked to the host cytosol ( T. gondii and Plasmodium) and how a secreted protein can immortalize the host cell ( Theileria sp.) have been illuminated recently. Moreover, how such secreted proteins affect the host innate immune responses against T. gondii and the liver stages of Plasmodium has also been unraveled at the genetic and molecular level, leading to unexpected insights. Methodological advances in metabolomics and molecular biology have been instrumental to solving some fundamental puzzles of mitochondrial carbon metabolism in Apicomplexa. Also, for the first time, the generation of stably transfected Cryptosporidium parasites was achieved, which opens up a wide variety of experimental possibilities for this understudied, important apicomplexan pathogen. PMID:27347391

  10. Tracking Transmission of Apicomplexan Symbionts in Diverse Caribbean Corals

    PubMed Central

    Kirk, Nathan L.; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W.; Fogarty, Nicole D.; Santos, Scott R.

    2013-01-01

    Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are

  11. The GlnR Regulon in Streptococcus mutans Is Differentially Regulated by GlnR and PmrA.

    PubMed

    Chen, Yi-Ywan M; Chen, Yueh-Ying; Hung, Jui-Lung; Chen, Pei-Min; Chia, Jean-San

    2016-01-01

    GlnR-mediated repression of the GlnR regulon at acidic pH is required for optimal acid tolerance in Streptococcus mutans, the etiologic agent for dental caries. Unlike most streptococci, the GlnR regulon is also regulated by newly identified PmrA (SMUGS5_RS05810) at the transcriptional level in S. mutans GS5. Results from gel mobility shift assays confirmed that both GlnR and PmrA recognized the putative GlnR box in the promoter regions of the GlnR regulon genes. By using a chemostat culture system, we found that PmrA activated the expression of the GlnR regulon at pH 7, and that this activation was enhanced by excess glucose. Deletion of pmrA (strain ΔPmrA) reduced the survival rate of S. mutans GS5 at pH 3 moderately, whereas the GlnR mutant (strain ΔGlnR) exhibited an acid-sensitive phenotype in the acid killing experiments. Elevated biofilm formation in both ΔGlnR and ΔPmrA mutant strains is likely a result of indirect regulation of the GlnR regulon since GlnR and PmrA regulate the regulon differently. Taken together, it is suggested that activation of the GlnR regulon by PmrA at pH 7 ensures adequate biosynthesis of amino acid precursor, whereas repression by GlnR at acidic pH allows greater ATP generation for acid tolerance. The tight regulation of the GlnR regulon in response to pH provides an advantage for S. mutans to better survive in its primary niche, the oral cavity. PMID:27454482

  12. The GlnR Regulon in Streptococcus mutans Is Differentially Regulated by GlnR and PmrA

    PubMed Central

    Chen, Yi-Ywan M.; Chen, Yueh-Ying; Hung, Jui-Lung; Chen, Pei-Min; Chia, Jean-San

    2016-01-01

    GlnR-mediated repression of the GlnR regulon at acidic pH is required for optimal acid tolerance in Streptococcus mutans, the etiologic agent for dental caries. Unlike most streptococci, the GlnR regulon is also regulated by newly identified PmrA (SMUGS5_RS05810) at the transcriptional level in S. mutans GS5. Results from gel mobility shift assays confirmed that both GlnR and PmrA recognized the putative GlnR box in the promoter regions of the GlnR regulon genes. By using a chemostat culture system, we found that PmrA activated the expression of the GlnR regulon at pH 7, and that this activation was enhanced by excess glucose. Deletion of pmrA (strain ΔPmrA) reduced the survival rate of S. mutans GS5 at pH 3 moderately, whereas the GlnR mutant (strain ΔGlnR) exhibited an acid-sensitive phenotype in the acid killing experiments. Elevated biofilm formation in both ΔGlnR and ΔPmrA mutant strains is likely a result of indirect regulation of the GlnR regulon since GlnR and PmrA regulate the regulon differently. Taken together, it is suggested that activation of the GlnR regulon by PmrA at pH 7 ensures adequate biosynthesis of amino acid precursor, whereas repression by GlnR at acidic pH allows greater ATP generation for acid tolerance. The tight regulation of the GlnR regulon in response to pH provides an advantage for S. mutans to better survive in its primary niche, the oral cavity. PMID:27454482

  13. Characterization of the ςB Regulon in Staphylococcus aureus

    PubMed Central

    Gertz, Silke; Engelmann, Susanne; Schmid, Roland; Ziebandt, Anne-Kathrin; Tischer, Karsten; Scharf, Christian; Hacker, Jörg; Hecker, Michael

    2000-01-01

    The ςB-dependent stress regulon in gram-positive bacteria might fulfill a physiological role in stress response and virulence similar to that of the ςS regulon in Escherichia coli and other gram-negative bacteria. In order to obtain evidence for the function of the ςB regulon of Staphylococcus aureus, especially in virulence control, ςB-dependent stress genes were identified. The two-dimensional protein pattern of wild-type cells of S. aureus COL was compared with that of an isogenic sigB mutant. By this approach, we found that the synthesis of about 27 cytoplasmic proteins seemed to be under the positive control of ςB. N-terminal sequencing of 18 proteins allowed the identification of their genes on the almost finished genome sequence of S. aureus COL and the analysis of the promoter structure. Transcriptional analyses of 11 of these genes confirmed their ςB dependency, and moreover, about 7 additional ςB-dependent genes were found which are cotranscribed with the newly detected genes, forming operons. Altogether, we identified 23 ςB-dependent genes and their corresponding proteins. Among them are proteins probably involved in the generation of NADH or in membrane transport mechanisms. Furthermore, at least one clpC-homologous gene was localized on the S. aureus sequence solely transcribed by ςB. In contrast, a second clpC-homologous gene in S. aureus forming an operon with ctsR, yacH, and yacI was ςB independently expressed. PMID:11092859

  14. N-Acetylgalactosamine Utilization Pathway and Regulon in Proteobacteria

    PubMed Central

    Leyn, Semen A.; Gao, Fang; Yang, Chen; Rodionov, Dmitry A.

    2012-01-01

    We used a comparative genomics approach to reconstruct the N-acetyl-d-galactosamine (GalNAc) and galactosamine (GalN) utilization pathways and transcriptional regulons in Proteobacteria. The reconstructed GalNAc/GalN utilization pathways include multiple novel genes with specific functional roles. Most of the pathway variations were attributed to the amino sugar transport, phosphorylation, and deacetylation steps, whereas the downstream catabolic enzymes in the pathway were largely conserved. The predicted GalNAc kinase AgaK, the novel variant of GalNAc-6-phosphate deacetylase AgaAII and the GalN-6-phosphate deaminase AgaS from Shewanella sp. ANA-3 were validated in vitro using individual enzymatic assays and reconstitution of the three-step pathway. By using genetic techniques, we confirmed that AgaS but not AgaI functions as the main GalN-6-P deaminase in the GalNAc/GalN utilization pathway in Escherichia coli. Regulons controlled by AgaR repressors were reconstructed by bioinformatics in most proteobacterial genomes encoding GalNAc pathways. Candidate AgaR-binding motifs share a common sequence with consensus CTTTC that was found in multiple copies and arrangements in regulatory regions of aga genes. This study provides comprehensive insights into the common and distinctive features of the GalNAc/GalN catabolism and its regulation in diverse Proteobacteria. PMID:22711537

  15. Characterization of the YdeO Regulon in Escherichia coli

    PubMed Central

    Yamanaka, Yuki; Oshima, Taku; Ishihama, Akira; Yamamoto, Kaneyoshi

    2014-01-01

    Enterobacteria are able to survive under stressful conditions within animals, such as acidic conditions in the stomach, bile salts during transfer to the intestine and anaerobic conditions within the intestine. The glutamate-dependent (GAD) system plays a major role in acid resistance in Escherichia coli, and expression of the GAD system is controlled by the regulatory cascade consisting of EvgAS > YdeO > GadE. To understand the YdeO regulon in vivo, we used ChIP-chip to interrogate the E. coli genome for candidate YdeO binding sites. All of the seven operons identified by ChIP-chip as being potentially regulated by YdeO were confirmed as being under the direct control of YdeO using RT-qPCR, EMSA, DNaseI-footprinting and reporter assays. Within this YdeO regulon, we identified four stress-response transcription factors, DctR, NhaR, GadE, and GadW and enzymes for anaerobic respiration. Both GadE and GadW are involved in regulation of the GAD system and NhaR is an activator for the sodium/proton antiporter gene. In conjunction with co-transcribed Slp, DctR is involved in protection against metabolic endoproducts under acidic conditions. Taken all together, we suggest that YdeO is a key regulator of E. coli survival in both acidic and anaerobic conditions. PMID:25375160

  16. Comparative genomics of metabolic capacities of regulons controlled by cis-regulatory RNA motifs in bacteria

    PubMed Central

    2013-01-01

    Background In silico comparative genomics approaches have been efficiently used for functional prediction and reconstruction of metabolic and regulatory networks. Riboswitches are metabolite-sensing structures often found in bacterial mRNA leaders controlling gene expression on transcriptional or translational levels. An increasing number of riboswitches and other cis-regulatory RNAs have been recently classified into numerous RNA families in the Rfam database. High conservation of these RNA motifs provides a unique advantage for their genomic identification and comparative analysis. Results A comparative genomics approach implemented in the RegPredict tool was used for reconstruction and functional annotation of regulons controlled by RNAs from 43 Rfam families in diverse taxonomic groups of Bacteria. The inferred regulons include ~5200 cis-regulatory RNAs and more than 12000 target genes in 255 microbial genomes. All predicted RNA-regulated genes were classified into specific and overall functional categories. Analysis of taxonomic distribution of these categories allowed us to establish major functional preferences for each analyzed cis-regulatory RNA motif family. Overall, most RNA motif regulons showed predictable functional content in accordance with their experimentally established effector ligands. Our results suggest that some RNA motifs (including thiamin pyrophosphate and cobalamin riboswitches that control the cofactor metabolism) are widespread and likely originated from the last common ancestor of all bacteria. However, many more analyzed RNA motifs are restricted to a narrow taxonomic group of bacteria and likely represent more recent evolutionary innovations. Conclusions The reconstructed regulatory networks for major known RNA motifs substantially expand the existing knowledge of transcriptional regulation in bacteria. The inferred regulons can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and

  17. Comparative Genomics of DtxR Family Regulons for Metal Homeostasis in Archaea

    PubMed Central

    Leyn, Semen A.

    2014-01-01

    The DtxR family consists of metal-dependent transcription factors (DtxR-TFs) that regulate the expression of genes involved in metal homeostasis in the cell. The majority of characterized DtxR-TFs belong to Bacteria. In the current work, we applied a comparative genomics approach to predict DNA-binding sites and reconstruct regulons for DtxR-TFs in Archaea. As a result, we inferred 575 candidate binding sites for 139 DtxR-TFs in 77 genomes from 15 taxonomic orders. Novel DNA motifs of archaeal DtxR-TFs that have a common palindromic structure were classified into 10 distinct groups. By combining functional regulon reconstructions with phylogenetic analysis, we selected 28 DtxR-TF clades and assigned them metal specificities and regulator names. The reconstructed FetR (ferrous iron), MntR (manganese), and ZntR (zinc) regulons largely contain known or putative metal uptake transporters from the FeoAB, NRAMP, ZIP, and TroA families. A novel family of putative iron transporters (named Irt), including multiple FetR-regulated paralogs, was identified in iron-oxidizing Archaea from the Sulfolobales order. The reconstructed DtxR-TF regulons were reconciled with available transcriptomics data in Archaeoglobus, Halobacterium, and Thermococcus spp. PMID:25404694

  18. Apicomplexan cell cycle flexibility: centrosome controls the clutch

    PubMed Central

    Chen, Chun-Ti; Gubbels, Marc-Jan

    2015-01-01

    The centrosome serves as a central hub coordinating multiple cellular events in eukaryotes. A recent study in Toxoplasma gondii revealed a unique bipartite structure of the centrosome, which coordinates the nuclear cycle (S-phase and mitosis) and budding cycle (cytokinesis) of the parasite, and deciphers the principle behind flexible apicomplexan cell division modes. PMID:25899747

  19. Diversity of extracellular proteins during the transition from the 'proto-apicomplexan' alveolates to the apicomplexan obligate parasites.

    PubMed

    Templeton, Thomas J; Pain, Arnab

    2016-01-01

    The recent completion of high-coverage draft genome sequences for several alveolate protozoans - namely, the chromerids, Chromera velia and Vitrella brassicaformis; the perkinsid Perkinsus marinus; the apicomplexan, Gregarina niphandrodes, as well as high coverage transcriptome sequence information for several colpodellids, allows for new genome-scale comparisons across a rich landscape of apicomplexans and other alveolates. Genome annotations can now be used to help interpret fine ultrastructure and cell biology, and guide new studies to describe a variety of alveolate life strategies, such as symbiosis or free living, predation, and obligate intracellular parasitism, as well to provide foundations to dissect the evolutionary transitions between these niches. This review focuses on the attempt to identify extracellular proteins which might mediate the physical interface of cell-cell interactions within the above life strategies, aided by annotation of the repertoires of predicted surface and secreted proteins encoded within alveolate genomes. In particular, we discuss what descriptions of the predicted extracellular proteomes reveal regarding a hypothetical last common ancestor of a pre-apicomplexan alveolate - guided by ultrastructure, life strategies and phylogenetic relationships - in an attempt to understand the evolution of obligate parasitism in apicomplexans. PMID:26585326

  20. The Regulation of the AdcR Regulon in Streptococcus pneumoniae Depends Both on Zn2+- and Ni2+-Availability

    PubMed Central

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P.

    2015-01-01

    By using a transcriptomic approach, we have elucidated the effect of Ni2+ on the global gene expression of S. pneumoniae D39 by identifying several differentially expressed genes/operons in the presence of a high extracellular concentration of Ni2+. The genes belonging to the AdcR regulon (adcRCBA, adcAII-phtD, phtA, phtB, and phtE) and the PsaR regulon (pcpA, prtA, and psaBCA) were highly upregulated in the presence of Ni2+. We have further studied the role of Ni2+ in the regulation of the AdcR regulon by using ICP-MS analysis, electrophoretic mobility shift assays and transcriptional lacZ-reporter studies, and demonstrate that Ni2+ is directly involved in the derepression of the AdcR regulon via the Zn2+-dependent repressor AdcR, and has an opposite effect on the expression of the AdcR regulon compared to Zn2+. PMID:26697415

  1. iRegulon: From a Gene List to a Gene Regulatory Network Using Large Motif and Track Collections

    PubMed Central

    Imrichová, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein

    2014-01-01

    Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from http://iregulon.aertslab.org. PMID:25058159

  2. Targeting Purine and Pyrimidine Metabolism in Human Apicomplexan Parasites

    PubMed Central

    Hyde, John E.

    2009-01-01

    Synthesis de novo, acquisition by salvage and interconversion of purines and pyrimidines represent the fundamental requirements for their eventual assembly into nucleic acids as nucleotides and the deployment of their derivatives in other biochemical pathways. A small number of drugs targeted to nucleotide metabolism, by virtue of their effect on folate biosynthesis and recycling, have been successfully used against apicomplexan parasites such as Plasmodium and Toxoplasma for many years, although resistance is now a major problem in the prevention and treatment of malaria. Many targets not involving folate metabolism have also been explored at the experimental level. However, the unravelling of the genome sequences of these eukaryotic unicellular organisms, together with increasingly sophisticated molecular analyses, opens up possibilities of introducing new drugs that could interfere with these processes. This review examines the status of established drugs of this type and the potential for further exploiting the vulnerability of apicomplexan human pathogens to inhibition of this key area of metabolism. PMID:17266529

  3. Parasite calcineurin regulates host cell recognition and attachment by apicomplexans

    PubMed Central

    Paul, Aditya S.; Saha, Sudeshna; Engelberg, Klemens; Jiang, Rays H.Y.; Coleman, Bradley I.; Kosber, Aziz L.; Chen, Chun-Ti; Ganter, Markus; Espy, Nicole; Gilberger, Tim W.; Gubbels, Marc-Jan; Duraisingh, Manoj T.

    2015-01-01

    SUMMARY Apicomplexans invade a variety of metazoan host cells through mechanisms involving host cell receptor engagement and secretion of parasite factors to facilitate cellular attachment. We find that the parasite homolog of calcineurin, a calcium-regulated phosphatase complex central to signal transduction in eukaryotes, also contributes to host cell invasion by the malaria parasite Plasmodium falciparum and related Toxoplasma gondii. Using reverse genetic and chemical-genetic approaches, we determine that calcineurin critically regulates and stabilizes attachment of extracellular P. falciparum to host erythrocytes before intracellular entry and has similar functions in host cell engagement by T. gondii. Calcineurin-mediated Plasmodium invasion is strongly associated with host receptors required for host cell recognition and calcineurin function distinguishes this form of receptor-mediated attachment from a second mode of host-parasite adhesion independent of host receptors. This specific role of calcineurin in coordinating physical interactions with host cells highlights an ancestral mechanism for parasitism used by apicomplexans. PMID:26118996

  4. Computational analysis of LexA regulons in Cyanobacteria

    PubMed Central

    2010-01-01

    Background The transcription factor LexA plays an important role in the SOS response in Escherichia coli and many other bacterial species studied. Although the lexA gene is encoded in almost every bacterial group with a wide range of evolutionary distances, its precise functions in each group/species are largely unknown. More recently, it has been shown that lexA genes in two cyanobacterial genomes Nostoc sp. PCC 7120 and Synechocystis sp. PCC 6803 might have distinct functions other than the regulation of the SOS response. To gain a general understanding of the functions of LexA and its evolution in cyanobacteria, we conducted the current study. Results Our analysis indicates that six of 33 sequenced cyanobacterial genomes do not harbor a lexA gene although they all encode the key SOS response genes, suggesting that LexA is not an indispensable transcription factor in these cyanobacteria, and that their SOS responses might be regulated by different mechanisms. Our phylogenetic analysis suggests that lexA was lost during the course of evolution in these six cyanobacterial genomes. For the 26 cyanobacterial genomes that encode a lexA gene, we have predicted their LexA-binding sites and regulons using an efficient binding site/regulon prediction algorithm that we developed previously. Our results show that LexA in most of these 26 genomes might still function as the transcriptional regulator of the SOS response genes as seen in E. coli and other organisms. Interestingly, putative LexA-binding sites were also found in some genomes for some key genes involved in a variety of other biological processes including photosynthesis, drug resistance, etc., suggesting that there is crosstalk between the SOS response and these biological processes. In particular, LexA in both Synechocystis sp. PCC6803 and Gloeobacter violaceus PCC7421 has largely diverged from those in other cyanobacteria in the sequence level. It is likely that LexA is no longer a regulator of the SOS response

  5. Identification of the CRE-1 Cellulolytic Regulon in Neurospora crassa

    PubMed Central

    Sun, Jianping; Glass, N. Louise

    2011-01-01

    Background In filamentous ascomycete fungi, the utilization of alternate carbon sources is influenced by the zinc finger transcription factor CreA/CRE-1, which encodes a carbon catabolite repressor protein homologous to Mig1 from Saccharomyces cerevisiae. In Neurospora crassa, deletion of cre-1 results in increased secretion of amylase and β-galactosidase. Methodology/Principal Findings Here we show that a strain carrying a deletion of cre-1 has increased cellulolytic activity and increased expression of cellulolytic genes during growth on crystalline cellulose (Avicel). Constitutive expression of cre-1 complements the phenotype of a N. crassa Δcre-1 strain grown on Avicel, and also results in stronger repression of cellulolytic protein secretion and enzyme activity. We determined the CRE-1 regulon by investigating the secretome and transcriptome of a Δcre-1 strain as compared to wild type when grown on Avicel versus minimal medium. Chromatin immunoprecipitation-PCR of putative target genes showed that CRE-1 binds to only some adjacent 5′-SYGGRG-3′ motifs, consistent with previous findings in other fungi, and suggests that unidentified additional regulatory factors affect CRE-1 binding to promoter regions. Characterization of 30 mutants containing deletions in genes whose expression level increased in a Δcre-1 strain under cellulolytic conditions identified novel genes that affect cellulase activity and protein secretion. Conclusions/Significance Our data provide comprehensive information on the CRE-1 regulon in N. crassa and contribute to deciphering the global role of carbon catabolite repression in filamentous ascomycete fungi during plant cell wall deconstruction. PMID:21980519

  6. Regulation of the Arabidopsis CBF regulon by a complex low-temperature regulatory network.

    PubMed

    Park, Sunchung; Lee, Chin-Mei; Doherty, Colleen J; Gilmour, Sarah J; Kim, YongSig; Thomashow, Michael F

    2015-04-01

    Exposure of Arabidopsis thaliana plants to low non-freezing temperatures results in an increase in freezing tolerance that involves action of the C-repeat binding factor (CBF) regulatory pathway. CBF1, CBF2 and CBF3, which are rapidly induced in response to low temperature, encode closely related AP2/ERF DNA-binding proteins that recognize the C-repeat (CRT)/dehydration-responsive element (DRE) DNA regulatory element present in the promoters of CBF-regulated genes. The CBF transcription factors alter the expression of more than 100 genes, known as the CBF regulon, which contribute to an increase in freezing tolerance. In this study, we investigated the extent to which cold induction of the CBF regulon is regulated by transcription factors other than CBF1, CBF2 and CBF3, and whether freezing tolerance is dependent on a functional CBF-CRT/DRE regulatory module. To address these issues we generated transgenic lines that constitutively overexpressed a truncated version of CBF2 that had dominant negative effects on the function of the CBF-CRT/DRE regulatory module, and 11 transcription factors encoded by genes that were rapidly cold-induced in parallel with the 'first-wave' CBF genes, and determined the effects that overexpressing these proteins had on global gene expression and freezing tolerance. Our results indicate that cold regulation of the CBF regulon involves extensive co-regulation by other first-wave transcription factors; that the low-temperature regulatory network beyond the CBF pathway is complex and highly interconnected; and that the increase in freezing tolerance that occurs with cold acclimation is only partially dependent on the CBF-CRT/DRE regulatory module. PMID:25736223

  7. Promoter Strength Properties of the Complete Sigma E Regulon of Escherichia coli and Salmonella enterica▿ †

    PubMed Central

    Mutalik, Vivek K.; Nonaka, Gen; Ades, Sarah E.; Rhodius, Virgil A.; Gross, Carol A.

    2009-01-01

    The σE-directed envelope stress response maintains outer membrane homeostasis and is an important virulence determinant upon host infection in Escherichia coli and related bacteria. σE is activated by at least two distinct mechanisms: accumulation of outer membrane porin precursors and an increase in the alarmone ppGpp upon transition to stationary phase. Expression of the σE regulon is driven from a suite of approximately 60 σE-dependent promoters. Using green fluorescent protein fusions to each of these promoters, we dissected promoter contributions to the output of the regulon under a variety of in vivo conditions. We found that the σE promoters exhibit a large dynamic range, with a few strong and many weak promoters. Interestingly, the strongest promoters control either transcriptional regulators or functions related to porin homeostasis, the very functions conserved among E. coli and its close relatives. We found that (i) the strength of most promoters is significantly affected by the presence of the upstream (−35 to −65) region of the promoter, which encompasses the UP element, a binding site for the C-terminal domain of the α-subunit of RNA polymerase; (ii) ppGpp generally activates σE promoters, and (iii) σE promoters are responsive to changing σE holoenzyme levels under physiological conditions, reinforcing the idea that the σE regulon is extremely dynamic, enabling cellular adaptation to a constantly changing environment. PMID:19783623

  8. The DosR Regulon Modulates Adaptive Immunity and Is Essential for Mycobacterium tuberculosis Persistence

    PubMed Central

    Mehra, Smriti; Foreman, Taylor W.; Didier, Peter J.; Ahsan, Muhammad H.; Hudock, Teresa A.; Kissee, Ryan; Golden, Nadia A.; Gautam, Uma S.; Johnson, Ann-Marie; Alvarez, Xavier; Russell-Lodrigue, Kasi E.; Doyle, Lara A.; Roy, Chad J.; Niu, Tianhua; Blanchard, James L.; Khader, Shabaana A.; Lackner, Andrew A.; Sherman, David R.

    2015-01-01

    Rationale: Hypoxia promotes dormancy by causing physiologic changes to actively replicating Mycobacterium tuberculosis. DosR controls the response of M. tuberculosis to hypoxia. Objectives: To understand DosR's contribution in the persistence of M. tuberculosis, we compared the phenotype of various DosR regulon mutants and a complemented strain to M. tuberculosis in macaques, which faithfully model M. tuberculosis infection. Methods: We measured clinical and microbiologic correlates of infection with M. tuberculosis relative to mutant/complemented strains in the DosR regulon, studied lung pathology and hypoxia, and compared immune responses in lung using transcriptomics and flow cytometry. Measurements and Main Results: Despite being able to replicate initially, mutants in DosR regulon failed to persist or cause disease. On the contrary, M. tuberculosis and a complemented strain were able to establish infection and tuberculosis. The attenuation of pathogenesis in animals infected with the mutants coincided with the appearance of a Th1 response and organization of hypoxic lesions wherein M. tuberculosis expressed dosR. The lungs of animals infected with the mutants (but not the complemented strain) exhibited early transcriptional signatures of T-cell recruitment, activation, and proliferation associated with an increase of T cells expressing homing and proliferation markers. Conclusions: Delayed adaptive responses, a hallmark of M. tuberculosis infection, not only lead to persistence but also interfere with the development of effective antituberculosis vaccines. The DosR regulon therefore modulates both the magnitude and the timing of adaptive immune responses in response to hypoxia in vivo, resulting in persistent infection. Hence, DosR regulates key aspects of the M. tuberculosis life cycle and limits lung pathology. PMID:25730547

  9. Ni induces the CRR1-dependent regulon revealing overlap and distinction between hypoxia and Cu deficiency responses in Chlamydomonas reinhardtii.

    PubMed

    Blaby-Haas, Crysten E; Castruita, Madeli; Fitz-Gibbon, Sorel T; Kropat, Janette; Merchant, Sabeeha S

    2016-07-13

    The selectivity of metal sensors for a single metal ion is critical for cellular metal homeostasis. A suite of metal-responsive regulators is required to maintain a prescribed balance of metal ions ensuring that each apo-protein binds the correct metal. However, there are cases when non-essential metals ions disrupt proper metal sensing. An analysis of the Ni-responsive transcriptome of the green alga Chlamydomonas reinhardtii reveals that Ni artificially turns on the CRR1-dependent Cu-response regulon. Since this regulon also responds to hypoxia, a combinatorial transcriptome analysis was leveraged to gain insight into the mechanisms by which Ni interferes with the homeostatic regulation of Cu and oxygen status. Based on parallels with the effect of Ni on the hypoxic response in animals, we propose that a possible link between Cu, oxygen and Ni sensing is an as yet uncharacterized prolyl hydroxylase that regulates a co-activator of CRR1. This analysis also identified transcriptional responses to the pharmacological activation of the Cu-deficiency regulon. Although the Ni-responsive CRR1 regulon is composed of 56 genes (defined as the primary response), 259 transcripts responded to Ni treatment only when a copy of the wild-type CRR1 gene was present. The genome-wide impact of CRR1 target genes on the transcriptome was also evident from the 210 transcripts that were at least 2-fold higher in the crr1 strain, where the abundance of many CRR1 targets was suppressed. Additionally, we identified 120 transcripts that responded to Ni independent of CRR1 function. The putative functions of the proteins encoded by these transcripts suggest that high Ni results in protein damage. PMID:27172123

  10. Modulating Salmonella Typhimurium's Response to a Changing Environment through Bacterial Enhancer-Binding Proteins and the RpoN Regulon

    PubMed Central

    Hartman, Christine E.; Samuels, David J.; Karls, Anna C.

    2016-01-01

    Transcription sigma factors direct the selective binding of RNA polymerase holoenzyme (Eσ) to specific promoters. Two families of sigma factors determine promoter specificity, the σ70 (RpoD) family and the σ54 (RpoN) family. In transcription controlled by σ54, the Eσ54-promoter closed complex requires ATP hydrolysis by an associated bacterial enhancer-binding protein (bEBP) for the transition to open complex and transcription initiation. Given the wide host range of Salmonella enterica serovar Typhimurium, it is an excellent model system for investigating the roles of RpoN and its bEBPs in modulating the lifestyle of bacteria. The genome of S. Typhimurium encodes 13 known or predicted bEBPs, each responding to a unique intracellular or extracellular signal. While the regulons of most alternative sigma factors respond to a specific environmental or developmental signal, the RpoN regulon is very diverse, controlling genes for response to nitrogen limitation, nitric oxide stress, availability of alternative carbon sources, phage shock/envelope stress, toxic levels of zinc, nucleic acid damage, and other stressors. This review explores how bEBPs respond to environmental changes encountered by S. Typhimurium during transmission/infection and influence adaptation through control of transcription of different components of the S. Typhimurium RpoN regulon. PMID:27583250

  11. Modulating Salmonella Typhimurium's Response to a Changing Environment through Bacterial Enhancer-Binding Proteins and the RpoN Regulon.

    PubMed

    Hartman, Christine E; Samuels, David J; Karls, Anna C

    2016-01-01

    Transcription sigma factors direct the selective binding of RNA polymerase holoenzyme (Eσ) to specific promoters. Two families of sigma factors determine promoter specificity, the σ(70) (RpoD) family and the σ(54) (RpoN) family. In transcription controlled by σ(54), the Eσ(54)-promoter closed complex requires ATP hydrolysis by an associated bacterial enhancer-binding protein (bEBP) for the transition to open complex and transcription initiation. Given the wide host range of Salmonella enterica serovar Typhimurium, it is an excellent model system for investigating the roles of RpoN and its bEBPs in modulating the lifestyle of bacteria. The genome of S. Typhimurium encodes 13 known or predicted bEBPs, each responding to a unique intracellular or extracellular signal. While the regulons of most alternative sigma factors respond to a specific environmental or developmental signal, the RpoN regulon is very diverse, controlling genes for response to nitrogen limitation, nitric oxide stress, availability of alternative carbon sources, phage shock/envelope stress, toxic levels of zinc, nucleic acid damage, and other stressors. This review explores how bEBPs respond to environmental changes encountered by S. Typhimurium during transmission/infection and influence adaptation through control of transcription of different components of the S. Typhimurium RpoN regulon. PMID:27583250

  12. Relation of intracellular signal levels and promoter activities in the gal regulon of Escherichia coli.

    PubMed

    Krishna, Sandeep; Orosz, László; Sneppen, Kim; Adhya, Sankar; Semsey, Szabolcs

    2009-08-28

    Transcription of many genes is regulated by combinations of multiple signals. In Escherichia coli, combinatorial control is typical in the case of operons related to utilization of different sugars in the absence of glucose. To understand regulation of the transport and metabolic pathways in the galactose system, we measured activities of the six gal regulon promoters simultaneously, using an in vitro transcription system containing purified components. Input functions were computed on the basis of the experimental measurements. We observed four different shapes of input functions. From the results, we can conclude that the structure of the regulatory network is insufficient for the determination of signal integration. It is the actual structure of the promoter and regulatory region, the mechanism of transcription regulation, and the interplay between transcription factors that shape the input function to be suitable for adaptation. PMID:19559028

  13. Genomic Reconstruction of the Transcriptional Regulatory Network in Bacillus subtilis

    PubMed Central

    Leyn, Semen A.; Kazanov, Marat D.; Sernova, Natalia V.; Ermakova, Ekaterina O.; Novichkov, Pavel S.

    2013-01-01

    The adaptation of microorganisms to their environment is controlled by complex transcriptional regulatory networks (TRNs), which are still only partially understood even for model species. Genome scale annotation of regulatory features of genes and TRN reconstruction are challenging tasks of microbial genomics. We used the knowledge-driven comparative-genomics approach implemented in the RegPredict Web server to infer TRN in the model Gram-positive bacterium Bacillus subtilis and 10 related Bacillales species. For transcription factor (TF) regulons, we combined the available information from the DBTBS database and the literature with bioinformatics tools, allowing inference of TF binding sites (TFBSs), comparative analysis of the genomic context of predicted TFBSs, functional assignment of target genes, and effector prediction. For RNA regulons, we used known RNA regulatory motifs collected in the Rfam database to scan genomes and analyze the genomic context of new RNA sites. The inferred TRN in B. subtilis comprises regulons for 129 TFs and 24 regulatory RNA families. First, we analyzed 66 TF regulons with previously known TFBSs in B. subtilis and projected them to other Bacillales genomes, resulting in refinement of TFBS motifs and identification of novel regulon members. Second, we inferred motifs and described regulons for 28 experimentally studied TFs with previously unknown TFBSs. Third, we discovered novel motifs and reconstructed regulons for 36 previously uncharacterized TFs. The inferred collection of regulons is available in the RegPrecise database (http://regprecise.lbl.gov/) and can be used in genetic experiments, metabolic modeling, and evolutionary analysis. PMID:23504016

  14. Genomic reconstruction of the transcriptional regulatory network in Bacillus subtilis.

    PubMed

    Leyn, Semen A; Kazanov, Marat D; Sernova, Natalia V; Ermakova, Ekaterina O; Novichkov, Pavel S; Rodionov, Dmitry A

    2013-06-01

    The adaptation of microorganisms to their environment is controlled by complex transcriptional regulatory networks (TRNs), which are still only partially understood even for model species. Genome scale annotation of regulatory features of genes and TRN reconstruction are challenging tasks of microbial genomics. We used the knowledge-driven comparative-genomics approach implemented in the RegPredict Web server to infer TRN in the model Gram-positive bacterium Bacillus subtilis and 10 related Bacillales species. For transcription factor (TF) regulons, we combined the available information from the DBTBS database and the literature with bioinformatics tools, allowing inference of TF binding sites (TFBSs), comparative analysis of the genomic context of predicted TFBSs, functional assignment of target genes, and effector prediction. For RNA regulons, we used known RNA regulatory motifs collected in the Rfam database to scan genomes and analyze the genomic context of new RNA sites. The inferred TRN in B. subtilis comprises regulons for 129 TFs and 24 regulatory RNA families. First, we analyzed 66 TF regulons with previously known TFBSs in B. subtilis and projected them to other Bacillales genomes, resulting in refinement of TFBS motifs and identification of novel regulon members. Second, we inferred motifs and described regulons for 28 experimentally studied TFs with previously unknown TFBSs. Third, we discovered novel motifs and reconstructed regulons for 36 previously uncharacterized TFs. The inferred collection of regulons is available in the RegPrecise database (http://regprecise.lbl.gov/) and can be used in genetic experiments, metabolic modeling, and evolutionary analysis. PMID:23504016

  15. RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond.

    PubMed

    Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muñiz-Rascado, Luis; García-Sotelo, Jair Santiago; Alquicira-Hernández, Kevin; Martínez-Flores, Irma; Pannier, Lucia; Castro-Mondragón, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martínez, César; Pérez-Rueda, Ernesto; Alquicira-Hernández, Shirley; Porrón-Sotelo, Liliana; López-Fuentes, Alejandra; Hernández-Koutoucheva, Anastasia; Del Moral-Chávez, Víctor; Rinaldi, Fabio; Collado-Vides, Julio

    2016-01-01

    RegulonDB (http://regulondb.ccg.unam.mx) is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for 'neighborhood' genes to known operons and regulons, and computational developments. PMID:26527724

  16. RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond

    PubMed Central

    Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muñiz-Rascado, Luis; García-Sotelo, Jair Santiago; Alquicira-Hernández, Kevin; Martínez-Flores, Irma; Pannier, Lucia; Castro-Mondragón, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martínez, César; Pérez-Rueda, Ernesto; Alquicira-Hernández, Shirley; Porrón-Sotelo, Liliana; López-Fuentes, Alejandra; Hernández-Koutoucheva, Anastasia; Moral-Chávez, Víctor Del; Rinaldi, Fabio; Collado-Vides, Julio

    2016-01-01

    RegulonDB (http://regulondb.ccg.unam.mx) is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for ‘neighborhood’ genes to known operons and regulons, and computational developments. PMID:26527724

  17. Activation of the latent PlcR regulon in Bacillus anthracis.

    PubMed

    Sastalla, Inka; Maltese, Lauren M; Pomerantseva, Olga M; Pomerantsev, Andrei P; Keane-Myers, Andrea; Leppla, Stephen H

    2010-10-01

    Many genes in Bacillus cereus and Bacillus thuringiensis are under the control of the transcriptional regulator PlcR and its regulatory peptide, PapR. In Bacillus anthracis, the causative agent of anthrax, PlcR is inactivated by truncation, and consequently genes having PlcR binding sites are expressed at very low levels when compared with B. cereus. We found that activation of the PlcR regulon in B. anthracis by expression of a PlcR-PapR fusion protein does not alter sporulation in strains containing the virulence plasmid pXO1 and thereby the global regulator AtxA. Using comparative 2D gel electrophoresis, we showed that activation of the PlcR regulon in B. anthracis leads to upregulation of many proteins found in the secretome of B. cereus, including phospholipases and proteases, such as the putative protease BA1995. Transcriptional analysis demonstrated expression of BA1995 to be dependent on PlcR-PapR, even though the putative PlcR recognition site of the BA1995 gene does not exactly match the PlcR consensus sequence, explaining why this protein had escaped recognition as belonging to the PlcR regulon. Additionally, while transcription of major PlcR-dependent haemolysins, sphingomyelinase and anthrolysin O is enhanced in response to PlcR activation in B. anthracis, only anthrolysin O contributes significantly to lysis of human erythrocytes. In contrast, the toxicity of bacterial culture supernatants from a PlcR-positive strain towards murine macrophages occurred independently of anthrolysin O expression in vitro and in vivo. PMID:20688829

  18. Evidence classification of high-throughput protocols and confidence integration in RegulonDB.

    PubMed

    Weiss, Verena; Medina-Rivera, Alejandra; Huerta, Araceli M; Santos-Zavaleta, Alberto; Salgado, Heladia; Morett, Enrique; Collado-Vides, Julio

    2013-01-01

    RegulonDB provides curated information on the transcriptional regulatory network of Escherichia coli and contains both experimental data and computationally predicted objects. To account for the heterogeneity of these data, we introduced in version 6.0, a two-tier rating system for the strength of evidence, classifying evidence as either 'weak' or 'strong' (Gama-Castro,S., Jimenez-Jacinto,V., Peralta-Gil,M. et al. RegulonDB (Version 6.0): gene regulation model of Escherichia Coli K-12 beyond transcription, active (experimental) annotated promoters and textpresso navigation. Nucleic Acids Res., 2008;36:D120-D124.). We now add to our classification scheme the classification of high-throughput evidence, including chromatin immunoprecipitation (ChIP) and RNA-seq technologies. To integrate these data into RegulonDB, we present two strategies for the evaluation of confidence, statistical validation and independent cross-validation. Statistical validation involves verification of ChIP data for transcription factor-binding sites, using tools for motif discovery and quality assessment of the discovered matrices. Independent cross-validation combines independent evidence with the intention to mutually exclude false positives. Both statistical validation and cross-validation allow to upgrade subsets of data that are supported by weak evidence to a higher confidence level. Likewise, cross-validation of strong confidence data extends our two-tier rating system to a three-tier system by introducing a third confidence score 'confirmed'. Database URL: http://regulondb.ccg.unam.mx/ PMID:23327937

  19. Prevalence of encysted apicomplexans in muscles of raptors.

    PubMed

    Lindsay, D S; Blagburn, B L

    1999-01-28

    An acid-pepsin digestion technique was used to examine portions of breast muscle and heart from raptors for encysted protozoans. Apicomplexan zoites were present in 52 (45.6%) of the 114 samples examined: 11 of 12 (91.7%) red-shouldered hawks (Buteo lineatus), 20 of 34 (58.8%) red-tailed hawks (Buteo jamaicensis), two of seven (28.6%) Cooper's hawks (Accipiter cooperi), three of four (75%) sharp-shinned hawks (Accipiter striatus), one (100%) Mississippi kites (Ictinia misisippiensis), one of two (50%) American kestrels (Falco sparverius), one bald eagle (Haliaeetus leucocephalus), one of two (50%) golden eagles (Aquila chrysaetos), one of three (33%) turkey vultures (Cathartes aura), two of three (66.7%) black vultures (Coragyps atratus), three of six (50%) great-horned owls (Bubo virginianus), five of 15 (33.3%) barred owls (Strix varia), and one of 12 (8.3%) screech owls (Asio otus). Encysted protozoans were not observed in digests of tissues from three broad-winged hawks (Buteo platypterus), four ospreys (Pandion haliaetus), and five barn owls (Tyto alba). Apicomplexan cysts resembling Sarcocystis species were observed in tissue sections of muscles from 28 (37.8%) of 74 raptors. PMID:9950339

  20. In silico analysis of the cyclophilin repertoire of apicomplexan parasites

    PubMed Central

    Krücken, Jürgen; Greif, Gisela; von Samson-Himmelstjerna, Georg

    2009-01-01

    Background Cyclophilins (Cyps) are peptidyl cis/trans isomerases implicated in diverse processes such as protein folding, signal transduction, and RNA processing. They are also candidate drug targets, in particular for the immunosuppressant cyclosporine A. In addition, cyclosporine is known to exhibit anti-parasitic effects on a wide range of organisms including several apicomplexa. In order to obtain new non-immunosuppressive drugs targeting apicomplexan cyclophilins, a profound knowledge of the cyclophilin repertoire of this phylum would be necessary. Results BLAST and maximum likelihood analyses identified 16 different cyclophilin subfamilies within the genomes of Cryptosporidium hominis, Toxoplasma gondii, Plasmodium falciparum, Theileria annulata, Theileria parva, and Babesia bovis. In addition to good statistical support from the phylogenetic analysis, these subfamilies are also confirmed by comparison of cyclophilin domain architecture. Within an individual genome, the number of different Cyp genes that could be deduced varies between 7–9 for Cryptosporidia and 14 for T. gondii. Many of the putative apicomplexan cyclophilins are predicted to be nuclear proteins, most of them presumably involved in RNA processing. Conclusion The genomes of apicomplexa harbor a cyclophilin repertoire that is at least as complex as that of most fungi. The identification of Cyp subfamilies that are specific for lower eukaryotes, apicomplexa, or even the genus Plasmodium is of particular interest since these subfamilies are not present in host cells and might therefore represent attractive drug targets. PMID:19555495

  1. An SOS Regulon under Control of a Noncanonical LexA-Binding Motif in the Betaproteobacteria

    PubMed Central

    Sanchez-Alberola, Neus; Campoy, Susana; Emerson, David; Barbé, Jordi

    2015-01-01

    ABSTRACT The SOS response is a transcriptional regulatory network governed by the LexA repressor that activates in response to DNA damage. In the Betaproteobacteria, LexA is known to target a palindromic sequence with the consensus sequence CTGT-N8-ACAG. We report the characterization of a LexA regulon in the iron-oxidizing betaproteobacterium Sideroxydans lithotrophicus. In silico and in vitro analyses show that LexA targets six genes by recognizing a binding motif with the consensus sequence GAACGaaCGTTC, which is strongly reminiscent of the Bacillus subtilis LexA-binding motif. We confirm that the closely related Gallionella capsiferriformans shares the same LexA-binding motif, and in silico analyses indicate that this motif is also conserved in the Nitrosomonadales and the Methylophilales. Phylogenetic analysis of LexA and the alpha subunit of DNA polymerase III (DnaE) reveal that the organisms harboring this noncanonical LexA form a compact taxonomic cluster within the Betaproteobacteria. However, their lexA gene is unrelated to the standard Betaproteobacteria lexA, and there is evidence of its spread through lateral gene transfer. In contrast to other reported cases of noncanonical LexA-binding motifs, the regulon of S. lithotrophicus is comparable in size and function to that of many other Betaproteobacteria, suggesting that a convergent SOS regulon has reevolved under the control of a new LexA protein. Analysis of the DNA-binding domain of S. lithotrophicus LexA reveals little sequence similarity with that of other LexA proteins targeting similar binding motifs, suggesting that network structure may limit site evolution or that structural constrains make the B. subtilis-type motif an optimal interface for multiple LexA sequences. IMPORTANCE Understanding the evolution of transcriptional systems enables us to address important questions in microbiology, such as the emergence and transfer potential of different regulatory systems to regulate virulence or

  2. The multifaceted RisA regulon of Bordetella pertussis.

    PubMed

    Coutte, Loïc; Huot, Ludovic; Antoine, Rudy; Slupek, Stephanie; Merkel, Tod J; Chen, Qing; Stibitz, Scott; Hot, David; Locht, Camille

    2016-01-01

    The whooping cough agent Bordetella pertussis regulates the production of its virulence factors by the BvgA/S system. Phosphorylated BvgA activates the virulence-activated genes (vags) and represses the expression of the virulence-repressed genes (vrgs) via the activation of the bvgR gene. In modulating conditions, with MgSO4, the BvgA/S system is inactive, and the vrgs are expressed. Here, we show that the expression of almost all vrgs depends on RisA, another transcriptional regulator. We also show that some vags are surprisingly no longer modulated by MgSO4 in the risA(-) background. RisA also regulates the expression of other genes, including chemotaxis and flagellar operons, iron-regulated genes, and genes of unknown function, which may or may not be controlled by BvgA/S. We identified RisK as the likely cognate RisA kinase and found that it is important for expression of most, but not all RisA-regulated genes. This was confirmed using the phosphoablative RisAD(60)N and the phosphomimetic RisAD(60)E analogues. Thus the RisA regulon adds a new layer of complexity to B. pertussis virulence gene regulation. PMID:27620673

  3. A novel sigma factor reveals a unique regulon controlling cell-specific recombination in Mycoplasma genitalium.

    PubMed

    Torres-Puig, Sergi; Broto, Alicia; Querol, Enrique; Piñol, Jaume; Pich, Oscar Q

    2015-05-26

    The Mycoplasma genitalium MG428 protein shows homology to members of the sigma-70 family of sigma factors. Herein, we found that MG428 activates transcription of recA, ruvA and ruvB as well as several genes with unknown function. Deletion of MG_428 or some of the up-regulated unknown genes led to severe recombination defects. Single cell analyses revealed that activation of the MG428-regulon is a rare event under laboratory growth conditions. A conserved sequence with sigma-70 promoter architecture (TTGTCA-N(18/19)-ATTWAT) was identified in the upstream region of all of the MG428-regulated genes or operons. Primer extension analyses demonstrated that transcription initiates immediately downstream of this sigma70-type promoter in a MG428-dependent manner. Furthermore, mutagenesis of the conserved -10 and -35 elements corroborated the requirement of these regions for promoter function. Therefore, a new mycoplasma promoter directs transcription of a unique recombination regulon. Additionally, MG428 was found to interact with the RNAP core enzyme, reinforcing the predicted role of this protein as an alternative sigma factor. Finally, our results indicate that MG428 contributes to the generation of genetic diversity in this model organism. Since recombination is an important mechanism to generate antigenic variation, MG428 emerges as a novel factor contributing to M. genitalium virulence. PMID:25925568

  4. A novel sigma factor reveals a unique regulon controlling cell-specific recombination in Mycoplasma genitalium

    PubMed Central

    Torres-Puig, Sergi; Broto, Alicia; Querol, Enrique; Piñol, Jaume; Pich, Oscar Q.

    2015-01-01

    The Mycoplasma genitalium MG428 protein shows homology to members of the sigma-70 family of sigma factors. Herein, we found that MG428 activates transcription of recA, ruvA and ruvB as well as several genes with unknown function. Deletion of MG_428 or some of the up-regulated unknown genes led to severe recombination defects. Single cell analyses revealed that activation of the MG428-regulon is a rare event under laboratory growth conditions. A conserved sequence with sigma-70 promoter architecture (TTGTCA-N18/19-ATTWAT) was identified in the upstream region of all of the MG428-regulated genes or operons. Primer extension analyses demonstrated that transcription initiates immediately downstream of this sigma70-type promoter in a MG428-dependent manner. Furthermore, mutagenesis of the conserved −10 and −35 elements corroborated the requirement of these regions for promoter function. Therefore, a new mycoplasma promoter directs transcription of a unique recombination regulon. Additionally, MG428 was found to interact with the RNAP core enzyme, reinforcing the predicted role of this protein as an alternative sigma factor. Finally, our results indicate that MG428 contributes to the generation of genetic diversity in this model organism. Since recombination is an important mechanism to generate antigenic variation, MG428 emerges as a novel factor contributing to M. genitalium virulence. PMID:25925568

  5. Sterol Composition and Biosynthetic Genes of Vitrella brassicaformis, a Recently Discovered Chromerid: Comparison to Chromera velia and Phylogenetic Relationship with Apicomplexan Parasites.

    PubMed

    Khadka, Manoj; Salem, Mohamed; Leblond, Jeffrey D

    2015-01-01

    Vitrella brassicaformis is the second discovered species in the Chromerida, and first in the family Vitrellaceae. Chromera velia, the first discovered species, forms an independent photosynthetic lineage with V. brassicaformis, and both are closely related to peridinin-containing dinoflagellates and nonphotosynthetic apicomplexans; both also show phylogenetic closeness with red algal plastids. We have utilized gas chromatography/mass spectrometry to identify two free sterols, 24-ethylcholest-5-en-3β-ol, and a minor unknown sterol which appeared to be a C(28:4) compound. We have also used RNA Seq analysis to identify seven genes found in the nonmevalonate/methylerythritol pathway (MEP) for sterol biosynthesis. Subsequent genome analysis of V. brassicaformis showed the presence of two mevalonate (MVA) pathway genes, though the genes were not observed in the transcriptome analysis. Transcripts from four genes (dxr, ispf, ispd, and idi) were selected and translated into proteins to study the phylogenetic relationship of sterol biosynthesis in V. brassicaformis and C. velia to other groups of algae and apicomplexans. On the basis of our genomic and transcriptomic analyses, we hypothesize that the MEP pathway was the primary pathway that apicomplexans used for sterol biosynthesis before they lost their sterol biosynthesis ability, although contribution of the MVA pathway cannot be discounted. PMID:25996517

  6. Factors mediating plastid dependency and the origins of parasitism in apicomplexans and their close relatives

    PubMed Central

    Janouškovec, Jan; Tikhonenkov, Denis V.; Burki, Fabien; Howe, Alexis T.; Kolísko, Martin; Mylnikov, Alexander P.; Keeling, Patrick J.

    2015-01-01

    Apicomplexans are a major lineage of parasites, including causative agents of malaria and toxoplasmosis. How such highly adapted parasites evolved from free-living ancestors is poorly understood, particularly because they contain nonphotosynthetic plastids with which they have a complex metabolic dependency. Here, we examine the origin of apicomplexan parasitism by resolving the evolutionary distribution of several key characteristics in their closest free-living relatives, photosynthetic chromerids and predatory colpodellids. Using environmental sequence data, we describe the diversity of these apicomplexan-related lineages and select five species that represent this diversity for transcriptome sequencing. Phylogenomic analysis recovered a monophyletic lineage of chromerids and colpodellids as the sister group to apicomplexans, and a complex distribution of retention versus loss for photosynthesis, plastid genomes, and plastid organelles. Reconstructing the evolution of all plastid and cytosolic metabolic pathways related to apicomplexan plastid function revealed an ancient dependency on plastid isoprenoid biosynthesis, predating the divergence of apicomplexan and dinoflagellates. Similarly, plastid genome retention is strongly linked to the retention of two genes in the plastid genome, sufB and clpC, altogether suggesting a relatively simple model for plastid retention and loss. Lastly, we examine the broader distribution of a suite of molecular characteristics previously linked to the origins of apicomplexan parasitism and find that virtually all are present in their free-living relatives. The emergence of parasitism may not be driven by acquisition of novel components, but rather by loss and modification of the existing, conserved traits. PMID:25717057

  7. [How does the apicomplexan parasite Theileria control host cell identity?].

    PubMed

    Marsolier, Justine; Weitzman, Jonathan B

    2014-01-01

    Infectious agents, like bacteria or virus, are responsible for a large number of pathologies in mammals. Microbes have developed mechanisms for interacting with host cell pathways and hijacking cellular machinery to change the phenotypic state. In this review, we focus on an interesting apicomplexan parasite called Theileria. Infection by the tick-transmitted T. annulata parasite causes Tropical Theileriosis in North Africa and Asia, and the related T. parva parasite causes East Coast Fever in Sub-Saharan Africa. This parasite is the only eukaryote known to induce the transformation of its mammalian host cells. Indeed, T. annulata and T. parva infect bovine leukocytes leading to transforming phenotypes, which partially mirror human lymphoma pathologies. Theileria infection causes hyperproliferation, invasiveness and escape from apoptosis, presumably through the manipulation of host cellular pathways. Several host-signaling mechanisms have been implicated. Here we describe the mechanisms involved in parasite-induced transformation phenotypes. PMID:25840458

  8. Growth Phase-Dependent Activation of the DccRS Regulon of Campylobacter jejuni▿

    PubMed Central

    Wösten, Marc M. S. M.; van Dijk, Linda; Parker, Craig T.; Guilhabert, Magalie R.; van der Meer-Janssen, Ynske P. M.; Wagenaar, Jaap A.; van Putten, Jos P. M.

    2010-01-01

    Two-component systems are widespread prokaryotic signal transduction devices which allow the regulation of cellular functions in response to changing environmental conditions. The two-component system DccRS (Cj1223c-Cj1222c) of Campylobacter jejuni is important for the colonization of chickens. Here, we dissect the DccRS system in more detail and provide evidence that the sensor DccS selectively phosphorylates the cognate effector, DccR. Microarray expression profiling, real-time reverse transcription-PCR (RT-PCR), electrophoretic mobility shift assay, and primer extension analyses revealed that the DccRS regulon of strain 81116 consists of five promoter elements, all containing the consensus direct repeat sequence WTTCAC-N6-TTCACW covering the putative −35 promoter regions. One of these promoters is located in front of an operon encoding a putative macrolide efflux pump while the others are in front of genes coding for putative periplasmic or membrane proteins. The DccRS-regulated genes in C. jejuni strain 81116 are needed to enhance early in vivo growth of C. jejuni in 7-day-old chickens. The DccRS system is activated in the late stationary bacterial growth phase, probably by released metabolic products. Whole-genome mRNA profiling and real-time RT-PCR analysis under these conditions demonstrated that the system has no influence on the transcription of genes outside the DccRS regulon. PMID:20348251

  9. RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more

    PubMed Central

    Salgado, Heladia; Peralta-Gil, Martin; Gama-Castro, Socorro; Santos-Zavaleta, Alberto; Muñiz-Rascado, Luis; García-Sotelo, Jair S.; Weiss, Verena; Solano-Lira, Hilda; Martínez-Flores, Irma; Medina-Rivera, Alejandra; Salgado-Osorio, Gerardo; Alquicira-Hernández, Shirley; Alquicira-Hernández, Kevin; López-Fuentes, Alejandra; Porrón-Sotelo, Liliana; Huerta, Araceli M.; Bonavides-Martínez, César; Balderas-Martínez, Yalbi I.; Pannier, Lucia; Olvera, Maricela; Labastida, Aurora; Jiménez-Jacinto, Verónica; Vega-Alvarado, Leticia; del Moral-Chávez, Victor; Hernández-Alvarez, Alfredo; Morett, Enrique; Collado-Vides, Julio

    2013-01-01

    This article summarizes our progress with RegulonDB (http://regulondb.ccg.unam.mx/) during the past 2 years. We have kept up-to-date the knowledge from the published literature regarding transcriptional regulation in Escherichia coli K-12. We have maintained and expanded our curation efforts to improve the breadth and quality of the encoded experimental knowledge, and we have implemented criteria for the quality of our computational predictions. Regulatory phrases now provide high-level descriptions of regulatory regions. We expanded the assignment of quality to various sources of evidence, particularly for knowledge generated through high-throughput (HT) technology. Based on our analysis of most relevant methods, we defined rules for determining the quality of evidence when multiple independent sources support an entry. With this latest release of RegulonDB, we present a new highly reliable larger collection of transcription start sites, a result of our experimental HT genome-wide efforts. These improvements, together with several novel enhancements (the tracks display, uploading format and curational guidelines), address the challenges of incorporating HT-generated knowledge into RegulonDB. Information on the evolutionary conservation of regulatory elements is also available now. Altogether, RegulonDB version 8.0 is a much better home for integrating knowledge on gene regulation from the sources of information currently available. PMID:23203884

  10. A comparison of the low temperature transcriptomes and CBF regulons of three plant species that differ in freezing tolerance: Solanum commersonii, Solanum tuberosum, and Arabidopsis thaliana

    PubMed Central

    Pino, María-Teresa; Jeknić, Zoran; Zou, Cheng; Shiu, Shin-Han; Chen, Tony H. H.; Thomashow, Michael F.

    2011-01-01

    Solanum commersonii and Solanum tuberosum are closely related plant species that differ in their abilities to cold acclimate; whereas S. commersonii increases in freezing tolerance in response to low temperature, S. tuberosum does not. In Arabidopsis thaliana, cold-regulated genes have been shown to contribute to freezing tolerance, including those that comprise the CBF regulon, genes that are controlled by the CBF transcription factors. The low temperature transcriptomes and CBF regulons of S. commersonii and S. tuberosum were therefore compared to determine whether there might be differences that contribute to their differences in ability to cold acclimate. The results indicated that both plants alter gene expression in response to low temperature to similar degrees with similar kinetics and that both plants have CBF regulons composed of hundreds of genes. However, there were considerable differences in the sets of genes that comprised the low temperature transcriptomes and CBF regulons of the two species. Thus differences in cold regulatory programmes may contribute to the differences in freezing tolerance of these two species. However, 53 groups of putative orthologous genes that are cold-regulated in S. commersonii, S. tuberosum, and A. thaliana were identified. Given that the evolutionary distance between the two Solanum species and A. thaliana is 112–156 million years, it seems likely that these conserved cold-regulated genes—many of which encode transcription factors and proteins of unknown function—have fundamental roles in plant growth and development at low temperature. PMID:21511909

  11. Five promoters integrate control of the cob/pdu regulon in Salmonella typhimurium.

    PubMed

    Chen, P; Ailion, M; Bobik, T; Stormo, G; Roth, J

    1995-10-01

    Propanediol is degraded by a B12-dependent pathway in Salmonella typhimurium. The enzymes for this pathway are encoded in a small region (minute 41) that includes the pdu operon (controlling B12-dependent degradation of propanediol) and the divergent cob operon (controlling synthesis of cobalamin, B12). Expression of both operons is induced by propanediol and globally controlled by the ArcA and Crp systems. The region between the two operons encodes two proteins, PduF, a transporter of propanediol, and PocR, which mediates the induction of the regulon by propanediol. Insertion mutations between the pdu and cob operons have been characterized, and their exact positions have been correlated with mutant phenotypes. The region includes five promoters, four of which are controlled by the PocR protein and induced by propanediol. The cob and pdu operons each have one regulated promoter; the pduF gene is expressed from two regulated promoters (P1 and P2). The P1 and P2 transcripts extend beyond pduF to include the pocR gene; thus the PocR protein autoregulates its expression from these promoters. The fifth promoter, PPoc, is adjacent to the pocR gene and associated with a Crp binding site. We suggest that all global control of the regulon is exerted by regulating the level of PocR protein at the P1, P2, and PPoc promoters. A putative binding site for the PocR protein has been identified by computer analysis. Eight close matches to this proposed site were found in regions near the four promoters known to be regulated by PocR protein: PPdu, P1, P2, and PCob. A three-state model is proposed in which the regulon uses all five of its promoters to control expression. PMID:7559322

  12. Maltotriose is the inducer of the maltose regulon of Escherichia coli.

    PubMed Central

    Raibaud, O; Richet, E

    1987-01-01

    In a cell-free system programmed with a plasmid bearing a malP'-'lacZ gene fusion under the control of malPp, beta-galactosidase synthesis was strictly dependent on the presence of both the MalT activator protein and the inducer of the Escherichia coli maltose regulon. We show that, among all maltodextrins tested (from maltose to maltoheptaose), only maltotriose was able to induce beta-galactosidase synthesis. Likewise, in an in vitro transcription system, initiation of transcription at malPp required the presence of the MalT protein and maltotriose along with the RNA polymerase holoenzyme; neither maltose nor maltotetraose could substitute for maltotriose. Images PMID:3298211

  13. The apicomplexan glideosome and adhesins -- structures and function

    PubMed Central

    Boucher, Lauren E.; Bosch, Jürgen

    2015-01-01

    The apicomplexan family of pathogens, which includes Plasmodium spp. and Toxoplasma gondii, are primarily obligate intracellular parasites and invade multiple cell types. These parasites express extracellular membrane protein receptors, adhesins, to form specific pathogen-host cell interaction complexes. Various adhesins are used to invade a variety of cell types. The receptors are linked to an actomyosin motor, which is part of a complex comprised of many proteins known as the invasion machinery or glideosome. To date, reviews on invasion have focused primarily on the molecular pathways and signals of invasion, with little or no structural information presented. Over 75 structures of parasite receptors and glideosome proteins have been deposited with the Protein Data Bank. These structures include adhesins, motor proteins, bridging proteins, inner membrane complex and cytoskeletal proteins, as well as co-crystal structures with peptides and antibodies. These structures provide information regarding key interactions necessary for target receptor engagement, machinery complex formation, how force is transmitted, and the basis of inhibitory antibodies. Additionally, these structures can provide starting points for the development of antibodies and inhibitory molecules targeting protein-protein interactions, with the aim to inhibit invasion. This review provides an overview of the parasite adhesin protein families, the glideosome components, glideosome architecture, and discuss recent work regarding alternative models. PMID:25764948

  14. In silico discovery of the dormancy regulons in a number of Actinobacteria genomes

    SciTech Connect

    Gerasimova, Anna; Dubchak, Inna; Arkin, Adam; Gelfand, Mikhail

    2010-11-16

    Mycobacterium tuberculosis is a dangerous Actinobacteria infecting nearly one third of the human population. It becomes dormant and phenotypically drug resistant in response to stresses. An important feature of the M. tuberculosis pathogenesis is the prevalence of latent infection without disease, making understanding of the mechanisms used by the bacteria to exist in this state and to switch to metabolically active infectious form a vital problem to consider. M. tuberculosis dormancy is regulated by the three-component regulatory system of two kinases (DosT and DevS) and transcriprional regulator (DevR). DevR activates transcription of a set of genes, which allow the bacteria to survive long periods of anaerobiosis, and may be important for long-term survival within the host during latent infection. The DevR-regulon is studied experimentally in M. tuberculosis and few other phylogenetically close Mycobacteria spp. As many other two-component systems, the devRS operon is autoregulated. However, the mechanism of the dormancy is not completely clear even for these bacteria and there is no data describing the dormancy regulons in other species.

  15. Characterization of the Ers Regulon of Enterococcus faecalis▿

    PubMed Central

    Riboulet-Bisson, Eliette; Sanguinetti, Maurizio; Budin-Verneuil, Aurélie; Auffray, Yanick; Hartke, Axel; Giard, Jean-Christophe

    2008-01-01

    Ers has been qualified as the PrfA-like transcriptional regulator of Enterococcus faecalis. In a previous study we reported that Ers is important for the survival within macrophages of this opportunist pathogenic bacterium. In the present work we have used proteomic and microarray expression profiling of E. faecalis JH2-2 and an ers-deleted mutant (Δers mutant) strains to define the Ers regulon. In addition to EF_0082 (encoding a putative facilitator family transporter), already known to be under Ers regulation, three genes or operons displayed a significant decrease (confirmed by reverse transcription quantitative PCR) in expression in the Δers mutant. The first locus corresponds to three genes: arcA, arcB, and arcC1 (arcABC). These genes are members of the ADI operon, encoding enzymes of the arginine deiminase system. The second is the EF_1459 gene, which encodes a hypothetical protein and is located within a putative phage genetic element. Lastly, Ef_3319 is annotated as the alpha subunit of the citrate lyase encoded by citF. citF is a member of a putative 12-gene operon involved in citrate catabolism. Moreover, the promoter sequence, similar to the “PrfA box” and found in the promoter regions of ers and EF_0082, has been shown to be included in the DNA segment recognized by Ers. Phenotypic analysis of the Δers mutant strain revealed a growth defect when cultured with arginine or citrate as the energy source; this was not seen for the wild type. As expected, similar results were obtained with mutants in which arcA and citF were inactivated. In addition, in the mouse peritonitis model of virulence, the Δers mutant appeared significantly less lethal than the JH2-2 wild-type strain. Taken together, these results indicate that the regulator Ers has a pleiotropic effect, especially in the cellular metabolism and virulence of E. faecalis. PMID:18426870

  16. Comparative genomics and functional analysis of rhamnose catabolic pathways and regulons in bacteria

    PubMed Central

    Rodionova, Irina A.; Li, Xiaoqing; Thiel, Vera; Stolyar, Sergey; Stanton, Krista; Fredrickson, James K.; Bryant, Donald A.; Osterman, Andrei L.; Best, Aaron A.; Rodionov, Dmitry A.

    2013-01-01

    L-rhamnose (L-Rha) is a deoxy-hexose sugar commonly found in nature. L-Rha catabolic pathways were previously characterized in various bacteria including Escherichia coli. Nevertheless, homology searches failed to recognize all the genes for the complete L-Rha utilization pathways in diverse microbial species involved in biomass decomposition. Moreover, the regulatory mechanisms of L-Rha catabolism have remained unclear in most species. A comparative genomics approach was used to reconstruct the L-Rha catabolic pathways and transcriptional regulons in the phyla Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Thermotogae. The reconstructed pathways include multiple novel enzymes and transporters involved in the utilization of L-Rha and L-Rha-containing polymers. Large-scale regulon inference using bioinformatics revealed remarkable variations in transcriptional regulators for L-Rha utilization genes among bacteria. A novel bifunctional enzyme, L-rhamnulose-phosphate aldolase (RhaE) fused to L-lactaldehyde dehydrogenase (RhaW), which is not homologous to previously characterized L-Rha catabolic enzymes, was identified in diverse bacteria including Chloroflexi, Bacilli, and Alphaproteobacteria. By using in vitro biochemical assays we validated both enzymatic activities of the purified recombinant RhaEW proteins from Chloroflexus aurantiacus and Bacillus subtilis. Another novel enzyme of the L-Rha catabolism, L-lactaldehyde reductase (RhaZ), was identified in Gammaproteobacteria and experimentally validated by in vitro enzymatic assays using the recombinant protein from Salmonella typhimurium. C. aurantiacus induced transcription of the predicted L-Rha utilization genes when L-Rha was present in the growth medium and consumed L-Rha from the medium. This study provided comprehensive insights to L-Rha catabolism and its regulation in diverse Bacteria. PMID:24391637

  17. Wider than Thought Phylogenetic Occurrence of Apicortin, A Characteristic Protein of Apicomplexan Parasites.

    PubMed

    Orosz, Ferenc

    2016-06-01

    Apicomplexan parasites cause serious illnesses, including malaria, in humans and domestic animals. The presence of apicortins is predominantly characteristic of this phylum. All the apicomplexan species sequenced contain an apicortin which unites two conserved domains: DCX and partial p25alpha. This paper identifies novel apicortin orthologs in silico and corrects in several cases the erroneous sequences of hypothetical apicortin proteins of Cryptosporidium, Eimeria, and Theileria genera published in databases. Plasmodium apicortins, except from Plasmodium gallinaceum, differ significantly from the other apicomplexan apicortins. The feature of this ortholog suggests that only orthologs of Plasmodiums hosted by mammals altered significantly. The free-living Chromerida, Chromera velia, and Vitrella brassicaformis, contain three paralogs. Their apicomplexan-type and nonapicomplexan-type apicortins might be "outparalogs." The fungal ortholog, Rozella allomycis, found at protein level, and the algal Nitella mirabilis, found as Transcriptome Shotgun Assembly (TSA), are similar to the known Opisthokont (Trichoplax adhaerens, Spizellomyces punctatus) and Viridiplantae (Nicotiana tabacum) ones, since they do not contain the long, unstructured N-terminal part present in apicomplexan apicortins. A few eumetazoan animals possess apicortin-like (partial) sequences at TSA level, which may be either contaminations or the result of horizontal gene transfer; in some cases the contamination has been proved. PMID:27282556

  18. Ubiquitous associations and a peak fall prevalence between apicomplexan symbionts and reef corals in Florida and the Bahamas

    NASA Astrophysics Data System (ADS)

    Kirk, N. L.; Thornhill, D. J.; Kemp, D. W.; Fitt, W. K.; Santos, S. R.

    2013-09-01

    Although apicomplexans are a widely recognized and important parasitic group, little is known about those associated with invertebrates, such as reef-building scleractinian corals. To resolve the potential impact of apicomplexans on coral health, it is first necessary to further describe this group of putative parasites and determine their prevalence among host species. Here, it was hypothesized that apicomplexan prevalence would vary seasonally, similar to what occurs in other marine apicomplexans as well as some coral symbionts. To test this, Caribbean scleractinian species Porites astreoides, Montastraea (= Orbicella) annularis, M. (= O.) faveolata, and Siderastrea siderea were sampled seasonally from two reefs each in the Florida Keys and the Bahamas for 9- and 5.5-year periods, respectively. Utilizing a PCR-based screening assay, apicomplexan DNA was detected from most Floridian (80.1 %: n = 555/693) and Bahamian (90.7 %: n = 311/343) coral tissue samples collected over these multi-year periods. Furthermore, apicomplexan DNA was detected from nearly all (98.7 %: n = 78/79) single polyps sampled at multiple locations within six M. faveolata colonies, indicating little to no intracolonial variation in the screening assay. Mixed-model logistic regression was utilized to determine the effects of season, host species, and reef on apicomplexan prevalence. The model identified a significant seasonal effect, with the highest apicomplexan prevalence occurring during fall. There also was a large effect of host species, with apicomplexan prevalence significantly lower among S. siderea colonies relative to the other species. While reef did not have a significant effect in the full model, there was a significant difference in apicomplexan prevalence between Floridian and Bahamian reefs for S. siderea, implying regional differences in this host species. Despite seasonal and species-specific differences in prevalence, apicomplexans are ubiquitous constituents of these

  19. Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis

    PubMed Central

    Mirouze, Nicolas; Bidnenko, Elena; Noirot, Philippe; Auger, Sandrine

    2015-01-01

    Under nitrogen limitation conditions, Bacillus subtilis induces a sophisticated network of adaptation responses. More precisely, the B. subtilis TnrA regulator represses or activates directly or indirectly the expression of a hundred genes in response to nitrogen availability. The global TnrA regulon have already been identified among which some directly TnrA-regulated genes have been characterized. However, a genome-wide mapping of in vivo TnrA-binding sites was still needed to clearly define the set of genes directly regulated by TnrA. Using chromatin immunoprecipitation coupled with hybridization to DNA tiling arrays (ChIP-on-chip), we now provide in vivo evidence that TnrA reproducibly binds to 42 regions on the chromosome. Further analysis with real-time in vivo transcriptional profiling, combined with results from previous reports, allowed us to define the TnrA primary regulon. We identified 35 promoter regions fulfilling three criteria necessary to be part of this primary regulon: (i) TnrA binding in ChIP-on-chip experiments and/or in previous in vitro studies; (ii) the presence of a TnrA box; (iii) TnrA-dependent expression regulation. In addition, the TnrA primary regulon delimitation allowed us to improve the TnrA box consensus. Finally, our results reveal new interconnections between the nitrogen regulatory network and other cellular processes. PMID:25755103

  20. A Comparative Genomics Approach to Prediction of New Members of Regulons

    PubMed Central

    Tan, Kai; Moreno-Hagelsieb, Gabriel; Collado-Vides, Julio; Stormo, Gary D.

    2001-01-01

    Identifying the complete transcriptional regulatory network for an organism is a major challenge. For each regulatory protein, we want to know all the genes it regulates, that is, its regulon. Examples of known binding sites can be used to estimate the binding specificity of the protein and to predict other binding sites. However, binding site predictions can be unreliable because determining the true specificity of the protein is difficult because of the considerable variability of binding sites. Because regulatory systems tend to be conserved through evolution, we can use comparisons between species to increase the reliability of binding site predictions. In this article, an approach is presented to evaluate the computational predicitions of regulatory sites. We combine the prediction of transcription units having orthologous genes with the prediction of transcription factor binding sites based on probabilistic models. We augment the sets of genes in Escherichia coli that are expected to be regulated by two transcription factors, the cAMP receptor protein and the fumarate and nitrate reduction regulatory protein, through a comparison with the Haemophilus influenzae genome. At the same time, we learned more about the regulatory networks of H. influenzae, a species with much less experimental knowledge than E. coli. By studying orthologous genes subject to regulation by the same transcription factor, we also gained understanding of the evolution of the entire regulatory systems. PMID:11282972

  1. Protococcidian Eleutheroschizon duboscqi, an Unusual Apicomplexan Interconnecting Gregarines and Cryptosporidia

    PubMed Central

    Valigurová, Andrea; Paskerova, Gita G.; Diakin, Andrei; Kováčiková, Magdaléna; Simdyanov, Timur G.

    2015-01-01

    -evaluation of epicellular development in other apicomplexans and directly compares their niche with that of E. duboscqi. PMID:25915503

  2. A chemical potentiator of copper-accumulation used to investigate the iron-regulons of Saccharomyces cerevisiae

    PubMed Central

    Foster, Andrew W; Dainty, Samantha J; Patterson, Carl J; Pohl, Ehmke; Blackburn, Hannah; Wilson, Clare; Hess, Corinna R; Rutherford, Julian C; Quaranta, Laura; Corran, Andy; Robinson, Nigel J

    2014-01-01

    The extreme resistance of Saccharomyces cerevisiae to copper is overcome by 2-(6-benzyl-2-pyridyl)quinazoline (BPQ), providing a chemical-biology tool which has been exploited in two lines of discovery. First, BPQ is shown to form a red (BPQ)2Cu(I) complex and promote Ctr1-independent copper-accumulation in whole cells and in mitochondria isolated from treated cells. Multiple phenotypes, including loss of aconitase activity, are consistent with copper-BPQ mediated damage to mitochondrial iron–sulphur clusters. Thus, a biochemical basis of copper-toxicity in S. cerevisiae is analogous to other organisms. Second, iron regulons controlled by Aft1/2, Cth2 and Yap5 that respond to mitochondrial iron–sulphur cluster status are modulated by copper-BPQ causing iron hyper-accumulation via upregulated iron-import. Comparison of copper-BPQ treated, untreated and copper-only treated wild-type and fra2Δ by RNA-seq has uncovered a new candidate Aft1 target-gene (LSO1) and paralogous non-target (LSO2), plus nine putative Cth2 target-transcripts. Two lines of evidence confirm that Fra2 dominates basal repression of the Aft1/2 regulons in iron-replete cultures. Fra2-independent control of these regulons is also observed but CTH2 itself appears to be atypically Fra2-dependent. However, control of Cth2-target transcripts which is independent of CTH2 transcript abundance or of Fra2, is also quantified. Use of copper-BPQ supports a substantial contribution of metabolite repression to iron-regulation. PMID:24895027

  3. The Gac Regulon of Pseudomonas fluorescens SBW25

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptome analysis of Pseudomonas fluorescens SBW25 showed that 702 genes were differentially regulated (FC>4, P<0.0001) in a gacS::Tn5 mutant, with 300 and 402 genes up- and down-regulated, respectively. Similar to the Gac-regulon of four other Pseudomonas species, genes involved in motility, b...

  4. Evidence for a Single Origin of the 35 kb Plastid DNA in Apicomplexans.

    PubMed

    Denny, P; Preiser, P; Williamson, D; Wilson, I

    1998-02-01

    Gene organization on three selected parts of the 35-kb plastid DNA of the malaria parasite Plasmodium falciparum was compared with that of two other apicomplexans, namely Toxoplasma gondii and Eimeria tenella. This comparison included the characteristic inverted ribosomal RNA repeat. A short segment of DNA from Theileria annulata also was included in a separate comparison. Criteria such as the presence or absence of particular genes, their map positions and their sequences, were used to assess whether the apicomplexan plastid DNAs originated from a single origin (a unitary hypothesis for the entire phylum), or whether disparate multiple events were more likely. The results provisionally favour a single origin although clearly this comparison of the apicomplexan plDNAs is still fragmentary. Contrary to the tendency towards homogeneity, evidence was found that the coccidian plastids may have evolved a suppressor mechanism for UGA stop codons. PMID:23196113

  5. Vitamin and co-factor biosynthesis pathways in Plasmodium and other apicomplexan parasites

    PubMed Central

    Müller, Sylke; Kappes, Barbara

    2007-01-01

    Vitamins are essential components of the human diet. By contrast, the malaria parasite Plasmodium falciparum and related apicomplexan parasites synthesise certain vitamins, de novo, either completely or in parts. The occurrence of the various biosynthesis pathways is specific to different apicomplexan parasites, emphasising their distinct requirements for nutrients and growth factors. The absence of vitamin biosynthesis from the human host implies that inhibition of the parasite pathways may be a way to interfere specifically with parasite development. However, the precise role of biosynthesis and potential uptake of vitamins for the overall regulation of vitamin homeostasis in the parasites needs to be established first. In this review Sylke Müller and Barbara Kappes focus mainly on the procurement of vitamin B1, B5 and B6 by Plasmodium and other apicomplexan parasites. PMID:17276140

  6. Re-emergence of the apicomplexan theileria equi in the United States: Elimination of persistent infection and transmission risk

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Arthropod-borne apicomplexan pathogens that cause asymptomatic persistent infections present a significant challenge due to their life-long transmission potential. Although anti-microbials have been used to ameliorate acute disease in animals and humans, chemotherapeutic efficacy for apicomplexan pa...

  7. Novel insights on ENTH domain-containing proteins in apicomplexan parasites.

    PubMed

    Kibria, K M Kaderi; Hossain, Mohammad Uzzal; Oany, Arafat Rahman; Ahmad, Shah Adil Ishtiyaq

    2016-06-01

    The phylum Apicomplexa includes a large group of early branching eukaryotes having significant medical and economical importance. The molecular machinery responsible for protein trafficking is poorly understood in these apicomplexans. One of the most important proteins involved in clathrin-mediated protein trafficking is Epsin, which contains ENTH domain, a conserved domain crucial for membrane bending leading to vesicle formation. We undertook homology searching and phylogenetic analyses to produce a rigorously annotated set of Epsin homologs retrieved from diverse apicomplexan genomes. Genomic and phylogenetic comparisons revealed that apicomplexans contain unusual Epsin homologs that are distinct from those observed in mammals and yeast. Although there are four Epsin genes in mammalian system and five in the yeast genome, apicomplexan parasites consist only a single Epsin gene. The apicomplexan Epsin contains the conserved ENTH domain consisting of phosphoinositide (PtdIns)-binding sites which indicate about their functional significance in the formation of vesicles; however, the absence of ubiquitin-interacting motif (UIM) suggests a possible different mechanism for protein trafficking. The existence of dileucine motif in Plasmodium, Cryptosporidum parvum and Eimeria tenella Epsins might solve their functionality while lacking a lot of conserved motifs as this motif is known to interact with different adaptor protein complexes (AP1, AP2 and AP3). Other Epsin homologs are also shown to have different peptide motifs reported for possible interaction with α-ear appendage, γ-ear appendage and EH domain present in different adaptors. Bioinformatic and phylogenetic analyses suggest that the apicomplexan Epsins have unusual functionality from that of the mammalian Epsins. This detailed study may greatly facilitate future molecular cell biological investigation for the role of Epsins in these parasites. PMID:26922178

  8. Genome-wide analysis of the RpoN regulon in Geobacter sulfurreducens

    PubMed Central

    2009-01-01

    Background The role of the RNA polymerase sigma factor RpoN in regulation of gene expression in Geobacter sulfurreducens was investigated to better understand transcriptional regulatory networks as part of an effort to develop regulatory modules for genome-scale in silico models, which can predict the physiological responses of Geobacter species during groundwater bioremediation or electricity production. Results An rpoN deletion mutant could not be obtained under all conditions tested. In order to investigate the regulon of the G. sulfurreducens RpoN, an RpoN over-expression strain was made in which an extra copy of the rpoN gene was under the control of a taclac promoter. Combining both the microarray transcriptome analysis and the computational prediction revealed that the G. sulfurreducens RpoN controls genes involved in a wide range of cellular functions. Most importantly, RpoN controls the expression of the dcuB gene encoding the fumarate/succinate exchanger, which is essential for cell growth with fumarate as the terminal electron acceptor in G. sulfurreducens. RpoN also controls genes, which encode enzymes for both pathways of ammonia assimilation that is predicted to be essential under all growth conditions in G. sulfurreducens. Other genes that were identified as part of the RpoN regulon using either the computational prediction or the microarray transcriptome analysis included genes involved in flagella biosynthesis, pili biosynthesis and genes involved in central metabolism enzymes and cytochromes involved in extracellular electron transfer to Fe(III), which are known to be important for growth in subsurface environment or electricity production in microbial fuel cells. The consensus sequence for the predicted RpoN-regulated promoter elements is TTGGCACGGTTTTTGCT. Conclusion The G. sulfurreducens RpoN is an essential sigma factor and a global regulator involved in a complex transcriptional network controlling a variety of cellular processes. PMID

  9. Modulation of toxin production by the flagellar regulon in Clostridium difficile.

    PubMed

    Aubry, Annie; Hussack, Greg; Chen, Wangxue; KuoLee, Rhonda; Twine, Susan M; Fulton, Kelly M; Foote, Simon; Carrillo, Catherine D; Tanha, Jamshid; Logan, Susan M

    2012-10-01

    We show in this study that toxin production in Clostridium difficile is altered in cells which can no longer form flagellar filaments. The impact of inactivation of fliC, CD0240, fliF, fliG, fliM, and flhB-fliR flagellar genes upon toxin levels in culture supernatants was assessed using cell-based cytotoxicity assay, proteomics, immunoassay, and immunoblotting approaches. Each of these showed that toxin levels in supernatants were significantly increased in a fliC mutant compared to that in the C. difficile 630 parent strain. In contrast, the toxin levels in supernatants secreted from other flagellar mutants were significantly reduced compared with that in the parental C. difficile 630 strain. Transcriptional analysis of the pathogenicity locus genes (tcdR, tcdB, tcdE, and tcdA) revealed a significant increase of all four genes in the fliC mutant strain, while transcription of all four genes was significantly reduced in fliM, fliF, fliG, and flhB-fliR mutants. These results demonstrate that toxin transcription in C. difficile is modulated by the flagellar regulon. More significantly, mutant strains showed a corresponding change in virulence compared to the 630 parent strain when tested in a hamster model of C. difficile infection. This is the first demonstration of differential flagellum-related transcriptional regulation of toxin production in C. difficile and provides evidence for elaborate regulatory networks for virulence genes in C. difficile. PMID:22851750

  10. The pH-Responsive Regulon of HP0244 (FlgS), the Cytoplasmic Histidine Kinase of Helicobacter pylori▿

    PubMed Central

    Wen, Yi; Feng, Jing; Scott, David R.; Marcus, Elizabeth A; Sachs, George

    2009-01-01

    Helicobacter pylori colonizes the acidic gastric environment, in contrast to all other neutralophiles, whose acid resistance and tolerance responses allow only gastric transit. This acid adaptation is dependent on regulation of gene expression in response to pH changes in the periplasm and cytoplasm. The cytoplasmic histidine kinase, HP0244, which until now was thought only to regulate flagellar gene expression via its cognate response regulator, HP0703, was found to generate a response to declining medium pH. Although not required for survival at pH 4.5, HP0244 is required for survival at pH 2.5 with 10 mM urea after 30 min. Transcriptional profiling of a HP0244 deletion mutant grown at pH 7.4 confirmed the contribution of HP0244 to σ54 activation via HP0703 to coordinate flagellar biosynthesis by a pH-independent regulon that includes 14 flagellar genes. Microarray analysis of cells grown at pH 4.5 without urea revealed an additional 22 genes, including 4 acid acclimation genes (ureA, ureB, ureI, and amiE) that are positively regulated by HP0244. Additionally, 86 differentially expressed genes, including 3 acid acclimation genes (ureF, rocF [arginase], and ansB [asparaginase]), were found in cells grown at pH 2.5 with 30 mM urea. Hence, HP0244 has, in addition to the pH-independent flagellar regulon, a pH-dependent regulon, which allows adaptation to a wider range of environmental acid conditions. An acid survival study using an HP0703 mutant and an electrophoretic mobility shift assay with in vitro-phosphorylated HP0703 showed that HP0703 does not contribute to acid survival and does not bind to the promoter regions of several genes in the HP0244 pH-dependent regulon, suggesting that there is a pathway outside the HP0703 regulon which transduces the acid-responsive signal sensed by HP0244. PMID:18978046

  11. A 1,3-1,4-β-Glucan Utilization Regulon in Paenibacillus sp. Strain JDR-2

    PubMed Central

    Chow, Virginia; Kim, Young Sik; Rhee, Mun Su; Sawhney, Neha; St. John, Franz J.; Nong, Guang; Rice, John D.

    2016-01-01

    Paenibacillus sp. strain JDR-2 (Paenibacillus JDR-2) secretes a multimodular cell-associated glycoside hydrolase family 10 (GH10) endoxylanase (XynA10A1) that catalyzes the depolymerization of methylglucuronoxylan (MeGXn) and rapidly assimilates the products of depolymerization. Efficient utilization of MeGXn has been postulated to result from the coupling of the processes of exocellular depolymerization and assimilation of oligosaccharide products, followed by intracellular metabolism. Growth and substrate utilization patterns with barley glucan and laminarin similar to those observed with MeGXn as a substrate suggest similar processes for 1,3-1,4-β-glucan and 1,3-β-glucan depolymerization and product assimilation. The Paenibacillus JDR-2 genome includes a cluster of genes encoding a secreted multimodular GH16 β-glucanase (Bgl16A1) containing surface layer homology (SLH) domains, a secreted GH16 β-glucanase with only a catalytic domain (Bgl16A2), transporter proteins, and transcriptional regulators. Recombinant Bgl16A1 and Bgl16A2 catalyze the formation of trisaccharides, tetrasaccharides, and larger oligosaccharides from barley glucan and of mono-, di-, tri-, and tetrasaccharides and larger oligosaccharides from laminarin. The lack of accumulation of depolymerization products during growth and a marked preference for polymeric glucan over depolymerization products support a process coupling extracellular depolymerization, assimilation, and intracellular metabolism for β-glucans similar to that ascribed to the GH10/GH67 xylan utilization system in Paenibacillus JDR-2. Coordinate expression of genes encoding GH16 β-glucanases, transporters, and transcriptional regulators supports their role as a regulon for the utilization of soluble β-glucans. As in the case of the xylan utilization regulons, this soluble β-glucan regulon provides advantages in the growth rate and yields on polymeric substrates and may be exploited for the efficient conversion of plant

  12. Mechanism of regulation of the formate-hydrogenlyase pathway by oxygen, nitrate, and pH: definition of the formate regulon.

    PubMed

    Rossmann, R; Sawers, G; Böck, A

    1991-11-01

    The products of a minimum of 15 genes are required for the synthesis of an active formate-hydrogenlyase (FHL) system in Escherichia coli. All are co-ordinately regulated in response to variations in the oxygen and nitrate concentration and the pH of the culture medium. Formate is obligately required for transcriptional activation of these genes. Analysis of the transcription of one of these genes, hycB linked to the lacZ reporter gene, revealed that oxygen and nitrate repression of transcription could be relieved completely, or partially in the case of nitrate, either by the addition of formate to the medium or by increasing the copy number of the gene encoding the transcriptional activator (fhlA) of this regulon. These studies uncovered a further level of regulation in which the transcription of hycB was reduced in cells grown on glucose. This effect was most clearly seen in aerobically grown cells when formate was added externally. Addition of cAMP overcame this glucose repression, which could be shown to be mediated by the cAMP receptor protein. These results would be consistent with the transport of formate being regulated by catabolite repression. Moreover, the repression of transcription through high pH also could be partially overcome by addition of increasing concentrations of formate to the medium, again being consistent with regulation at the level of formate import and export. Taken together, all these observations indicate that it is the intracellular level of formate that determines the transcription of the genes of the formate regulon by FhlA. This represents a novel positive feedback mechanism in which the activator of a regulon induces its own synthesis in response to increases in the concentration of the catabolic substrate, and this in turn is governed by the relative affinities of FhlA and the three formate dehydrogenase isoenzymes for formate. PMID:1779767

  13. Genome Sequence of Babesia bovis and Camparative Analysis of Apicomplexan Hemoprotozoa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related...

  14. Apical membrane antigen 1 mediates apicomplexan parasite attachment but is dispensable for host cell invasion

    PubMed Central

    Bargieri, Daniel Y.; Andenmatten, Nicole; Lagal, Vanessa; Thiberge, Sabine; Whitelaw, Jamie A.; Tardieux, Isabelle; Meissner, Markus; Ménard, Robert

    2013-01-01

    Apicomplexan parasites invade host cells by forming a ring-like junction with the cell surface and actively sliding through the junction inside an intracellular vacuole. Apical membrane antigen 1 is conserved in apicomplexans and a long-standing malaria vaccine candidate. It is considered to have multiple important roles during host cell penetration, primarily in structuring the junction by interacting with the rhoptry neck 2 protein and transducing the force generated by the parasite motor during internalization. Here, we generate Plasmodium sporozoites and merozoites and Toxoplasma tachyzoites lacking apical membrane antigen 1, and find that the latter two are impaired in host cell attachment but the three display normal host cell penetration through the junction. Therefore, apical membrane antigen 1, rather than an essential invasin, is a dispensable adhesin of apicomplexan zoites. These genetic data have implications on the use of apical membrane antigen 1 or the apical membrane antigen 1–rhoptry neck 2 interaction as targets of intervention strategies against malaria or other diseases caused by apicomplexans. PMID:24108241

  15. Apicomplexans pulling the strings: manipulation of the host cell cytoskeleton dynamics.

    PubMed

    Cardoso, Rita; Soares, Helena; Hemphill, Andrew; Leitão, Alexandre

    2016-07-01

    Invasive stages of apicomplexan parasites require a host cell to survive, proliferate and advance to the next life cycle stage. Once invasion is achieved, apicomplexans interact closely with the host cell cytoskeleton, but in many cases the different species have evolved distinct mechanisms and pathways to modulate the structural organization of cytoskeletal filaments. The host cell cytoskeleton is a complex network, largely, but not exclusively, composed of microtubules, actin microfilaments and intermediate filaments, all of which are modulated by associated proteins, and it is involved in diverse functions including maintenance of cell morphology and mechanical support, migration, signal transduction, nutrient uptake, membrane and organelle trafficking and cell division. The ability of apicomplexans to modulate the cytoskeleton to their own advantage is clearly beneficial. We here review different aspects of the interactions of apicomplexans with the three main cytoskeletal filament types, provide information on the currently known parasite effector proteins and respective host cell targets involved, and how these interactions modulate the host cell physiology. Some of these findings could provide novel targets that could be exploited for the development of preventive and/or therapeutic strategies. PMID:27041483

  16. A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes.

    PubMed

    Sidik, Saima M; Huet, Diego; Ganesan, Suresh M; Huynh, My-Hang; Wang, Tim; Nasamu, Armiyaw S; Thiru, Prathapan; Saeij, Jeroen P J; Carruthers, Vern B; Niles, Jacquin C; Lourido, Sebastian

    2016-09-01

    Apicomplexan parasites are leading causes of human and livestock diseases such as malaria and toxoplasmosis, yet most of their genes remain uncharacterized. Here, we present the first genome-wide genetic screen of an apicomplexan. We adapted CRISPR/Cas9 to assess the contribution of each gene from the parasite Toxoplasma gondii during infection of human fibroblasts. Our analysis defines ∼200 previously uncharacterized, fitness-conferring genes unique to the phylum, from which 16 were investigated, revealing essential functions during infection of human cells. Secondary screens identify as an invasion factor the claudin-like apicomplexan microneme protein (CLAMP), which resembles mammalian tight-junction proteins and localizes to secretory organelles, making it critical to the initiation of infection. CLAMP is present throughout sequenced apicomplexan genomes and is essential during the asexual stages of the malaria parasite Plasmodium falciparum. These results provide broad-based functional information on T. gondii genes and will facilitate future approaches to expand the horizon of antiparasitic interventions. PMID:27594426

  17. Hyperosmotic shock induces the sigma32 and sigmaE stress regulons of Escherichia coli.

    PubMed

    Bianchi, A A; Baneyx, F

    1999-12-01

    The rise in the levels of sigmaS that accompanies hyperosmotic shock plays an important role in Escherichia coli survival by increasing the transcription of genes involved in the synthesis and transport of osmoprotectants. To determine if other stress regulons collaborate with sigmaS in dealing with high osmolality, we used single copy fusions of lacZ to representative promoters induced by protein misfolding in the cytoplasm (dnaK and ibp ), extracytoplasmic stress [P3rpoH and htrA(degP )] and cold shock (cspA). Both the sigma32-dependent, dnaK and ibp, promoters, and the sigmaE-dependent, P3rpoH and htrA, promoters were rapidly but transiently induced when mid-exponential phase cells were treated with 0.464 M sucrose. The cspA promoter, however, did not respond to the same treatment. Overproduction of the cytoplasmic domain of the sigmaE anti-sigma factor, RseA, reduced the magnitude of osmotic induction in lambdaphi(P3rpoH:lacZ ) lysogens, but had no effect on the activation of the dnaK and ibp promoters. Similarly, induction of the dnaK:lacZ and ibp:lacZ fusions was not altered in either rpoS or ompR genetic backgrounds. Osmotic upshift led to a twofold increase in the enzymatic activity of the lambdaTLF247 rpoH:lacZ translational fusion whether or not the cells were treated with rifampicin, indicating that both heat shock and exposure to high osmolality trigger a transient increase in rpoH translation. Our results suggest that the sigma32, sigmaE and sigmaS regulons closely co-operate in the managment of hyperosmotic stress. Induction of the sigma32 and sigmaE regulons appears to be an emergency response required to repair protein misfolding and facilitate the proper folding of proteins that are rapidly synthesized following loss of turgor, while providing a mechanism to increase the activity of sigmaS, the primary stress factor in osmoadaptation. PMID:10594827

  18. Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry

    PubMed Central

    Jha, Ramesh K.; Kern, Theresa L.; Fox, David T.; M. Strauss, Charlie E.

    2014-01-01

    We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 μM exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB. PMID:24861620

  19. Effect of database drift on network topology and enrichment analyses: a case study for RegulonDB.

    PubMed

    Beber, Moritz E; Muskhelishvili, Georgi; Hütt, Marc-Thorsten

    2016-01-01

    RegulonDB is a database storing the biological information behind the transcriptional regulatory network (TRN) of the bacterium Escherichia coli. It is one of the key bioinformatics resources for Systems Biology investigations of bacterial gene regulation. Like most biological databases, the content drifts with time, both due to the accumulation of new information and due to refinements in the underlying biological concepts. Conclusions based on previous database versions may no longer hold. Here, we study the change of some topological properties of the TRN of E. coli, as provided by RegulonDB across 16 versions, as well as a simple index, digital control strength, quantifying the match between gene expression profiles and the transcriptional regulatory networks. While many of network characteristics change dramatically across the different versions, the digital control strength remains rather robust and in tune with previous results for this index. Our study shows that: (i) results derived from network topology should, when possible, be studied across a range of database versions, before detailed biological conclusions are derived, and (ii) resorting to simple indices, when interpreting high-throughput data from a network perspective, may help achieving a robustness of the findings against variation of the underlying biological information. Database URL: www.regulondb.ccg.unam.mx. PMID:26980514

  20. Effect of database drift on network topology and enrichment analyses: a case study for RegulonDB

    PubMed Central

    Muskhelishvili, Georgi; Hütt, Marc-Thorsten

    2016-01-01

    RegulonDB is a database storing the biological information behind the transcriptional regulatory network (TRN) of the bacterium Escherichia coli. It is one of the key bioinformatics resources for Systems Biology investigations of bacterial gene regulation. Like most biological databases, the content drifts with time, both due to the accumulation of new information and due to refinements in the underlying biological concepts. Conclusions based on previous database versions may no longer hold. Here, we study the change of some topological properties of the TRN of E. coli, as provided by RegulonDB across 16 versions, as well as a simple index, digital control strength, quantifying the match between gene expression profiles and the transcriptional regulatory networks. While many of network characteristics change dramatically across the different versions, the digital control strength remains rather robust and in tune with previous results for this index. Our study shows that: (i) results derived from network topology should, when possible, be studied across a range of database versions, before detailed biological conclusions are derived, and (ii) resorting to simple indices, when interpreting high-throughput data from a network perspective, may help achieving a robustness of the findings against variation of the underlying biological information. Database URL: www.regulondb.ccg.unam.mx PMID:26980514

  1. The HU Regulon Is Composed of Genes Responding to Anaerobiosis, Acid Stress, High Osmolarity and SOS Induction

    PubMed Central

    Oberto, Jacques; Nabti, Sabrina; Jooste, Valérie; Mignot, Hervé; Rouviere-Yaniv, Josette

    2009-01-01

    Background The Escherichia coli heterodimeric HU protein is a small DNA-bending protein associated with the bacterial nucleoid. It can introduce negative supercoils into closed circular DNA in the presence of topoisomerase I. Cells lacking HU grow very poorly and display many phenotypes. Methodology/Principal Findings We analyzed the transcription profile of every Escherichia coli gene in the absence of one or both HU subunits. This genome-wide in silico transcriptomic approach, performed in parallel with in vivo genetic experimentation, defined the HU regulon. This large regulon, which comprises 8% of the genome, is composed of four biologically relevant gene classes whose regulation responds to anaerobiosis, acid stress, high osmolarity, and SOS induction. Conclusions/Significance The regulation a large number of genes encoding enzymes involved in energy metabolism and catabolism pathways by HU explains the highly pleiotropic phenotype of HU-deficient cells. The uniform chromosomal distribution of the many operons regulated by HU strongly suggests that the transcriptional and nucleoid architectural functions of HU constitute two aspects of a unique protein-DNA interaction mechanism. PMID:19194530

  2. Development of a Novel Method for Analyzing Pseudomonas aeruginosa Twitching Motility and Its Application to Define the AmrZ Regulon.

    PubMed

    Xu, Binjie; Wozniak, Daniel J

    2015-01-01

    Twitching motility is an important migration mechanism for the Gram-negative bacterium Pseudomonas aeruginosa. In the commonly used subsurface twitching assay, the sub-population of P. aeruginosa with active twitching motility is difficult to harvest for high-throughput studies. Here we describe the development of a novel method that allows efficient isolation of bacterial sub-populations conducting highly active twitching motility. The transcription factor AmrZ regulates multiple P. aeruginosa virulence factors including twitching motility, yet the mechanism of this activation remains unclear. We therefore set out to understand this mechanism by defining the AmrZ regulon using DNA microarrays in combination with the newly developed twitching motility method. We discovered 112 genes in the AmrZ regulon and many encode virulence factors. One gene of interest and the subsequent focus was lecB, which encodes a fucose-binding lectin. DNA binding assays revealed that AmrZ activates lecB transcription by directly binding to its promoter. The lecB gene was previously shown to be required for twitching motility in P. aeruginosa strain PAK; however, our lecB deletion had no effect on twitching motility in strain PAO1. Collectively, in this study a novel condition was developed for quantitative studies of twitching motility, under which the AmrZ regulon was defined. PMID:26309248

  3. Development of a Novel Method for Analyzing Pseudomonas aeruginosa Twitching Motility and Its Application to Define the AmrZ Regulon

    PubMed Central

    Xu, Binjie; Wozniak, Daniel J.

    2015-01-01

    Twitching motility is an important migration mechanism for the Gram-negative bacterium Pseudomonas aeruginosa. In the commonly used subsurface twitching assay, the sub-population of P. aeruginosa with active twitching motility is difficult to harvest for high-throughput studies. Here we describe the development of a novel method that allows efficient isolation of bacterial sub-populations conducting highly active twitching motility. The transcription factor AmrZ regulates multiple P. aeruginosa virulence factors including twitching motility, yet the mechanism of this activation remains unclear. We therefore set out to understand this mechanism by defining the AmrZ regulon using DNA microarrays in combination with the newly developed twitching motility method. We discovered 112 genes in the AmrZ regulon and many encode virulence factors. One gene of interest and the subsequent focus was lecB, which encodes a fucose-binding lectin. DNA binding assays revealed that AmrZ activates lecB transcription by directly binding to its promoter. The lecB gene was previously shown to be required for twitching motility in P. aeruginosa strain PAK; however, our lecB deletion had no effect on twitching motility in strain PAO1. Collectively, in this study a novel condition was developed for quantitative studies of twitching motility, under which the AmrZ regulon was defined. PMID:26309248

  4. Characterization of the ArsRS regulon of Helicobacter pylori, involved in acid adaptation.

    PubMed

    Pflock, Michael; Finsterer, Nadja; Joseph, Biju; Mollenkopf, Hans; Meyer, Thomas F; Beier, Dagmar

    2006-05-01

    The human gastric pathogen Helicobacter pylori is extremely well adapted to the highly acidic conditions encountered in the stomach. The pronounced acid resistance of H. pylori relies mainly on the ammonia-producing enzyme urease; however, urease-independent mechanisms are likely to contribute to acid adaptation. Acid-responsive gene regulation is mediated at least in part by the ArsRS two-component system consisting of the essential OmpR-like response regulator ArsR and the nonessential cognate histidine kinase ArsS, whose autophosphorylation is triggered in response to low pH. In this study, by global transcriptional profiling of an ArsS-deficient H. pylori mutant grown at pH 5.0, we define the ArsR approximately P-dependent regulon consisting of 109 genes, including the urease gene cluster, the genes encoding the aliphatic amidases AmiE and AmiF, and the rocF gene encoding arginase. We show that ArsR approximately P controls the acid-induced transcription of amiE and amiF by binding to extended regions located upstream of the -10 box of the respective promoters. In contrast, transcription of rocF is repressed by ArsR approximately P at neutral, acidic, and mildly alkaline pH via high-affinity binding of the response regulator to a site overlapping the promoter of the rocF gene. PMID:16672598

  5. The Calcium Signaling Toolkit of the Apicomplexan Parasites Toxoplasma gondii and Plasmodium spp

    PubMed Central

    Lourido, Sebastian; Moreno, Silvia N.J.

    2015-01-01

    Apicomplexan parasites have complex life cycles, frequently split between different hosts and reliant on rapid responses as the parasites react to changing environmental conditions. Calcium ion (Ca2+) signaling is consequently essential for the cellular and developmental changes that support apicomplexan parasitism. Apicomplexan genomes reveal a rich repertoire of genes involved in calcium signaling, although many of the genes responsible for observed physiological changes remain unknown. There is evidence, for example, for the presence of a nifedipine-sensitive calcium entry mechanism in Toxoplasma, but the molecular components involved in Ca2+ entry in both Toxoplasma and Plasmodium, have not been identified. The major calcium stores are the endoplasmic reticulum (ER), the acidocalcisomes, and the plant-like vacuole in Toxoplasma, or the food vacuole in Plasmodium spp. Pharmacological evidence suggests that Ca2+ release from intracellular stores may be mediated by inositol 1,4,5-trisphosphate (IP3) or cyclic ADP ribose (cADPR) although there is no molecular evidence for the presence of receptors for these second messengers in the parasites. Several Ca2+-ATPases are present in apicomplexans and a putative mitochondrial Ca2+/H+ exchanger has been identified. Apicomplexan genomes contain numerous genes encoding Ca2+-binding proteins, with the notable expansion of calcium-dependent protein kinases (CDPKs), whose study has revealed novel roles in gliding motility, microneme secretion, host cell invasion and egress, and parasite differentiation. Microneme secretion has also been shown to depend on the C2 domain containing protein DOC2 in both Plasmodium spp. and Toxoplasma, providing further evidence for the complex transduction of Ca2+ signals in these organisms. The characterization of these pathways could lead to the discovery of novel drug targets and to a better understanding of the role of Ca2+ in these parasites. PMID:25605521

  6. The Pho regulon: a huge regulatory network in bacteria

    PubMed Central

    Santos-Beneit, Fernando

    2015-01-01

    One of the most important achievements of bacteria is its capability to adapt to the changing conditions of the environment. The competition for nutrients with other microorganisms, especially in the soil, where nutritional conditions are more variable, has led bacteria to evolve a plethora of mechanisms to rapidly fine-tune the requirements of the cell. One of the essential nutrients that are normally found in low concentrations in nature is inorganic phosphate (Pi). Bacteria, as well as other organisms, have developed several systems to cope for the scarcity of this nutrient. To date, the unique mechanism responding to Pi starvation known in detail is the Pho regulon, which is normally controlled by a two component system and constitutes one of the most sensible and efficient regulatory mechanisms in bacteria. Many new members of the Pho regulon have emerged in the last years in several bacteria; however, there are still many unknown questions regarding the activation and function of the whole system. This review describes the most important findings of the last three decades in relation to Pi regulation in bacteria, including: the PHO box, the Pi signaling pathway and the Pi starvation response. The role of the Pho regulon in nutritional regulation cross-talk, secondary metabolite production, and pathogenesis is discussed in detail. PMID:25983732

  7. Identification of the PhoB Regulon and Role of PhoU in the Phosphate Starvation Response of Caulobacter crescentus

    PubMed Central

    Lubin, Emma A.; Henry, Jonathan T.; Fiebig, Aretha; Crosson, Sean

    2015-01-01

    ABSTRACT An ability to sense and respond to changes in extracellular phosphate is critical for the survival of most bacteria. For Caulobacter crescentus, which typically lives in phosphate-limited environments, this process is especially crucial. Like many bacteria, Caulobacter responds to phosphate limitation through a conserved two-component signaling pathway called PhoR-PhoB, but the direct regulon of PhoB in this organism is unknown. Here we used chromatin immunoprecipitation-DNA sequencing (ChIP-Seq) to map the global binding patterns of the phosphate-responsive transcriptional regulator PhoB under phosphate-limited and -replete conditions. Combined with genome-wide expression profiling, our work demonstrates that PhoB is induced to regulate nearly 50 genes under phosphate-starved conditions. The PhoB regulon is comprised primarily of genes known or predicted to help Caulobacter scavenge for and import inorganic phosphate, including 15 different membrane transporters. We also investigated the regulatory role of PhoU, a widely conserved protein proposed to coordinate phosphate import with expression of the PhoB regulon by directly modulating the histidine kinase PhoR. However, our studies show that it likely does not play such a role in Caulobacter, as PhoU depletion has no significant effect on PhoB-dependent gene expression. Instead, cells lacking PhoU exhibit striking accumulation of large polyphosphate granules, suggesting that PhoU participates in controlling intracellular phosphate metabolism. IMPORTANCE The transcription factor PhoB is widely conserved throughout the bacterial kingdom, where it helps organisms respond to phosphate limitation by driving the expression of a battery of genes. Most of what is known about PhoB and its target genes is derived from studies of Escherichia coli. Our work documents the PhoB regulon in Caulobacter crescentus, and comparison to the regulon in E. coli reveals significant differences, highlighting the evolutionary

  8. Selective inhibition of yeast regulons by daunorubicin: A transcriptome-wide analysis

    PubMed Central

    Rojas, Marta; Casado, Marta; Portugal, José; Piña, Benjamin

    2008-01-01

    Background The antitumor drug daunorubicin exerts some of its cytotoxic effects by binding to DNA and inhibiting the transcription of different genes. We analysed this effect in vivo at the transcriptome level using the budding yeast Saccharomyces cerevisiae as a model and sublethal (IC40) concentrations of the drug to minimise general toxic effects. Results Daunorubicin affected a minor proportion (14%) of the yeast transcriptome, increasing the expression of 195 genes and reducing expression of 280 genes. Daunorubicin down-regulated genes included essentially all genes involved in the glycolytic pathway, the tricarboxylic acid cycle and alcohol metabolism, whereas transcription of ribosomal protein genes was not affected or even slightly increased. This pattern is consistent with a specific inhibition of glucose usage in treated cells, with only minor effects on proliferation or other basic cell functions. Analysis of promoters of down-regulated genes showed that they belong to a limited number of transcriptional regulatory units (regulons). Consistently, data mining showed that daunorubicin-induced changes in expression patterns were similar to those observed in yeast strains deleted for some transcription factors functionally related to the glycolysis and/or the cAMP regulatory pathway, which appeared to be particularly sensitive to daunorubicin. Conclusion The effects of daunorubicin treatment on the yeast transcriptome are consistent with a model in which this drug impairs binding of different transcription factors by competing for their DNA binding sequences, therefore limiting their effectiveness and affecting the corresponding regulatory networks. This proposed mechanism might have broad therapeutic implications against cancer cells growing under hypoxic conditions. PMID:18667070

  9. Prediction of transcription regulatory sites in Archaea by a comparative genomic approach.

    PubMed

    Gelfand, M S; Koonin, E V; Mironov, A A

    2000-02-01

    Intragenomic and intergenomic comparisons of upstream nucleotide sequences of archaeal genes were performed with the goal of predicting transcription regulatory sites (operators) and identifying likely regulons. Learning sets for the detection of regulatory sites were constructed using the available experimental data on archaeal transcription regulation or by analogy with known bacterial regulons, and further analysis was performed using iterative profile searches. The information content of the candidate signals detected by this method is insufficient for reliable predictions to be made. Therefore, this approach has to be complemented by examination of evolutionary conservation in different archaeal genomes. This combined strategy resulted in the prediction of a conserved heat shock regulon in all euryarchaea, a nitrogen fixation regulon in the methanogens Methanococcus jannaschii and Methanobacterium thermoautotrophicum and an aromatic amino acid regulon in M.thermoautotrophicum. Unexpectedly, the heat shock regulatory site was detected not only for genes that encode known chaperone proteins but also for archaeal histone genes. This suggests a possible function for archaeal histones in stress-related changes in DNA condensation. In addition, comparative analysis of the genomes of three Pyrococcus species resulted in the prediction of their purine metabolism and transport regulon. The results demonstrate the feasibility of prediction of at least some transcription regulatory sites by comparing poorly characterized prokaryotic genomes, particularly when several closely related genome sequences are available. PMID:10637320

  10. Transcriptional regulation of drought response: a tortuous network of transcriptional factors

    PubMed Central

    Singh, Dhriti; Laxmi, Ashverya

    2015-01-01

    Drought is one of the leading factors responsible for the reduction in crop yield worldwide. Due to climate change, in future, more areas are going to be affected by drought and for prolonged periods. Therefore, understanding the mechanisms underlying the drought response is one of the major scientific concerns for improving crop yield. Plants deploy diverse strategies and mechanisms to respond and tolerate drought stress. Expression of numerous genes is modulated in different plants under drought stress that help them to optimize their growth and development. Plant hormone abscisic acid (ABA) plays a major role in plant response and tolerance by regulating the expression of many genes under drought stress. Transcription factors being the major regulator of gene expression play a crucial role in stress response. ABA regulates the expression of most of the target genes through ABA-responsive element (ABRE) binding protein/ABRE binding factor (AREB/ABF) transcription factors. Genes regulated by AREB/ABFs constitute a regulon termed as AREB/ABF regulon. In addition to this, drought responsive genes are also regulated by ABA-independent mechanisms. In ABA-independent regulation, dehydration-responsive element binding protein (DREB), NAM, ATAF, and CUC regulons play an important role by regulating many drought-responsive genes. Apart from these major regulons, MYB/MYC, WRKY, and nuclear factor-Y (NF-Y) transcription factors are also involved in drought response and tolerance. Our understanding about transcriptional regulation of drought is still evolving. Recent reports have suggested the existence of crosstalk between different transcription factors operating under drought stress. In this article, we have reviewed various regulons working under drought stress and their crosstalk with each other. PMID:26579147

  11. Transcriptome-based analysis of the Pantoea stewartii quorum-sensing regulon and identification of EsaR direct targets.

    PubMed

    Ramachandran, Revathy; Burke, Alison Kernell; Cormier, Guy; Jensen, Roderick V; Stevens, Ann M

    2014-09-01

    Pantoea stewartii subsp. stewartii is a proteobacterium that causes Stewart's wilt disease in corn plants. The bacteria form a biofilm in the xylem of infected plants and produce capsule that blocks water transport, eventually causing wilt. At low cell densities, the quorum-sensing (QS) regulatory protein EsaR is known to directly repress expression of esaR itself as well as the genes for the capsular synthesis operon transcription regulator, rcsA, and a 2,5-diketogluconate reductase, dkgA. It simultaneously directly activates expression of genes for a putative small RNA, esaS, the glycerol utilization operon, glpFKX, and another transcriptional regulator, lrhA. At high bacterial cell densities, all of this regulation is relieved when EsaR binds an acylated homoserine lactone signal, which is synthesized constitutively over growth. QS-dependent gene expression is critical for the establishment of disease in the plant. However, the identity of the full set of genes controlled by EsaR/QS is unknown. A proteomic approach previously identified around 30 proteins in the QS regulon. In this study, a whole-transcriptome, next-generation sequencing analysis of rRNA-depleted RNA from QS-proficient and -deficient P. stewartii strains was performed to identify additional targets of EsaR. EsaR-dependent transcriptional regulation of a subset of differentially expressed genes was confirmed by quantitative reverse transcription-PCR (qRT-PCR). Electrophoretic mobility shift assays demonstrated that EsaR directly bound 10 newly identified target promoters. Overall, the QS regulon of P. stewartii orchestrates three major physiological responses: capsule and cell envelope biosynthesis, surface motility and adhesion, and stress response. PMID:25015891

  12. Transcriptome-Based Analysis of the Pantoea stewartii Quorum-Sensing Regulon and Identification of EsaR Direct Targets

    PubMed Central

    Ramachandran, Revathy; Burke, Alison Kernell; Cormier, Guy; Jensen, Roderick V.

    2014-01-01

    Pantoea stewartii subsp. stewartii is a proteobacterium that causes Stewart's wilt disease in corn plants. The bacteria form a biofilm in the xylem of infected plants and produce capsule that blocks water transport, eventually causing wilt. At low cell densities, the quorum-sensing (QS) regulatory protein EsaR is known to directly repress expression of esaR itself as well as the genes for the capsular synthesis operon transcription regulator, rcsA, and a 2,5-diketogluconate reductase, dkgA. It simultaneously directly activates expression of genes for a putative small RNA, esaS, the glycerol utilization operon, glpFKX, and another transcriptional regulator, lrhA. At high bacterial cell densities, all of this regulation is relieved when EsaR binds an acylated homoserine lactone signal, which is synthesized constitutively over growth. QS-dependent gene expression is critical for the establishment of disease in the plant. However, the identity of the full set of genes controlled by EsaR/QS is unknown. A proteomic approach previously identified around 30 proteins in the QS regulon. In this study, a whole-transcriptome, next-generation sequencing analysis of rRNA-depleted RNA from QS-proficient and -deficient P. stewartii strains was performed to identify additional targets of EsaR. EsaR-dependent transcriptional regulation of a subset of differentially expressed genes was confirmed by quantitative reverse transcription-PCR (qRT-PCR). Electrophoretic mobility shift assays demonstrated that EsaR directly bound 10 newly identified target promoters. Overall, the QS regulon of P. stewartii orchestrates three major physiological responses: capsule and cell envelope biosynthesis, surface motility and adhesion, and stress response. PMID:25015891

  13. Effects of Enrichment on Expression of Key Nutrient Regulons in Extremophiles in Hydrothermal Springs at Yellowstone National Park

    NASA Astrophysics Data System (ADS)

    Knowlton, M.; Elser, J. J.; Poret-peterson, A. T.

    2011-12-01

    To cope with nutrient limitation, micro-organisms have evolved diverse means to increase acquisition of nutrients such as ammonium, nitrate, and phosphate and trace metals when they become limiting. These strategies typically involve production of compound-specific transporters (i.e., ammonium transporters) or extracellular enzymes (i.e., alkaline phosphatase). Genes that encode these proteins are often under the control of shared regulatory proteins called regulons. Regulons of genes for N, P, or Fe metabolism ultimately affect the transport of vital nutrients into and out of cells and thus help organisms deal with nutrient limitation. Regulons for N, P, and Fe have been found and studied ex situ for model organisms under various nutrient-limiting conditions but are relatively unstudied in the field, especially in hydrothermal systems. The aim of this study was to characterize transcription patterns of genes for N, P, and Fe processing under experimental nutrient enrichment in a complex microbial community from an alkaline hot spring located in Yellowstone National Park. Microbial mat samples and hot spring water were placed in bottles, subjected to a fully factorial manipulation of N (125 μM N as ammonium nitrate), phosphorus (7.8 μM P as sodium phosphate), and Fe (7.8 x 10-2 μM Fe as ferric citrate), and incubated overnight at in situ temperatures. Following incubation, hot spring water was filtered and preserved for nutrient analyses and biomass subsamples were snap-frozen for molecular analysis. Chemical analysis showed a total removal of NH4 and PO4 from the water in all treatments. NO3 decreased slightly in most treatments (control, +N, +P, +Fe, +PFe, and +NPFe) but increased in the others (+NFe and +NP). Interestingly, Fe concentrations were lower in amended samples (+Fe, +NFe, +PFe, and +NPFe) than in unamended samples (control, +N, +P, +NP). To assess the transcriptional responses, primers were designed to target genes controlled by the ferric uptake

  14. PTS phosphorylation of Mga modulates regulon expression and virulence in the group A streptococcus.

    PubMed

    Hondorp, Elise R; Hou, Sherry C; Hause, Lara L; Gera, Kanika; Lee, Ching-En; McIver, Kevin S

    2013-06-01

    The ability of a bacterial pathogen to monitor available carbon sources in host tissues provides a clear fitness advantage. In the group A streptococcus (GAS), the virulence regulator Mga contains homology to phosphotransferase system (PTS) regulatory domains (PRDs) found in sugar operon regulators. Here we show that Mga was phosphorylated in vitro by the PTS components EI/HPr at conserved PRD histidines. A ΔptsI (EI-deficient) GAS mutant exhibited decreased Mga activity. However, PTS-mediated phosphorylation inhibited Mga-dependent transcription of emm in vitro. Using alanine (unphosphorylated) and aspartate (phosphomimetic) mutations of PRD histidines, we establish that a doubly phosphorylated PRD1 phosphomimetic (D/DMga4) is completely inactive in vivo, shutting down expression of the Mga regulon. Although D/DMga4 is still able to bind DNA in vitro, homo-multimerization of Mga is disrupted and the protein is unable to activate transcription. PTS-mediated regulation of Mga activity appears to be important for pathogenesis, as bacteria expressing either non-phosphorylated (A/A) or phosphomimetic (D/D) PRD1 Mga mutants were attenuated in a model of GAS invasive skin disease. Thus, PTS-mediated phosphorylation of Mga may allow the bacteria to modulate virulence gene expression in response to carbohydrate status. Furthermore, PRD-containing virulence regulators (PCVRs) appear to be widespread in Gram-positive pathogens. PMID:23651410

  15. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  16. Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium

    PubMed Central

    Wernimont, Amy K.; Artz, Jennifer D.; Finerty, Patrick; Lin, Y.; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond

    2013-01-01

    Calcium-dependent protein kinases (CDPKs) play pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites, and comprise a CaMK-like kinase domain regulated by a calcium-binding domain in the C-terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N-terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate-binding site. This large conformational change constitutes a distinct mechanism in calcium signal transduction pathways. PMID:20436473

  17. A DOC2 Protein Identified by Mutational Profiling is Essential for Apicomplexan Parasite Exocytosis

    PubMed Central

    Farrell, Andrew; Thirugnanam, Sivasakthivel; Lorestani, Alexander; Dvorin, Jeffrey D.; Eidell, Keith P.; Ferguson, David J.P.; Anderson-White, Brooke R.; Duraisingh, Manoj T.; Marth, Gabor T.; Gubbels, Marc-Jan

    2012-01-01

    Exocytosis is essential to the lytic cycle of apicomplexan parasites and required for the pathogenesis of toxoplasmosis and malaria. DOC2 proteins recruit the membrane fusion machinery required for exocytosis in a Ca2+-dependent fashion. Here, the phenotype of a Toxoplasma gondii conditional mutant impaired in host cell invasion and egress was pinpointed to a defect in secretion of the micronemes, an apicomplexan-specific organelle that contains adhesion proteins. Whole genome sequencing identified the etiological point mutation in TgDOC2.1. A conditional allele of the orthologous gene engineered into Plasmodium falciparum was also defective in microneme secretion. However, the major effect was on invasion, suggesting microneme secretion is dispensable for Plasmodium egress. PMID:22246776

  18. Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium

    SciTech Connect

    Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond

    2010-09-21

    Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

  19. Cryptic organelle homology in Apicomplexan parasites: Insights from evolutionary cell biology

    PubMed Central

    Klinger, Christen M.; Nisbet, R. Ellen; Ouologuem, Dinkorma T.; Roos, David S.; Dacks, Joel B.

    2013-01-01

    The economic and clinical significance of apicomplexan parasites drives interest in their many evolutionary novelties. Distinctive intracellular organelles play key roles in parasite motility, invasion, metabolism, and replication, and understanding their relationship with the organelles of better-studied eukaryotic systems suggests potential targets for therapeutic intervention. Recent work has demonstrated divergent aspects of canonical eukaryotic components in the apicomplexa, including Golgi bodies and mitochondria. The apicoplast is a relict plastid of secondary endosymbiotic origin, harboring metabolic pathways distinct from those of host species. The inner membrane complex is derived from the cortical alveoli defining the superphylum Alveolata, but in apicomplexans functions in parasite motility and replication. Micronemes and rhoptries are associated with establishment of the intracellular niche, and define the apical complex for which the phylum is named. Morphological, cell biological and molecular evidence strongly suggest that these organelles are derived from the endocytic pathway. PMID:23932202

  20. Genome-scale protein expression and structural biology of Plasmodium falciparum and related Apicomplexan organisms.

    PubMed

    Vedadi, Masoud; Lew, Jocelyne; Artz, Jennifer; Amani, Mehrnaz; Zhao, Yong; Dong, Aiping; Wasney, Gregory A; Gao, Mian; Hills, Tanya; Brokx, Stephen; Qiu, Wei; Sharma, Sujata; Diassiti, Angelina; Alam, Zahoor; Melone, Michelle; Mulichak, Anne; Wernimont, Amy; Bray, James; Loppnau, Peter; Plotnikova, Olga; Newberry, Kate; Sundararajan, Emayavaram; Houston, Simon; Walker, John; Tempel, Wolfram; Bochkarev, Alexey; Kozieradzki, Ivona; Edwards, Aled; Arrowsmith, Cheryl; Roos, David; Kain, Kevin; Hui, Raymond

    2007-01-01

    Parasites from the protozoan phylum Apicomplexa are responsible for diseases, such as malaria, toxoplasmosis and cryptosporidiosis, all of which have significantly higher rates of mortality and morbidity in economically underdeveloped regions of the world. Advances in vaccine development and drug discovery are urgently needed to control these diseases and can be facilitated by production of purified recombinant proteins from Apicomplexan genomes and determination of their 3D structures. To date, both heterologous expression and crystallization of Apicomplexan proteins have seen only limited success. In an effort to explore the effectiveness of producing and crystallizing proteins on a genome-scale using a standardized methodology, over 400 distinct Plasmodium falciparum target genes were chosen representing different cellular classes, along with select orthologues from four other Plasmodium species as well as Cryptosporidium parvum and Toxoplasma gondii. From a total of 1008 genes from the seven genomes, 304 (30.2%) produced purified soluble proteins and 97 (9.6%) crystallized, culminating in 36 crystal structures. These results demonstrate that, contrary to previous findings, a standardized platform using Escherichia coli can be effective for genome-scale production and crystallography of Apicomplexan proteins. Predictably, orthologous proteins from different Apicomplexan genomes behaved differently in expression, purification and crystallization, although the overall success rates of Plasmodium orthologues do not differ significantly. Their differences were effectively exploited to elevate the overall productivity to levels comparable to the most successful ongoing structural genomics projects: 229 of the 468 target genes produced purified soluble protein from one or more organisms, with 80 and 32 of the purified targets, respectively, leading to crystals and ultimately structures from one or more orthologues. PMID:17125854

  1. Is an Apicomplexan Parasite Responsible for the Collapse of the Iceland Scallop (Chlamys islandica) Stock?

    PubMed Central

    Kristmundsson, Árni; Erlingsdóttir, Ásthildur; Freeman, Mark A.

    2015-01-01

    Due to the total and unexpected collapse of the Iceland scallop, Chlamys islandica, stocks around Iceland during the 2000s, a commercial fishing ban has been imposed on this valuable resource since 2003. Following the initial identification of an apicomplexan parasite in the scallops, a long-term surveillance program was established to evaluate the effect of the parasite on the population. The infections were highly prevalent in all shell sizes throughout the study. However, the parasite only impacts mature scallops where they cause severe macroscopic changes, characterized by an extensively diminished and abnormally coloured adductor muscle. A highly significant relationship was observed between infection intensity and gonad and adductor muscle indices. The first four years of the study, were characterized by high infection intensity and very poor condition of the adductor muscle and gonads, whilst during subsequent years, infections gradually decreased and the condition of the scallops improved. Histopathological changes were restricted to the presence of apicomplexan zoites which were widely distributed, causing varying degrees of pathology in all organs. In heavy infections, muscular and connective tissues were totally necrotized, destroying significant parts of numerous organs, especially the adductor muscle, digestive gland and gonads. The progression of the disease was in good synchrony with the mortality rates and the subsequent decline observed in the scallop stock and recruitment indices. Our findings strongly suggest that the apicomplexan parasite played a major role in the collapse of the Iceland scallop stock in Breidafjordur. In addition to causing mortality, the infections significantly impact gonad development which contributes further to the collapse of the stock in the form of lower larval recruitment. Furthermore, compelling evidence exists that this apicomplexan pathogen is causing serious disease outbreaks in other scallop populations. Similar

  2. Characterization of relA and codY mutants of Listeria monocytogenes: identification of the CodY regulon and its role in virulence.

    PubMed

    Bennett, Hayley J; Pearce, David M; Glenn, Sarah; Taylor, Clare M; Kuhn, Michael; Sonenshein, Abraham L; Andrew, Peter W; Roberts, Ian S

    2007-03-01

    Listeria monocytogenes is a Gram-positive intracellular parasite and the causative organism of human listeriosis. In this article we demonstrate that L. monocytogenes encodes a functional member of the CodY family of global regulatory proteins that is responsive to both GTP and branched chain amino acids. By transcript analyses we identified the CodY regulon in L. monocytogenes and demonstrated that it comprises genes involved in amino acid metabolism, nitrogen assimilation as well as genes involved in sugar uptake and incorporation, indicating a role for CodY in L. monocytogenes in both carbon and nitrogen assimilation. A DeltarelA mutation reduced expression of the CodY regulon in early stationary phase and introduction of a DeltacodY mutation into a DeltarelA strain restored virulence. These data indicate that the avirulence of the DeltarelA mutant can in part be explained by the continued repression of the CodY regulon. The phenotypes of DeltarelA and DeltacodY mutants were studied in J774.A1 and Caco-2 cells and the DeltarelA mutation shown to effect intracellular growth. These results provide the first direct evidence that the activity of a CodY-type protein influences pathogenesis and provides new information on the physiological adaptation of L. monocytogenes to post-exponential phase growth and virulence. PMID:17302820

  3. Comparative Analysis of Apicoplast-Targeted Protein Extension Lengths in Apicomplexan Parasites

    PubMed Central

    Seliverstov, Alexandr V.; Zverkov, Oleg A.; Istomina, Svetlana N.; Pirogov, Sergey A.; Kitsis, Philip S.

    2015-01-01

    In general, the mechanism of protein translocation through the apicoplast membrane requires a specific extension of a functionally important region of the apicoplast-targeted proteins. The corresponding signal peptides were detected in many apicomplexans but not in the majority of apicoplast-targeted proteins in Toxoplasma gondii. In T. gondii signal peptides are either much diverged or their extension region is processed, which in either case makes the situation different from other studied apicomplexans. We propose a statistic method to compare extensions of the functionally important regions of apicoplast-targeted proteins. More specifically, we provide a comparison of extension lengths of orthologous apicoplast-targeted proteins in apicomplexan parasites. We focus on results obtained for the model species T. gondii, Neospora caninum, and Plasmodium falciparum. With our method, cross species comparisons demonstrate that, in average, apicoplast-targeted protein extensions in T. gondii are 1.5-fold longer than in N. caninum and 2-fold longer than in P. falciparum. Extensions in P. falciparum less than 87 residues in size are longer than the corresponding extensions in N. caninum and, reversely, are shorter if they exceed 88 residues. PMID:26114107

  4. Two recently sequenced vertebrate genomes are contaminated with apicomplexan species of the Sarcocystidae family.

    PubMed

    Orosz, Ferenc

    2015-11-01

    This paper highlights a general problem, namely that host genome sequences can easily be contaminated with parasite sequences, thus careful isolation of genetic material and careful bioinformatics analysis are needed in all cases. Two recently published genomes are shown here to be contaminated with sequences of apicomplexan parasites which belong to the Sarcocystidae family. Sequences of the characteristic apicomplexan organelle, the apicoplast, were used as queries in BLASTN searches against nucleotide sequences of various animal groups looking for possible contamination. Draft genomes of a bird, Colinus virginianus (Halley et al., 2014), and a bat, Myotis davidii (Zhang et al., 2013) were found to contain at least six and 17 contigs, respectively, originating from the apicoplast of an apicomplexan species, and other genes specific to this phylum can also be found in the published genomes. Obviously, the sources of the genetic material, the muscle and the kidney of the animals, respectively, contained the parasitic cysts. Phylogenetic analyses using 18S rRNA and internal transcribed spacer 1 genes show that the parasite contaminating C. virginianus is a species of Sarcocystis related to ones known to cycle between avian and mammalian hosts. In the case of M. davidii it belongs to the Nephroisospora genus, the only member of which, Nephroisospora eptesici, has been recently identified from the kidney of big brown bats (Eptesicus fuscus). PMID:26264549

  5. The Organellar Genomes of Chromera and Vitrella, the Phototrophic Relatives of Apicomplexan Parasites.

    PubMed

    Oborník, Miroslav; Lukeš, Julius

    2015-01-01

    Apicomplexa are known to contain greatly reduced organellar genomes. Their mitochondrial genome carries only three protein-coding genes, and their plastid genome is reduced to a 35-kb-long circle. The discovery of coral-endosymbiotic algae Chromera velia and Vitrella brassicaformis, which share a common ancestry with Apicomplexa, provided an opportunity to study possibly ancestral forms of organellar genomes, a unique glimpse into the evolutionary history of apicomplexan parasites. The structurally similar mitochondrial genomes of Chromera and Vitrella differ in gene content, which is reflected in the composition of their respiratory chains. Thus, Chromera lacks respiratory complexes I and III, whereas Vitrella and apicomplexan parasites are missing only complex I. Plastid genomes differ substantially between these algae, particularly in structure: The Chromera plastid genome is a linear, 120-kb molecule with large and divergent genes, whereas the plastid genome of Vitrella is a highly compact circle that is only 85 kb long but nonetheless contains more genes than that of Chromera. It appears that organellar genomes have already been reduced in free-living phototrophic ancestors of apicomplexan parasites, and such reduction is not associated with parasitism. PMID:26092225

  6. Protein level identification of the Listeria monocytogenes Sigma H, Sigma L, and Sigma C regulons

    PubMed Central

    2013-01-01

    Background Transcriptional regulation by alternative sigma (σ) factors represents an important mechanism that allows bacteria to rapidly regulate transcript and protein levels in response to changing environmental conditions. While the role of the alternative σ factor σB has been comparatively well characterized in L. monocytogenes, our understanding of the roles of the three other L. monocytogenes alternative σ factors is still limited. In this study, we employed a quantitative proteomics approach using Isobaric Tags for Relative and Absolute Quantitation (iTRAQ) to characterize the L. monocytogenes σL, σH, and σC protein regulons. Proteomic comparisons used a quadruple alternative σ factor mutant strain (ΔBCHL) and strains expressing a single alternative σ factor (i.e., σL, σH, and σC; strains ΔBCH, ΔBCL, and ΔBHL) to eliminate potential redundancies between σ factors. Results Among the three alternative σ factors studied here, σH provides positive regulation for the largest number of proteins, consistent with previous transcriptomic studies, while σL appears to contribute to negative regulation of a number of proteins. σC was found to regulate a small number of proteins in L. monocytogenes grown to stationary phase at 37°C. Proteins identified as being regulated by multiple alternative σ factors include MptA, which is a component of a PTS system with a potential role in regulation of PrfA activity. Conclusions This study provides initial insights into global regulation of protein production by the L. monocytogenes alternative σ factors σL, σH, and σC. While, among these σ factors, σH appears to positively regulate the largest number of proteins, we also identified PTS systems that appear to be co-regulated by multiple alternative σ factors. Future studies should not only explore potential roles of alternative σ factors in activating a “cascade” of PTS systems that potentially regulate PrfA, but also may want to explore the

  7. Genetic characterization of the HrpL regulon of the fire blight pathogen Erwinia amylovora reveals novel virulence factors.

    PubMed

    McNally, R Ryan; Toth, Ian K; Cock, Peter J A; Pritchard, Leighton; Hedley, Pete E; Morris, Jenny A; Zhao, Youfu; Sundin, George W

    2012-02-01

    The bacterial pathogen Erwinia amylovora is the causal agent of fire blight, an economically significant disease of apple and pear. Disease initiation by E. amylovora requires the translocation of effector proteins into host cells via the hypersensitive response and pathogenicity (hrp) type III secretion system (T3SS). The alternative sigma factor HrpL positively regulates the transcription of structural and translocated components of the T3SS via hrp promoter elements. To characterize genome-wide HrpL-dependent gene expression in E. amylovora Ea1189, wild-type and Ea1189ΔhrpL strains were cultured in hrp-inducing minimal medium, and total RNA was compared using a custom microarray designed to represent the annotated genes of E. amylovora ATCC 49946. The results revealed 24 genes differentially regulated in Ea1189ΔhrpL relative to Ea1189 with fold-change expression ratios greater than 1.5; of these, 19 genes exhibited decreased transcript abundance and five genes showed increased transcript abundance relative to Ea1189. To expand our understanding of the HrpL regulon and to elucidate direct versus indirect HrpL-mediated effects on gene expression, the genome of E. amylovora ATCC 49946 was examined in silico using a hidden Markov model assembled from known Erwinia spp. hrp promoters. This technique identified 15 putative type III novel hrp promoters, seven of which were validated with quantitative polymerase chain reaction based on expression analyses. It was found that HrpL-regulated genes encode all known components of the hrp T3SS, as well as five putative type III effectors. Eight genes displayed apparent indirect HrpL regulation, suggesting that the HrpL regulon is connected to downstream signalling networks. The construction of deletion mutants of three novel HrpL-regulated genes resulted in the identification of additional virulence factors as well as mutants displaying abnormal motility and biofilm phenotypes. PMID:21831138

  8. The CBF1-dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp.

    PubMed

    Benedict, Catherine; Skinner, Jeffrey S; Meng, Rengong; Chang, Yongjian; Bhalerao, Rishikesh; Huner, Norman P A; Finn, Chad E; Chen, Tony H H; Hurry, Vaughan

    2006-07-01

    The meristematic tissues of temperate woody perennials must acclimate to freezing temperatures to survive the winter and resume growth the following year. To determine whether the C-repeat binding factor (CBF) family of transcription factors contributing to this process in annual herbaceous species also functions in woody perennials, we investigated the changes in phenotype and transcript profile of transgenic Populus constitutively expressing CBF1 from Arabidopsis (AtCBF1). Ectopic expression of AtCBF1 was sufficient to significantly increase the freezing tolerance of non-acclimated leaves and stems relative to wild-type plants. cDNA microarray experiments identified genes up-regulated by ectopic AtCBF1 expression in Populus, demonstrated a strong conservation of the CBF regulon between Populus and Arabidopsis and identified differences between leaf and stem regulons. We studied the induction kinetics and tissue specificity of four CBF paralogues identified from the Populus balsamifera subsp. trichocarpa genome sequence (PtCBFs). All four PtCBFs are cold-inducible in leaves, but only PtCBF1 and PtCBF3 show significant induction in stems. Our results suggest that the central role played by the CBF family of transcriptional activators in cold acclimation of Arabidopsis has been maintained in Populus. However, the differential expression of the PtCBFs and differing clusters of CBF-responsive genes in annual (leaf) and perennial (stem) tissues suggest that the perennial-driven evolution of winter dormancy may have given rise to specific roles for these 'master-switches' in the different annual and perennial tissues of woody species. PMID:17080948

  9. Expanding the Direct HetR Regulon in Anabaena sp. Strain PCC 7120

    PubMed Central

    Videau, Patrick; Ni, Shuisong; Rivers, Orion S.; Ushijima, Blake; Feldmann, Erik A.; Cozy, Loralyn M.; Kennedy, Michael A.

    2014-01-01

    In response to a lack of environmental combined nitrogen, the filamentous cyanobacterium Anabaena sp. strain PCC 7120 differentiates nitrogen-fixing heterocyst cells in a periodic pattern. HetR is a transcription factor that coordinates the regulation of this developmental program. An inverted repeat-containing sequence in the hepA promoter required for proheterocyst-specific transcription was identified based on sequence similarity to a previously characterized binding site for HetR in the promoter of hetP. The binding affinity of HetR for the hepA site is roughly an order of magnitude lower than that for the hetP binding site. A BLAST search of the Anabaena genome identified 166 hepA-like sites that occur as single or tandem sites (two binding sites separated by 13 bp). The vast majority of these sites are present in predicted intergenic regions. HetR bound five representative single binding sites in vitro, and binding was abrogated by transversions in the binding sites that conserved the inverted repeat nature of the sites. Binding to four representative tandem sites was not observed. Transcriptional fusions of the green fluorescent protein gene gfp with putative promoter regions associated with the representative binding sites indicated that HetR could function as either an activator or repressor and that activation was cell-type specific. Taken together, we have expanded the direct HetR regulon and propose a model in which three categories of HetR binding sites, based on binding affinity and nucleotide sequence, contribute to three of the four phases of differentiation. PMID:24375104

  10. On the necessity and biological significance of threshold-free regulon prediction outputs.

    PubMed

    Rigali, Sébastien; Nivelle, Renaud; Tocquin, Pierre

    2015-02-01

    The in silico prediction of cis-acting elements in a genome is an efficient way to quickly obtain an overview of the biological processes controlled by a trans-acting factor, and connections between regulatory networks. Several regulon prediction web tools are available, designed to identify DNA motifs predicted to be bound by transcription factors using position weight matrix-based algorithms. In this paper we expose and discuss the conflicting objectives of software creators (bioinformaticians) and software users (biologists), who aim for reliable and exhaustive prediction outputs, respectively. Software makers, concerned with providing tools that minimise the number of false positive hits, often impose a stringent threshold score for a sequence to be included in the list of the putative cis-acting sites. This rigidity eventually results in the identification of strongly reliable but largely straightforward sites, i.e. those associated with genes already anticipated to be targeted by the studied transcription factor. Importantly, this biased identification of strongly bound sequences contrasts with the biological reality where, in many circumstances, a weak DNA-protein interaction is required for the appropriate gene's expression. We show here a series of transcriptionally controlled systems involving weakly bound cis-acting elements that could never have been discovered because of the policy of preventing software users from modifying the screening parameters. Proposing only trustworthy prediction outputs thus prevents biologists from fully utilising their knowledge background and deciding to analyse statistically irrelevant hits that could nonetheless be potentially involved in subtle, unexpected, though essential cis-trans relationships. PMID:25387521

  11. The regulatory cascade that activates the Hrp regulon in Erwinia herbicola pv. gypsophilae.

    PubMed

    Nizan-Koren, R; Manulis, S; Mor, H; Iraki, N M; Barash, I

    2003-03-01

    The pathogenicity of Erwinia herbicola pv. gypsophilae (Ehg) is dependent on a plasmid (pPATH(Ehg)) that harbors the hrp gene cluster and additional virulence genes. The hrp regulatory cascade of Ehg comprises an hrpXY operon encoding a two-component system; hrpS encoding a transcriptional factor of the NtrC family and hrpL encoding an alternative sigma factor. Results obtained suggest the following signal transduction model for activating the Hrp regulon: phosphorylated HrpY activates hrpS, HrpS activates hrpL, and HrpL activates genes containing "hrp box" promoter. This model was supported by studies on the effects of mutations in the regulatory genes on pathogenicity and complementation analysis. Nonpolar mutations in hrpX did not affect virulence or transcription of downstream genes. Site-directed mutagenesis of the conserved aspartate 57 in HrpY suggested that its phosphorylation is crucial for activating the hrp regulatory cascade. Studies on the effects of mutations in the hrp regulatory genes on transcriptional activity of downstream genes or of their isolated promoters in planta showed dependency of hrpS expression on active HrpY, of hrpL expression on active HrpS, and of hrpN or hrpJ expression on active HrpL. These results were also partially supported by overexpression of regulatory genes under in vitro conditions. The hrpXY is constitutively expressed with high basal levels under repressive conditions, in contrast to hrpS and hrpL, which exhibit low basal expression levels and are environmentally regulated. PMID:12650456

  12. Regulon of the N-Acetylglucosamine Utilization Regulator NagR in Bacillus subtilis▿†

    PubMed Central

    Bertram, Ralph; Rigali, Sébastien; Wood, Natalie; Lulko, Andrzej T.; Kuipers, Oscar P.; Titgemeyer, Fritz

    2011-01-01

    N-Acetylglucosamine (GlcNAc) is the most abundant carbon-nitrogen biocompound on earth and has been shown to be an important source of nutrients for both catabolic and anabolic purposes in Bacillus species. In this work we show that the GntR family regulator YvoA of Bacillus subtilis serves as a negative transcriptional regulator of GlcNAc catabolism gene expression. YvoA represses transcription by binding a 16-bp sequence upstream of nagP encoding the GlcNAc-specific EIIBC component of the sugar phosphotransferase system involved in GlcNAc transport and phosphorylation, as well as another very similar 16-bp sequence upstream of the nagAB-yvoA locus, wherein nagA codes for N-acetylglucosamine-6-phosphate deacetylase and nagB codes for the glucosamine-6-phosphate (GlcN-6-P) deaminase. In vitro experiments demonstrated that GlcN-6-P acts as an inhibitor of YvoA DNA-binding activity, as occurs for its Streptomyces ortholog, DasR. Interestingly, we observed that the expression of nag genes was still activated upon addition of GlcNAc in a ΔyvoA mutant background, suggesting the existence of an auxiliary transcriptional control instance. Initial computational prediction of the YvoA regulon showed a distribution of YvoA binding sites limited to nag genes and therefore suggests renaming YvoA to NagR, for N-acetylglucosamine utilization regulator. Whole-transcriptome studies showed significant repercussions of nagR deletion for several major B. subtilis regulators, probably indirectly due to an excess of the crucial molecules acetate, ammonia, and fructose-6-phosphate, resulting from complete hydrolysis of GlcNAc. We discuss a model deduced from NagR-mediated gene expression, which highlights clear connections with pathways for GlcNAc-containing polymer biosynthesis and adaptation to growth under oxygen limitation. PMID:21602348

  13. Overlapping Alternative Sigma Factor Regulons in the Response to Singlet Oxygen in Rhodobacter sphaeroides▿ †

    PubMed Central

    Nuss, Aaron M.; Glaeser, Jens; Berghoff, Bork A.; Klug, Gabriele

    2010-01-01

    Organisms performing photosynthesis in the presence of oxygen have to cope with the formation of highly reactive singlet oxygen (1O2) and need to mount an adaptive response to photooxidative stress. Here we show that the alternative sigma factors RpoHI and RpoHII are both involved in the 1O2 response and in the heat stress response in Rhodobacter sphaeroides. We propose RpoHII to be the major player in the 1O2 response, whereas RpoHI is more important for the heat stress response. Mapping of the 5′ ends of RpoHII- and also RpoHI/RpoHII-dependent transcripts revealed clear differences in the −10 regions of the putative promoter sequences. By using bioinformatic tools, we extended the RpoHII regulon, which includes genes induced by 1O2 exposure. These genes encode proteins which are, e.g., involved in methionine sulfoxide reduction and in maintaining the quinone pool. Furthermore, we identified small RNAs which depend on RpoHI and RpoHII and are likely to contribute to the defense against photooxidative stress and heat stress. PMID:20304993

  14. A regulon conserved in monocot and dicot plants defines a functional module in antifungal plant immunity

    PubMed Central

    Humphry, Matt; Bednarek, Paweł; Kemmerling, Birgit; Koh, Serry; Stein, Mónica; Göbel, Ulrike; Stüber, Kurt; Piślewska-Bednarek, Mariola; Loraine, Ann; Schulze-Lefert, Paul; Somerville, Shauna; Panstruga, Ralph

    2010-01-01

    At least two components that modulate plant resistance against the fungal powdery mildew disease are ancient and have been conserved since the time of the monocot–dicot split (≈200 Mya). These components are the seven transmembrane domain containing MLO/MLO2 protein and the syntaxin ROR2/PEN1, which act antagonistically and have been identified in the monocot barley (Hordeum vulgare) and the dicot Arabidopsis thaliana, respectively. Additionally, syntaxin-interacting N-ethylmaleimide sensitive factor adaptor protein receptor proteins (VAMP721/722 and SNAP33/34) as well as a myrosinase (PEN2) and an ABC transporter (PEN3) contribute to antifungal resistance in both barley and/or Arabidopsis. Here, we show that these genetically defined defense components share a similar set of coexpressed genes in the two plant species, comprising a statistically significant overrepresentation of gene products involved in regulation of transcription, posttranslational modification, and signaling. Most of the coexpressed Arabidopsis genes possess a common cis-regulatory element that may dictate their coordinated expression. We exploited gene coexpression to uncover numerous components in Arabidopsis involved in antifungal defense. Together, our data provide evidence for an evolutionarily conserved regulon composed of core components and clade/species-specific innovations that functions as a module in plant innate immunity. PMID:21098265

  15. The role of the trehalose system in regulating the maltose regulon of Escherichia coli.

    PubMed

    Decker, K; Gerhardt, F; Boos, W

    1999-05-01

    The maltose regulon consists of 10 genes encoding an ABC transporter for maltose and maltodextrins as well as enzymes necessary for their degradation. MalK, the energy-transducing subunit of the transport system, acts phenotypically as a repressor of MalT, the transcriptional activator of the mal genes. Using MacConkey maltose indicator plates we isolated an insertion mutation that strongly reduced the repressing effect of overproduced MalK. The insertion had occurred in treR encoding the repressor of the trehalose system. The loss of TreR function led to derepression of treB encoding an enzymeIITre of the PTS for trehalose and of treC encoding TreC, the cytoplasmic trehalose-6-phosphate hydrolase. Further analysis revealed that maltose can enter the cell by facilitated diffusion through enzymeIITre, thus causing induction of the maltose system. In addition, derepression of TreC by itself caused induction of the maltose system, and a mutant lacking TreC was reduced in the uninduced level of mal gene expression indicating synthesis of endogenous inducer by TreC. Extracts containing TreC transformed [14C]-maltose into another 14C-labelled compound (preliminarily identified as maltose 1-phosphate) that is likely to be an alternative inducer of the maltose system. PMID:10361281

  16. The Rip1 Protease of Mycobacterium tuberculosis Controls the SigD Regulon

    PubMed Central

    Schneider, Jessica S.; Sklar, Joseph G.

    2014-01-01

    Regulated intramembrane proteolysis of membrane-embedded substrates by site-2 proteases (S2Ps) is a widespread mechanism of transmembrane signal transduction in bacteria and bacterial pathogens. We previously demonstrated that the Mycobacterium tuberculosis S2P Rip1 is required for full virulence in the mouse model of infection. Rip1 controls transcription in part through proteolysis of three transmembrane anti-sigma factors, anti-SigK, -L, and -M, but there are also Rip1-dependent, SigKLM-independent pathways. To determine the contribution of the sigma factors K, L, and M to the Δrip1 attenuation phenotype, we constructed an M. tuberculosis ΔsigKΔ sigL ΔsigM mutant and found that this strain fails to recapitulate the marked attenuation of Δrip1 in mice. In a search for additional pathways controlled by Rip1, we demonstrated that the SigD regulon is positively regulated by the Rip1 pathway. Rip1 cleavage of transmembrane anti-SigD is required for expression of SigD target genes. In the absence of Rip1, proteolytic maturation of RsdA is impaired. These findings identify RsdA/SigD as a fourth arm of the branched pathway controlled by Rip1 in M. tuberculosis. PMID:24816608

  17. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment.

    PubMed

    Wagner, Victoria E; Bushnell, Daniel; Passador, Luciano; Brooks, Andrew I; Iglewski, Barbara H

    2003-04-01

    Bacterial communication via quorum sensing (QS) has been reported to be important in the production of virulence factors, antibiotic sensitivity, and biofilm development. Two QS systems, known as the las and rhl systems, have been identified previously in the opportunistic pathogen Pseudomonas aeruginosa. High-density oligonucleotide microarrays for the P. aeruginosa PAO1 genome were used to investigate global gene expression patterns modulated by QS regulons. In the initial experiments we focused on identifying las and/or rhl QS-regulated genes using a QS signal generation-deficient mutant (PAO-JP2) that was cultured with and without added exogenous autoinducers [N-(3-oxododecanoyl) homoserine lactone and N-butyryl homoserine lactone]. Conservatively, 616 genes showed statistically significant differential expression (P transcripts of many genes that were identified as being QS regulated. PMID:12644477

  18. Fur regulon of Salmonella typhimurium: identification of new iron-regulated genes.

    PubMed Central

    Tsolis, R M; Bäumler, A J; Stojiljkovic, I; Heffron, F

    1995-01-01

    In order to identify genes belonging to the Fur regulon of Salmonella typhimurium, a bank of 10,000 independent S. typhimurium MudJ insertion mutants was screened for lacZ fusions regulated by the iron response regulator Fur. In parallel, a plasmid gene bank of S. typhimurium consisting of 10,000 independent clones was screened for Fur-regulated promoters or iron binding proteins by the Fur titration assay (FURTA). Fur-regulated MudJ insertions and Fur-regulated promoters were mapped. In addition, iron-regulated promoter activities of transcriptional fusions from MudJ insertions and FURTA-positive clones were quantified. The nucleotide sequences of 11 FURTA-positive plasmids and of short fragments of DNA flanking three MudJ insertions were determined. By these methods we identified 14 Fur-regulated genes of S. typhimurium. For 11 of these genes, Fur-regulated homologs have been described in Escherichia coli or Yersinia enterocolitica, including fhuA,fhuB,fepA,fes,fepD,p43,entB,fur ,foxA,hemP, and fhuE. In addition, we identified three genes with homologs in other bacteria which have not previously been shown to be Fur regulated. PMID:7642488

  19. Conserved CO-FT regulons contribute to the photoperiod flowering control in soybean

    PubMed Central

    2014-01-01

    Background CO and FT orthologs, belonging to the BBX and PEBP family, respectively, have important and conserved roles in the photoperiod regulation of flowering time in plants. Soybean genome experienced at least three rounds of whole genome duplications (WGDs), which resulted in multiple copies of about 75% of genes. Subsequent subfunctionalization is the main fate for paralogous gene pairs during the evolutionary process. Results The phylogenic relationships revealed that CO orthologs were widespread in the plant kingdom while FT orthologs were present only in angiosperms. Twenty-eight CO homologous genes and twenty-four FT homologous genes were gained in the soybean genome. Based on the collinear relationship, the soybean ancestral CO ortholog experienced three WGD events, but only two paralogous gene pairs (GmCOL1/2 and GmCOL5/13) survived in the modern soybean. The paralogous gene pairs, GmCOL1/2 or GmCOL5/13, showed similar expression patterns in pair but different between pairs, indicating that they functionally diverged. GmFTL1 to 7 were derived from the same ancestor prior to the whole genome triplication (WGT) event, and after the Legume WGD event the ancestor diverged into two branches, GmFTL3/5/7 and GmFTL1/2/4/6. GmFTL7 were truncated in the N-terminus compared to other FT-lineage genes, but ubiquitously expressed. Expressions of GmFTL1 to 6 were higher in leaves at the flowering stage than that at the seedling stage. GmFTL3 was expressed at the highest level in all tissues except roots at the seedling stage, and its circadian pattern was different from the other five ones. The transcript of GmFTL6 was highly accumulated in seedling roots. The circadian rhythms of GmCOL5/13 and GmFT1/2/4/5/6 were synchronized in a day, demonstrating the complicate relationship of CO-FT regulons in soybean leaves. Over-expression of GmCOL2 did not rescue the flowering phenotype of the Arabidopsis co mutant. However, ectopic expression of GmCOL5 did rescue the co mutant

  20. Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi

    PubMed Central

    Lavoie, Hugo; Hogues, Hervé; Whiteway, Malcolm

    2013-01-01

    Growing evidence suggests that transcriptional regulatory networks in many organisms are highly flexible. Here, we discuss the evolution of transcriptional regulatory networks governing the metabolic machinery of sequenced ascomycetes. In particular, recent work has shown that transcriptional rewiring is common in regulons controlling processes such as production of ribosome components and metabolism of carbohydrates and lipids. We note that dramatic rearrangements of the transcriptional regulatory components of metabolic functions have occurred among ascomycetes species. PMID:19875326

  1. Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus

    PubMed Central

    2011-01-01

    Background Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. Results To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. Multiple variations in regulatory strategies between the Shewanella spp. and E. coli include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp). Conclusions We tentatively defined the first reference collection of ~100 transcriptional regulons in 16 Shewanella genomes. The resulting regulatory network contains ~600 regulated genes per genome that are mostly involved in metabolism of carbohydrates, amino acids, fatty acids, vitamins, metals, and stress responses. Several reconstructed regulons including NagR for N-acetylglucosamine catabolism were experimentally validated in S. oneidensis MR-1. Analysis of

  2. Evolving Insights into Protein Trafficking to the Multiple Compartments of the Apicomplexan Plastid

    PubMed Central

    PARSONS, MARILYN; KARNATAKI, ANURADHA; DEROCHER, AMY E.

    2010-01-01

    The apicoplast is a relict plastid found in many medically important apicomplexan parasites, such as Plasmodium and Toxoplasma. Phylogenetic analysis and the presence of four bounding membranes indicate that the apicoplast arose from a secondary endosymbiosis. Here we review what has been discovered about the complex journey proteins take to reach compartments of the apicoplast. The targeting sequences for luminal proteins are well-defined, but those routing proteins to other compartments are only beginning to be studied. Recent work suggests that the trafficking mechanisms involve a variety of molecules of different phylogenetic origins. We highlight some remaining questions regarding protein trafficking to this divergent organelle. PMID:19527348

  3. Characterization of the Oxygen-Responsive NreABC Regulon of Staphylococcus aureus▿ †

    PubMed Central

    Schlag, Steffen; Fuchs, Stephan; Nerz, Christiane; Gaupp, Rosmarie; Engelmann, Susanne; Liebeke, Manuel; Lalk, Michael; Hecker, Michael; Götz, Friedrich

    2008-01-01

    Here, we investigate the functionality of the oxygen-responsive nitrogen regulation system NreABC in the human pathogen Staphylococcus aureus and evaluate its role in anaerobic gene regulation and virulence factor expression. Deletion of nreABC resulted in severe impairment of dissimilatory nitrate and nitrite reduction and led to a small-colony phenotype in the presence of nitrate during anaerobic growth. For characterization of the NreABC regulon, comparative DNA microarray and proteomic analyses between the wild type and nreABC mutant were performed under anoxic conditions in the absence and presence of nitrate. A reduced expression of virulence factors was not observed in the mutant. However, both the transcription of genes involved in nitrate and nitrite reduction and the accumulation of corresponding proteins were highly decreased in the nreABC mutant, which was unable to utilize nitrate as a respiratory oxidant and, hence, was forced to use fermentative pathways. These data were corroborated by the quantification of the extracellular metabolites lactate and acetate. Using an Escherichia coli-compatible two-plasmid system, the activation of the promoters of the nitrate and nitrite reductase operons and of the putative nitrate/nitrite transporter gene narK by NreBC was confirmed. Overall, our data indicate that NreABC is very likely a specific regulation system that is essential for the transcriptional activation of genes involved in dissimilatory reduction and transport of nitrate and nitrite. The study underscores the importance of NreABC as a fitness factor for S. aureus in anoxic environments. PMID:18820014

  4. Global Analysis of the HrpL Regulon in the Plant Pathogen Pseudomonas syringae pv. tomato DC3000 Reveals New Regulon Members with Diverse Functions

    PubMed Central

    Lam, Hanh N.; Chakravarthy, Suma; Wei, Hai-Lei; BuiNguyen, HoangChuong; Stodghill, Paul V.; Collmer, Alan; Swingle, Bryan M.; Cartinhour, Samuel W.

    2014-01-01

    The type III secretion system (T3SS) is required for virulence in the gram-negative plant pathogen Pseudomonas syringae pv. tomato DC3000. The alternative sigma factor HrpL directly regulates expression of T3SS genes via a promoter sequence, often designated as the “hrp promoter.” Although the HrpL regulon has been extensively investigated in DC3000, it is not known whether additional regulon members remain to be found. To systematically search for HrpL-regulated genes, we used chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-Seq) and bulk mRNA sequencing (RNA-Seq) to identify HrpL-binding sites and likely hrp promoters. The analysis recovered 73 sites of interest, including 20 sites that represent new hrp promoters. The new promoters lie upstream of a diverse set of genes encoding potential regulators, enzymes and hypothetical proteins. PSPTO_5633 is the only new HrpL regulon member that is potentially an effector and is now designated HopBM1. Deletions in several other new regulon members, including PSPTO_5633, PSPTO_0371, PSPTO_2130, PSPTO_2691, PSPTO_2696, PSPTO_3331, and PSPTO_5240, in either DC3000 or ΔhopQ1-1 backgrounds, do not affect the hypersensitive response or in planta growth of the resulting strains. Many new HrpL regulon members appear to be unrelated to the T3SS, and orthologs for some of these can be identified in numerous non-pathogenic bacteria. With the identification of 20 new hrp promoters, the list of HrpL regulon members is approaching saturation and most likely includes all DC3000 effectors. PMID:25170934

  5. RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach

    PubMed Central

    Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna

    2010-01-01

    RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at http://regpredict.lbl.gov. PMID:20542910

  6. RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach

    SciTech Connect

    Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna

    2010-05-26

    RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at http://regpredict.lbl.gov.

  7. Metabolic pathway redundancy within the apicomplexan-dinoflagellate radiation argues against an ancient chromalveolate plastid.

    PubMed

    Waller, Ross F; Gornik, Sebastian G; Koreny, Ludek; Pain, Arnab

    2016-01-01

    The chromalveolate hypothesis presents an attractively simple explanation for the presence of red algal-derived secondary plastids in 5 major eukaryotic lineages: "chromista" phyla, cryptophytes, haptophytes and ochrophytes; and alveolate phyla, dinoflagellates and apicomplexans. It posits that a single secondary endosymbiotic event occurred in a common ancestor of these diverse groups, and that this ancient plastid has since been maintained by vertical inheritance only. Substantial testing of this hypothesis by molecular phylogenies has, however, consistently failed to provide support for the predicted monophyly of the host organisms that harbour these plastids-the "chromalveolates." This lack of support does not disprove the chromalveolate hypothesis per se, but rather drives the proposed endosymbiosis deeper into the eukaryotic tree, and requires multiple plastid losses to have occurred within intervening aplastidic lineages. An alternative perspective on plastid evolution is offered by considering the metabolic partnership between the endosymbiont and its host cell. A recent analysis of metabolic pathways in a deep-branching dinoflagellate indicates a high level of pathway redundancy in the common ancestor of apicomplexans and dinoflagellates, and differential losses of these pathways soon after radiation of the major extant lineages. This suggests that vertical inheritance of an ancient plastid in alveolates is highly unlikely as it would necessitate maintenance of redundant pathways over very long evolutionary timescales. PMID:27066182

  8. An atomic-resolution view of neofunctionalization in the evolution of apicomplexan lactate dehydrogenases

    PubMed Central

    Boucher, Jeffrey I; Jacobowitz, Joseph R; Beckett, Brian C; Classen, Scott; Theobald, Douglas L

    2014-01-01

    Malate and lactate dehydrogenases (MDH and LDH) are homologous, core metabolic enzymes that share a fold and catalytic mechanism yet possess strict specificity for their substrates. In the Apicomplexa, convergent evolution of an unusual LDH from MDH produced a difference in specificity exceeding 12 orders of magnitude. The mechanisms responsible for this extraordinary functional shift are currently unknown. Using ancestral protein resurrection, we find that specificity evolved in apicomplexan LDHs by classic neofunctionalization characterized by long-range epistasis, a promiscuous intermediate, and few gain-of-function mutations of large effect. In canonical MDHs and LDHs, a single residue in the active-site loop governs substrate specificity: Arg102 in MDHs and Gln102 in LDHs. During the evolution of the apicomplexan LDH, however, specificity switched via an insertion that shifted the position and identity of this ‘specificity residue’ to Trp107f. Residues far from the active site also determine specificity, as shown by the crystal structures of three ancestral proteins bracketing the key duplication event. This work provides an unprecedented atomic-resolution view of evolutionary trajectories creating a nascent enzymatic function. DOI: http://dx.doi.org/10.7554/eLife.02304.001 PMID:24966208

  9. A Conserved Apicomplexan Microneme Protein Contributes to Toxoplasma gondii Invasion and Virulence

    PubMed Central

    Huynh, My-Hang; Boulanger, Martin J.

    2014-01-01

    The obligate intracellular parasite Toxoplasma gondii critically relies on host cell invasion during infection. Proteins secreted from the apical micronemes are central components for host cell recognition, invasion, egress, and virulence. Although previous work established that the sporozoite protein with an altered thrombospondin repeat (SPATR) is a micronemal protein conserved in other apicomplexan parasites, including Plasmodium, Neospora, and Eimeria, no genetic evidence of its contribution to invasion has been reported. SPATR contains a predicted epidermal growth factor domain and two thrombospondin type 1 repeats, implying a role in host cell recognition. In this study, we assess the contribution of T. gondii SPATR (TgSPATR) to T. gondii invasion by genetically ablating it and restoring its expression by genetic complementation. Δspatr parasites were ∼50% reduced in invasion compared to parental strains, a defect that was reversed in the complemented strain. In mouse virulence assays, Δspatr parasites were significantly attenuated, with ∼20% of mice surviving infection. Given the conservation of this protein among the Apicomplexa, we assessed whether the Plasmodium falciparum SPATR ortholog (PfSPATR) could complement the absence of the TgSPATR. Although PfSPATR showed correct micronemal localization, it did not reverse the invasion deficiency of Δspatr parasites, because of an apparent failure in secretion. Overall, the results suggest that TgSPATR contributes to invasion and virulence, findings that have implications for the many genera and life stages of apicomplexans that express SPATR. PMID:25092910

  10. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans

    PubMed Central

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

    2015-01-01

    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191

  11. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans.

    PubMed

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

    2015-08-01

    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191

  12. Sphingolipid synthesis and scavenging in the intracellular apicomplexan parasite, Toxoplasma gondii

    PubMed Central

    Pratt, Steven; Wansadhipathi-Kannangara, Nilu K.; Bruce, Catherine R.; Mina, John G.; Shams-Eldin, Hosam; Casas, Josefina; Hanada, Kentaro; Schwarz, Ralph T.; Sonda, Sabrina; Denny, Paul W.

    2013-01-01

    Sphingolipids are essential components of eukaryotic cell membranes, particularly the plasma membrane, and are involved in a diverse array of signal transduction pathways. Mammals produce sphingomyelin (SM) as the primary complex sphingolipid via the well characterised SM synthase. In contrast yeast, plants and some protozoa utilise an evolutionarily related inositol phosphorylceramide (IPC) synthase to synthesise IPC. This activity has no mammalian equivalent and IPC synthase has been proposed as a target for anti-fungals and anti-protozoals. However, detailed knowledge of the sphingolipid biosynthetic pathway of the apicomplexan protozoan parasites was lacking. In this study bioinformatic analyses indicated a single copy orthologue of the putative SM synthase from the apicomplexan Plasmodium falciparum (the causative agent of malaria) was a bona fide sphingolipid synthase in the related model parasite, Toxoplasma gondii (TgSLS). Subsequently, TgSLS was indicated, by complementation of a mutant cell line, to be a functional orthologue of the yeast IPC synthase (AUR1p), demonstrating resistance to the well characterised AUR1p inhibitor aureobasidin A. In vitro, recombinant TgSLS exhibited IPC synthase activity and, for the first time, the presence of IPC was demonstrated in T. gondii lipid extracts by mass spectrometry. Furthermore, host sphingolipid biosynthesis was indicated to influence, but be non-essential for, T. gondii proliferation, suggesting that whilst scavenging does take place de novo sphingolipid synthesis may be important for parasitism. PMID:23246819

  13. Hepatozoon ellisgreineri n. sp. (Hepatozoidae): description of the first avian apicomplexan blood parasite inhabiting granulocytes.

    PubMed

    Valkiūnas, Gediminas; Mobley, Kristin; Iezhova, Tatjana A

    2016-02-01

    Blood parasites of the genus Hepatozoon (Apicomplexa, Hepatozoidae) infect all groups of terrestrial vertebrates, and particularly high prevalence and species diversity have been reported in reptiles and mammals. A few morphologically similar species, in which gamonts inhabit mononuclear leukocytes and red blood cells, have been described in birds. Here, we report a new Hepatozoon species, which was found in wild-caught secretary birds Sagittarius serpentarius, from Tanzania. Hepatozoon ellisgreineri n. sp. can be readily distinguished from all described species of avian Hepatozoon because its gamonts develop only in granulocytes, predominantly in heterophils, a unique characteristic among bird parasites of this genus. Additionally, this is the first reported avian apicomplexan blood parasite, which inhabits and matures in granulocytes. We describe H. ellisgreineri based on morphological characteristics of blood stages and their host cells. This finding broadens knowledge about host cells of avian Hepatozoon spp. and other avian apicomplexan blood parasites, contributing to the better understanding of the diversity of haematozoa. This is the first report of hepatozoonosis in endangered African birds of the Sagittariidae. PMID:26472715

  14. Metabolic pathway redundancy within the apicomplexan-dinoflagellate radiation argues against an ancient chromalveolate plastid

    PubMed Central

    Waller, Ross F.; Gornik, Sebastian G.; Koreny, Ludek; Pain, Arnab

    2016-01-01

    ABSTRACT The chromalveolate hypothesis presents an attractively simple explanation for the presence of red algal-derived secondary plastids in 5 major eukaryotic lineages: “chromista” phyla, cryptophytes, haptophytes and ochrophytes; and alveolate phyla, dinoflagellates and apicomplexans. It posits that a single secondary endosymbiotic event occurred in a common ancestor of these diverse groups, and that this ancient plastid has since been maintained by vertical inheritance only. Substantial testing of this hypothesis by molecular phylogenies has, however, consistently failed to provide support for the predicted monophyly of the host organisms that harbour these plastids—the “chromalveolates.” This lack of support does not disprove the chromalveolate hypothesis per se, but rather drives the proposed endosymbiosis deeper into the eukaryotic tree, and requires multiple plastid losses to have occurred within intervening aplastidic lineages. An alternative perspective on plastid evolution is offered by considering the metabolic partnership between the endosymbiont and its host cell. A recent analysis of metabolic pathways in a deep-branching dinoflagellate indicates a high level of pathway redundancy in the common ancestor of apicomplexans and dinoflagellates, and differential losses of these pathways soon after radiation of the major extant lineages. This suggests that vertical inheritance of an ancient plastid in alveolates is highly unlikely as it would necessitate maintenance of redundant pathways over very long evolutionary timescales. PMID:27066182

  15. A Unique Hexokinase in Cryptosporidium parvum, an Apicomplexan Pathogen Lacking the Krebs Cycle and Oxidative Phosphorylation

    PubMed Central

    Yu, Yonglan; Zhang, Haili; Guo, Fengguang; Sun, Mingfei; Zhu, Guan

    2014-01-01

    Cryptosporidium parvum may cause virtually untreatable infections in AIDS patients, and is recently identified as one of the top four diarrheal pathogens in children in developing countries. Cryptosporidium differs from other apicomplexans (e.g., Plasmodium and Toxoplasma) by lacking many metabolic pathways including the Krebs cycle and cytochrome-based respiratory chain, thus relying mainly on glycolysis for ATP production. Here we report the molecular and biochemical characterizations of a hexokinase in C. parvum (CpHK). Our phylogenetic reconstructions indicated that apicomplexan hexokinases including CpHK were highly divergent from those of humans and animals (i.e., at the base of the eukaryotic clade). CpHK displays unique kinetic features that differ from those in mammals and Toxoplasma gondii (TgHK) in the preference towards various hexoses and its capacity to use ATP and other NTPs. CpHK also displays substrate inhibition by ATP. Moreover, 2-deoxy-D-glucose (2DG) could not only inhibit the CpHK activity, but also the parasite growth in vitro at concentrations nontoxic to host cells (IC50 = 0.54 mM). While the exact action of 2-deoxy-D-glucose on the parasite is subject to further verification, our data suggest that CpHK and the glycolytic pathway may be explored for developing anti-cryptosporidial therapeutics. PMID:25216472

  16. Exposure of Bacillus subtilis to Low Pressure (5 Kilopascals) Induces Several Global Regulons, Including Those Involved in the SigB-Mediated General Stress Response

    PubMed Central

    Waters, Samantha M.; Robles-Martínez, José A.

    2014-01-01

    Studies of how microorganisms respond to pressure have been limited mostly to the extreme high pressures of the deep sea (i.e., the piezosphere). In contrast, despite the fact that the growth of most bacteria is inhibited at pressures below ∼2.5 kPa, little is known of microbial responses to low pressure (LP). To study the global LP response, we performed transcription microarrays on Bacillus subtilis cells grown under normal atmospheric pressure (∼101 kPa) and a nearly inhibitory LP (5 kPa), equivalent to the pressure found at an altitude of ∼20 km. Microarray analysis revealed altered levels of 363 transcripts belonging to several global regulons (AbrB, CcpA, CodY, Fur, IolR, ResD, Rok, SigH, Spo0A). Notably, the highest number of upregulated genes, 86, belonged to the SigB-mediated general stress response (GSR) regulon. Upregulation of the GSR by LP was confirmed by monitoring the expression of the SigB-dependent ctc-lacZ reporter fusion. Measuring transcriptome changes resulting from exposure of bacterial cells to LP reveals insights into cellular processes that may respond to LP exposure. PMID:24878601

  17. The FurA regulon in Anabaena sp. PCC 7120: in silico prediction and experimental validation of novel target genes

    PubMed Central

    González, Andrés; Angarica, Vladimir Espinosa; Sancho, Javier; Fillat, María F.

    2014-01-01

    In the filamentous cyanobacterium Anabaena sp. PCC 7120, the ferric uptake regulator FurA functions as a global transcriptional regulator. Despite several analyses have focused on elucidating the FurA-regulatory network, the number of target genes described for this essential transcription factor is limited to a handful of examples. In this article, we combine an in silico genome-wide predictive approach with experimental determinations to better define the FurA regulon. Predicted FurA-binding sites were identified upstream of 215 genes belonging to diverse functional categories including iron homeostasis, photosynthesis and respiration, heterocyst differentiation, oxidative stress defence and light-dependent signal transduction mechanisms, among others. The probabilistic model proved to be effective at discerning FurA boxes from non-cognate sequences, while subsequent electrophoretic mobility shift assay experiments confirmed the in vitro specific binding of FurA to at least 20 selected predicted targets. Gene-expression analyses further supported the dual role of FurA as transcriptional modulator that can act both as repressor and as activator. In either role, the in vitro affinity of the protein to its target sequences is strongly dependent on metal co-regulator and reducing conditions, suggesting that FurA couples in vivo iron homeostasis and the response to oxidative stress to major physiological processes in cyanobacteria. PMID:24503250

  18. Technical considerations in using DNA microarrays to define regulons.

    PubMed

    Rhodius, Virgil A; Wade, Joseph T

    2009-01-01

    Transcription is the major regulatory target of gene expression in bacteria, and is controlled by many regulatory proteins and RNAs. Microarrays are a powerful tool to study the regulation of transcription on a genomic scale. Here we describe the use of transcription profiling and ChIP-chip to study transcriptional regulation in bacteria. Transcription profiling determines the outcome of regulatory events whereas ChIP-chip identifies the protein-DNA interactions that determine these events. Together they can provide detailed information on transcriptional regulatory systems. PMID:18955146

  19. The ATP-binding cassette subunit of the maltose transporter MalK antagonizes MalT, the activator of the Escherichia coli mal regulon.

    PubMed

    Panagiotidis, C H; Boos, W; Shuman, H A

    1998-11-01

    Transcription of the mal regulon of Escherichia coli K-12 is regulated by the positive activator, MalT. In the presence of ATP and maltotriose, MalT binds to decanucleotide MalT boxes that are found upstream of mal promoters and activates transcription at these sites. The earliest studies of the mal regulon, however, suggested a negative role for the MalK protein, the ATP-binding cassette subunit of the maltose transporter, in regulating mal gene expression. More recently, it was found that overexpression of the MalK protein resulted in very low levels of mal gene transcription. In this report we describe the use of tagged versions of MalT to provide evidence that it physically interacts with the MalK protein both in vitro and in vivo. In addition, we show that a novel malK mutation, malK941, results in an increased ability of MalK to down-modulate MalT activity in vivo. The fact that the MalK941 protein binds but does not hydrolyse ATP suggests that the MalK941 mutant protein mimics the inactive, ATP-bound form of the normal MalK protein. In contrast, cells with high levels of MalK ATPase show a reduced ability to down-modulate MalT and express several mal genes constitutively. These results are consistent with a model in which the inactive form of MalK down-modulates MalT and decreases transcription, whereas the active form of MalK does not. This model suggests that bacteria may be able to couple information about extracellular substrate availability to the transcriptional apparatus via the levels of ATP hydrolysis associated with transport. PMID:9822819

  20. Comparative genomics of transcriptional regulation of methionine metabolism in Proteobacteria.

    PubMed

    Leyn, Semen A; Suvorova, Inna A; Kholina, Tatiana D; Sherstneva, Sofia S; Novichkov, Pavel S; Gelfand, Mikhail S; Rodionov, Dmitry A

    2014-01-01

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ∼ 200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria. PMID:25411846

  1. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    DOE PAGESBeta

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.

    2014-11-20

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less

  2. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    SciTech Connect

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.

    2014-11-20

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.

  3. Comparative Genomics of Transcriptional Regulation of Methionine Metabolism in Proteobacteria

    PubMed Central

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.

    2014-01-01

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ∼200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria. PMID:25411846

  4. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus

    PubMed Central

    Khoroshkin, Matvei S.; Leyn, Semen A.; Van Sinderen, Douwe; Rodionov, Dmitry A.

    2016-01-01

    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics. PMID:26903998

  5. Deciphering the Ubiquitin-Mediated Pathway in Apicomplexan Parasites: A Potential Strategy to Interfere with Parasite Virulence

    PubMed Central

    Ponts, Nadia; Yang, Jianfeng; Chung, Duk-Won Doug; Prudhomme, Jacques; Girke, Thomas; Horrocks, Paul; Le Roch, Karine G.

    2008-01-01

    Background Reversible modification of proteins through the attachment of ubiquitin or ubiquitin-like modifiers is an essential post-translational regulatory mechanism in eukaryotes. The conjugation of ubiquitin or ubiquitin-like proteins has been demonstrated to play roles in growth, adaptation and homeostasis in all eukaryotes, with perturbation of ubiquitin-mediated systems associated with the pathogenesis of many human diseases, including cancer and neurodegenerative disorders. Methodology/Principal Findings Here we describe the use of an HMM search of functional Pfam domains found in the key components of the ubiquitin-mediated pathway necessary to activate and reversibly modify target proteins in eight apicomplexan parasitic protozoa for which complete or late-stage genome projects exist. In parallel, the same search was conducted on five model organisms, single-celled and metazoans, to generate data to validate both the search parameters employed and aid paralog classification in Apicomplexa. For each of the 13 species investigated, a set of proteins predicted to be involved in the ubiquitylation pathway has been identified and demonstrates increasing component members of the ubiquitylation pathway correlating with organism and genome complexity. Sequence homology and domain architecture analyses facilitated prediction of apicomplexan-specific protein function, particularly those involved in regulating cell division during these parasite's complex life cycles. Conclusions/Significance This study provides a comprehensive analysis of proteins predicted to be involved in the apicomplexan ubiquitin-mediated pathway. Given the importance of such pathway in a wide variety of cellular processes, our data is a key step in elucidating the biological networks that, in part, direct the pathogenicity of these parasites resulting in a massive impact on global health. Moreover, apicomplexan-specific adaptations of the ubiquitylation pathway may represent new therapeutic

  6. Systems biology of GAL regulon in Saccharomyces cerevisiae.

    PubMed

    Pannala, Venkat Reddy; Bhat, Paike Jayadeva; Bhartiya, Sharad; Venkatesh, K V

    2010-01-01

    Evolutionary success of an organism depends on its ability to express or adapt to constantly changing environmental conditions. Saccharomyces cerevisiae has evolved an elaborate genetic circuit to regulate the expression of galactose-metabolizing enzymes in the presence of galactose but in the absence of glucose. The circuit possesses molecular mechanisms such as multiple binding sites, cooperativity, autoregulation, nucleocytoplasmic shuttling, and substrate sensing mechanism. Furthermore, the GAL system consists of two positive (activating) feedback and one negative (repressing) feedback loops. These individual mechanisms, elucidated through experimental approach, can be integrated to obtain a system-wide behavior. Mathematical models in conjunction with guided experiments have demonstrated system-level properties such as ultrasensitivity, memory, noise attenuation, rapid response, and sensitive response arising out of the molecular interactions. These system-level properties allow S. cerevisiae to adapt and grow in a galactose medium under noisy and changing environments. This review focuses on system-level models and properties of the GAL regulon. PMID:20836013

  7. Bacterial regulon evolution: distinct responses and roles for the identical OmpR proteins of Salmonella Typhimurium and Escherichia coli in the acid stress response.

    PubMed

    Quinn, Heather J; Cameron, Andrew D S; Dorman, Charles J

    2014-03-01

    The evolution of new gene networks is a primary source of genetic innovation that allows bacteria to explore and exploit new niches, including pathogenic interactions with host organisms. For example, the archetypal DNA binding protein, OmpR, is identical between Salmonella Typhimurium serovar Typhimurium and Escherichia coli, but regulatory specialization has resulted in different environmental triggers of OmpR expression and largely divergent OmpR regulons. Specifically, ompR mRNA and OmpR protein levels are elevated by acid pH in S. Typhimurium but not in E. coli. This differential expression pattern is due to differences in the promoter regions of the ompR genes and the E. coli ompR orthologue can be made acid-inducible by introduction of the appropriate sequences from S. Typhimurium. The OmpR regulon in S. Typhimurium overlaps that of E. coli at only 15 genes and includes many horizontally acquired genes (including virulence genes) that E. coli does not have. We found that OmpR binds to its genomic targets in higher abundance when the DNA is relaxed, something that occurs in S. Typhimurium as a result of acid stress and which is a requirement for optimal expression of its virulence genes. The genomic targets of OmpR do not share a strong nucleotide sequence consensus: we propose that the ability of OmpR to recruit additional genes to its regulon arises from its modest requirements for specificity in its DNA targets with its preference for relaxed DNA allowing it to cooperate with DNA-topology-based allostery to modulate transcription in response to acid stress. PMID:24603618

  8. Identification of the Treponema pallidum subsp. pallidum TP0092 (RpoE) Regulon and Its Implications for Pathogen Persistence in the Host and Syphilis Pathogenesis

    PubMed Central

    Denisenko, Oleg; Tompa, Martin; Centurion-Lara, Arturo

    2013-01-01

    Bacteria often respond to harmful environmental stimuli with the induction of extracytoplasmic function (ECF) sigma (σ) factors that in turn direct RNA polymerase to transcribe specific groups of response genes (or regulons) to minimize cellular damage and favor adaptation to the changed extracellular milieu. In Treponema pallidum subsp. pallidum, the agent of syphilis, the TP0092 gene is predicted to code for the pathogen's only annotated ECF σ factor, homologous to RpoE, known in Escherichia coli to control a key transduction pathway for maintenance of envelope homeostasis in response to external stress and cell growth. Here we have shown that TP0092 is highly transcribed during experimental syphilis. Furthermore, TP0092 transcription levels significantly increase as infection progresses toward immune clearance of the pathogen, suggesting a role for TP0092 in helping T. pallidum respond to harmful stimuli in the host environment. To investigate this hypothesis, we determined the TP0092 regulon at two different time points during infection using chromatin immunoprecipitation followed by high-throughput sequencing. A total of 22 chromosomal regions, all containing putative TP0092-binding sites and corresponding to as many T. pallidum genes, were identified. Noteworthy among them are the genes encoding desulfoferrodoxin and thioredoxin, involved in detoxification of reactive oxygen species (ROS). Because T. pallidum does not possess other enzymes for ROS detoxification, such as superoxide dismutase, catalase, or glutathione peroxidase, our results suggest that the TP0092 regulon is important in protecting the syphilis spirochete from damage caused by ROS produced at the site of infection during the inflammatory response. PMID:23243302

  9. High- and low-threshold genes in the Spo0A regulon of Bacillus subtilis.

    PubMed

    Fujita, Masaya; González-Pastor, José Eduardo; Losick, Richard

    2005-02-01

    The master regulator for entry into sporulation in Bacillus subtilis is the response regulator Spo0A, which directly governs the expression of about 121 genes. Using cells in which the synthesis of Spo0A was under the control of an inducible promoter or in which production of the regulatory protein was impaired by a promoter mutation, we found that sporulation required a high (threshold) level of Spo0A and that many genes in the regulon differentially responded to high and low doses of the regulator. We distinguished four categories of genes, as follows: (i) those that required a high level of Spo0A to be activated, (ii) those that required a high level of Spo0A to be repressed, (iii) those that were activated at a low level of the regulator, and (iv) those that were repressed at a low dose of the regulator. Genes that required a high dose of Spo0A to be activated were found to have low binding constants for the DNA-binding protein. Some genes that were turned on at a low dose of Spo0A either had a high binding constant for the regulatory protein or were activated by an indirect mechanism involving Spo0A-mediated relief of repression by the repressor protein AbrB. We propose that progressive increases in the level of Spo0A leads to an early phase of transcription in which genes that play auxiliary roles in development, such as cannibalism and biofilm formation, are turned on and a later phase in which genes that play a direct role in sporulation are activated. PMID:15687200

  10. RNA-Seq analysis reveals a six-gene SoxR regulon in Streptomyces coelicolor.

    PubMed

    Naseer, Nawar; Shapiro, Joshua A; Chander, Monica

    2014-01-01

    The redox-regulated transcription factor SoxR is conserved in diverse bacteria, but emerging studies suggest that this protein plays distinct physiological roles in different bacteria. SoxR regulates a global oxidative stress response (involving > 100 genes) against exogenous redox-cycling drugs in Escherichia coli and related enterics. In the antibiotic producers Streptomyces coelicolor and Pseudomonas aeruginosa, however, SoxR regulates a smaller number of genes that encode membrane transporters and proteins with homology to antibiotic-tailoring enzymes. In both S. coelicolor and P. aeruginosa, SoxR-regulated genes are expressed in stationary phase during the production of endogenously-produced redox-active antibiotics. These observations suggest that SoxR evolved to sense endogenous secondary metabolites and activate machinery to process and transport them in antibiotic-producing bacteria. Previous bioinformatics analysis that searched the genome for SoxR-binding sites in putative promoters defined a five-gene SoxR regulon in S. coelicolor including an ABC transporter, two oxidoreductases, a monooxygenase and an epimerase/dehydratase. Since this in silico screen may have missed potential SoxR-targets, we conducted a whole genome transcriptome comparison of wild type S. coelicolor and a soxR-deficient mutant in stationary phase using RNA-Seq. Our analysis revealed a sixth SoxR-regulated gene in S. coelicolor that encodes a putative quinone oxidoreductase. Knowledge of the full complement of genes regulated by SoxR will facilitate studies to elucidate the function of this regulatory molecule in antibiotic producers. PMID:25162599

  11. soxR, a locus governing a superoxide response regulon in Escherichia coli K-12.

    PubMed Central

    Tsaneva, I R; Weiss, B

    1990-01-01

    The nfo (endonuclease IV) gene of Escherichia coli is induced by superoxide generators such as paraquat (methyl viologen). An nfo'-lacZ operon fusion was used to isolate extragenic mutations affecting its expression. The mutations also affected the expression of glucose 6-phosphate dehydrogenase, Mn2(+)-superoxide dismutase (sodA), and three lacZ fusions to soi (superoxide-inducible) genes of unknown function. The mutations were located 2 kilobases clockwise of ssb at 92 min on the current linkage map. One set of mutations, in a new gene designated soxR, caused constitutive overexpression of nfo and the other genes. It included insertions or deletions affecting the carboxyl end of a 17-kilodalton polypeptide. In a soxR mutant, the expression of sodA, unlike that of nfo, was also regulated independently by oxygen tension. Two other mutants were isolated in which the target genes were noninducible; they had an increased sensitivity to killing by superoxide-generating compounds. One had a Tn10 insertion in or near soxR; the other had a multigene deletion encompassing soxR. Therefore, the region functions as a positive regulator because it encodes one or more products needed for the induction of nfo. Regulation is likely to be at the level of transcription because the mutations were able to affect the expression of an nfo'-lac operon fusion that contained the ribosome-binding site for lacZ. Some mutant plasmids that failed to suppress (or complement) constitutivity in trans had insertion mutations several hundred nucleotides upstream of soxR in the general region of a gene for a 13-kilodalton protein encoded by the opposite strand, raising the possibility of a second regulatory gene in this region. The result define a new regulon, controlled by soxR, mediating at least part of the global response to superoxide in E. coli. Images PMID:1695893

  12. The Mycobacterium DosR regulon structure and diversity revealed by comparative genomic analysis.

    PubMed

    Chen, Tian; He, Liming; Deng, Wanyan; Xie, Jianping

    2013-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), which claims approximately two million people annually, remains a global health concern. The non-replicating or dormancy like state of this pathogen which is impervious to anti-tuberculosis drugs is widely recognized as the culprit for this scenario. The dormancy survival regulator (DosR) regulon, composed of 48 co-regulated genes, is held as essential for Mtb persistence. The DosR regulon is regulated by a two-component regulatory system consisting of two sensor kinases-DosS (Rv3132c) and DosT (Rv2027c), and a response regulator DosR (Rv3133c). The underlying regulatory mechanism of DosR regulon expression is very complex. Many factors are involved, particularly the oxygen tension. The DosR regulon enables the pathogen to persist during lengthy hypoxia. Comparative genomic analysis demonstrated that the DosR regulon is widely distributed among the mycobacterial genomes, ranging from the pathogenic strains to the environmental strains. In-depth studies on the DosR response should provide insights into its role in TB latency in vivo and shape new measures to combat this exceeding recalcitrant pathogen. PMID:22833514

  13. MicroRNAs in the Host-Apicomplexan Parasites Interactions: A Review of Immunopathological Aspects

    PubMed Central

    Judice, Carla C.; Bourgard, Catarina; Kayano, Ana C. A. V.; Albrecht, Letusa; Costa, Fabio T. M.

    2016-01-01

    MicroRNAs (miRNAs), a class of small non-coding regulatory RNAs, have been detected in a variety of organisms ranging from ancient unicellular eukaryotes to mammals. They have been associated with numerous molecular mechanisms involving developmental, physiological and pathological changes of cells and tissues. Despite the fact that miRNA-silencing mechanisms appear to be absent in some Apicomplexan species, an increasing number of studies have reported a role for miRNAs in host-parasite interactions. Host miRNA expression can change following parasite infection and the consequences can lead, for instance, to parasite clearance. In this context, the immune system signaling appears to have a crucial role. PMID:26870701

  14. Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti†

    PubMed Central

    Cornillot, Emmanuel; Hadj-Kaddour, Kamel; Dassouli, Amina; Noel, Benjamin; Ranwez, Vincent; Vacherie, Benoît; Augagneur, Yoann; Brès, Virginie; Duclos, Aurelie; Randazzo, Sylvie; Carcy, Bernard; Debierre-Grockiego, Françoise; Delbecq, Stéphane; Moubri-Ménage, Karina; Shams-Eldin, Hosam; Usmani-Brown, Sahar; Bringaud, Frédéric; Wincker, Patrick; Vivarès, Christian P.; Schwarz, Ralph T.; Schetters, Theo P.; Krause, Peter J.; Gorenflot, André; Berry, Vincent; Barbe, Valérie; Ben Mamoun, Choukri

    2012-01-01

    We have sequenced the genome of the emerging human pathogen Babesia microti and compared it with that of other protozoa. B. microti has the smallest nuclear genome among all Apicomplexan parasites sequenced to date with three chromosomes encoding ∼3500 polypeptides, several of which are species specific. Genome-wide phylogenetic analyses indicate that B. microti is significantly distant from all species of Babesidae and Theileridae and defines a new clade in the phylum Apicomplexa. Furthermore, unlike all other Apicomplexa, its mitochondrial genome is circular. Genome-scale reconstruction of functional networks revealed that B. microti has the minimal metabolic requirement for intraerythrocytic protozoan parasitism. B. microti multigene families differ from those of other protozoa in both the copy number and organization. Two lateral transfer events with significant metabolic implications occurred during the evolution of this parasite. The genomic sequencing of B. microti identified several targets suitable for the development of diagnostic assays and novel therapies for human babesiosis. PMID:22833609

  15. The apicoplast: a review of the derived plastid of apicomplexan parasites.

    PubMed

    Waller, Ross F; McFadden, Geoffrey I

    2005-01-01

    The apicoplast is a plastid organelle, homologous to chloroplasts of plants, that is found in apicomplexan parasites such as the causative agents of Malaria Plasmodium spp. It occurs throughout the Apicomplexa and is an ancient feature of this group acquired by the process of endosymbiosis. Like plant chloroplasts, apicoplasts are semi-autonomous with their own genome and expression machinery. In addition, apicoplasts import numerous proteins encoded by nuclear genes. These nuclear genes largely derive from the endosymbiont through a process of intracellular gene relocation. The exact role of a plastid in parasites is uncertain but early clues indicate synthesis of lipids, heme and isoprenoids as possibilities. The various metabolic processes of the apicoplast are potentially excellent targets for drug therapy. PMID:15580780

  16. Inference of the Transcriptional Regulatory Network in Staphylococcus aureus by Integration of Experimental and Genomics-Based Evidence▿†

    PubMed Central

    Ravcheev, Dmitry A.; Best, Aaron A.; Tintle, Nathan; DeJongh, Matthew; Osterman, Andrei L.; Novichkov, Pavel S.; Rodionov, Dmitry A.

    2011-01-01

    Transcriptional regulatory networks are fine-tuned systems that help microorganisms respond to changes in the environment and cell physiological state. We applied the comparative genomics approach implemented in the RegPredict Web server combined with SEED subsystem analysis and available information on known regulatory interactions for regulatory network reconstruction for the human pathogen Staphylococcus aureus and six related species from the family Staphylococcaceae. The resulting reference set of 46 transcription factor regulons contains more than 1,900 binding sites and 2,800 target genes involved in the central metabolism of carbohydrates, amino acids, and fatty acids; respiration; the stress response; metal homeostasis; drug and metal resistance; and virulence. The inferred regulatory network in S. aureus includes ∼320 regulatory interactions between 46 transcription factors and ∼550 candidate target genes comprising 20% of its genome. We predicted ∼170 novel interactions and 24 novel regulons for the control of the central metabolic pathways in S. aureus. The reconstructed regulons are largely variable in the Staphylococcaceae: only 20% of S. aureus regulatory interactions are conserved across all studied genomes. We used a large-scale gene expression data set for S. aureus to assess relationships between the inferred regulons and gene expression patterns. The predicted reference set of regulons is captured within the Staphylococcus collection in the RegPrecise database (http://regprecise.lbl.gov). PMID:21531804

  17. The Listeria monocytogenes σB Regulon and Its Virulence-Associated Functions Are Inhibited by a Small Molecule

    PubMed Central

    Palmer, M. Elizabeth; Chaturongakul, Soraya; Wiedmann, Martin; Boor, Kathryn J.

    2011-01-01

    ABSTRACT The stress-responsive alternative sigma factor σB is conserved across diverse Gram-positive bacterial genera. In Listeria monocytogenes, σB regulates transcription of >150 genes, including genes contributing to virulence and to bacterial survival under host-associated stress conditions, such as those encountered in the human gastrointestinal lumen. An inhibitor of L. monocytogenes σB activity was identified by screening ~57,000 natural and synthesized small molecules using a high-throughput cell-based assay. The compound fluoro-phenyl-styrene-sulfonamide (FPSS) (IC50 = 3.5 µM) downregulated the majority of genes previously identified as members of the σB regulon in L. monocytogenes 10403S, thus generating a transcriptional profile comparable to that of a 10403S ΔsigB strain. Specifically, of the 208 genes downregulated by FPSS, 75% had been identified previously as positively regulated by σB. Downregulated genes included key virulence and stress response genes, such as inlA, inlB, bsh, hfq, opuC, and bilE. From a functional perspective, FPSS also inhibited L. monocytogenes invasion of human intestinal epithelial cells and bile salt hydrolase activity. The ability of FPSS to inhibit σB activity in both L. monocytogenes and Bacillus subtilis indicates its utility as a specific inhibitor of σB across multiple Gram-positive genera. PMID:22128349

  18. Variable Suites of Non-effector Genes Are Co-regulated in the Type III Secretion Virulence Regulon across the Pseudomonas syringae Phylogeny

    PubMed Central

    Mucyn, Tatiana S.; Yourstone, Scott; Lind, Abigail L.; Biswas, Surojit; Nishimura, Marc T.; Baltrus, David A.; Cumbie, Jason S.; Chang, Jeff H.; Jones, Corbin D.; Dangl, Jeffery L.; Grant, Sarah R.

    2014-01-01

    Pseudomonas syringae is a phylogenetically diverse species of Gram-negative bacterial plant pathogens responsible for crop diseases around the world. The HrpL sigma factor drives expression of the major P. syringae virulence regulon. HrpL controls expression of the genes encoding the structural and functional components of the type III secretion system (T3SS) and the type three secreted effector proteins (T3E) that are collectively essential for virulence. HrpL also regulates expression of an under-explored suite of non-type III effector genes (non-T3E), including toxin production systems and operons not previously associated with virulence. We implemented and refined genome-wide transcriptional analysis methods using cDNA-derived high-throughput sequencing (RNA-seq) data to characterize the HrpL regulon from six isolates of P. syringae spanning the diversity of the species. Our transcriptomes, mapped onto both complete and draft genomes, significantly extend earlier studies. We confirmed HrpL-regulation for a majority of previously defined T3E genes in these six strains. We identified two new T3E families from P. syringae pv. oryzae 1_6, a strain within the relatively underexplored phylogenetic Multi-Locus Sequence Typing (MLST) group IV. The HrpL regulons varied among strains in gene number and content across both their T3E and non-T3E gene suites. Strains within MLST group II consistently express the lowest number of HrpL-regulated genes. We identified events leading to recruitment into, and loss from, the HrpL regulon. These included gene gain and loss, and loss of HrpL regulation caused by group-specific cis element mutations in otherwise conserved genes. Novel non-T3E HrpL-regulated genes include an operon that we show is required for full virulence of P. syringae pv. phaseolicola 1448A on French bean. We highlight the power of integrating genomic, transcriptomic, and phylogenetic information to drive concise functional experimentation and to derive better

  19. Investigation of the malE Promoter and MalR, a Positive Regulator of the Maltose Regulon, for an Improved Expression System in Sulfolobus acidocaldarius

    PubMed Central

    Wagner, Michaela; Wagner, Alexander; Ma, Xiaoqing; Kort, Julia Christin; Ghosh, Abhrajyoti; Rauch, Bernadette; Siebers, Bettina

    2014-01-01

    In this study, the regulator MalR (Saci_1161) of the TrmB family from Sulfolobus acidocaldarius was identified and was shown to be involved in transcriptional control of the maltose regulon (Saci_1660 to Saci_1666), including the ABC transporter (malEFGK), α-amylase (amyA), and α-glycosidase (malA). The ΔmalR deletion mutant exhibited a significantly decreased growth rate on maltose and dextrin but not on sucrose. The expression of the genes organized in the maltose regulon was induced only in the presence of MalR and maltose in the growth medium, indicating that MalR, in contrast to its TrmB and TrmB-like homologues, is an activator of the maltose gene cluster. Electrophoretic mobility shift assays revealed that the binding of MalR to malE was independent of sugars. Here we report the identification of the archaeal maltose regulator protein MalR, which acts as an activator and controls the expression of genes involved in maltose transport and metabolic conversion in S. acidocaldarius, and its use for improvement of the S. acidocaldarius expression system under the control of an optimized maltose binding protein (malE) promoter by promoter mutagenesis. PMID:24271181

  20. Proteomic analysis of the quorum-sensing regulon in Pantoea stewartii and identification of direct targets of EsaR.

    PubMed

    Ramachandran, Revathy; Stevens, Ann M

    2013-10-01

    The proteobacterium Pantoea stewartii subsp. stewartii causes Stewart's wilt disease in maize when it colonizes the xylem and secretes large amounts of stewartan, an exopolysaccharide. The success of disease pathogenesis lies in the timing of bacterial virulence factor expression through the different stages of infection. Regulation is achieved through a quorum-sensing (QS) system consisting of the acyl-homoserine lactone (AHL) synthase, EsaI, and the transcription regulator EsaR. At low cell densities, EsaR represses transcription of itself and of rcsA, an activator of the stewartan biosynthesis operon; it also activates esaS, which encodes a small RNA (sRNA). Repression or activation ceases at high cell densities when EsaI synthesizes sufficient levels of the AHL ligand N-3-oxo-hexanoyl-L-homoserine lactone to bind and inactivate EsaR. This study aims to identify other genes activated or repressed by EsaR during the QS response. Proteomic analysis identified a QS regulon of more than 30 proteins. Electrophoretic mobility shift assays of promoters of genes encoding differentially expressed proteins distinguished direct targets of EsaR from indirect targets. Additional quantitative reverse transcription-PCR (qRT-PCR) and DNA footprinting analysis established that EsaR directly regulates the promoters of dkgA, glpF, and lrhA. The proteins encoded by dkgA, glpF, and lrhA are a 2,5-diketogluconate reductase, glycerol facilitator, and transcriptional regulator of chemotaxis and motility, respectively, indicating a more global QS response in P. stewartii than previously recognized. PMID:23913428

  1. Proteomic Analysis of the Quorum-Sensing Regulon in Pantoea stewartii and Identification of Direct Targets of EsaR

    PubMed Central

    Ramachandran, Revathy

    2013-01-01

    The proteobacterium Pantoea stewartii subsp. stewartii causes Stewart's wilt disease in maize when it colonizes the xylem and secretes large amounts of stewartan, an exopolysaccharide. The success of disease pathogenesis lies in the timing of bacterial virulence factor expression through the different stages of infection. Regulation is achieved through a quorum-sensing (QS) system consisting of the acyl-homoserine lactone (AHL) synthase, EsaI, and the transcription regulator EsaR. At low cell densities, EsaR represses transcription of itself and of rcsA, an activator of the stewartan biosynthesis operon; it also activates esaS, which encodes a small RNA (sRNA). Repression or activation ceases at high cell densities when EsaI synthesizes sufficient levels of the AHL ligand N-3-oxo-hexanoyl-l-homoserine lactone to bind and inactivate EsaR. This study aims to identify other genes activated or repressed by EsaR during the QS response. Proteomic analysis identified a QS regulon of more than 30 proteins. Electrophoretic mobility shift assays of promoters of genes encoding differentially expressed proteins distinguished direct targets of EsaR from indirect targets. Additional quantitative reverse transcription-PCR (qRT-PCR) and DNA footprinting analysis established that EsaR directly regulates the promoters of dkgA, glpF, and lrhA. The proteins encoded by dkgA, glpF, and lrhA are a 2,5-diketogluconate reductase, glycerol facilitator, and transcriptional regulator of chemotaxis and motility, respectively, indicating a more global QS response in P. stewartii than previously recognized. PMID:23913428

  2. Analysis of the ArcA regulon in anaerobically grown Salmonella enterica sv. Typhimurium

    PubMed Central

    2011-01-01

    Background Salmonella enterica serovar Typhimurium (S. Typhimurium) is a Gram-negative pathogen that must successfully adapt to the broad fluctuations in the concentration of dissolved dioxygen encountered in the host. In Escherichia coli, ArcA (Aerobic Respiratory Control) helps the cells to sense and respond to the presence of dioxygen. The global role of ArcA in E. coli is well characterized; however, little is known about its role in anaerobically grown S. Typhimurium. Results We compared the transcriptional profiles of the virulent wild-type (WT) strain (ATCC 14028s) and its isogenic arcA mutant grown under anaerobic conditions. We found that ArcA directly or indirectly regulates 392 genes (8.5% of the genome); of these, 138 genes are poorly characterized. Regulation by ArcA in S. Typhimurium is similar, but distinct from that in E. coli. Thus, genes/operons involved in core metabolic pathways (e.g., succinyl-CoA, fatty acid degradation, cytochrome oxidase complexes, flagellar biosynthesis, motility, and chemotaxis) were regulated similarly in the two organisms. However, genes/operons present in both organisms, but regulated differently by ArcA in S. Typhimurium included those coding for ethanolamine utilization, lactate transport and metabolism, and succinate dehydrogenases. Salmonella-specific genes/operons regulated by ArcA included those required for propanediol utilization, flagellar genes (mcpAC, cheV), Gifsy-1 prophage genes, and three SPI-3 genes (mgtBC, slsA, STM3784). In agreement with our microarray data, the arcA mutant was non-motile, lacked flagella, and was as virulent in mice as the WT. Additionally, we identified a set of 120 genes whose regulation was shared with the anaerobic redox regulator, Fnr. Conclusion(s) We have identified the ArcA regulon in anaerobically grown S. Typhimurium. Our results demonstrated that in S. Typhimurium, ArcA serves as a transcriptional regulator coordinating cellular metabolism, flagella biosynthesis, and

  3. Quantitative and temporal definition of the Mla transcriptional regulon during barley-powdery mildew interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Barley Mildew resistance locus a (Mla) is a major determinant of immunity to the powdery mildew pathogen, Blumeria graminis f. sp. hordei. Alleles of Mla encode cytoplasmic- and membrane-localized coiled-coil, nucleotide binding site, leucine-rich repeat proteins that mediate resistance when complem...

  4. The proteasome stress regulon is controlled by a pair of NAC transcription factors in arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteotoxic stress is mitigated by a variety of mechanisms, including activation of the unfolded protein response and coordinated increases in protein chaperones and activities that direct proteolysis such as the 26S proteasome. Using RNA-seq analyses combined with either chemical inhibitors or mut...

  5. Towards a molecular understanding of the apicomplexan actin motor: on a road to novel targets for malaria remedies?

    SciTech Connect

    Kumpula, Esa-Pekka; Kursula, Inari

    2015-04-16

    In this review, current structural understanding of the apicomplexan glideosome and actin regulation is described. Apicomplexan parasites are the causative agents of notorious human and animal diseases that give rise to considerable human suffering and economic losses worldwide. The most prominent parasites of this phylum are the malaria-causing Plasmodium species, which are widespread in tropical and subtropical regions, and Toxoplasma gondii, which infects one third of the world’s population. These parasites share a common form of gliding motility which relies on an actin–myosin motor. The components of this motor and the actin-regulatory proteins in Apicomplexa have unique features compared with all other eukaryotes. This, together with the crucial roles of these proteins, makes them attractive targets for structure-based drug design. In recent years, several structures of glideosome components, in particular of actins and actin regulators from apicomplexan parasites, have been determined, which will hopefully soon allow the creation of a complete molecular picture of the parasite actin–myosin motor and its regulatory machinery. Here, current knowledge of the function of this motor is reviewed from a structural perspective.

  6. Genomic reconstruction of transcriptional regulatory networks in lactic acid bacteria

    PubMed Central

    2013-01-01

    Background Genome scale annotation of regulatory interactions and reconstruction of regulatory networks are the crucial problems in bacterial genomics. The Lactobacillales order of bacteria collates various microorganisms having a large economic impact, including both human and animal pathogens and strains used in the food industry. Nonetheless, no systematic genome-wide analysis of transcriptional regulation has been previously made for this taxonomic group. Results A comparative genomics approach was used for reconstruction of transcriptional regulatory networks in 30 selected genomes of lactic acid bacteria. The inferred networks comprise regulons for 102 orthologous transcription factors (TFs), including 47 novel regulons for previously uncharacterized TFs. Numerous differences between regulatory networks of the Streptococcaceae and Lactobacillaceae groups were described on several levels. The two groups are characterized by substantially different sets of TFs encoded in their genomes. Content of the inferred regulons and structure of their cognate TF binding motifs differ for many orthologous TFs between the two groups. Multiple cases of non-orthologous displacements of TFs that control specific metabolic pathways were reported. Conclusions The reconstructed regulatory networks substantially expand the existing knowledge of transcriptional regulation in lactic acid bacteria. In each of 30 studied genomes the obtained regulatory network contains on average 36 TFs and 250 target genes that are mostly involved in carbohydrate metabolism, stress response, metal homeostasis and amino acids biosynthesis. The inferred networks can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. All reconstructed regulons are captured within the Streptococcaceae and Lactobacillaceae collections in the RegPrecise database (http://regprecise.lbl.gov). PMID:23398941

  7. Fumarase C, the stable fumarase of Escherichia coli, is controlled by the soxRS regulon.

    PubMed Central

    Liochev, S I; Fridovich, I

    1992-01-01

    Fumarase C was strongly induced by paraquat in a parental strain of Escherichia coli but was not induced in a strain lacking the soxRS response. Moreover, a strain that constitutively expresses the soxRS regulon contained more fumarase C than did the parental strain. The Mn-containing superoxide dismutase and glucose-6-phosphate dehydrogenase, members of the soxRS regulon, were similarly induced by paraquat. Mutational defects in glucose-6-phosphate dehydrogenase increased the induction of fumarase C by paraquat. For Mn-containing superoxide dismutase, responsiveness to paraquat was also enhanced in the glucose-6-phosphate dehydrogenase-defective strains. Overproduction of the Mn-containing superoxide dismutase, elicited by isopropyl beta-D-thiogalactoside in a tac-sodA fusion strain, did not diminish induction of fumarase C or of glucose-6-phosphate dehydrogenase by paraquat, and induction of these enzymes was more sensitive to paraquat when the cells were growing on succinate rather than on LB medium. These results indicate that fumarase C is a member of the soxRS regulon and that this regulon does not respond to changes in O2- concentration but perhaps does respond to some consequence of a decrease in the ratio of NADPH to NADP+. PMID:1631070

  8. Lipid Synthesis in Protozoan Parasites: a Comparison Between Kinetoplastids and Apicomplexans

    PubMed Central

    Ramakrishnan, Srinivasan; Serricchio, Mauro; Striepen, Boris; Bütikofer, Peter

    2013-01-01

    Lipid metabolism is of crucial importance for pathogens. Lipids serve as cellular building blocks, signalling molecules, energy stores, posttranslational modifiers, and pathogenesis factors. Parasites rely on a complex system of uptake and synthesis mechanisms to satisfy their lipid needs. The parameters of this system change dramatically as the parasite transits through the various stages of its life cycle. Here we discuss the tremendous recent advances that have been made in the understanding of the synthesis and uptake pathways for fatty acids and phospholipids in apicomplexan and kinetoplastid parasites, including Plasmodium, Toxoplasma, Cryptosporidium, Trypanosoma and Leishmania. Lipid synthesis differs in significant ways between parasites from both phyla and the human host. Parasites have acquired novel pathways through endosymbiosis, as in the case of the apicoplast, have dramatically reshaped substrate and product profiles, and have evolved specialized lipids to interact with or manipulate the host. These differences potentially provide opportunities for drug development. We outline the lipid pathways for key species in detail as they progress through the developmental cycle and highlight those that are of particular importance to the biology of the pathogens and/or are the most promising targets for parasite-specific treatment. PMID:23827884

  9. Ribosomal Protein P2 from apicomplexan parasite Toxoplasma gondii is intrinsically a molten globule.

    PubMed

    Mishra, Pushpa; Choudhary, Sinjan; Hosur, Ramakrishna V

    2015-01-01

    Toxoplasma gondii is an apicomplexan parasite, which causes toxoplasmosis. Toxoplasma P2 (TgP2) is a ribosomal protein and exists as supramolecular assembly with other proteins in the ribosome. It is also shown that TgP2 is involved in some extra ribosomal functions. However, till date the protein has evaded structural characterization by any of the known techniques. In this background, we report here a systematic study using a variety of biophysical techniques and NMR, under different conditions of pH and temperature, and deduce that TgP2 consists of only helices and unstructured regions, is a monomer at low pH but forms multimers at higher pH, and has intrinsically a molten globule structure. The C-terminal half is flexible and the helices are concentrated in the N-terminal half of the chain. The dynamism inherent to the molten globule structure may have functional implications for its extra-ribosomal functions. which is contrast to that of human P2. PMID:25866913

  10. A large-scale proteogenomics study of apicomplexan pathogens—Toxoplasma gondii and Neospora caninum

    PubMed Central

    Krishna, Ritesh; Xia, Dong; Sanderson, Sanya; Shanmugasundram, Achchuthan; Vermont, Sarah; Bernal, Axel; Daniel-Naguib, Gianluca; Ghali, Fawaz; Brunk, Brian P; Roos, David S; Wastling, Jonathan M; Jones, Andrew R

    2015-01-01

    Proteomics data can supplement genome annotation efforts, for example being used to confirm gene models or correct gene annotation errors. Here, we present a large-scale proteogenomics study of two important apicomplexan pathogens: Toxoplasma gondii and Neospora caninum. We queried proteomics data against a panel of official and alternate gene models generated directly from RNASeq data, using several newly generated and some previously published MS datasets for this meta-analysis. We identified a total of 201 996 and 39 953 peptide-spectrum matches for T. gondii and N. caninum, respectively, at a 1% peptide FDR threshold. This equated to the identification of 30 494 distinct peptide sequences and 2921 proteins (matches to official gene models) for T. gondii, and 8911 peptides/1273 proteins for N. caninum following stringent protein-level thresholding. We have also identified 289 and 140 loci for T. gondii and N. caninum, respectively, which mapped to RNA-Seq-derived gene models used in our analysis and apparently absent from the official annotation (release 10 from EuPathDB) of these species. We present several examples in our study where the RNA-Seq evidence can help in correction of the current gene model and can help in discovery of potential new genes. The findings of this study have been integrated into the EuPathDB. The data have been deposited to the ProteomeXchange with identifiers PXD000297and PXD000298. PMID:25867681

  11. Analysis of the RpoS regulon in Borrelia burgdorferi in response to mammalian host signals provides insight into RpoS function during the enzootic cycle

    PubMed Central

    Caimano, Melissa J.; Iyer, Radha; Eggers, Christian H.; Gonzalez, Cynthia; Morton, Elizabeth A.; Gilbert, Michael A.; Schwartz, Ira; Radolf, Justin D.

    2010-01-01

    Summary Borrelia burgdorferi (Bb) adapts to its arthropod and mammalian hosts by altering its transcriptional and antigenic profiles in response to environmental signals associated with each of these milieus. In studies presented here, we provide evidence to suggest that mammalian host signals are important for modulating and maintaining both the positive and negative aspects of mammalian host adaptation mediated by the alternative sigma factor RpoS in Bb. Although considerable overlap was observed between genes induced by RpoS during growth within the mammalian host and following temperature-shift, comparative microarray analyses demonstrated unequivocally that RpoS-mediated repression requires mammalian host-specific signals. A substantial portion of the in vivo RpoS regulon was uniquely upregulated within dialysis membrane chambers, further underscoring the importance of host-derived environmental stimuli for differential gene expression in Bb. Expression profiling of genes within the RpoS regulon by quantitative reverse transcription polymerase chain reaction (qRT-PCR) revealed a level of complexity to RpoS-dependent gene regulation beyond that observed by microarray, including a broad range of expression levels and the presence of genes whose expression is only partially dependent on RpoS. Analysis of Bb-infected ticks by qRT-PCR established that expression of rpoS is induced during the nymphal blood meal but not within unfed nymphs or engorged larvae. Together, these data have led us to postulate that RpoS acts as a gatekeeper for the reciprocal regulation of genes involved in the establishment of infection within the mammalian host and the maintenance of spirochetes within the arthropod vector. PMID:17645733

  12. Role of the small RNA RyhB in the Fur regulon in mediating the capsular polysaccharide biosynthesis and iron acquisition systems in Klebsiella pneumoniae

    PubMed Central

    2012-01-01

    Background The capsular polysaccharide (CPS) and iron acquisition systems are important determinants of Klebsiella pneumoniae infections, and we have previously reported that the ferric uptake repressor (Fur) can play dual role in iron acquisition and CPS biosynthesis. In many bacteria, Fur negatively controls the transcription of the small non-coding RNA RyhB to modulate cellular functions and virulence. However, in K. pneumoniae, the role played by RyhB in the Fur regulon has not been characterised. This study investigated Fur regulation of ryhB transcription and the functional role of RyhB in K. pneumoniae. Results Deletion of fur from K. pneumoniae increased the transcription of ryhB; the electric mobility shift assay and the Fur-titration assay revealed that Fur could bind to the promoter region of ryhB, suggesting that Fur directly represses ryhB transcription. Additionally, in a Δfur strain with elevated CPS production, deletion of ryhB obviously reduced CPS production. The following promoter-reporter assay and quantitative real-time PCR of cps genes verified that RyhB activated orf1 and orf16 transcription to elevate CPS production. However, deletion of ryhB did not affect the mRNA levels of rcsA, rmpA, or rmpA2. These results imply that Fur represses the transcription of ryhB to mediate the biosynthesis of CPS, which is independent of RcsA, RmpA, and RmpA2. In addition, the Δfur strain’s high level of serum resistance was attenuated by the deletion of ryhB, indicating that RyhB plays a positive role in protecting the bacterium from serum killing. Finally, deletion of ryhB in Δfur reduced the expression of several genes corresponding to 3 iron acquisition systems in K. pneumoniae, and resulted in reduced siderophore production. Conclusions The regulation and functional role of RyhB in K. pneumoniae is characterized in this study. RyhB participates in Fur regulon to modulate the bacterial CPS biosynthesis and iron acquisition systems in K. pneumoniae

  13. RivR and the small RNA RivX: the missing links between the CovR regulatory cascade and the Mga regulon.

    PubMed

    Roberts, Samantha A; Scott, June R

    2007-12-01

    The CovR/S two-component system regulates the transcription of many genes that are crucial for the virulence of Streptococcus pyogenes (group A Streptococcus, GAS). Previously, we demonstrated that one gene repressed directly by CovR is rivR, which encodes a member of the RofA-like family of transcriptional regulators. In this study, we deleted rivR and its downstream gene rivX in a DeltacovR background. Microarray analysis revealed that the products of the rivRX locus exert positive control over the transcription of members of the Mga regulon. Using mutational analysis, we established that rivX encodes a small regulatory RNA. We found that RivR enhances transcriptional activation by Mga in vivo and in vitro. An M1 DeltacovRDeltarivRX strain is attenuated for virulence in a murine model of invasive soft tissue infection and this attenuation is complemented by rivRX expressed from a plasmid, demonstrating the importance of the rivRX locus in pathogenesis. This study provides the first link between the CovR and Mga regulatory networks. By integrating the signals received through these two global regulators, GAS is able to select from its repertoire different combinations of specific virulence factors to express in response to a broad spectrum of environmental conditions. PMID:18005100

  14. Attenuation of virulence in an apicomplexan hemoparasite results in reduced genome diversity at the population level

    PubMed Central

    2011-01-01

    Background Virulence acquisition and loss is a dynamic adaptation of pathogens to thrive in changing milieus. We investigated the mechanisms of virulence loss at the whole genome level using Babesia bovis as a model apicomplexan in which genetically related attenuated parasites can be reliably derived from virulent parental strains in the natural host. We expected virulence loss to be accompanied by consistent changes at the gene level, and that such changes would be shared among attenuated parasites of diverse geographic and genetic background. Results Surprisingly, while single nucleotide polymorphisms in 14 genes distinguished all attenuated parasites from their virulent parental strains, all non-synonymous changes resulted in no deleterious amino acid modification that could consistently be associated with attenuation (or virulence) in this hemoparasite. Interestingly, however, attenuation significantly reduced the overall population's genome diversity with 81% of base pairs shared among attenuated strains, compared to only 60% of base pairs common among virulent parental parasites. There were significantly fewer genes that were unique to their geographical origins among the attenuated parasites, resulting in a simplified population structure among the attenuated strains. Conclusions This simplified structure includes reduced diversity of the variant erythrocyte surface 1 (ves) multigene family repertoire among attenuated parasites when compared to virulent parental strains, possibly suggesting that overall variance in large protein families such as Variant Erythrocyte Surface Antigens has a critical role in expression of the virulence phenotype. In addition, the results suggest that virulence (or attenuation) mechanisms may not be shared among all populations of parasites at the gene level, but instead may reflect expansion or contraction of the population structure in response to shifting milieus. PMID:21838895

  15. Re-Emergence of the Apicomplexan Theileria equi in the United States: Elimination of Persistent Infection and Transmission Risk

    PubMed Central

    Ueti, Massaro W.; Mealey, Robert H.; Kappmeyer, Lowell S.; White, Stephen N.; Kumpula-McWhirter, Nancy; Pelzel, Angela M.; Grause, Juanita F.; Bunn, Thomas O.; Schwartz, Andy; Traub-Dargatz, Josie L.; Hendrickson, Amy; Espy, Benjamin; Guthrie, Alan J.; Fowler, W. Kent; Knowles, Donald P.

    2012-01-01

    Arthropod-borne apicomplexan pathogens that cause asymptomatic persistent infections present a significant challenge due to their life-long transmission potential. Although anti-microbials have been used to ameliorate acute disease in animals and humans, chemotherapeutic efficacy for apicomplexan pathogen elimination from a persistently infected host and removal of transmission risk is largely unconfirmed. The recent re-emergence of the apicomplexan Theileria equi in U.S. horses prompted testing whether imidocarb dipropionate was able to eliminate T. equi from naturally infected horses and remove transmission risk. Following imidocarb treatment, levels of T. equi declined from a mean of 104.9 organisms/ml of blood to undetectable by nested PCR in 24 of 25 naturally infected horses. Further, blood transfer from treated horses that became nested PCR negative failed to transmit to naïve splenectomized horses. Although these results were consistent with elimination of infection in 24 of 25 horses, T. equi-specific antibodies persisted in the majority of imidocarb treated horses. Imidocarb treatment was unsuccessful in one horse which remained infected as measured by nested PCR and retained the ability to infect a naïve recipient via intravenous blood transfer. However, a second round of treatment eliminated T. equi infection. These results support the utility of imidocarb chemotherapy for assistance in the control and eradication of this tick-borne pathogen. Successful imidocarb dipropionate treatment of persistently infected horses provides a tool to aid the global equine industry by removing transmission risk associated with infection and facilitating international movement of equids between endemic and non-endemic regions. PMID:22970295

  16. Control site location and transcriptional regulation in Escherichia coli.

    PubMed Central

    Collado-Vides, J; Magasanik, B; Gralla, J D

    1991-01-01

    The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993

  17. The Zur regulon of Corynebacterium glutamicum ATCC 13032

    PubMed Central

    2010-01-01

    Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc

  18. Evolutionary and Functional Relationships of the dha Regulon by Genomic Context Analysis.

    PubMed

    Martins-Pinheiro, Marinalva; Lima, Wanessa C; Asif, Huma; Oller, Cláudio A; Menck, Carlos F M

    2016-01-01

    3-hydroxypropionaldehyde (3-HPA) and 1,3-propanediol (1,3-PD) are subproducts of glycerol degradation and of economical interest as they are used for polymers synthesis, such as polyesters and polyurethanes. Some few characterized bacterial species (mostly from Firmicutes and Gamma-proteobacteria groups) are able to catabolize these monomers from glycerol using the gene products from the dha regulon. To expand our knowledge and direct further experimental studies on the regulon and related genes for the anaerobic glycerol metabolism, an extensive genomic screening was performed to identify the presence of the dha genes in fully sequenced prokaryotic genomes. Interestingly, this work shows that although only few bacteria species are known to produce 3-HPA or 1,3-PD, the incomplete regulon is found in more than 100 prokaryotic genomes. However, the complete pathway is found only in a few dozen species belonging to five different taxonomic groups, including one Archaea species, Halalkalicoccus jeotgali. Phylogenetic analysis and conservation of both gene synteny and primary sequence similarity reinforce the idea that these genes have a common origin and were possibly acquired by lateral gene transfer (LGT). Besides the evolutionary aspect, the identification of homologs from several different organisms may predict potential alternative targets for faster or more efficient biological synthesis of 3-HPA or 1,3-PD. PMID:26938861

  19. The Streptococcus sanguinis Competence Regulon Is Not Required for Infective Endocarditis Virulence in a Rabbit Model

    PubMed Central

    Callahan, Jill E.; Munro, Cindy L.; Kitten, Todd

    2011-01-01

    Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility in S. sanguinis. Strains deleted for the comCDE or comX master regulatory genes were created. Using a rabbit endocarditis model in conjunction with a variety of virulence assays, we determined that both mutants possessed infectivity equivalent to that of a virulent control strain, and that measures of disease were similar in rabbits infected with each strain. These results suggest that the com regulon is not required for S. sanguinis infective endocarditis virulence in this model. We propose that the different roles of the S. sanguinis, S. pneumoniae, and S. mutans com regulons in virulence can be understood in relation to the pathogenic mechanisms employed by each species. PMID:22039480

  20. Evolutionary and Functional Relationships of the dha Regulon by Genomic Context Analysis

    PubMed Central

    Martins-Pinheiro, Marinalva; Lima, Wanessa C.; Asif, Huma; Oller, Cláudio A.; Menck, Carlos F. M.

    2016-01-01

    3-hydroxypropionaldehyde (3-HPA) and 1,3-propanediol (1,3-PD) are subproducts of glycerol degradation and of economical interest as they are used for polymers synthesis, such as polyesters and polyurethanes. Some few characterized bacterial species (mostly from Firmicutes and Gamma-proteobacteria groups) are able to catabolize these monomers from glycerol using the gene products from the dha regulon. To expand our knowledge and direct further experimental studies on the regulon and related genes for the anaerobic glycerol metabolism, an extensive genomic screening was performed to identify the presence of the dha genes in fully sequenced prokaryotic genomes. Interestingly, this work shows that although only few bacteria species are known to produce 3-HPA or 1,3-PD, the incomplete regulon is found in more than 100 prokaryotic genomes. However, the complete pathway is found only in a few dozen species belonging to five different taxonomic groups, including one Archaea species, Halalkalicoccus jeotgali. Phylogenetic analysis and conservation of both gene synteny and primary sequence similarity reinforce the idea that these genes have a common origin and were possibly acquired by lateral gene transfer (LGT). Besides the evolutionary aspect, the identification of homologs from several different organisms may predict potential alternative targets for faster or more efficient biological synthesis of 3-HPA or 1,3-PD. PMID:26938861

  1. Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene.

    PubMed Central

    Nunoshiba, T; Hidalgo, E; Amábile Cuevas, C F; Demple, B

    1992-01-01

    Escherichia coli responds to the redox stress imposed by superoxide-generating agents such as paraquat by activating the synthesis of as many as 80 polypeptides. Expression of a key group of these inducible proteins is controlled at the transcriptional level by the soxRS locus (the soxRS regulon). A two-stage control system was hypothesized for soxRS, in which an intracellular redox signal would trigger the SoxR protein as a transcriptional activator of the soxS gene and the resulting increased levels of SoxS protein would activate transcription of the various soxRS regulon genes (B. Demple and C.F. Amábile Cuevas, Cell 67:837-839, 1990). We have constructed operon fusions of the E. coli lac genes to the soxS promoter to monitor soxS transcription. Expression from the soxS promoter is strongly inducible by paraquat in a manner strictly dependent on a functional soxR gene. Several other superoxide-generating agents also trigger soxR(+)-dependent soxS expression, and the inductions by paraquat and phenazine methosulfate were dependent on the presence of oxygen. Numerous other oxidative stress agents (H2O2, gamma rays, heat shock, etc.) failed to induce soxS, while aerobic growth of superoxide dismutase-deficient bacteria triggered soxR-dependent soxS expression. These results indicate a specific redox signal for soxS induction. A direct role for SoxR protein in the activation of the soxS gene is indicated by band-shift and DNase I footprinting experiments that demonstrate specific binding of the SoxR protein in cell extracts to the soxS promoter. The mode of SoxR binding to DNA appears to be similar to that of its homolog MerR in that the SoxR footprint spans the -10 to -35 region of the soxS promoter. Images PMID:1400156

  2. Deletion of mtrC in Haemophilus ducreyi Increases Sensitivity to Human Antimicrobial Peptides and Activates the CpxRA Regulon

    PubMed Central

    Rinker, Sherri D.; Trombley, Michael P.; Gu, Xiaoping; Fortney, Kate R.; Bauer, Margaret E.

    2011-01-01

    Haemophilus ducreyi resists killing by antimicrobial peptides encountered during human infection, including cathelicidin LL-37, α-defensins, and β-defensins. In this study, we examined the role of the proton motive force-dependent multiple transferable resistance (MTR) transporter in antimicrobial peptide resistance in H. ducreyi. We found a proton motive force-dependent effect on H. ducreyi's resistance to LL-37 and β-defensin HBD-3, but not α-defensin HNP-2. Deletion of the membrane fusion protein MtrC rendered H. ducreyi more sensitive to LL-37 and human β-defensins but had relatively little effect on α-defensin resistance. The mtrC mutant 35000HPmtrC exhibited phenotypic changes in outer membrane protein profiles, colony morphology, and serum sensitivity, which were restored to wild type by trans-complementation with mtrC. Similar phenotypes were reported in a cpxA mutant; activation of the two-component CpxRA regulator was confirmed by showing transcriptional effects on CpxRA-regulated genes in 35000HPmtrC. A cpxR mutant had wild-type levels of antimicrobial peptide resistance; a cpxA mutation had little effect on defensin resistance but led to increased sensitivity to LL-37. 35000HPmtrC was more sensitive than the cpxA mutant to LL-37, indicating that MTR contributed to LL-37 resistance independent of the CpxRA regulon. The CpxRA regulon did not affect proton motive force-dependent antimicrobial peptide resistance; however, 35000HPmtrC had lost proton motive force-dependent peptide resistance, suggesting that the MTR transporter promotes proton motive force-dependent resistance to LL-37 and human β-defensins. This is the first report of a β-defensin resistance mechanism in H. ducreyi and shows that LL-37 resistance in H. ducreyi is multifactorial. PMID:21444663

  3. Disassembly activity of actin-depolymerizing factor (ADF) is associated with distinct cellular processes in apicomplexan parasites

    PubMed Central

    Haase, Silvia; Zimmermann, Dennis; Olshina, Maya A.; Wilkinson, Mark; Fisher, Fabio; Tan, Yan Hong; Stewart, Rebecca J.; Tonkin, Christopher J.; Wong, Wilson; Kovar, David R.; Baum, Jake

    2015-01-01

    Proteins of the actin-depolymerizing factor (ADF)/cofilin family have been shown to be crucial for the motility and survival of apicomplexan parasites. However, the mechanisms by which ADF proteins fulfill their function remain poorly understood. In this study, we investigate the comparative activities of ADF proteins from Toxoplasma gondii and Plasmodium falciparum, the human malaria parasite, using a conditional T. gondii ADF-knockout line complemented with ADF variants from either species. We show that P. falciparum ADF1 can fully restore native TgADF activity, demonstrating functional conservation between parasites. Strikingly, mutation of a key basic residue (Lys-72), previously implicated in disassembly in PfADF1, had no detectable phenotypic effect on parasite growth, motility, or development. In contrast, organelle segregation was severely impaired when complementing with a TgADF mutant lacking the corresponding residue (Lys-68). Biochemical analyses of each ADF protein confirmed the reduced ability of lysine mutants to mediate actin depolymerization via filament disassembly although not severing, in contrast to previous reports. These data suggest that actin filament disassembly is essential for apicomplexan parasite development but not for motility, as well as pointing to genus-specific coevolution between ADF proteins and their native actin. PMID:26157165

  4. Disassembly activity of actin-depolymerizing factor (ADF) is associated with distinct cellular processes in apicomplexan parasites.

    PubMed

    Haase, Silvia; Zimmermann, Dennis; Olshina, Maya A; Wilkinson, Mark; Fisher, Fabio; Tan, Yan Hong; Stewart, Rebecca J; Tonkin, Christopher J; Wong, Wilson; Kovar, David R; Baum, Jake

    2015-09-01

    Proteins of the actin-depolymerizing factor (ADF)/cofilin family have been shown to be crucial for the motility and survival of apicomplexan parasites. However, the mechanisms by which ADF proteins fulfill their function remain poorly understood. In this study, we investigate the comparative activities of ADF proteins from Toxoplasma gondii and Plasmodium falciparum, the human malaria parasite, using a conditional T. gondii ADF-knockout line complemented with ADF variants from either species. We show that P. falciparum ADF1 can fully restore native TgADF activity, demonstrating functional conservation between parasites. Strikingly, mutation of a key basic residue (Lys-72), previously implicated in disassembly in PfADF1, had no detectable phenotypic effect on parasite growth, motility, or development. In contrast, organelle segregation was severely impaired when complementing with a TgADF mutant lacking the corresponding residue (Lys-68). Biochemical analyses of each ADF protein confirmed the reduced ability of lysine mutants to mediate actin depolymerization via filament disassembly although not severing, in contrast to previous reports. These data suggest that actin filament disassembly is essential for apicomplexan parasite development but not for motility, as well as pointing to genus-specific coevolution between ADF proteins and their native actin. PMID:26157165

  5. Towards a molecular understanding of the apicomplexan actin motor: on a road to novel targets for malaria remedies?

    PubMed Central

    Kumpula, Esa-Pekka; Kursula, Inari

    2015-01-01

    Apicomplexan parasites are the causative agents of notorious human and animal diseases that give rise to considerable human suffering and economic losses worldwide. The most prominent parasites of this phylum are the malaria-causing Plasmodium species, which are widespread in tropical and subtropical regions, and Toxoplasma gondii, which infects one third of the world’s population. These parasites share a common form of gliding motility which relies on an actin–myosin motor. The components of this motor and the actin-regulatory proteins in Apicomplexa have unique features compared with all other eukaryotes. This, together with the crucial roles of these proteins, makes them attractive targets for structure-based drug design. In recent years, several structures of glideosome components, in particular of actins and actin regulators from apicomplexan parasites, have been determined, which will hopefully soon allow the creation of a complete molecular picture of the parasite actin–myosin motor and its regulatory machinery. Here, current knowledge of the function of this motor is reviewed from a structural perspective. PMID:25945702

  6. Three Chymotrypsin Genes Are Members of the AdpA Regulon in the A-Factor Regulatory Cascade in Streptomyces griseus

    PubMed Central

    Tomono, Ayami; Tsai, Yisan; Ohnishi, Yasuo; Horinouchi, Sueharu

    2005-01-01

    AdpA is a key transcriptional activator in the A-factor regulatory cascade in Streptomyces griseus, activating a number of genes required for secondary metabolism and morphological differentiation. Of the five chymotrypsin-type serine protease genes, sprA, sprB, and sprD were transcribed in response to AdpA, showing that these protease genes are members of the AdpA regulon. These proteases were predicted to play the same physiological role, since these protease genes were transcribed in a similar time course during growth and the matured enzymes showed high end-to-end similarity to one another. AdpA bound two sites upstream of the sprA promoter approximately at positions −375 and −50 with respect to the transcriptional start point of sprA. Mutational analysis of the AdpA-binding sites showed that both AdpA-binding sites were essential for transcriptional activation. AdpA bound a single site at position −50 in front of the sprB promoter and greatly enhanced the transcription of sprB. The AdpA-binding site at position −40 was essential for transcription of sprD, although there was an additional AdpA-binding site at position −180. Most chymotrypsin activity excreted by S. griseus was attributed to SprA and SprB, because mutant ΔsprAB, having a deletion in both sprA and sprB, lost almost all chymotrypsin activity, as did mutant ΔadpA. Even the double mutant ΔsprAB and triple mutant ΔsprABD grew normally and developed aerial hyphae and spores over the same time course as the wild-type strain. PMID:16159767

  7. Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus

    SciTech Connect

    Rodionov, Dmitry A.; Novichkov, Pavel; Stavrovskaya, Elena D.; Rodionova, Irina A.; Li, Xiaoqing; Kazanov, Marat D.; Ravcheev, Dmitry A.; Gerasimova, Anna V.; Kazakov, Alexey E.; Kovaleva, Galina Y.; Permina, Elizabeth A.; Laikova, Olga N.; Overbeek, Ross; Romine, Margaret F.; Fredrickson, Jim K.; Arkin, Adam P.; Dubchak, Inna; Osterman, Andrei L.; Gelfand, Mikhail S.

    2011-06-15

    Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. Despite the growing number of genome-scale gene expression studies, our abilities to convert the results of these studies into accurate regulatory annotations and to project them from model to other organisms are extremely limited. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. However, even orthologous regulators with conserved DNA-binding motifs may control substantially different gene sets, revealing striking differences in regulatory strategies between the Shewanella spp. and E. coli. Multiple examples of regulatory network rewiring include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), and numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. NagR for N-acetylglucosamine catabolism and PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp).

  8. DB-AT: a 2015 update to the Full-parasites database brings a multitude of new transcriptomic data for apicomplexan parasites

    PubMed Central

    Jąkalski, Marcin; Wakaguri, Hiroyuki; Kischka, Tabea G.; Nishikawa, Yoshifumi; Kawazu, Shin-ichiro; Matsubayashi, Makoto; Kawahara, Fumiya; Tsuji, Naotoshi; Cao, Shinuo; Sunaga, Fujiko; Xuan, Xuenan; Okubo, Kazuhiro; Igarashi, Ikuo; Tuda, Josef; Mongan, Arthur E.; Eshita, Yuki; Maeda, Ryuichiro; Makałowski, Wojciech; Suzuki, Yutaka; Yamagishi, Junya

    2015-01-01

    The previous release of our Full-parasites database (http://fullmal.hgc.jp/) brought enhanced functionality, an expanded full-length cDNA content, and new RNA-Seq datasets from several important apicomplexan parasites. The 2015 update witnesses the major shift in the databases content with focus on diverse transcriptomes of the apicomplexan parasites. The content of the database was substantially enriched with transcriptome information for new apicomplexan parasites. The latest version covers a total of 17 species, with addition of our newly generated RNA-Seq data of a total of 909 150 388 tags. Moreover, we have generated and included two novel and unique datasets, which represent diverse nature of transcriptomes in individual parasites in vivo and in vitro. One is the data collected from 116 Indonesian patients infected with Plasmodium falciparum. The other is a series of transcriptome data collected from a total of 38 single cells of P. falciparum cultured in vitro. We believe that with the recent advances our database becomes an even better resource and a unique platform in the analysis of apicomplexan parasites and their interaction with their hosts. To adequately reflect the recent modifications and the current content we have changed the database name to DB-AT—DataBase of Apicomplexa Transcriptomes. PMID:25414358

  9. Evidence of tRNA cleavage in apicomplexan parasites: half-tRNAs as new potential regulatory molecules of Toxoplasma gondii and Plasmodium berghei

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several lines of evidence demonstrated that organisms ranging from bacteria to higher animals possess a regulated endonucleolytic cleavage pathway producing half-tRNA fragments. In the present study, we investigated the occurrence of this phenomenon in two distantly related apicomplexan parasites, T...

  10. Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks

    SciTech Connect

    Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.; Alm, EricJ.; Gelfand, Mikhail S.

    2005-09-01

    Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the

  11. Nitrofurantoin, phenazopyridine, and the superoxide-response regulon soxRS of Escherichia coli.

    PubMed

    Amábile-Cuevas, Carlos F; Arredondo-García, José Luis

    2013-12-01

    Nitrofurantoin and phenazopyridine are two drugs commonly used against urinary tract infections. Both compounds exert oxidative damage in patients deficient in glucose-6-phosphate dehydrogenase. This study was done to assess the interactions of these drugs with the soxRS regulon of Escherichia coli, a superoxide-defense system (that includes a nitroreductase that yields the active metabolite of nitrofurantoin) involved in antibiotic multi-resistance. The effects of either nitrofurantoin or phenazopyridine, upon strains with different soxRS genotypes, were measured as minimum inhibitory concentrations (MICs) and growth curves. Also, the ability of these drugs to induce the expression of a soxS'::lacZ gene fusion was assessed. The effect of antibiotics in the presence of phenazopyridine, paraquat (a known soxRS inducer), or an efflux inhibitor, was measured using the disk diffusion method. A strain constitutively expressing the soxRS regulon was slightly more susceptible to nitrofurantoin, and more resistant to phenazopyridine, compared to wild-type and soxRS-deleted strains, during early treatment, but 24-h MICs were the same (8 mg/l nitrofurantoin, 1,000 mg/l phenazopyridine) for all strains. Both compounds were capable of inducing the expression of a soxS'::lacZ fusion, but less than paraquat. Subinhibitory concentrations of phenazopyridine increased the antimicrobial effect of ampicillin, chloramphenicol, tetracycline, and nitrofurantoin. The induction or constitutive expression of the soxRS regulon seems to be a disadvantage for E. coli during nitrofurantoin exposure; but might be an advantage during phenazopyridine exposure, indicating that the latter compound could act as a selective pressure for mutations related to virulence and antibiotic multi-resistance. PMID:23793794

  12. Mg(2+) signalling defines the group A streptococcal CsrRS (CovRS) regulon.

    PubMed

    Gryllos, Ioannis; Grifantini, Renata; Colaprico, Annalisa; Jiang, Shengmei; Deforce, Emelia; Hakansson, Anders; Telford, John L; Grandi, Guido; Wessels, Michael R

    2007-08-01

    CsrRS (or CovRS) is a two-component system implicated in the control of multiple virulence determinants in the important human pathogen, group A Streptococcus (GAS). Earlier studies suggested that extracellular Mg(2+) signalled through the presumed sensor histidine kinase, CsrS. We now confirm those findings, as complementation of a csrS mutant restored Mg(2+)-dependent gene regulation. Moreover, we present strong evidence that Mg(2+) signals through CsrS to regulate an extensive and previously undefined repertoire of GAS genes. The effect of Mg(2+) on regulation of global gene expression was evaluated using genomic microarrays in an M-type 3 strain of GAS and in an isogenic csrS mutant. Unexpectedly, of the 72 genes identified in the Mg(2+)-stimulated CsrRS regulon, 42 were absent from the CsrR regulon (the latter being defined by comparison of wild-type and CsrR mutant transcriptomes at low Mg(2+)). We observed CsrS-dependent regulation of 72 of the 73 genes whose expression changed in response to elevated extracellular Mg(2+) in wild-type bacteria, a result that identifies CsrS as the principal, if not exclusive, sensor for extracellular Mg(2+) in GAS. To our knowledge, this study is the first to characterize global gene regulation by a GAS two-component system in response to a specific environmental stimulus. PMID:17608796

  13. Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics and in vitro DNA band shift assays.

    PubMed

    Jochmann, Nina; Kurze, Anna-Katharina; Czaja, Lisa F; Brinkrolf, Karina; Brune, Iris; Hüser, Andrea T; Hansmeier, Nicole; Pühler, Alfred; Borovok, Ilya; Tauch, Andreas

    2009-05-01

    The lexA gene of Corynebacterium glutamicum ATCC 13032 was deleted to create the mutant strain C. glutamicum NJ2114, which has an elongated cell morphology and an increased doubling time. To characterize the SOS regulon in C. glutamicum, the transcriptomes of NJ2114 and a DNA-damage-induced wild-type strain were compared with that of a wild-type control using DNA microarray hybridization. The expression data were combined with bioinformatic pattern searches for LexA binding sites, leading to the detection of 46 potential SOS boxes located upstream of differentially expressed transcription units. Binding of a hexahistidyl-tagged LexA protein to 40 double-stranded oligonucleotides containing the potential SOS boxes was demonstrated in vitro by DNA band shift assays. It turned out that LexA binds not only to SOS boxes in the promoter-operator region of upregulated genes, but also to SOS boxes detected upstream of downregulated genes. These results demonstrated that LexA controls directly the expression of at least 48 SOS genes organized in 36 transcription units. The deduced genes encode a variety of physiological functions, many of them involved in DNA repair and survival after DNA damage, but nearly half of them have hitherto unknown functions. Alignment of the LexA binding sites allowed the corynebacterial SOS box consensus sequence TcGAA(a/c)AnnTGTtCGA to be deduced. Furthermore, the common intergenic region of lexA and the differentially expressed divS-nrdR operon, encoding a cell division suppressor and a regulator of deoxyribonucleotide biosynthesis, was characterized in detail. Promoter mapping revealed differences in divS-nrdR expression during SOS response and normal growth conditions. One of the four LexA binding sites detected in the intergenic region is involved in regulating divS-nrdR transcription, whereas the other sites are apparently used for negative autoregulation of lexA expression. PMID:19372162

  14. A Multi-Serotype Approach Clarifies the Catabolite Control Protein A Regulon in the Major Human Pathogen Group A Streptococcus.

    PubMed

    DebRoy, Sruti; Saldaña, Miguel; Travisany, Dante; Montano, Andrew; Galloway-Peña, Jessica; Horstmann, Nicola; Yao, Hui; González, Mauricio; Maass, Alejandro; Latorre, Mauricio; Shelburne, Samuel A

    2016-01-01

    Catabolite control protein A (CcpA) is a highly conserved, master regulator of carbon source utilization in gram-positive bacteria, but the CcpA regulon remains ill-defined. In this study we aimed to clarify the CcpA regulon by determining the impact of CcpA-inactivation on the virulence and transcriptome of three distinct serotypes of the major human pathogen Group A Streptococcus (GAS). CcpA-inactivation significantly decreased GAS virulence in a broad array of animal challenge models consistent with the idea that CcpA is critical to gram-positive bacterial pathogenesis. Via comparative transcriptomics, we established that the GAS CcpA core regulon is enriched for highly conserved CcpA binding motifs (i.e. cre sites). Conversely, strain-specific differences in the CcpA transcriptome seems to consist primarily of affected secondary networks. Refinement of cre site composition via analysis of the core regulon facilitated development of a modified cre consensus that shows promise for improved prediction of CcpA targets in other medically relevant gram-positive pathogens. PMID:27580596

  15. A Multi-Serotype Approach Clarifies the Catabolite Control Protein A Regulon in the Major Human Pathogen Group A Streptococcus

    PubMed Central

    DebRoy, Sruti; Saldaña, Miguel; Travisany, Dante; Montano, Andrew; Galloway-Peña, Jessica; Horstmann, Nicola; Yao, Hui; González, Mauricio; Maass, Alejandro; Latorre, Mauricio; Shelburne, Samuel A.

    2016-01-01

    Catabolite control protein A (CcpA) is a highly conserved, master regulator of carbon source utilization in gram-positive bacteria, but the CcpA regulon remains ill-defined. In this study we aimed to clarify the CcpA regulon by determining the impact of CcpA-inactivation on the virulence and transcriptome of three distinct serotypes of the major human pathogen Group A Streptococcus (GAS). CcpA-inactivation significantly decreased GAS virulence in a broad array of animal challenge models consistent with the idea that CcpA is critical to gram-positive bacterial pathogenesis. Via comparative transcriptomics, we established that the GAS CcpA core regulon is enriched for highly conserved CcpA binding motifs (i.e. cre sites). Conversely, strain-specific differences in the CcpA transcriptome seems to consist primarily of affected secondary networks. Refinement of cre site composition via analysis of the core regulon facilitated development of a modified cre consensus that shows promise for improved prediction of CcpA targets in other medically relevant gram-positive pathogens. PMID:27580596

  16. Two-dimensional electrophoresis analysis of the extracellular proteome of Bacillus cereus reveals the importance of the PlcR regulon.

    PubMed

    Gohar, Michel; Økstad, Ole Andreas; Gilois, Nathalie; Sanchis, Vincent; Kolstø, Anne-Brit; Lereclus, Didier

    2002-06-01

    Many virulence factors are secreted by the gram-positive, spore forming bacterium Bacillus cereus. Most of them are regulated by the transcriptional activator, PlcR, which is maximally expressed at the beginning of the stationary phase. We used a proteomic approach to study the impact of the PlcR regulon on the secreted proteins of B. cereus, by comparing the extracellular proteomes of strains ATCC 14579 and ATCC 14579 Delta plcR, in which plcR has been disrupted. Our study indicated that, quantitatively, most of the proteins secreted at the onset of the stationary phase are putative virulence factors, all of which are regulated, directly or indirectly, by PlcR. The inactivation of plcR abolished the secretion of some of these virulence factors, and strongly decreased that of others. The genes encoding proteins that are not secreted in the DeltaplcR mutant possessed a regulatory sequence, the PlcR box, upstream from their coding sequence. These proteins include collagenase, phospholipases, haemolysins, proteases and enterotoxins. Proteins for which the secretion was strongly decreased, but not abolished, in the DeltaplcR mutant did not display the PlcR box upstream from their genes. These proteins include flagellins and InhA2. InhA2 is a homologue of InhA, a Bacillus thuringiensis metalloprotease that specifically degrades antibacterial peptides. The mechanism by which PlcR affects the production of flagellins and InhA2 is not known. PMID:12112862

  17. TrxR, a new CovR-repressed response regulator that activates the Mga virulence regulon in group A Streptococcus.

    PubMed

    Leday, Temekka V; Gold, Kathryn M; Kinkel, Traci L; Roberts, Samantha A; Scott, June R; McIver, Kevin S

    2008-10-01

    Coordinate regulation of virulence factors by the group A streptococcus (GAS) Streptococcus pyogenes is important in this pathogen's ability to cause disease. To further elucidate the regulatory network in this human pathogen, the CovR-repressed two-component system (TCS) trxSR was chosen for further analysis based on its homology to a virulence-related TCS in Streptococcus pneumoniae. In a murine skin infection model, an insertion mutation in the response regulator gene, trxR, led to a significant reduction in lesion size, lesion severity, and lethality. Curing the trxR mutation restored virulence comparable to the wild-type strain. The trxSR operon was defined in vivo, and CovR was found to directly repress its promoter in vitro. DNA microarray analysis established that TrxR activates transcription of Mga-regulated virulence genes, which may explain the virulence attenuation of the trxR mutant. This regulation appears to occur by activation of the mga promoter, Pmga, as demonstrated by analysis of a luciferase reporter fusion. Complementation of the trxR mutant with trxR on a plasmid restored expression of Mga regulon genes and restored virulence in the mouse model to wild-type levels. TrxR is the first TCS shown to regulate Mga expression. Because it is CovR repressed, TrxR defines a new pathway by which CovR can influence Mga to affect pathogenesis in the GAS. PMID:18678666

  18. The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

    PubMed

    Chen, Y M; Zhu, Y; Lin, E C

    1987-12-01

    In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans. PMID:3325779

  19. TrxR, a New CovR-Repressed Response Regulator That Activates the Mga Virulence Regulon in Group A Streptococcus▿ †

    PubMed Central

    Leday, Temekka V.; Gold, Kathryn M.; Kinkel, Traci L.; Roberts, Samantha A.; Scott, June R.; McIver, Kevin S.

    2008-01-01

    Coordinate regulation of virulence factors by the group A streptococcus (GAS) Streptococcus pyogenes is important in this pathogen's ability to cause disease. To further elucidate the regulatory network in this human pathogen, the CovR-repressed two-component system (TCS) trxSR was chosen for further analysis based on its homology to a virulence-related TCS in Streptococcus pneumoniae. In a murine skin infection model, an insertion mutation in the response regulator gene, trxR, led to a significant reduction in lesion size, lesion severity, and lethality. Curing the trxR mutation restored virulence comparable to the wild-type strain. The trxSR operon was defined in vivo, and CovR was found to directly repress its promoter in vitro. DNA microarray analysis established that TrxR activates transcription of Mga-regulated virulence genes, which may explain the virulence attenuation of the trxR mutant. This regulation appears to occur by activation of the mga promoter, Pmga, as demonstrated by analysis of a luciferase reporter fusion. Complementation of the trxR mutant with trxR on a plasmid restored expression of Mga regulon genes and restored virulence in the mouse model to wild-type levels. TrxR is the first TCS shown to regulate Mga expression. Because it is CovR repressed, TrxR defines a new pathway by which CovR can influence Mga to affect pathogenesis in the GAS. PMID:18678666

  20. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.

    PubMed

    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K

    2014-09-01

    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite. PMID:24923662

  1. A route for fructose utilization by Escherichia coli involving the fucose regulon.

    PubMed

    Kornberg, Hans; Lourenco, Christopher

    2006-12-19

    Fructose can be taken up by Escherichia coli via a variety of membrane-spanning proteins that recognize sugars with the 3,4,5-d-arabino-hexose configuration. Here, we describe a mutant that is devoid of those proteins but takes up fructose via the FucP carrier normally used for the transport of alpha-L-fucose; this implies that the fructose is taken up in the alpha- or beta-fructopyranose form. For growth, the assimilated fructose is sequentially phosphorylated by ATP and (i) manno(fructo)kinase, to form fructose 6-phosphate, and (ii) phosphofructokinase, to form fructose 1,6-bisphosphate, which is a member of central routes of glycolysis and gluconeogenesis. The mutation that confers on the organism the ability to take up fructose via the fucose regulon was located as a deletion of the fucA gene with consequent induction of the proton-linked fucose transporter, FucP. PMID:17159144

  2. Autonomous induction of recombinant proteins by minimally rewiring native quorum sensing regulon of E. coli.

    PubMed

    Tsao, Chen-Yu; Hooshangi, Sara; Wu, Hsuan-Chen; Valdes, James J; Bentley, William E

    2010-05-01

    Quorum sensing (QS) enables an individual bacterium's metabolic state to be communicated to and ultimately control the phenotype of an emerging population. Harnessing the hierarchical nature of this signal transduction process may enable the exploitation of individual cell characteristics to direct or "program" entire populations of cells. We re-engineered the native QS regulon so that individual cell signals (autoinducers) are used to guide high level expression of recombinant proteins in E. coli populations. Specifically, the autoinducer-2 (AI-2) QS signal initiates and guides the overexpression of green fluorescent protein (GFP), chloramphenicol acetyl transferase (CAT) and beta-galactosidase (LacZ). The new process requires no supervision or input (e.g., sampling for optical density measurement, inducer addition, or medium exchange) and represents a low-cost, high-yield platform for recombinant protein production. Moreover, rewiring a native signal transduction circuit exemplifies an emerging class of metabolic engineering approaches that target regulatory functions. PMID:20060924

  3. Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses

    SciTech Connect

    Gao, Haichun; Wang, Xiaohu; Yang, Zamin Koo; Palzkill, Timothy; Zhou, Jizhong

    2008-01-01

    The Arc two-component system is a global regulator controlling many genes involved in aerobic/anaerobic respiration and fermentative metabolism in Escherichia coli. Shewanella oneidensis MR-1 contains a gene encoding a putative ArcA homolog with {approx} 81% amino acid sequence identity to the E. coli ArcA protein but not a full-length arcB gene. To understand the role of ArcA in S. oneidensis, an arcA deletion strain was constructed and subjected to both physiological characterization and microarray analysis. Compared to the wild-type MR-1, the mutant exhibited impaired aerobic growth and a defect in utilizing DMSO in the absence of O{sub 2}. Microarray analyses on cells grown aerobically and anaerobically on fumarate revealed that expression of 1009 genes was significantly affected (p < 0.05) by the mutation. In contrast to E. coli ArcA, the protein appears to be dispensable in regulation of the TCA cycle in S. oneidensis. To further determine genes regulated by the Arc system, an ArcA recognition weight matrix from DNA-binding data and bioinformatics analysis was generated and used to produce an ArcA sequence affinity map. By combining both techniques, we identified an ArcA regulon of at least 50 operons, of which only 6 were found to be directly controlled by ArcA in E. coli. These results indicate that the Arc system in S. oneidensis differs from that in E. coli substantially in terms of its physiological function and regulon while their binding motif are strikingly similar.

  4. Regulon Controlled by the GppX Hybrid Two Component system in Porphyromonas gingivalis

    PubMed Central

    Hirano, Takanori; Beck, David A. C.; Wright, Chris J.; Demuth, Donald R.; Hackett, Murray; Lamont, Richard J.

    2012-01-01

    Summary The periodontal pathogen Porphyromonas gingivalis experiences a number of environmental conditions in the oral cavity and must monitor and respond to a variety of environmental cues. However the organism possesses only five full two-component systems, one of which is the hybrid system GppX. To investigate the regulon controlled by GppX we performed RNA-Seq on a ΔgppX mutant. Fifty three genes were up-regulated and 37 genes were down-regulated in the ΔgppX mutant. Pathway analyses revealed no systemic function for GppX under nutrient replete conditions; however, over 40% of the differentially abundant genes were annotated as encoding hypothetical proteins indicating a novel role for GppX. Abundance of small (s)RNA was, in general, not affected by the absence of GppX. To further define the role of GppX with respect to regulation of a hypothetical protein observed with the greatest significant relative abundance change relative to a wild-type control, PGN_0151, we constructed a series of strains in which a ΔgppX mutation was complemented with GppX protein containing specific domain and phosphotransfer mutations. The transmembrane domains, the DNA binding domain and the phosphotransfer residues were all required for regulation of PGN_0151. In addition, binding of GppX to the PGN_0151 promoter regions was confirmed by an electrophoretic mobility shift assay (EMSA). Both the ΔgppX mutant and a ΔPGN_0151 mutant were deficient in monospecies biofilm formation, suggesting a role for the GppX-PGN_0151 regulon in colonization and survival of the organism. PMID:23194602

  5. FITBAR: a web tool for the robust prediction of prokaryotic regulons

    PubMed Central

    2010-01-01

    Background The binding of regulatory proteins to their specific DNA targets determines the accurate expression of the neighboring genes. The in silico prediction of new binding sites in completely sequenced genomes is a key aspect in the deeper understanding of gene regulatory networks. Several algorithms have been described to discriminate against false-positives in the prediction of new binding targets; however none of them has been implemented so far to assist the detection of binding sites at the genomic scale. Results FITBAR (Fast Investigation Tool for Bacterial and Archaeal Regulons) is a web service designed to identify new protein binding sites on fully sequenced prokaryotic genomes. This tool consists in a workbench where the significance of the predictions can be compared using different statistical methods, a feature not found in existing resources. The Local Markov Model and the Compound Importance Sampling algorithms have been implemented to compute the P-value of newly discovered binding sites. In addition, FITBAR provides two optimized genomic scanning algorithms using either log-odds or entropy-weighted position-specific scoring matrices. Other significant features include the production of a detailed genomic context map for each detected binding site and the export of the search results in spreadsheet and portable document formats. FITBAR discovery of a high affinity Escherichia coli NagC binding site was validated experimentally in vitro as well as in vivo and published. Conclusions FITBAR was developed in order to allow fast, accurate and statistically robust predictions of prokaryotic regulons. This feature constitutes the main advantage of this web tool over other matrix search programs and does not impair its performance. The web service is available at http://archaea.u-psud.fr/fitbar. PMID:21070640

  6. 1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon

    SciTech Connect

    I-Teh Tong; Hans H. Liao; Cameron, D.C. )

    1991-12-01

    The dha regulon in Klebsiella pneumoniae enables the organism to grown anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydoxyacetone and was screened for the production of 1, 3-PD. The cosmid pTC1 (42.5 kn total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycersol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1, 3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering.

  7. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.

    PubMed

    Rooney, Alejandro P

    2004-09-01

    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  8. A host GPCR signaling network required for the cytolysis of infected cells facilitates release of apicomplexan parasites.

    PubMed

    Millholland, Melanie G; Mishra, Satish; Dupont, Christopher D; Love, Melissa S; Patel, Bhumit; Shilling, Dustin; Kazanietz, Marcelo G; Foskett, J Kevin; Hunter, Christopher A; Sinnis, Photini; Greenbaum, Doron C

    2013-01-16

    Following intracellular replication, the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii cause host cell cytolysis to facilitate parasite release and disease progression. Parasite exit from infected cells requires the interplay of parasite-derived proteins and host actin cytoskeletal changes; however, the host proteins underlying these changes remain obscure. We report the identification of a Gα(q)-coupled host-signaling cascade required for the egress of both P. falciparum and T. gondii. Gα(q)-coupled signaling results in protein kinase C (PKC)-mediated loss of the host cytoskeletal protein adducin and weakening of the cellular cytoskeleton. This cytoskeletal compromise induces catastrophic Ca(2+) influx mediated by the mechanosensitive cation channel TRPC6, which activates host calpain that proteolyzes the host cytoskeleton allowing parasite release. Reinforcing the feasibility of targeting host proteins as an antiparasitic strategy, mammalian PKC inhibitors demonstrated activity in murine models of malaria and toxoplasmosis. Importantly, an orally bioavailable PKC inhibitor prolonged survival in an experimental cerebral malaria model. PMID:23332153

  9. Construction and validation of a first-generation long-oligonulceotide microarray by transcriptional of the Bordetella bronchiseptica Bvg regulon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Bordetella bronchiseptica is a bacterial respiratory pathogen that infects a broad range of mammals, causing chronic and often subclinical infections. Gene expression in Bordetella is regulated by a two-component sensory transduction system, BvgAS, which controls the expression of a spec...

  10. Quantitative and qualitative stem rust resistance factors in barley are associated with transcriptional suppression of defense regulons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stem rust (Puccinia graminis f. sp. tritici; Pgt) is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99) is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known so...

  11. Divergence of the mitochondrial genome structure in the apicomplexan parasites, Babesia and Theileria.

    PubMed

    Hikosaka, Kenji; Watanabe, Yoh-Ichi; Tsuji, Naotoshi; Kita, Kiyoshi; Kishine, Hiroe; Arisue, Nobuko; Palacpac, Nirianne Marie Q; Kawazu, Shin-Ichiro; Sawai, Hiromi; Horii, Toshihiro; Igarashi, Ikuo; Tanabe, Kazuyuki

    2010-05-01

    Mitochondrial (mt) genomes from diverse phylogenetic groups vary considerably in size, structure, and organization. The genus Plasmodium, causative agent of malaria, of the phylum Apicomplexa, has the smallest mt genome in the form of a circular and/or tandemly repeated linear element of 6 kb, encoding only three protein genes (cox1, cox3, and cob). The closely related genera Babesia and Theileria also have small mt genomes (6.6 kb) that are monomeric linear with an organization distinct from Plasmodium. To elucidate the structural divergence and evolution of mt genomes between Babesia/Theileria and Plasmodium, we determined five new sequences from Babesia bigemina, B. caballi, B. gibsoni, Theileria orientalis, and T. equi. Together with previously reported sequences of B. bovis, T. annulata, and T. parva, all eight Babesia and Theileria mt genomes are linear molecules with terminal inverted repeats (TIRs) on both ends containing three protein-coding genes (cox1, cox3, and cob) and six large subunit (LSU) ribosomal RNA (rRNA) gene fragments. The organization and transcriptional direction of protein-coding genes and the rRNA gene fragments were completely conserved in the four Babesia species. In contrast, notable variation occurred in the four Theileria species. Although the genome structures of T. annulata and T. parva were nearly identical to those of Babesia, an inversion in the 3-kb central region was found in T. orientalis. Moreover, the T. equi mt genome is the largest (8.2 kb) and most divergent with unusually long TIR sequences, in which cox3 and two LSU rRNA gene fragments are located. The T. equi mt genome showed little synteny to the other species. These results suggest that the Theileria mt genome is highly diverse with lineage-specific evolution in two Theileria species: genome inversion in T. orientalis and gene-embedded long TIR in T. equi. PMID:20034997

  12. The Carbonic Anhydrase Inhibitor Ethoxzolamide Inhibits the Mycobacterium tuberculosis PhoPR Regulon and Esx-1 Secretion and Attenuates Virulence

    PubMed Central

    Johnson, Benjamin K.; Colvin, Christopher J.; Needle, David B.; Mba Medie, Felix; Champion, Patricia A. DiGiuseppe

    2015-01-01

    Mycobacterium tuberculosis must sense and adapt to host environmental cues to establish and maintain an infection. The two-component regulatory system PhoPR plays a central role in sensing and responding to acidic pH within the macrophage and is required for M. tuberculosis intracellular replication and growth in vivo. Therefore, the isolation of compounds that inhibit PhoPR-dependent adaptation may identify new antivirulence therapies to treat tuberculosis. Here, we report that the carbonic anhydrase inhibitor ethoxzolamide inhibits the PhoPR regulon and reduces pathogen virulence. We show that treatment of M. tuberculosis with ethoxzolamide recapitulates phoPR mutant phenotypes, including downregulation of the core PhoPR regulon, altered accumulation of virulence-associated lipids, and inhibition of Esx-1 protein secretion. Quantitative single-cell imaging of a PhoPR-dependent fluorescent reporter strain demonstrates that ethoxzolamide inhibits PhoPR-regulated genes in infected macrophages and mouse lungs. Moreover, ethoxzolamide reduces M. tuberculosis growth in both macrophages and infected mice. Ethoxzolamide inhibits M. tuberculosis carbonic anhydrase activity, supporting a previously unrecognized link between carbonic anhydrase activity and PhoPR signaling. We propose that ethoxzolamide may be pursued as a new class of antivirulence therapy that functions by modulating expression of the PhoPR regulon and Esx-1-dependent virulence. PMID:25987613

  13. The Carbonic Anhydrase Inhibitor Ethoxzolamide Inhibits the Mycobacterium tuberculosis PhoPR Regulon and Esx-1 Secretion and Attenuates Virulence.

    PubMed

    Johnson, Benjamin K; Colvin, Christopher J; Needle, David B; Mba Medie, Felix; Champion, Patricia A DiGiuseppe; Abramovitch, Robert B

    2015-08-01

    Mycobacterium tuberculosis must sense and adapt to host environmental cues to establish and maintain an infection. The two-component regulatory system PhoPR plays a central role in sensing and responding to acidic pH within the macrophage and is required for M. tuberculosis intracellular replication and growth in vivo. Therefore, the isolation of compounds that inhibit PhoPR-dependent adaptation may identify new antivirulence therapies to treat tuberculosis. Here, we report that the carbonic anhydrase inhibitor ethoxzolamide inhibits the PhoPR regulon and reduces pathogen virulence. We show that treatment of M. tuberculosis with ethoxzolamide recapitulates phoPR mutant phenotypes, including downregulation of the core PhoPR regulon, altered accumulation of virulence-associated lipids, and inhibition of Esx-1 protein secretion. Quantitative single-cell imaging of a PhoPR-dependent fluorescent reporter strain demonstrates that ethoxzolamide inhibits PhoPR-regulated genes in infected macrophages and mouse lungs. Moreover, ethoxzolamide reduces M. tuberculosis growth in both macrophages and infected mice. Ethoxzolamide inhibits M. tuberculosis carbonic anhydrase activity, supporting a previously unrecognized link between carbonic anhydrase activity and PhoPR signaling. We propose that ethoxzolamide may be pursued as a new class of antivirulence therapy that functions by modulating expression of the PhoPR regulon and Esx-1-dependent virulence. PMID:25987613

  14. Dissecting the interface between apicomplexan parasite and host cell: Insights from a divergent AMA-RON2 pair.

    PubMed

    Parker, Michelle L; Penarete-Vargas, Diana M; Hamilton, Phineas T; Guérin, Amandine; Dubey, Jitender P; Perlman, Steve J; Spano, Furio; Lebrun, Maryse; Boulanger, Martin J

    2016-01-12

    Plasmodium falciparum and Toxoplasma gondii are widely studied parasites in phylum Apicomplexa and the etiological agents of severe human malaria and toxoplasmosis, respectively. These intracellular pathogens have evolved a sophisticated invasion strategy that relies on delivery of proteins into the host cell, where parasite-derived rhoptry neck protein 2 (RON2) family members localize to the host outer membrane and serve as ligands for apical membrane antigen (AMA) family surface proteins displayed on the parasite. Recently, we showed that T. gondii harbors a novel AMA designated as TgAMA4 that shows extreme sequence divergence from all characterized AMA family members. Here we show that sporozoite-expressed TgAMA4 clusters in a distinct phylogenetic clade with Plasmodium merozoite apical erythrocyte-binding ligand (MAEBL) proteins and forms a high-affinity, functional complex with its coevolved partner, TgRON2L1. High-resolution crystal structures of TgAMA4 in the apo and TgRON2L1-bound forms complemented with alanine scanning mutagenesis data reveal an unexpected architecture and assembly mechanism relative to previously characterized AMA-RON2 complexes. Principally, TgAMA4 lacks both a deep surface groove and a key surface loop that have been established to govern RON2 ligand binding selectivity in other AMAs. Our study reveals a previously underappreciated level of molecular diversity at the parasite-host-cell interface and offers intriguing insight into the adaptation strategies underlying sporozoite invasion. Moreover, our data offer the potential for improved design of neutralizing therapeutics targeting a broad range of AMA-RON2 pairs and apicomplexan invasive stages. PMID:26712012

  15. Molecular systematics of marine gregarine apicomplexans from Pacific tunicates, with descriptions of five novel species of Lankesteria.

    PubMed

    Rueckert, Sonja; Wakeman, Kevin C; Jenke-Kodama, Holger; Leander, Brian S

    2015-08-01

    The eugregarines are a group of apicomplexan parasites that mostly infect the intestines of invertebrates. The high level of morphological variation found within and among species of eugregarines makes it difficult to find consistent and reliable traits that unite even closely related lineages. Based mostly on traits observed with light microscopy, the majority of described eugregarines from marine invertebrates has been classified into a single group, the Lecudinidae. Our understanding of the overall diversity and phylogenetic relationships of lecudinids is very poor, mainly because only a modest amount of exploratory research has been done on the group and very few species of lecudinids have been characterized at the molecular phylogenetic level. In an attempt to understand the diversity of marine gregarines better, we surveyed lecudinids that infect the intestines of Pacific ascidians (i.e. sea squirts) using ultrastructural and molecular phylogenetic approaches; currently, these species fall within one genus, Lankesteria. We collected lecudinid gregarines from six ascidian host species, and our data demonstrated that each host was infected by a different species of Lankesteria: (i) Lankesteria hesperidiiformis sp. nov., isolated from Distaplia occidentalis, (ii) Lankesteria metandrocarpae sp. nov., isolated from Metandrocarpa taylori, (iii) Lankesteria halocynthiae sp. nov., isolated from Halocynthia aurantium, (iv) Lankesteria herdmaniae sp. nov., isolated from Herdmania momus, (v) Lankesteria cf. ritterellae, isolated from Ritterella rubra, and (vi) Lankesteria didemni sp. nov., isolated from Didemnum vexillum. Visualization of the trophozoites with scanning electron microscopy showed that four of these species were covered with epicytic folds, whereas two of the species were covered with a dense pattern of epicytic knobs. The molecular phylogenetic data suggested that species of Lankesteria with surface knobs form a clade that is nested within a paraphyletic

  16. The conserved apicomplexan Aurora kinase TgArk3 is involved in endodyogeny, duplication rate and parasite virulence.

    PubMed

    Berry, Laurence; Chen, Chun-Ti; Reininger, Luc; Carvalho, Teresa G; El Hajj, Hiba; Morlon-Guyot, Juliette; Bordat, Yann; Lebrun, Maryse; Gubbels, Marc-Jan; Doerig, Christian; Daher, Wassim

    2016-08-01

    Aurora kinases are eukaryotic serine/threonine protein kinases that regulate key events associated with chromatin condensation, centrosome and spindle function and cytokinesis. Elucidating the roles of Aurora kinases in apicomplexan parasites is crucial to understand the cell cycle control during Plasmodium schizogony or Toxoplasma endodyogeny. Here, we report on the localization of two previously uncharacterized Toxoplasma Aurora-related kinases (Ark2 and Ark3) in tachyzoites and of the uncharacterized Ark3 orthologue in Plasmodium falciparum erythrocytic stages. In Toxoplasma gondii, we show that TgArk2 and TgArk3 concentrate at specific sub-cellular structures linked to parasite division: the mitotic spindle and intranuclear mitotic structures (TgArk2), and the outer core of the centrosome and the budding daughter cells cytoskeleton (TgArk3). By tagging the endogenous PfArk3 gene with the green fluorescent protein in live parasites, we show that PfArk3 protein expression peaks late in schizogony and localizes at the periphery of budding schizonts. Disruption of the TgArk2 gene reveals no essential function for tachyzoite propagation in vitro, which is surprising giving that the P. falciparum and P. berghei orthologues are essential for erythrocyte schizogony. In contrast, knock-down of TgArk3 protein results in pronounced defects in parasite division and a major growth deficiency. TgArk3-depleted parasites display several defects, such as reduced parasite growth rate, delayed egress and parasite duplication, defect in rosette formation, reduced parasite size and invasion efficiency and lack of virulence in mice. Our study provides new insights into cell cycle control in Toxoplasma and malaria parasites and highlights Aurora kinase 3 as potential drug target. PMID:26833682

  17. Xylan utilization regulon in Xanthomonas citri pv. citri Strain 306: gene expression and utilization of oligoxylosides.

    PubMed

    Chow, V; Shantharaj, D; Guo, Y; Nong, G; Minsavage, G V; Jones, J B; Preston, J F

    2015-03-01

    Xanthomonas citri pv. citri strain 306 (Xcc306), a causative agent of citrus canker, produces endoxylanases that catalyze the depolymerization of cell wall-associated xylans. In the sequenced genomes of all plant-pathogenic xanthomonads, genes encoding xylanolytic enzymes are clustered in three adjacent operons. In Xcc306, these consecutive operons contain genes encoding the glycoside hydrolase family 10 (GH10) endoxylanases Xyn10A and Xyn10C, the agu67 gene, encoding a GH67 α-glucuronidase (Agu67), the xyn43E gene, encoding a putative GH43 α-l-arabinofuranosidase, and the xyn43F gene, encoding a putative β-xylosidase. Recombinant Xyn10A and Xyn10C convert polymeric 4-O-methylglucuronoxylan (MeGXn) to oligoxylosides methylglucuronoxylotriose (MeGX3), xylotriose (X3), and xylobiose (X2). Xcc306 completely utilizes MeGXn predigested with Xyn10A or Xyn10C but shows little utilization of MeGXn. Xcc306 with a deletion in the gene encoding α-glucuronidase (Xcc306 Δagu67) will not utilize MeGX3 for growth, demonstrating the role of Agu67 in the complete utilization of GH10-digested MeGXn. Preferential growth on oligoxylosides compared to growth on polymeric MeGXn indicates that GH10 xylanases, either secreted by Xcc306 in planta or produced by the plant host, generate oligoxylosides that are processed by Xyn10 xylanases and Agu67 residing in the periplasm. Coordinate induction by oligoxylosides of xyn10, agu67, cirA, the tonB receptor, and other genes within these three operons indicates that they constitute a regulon that is responsive to the oligoxylosides generated by the action of Xcc306 GH10 xylanases on MeGXn. The combined expression of genes in this regulon may allow scavenging of oligoxylosides derived from cell wall deconstruction, thereby contributing to the tissue colonization and/or survival of Xcc306 and, ultimately, to plant disease. PMID:25595763

  18. Combined Amplicon Pyrosequencing Assays Reveal Presence of the Apicomplexan “type-N” (cf. Gemmocystis cylindrus) and Chromera velia on the Great Barrier Reef, Australia

    PubMed Central

    Šlapeta, Jan; Linares, Marjorie C.

    2013-01-01

    Background The coral is predominantly composed of the metabolically dependent coral host and the photosynthetic dinoflagellate Symbiodinium sp. The system as a whole interacts with symbiotic eukaryotes, bacteria and viruses. Gemmocystiscylindrus (cf. “type-N” symbiont) belonging to the obligatory parasitic phylum Apicomplexa (Alveolata) is ubiquitous in the Caribbean coral, but its presence in the Great Barrier Reef coral has yet to be documented. Approaches allowing identification of the healthy community from the pathogenic or saprobic organisms are needed for sustainable coral reef monitoring. Methods & Principal Findings We investigated the diversity of eukaryotes associated with a common reef-building corals from the southern Great Barrier Reef. We used three tag encoded 454 amplicon pyrosequencing assays targeting eukaryote small-subunit rRNA gene to demonstrate the presence of the apicomplexan type-N and a photosynthetic sister species to Apicomplexa - Chromeravelia. Amplicon pyrosequencing revealed presence of the small-subunit rRNA genes of known eukaryotic pathogens (Cryptosporidium and Cryptococcus). We therefore conducted bacterial tag encoded amplicon pyrosequencing assay for small-subunit rRNA gene to support effluent exposure of the coral. Bacteria of faecal origin (Enterobacteriales) formed 41% of total sequences in contrast to 0-2% of the coral-associated bacterial communities with and without C. velia, respectively. Significance This is the first time apicomplexan type-N has been detected in the Great Barrier Reef. Eukaryote tag encoded amplicon pyrosequencing assays demonstrate presence of apicomplexan type-N and C. Velia in total coral DNA. The data highlight the need for combined approaches for eukaryotic diversity studies coupled with bacterial community assessment to achieve a more realistic goals of defining the holobiont community and assessing coral disease. With increasing evidence of Apicomplexa in coral reef environments, it is

  19. Identification, Functional Characterization and Regulon Prediction of a Novel Two Component System Comprising BAS0540-BAS0541 of Bacillus anthracis

    PubMed Central

    Gopalani, Monisha; Kandari, Divya; Bhatnagar, Rakesh

    2016-01-01

    Two component systems (TCSs) can be envisaged as complex molecular devices that help the bacteria to sense its environment and respond aptly. 41 TCSs are predicted in Bacillus anthracis, a potential bioterrorism agent, of which only four have been studied so far. Thus, the intricate signaling network contributed by TCSs remains largely unmapped in B. anthracis and needs comprehensive exploration. In this study, we functionally characterized one such system composed of BAS0540 (Response regulator) and BAS0541 (Histidine kinase). BAS0540-BAS0541, the closest homolog of CiaRH of Streptococcus in B. anthracis, forms a functional TCS with BAS0541 displaying autophosphorylation and subsequent phosphotransfer to BAS0540. BAS0540 was also found to accept phosphate from physiologically relevant small molecule phosphodonors like acetyl phosphate and carbamoyl phosphate. Results of qRT-PCR and immunoblotting demonstrated that BAS0540 exhibits a constitutive expression throughout the growth of B. anthracis. Regulon prediction for BAS0540 in B. anthracis was done in silico using the consensus DNA binding sequence of CiaR of Streptococcus. The predicted regulon of BAS0540 comprised of 23 genes, which could be classified into 8 functionally diverse categories. None of the proven virulence factors were a part of the predicted regulon, an observation contrasting with the regulon of CiaRH in Streptococci. Electrophoretic mobility shift assay was used to show direct binding of purified BAS0540 to the upstream regions of 5 putative regulon candidates- BAS0540 gene itself; a gene predicted to encode cell division protein FtsA; a self–immunity gene; a RND family transporter gene and a gene encoding stress (heat) responsive protein. A significant enhancement in the DNA binding ability of BAS0540 was observed upon phosphorylation. Overexpression of response regulator BAS0540 in B. anthracis led to a prodigious increase of ~6 folds in the cell length, thereby conferring it a filamentous

  20. Identification, Functional Characterization and Regulon Prediction of a Novel Two Component System Comprising BAS0540-BAS0541 of Bacillus anthracis.

    PubMed

    Gopalani, Monisha; Dhiman, Alisha; Rahi, Amit; Kandari, Divya; Bhatnagar, Rakesh

    2016-01-01

    Two component systems (TCSs) can be envisaged as complex molecular devices that help the bacteria to sense its environment and respond aptly. 41 TCSs are predicted in Bacillus anthracis, a potential bioterrorism agent, of which only four have been studied so far. Thus, the intricate signaling network contributed by TCSs remains largely unmapped in B. anthracis and needs comprehensive exploration. In this study, we functionally characterized one such system composed of BAS0540 (Response regulator) and BAS0541 (Histidine kinase). BAS0540-BAS0541, the closest homolog of CiaRH of Streptococcus in B. anthracis, forms a functional TCS with BAS0541 displaying autophosphorylation and subsequent phosphotransfer to BAS0540. BAS0540 was also found to accept phosphate from physiologically relevant small molecule phosphodonors like acetyl phosphate and carbamoyl phosphate. Results of qRT-PCR and immunoblotting demonstrated that BAS0540 exhibits a constitutive expression throughout the growth of B. anthracis. Regulon prediction for BAS0540 in B. anthracis was done in silico using the consensus DNA binding sequence of CiaR of Streptococcus. The predicted regulon of BAS0540 comprised of 23 genes, which could be classified into 8 functionally diverse categories. None of the proven virulence factors were a part of the predicted regulon, an observation contrasting with the regulon of CiaRH in Streptococci. Electrophoretic mobility shift assay was used to show direct binding of purified BAS0540 to the upstream regions of 5 putative regulon candidates- BAS0540 gene itself; a gene predicted to encode cell division protein FtsA; a self-immunity gene; a RND family transporter gene and a gene encoding stress (heat) responsive protein. A significant enhancement in the DNA binding ability of BAS0540 was observed upon phosphorylation. Overexpression of response regulator BAS0540 in B. anthracis led to a prodigious increase of ~6 folds in the cell length, thereby conferring it a filamentous

  1. Model of transcriptional activation by MarA in escherichia coli

    SciTech Connect

    Wall, Michael E; Rosner, Judah L; Martin, Robert G

    2009-01-01

    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

  2. Binding motifs in bacterial gene promoters modulate transcriptional effects of global regulators CRP and ArcA

    SciTech Connect

    Leuze, Mike; Karpinets, Tatiana V.; Syed, Mustafa H.; Beliaev, Alex S.; Uberbacher, Edward

    2012-05-30

    Bacterial gene regulation involves transcription factors (TF) that bind to DNA recognition sequences in operon promoters. These recognition sequences, many of which are palindromic, are known as regulatory elements or transcription factor binding sites (TFBS). Some TFs are global regulators that can modulate the expression of hundreds of genes. In this study we examine global regulator half-sites, where a half-site, which we shall call a binding motif (BM), is one half of a palindromic TFBS. We explore the hypothesis that the number of BMs plays an important role in transcriptional regulation, examining empirical data from transcriptional profiling of the CRP and ArcA regulons. We compare the power of BM counts and of full TFBS characteristics to predict induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full TFBS quality or location.

  3. Genome-Wide Analysis of Cell Type-Specific Gene Transcription during Spore Formation in Clostridium difficile

    PubMed Central

    Saujet, Laure; Soutourina, Olga; Monot, Marc; Shelyakin, Pavel V.; Gelfand, Mikhail S.; Dupuy, Bruno; Henriques, Adriano O.; Martin-Verstraete, Isabelle

    2013-01-01

    Clostridium difficile, a Gram positive, anaerobic, spore-forming bacterium is an emergent pathogen and the most common cause of nosocomial diarrhea. Although transmission of C. difficile is mediated by contamination of the gut by spores, the regulatory cascade controlling spore formation remains poorly characterized. During Bacillus subtilis sporulation, a cascade of four sigma factors, σF and σG in the forespore and σE and σK in the mother cell governs compartment-specific gene expression. In this work, we combined genome wide transcriptional analyses and promoter mapping to define the C. difficile σF, σE, σG and σK regulons. We identified about 225 genes under the control of these sigma factors: 25 in the σF regulon, 97 σE-dependent genes, 50 σG-governed genes and 56 genes under σK control. A significant fraction of genes in each regulon is of unknown function but new candidates for spore coat proteins could be proposed as being synthesized under σE or σK control and detected in a previously published spore proteome. SpoIIID of C. difficile also plays a pivotal role in the mother cell line of expression repressing the transcription of many members of the σE regulon and activating sigK expression. Global analysis of developmental gene expression under the control of these sigma factors revealed deviations from the B. subtilis model regarding the communication between mother cell and forespore in C. difficile. We showed that the expression of the σE regulon in the mother cell was not strictly under the control of σF despite the fact that the forespore product SpoIIR was required for the processing of pro-σE. In addition, the σK regulon was not controlled by σG in C. difficile in agreement with the lack of pro-σK processing. This work is one key step to obtain new insights about the diversity and evolution of the sporulation process among Firmicutes. PMID:24098137

  4. Genome-wide analysis of cell type-specific gene transcription during spore formation in Clostridium difficile.

    PubMed

    Saujet, Laure; Pereira, Fátima C; Serrano, Monica; Soutourina, Olga; Monot, Marc; Shelyakin, Pavel V; Gelfand, Mikhail S; Dupuy, Bruno; Henriques, Adriano O; Martin-Verstraete, Isabelle

    2013-01-01

    Clostridium difficile, a Gram positive, anaerobic, spore-forming bacterium is an emergent pathogen and the most common cause of nosocomial diarrhea. Although transmission of C. difficile is mediated by contamination of the gut by spores, the regulatory cascade controlling spore formation remains poorly characterized. During Bacillus subtilis sporulation, a cascade of four sigma factors, σ(F) and σ(G) in the forespore and σ(E) and σ(K) in the mother cell governs compartment-specific gene expression. In this work, we combined genome wide transcriptional analyses and promoter mapping to define the C. difficile σ(F), σ(E), σ(G) and σ(K) regulons. We identified about 225 genes under the control of these sigma factors: 25 in the σ(F) regulon, 97 σ(E)-dependent genes, 50 σ(G)-governed genes and 56 genes under σ(K) control. A significant fraction of genes in each regulon is of unknown function but new candidates for spore coat proteins could be proposed as being synthesized under σ(E) or σ(K) control and detected in a previously published spore proteome. SpoIIID of C. difficile also plays a pivotal role in the mother cell line of expression repressing the transcription of many members of the σ(E) regulon and activating sigK expression. Global analysis of developmental gene expression under the control of these sigma factors revealed deviations from the B. subtilis model regarding the communication between mother cell and forespore in C. difficile. We showed that the expression of the σ(E) regulon in the mother cell was not strictly under the control of σ(F) despite the fact that the forespore product SpoIIR was required for the processing of pro-σ(E). In addition, the σ(K) regulon was not controlled by σ(G) in C. difficile in agreement with the lack of pro-σ(K) processing. This work is one key step to obtain new insights about the diversity and evolution of the sporulation process among Firmicutes. PMID:24098137

  5. Comparative genomics of CytR, an unusual member of the LacI family of transcription factors.

    PubMed

    Sernova, Natalia V; Gelfand, Mikhail S

    2012-01-01

    CytR is a transcription regulator from the LacI family, present in some gamma-proteobacteria including Escherichia coli and known not only for its cellular role, control of transport and utilization of nucleosides, but for a number of unusual structural properties. The present study addressed three related problems: structure of CytR-binding sites and motifs, their evolutionary conservation, and identification of new members of the CytR regulon. While the majority of CytR-binding sites are imperfect inverted repeats situated between binding sites for another transcription factor, CRP, other architectures were observed, in particular, direct repeats. While the similarity between sites for different genes in one genome is rather low, and hence the consensus motif is weak, there is high conservation of orthologous sites in different genomes (mainly in the Enterobacteriales) arguing for the presence of specific CytR-DNA contacts. On larger evolutionary distances candidate CytR sites may migrate but the approximate distance between flanking CRP sites tends to be conserved, which demonstrates that the overall structure of the CRP-CytR-DNA complex is gene-specific. The analysis yielded candidate CytR-binding sites for orthologs of known regulon members in less studied genomes of the Enterobacteriales and Vibrionales and identified a new candidate member of the CytR regulon, encoding a transporter named NupT (YcdZ). PMID:23028500

  6. Comparative Genomics of CytR, an Unusual Member of the LacI Family of Transcription Factors

    PubMed Central

    Sernova, Natalia V.; Gelfand, Mikhail S.

    2012-01-01

    CytR is a transcription regulator from the LacI family, present in some gamma-proteobacteria including Escherichia coli and known not only for its cellular role, control of transport and utilization of nucleosides, but for a number of unusual structural properties. The present study addressed three related problems: structure of CytR-binding sites and motifs, their evolutionary conservation, and identification of new members of the CytR regulon. While the majority of CytR-binding sites are imperfect inverted repeats situated between binding sites for another transcription factor, CRP, other architectures were observed, in particular, direct repeats. While the similarity between sites for different genes in one genome is rather low, and hence the consensus motif is weak, there is high conservation of orthologous sites in different genomes (mainly in the Enterobacteriales) arguing for the presence of specific CytR-DNA contacts. On larger evolutionary distances candidate CytR sites may migrate but the approximate distance between flanking CRP sites tends to be conserved, which demonstrates that the overall structure of the CRP-CytR-DNA complex is gene-specific. The analysis yielded candidate CytR-binding sites for orthologs of known regulon members in less studied genomes of the Enterobacteriales and Vibrionales and identified a new candidate member of the CytR regulon, encoding a transporter named NupT (YcdZ). PMID:23028500

  7. The RNA-binding protein SFPQ orchestrates an RNA regulon to promote axon viability.

    PubMed

    Cosker, Katharina E; Fenstermacher, Sara J; Pazyra-Murphy, Maria F; Elliott, Hunter L; Segal, Rosalind A

    2016-05-01

    To achieve accurate spatiotemporal patterns of gene expression, RNA-binding proteins (RBPs) guide nuclear processing, intracellular trafficking and local translation of target mRNAs. In neurons, RBPs direct transport of target mRNAs to sites of translation in remote axons and dendrites. However, it is not known whether an individual RBP coordinately regulates multiple mRNAs within these morphologically complex cells. Here we identify SFPQ (splicing factor, poly-glutamine rich) as an RBP that binds and regulates multiple mRNAs in dorsal root ganglion sensory neurons and thereby promotes neurotrophin-dependent axonal viability. SFPQ acts in nuclei, cytoplasm and axons to regulate functionally related mRNAs essential for axon survival. Notably, SFPQ is required for coassembly of LaminB2 (Lmnb2) and Bclw (Bcl2l2) mRNAs in RNA granules and for axonal trafficking of these mRNAs. Together these data demonstrate that SFPQ orchestrates spatial gene expression of a newly identified RNA regulon essential for axonal viability. PMID:27019013

  8. The roles of peroxide protective regulons in protecting Xanthomonas campestris pv. campestris from sodium hypochlorite stress.

    PubMed

    Charoenlap, Nisanart; Sornchuer, Phornphan; Piwkam, Anong; Srijaruskul, Kriangsuk; Mongkolsuk, Skorn; Vattanaviboon, Paiboon

    2015-05-01

    The exposure of Xanthomonas campestris pv. campestris to sublethal concentrations of a sodium hypochlorite (NaOCl) solution induced the expression of genes that encode peroxide scavenging enzymes within the OxyR and OhrR regulons. Sensitivity testing in various X. campestris mutants indicated that oxyR, katA, katG, ahpC, and ohr contributed to protection against NaOCl killing. The pretreatment of X. campestris cultures with oxidants, such as hydrogen peroxide (H2O2), t-butyl hydroperoxide, and the superoxide generator menadione, protected the bacteria from lethal concentrations of NaOCl in an OxyR-dependent manner. Treating the bacteria with a low concentration of NaOCl resulted in the adaptive protection from NaOCl killing and also provided cross-protection from H2O2 killing. Taken together, the results suggest that the toxicity of NaOCl is partially mediated by the generation of peroxides and other reactive oxygen species that are removed by primary peroxide scavenging enzymes, such as catalases and AhpC, as a part of an overall strategy that protects the bacteria from the lethal effects of NaOCl. PMID:25825971

  9. Variation in the group B Streptococcus CsrRS regulon and effects on pathogenicity.

    PubMed

    Jiang, Sheng-Mei; Ishmael, Nadeeza; Dunning Hotopp, Julie; Puliti, Manuela; Tissi, Luciana; Kumar, Nikhil; Cieslewicz, Michael J; Tettelin, Hervé; Wessels, Michael R

    2008-03-01

    CsrRS (or CovRS) is a two-component regulatory system that controls expression of multiple virulence factors in the important human pathogen group B Streptococcus (GBS). We now report global gene expression studies in GBS strains 2603V/R and 515 and their isogenic csrR and csrS mutants. Together with data reported previously for strain NEM316, the results reveal a conserved 39-gene CsrRS regulon. In vitro phosphorylation-dependent binding of recombinant CsrR to promoter regions of both positively and negatively regulated genes suggests that direct binding of CsrR can mediate activation as well as repression of target gene expression. Distinct patterns of gene regulation in csrR versus csrS mutants in strain 2603V/R compared to 515 were associated with different hierarchies of relative virulence of wild-type, csrR, and csrS mutants in murine models of systemic infection and septic arthritis. We conclude that CsrRS regulates a core group of genes including important virulence factors in diverse strains of GBS but also displays marked variability in the repertoire of regulated genes and in the relative effects of CsrS signaling on CsrR-mediated gene regulation. Such variation is likely to play an important role in strain-specific adaptation of GBS to particular host environments and pathogenic potential in susceptible hosts. PMID:18203834

  10. Variation in the Group B Streptococcus CsrRS Regulon and Effects on Pathogenicity▿ †

    PubMed Central

    Jiang, Sheng-Mei; Ishmael, Nadeeza; Hotopp, Julie Dunning; Puliti, Manuela; Tissi, Luciana; Kumar, Nikhil; Cieslewicz, Michael J.; Tettelin, Hervé; Wessels, Michael R.

    2008-01-01

    CsrRS (or CovRS) is a two-component regulatory system that controls expression of multiple virulence factors in the important human pathogen group B Streptococcus (GBS). We now report global gene expression studies in GBS strains 2603V/R and 515 and their isogenic csrR and csrS mutants. Together with data reported previously for strain NEM316, the results reveal a conserved 39-gene CsrRS regulon. In vitro phosphorylation-dependent binding of recombinant CsrR to promoter regions of both positively and negatively regulated genes suggests that direct binding of CsrR can mediate activation as well as repression of target gene expression. Distinct patterns of gene regulation in csrR versus csrS mutants in strain 2603V/R compared to 515 were associated with different hierarchies of relative virulence of wild-type, csrR, and csrS mutants in murine models of systemic infection and septic arthritis. We conclude that CsrRS regulates a core group of genes including important virulence factors in diverse strains of GBS but also displays marked variability in the repertoire of regulated genes and in the relative effects of CsrS signaling on CsrR-mediated gene regulation. Such variation is likely to play an important role in strain-specific adaptation of GBS to particular host environments and pathogenic potential in susceptible hosts. PMID:18203834

  11. Characterization of the SigD Regulon of C. difficile and Its Positive Control of Toxin Production through the Regulation of tcdR

    PubMed Central

    El Meouche, Imane; Peltier, Johann; Monot, Marc; Soutourina, Olga; Pestel-Caron, Martine; Dupuy, Bruno; Pons, Jean-Louis

    2013-01-01

    Clostridium difficile intestinal disease is mediated largely by the actions of toxins A (TcdA) and B (TcdB), whose production occurs after the initial steps of colonization involving different surface or flagellar proteins. In B. subtilis, the sigma factor SigD controls flagellar synthesis, motility, and vegetative autolysins. A homolog of SigD encoding gene is present in the C.difficile 630 genome. We constructed a sigD mutant in C. difficile 630 ∆erm to analyze the regulon of SigD using a global transcriptomic approach. A total of 103 genes were differentially expressed between the wild-type and the sigD mutant, including genes involved in motility, metabolism and regulation. In addition, the sigD mutant displayed decreased expression of genes involved in flagellar biosynthesis, and also of genes encoding TcdA and TcdB as well as TcdR, the positive regulator of the toxins. Genomic analysis and RACE-PCR experiments allowed us to characterize promoter sequences of direct target genes of SigD including tcdR and to identify the SigD consensus. We then established that SigD positively regulates toxin expression via direct control of tcdR transcription. Interestingly, the overexpression of FlgM, a putative anti-SigD factor, inhibited the positive regulation of motility and toxin synthesis by SigD. Thus, SigD appears to be the first positive regulator of the toxin synthesis in C. difficile. PMID:24358307

  12. Characterization of DNA Binding Sites of RokB, a ROK-Family Regulator from Streptomyces coelicolor Reveals the RokB Regulon

    PubMed Central

    Bekiesch, Paulina; Forchhammer, Karl; Apel, Alexander Kristian

    2016-01-01

    ROK-family proteins have been described to act either as sugar kinases or as transcriptional regulators. Few ROK-family regulators have been characterized so far and most of them are involved in carbon catabolite repression. RokB (Sco6115) has originally been identified in a DNA-affinity capturing approach as a possible regulator of the heterologously expressed novobiocin biosynthetic gene cluster in Streptomyces coelicolor M512. Interestingly, both, the rokB deletion mutants as well as its overexpressing mutants showed significantly reduced novobiocin production in the host strain S.coelicolor M512. We identified the DNA-binding site for RokB in the promoter region of the novobiocin biosynthetic genes novH-novW. It overlaps with the novH start codon which may explain the reduction of novobiocin production caused by overexpression of rokB. Bioinformatic screening coupled with surface plasmon resonance based interaction studies resulted in the discovery of five RokB binding sites within the genome of S. coelicolor. Using the genomic binding sites, a consensus motif for RokB was calculated, which differs slightly from previously determined binding motifs for ROK-family regulators. The annotations of the possible members of the so defined RokB regulon gave hints that RokB might be involved in amino acid metabolism and transport. This hypothesis was supported by feeding experiments with casamino acids and L-tyrosine, which could also explain the reduced novobiocin production in the deletion mutants. PMID:27145180

  13. Characterization of the SigD regulon of C. difficile and its positive control of toxin production through the regulation of tcdR.

    PubMed

    El Meouche, Imane; Peltier, Johann; Monot, Marc; Soutourina, Olga; Pestel-Caron, Martine; Dupuy, Bruno; Pons, Jean-Louis

    2013-01-01

    Clostridium difficile intestinal disease is mediated largely by the actions of toxins A (TcdA) and B (TcdB), whose production occurs after the initial steps of colonization involving different surface or flagellar proteins. In B. subtilis, the sigma factor SigD controls flagellar synthesis, motility, and vegetative autolysins. A homolog of SigD encoding gene is present in the C.difficile 630 genome. We constructed a sigD mutant in C. difficile 630 ∆erm to analyze the regulon of SigD using a global transcriptomic approach. A total of 103 genes were differentially expressed between the wild-type and the sigD mutant, including genes involved in motility, metabolism and regulation. In addition, the sigD mutant displayed decreased expression of genes involved in flagellar biosynthesis, and also of genes encoding TcdA and TcdB as well as TcdR, the positive regulator of the toxins. Genomic analysis and RACE-PCR experiments allowed us to characterize promoter sequences of direct target genes of SigD including tcdR and to identify the SigD consensus. We then established that SigD positively regulates toxin expression via direct control of tcdR transcription. Interestingly, the overexpression of FlgM, a putative anti-SigD factor, inhibited the positive regulation of motility and toxin synthesis by SigD. Thus, SigD appears to be the first positive regulator of the toxin synthesis in C. difficile. PMID:24358307

  14. Environmental conditions and transcriptional regulation in Escherichia coli: a physiological integrative approach.

    PubMed

    Martínez-Antonio, Agustino; Salgado, Heladia; Gama-Castro, Socorro; Gutiérrez-Ríos, Rosa María; Jiménez-Jacinto, Verónica; Collado-Vides, Julio

    2003-12-30

    Bacteria develop a number of devices for sensing, responding, and adapting to different environmental conditions. Understanding within a genomic perspective how the transcriptional machinery of bacteria is modulated, as a response for changing conditions, is a major challenge for biologists. Knowledge of which genes are turned on or turned off under specific conditions is essential for our understanding of cell behavior. In this study we describe how the information pertaining to gene expression and associated growth conditions (even with very little knowledge of the associated regulatory mechanisms) is gathered from the literature and incorporated into RegulonDB, a database on transcriptional regulation and operon organization in E. coli. The link between growth conditions, signal transduction, and transcriptional regulation is modeled in the database in a simple format that highlights biological relevant information. As far as we know, there is no other database that explicitly clarifies the effect of environmental conditions on gene transcription. We discuss how this knowledge constitutes a benchmark that will impact future research aimed at integration of regulatory responses in the cell; for instance, analysis of microarrays, predicting culture behavior in biotechnological processes, and comprehension of dynamics of regulatory networks. This integrated knowledge will contribute to the future goal of modeling the behavior of E. coli as an entire cell. The RegulonDB database can be accessed on the web at the URL: http://www.cifn.unam.mx/Computational_Biology/regulondb/. PMID:14708114

  15. Identification of a Salmonella ancillary copper detoxification mechanism by a comparative analysis of the genome-wide transcriptional response to copper and zinc excess.

    PubMed

    Pontel, Lucas B; Scampoli, Nadia L; Porwollik, Steffen; Checa, Susana K; McClelland, Michael; Soncini, Fernando C

    2014-08-01

    Copper and zinc are essential metal ions, but toxic in excess. Bacteria have evolved different strategies to control their intracellular concentrations, ensuring proper supply while avoiding toxicity, including the induction of metal-specific as well as non-specific mechanisms. We compared the transcriptional profiles of Salmonella Typhimurium after exposure to either copper or zinc ions in both rich and minimal media. Besides metal-specific regulatory networks many global stress-response pathways react to an excess of either of these metal ions. Copper excess affects both zinc and iron homeostasis by inducing transcription of these metal-specific regulons. In addition to the control of zinc-specific regulons, zinc excess affects the Cpx regulon and the σ(E) envelope-stress responses. Finally, novel metal-specific upregulated genes were detected including a new copper-detoxification pathway that involves the siderophore enterobactin and the outer-membrane protein TolC. This work sheds light onto the transcriptional landscape of Salmonella after copper or zinc overload, and discloses a new mechanism of copper detoxification. PMID:24858080

  16. Multivariate PLS Modeling of Apicomplexan FabD-Ligand Interaction Space for Mapping Target-Specific Chemical Space and Pharmacophore Fingerprints

    PubMed Central

    Surolia, Avadhesha

    2015-01-01

    Biomolecular recognition underlying drug-target interactions is determined by both binding affinity and specificity. Whilst, quantification of binding efficacy is possible, determining specificity remains a challenge, as it requires affinity data for multiple targets with the same ligand dataset. Thus, understanding the interaction space by mapping the target space to model its complementary chemical space through computational techniques are desirable. In this study, active site architecture of FabD drug target in two apicomplexan parasites viz. Plasmodium falciparum (PfFabD) and Toxoplasma gondii (TgFabD) is explored, followed by consensus docking calculations and identification of fifteen best hit compounds, most of which are found to be derivatives of natural products. Subsequently, machine learning techniques were applied on molecular descriptors of six FabD homologs and sixty ligands to induce distinct multivariate partial-least square models. The biological space of FabD mapped by the various chemical entities explain their interaction space in general. It also highlights the selective variations in FabD of apicomplexan parasites with that of the host. Furthermore, chemometric models revealed the principal chemical scaffolds in PfFabD and TgFabD as pyrrolidines and imidazoles, respectively, which render target specificity and improve binding affinity in combination with other functional descriptors conducive for the design and optimization of the leads. PMID:26535573

  17. Sputum is a surrogate for bronchoalveolar lavage for monitoring Mycobacterium tuberculosis transcriptional profiles in TB patients.

    PubMed

    Garcia, Benjamin J; Loxton, Andre G; Dolganov, Gregory M; Van, Tran T; Davis, J Lucian; de Jong, Bouke C; Voskuil, Martin I; Leach, Sonia M; Schoolnik, Gary K; Walzl, Gerhard; Strong, Michael; Walter, Nicholas D

    2016-09-01

    Pathogen-targeted transcriptional profiling in human sputum may elucidate the physiologic state of Mycobacterium tuberculosis (M. tuberculosis) during infection and treatment. However, whether M. tuberculosis transcription in sputum recapitulates transcription in the lung is uncertain. We therefore compared M. tuberculosis transcription in human sputum and bronchoalveolar lavage (BAL) samples from 11 HIV-negative South African patients with pulmonary tuberculosis. We additionally compared these clinical samples with in vitro log phase aerobic growth and hypoxic non-replicating persistence (NRP-2). Of 2179 M. tuberculosis transcripts assayed in sputum and BAL via multiplex RT-PCR, 194 (8.9%) had a p-value <0.05, but none were significant after correction for multiple testing. Categorical enrichment analysis indicated that expression of the hypoxia-responsive DosR regulon was higher in BAL than in sputum. M. tuberculosis transcription in BAL and sputum was distinct from both aerobic growth and NRP-2, with a range of 396-1020 transcripts significantly differentially expressed after multiple testing correction. Collectively, our results indicate that M. tuberculosis transcription in sputum approximates M. tuberculosis transcription in the lung. Minor differences between M. tuberculosis transcription in BAL and sputum suggested lower oxygen concentrations or higher nitric oxide concentrations in BAL. M. tuberculosis-targeted transcriptional profiling of sputa may be a powerful tool for understanding M. tuberculosis pathogenesis and monitoring treatment responses in vivo. PMID:27553415

  18. Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility.

    PubMed

    Wang, Qingfeng; Harshey, Rasika M

    2009-10-01

    In Salmonella enterica, an activated Rcs signalling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes -fliPQR- located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signalling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

  19. Rcs signaling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility

    PubMed Central

    Wang, Qingfeng; Harshey, Rasika M.

    2009-01-01

    Summary In Salmonella enterica, an activated Rcs signaling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes - fliPQR - located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signaling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

  20. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    SciTech Connect

    Leuze, Michael Rex; Karpinets, Tatiana V; Syed, Mustafa H; Beliaev, Alexander S; Uberbacher, Edward C

    2012-01-01

    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  1. Transcriptional and Physiological Changes during Mycobacterium tuberculosis Reactivation from Non-replicating Persistence

    PubMed Central

    Du, Peicheng; Sohaskey, Charles D.; Shi, Lanbo

    2016-01-01

    Mycobacterium tuberculosis can persist for years in the hostile environment of the host in a non-replicating or slowly replicating state. While active disease predominantly results from reactivation of a latent infection, the molecular mechanisms of M. tuberculosis reactivation are still poorly understood. We characterized the physiology and global transcriptomic profiles of M. tuberculosis during reactivation from hypoxia-induced non-replicating persistence. We found that M. tuberculosis reactivation upon reaeration was associated with a lag phase, in which the recovery of cellular physiological and metabolic functions preceded the resumption of cell replication. Enrichment analysis of the transcriptomic dynamics revealed changes to many metabolic pathways and transcription regulons/subnetworks that orchestrated the metabolic and physiological transformation in preparation for cell division. In particular, we found that M. tuberculosis reaeration lag phase is associated with down-regulation of persistence-associated regulons/subnetworks, including DosR, MprA, SigH, SigE, and ClgR, as well as metabolic pathways including those involved in the uptake of lipids and their catabolism. More importantly, we identified a number of up-regulated transcription regulons and metabolic pathways, including those involved in metal transport and remobilization, second messenger-mediated responses, DNA repair and recombination, and synthesis of major cell wall components. We also found that inactivation of the major alternative sigma factors SigE or SigH disrupted exit from persistence, underscoring the importance of the global transcriptional reprogramming during M. tuberculosis reactivation. Our observations suggest that M. tuberculosis lag phase is associated with a global gene expression reprogramming that defines the initiation of a reactivation process.

  2. Crystal structure of PhoU from Pseudomonas aeruginosa, a negative regulator of the Pho regulon.

    PubMed

    Lee, Sang Jae; Park, Ye Seol; Kim, Soon-Jong; Lee, Bong-Jin; Suh, Se Won

    2014-10-01

    In Escherichia coli, seven genes (pstS, pstC, pstA, pstB, phoU, phoR, and phoB) are involved in sensing environmental phosphate (Pi) and controlling the expression of the Pho regulon. PhoU is a negative regulator of the Pi-signaling pathway and modulates Pi transport through Pi transporter proteins (PstS, PstC, PstA, and PstB) through the two-component system PhoR and PhoB. Inactivation of PhoY2, one of the two PhoU homologs in Mycobacterium tuberculosis, causes defects in persistence phenotypes and increased susceptibility to antibiotics and stresses. Despite the important biological role, the mechanism of PhoU function is still unknown. Here we have determined the crystal structure of PhoU from Pseudomonas aeruginosa. It exists as a dimer in the crystal, with each monomer consisting of two structurally similar three-helix bundles. Our equilibrium sedimentation measurements support the reversible monomer-dimer equilibrium model in which P. aeruginosa PhoU exists in solution predominantly as dimers, with monomers in a minor fraction, at low protein concentrations. The dissociation constant for PhoU dimerization is 3.2×10(-6)M. The overall structure of P. aeruginosa PhoU dimer resembles those of Aquifex aeolicus PhoU and Thermotoga maritima PhoU2. However, it shows distinct structural features in some loops and the dimerization pattern. PMID:25220976

  3. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    PubMed

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

  4. Liberate and Grab It, Ingest and Digest It: the GbdR Regulon of the Pathogen Pseudomonas aeruginosa

    PubMed Central

    2014-01-01

    The compatible solute glycine betaine is a powerful osmostress protectant, but many microorganisms can also use it as a nutrient. K. J. Hampel et al. (J. Bacteriol. 196:7–15, 2014) defined a regulon in the notorious pathogen Pseudomonas aeruginosa that comprises modules for the harvest and import of the glycine betaine biosynthetic precursor choline and its subsequent catabolism to pyruvate. The reported data link the GbdR activator with the metabolism of host-derived compounds (e.g., phosphocholine) and virulence traits of P. aeruginosa. PMID:24163344

  5. CANDIDATE REGULATORS OF THE COLD STRESS RESPONSE GENE REGULON OF RICE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional regulatory network is an important component of the mechanisms that define the adaptive responses of plants to cold stress. In cold-acclimating plants, the centerpiece of such network is the CBF/DREB family of AP2-type transcription factors. In non-acclimating plants like rice, the n...

  6. Transcriptional and posttranscriptional regulation of cyanobacterial photosynthesis.

    PubMed

    Wilde, Annegret; Hihara, Yukako

    2016-03-01

    Cyanobacteria are well established model organisms for the study of oxygenic photosynthesis, nitrogen metabolism, toxin biosynthesis, and salt acclimation. However, in comparison to other model bacteria little is known about regulatory networks, which allow cyanobacteria to acclimate to changing environmental conditions. The current work has begun to illuminate how transcription factors modulate expression of different photosynthetic regulons. During the past few years, the research on other regulatory principles like RNA-based regulation showed the importance of non-protein regulators for bacterial lifestyle. Investigations on modulation of photosynthetic components should elucidate the contributions of all factors within the context of a larger regulatory network. Here, we focus on regulation of photosynthetic processes including transcriptional and posttranscriptional mechanisms, citing examples from a limited number of cyanobacterial species. Though, the general idea holds true for most species, important differences exist between various organisms, illustrating diversity of acclimation strategies in the very heterogeneous cyanobacterial clade. This article is part of a Special Issue entitled Organization and dynamics of bioenergetic systems in bacteria, edited by Prof Conrad Mullineaux. PMID:26549130

  7. Identification and characterization of transcription networks in environmentally significant species

    SciTech Connect

    Lawrence, Charles E.; McCue, Lee Ann

    2005-11-30

    Understanding the regulation of gene expression, transcription regulation in particular, is one of the grand challenges of molecular biology. Transcription regulation is arguably the most important foundation of cellular function, since it exerts the most fundamental control of the abundance of virtually all of a cell's functional macromolecules. Nevertheless, this process, perhaps because of its difficulty, has been the subject of only a limited number of genomic level analyses. We have undertaken bioinformatics projects to address this issue by developing (1) a cross-species comparison method (i.e. phylogenetic footprinting) for the identification of transcription factor binding sites, (2) a Bayesian clustering method to identify regulons, (3) an improved scanning algorithm that uses a position weight matrix and several related species sequence data to locate transcription factor binding sites, and (4) a method to predict cognate binding sites for transcription factors of unknown specificity. These bioinformatics methods were developed using the model proteobacterium Escherichia coli, with further applications to the genomes of environmentally significant microbes (Rhodopseudomonas palustris, Shewanella oneidensis) in later years of the grant.

  8. Immunogenicity of Eight Dormancy Regulon-Encoded Proteins of Mycobacterium tuberculosis in DNA-Vaccinated and Tuberculosis-Infected Mice▿

    PubMed Central

    Roupie, Virginie; Romano, Marta; Zhang, Lei; Korf, Hannelie; Lin, May Young; Franken, Kees L. M. C.; Ottenhoff, Tom H. M.; Klein, Michèl R.; Huygen, Kris

    2007-01-01

    Hypoxia and low concentrations of nitric oxide have been reported to upregulate in vitro gene expression of 48 proteins of the dormancy (DosR) regulon of Mycobacterium tuberculosis. These proteins are thought to be essential for the survival of bacteria during persistence in vivo and are targeted by the immune system during latent infection in humans. Here we have analyzed the immunogenicity of eight DosR regulon-encoded antigens by plasmid DNA vaccination of BALB/c and C57BL/6 mice, i.e., Rv1733c, Rv1738, Rv2029c (pfkB), Rv2031c/hspX (acr), Rv2032 (acg), Rv2626c, Rv2627c, and Rv2628. Strong humoral and/or cellular Th1-type (interleukin-2 and gamma interferon) immune responses could be induced against all but one (Rv1738) of these antigens. The strongest Th1 responses were measured following vaccination with DNA encoding Rv2031c and Rv2626c. Using synthetic 20-mer overlapping peptides, 11 immunodominant, predicted major histocompatibility complex class II-restricted epitopes and one Kd-restricted T-cell epitope could be identified. BALB/c and (B6D2)F1 mice persistently infected with M. tuberculosis developed immune responses against Rv1733c, Rv2031c, and Rv2626c. These findings have implications for proof-of-concept studies in mice mimicking tuberculosis (TB) latency models and their extrapolation to humans for potential new vaccination strategies against TB. PMID:17145953

  9. Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework.

    PubMed

    Mehra, Varun; Ghosh, Tarini Shankar; Mande, Sharmila S

    2016-09-01

    Horizontal Gene Transfer (HGT) events, initially thought to be rare in Mycobacterium tuberculosis, have recently been shown to be involved in the acquisition of virulence operons in M. tuberculosis. We have developed a new partitioning framework based HGT prediction algorithm, called Grid3M, and applied the same for the prediction of HGTs in Mycobacteria. Validation and testing using simulated and real microbial genomes indicated better performance of Grid3M as compared with other widely used HGT prediction methods. Specific analysis of the genes belonging to dormancy/reactivation regulons across 14 mycobacterial genomes indicated that horizontal acquisition is specifically restricted to important accessory proteins. The results also revealed Burkholderia species to be a probable source of HGT genes belonging to these regulons. The current study provides a basis for similar analyses investigating the functional/evolutionary aspects of HGT genes in other pathogens. A database of Grid3M predicted HGTs in completely sequenced genomes is available at https://metagenomics.atc.tcs.com/Grid3M/. PMID:27581938

  10. Ascorbic acid-dependent gene expression in Streptococcus pneumoniae and the activator function of the transcriptional regulator UlaR2

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P.

    2015-01-01

    In this study, we have explored the impact of ascorbic acid on the transcriptome of Streptococcus pneumoniae D39. The expression of several genes and operons, including the ula operon (which has been previously shown to be involved in ascorbic acid utilization), the AdcR regulon (which has been previously shown to be involved in zinc transport and virulence) and a PTS operon (which we denote here as ula2 operon) were altered in the presence of ascorbic acid. The ula2 operon consists of five genes, including the transcriptional activator ulaR2. Our β-galactosidase assay data and transcriptome comparison of the ulaR2 mutant with the wild-type demonstrated that the transcriptional activator UlaR2 in the presence of ascorbic acid activates the expression of the ula2 operon. We further predict a 16-bp regulatory site (5′-ATATTGTGCTCAAATA-3′) for UlaR2 in the Pula2. Furthermore, we have explored the effect of ascorbic acid on the expression of the AdcR regulon. Our ICP-MS analysis showed that addition of ascorbic acid to the medium causes zinc starvation in the cell which leads to the activation of the AdcR regulon. PMID:25717320

  11. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    SciTech Connect

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.; Llinás, Manuel

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened or eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.

  12. Use of a promiscuous, constitutively-active bacterial enhancer-binding protein to define the Sigma54 (RpoN) regulon of Salmonella Typhimurium LT2

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Sigma54, or RpoN, is an alternative s factor found widely in eubacteria. A significant complication in analysis of the global sigma54 regulon in a bacterium is that the sigma54 RNA polymerase holoenzyme requires interaction with an active bacterial enhancer-binding protein (bEBP) to init...

  13. DevS/DosS sensor is bifunctional and its phosphatase activity precludes aerobic DevR/DosR regulon expression in Mycobacterium tuberculosis.

    PubMed

    Kaur, Kohinoor; Kumari, Priyanka; Sharma, Saurabh; Sehgal, Snigdha; Tyagi, Jaya Sivaswami

    2016-08-01

    Two-component systems, comprising histidine kinases and response regulators, empower bacteria to sense and adapt to diverse environmental stresses. Some histidine kinases are bifunctional; their phosphorylation (kinase) and dephosphorylation (phosphatase) activities toward their cognate response regulators permit the rapid reversal of genetic responses to an environmental stimulus. DevR-DevS/DosR-DosS is one of the best-characterized two-component systems of Mycobacterium tuberculosis. The kinase function of DevS is activated by gaseous stress signals, including hypoxia, resulting in the induction of ~ 48-genes DevR dormancy regulon. Regulon expression is tightly controlled and lack of expression in aerobic Mtb cultures is ascribed to the absence of phosphorylated DevR. Here we show that DevS is a bifunctional sensor and possesses a robust phosphatase activity toward DevR. We used site-specific mutagenesis to generate substitutions in conserved residues in the dimerization and histidine phosphotransfer domain of DevS and determined their role in kinase/phosphatase functions. In vitro and in vivo experiments, including a novel in vivo phosphatase assay, collectively establish that these conserved residues are critical for regulating kinase/phosphatase functions. Our findings establish DevS phosphatase function as an effective control mechanism to block aerobic expression of the DevR dormancy regulon. Asp-396 is essential for both kinase and phosphatase functions, whereas Gln-400 is critical for phosphatase function. The positive and negative functions perform opposing roles in DevS: the kinase function triggers regulon induction under hypoxia, whereas its phosphatase function prevents expression under aerobic conditions. A finely tuned balance in these opposing activities calibrates the dormancy regulon response output. PMID:27327040

  14. Immunogenicity of Novel DosR Regulon-Encoded Candidate Antigens of Mycobacterium tuberculosis in Three High-Burden Populations in Africa▿ †

    PubMed Central

    Black, Gillian F.; Thiel, Bonnie A.; Ota, Martin O.; Parida, Shreemanta K.; Adegbola, Richard; Boom, W. Henry; Dockrell, Hazel M.; Franken, Kees L. M. C.; Friggen, Annemiek H.; Hill, Philip C.; Klein, Michel R.; Lalor, Maeve K.; Mayanja, Harriet; Schoolnik, Gary; Stanley, Kim; Weldingh, Karin; Kaufmann, Stefan H. E.; Walzl, Gerhard; Ottenhoff, Tom H. M.

    2009-01-01

    Increasing knowledge about DosR regulon-encoded proteins has led us to produce novel Mycobacterium tuberculosis antigens for immunogenicity testing in human populations in three countries in Africa to which tuberculosis (TB) is endemic. A total of 131 tuberculin skin test-positive and/or ESAT-6/CFP10-positive, human immunodeficiency virus-negative adult household contacts of active pulmonary TB cases from South Africa (n = 56), The Gambia (n = 26), and Uganda (n = 49) were tested for gamma interferon responses to 7 classical and 51 DosR regulon-encoded M. tuberculosis recombinant protein antigens. ESAT-6/CFP10 fusion protein evoked responses in >75% of study participants in all three countries. Of the DosR regulon-encoded antigens tested, Rv1733c was the most commonly recognized by participants from both South Africa and Uganda and the third most commonly recognized antigen in The Gambia. The four most frequently recognized DosR regulon-encoded antigens in Uganda (Rv1733c, Rv0081, Rv1735c, and Rv1737c) included the three most immunogenic antigens in South Africa. In contrast, Rv3131 induced the highest percentage of responders in Gambian contacts (38%), compared to only 3.4% of Ugandan contacts and no South African contacts. Appreciable percentages of TB contacts with a high likelihood of latent M. tuberculosis infection responded to several novel DosR regulon-encoded M. tuberculosis proteins. In addition to significant similarities in antigen recognition profiles between the three African population groups, there were also disparities, which may stem from genetic differences between both pathogen and host populations. Our findings have implications for the selection of potential TB vaccine candidates and for determining biosignatures of latent M. tuberculosis infection, active TB disease, and protective immunity. PMID:19553548

  15. The functional landscape bound to the transcription factors of Escherichia coli K-12.

    PubMed

    Pérez-Rueda, Ernesto; Tenorio-Salgado, Silvia; Huerta-Saquero, Alejandro; Balderas-Martínez, Yalbi I; Moreno-Hagelsieb, Gabriel

    2015-10-01

    Motivated by the experimental evidences accumulated in the last ten years and based on information deposited in RegulonDB, literature look up, and sequence analysis, we analyze the repertoire of 304 DNA-binding Transcription factors (TFs) in Escherichia coli K-12. These regulators were grouped in 78 evolutionary families and are regulating almost half of the total genes in this bacterium. In structural terms, 60% of TFs are composed by two-domains, 30% are monodomain, and 10% three- and four-structural domains. As previously noticed, the most abundant DNA-binding domain corresponds to the winged helix-turn-helix, with few alternative DNA-binding structures, resembling the hypothesis of successful protein structures with the emergence of new ones at low scales. In summary, we identified and described the characteristics associated to the DNA-binding TF in E. coli K-12. We also identified twelve functional modules based on a co-regulated gene matrix. Finally, diverse regulons were predicted based on direct associations between the TFs and potential regulated genes. This analysis should increase our knowledge about the gene regulation in the bacterium E. coli K-12, and provide more additional clues for comprehensive modelling of transcriptional regulatory networks in other bacteria. PMID:26094112

  16. Deciphering the Regulon of Streptomyces coelicolor AbrC3, a Positive Response Regulator of Antibiotic Production

    PubMed Central

    Rico, Sergio; Santamaría, Ramón I.; Yepes, Ana; Rodríguez, Héctor; Laing, Emma; Bucca, Giselda; Smith, Colin P.

    2014-01-01

    The atypical two-component system (TCS) AbrC1/C2/C3 (encoded by SCO4598, SCO4597, and SCO4596), comprising two histidine kinases (HKs) and a response regulator (RR), is crucial for antibiotic production in Streptomyces coelicolor and for morphological differentiation under certain nutritional conditions. In this study, we demonstrate that deletion of the RR-encoding gene, abrC3 (SCO4596), results in a dramatic decrease in actinorhodin (ACT) and undecylprodiginine (RED) production and delays morphological development. In contrast, the overexpression of abrC3 in the parent strain leads to a 33% increase in ACT production in liquid medium. Transcriptomic analysis and chromatin immunoprecipitation with microarray technology (ChIP-chip) analysis of the ΔabrC3 mutant and the parent strain revealed that AbrC3 directly controls ACT production by binding to the actII-ORF4 promoter region; this was independently verified by in vitro DNA-binding assays. This binding is dependent on the sequence 5′-GAASGSGRMS-3′. In contrast, the regulation of RED production is not due to direct binding of AbrC3 to either the redZ or redD promoter region. This study also revealed other members of the AbrC3 regulon: AbrC3 is a positive autoregulator which also binds to the promoter regions of SCO0736, bdtA (SCO3328), absR1 (SCO6992), and SCO6809. The direct targets share the 10-base consensus binding sequence and may be responsible for some of the phenotypes of the ΔabrC3 mutant. The identification of the AbrC3 regulon as part of the complex regulatory network governing antibiotic production widens our knowledge regarding TCS involvement in control of antibiotic synthesis and may contribute to the rational design of new hyperproducer host strains through genetic manipulation of such systems. PMID:24509929

  17. Transcriptional Control by A-Factor of Two Trypsin Genes in Streptomyces griseus

    PubMed Central

    Kato, Jun-ya; Chi, Won-Jae; Ohnishi, Yasuo; Hong, Soon-Kwang; Horinouchi, Sueharu

    2005-01-01

    AdpA is the key transcriptional activator for a number of genes of various functions in the A-factor regulatory cascade in Streptomyces griseus, forming an AdpA regulon. Trypsin-like activity was detected at a late stage of growth in the wild-type strain but not in an A-factor-deficient mutant. Consistent with these observations, two trypsin genes, sprT and sprU, in S. griseus were found to be members of the AdpA regulon; AdpA activated the transcription of both genes by binding to the operators located at about −50 nucleotide positions with respect to the transcriptional start point. The transcription of sprT and sprU, induced by AdpA, was most active at the onset of sporulation. Most trypsin activity exerted by S. griseus was attributed to SprT, because trypsin activity in an sprT-disrupted mutant was greatly reduced but that in an sprU-disrupted mutant was only slightly reduced. This was consistent with the observation that the amount of the sprT mRNA was much greater than that of the sprU transcript. Disruption of both sprT and sprU (mutant ΔsprTU) reduced trypsin activity to almost zero, indicating that no trypsin genes other than these two were present in S. griseus. Even the double mutant ΔsprTU grew normally and developed aerial hyphae and spores over the same time course as the wild-type strain. PMID:15601713

  18. Temperature-controlled plasmid regulon associated with low calcium response in Yersinia pestis.

    PubMed Central

    Yother, J; Chamness, T W; Goguen, J D

    1986-01-01

    Both the low calcium response and virulence in Yersinia pestis strain KIM5 are mediated by genes located on the 75.4-kilobase plasmid pCD1. The results presented here demonstrate the existence of two new genetic loci of pCD1 whose expression is regulated in response to temperature. Levels of transcription in the trtA and trtB loci were elevated 12- to 16-fold at 37 degrees C compared with levels of transcription at 30 degrees C. In addition, the absolute levels of transcription were the highest that have been reported for genes on pCD1. Mutations in trtB also abolished production of the V antigen. Thermal induction at these loci was dramatically reduced in strains harboring a Tn5 insertion in the lcrF locus of pCD1. lcrF lies 33 and 13 kilobases from the trtA and trtB loci, respectively. Thus, lcrF is a positive regulatory gene responsible for temperature-induced transcription of genes required for the low calcium response. PMID:3944056

  19. Candidate regulators of the cold stress response gene regulon of rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional regulation is an important aspect of the complex network of genes involved in plant responses to low temperature. At the seedling stage, most japonica cultivars can survive continuous exposure to as low as 10oC for up to 7 days better than most indica cultivars. Here we present a sna...

  20. Characterization of the Fur regulon in Pseudomonas syringae pv. tomato DC3000

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The plant pathogen Pseudomonas syringae pv. tomato DC3000 is found in a wide variety of environments and as a result must monitor and respond to various environmental signals. In previous studies, we investigated the transcriptional response of DC3000 to iron, an essential element for bacterial grow...

  1. Effects of triclocarban on the transcription of estrogen, androgen and aryl hydrocarbon receptor responsive genes in human breast cancer cells.

    PubMed

    Tarnow, Patrick; Tralau, Tewes; Hunecke, Danele; Luch, Andreas

    2013-08-01

    Triclocarban (TCC) is an antimicrobial agent that is used in detergents, soaps and other personal hygiene products. Similarly to triclosan the widespread use of TCC has raised concerns about its endocrine potential. In luciferase-based reporter assays TCC has been shown to enhance estrogenic and androgenic activities following cellular coexposure with estrogen or dihydrotestosterone, respectively. The present study demonstrates that although coexposure with TCC enhances the estrogenic and androgenic readout of luciferase-based reporter cell lines such as HeLa9908 and MDA-kb2, it fails to act as a xenoandrogen on transcriptional level, nor does it induce cell proliferation in the estrogen sensitive E-screen. In addition TCC did not alter the expression of estrogen responsive genes in human mammary carcinoma MCF-7 cells exposed to 17β-estradiol, bisphenol A, butylparaben or genistein. However, TCC was shown to interfere with the regulon of the aryl hydrocarbon receptor (AhR) as TCC showed a costimulatory effect on transcription of CYP1A1 and CYP1B1, effectively lowering the transcriptional threshold for both genes in the presence of estrogens. It thus seems, that while the induction of the respective luciferase reporter assays by TCC is an unspecific false positive signal caused by luciferase stabilisation, TCC has the potential to interfere with the regulatory crosstalk of the estrogen receptor (ER) and the AhR regulon. PMID:23524099

  2. Transcription of two sigma 70 homologue genes, sigA and sigB, in stationary-phase Mycobacterium tuberculosis.

    PubMed

    Hu, Y; Coates, A R

    1999-01-01

    The sigA and sigB genes of Mycobacterium tuberculosis encode two sigma 70-like sigma factors of RNA polymerase. While transcription of the sigA gene is growth rate independent, sigB transcription is increased during entry into stationary phase. The sigA gene transcription is unresponsive to environmental stress but that of sigB is very responsive, more so in stationary-phase growth than in log-phase cultures. These data suggest that SigA is a primary sigma factor which, like sigma70, controls the transcription of the housekeeping type of promoters. In contrast, SigB, although showing some overlap in function with SigA, is more like the alternative sigma factor, sigmaS, which controls the transcription of the gearbox type of promoters. Primer extension analysis identified the RNA start sites for both genes as 129 nucleotides upstream to the GTG start codon of sigA and 27 nucleotides from the ATG start codon of sigB. The -10 promoter of sigA but not that of sigB was similar to the sigma70 promoter. The half-life of the sigA transcript was very long, and this is likely to play an important part in its regulation. In contrast, the half-life of the sigB transcript was short, about 2 min. These results demonstrate that the sigB gene may control the regulons of stationary phase and general stress resistance, while sigA may be involved in the housekeeping regulons. PMID:9882660

  3. IGF2BP3 modulates the interaction of invasion-associated transcripts with RISC

    PubMed Central

    Ennajdaoui, Hanane; Howard, Jonathan M.; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J.; Uren, Philip J.; Dargyte, Marija; Katzman, Sol; Draper, Jolene M.; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C.; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D.; Toloue, Masoud M.; Blencowe, Benjamin J.; Penalva, Luiz O.F.; Sanford, Jeremy R.

    2016-01-01

    Summary Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy. But its role(s) in pathogenesis remain enigmatic. Here, we interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches we identify 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual-nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and miRNA binding sites. IGF2BP3 promotes association of the RNA induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. PMID:27210763

  4. IGF2BP3 Modulates the Interaction of Invasion-Associated Transcripts with RISC.

    PubMed

    Ennajdaoui, Hanane; Howard, Jonathan M; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J; Uren, Philip J; Dargyte, Marija; Katzman, Sol; Draper, Jolene M; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D; Toloue, Masoud M; Blencowe, Benjamin J; Penalva, Luiz O F; Sanford, Jeremy R

    2016-05-31

    Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy, but its role(s) in pathogenesis remains enigmatic. We interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches, we have identified 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation, and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and microRNA (miRNA) binding sites. IGF2BP3 promotes association of the RNA-induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. PMID:27210763

  5. Global Analysis of Photosynthesis Transcriptional Regulatory Networks

    PubMed Central

    Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.

    2014-01-01

    Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

  6. Global analysis of photosynthesis transcriptional regulatory networks.

    PubMed

    Imam, Saheed; Noguera, Daniel R; Donohue, Timothy J

    2014-12-01

    Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

  7. Aminopeptidase N1 (EtAPN1), an M1 Metalloprotease of the Apicomplexan Parasite Eimeria tenella, Participates in Parasite Development

    PubMed Central

    Gras, Simon; Byzia, Anna; Gilbert, Florence B.; McGowan, Sheena; Drag, Marcin; Niepceron, Alisson; Lecaille, Fabien; Lalmanach, Gilles; Brossier, Fabien

    2014-01-01

    Aminopeptidases N are metalloproteases of the M1 family that have been reported in numerous apicomplexan parasites, including Plasmodium, Toxoplasma, Cryptosporidium, and Eimeria. While investigating the potency of aminopeptidases as therapeutic targets against coccidiosis, one of the most important avian diseases caused by the genus Eimeria, we identified and characterized Eimeria tenella aminopeptidase N1 (EtAPN1). Its inhibition by bestatin and amastatin, as well as its reactivation by divalent ions, is typical of zinc-dependent metalloproteases. EtAPN1 shared a similar sequence, three-dimensional structure, and substrate specificity and similar kinetic parameters with A-M1 from Plasmodium falciparum (PfA-M1), a validated target in the treatment of malaria. EtAPN1 is synthesized as a 120-kDa precursor and cleaved into 96-, 68-, and 38-kDa forms during sporulation. Further, immunolocalization assays revealed that, similar to PfA-M1, EtAPN1 is present during the intracellular life cycle stages in both the parasite cytoplasm and the parasite nucleus. The present results support the hypothesis of a conserved role between the two aminopeptidases, and we suggest that EtAPN1 might be a valuable target for anticoccidiosis drugs. PMID:24839124

  8. Identification and characterization of Toxoplasma SIP, a conserved apicomplexan cytoskeleton protein involved in maintaining the shape, motility and virulence of the parasite

    PubMed Central

    Lentini, Gaelle; Kong-Hap, Marie; El Hajj, Hiba; Francia, Maria; Claudet, Cyrille; Striepen, Boris; Dubremetz, Jean-François; Lebrun, Maryse

    2015-01-01

    Summary Apicomplexa possess a complex pellicle that is composed of a plasma membrane and a closely apposed inner membrane complex (IMC) that serves as a support for the actin-myosin motor required for motility and host cell invasion. The IMC consists of longitudinal plates of flattened vesicles, fused together and lined on the cytoplasmic side by a subpellicular network of intermediate filament-like proteins. The spatial organization of the IMC has been well described by electron microscopy, but its composition and molecular organization is largely unknown. Here, we identify a novel protein of the IMC cytoskeletal network in Toxoplasma gondii, called TgSIP, and conserved among apicomplexan parasites. To finely pinpoint the localization of TgSIP, we used structured illumination super resolution microscopy and revealed that it likely decorates the transverse sutures of the plates and the basal end of the IMC. This suggests that TgSIP might contribute to the organization or physical connection among the different components of the IMC. We generated a T. gondii SIP deletion mutant and showed that parasites lacking TgSIP are significantly shorter than wild-type parasites and show defects in gliding motility, invasion and reduced infectivity in mice. PMID:25088010

  9. Deep Sequencing Analysis of Small Noncoding RNA and mRNA Targets of the Global Post-Transcriptional Regulator, Hfq

    PubMed Central

    Sittka, Alexandra; Lucchini, Sacha; Papenfort, Kai; Sharma, Cynthia M.; Rolle, Katarzyna; Binnewies, Tim T.; Hinton, Jay C. D.; Vogel, Jörg

    2008-01-01

    Recent advances in high-throughput pyrosequencing (HTPS) technology now allow a thorough analysis of RNA bound to cellular proteins, and, therefore, of post-transcriptional regulons. We used HTPS to discover the Salmonella RNAs that are targeted by the common bacterial Sm-like protein, Hfq. Initial transcriptomic analysis revealed that Hfq controls the expression of almost a fifth of all Salmonella genes, including several horizontally acquired pathogenicity islands (SPI-1, -2, -4, -5), two sigma factor regulons, and the flagellar gene cascade. Subsequent HTPS analysis of 350,000 cDNAs, derived from RNA co-immunoprecipitation (coIP) with epitope-tagged Hfq or control coIP, identified 727 mRNAs that are Hfq-bound in vivo. The cDNA analysis discovered new, small noncoding RNAs (sRNAs) and more than doubled the number of sRNAs known to be expressed in Salmonella to 64; about half of these are associated with Hfq. Our analysis explained aspects of the pleiotropic effects of Hfq loss-of-function. Specifically, we found that the mRNAs of hilD (master regulator of the SPI-1 invasion genes) and flhDC (flagellar master regulator) were bound by Hfq. We predicted that defective SPI-1 secretion and flagellar phenotypes of the hfq mutant would be rescued by overexpression of HilD and FlhDC, and we proved this to be correct. The combination of epitope-tagging and HTPS of immunoprecipitated RNA detected the expression of many intergenic chromosomal regions of Salmonella. Our approach overcomes the limited availability of high-density microarrays that have impeded expression-based sRNA discovery in microorganisms. We present a generic strategy that is ideal for the systems-level analysis of the post-transcriptional regulons of RNA-binding proteins and for sRNA discovery in a wide range of bacteria. PMID:18725932

  10. Identification of the REST regulon reveals extensive transposable element-mediated binding site duplication

    PubMed Central

    Johnson, Rory; Gamblin, Richard J.; Ooi, Lezanne; Bruce, Alexander W.; Donaldson, Ian J.; Westhead, David R.; Wood, Ian C.; Jackson, Richard M.; Buckley, Noel J.

    2006-01-01

    The genome-wide mapping of gene-regulatory motifs remains a major goal that will facilitate the modelling of gene-regulatory networks and their evolution. The repressor element 1 is a long, conserved transcription factor-binding site which recruits the transcriptional repressor REST to numerous neuron-specific target genes. REST plays important roles in multiple biological processes and disease states. To map RE1 sites and target genes, we created a position specific scoring matrix representing the RE1 and used it to search the human and mouse genomes. We identified 1301 and 997 RE1s inhuman and mouse genomes, respectively, of which >40% are novel. By employing an ontological analysis we show that REST target genes are significantly enriched in a number of functional classes. Taking the novel REST target gene CACNA1A as an experimental model, we show that it can be regulated by multiple RE1s of different binding affinities, which are only partially conserved between human and mouse. A novel BLAST methodology indicated that many RE1s belong to closely related families. Most of these sequences are associated with transposable elements, leading us to propose that transposon-mediated duplication and insertion of RE1s has led to the acquisition of novel target genes by REST during evolution. PMID:16899447

  11. Elucidation of the RamA regulon in Klebsiella pneumoniae reveals a role in LPS regulation.

    PubMed

    De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monahan, Avril; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J; Bengoechea, José; Gally, David L; Fanning, Séamus; Elborn, Joseph S; Schneiders, Thamarai

    2015-01-01

    Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

  12. Elucidation of the RamA Regulon in Klebsiella pneumoniae Reveals a Role in LPS Regulation

    PubMed Central

    De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P.; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J.; Bengoechea, José; Gally, David L.; Fanning, Séamus; Elborn, Joseph S.; Schneiders, Thamarai

    2015-01-01

    Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

  13. RegR virulence regulon of rabbit-specific enteropathogenic Escherichia coli strain E22.

    PubMed

    Srikhanta, Yogitha N; Hocking, Dianna M; Praszkier, Judyta; Wakefield, Matthew J; Robins-Browne, Roy M; Yang, Ji; Tauschek, Marija

    2013-04-01

    AraC-like regulators play a key role in the expression of virulence factors in enteric pathogens, such as enteropathogenic Escherichia coli (EPEC), enterotoxigenic E. coli, enteroaggregative E. coli, and Citrobacter rodentium. Bioinformatic analysis of the genome of rabbit-specific EPEC (REPEC) strain E22 (O103:H2) revealed the presence of a gene encoding an AraC-like regulatory protein, RegR, which shares 71% identity to the global virulence regulator, RegA, of C. rodentium. Microarray analysis demonstrated that RegR exerts 25- to 400-fold activation on transcription of several genes encoding putative virulence-associated factors, including a fimbrial operon (SEF14), a serine protease, and an autotransporter adhesin. These observations were confirmed by proteomic analysis of secreted and heat-extracted surface-associated proteins. The mechanism of RegR-mediated activation was investigated by using its most highly upregulated gene target, sefA. Transcriptional analyses and electrophoretic mobility shift assays showed that RegR activates the expression of sefA by binding to a region upstream of the sefA promoter, thereby relieving gene silencing by the global regulatory protein H-NS. Moreover, RegR was found to contribute significantly to virulence in a rabbit infection experiment. Taken together, our findings indicate that RegR controls the expression of a series of accessory adhesins that significantly enhance the virulence of REPEC strain E22. PMID:23340312

  14. Microarray analysis identifies Salmonella genes belonging to the low-shear modeled microgravity regulon

    NASA Technical Reports Server (NTRS)

    Wilson, James W.; Ramamurthy, Rajee; Porwollik, Steffen; McClelland, Michael; Hammond, Timothy; Allen, Pat; Ott, C. Mark; Pierson, Duane L.; Nickerson, Cheryl A.

    2002-01-01

    The low-shear environment of optimized rotation suspension culture allows both eukaryotic and prokaryotic cells to assume physiologically relevant phenotypes that have led to significant advances in fundamental investigations of medical and biological importance. This culture environment has also been used to model microgravity for ground-based studies regarding the impact of space flight on eukaryotic and prokaryotic physiology. We have previously demonstrated that low-shear modeled microgravity (LSMMG) under optimized rotation suspension culture is a novel environmental signal that regulates the virulence, stress resistance, and protein expression levels of Salmonella enterica serovar Typhimurium. However, the mechanisms used by the cells of any species, including Salmonella, to sense and respond to LSMMG and identities of the genes involved are unknown. In this study, we used DNA microarrays to elucidate the global transcriptional response of Salmonella to LSMMG. When compared with identical growth conditions under normal gravity (1 x g), LSMMG differentially regulated the expression of 163 genes distributed throughout the chromosome, representing functionally diverse groups including transcriptional regulators, virulence factors, lipopolysaccharide biosynthetic enzymes, iron-utilization enzymes, and proteins of unknown function. Many of the LSMMG-regulated genes were organized in clusters or operons. The microarray results were further validated by RT-PCR and phenotypic analyses, and they indicate that the ferric uptake regulator is involved in the LSMMG response. The results provide important insight about the Salmonella LSMMG response and could provide clues for the functioning of known Salmonella virulence systems or the identification of uncharacterized bacterial virulence strategies.

  15. Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress

    PubMed Central

    2013-01-01

    Background Organisms of the genus Clostridium are Gram-positive endospore formers of great importance to the carbon cycle, human normo- and pathophysiology, but also in biofuel and biorefinery applications. Exposure of Clostridium organisms to chemical and in particular toxic metabolite stress is ubiquitous in both natural (such as in the human microbiome) and engineered environments, engaging both the general stress response as well as specialized programs. Yet, despite its fundamental and applied significance, it remains largely unexplored at the systems level. Results We generated a total of 96 individual sets of microarray data examining the transcriptional changes in C. acetobutylicum, a model Clostridium organism, in response to three levels of chemical stress from the native metabolites, butanol and butyrate. We identified 164 significantly differentially expressed transcriptional regulators and detailed the cellular programs associated with general and stressor-specific responses, many previously unexplored. Pattern-based, comparative genomic analyses enabled us, for the first time, to construct a detailed picture of the genetic circuitry underlying the stress response. Notably, a list of the regulons and DNA binding motifs of the stress-related transcription factors were identified: two heat-shock response regulators, HrcA and CtsR; the SOS response regulator LexA; the redox sensor Rex; and the peroxide sensor PerR. Moreover, several transcriptional regulators controlling stress-responsive amino acid and purine metabolism and their regulons were also identified, including ArgR (arginine biosynthesis and catabolism regulator), HisR (histidine biosynthesis regulator), CymR (cysteine metabolism repressor) and PurR (purine metabolism repressor). Conclusions Using an exceptionally large set of temporal transcriptional data and regulon analyses, we successfully built a STRING-based stress response network model integrating important players for the general and

  16. Energetic Consequences of nitrite stress in Desulfovibrio vulgarisHildenborough, inferred from global transcriptional analysis

    SciTech Connect

    He, Qiang; Huang, Katherine H.; He, Zhili; Alm, Eric J.; Fields,Matthew W.; Hazen, Terry C.; Arkin, Adam P.; Wall, Judy D.; Zhou, Jizhong

    2005-11-03

    Many of the proteins that are candidates for bioenergetic pathways involved with sulfate respiration in Desulfovibrio spp. have been studied, but complete pathways and overall cell physiology remain to be resolved for many environmentally relevant conditions. In order to understand the metabolism of these microorganisms under adverse environmental conditions for improved bioremediation efforts, Desulfovibrio vulgaris Hildenborough was used as a model organism to study stress response to nitrite, an important intermediate in the nitrogen cycle. Previous physiological studies demonstrated that growth was inhibited by nitrite and that nitrite reduction was observed to be the primary mechanism of detoxification. Global transcriptional profiling with whole-genome microarrays revealed coordinated cascades of responses to nitrite in pathways of energy metabolism, nitrogen metabolism, oxidative stress response, and iron homeostasis. In agreement with previous observations, nitrite-stressed cells showed a decrease in the expression of genes encoding sulfate reduction functions in addition to respiratory oxidative phosphorylation and ATP synthase activity. Consequently, the stressed cells had decreased expression of the genes encoding ATP-dependent amino acid transporters and proteins involved in translation. Other genes up-regulated in response to nitrite include the genes in the Fur regulon, which is suggested to be involved in iron homeostasis, and genes in the Per regulon, which is predicted to be responsible for oxidative stress response.

  17. The Activity of the Pseudomonas aeruginosa Virulence Regulator σ(VreI) Is Modulated by the Anti-σ Factor VreR and the Transcription Factor PhoB.

    PubMed

    Quesada, Jose M; Otero-Asman, Joaquín R; Bastiaansen, Karlijn C; Civantos, Cristina; Llamas, María A

    2016-01-01

    Gene regulation in bacteria is primarily controlled at the level of transcription initiation by modifying the affinity of the RNA polymerase (RNAP) for the promoter. This control often occurs through the substitution of the RNAP sigma (σ) subunit. Next to the primary σ factor, most bacteria contain a variable number of alternative σ factors of which the extracytoplasmic function group (σ(ECF)) is predominant. Pseudomonas aeruginosa contains nineteen σ(ECF), including the virulence regulator σ(VreI). σ(VreI) is encoded by the vreAIR operon, which also encodes a receptor-like protein (VreA) and an anti-σ factor (VreR). These three proteins form a signal transduction pathway known as PUMA3, which controls expression of P. aeruginosa virulence functions. Expression of the vreAIR operon occurs under inorganic phosphate (Pi) limitation and requires the PhoB transcription factor. Intriguingly, the genes of the σ(VreI) regulon are also expressed in low Pi despite the fact that the σ(VreI) repressor, the anti-σ factor VreR, is also produced in this condition. Here we show that although σ(VreI) is partially active under Pi starvation, maximal transcription of the σ(VreI) regulon genes requires the removal of VreR. This strongly suggests that an extra signal, probably host-derived, is required in vivo for full σ(VreI) activation. Furthermore, we demonstrate that the activity of σ(VreI) is modulated not only by VreR but also by the transcription factor PhoB. Presence of this regulator is an absolute requirement for σ(VreI) to complex the DNA and initiate transcription of the PUMA3 regulon. The potential DNA binding sites of these two proteins, which include a pho box and -10 and -35 elements, are proposed. PMID:27536271

  18. The Activity of the Pseudomonas aeruginosa Virulence Regulator σVreI Is Modulated by the Anti-σ Factor VreR and the Transcription Factor PhoB

    PubMed Central

    Quesada, Jose M.; Otero-Asman, Joaquín R.; Bastiaansen, Karlijn C.; Civantos, Cristina; Llamas, María A.

    2016-01-01

    Gene regulation in bacteria is primarily controlled at the level of transcription initiation by modifying the affinity of the RNA polymerase (RNAP) for the promoter. This control often occurs through the substitution of the RNAP sigma (σ) subunit. Next to the primary σ factor, most bacteria contain a variable number of alternative σ factors of which the extracytoplasmic function group (σECF) is predominant. Pseudomonas aeruginosa contains nineteen σECF, including the virulence regulator σVreI. σVreI is encoded by the vreAIR operon, which also encodes a receptor-like protein (VreA) and an anti-σ factor (VreR). These three proteins form a signal transduction pathway known as PUMA3, which controls expression of P. aeruginosa virulence functions. Expression of the vreAIR operon occurs under inorganic phosphate (Pi) limitation and requires the PhoB transcription factor. Intriguingly, the genes of the σVreI regulon are also expressed in low Pi despite the fact that the σVreI repressor, the anti-σ factor VreR, is also produced in this condition. Here we show that although σVreI is partially active under Pi starvation, maximal transcription of the σVreI regulon genes requires the removal of VreR. This strongly suggests that an extra signal, probably host-derived, is required in vivo for full σVreI activation. Furthermore, we demonstrate that the activity of σVreI is modulated not only by VreR but also by the transcription factor PhoB. Presence of this regulator is an absolute requirement for σVreI to complex the DNA and initiate transcription of the PUMA3 regulon. The potential DNA binding sites of these two proteins, which include a pho box and −10 and −35 elements, are proposed. PMID:27536271

  19. Differential expression of transcriptional regulatory units in the prefrontal cortex of patients with bipolar disorder: potential role of early growth response gene 3.

    PubMed

    Pfaffenseller, B; da Silva Magalhães, P V; De Bastiani, M A; Castro, M A A; Gallitano, A L; Kapczinski, F; Klamt, F

    2016-01-01

    Bipolar disorder (BD) is a severe mental illness with a strong genetic component. Despite its high degree of heritability, current genetic studies have failed to reveal individual loci of large effect size. In lieu of focusing on individual genes, we investigated regulatory units (regulons) in BD to identify candidate transcription factors (TFs) that regulate large groups of differentially expressed genes. Network-based approaches should elucidate the molecular pathways governing the pathophysiology of BD and reveal targets for potential therapeutic intervention. The data from a large-scale microarray study was used to reconstruct the transcriptional associations in the human prefrontal cortex, and results from two independent microarray data sets to obtain BD gene signatures. The regulatory network was derived by mapping the significant interactions between known TFs and all potential targets. Five regulons were identified in both transcriptional network models: early growth response 3 (EGR3), TSC22 domain family, member 4 (TSC22D4), interleukin enhancer-binding factor 2 (ILF2), Y-box binding protein 1 (YBX1) and MAP-kinase-activating death domain (MADD). With a high stringency threshold, the consensus across tests was achieved only for the EGR3 regulon. We identified EGR3 in the prefrontal cortex as a potential key target, robustly repressed in both BD signatures. Considering that EGR3 translates environmental stimuli into long-term changes in the brain, disruption in biological pathways involving EGR3 may induce an impaired response to stress and influence on risk for psychiatric disorders, particularly BD. PMID:27163206

  20. A novel transcriptional autoregulatory loop enhances expression of the Pantoea stewartii subsp. stewartii Hrp type III secretion system.

    PubMed

    Merighi, Massimo; Majerczak, Doris R; Coplin, David L

    2005-02-15

    The hrp type III secretion regulon of Pantoea stewartii is regulated by a cascade involving the HrpX/HrpY two-component system, the HrpS enhancer-binding protein and the HrpL alternate sigma factor. hrpXY is both constitutive and autoregulated; HrpY controls hrpS; and HrpS activates hrpL. These regulatory genes are arranged in the order hrpL, hrpXY and hrpS and constitute three operons. This study describes a novel autoregulatory loop involving HrpS. Genetic experiments using a chromosomal hrpS-lacZ fusion demonstrated that ectopic expression of HrpS increases hrpS transcription and that this effect is blocked by polar mutations in hrpXY and hrpL and by a nonpolar mutation in hrpY. RT-PCR and Northern blot analysis revealed a hrpL-hrpXY polycistronic mRNA. These results suggest that HrpS-mediated autoregulation is due to activation of hrpS by increased levels of HrpY resulting from read-through transcription of hrpXY from the hrpL promoter. This novel autoregulatory loop may serve to rapidly induce hrp genes during infection and to compensate for negative regulatory mechanisms that keep the regulon off in the insect vector. PMID:15751134

  1. Impact of Anaerobiosis on Expression of the Iron-Responsive Fur and RyhB Regulons

    PubMed Central

    Beauchene, Nicole A.; Myers, Kevin S.; Chung, Dongjun; Park, Dan M.; Weisnicht, Allison M.; Keleş, Sündüz

    2015-01-01

    ABSTRACT Iron, a major protein cofactor, is essential for most organisms. Despite the well-known effects of O2 on the oxidation state and solubility of iron, the impact of O2 on cellular iron homeostasis is not well understood. Here we report that in Escherichia coli K-12, the lack of O2 dramatically changes expression of genes controlled by the global regulators of iron homeostasis, the transcription factor Fur and the small RNA RyhB. Using chromatin immunoprecipitation sequencing (ChIP-seq), we found anaerobic conditions promote Fur binding to more locations across the genome. However, by expression profiling, we discovered that the major effect of anaerobiosis was to increase the magnitude of Fur regulation, leading to increased expression of iron storage proteins and decreased expression of most iron uptake pathways and several Mn-binding proteins. This change in the pattern of gene expression also correlated with an unanticipated decrease in Mn in anaerobic cells. Changes in the genes posttranscriptionally regulated by RyhB under aerobic and anaerobic conditions could be attributed to O2-dependent changes in transcription of the target genes: aerobic RyhB targets were enriched in iron-containing proteins associated with aerobic energy metabolism, whereas anaerobic RyhB targets were enriched in iron-containing anaerobic respiratory functions. Overall, these studies showed that anaerobiosis has a larger impact on iron homeostasis than previously anticipated, both by expanding the number of direct Fur target genes and the magnitude of their regulation and by altering the expression of genes predicted to be posttranscriptionally regulated by the small RNA RyhB under iron-limiting conditions. PMID:26670385

  2. Transcriptome Analysis of the ArgR Regulon in Pseudomonas aeruginosa

    PubMed Central

    Lu, Chung-Dar; Yang, Zhe; Li, Wei

    2004-01-01

    Arginine metabolism in pseudomonads with multiple catabolic pathways for its utilization as carbon and nitrogen sources is of particular interest as the model system to study control of metabolic integration. We performed transcriptome analyses to identify genes controlled by the arginine regulatory protein ArgR and to better understand arginine metabolic pathways of P. aeruginosa. We compared gene expression in wild-type strain PAO1 with that in argR mutant strain PAO501 grown in glutamate minimal medium in the presence and absence of arginine. Ten putative transcriptional units of 28 genes were inducible by ArgR and arginine, including all known ArgR-regulated operons under aerobic conditions. The newly identified genes include the putative adcAB operon, which encodes a catabolic arginine decarboxylase and an antiporter protein, and PA0328, which encodes a hypothetical fusion protein of a peptidase and a type IV autotransporter. Also identified as members of the arginine network are the following solute transport systems: PA1971 (braZ) for branched-chain amino acids permease; PA2042 for a putative sodium:serine symporter; PA3934, which belongs to the family of small oligopeptide transporters; and PA5152-5155, which encodes components of an ABC transporter for a putative opine uptake system. The effect of arginine on the expression of these genes was confirmed by lacZ fusion studies and by DNA binding studies with purified ArgR. Only five transcriptional units of nine genes were qualified as repressible by ArgR and arginine, with three operons (argF, carAB, and argG) in arginine biosynthesis and two operons (gltBD and gdhA) in glutamate biosynthesis. These results indicate that ArgR is important in control of arginine and glutamate metabolism and that arginine and ArgR may have a redundant effect in inducing the uptake systems of certain compounds. PMID:15175299

  3. Contribution of the Salmonella enterica KdgR Regulon to Persistence of the Pathogen in Vegetable Soft Rots

    PubMed Central

    George, Andrée S.; Salas González, Isai; Lorca, Graciela L.

    2015-01-01

    During their colonization of plants, human enteric pathogens, such as Salmonella enterica, are known to benefit from interactions with phytopathogens. At least in part, benefits derived by Salmonella from the association with a soft rot caused by Pectobacterium carotovorum were shown to be dependent on Salmonella KdgR, a regulator of genes involved in the uptake and utilization of carbon sources derived from the degradation of plant polymers. A Salmonella kdgR mutant was more fit in soft rots but not in the lesions caused by Xanthomonas spp. and Pseudomonas spp. Bioinformatic, phenotypic, and gene expression analyses demonstrated that the KdgR regulon included genes involved in uptake and metabolism of molecules resulting from pectin degradation as well as those central to the utilization of a number of other carbon sources. Mutant analyses indicated that the Entner-Doudoroff pathway, in part controlled by KdgR, was critical for the persistence within soft rots and likely was responsible for the kdgR phenotype. PMID:26682862

  4. Survival of enterohemorrhagic Escherichia coli in the presence of Acanthamoeba castellanii and its dependence on Pho regulon

    PubMed Central

    Chekabab, Samuel Mohammed; Daigle, France; Charette, Steve J; Dozois, Charles M; Harel, Josée

    2012-01-01

    Enterohemorrhagic Escherichia coli (EHEC) are involved in outbreaks of food-borne illness and transmitted to humans through bovine products or water contaminated by cattle feces. Microbial interaction is one of the strategies used by pathogenic bacteria to survive in the environment. Among protozoa, the free-living amoebae are known to host and protect several water-borne pathogens. In this study, the interaction between EHEC and the predacious protozoa Acanthamoeba castellanii was investigated. Using monoculture and cocultures, growth of both organisms was estimated for 3 weeks by total and viable cell counts. The numbers of EHEC were significantly higher when cultured with amoebae than without, and less EHEC shifted into a viable but nonculturable state in the presence of amoebae. Using several mutants, we observed that the Pho regulon is required for EHEC growth when cocultured with amoebae. In contrast, the Shiga toxins (Stx) were not involved in this association phenotype. Cocultures monitored by electron microscopy revealed a loss of the regular rod shape of EHEC and the secretion of multilamellar vesicles by the amoebae, which did not contain bacteria. As the interaction between A. castellanii and EHEC appears beneficial for bacterial growth, this supports a potential role for protozoa in promoting the persistence of EHEC in the environment. PMID:23233434

  5. Analysis of the Corynebacterium diphtheriae DtxR regulon: identification of a putative siderophore synthesis and transport system that is similar to the Yersinia high-pathogenicity island-encoded yersiniabactin synthesis and uptake system.

    PubMed

    Kunkle, Carey A; Schmitt, Michael P

    2003-12-01

    The diphtheria toxin repressor, DtxR, is a global iron-dependent regulatory protein in Corynebacterium diphtheriae that controls gene expression by binding to 19-bp operator sequences. To further define the DtxR regulon in C. diphtheriae, a DtxR repressor titration assay (DRTA) was developed and used to identify 10 previously unknown DtxR binding sites. Open reading frames downstream from seven of the newly identified DtxR binding sites are predicted to encode proteins associated with iron or heme transport. Electrophoretic mobility shift assays indicated that DtxR was able to bind to DNA fragments carrying the 19-bp operator regions, and transcriptional analysis of putative promoter elements adjacent to the binding site sequences revealed that most of these regions displayed iron- and DtxR-regulated activity. A putative siderophore biosynthesis and transport operon located downstream from one of the DtxR binding sites, designated sid, is similar to the yersiniabactin synthesis and uptake genes encoded on the Yersinia pestis high pathogenicity island. The siderophore biosynthetic genes in the sid operon contained a large deletion in the C. diphtheriae C7 strain, but the sid genes were unaffected in four clinical isolates that are representative of the dominant strains from the recent diphtheria epidemic in the former Soviet Union. Mutations in the siderophore biosynthetic genes in a clinical strain had no effect on siderophore synthesis or growth in low-iron conditions; however, a mutation in one of the putative transport proteins, cdtP, resulted in reduced growth in iron-depleted media, which suggests that this system may have a role in iron uptake. The findings from this study indicate that C. diphtheriae contains at least 18 DtxR binding sites and that DtxR may affect the expression of as many as 40 genes. PMID:14617647

  6. Improving the gene structure annotation of the apicomplexan parasite Neospora caninum fulfils a vital requirement towards an in silico-derived vaccine.

    PubMed

    Goodswen, Stephen J; Barratt, Joel L N; Kennedy, Paul J; Ellis, John T

    2015-04-01

    Neospora caninum is an apicomplexan parasite which can cause abortion in cattle, instigating major economic burden. Vaccination has been proposed as the most cost-effective control measure to alleviate this burden. Consequently the overriding aspiration for N. caninum research is the identification and subsequent evaluation of vaccine candidates in animal models. To save time, cost and effort, it is now feasible to use an in silico approach for vaccine candidate prediction. Precise protein sequences, derived from the correct open reading frame, are paramount and arguably the most important factor determining the success or failure of this approach. The challenge is that publicly available N. caninum sequences are mostly derived from gene predictions. Annotated inaccuracies can lead to erroneously predicted vaccine candidates by bioinformatics programs. This study evaluates the current N. caninum annotation for potential inaccuracies. Comparisons with annotation from a closely related pathogen, Toxoplasma gondii, are also made to distinguish patterns of inconsistency. More importantly, a mRNA sequencing (RNA-Seq) experiment is used to validate the annotation. Potential discrepancies originating from a questionable start codon context and exon boundaries were identified in 1943 protein coding sequences. We conclude, where experimental data were available, that the majority of N. caninum gene sequences were reliably predicted. Nevertheless, almost 28% of genes were identified as questionable. Given the limitations of RNA-Seq, the intention of this study was not to replace the existing annotation but to support or oppose particular aspects of it. Ideally, many studies aimed at improving the annotation are required to build a consensus. We believe this study, in providing a new resource on gene structure and annotation, is a worthy contributor to this endeavour. PMID:25747726

  7. Species boundaries in gregarine apicomplexan parasites: a case study-comparison of morphometric and molecular variability in Lecudina cf. tuzetae (Eugregarinorida, Lecudinidae).

    PubMed

    Rueckert, Sonja; Villette, Petra M A H; Leander, Brian S

    2011-01-01

    Trophozoites of gregarine apicomplexans are large feeding cells with diverse morphologies that have played a prominent role in gregarine systematics. The range of variability in trophozoite shapes and sizes can be very high even within a single species depending on developmental stages and host environmental conditions; this makes the delimitation of different species of gregarines based on morphological criteria alone very difficult. Accordingly, comparisons of morphological variability and molecular variability in gregarines are necessary to provide a pragmatic framework for establishing species boundaries within this diverse and poorly understood group of parasites. We investigated the morphological and molecular variability present in the gregarine Lecudina cf. tuzetae from the intestines of Nereis vexillosa (Polychaeta) collected in two different locations in Canada. Three distinct morphotypes of trophozoites were identified and the small subunit (SSU) rDNA was sequenced either from multicell isolates of the same morphotype or from single cells. The aim of this investigation was to determine whether the different morphotypes and localities reflected phylogenetic relatedness as inferred from the SSU rDNA sequence data. Phylogenetic analyses of the SSU rDNA demonstrated that the new sequences did not cluster according to morphotype or locality and instead were intermingled within a strongly supported clade. A comparison of 1,657 bp from 45 new sequences demonstrated divergences between 0% and 3.9%. These data suggest that it is necessary to acquire both morphological and molecular data in order to effectively delimit the "clouds" of variation associated with each gregarine species and to unambiguously reidentify these species in the future. PMID:21569160

  8. Genome-wide transcriptional response of an avian pathogenic Escherichia coli (APEC) pst mutant

    PubMed Central

    Crépin, Sébastien; Lamarche, Martin G; Garneau, Philippe; Séguin, Julie; Proulx, Julie; Dozois, Charles M; Harel, Josée

    2008-01-01

    Background Avian pathogenic E. coli (APEC) are associated with extraintestinal diseases in poultry. The pstSCAB-phoU operon belongs to the Pho regulon and encodes the phosphate specific transport (Pst) system. A functional Pst system is required for full virulence in APEC and other bacteria and contributes to resistance of APEC to serum, to cationic antimicrobial peptides and acid shock. The global mechanisms contributing to the attenuation and decreased resistance of the APEC pst mutant to environmental stresses have not been investigated at the transcriptional level. To determine the global effect of a pst mutation on gene expression, we compared the transcriptomes of APEC strain χ7122 and its isogenic pst mutant (K3) grown in phosphate-rich medium. Results Overall, 470 genes were differentially expressed by at least 1.5-fold. Interestingly, the pst mutant not only induced systems involved in phosphate acquisition and metabolism, despite phosphate availability, but also modulated stress response mechanisms. Indeed, transcriptional changes in genes associated with the general stress responses, including the oxidative stress response were among the major differences observed. Accordingly, the K3 strain was less resistant to reactive oxygen species (ROS) than the wild-type strain. In addition, the pst mutant demonstrated reduced expression of genes involved in lipopolysaccharide modifications and coding for cell surface components such as type 1 and F9 fimbriae. Phenotypic tests also established that the pst mutant was impaired in its capacity to produce type 1 fimbriae, as demonstrated by western blotting and agglutination of yeast cells, when compared to wild-type APEC strain χ7122. Conclusion Overall, our data elucidated the effects of a pst mutation on the transcriptional response, and further support the role of the Pho regulon as part of a complex network contributing to phosphate homeostasis, adaptive stress responses, and E. coli virulence. PMID:19038054

  9. Genes of the GadX-GadW regulon in Escherichia coli.

    PubMed

    Tucker, Don L; Tucker, Nancy; Ma, Zhuo; Foster, John W; Miranda, Regina L; Cohen, Paul S; Conway, Tyrrell

    2003-05-01

    Acid in the stomach is thought to be a barrier to bacterial colonization of the intestine. Escherichia coli, however, has three systems for acid resistance, which overcome this barrier. The most effective of these systems is dependent on transport and decarboxylation of glutamate. GadX regulates two genes that encode isoforms of glutamate decarboxylase critical to this system, but additional genes associated with the glutamate-dependent acid resistance system remained to be identified. The gadX gene and a second downstream araC-like transcription factor gene, gadW, were mutated separately and in combination, and the gene expression profiles of the mutants were compared to those of the wild-type strain grown in neutral and acidified media under conditions favoring induction of glutamate-dependent acid resistance. Cluster and principal-component analyses identified 15 GadX-regulated, acid-inducible genes. Reverse transcriptase mapping demonstrated that these genes are organized in 10 operons. Analysis of the strain lacking GadX but possessing GadW confirmed that GadX is a transcriptional activator under acidic growth conditions. Analysis of the strain lacking GadW but possessing GadX indicated that GadW exerts negative control over three GadX target genes. The strain lacking both GadX and GadW was defective in acid induction of most but not all GadX target genes, consistent with the roles of GadW as an inhibitor of GadX-dependent activation of some genes and an activator of other genes. Resistance to acid was decreased under certain conditions in a gadX mutant and even more so by combined mutation of gadX and gadW. However, there was no defect in colonization of the streptomycin-treated mouse model by the gadX mutant in competition with the wild type, and the gadX gadW mutant was a better colonizer than the wild type. Thus, E. coli colonization of the mouse does not appear to require glutamate-dependent acid resistance. PMID:12730179

  10. Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655.

    PubMed

    Seo, Sang Woo; Kim, Donghyuk; Szubin, Richard; Palsson, Bernhard O

    2015-08-25

    Three transcription factors (TFs), OxyR, SoxR, and SoxS, play a critical role in transcriptional regulation of the defense system for oxidative stress in bacteria. However, their full genome-wide regulatory potential is unknown. Here, we perform a genome-scale reconstruction of the OxyR, SoxR, and SoxS regulons in Escherichia coli K-12 MG1655. Integrative data analysis reveals that a total of 68 genes in 51 transcription units (TUs) belong to these regulons. Among them, 48 genes showed more than 2-fold changes in expression level under single-TF-knockout conditions. This reconstruction expands the genome-wide roles of these factors to include direct activation of genes related to amino acid biosynthesis (methionine and aromatic amino acids), cell wall synthesis (lipid A biosynthesis and peptidoglycan growth), and divalent metal ion transport (Mn(2+), Zn(2+), and Mg(2+)). Investigating the co-regulation of these genes with other stress-response TFs reveals that they are independently regulated by stress-specific TFs. PMID:26279566

  11. A Network of Paralogous Stress Response Transcription Factors in the Human Pathogen Candida glabrata

    PubMed Central

    Merhej, Jawad; Thiebaut, Antonin; Blugeon, Corinne; Pouch, Juliette; Ali Chaouche, Mohammed El Amine; Camadro, Jean-Michel; Le Crom, Stéphane; Lelandais, Gaëlle; Devaux, Frédéric

    2016-01-01

    The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq), transcriptome analyses, and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1) transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata, and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption, and iron metabolism. PMID:27242683

  12. A Network of Paralogous Stress Response Transcription Factors in the Human Pathogen Candida glabrata.

    PubMed

    Merhej, Jawad; Thiebaut, Antonin; Blugeon, Corinne; Pouch, Juliette; Ali Chaouche, Mohammed El Amine; Camadro, Jean-Michel; Le Crom, Stéphane; Lelandais, Gaëlle; Devaux, Frédéric

    2016-01-01

    The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq), transcriptome analyses, and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1) transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata, and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption, and iron metabolism. PMID:27242683

  13. Overproduction of acetate kinase activates the phosphate regulon in the absence of the phoR and phoM functions in Escherichia coli.

    PubMed Central

    Lee, T Y; Makino, K; Shinagawa, H; Nakata, A

    1990-01-01

    A DNA fragment of Escherichia coli cloned on pBR322 elevated the production of alkaline phosphatase and phosphate-binding protein in a phoR phoM strain. Nucleotide sequence analysis and enzyme assays revealed that the DNA fragment contained the ackA gene, which codes for acetate kinase. A high gene dosage of ackA was needed to induce the production of alkaline phosphatase and phosphate-binding protein in this strain. Overexpression of ackA elevated the intracellular ATP concentration, an effect that might be related to activation of the phosphate regulon in the phoR phoM strain. Images PMID:2158965

  14. Nuclear Glycolytic Enzyme Enolase of Toxoplasma gondii Functions as a Transcriptional Regulator

    PubMed Central

    Mouveaux, Thomas; Oria, Gabrielle; Werkmeister, Elisabeth; Slomianny, Christian; Fox, Barbara A.; Bzik, David J.; Tomavo, Stanislas

    2014-01-01

    Apicomplexan parasites including Toxoplasma gondii have complex life cycles within different hosts and their infectivity relies on their capacity to regulate gene expression. However, little is known about the nuclear factors that regulate gene expression in these pathogens. Here, we report that T. gondii enolase TgENO2 is targeted to the nucleus of actively replicating parasites, where it specifically binds to nuclear chromatin in vivo. Using a ChIP-Seq technique, we provide evidence for TgENO2 enrichment at the 5′ untranslated gene regions containing the putative promoters of 241 nuclear genes. Ectopic expression of HA-tagged TgENO1 or TgENO2 led to changes in transcript levels of numerous gene targets. Targeted disruption of TgENO1 gene results in a decrease in brain cyst burden of chronically infected mice and in changes in transcript levels of several nuclear genes. Complementation of this knockout mutant with ectopic TgENO1-HA fully restored normal transcript levels. Our findings reveal that enolase functions extend beyond glycolytic activity and include a direct role in coordinating gene regulation in T. gondii. PMID:25153525

  15. Nuclear glycolytic enzyme enolase of Toxoplasma gondii functions as a transcriptional regulator.

    PubMed

    Mouveaux, Thomas; Oria, Gabrielle; Werkmeister, Elisabeth; Slomianny, Christian; Fox, Barbara A; Bzik, David J; Tomavo, Stanislas

    2014-01-01

    Apicomplexan parasites including Toxoplasma gondii have complex life cycles within different hosts and their infectivity relies on their capacity to regulate gene expression. However, little is known about the nuclear factors that regulate gene expression in these pathogens. Here, we report that T. gondii enolase TgENO2 is targeted to the nucleus of actively replicating parasites, where it specifically binds to nuclear chromatin in vivo. Using a ChIP-Seq technique, we provide evidence for TgENO2 enrichment at the 5' untranslated gene regions containing the putative promoters of 241 nuclear genes. Ectopic expression of HA-tagged TgENO1 or TgENO2 led to changes in transcript levels of numerous gene targets. Targeted disruption of TgENO1 gene results in a decrease in brain cyst burden of chronically infected mice and in changes in transcript levels of several nuclear genes. Complementation of this knockout mutant with ectopic TgENO1-HA fully restored normal transcript levels. Our findings reveal that enolase functions extend beyond glycolytic activity and include a direct role in coordinating gene regulation in T. gondii. PMID:25153525

  16. The Unfolded Protein Response in the Protozoan Parasite Toxoplasma gondii Features Translational and Transcriptional Control

    PubMed Central

    Joyce, Bradley R.; Tampaki, Zoi; Kim, Kami

    2013-01-01

    The unfolded protein response (UPR) is an important regulatory network that responds to perturbations in protein homeostasis in the endoplasmic reticulum (ER). In mammalian cells, the UPR features translational and transcriptional mechanisms of gene expression aimed at restoring proteostatic control. A central feature of the UPR is phosphorylation of the α subunit of eukaryotic initiation factor-2 (eIF2) by PERK (EIF2AK3/PEK), which reduces the influx of nascent proteins into the ER by lowering global protein synthesis, coincident with preferential translation of key transcription activators of genes that function to expand the processing capacity of this secretory organelle. Upon ER stress, the apicomplexan parasite Toxoplasma gondii is known to induce phosphorylation of Toxoplasma eIF2α and lower translation initiation. To characterize the nature of the ensuing UPR in this parasite, we carried out microarray analyses to measure the changes in the transcriptome and in translational control during ER stress. We determined that a collection of transcripts linked with the secretory process are induced in response to ER stress, supporting the idea that a transcriptional induction phase of the UPR occurs in Toxoplasma. Furthermore, we determined that about 500 gene transcripts showed enhanced association with translating ribosomes during ER stress. Many of these target genes are suggested to be involved in gene expression, including JmjC5, which continues to be actively translated during ER stress. This study indicates that Toxoplasma triggers a UPR during ER stress that features both translational and transcriptional regulatory mechanisms, which is likely to be important for parasite invasion and development. PMID:23666622

  17. Boosting transcription by transcription: enhancer-associated transcripts.

    PubMed

    Darrow, Emily M; Chadwick, Brian P

    2013-12-01

    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review, we focus on the possible functions of enhancer transcription by highlighting several recent enhancer RNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression. PMID:24178450

  18. Regulation of the phosphate regulon in Escherichia coli K-12: regulation of the negative regulatory gene phoU and identification of the gene product.

    PubMed Central

    Nakata, A; Amemura, M; Shinagawa, H

    1984-01-01

    The phoU gene is one of the negative regulatory genes of the pho regulon of Escherichia coli. The DNA fragment carrying phoU has been cloned on pBR322 (Amemura et al., J. Bacteriol. 152:692-701, 1982). Further subcloning, Tn1000 insertion inactivation, and complementation tests localized the phoU gene within a 1.1-kilobase region on the cloned DNA fragment. The gene product of phoU was identified by the maxicell method as a protein with an approximate molecular weight of 27,000. A hybrid plasmid that contains a phoU'-lac'Z fused gene was constructed in vitro. This plasmid enabled us to study phoU gene expression by measuring the beta-galactosidase level in the cells. The plasmid was introduced into various regulatory mutants related to the pho regulon, and phoU gene expression in these strains was studied under limited and excess phosphate conditions. It was found that phoU is expressed at a higher level when the cells are cultured under the excess phosphate condition. The higher phoU expression was observed in a phoB mutant and a phoR-phoM double mutant. The implications of these findings for the regulation of pho genes are discussed. Images PMID:6090402

  19. Reconstitution of maltose chemotaxis in Escherichia coli by addition of maltose-binding protein to calcium-treated cells of maltose regulon mutants.

    PubMed

    Brass, J M; Manson, M D

    1984-03-01

    Maltose chemotaxis was reconstituted in delta malE cells lacking maltose-binding protein (MBP). Purified MBP was introduced into intact cells during incubation with 250 mM CaCl2 in Tris-hydrochloride buffer at 0 degrees C. After removal of extracellular CaCl2 and MBP, chemotaxis was measured with tethered bacteria in a flow chamber or with free-swimming cells in a capillary assay. About 20% of tethered cells responded to 10(-4) M maltose; the mean response times were about half those of CaCl2-treated wild-type cells (100 s as opposed to 190 s). In capillary tests, the maltose response of reconstituted cells was between 15 and 40% of the aspartate response, about the same percentage as in wild-type cells. The best reconstitution was seen with 0.5 to 1 mM MBP in the reconstitution mixture, which is similar to the periplasmic MBP concentration estimated for maltose-induced wild-type cells. Strains containing large deletions of the malB region and malT mutants lacking the positive regulator gene of the mal regulon also could be reconstituted for maltose chemotaxis, showing that no product of the mal regulon other than MBP is essential for maltose chemotaxis. PMID:6321442

  20. Nitrogen Fixation and Molecular Oxygen: Comparative Genomic Reconstruction of Transcription Regulation in Alphaproteobacteria.

    PubMed

    Tsoy, Olga V; Ravcheev, Dmitry A; Čuklina, Jelena; Gelfand, Mikhail S

    2016-01-01

    Biological nitrogen fixation plays a crucial role in the nitrogen cycle. An ability to fix atmospheric nitrogen, reducing it to ammonium, was described for multiple species of Bacteria and Archaea. The transcriptional regulatory network for nitrogen fixation was extensively studied in several representatives of the class Alphaproteobacteria. This regulatory network includes the activator of nitrogen fixation NifA, working in tandem with the alternative sigma-factor RpoN as well as oxygen-responsive regulatory systems, one-component regulators FnrN/FixK and two-component system FixLJ. Here we used a comparative genomics approach for in silico study of the transcriptional regulatory network in 50 genomes of Alphaproteobacteria. We extended the known regulons and proposed the scenario for the evolution of the nitrogen fixation transcriptional network. The reconstructed network substantially expands the existing knowledge of transcriptional regulation in nitrogen-fixing microorganisms and can be used for genetic experiments, metabolic reconstruction, and evolutionary analysis. PMID:27617010

  1. Nitrogen Fixation and Molecular Oxygen: Comparative Genomic Reconstruction of Transcription Regulation in Alphaproteobacteria

    PubMed Central

    Tsoy, Olga V.; Ravcheev, Dmitry A.; Čuklina, Jelena; Gelfand, Mikhail S.

    2016-01-01

    Biological nitrogen fixation plays a crucial role in the nitrogen cycle. An ability to fix atmospheric nitrogen, reducing it to ammonium, was described for multiple species of Bacteria and Archaea. The transcriptional regulatory network for nitrogen fixation was extensively studied in several representatives of the class Alphaproteobacteria. This regulatory network includes the activator of nitrogen fixation NifA, working in tandem with the alternative sigma-factor RpoN as well as oxygen-responsive regulatory systems, one-component regulators FnrN/FixK and two-component system FixLJ. Here we used a comparative genomics approach for in silico study of the transcriptional regulatory network in 50 genomes of Alphaproteobacteria. We extended the known regulons and proposed the scenario for the evolution of the nitrogen fixation transcriptional network. The reconstructed network substantially expands the existing knowledge of transcriptional regulation in nitrogen-fixing microorganisms and can be used for genetic experiments, metabolic reconstruction, and evolutionary analysis. PMID:27617010

  2. Decoding Biomass-Sensing Regulons of Clostridium thermocellum Alternative Sigma-I Factors in a Heterologous Bacillus subtilis Host System

    PubMed Central

    Rozman Grinberg, Inna; Garty, Yuval; Bayer, Edward A.; Shoham, Yuval; Lamed, Raphael; Borovok, Ilya

    2016-01-01

    The Gram-positive, anaerobic, cellulolytic, thermophile Clostridium (Ruminiclostridium) thermocellum secretes a multi-enzyme system called the cellulosome to solubilize plant cell wall polysaccharides. During the saccharolytic process, the enzymatic composition of the cellulosome is modulated according to the type of polysaccharide(s) present in the environment. C. thermocellum has a set of eight alternative RNA polymerase sigma (σ) factors that are activated in response to extracellular polysaccharides and share sequence similarity to the Bacillus subtilis σI factor. The aim of the present work was to demonstrate whether individual C. thermocellum σI-like factors regulate specific cellulosomal genes, focusing on C. thermocellum σI6 and σI3 factors. To search for putative σI6- and σI3-dependent promoters, bioinformatic analysis of the upstream regions of the cellulosomal genes was performed. Because of the limited genetic tools available for C. thermocellum, the functionality of the predicted σI6- and σI3-dependent promoters was studied in B. subtilis as a heterologous host. This system enabled observation of the activation of 10 predicted σI6-dependent promoters associated with the C. thermocellum genes: sigI6 (itself, Clo1313_2778), xyn11B (Clo1313_0522), xyn10D (Clo1313_0177), xyn10Z (Clo1313_2635), xyn10Y (Clo1313_1305), cel9V (Clo1313_0349), cseP (Clo1313_2188), sigI1 (Clo1313_2174), cipA (Clo1313_0627), and rsgI5 (Clo1313_0985). Additionally, we observed the activation of 4 predicted σI3-dependent promoters associated with the C. thermocellum genes: sigI3 (itself, Clo1313_1911), pl11 (Clo1313_1983), ce12 (Clo1313_0693) and cipA. Our results suggest possible regulons of σI6 and σI3 in C. thermocellum, as well as the σI6 and σI3 promoter consensus sequences. The proposed -35 and -10 promoter consensus elements of σI6 are CNNAAA and CGAA, respectively. Additionally, a less conserved CGA sequence next to the C in the -35 element and a highly

  3. Decoding Biomass-Sensing Regulons of Clostridium thermocellum Alternative Sigma-I Factors in a Heterologous Bacillus subtilis Host System.

    PubMed

    Muñoz-Gutiérrez, Iván; Ortiz de Ora, Lizett; Rozman Grinberg, Inna; Garty, Yuval; Bayer, Edward A; Shoham, Yuval; Lamed, Raphael; Borovok, Ilya

    2016-01-01

    The Gram-positive, anaerobic, cellulolytic, thermophile Clostridium (Ruminiclostridium) thermocellum secretes a multi-enzyme system called the cellulosome to solubilize plant cell wall polysaccharides. During the saccharolytic process, the enzymatic composition of the cellulosome is modulated according to the type of polysaccharide(s) present in the environment. C. thermocellum has a set of eight alternative RNA polymerase sigma (σ) factors that are activated in response to extracellular polysaccharides and share sequence similarity to the Bacillus subtilis σI factor. The aim of the present work was to demonstrate whether individual C. thermocellum σI-like factors regulate specific cellulosomal genes, focusing on C. thermocellum σI6 and σI3 factors. To search for putative σI6- and σI3-dependent promoters, bioinformatic analysis of the upstream regions of the cellulosomal genes was performed. Because of the limited genetic tools available for C. thermocellum, the functionality of the predicted σI6- and σI3-dependent promoters was studied in B. subtilis as a heterologous host. This system enabled observation of the activation of 10 predicted σI6-dependent promoters associated with the C. thermocellum genes: sigI6 (itself, Clo1313_2778), xyn11B (Clo1313_0522), xyn10D (Clo1313_0177), xyn10Z (Clo1313_2635), xyn10Y (Clo1313_1305), cel9V (Clo1313_0349), cseP (Clo1313_2188), sigI1 (Clo1313_2174), cipA (Clo1313_0627), and rsgI5 (Clo1313_0985). Additionally, we observed the activation of 4 predicted σI3-dependent promoters associated with the C. thermocellum genes: sigI3 (itself, Clo1313_1911), pl11 (Clo1313_1983), ce12 (Clo1313_0693) and cipA. Our results suggest possible regulons of σI6 and σI3 in C. thermocellum, as well as the σI6 and σI3 promoter consensus sequences. The proposed -35 and -10 promoter consensus elements of σI6 are CNNAAA and CGAA, respectively. Additionally, a less conserved CGA sequence next to the C in the -35 element and a highly

  4. Induction of the heat shock regulon of Escherichia coli markedly increases production of bacterial viruses at high temperatures.

    PubMed Central

    Wiberg, J S; Mowrey-McKee, M F; Stevens, E J

    1988-01-01

    Production of bacteriophages T2, T4, and T6 at 42.8 to 44 degrees C was increased from 8- to 260-fold by adapting the Escherichia coli host (grown at 30 degrees C) to growth at the high temperature for 8 min before infection; this increase was abolished if the host htpR (rpoH) gene was inactive. Others have shown that the htpR protein increases or activates the synthesis of at least 17 E. coli heat shock proteins upon raising the growth temperature above a certain level. At 43.8 to 44 degrees C in T4-infected, unadapted cells, the rates of RNA, DNA, and protein synthesis were about 100, 70, and 70%, respectively, of those in T4-infected, adapted cells. Production of the major processed capsid protein, gp23, was reduced significantly more than that of most other T4 proteins in unadapted cells relative to adapted cells. Only 4.6% of the T4 DNA made in unadapted cells was resistant to micrococcal nuclease, versus 50% in adapted cells. Thus, defective maturation of T4 heads appears to explain the failure of phage production in unadapted cells. Overproduction of the heat shock protein GroEL from plasmids restored T4 production in unadapted cells to about 50% of that seen in adapted cells. T4-infected, adapted E. coli B at around 44 degrees C exhibited a partial tryptophan deficiency; this correlated with reduced uptake of uracil that is probably caused by partial induction of stringency. Production of bacteriophage T7 at 44 degrees C was increased two- to fourfold by adapting the host to 44 degrees C before infection; evidence against involvement of the htpR (rpoH) gene is presented. This work and recent work with bacteriophage lambda (C. Waghorne and C.R. Fuerst, Virology 141:51-64, 1985) appear to represent the first demonstrations for any virus that expression of the heat shock regulon of a host is necessary for virus production at high temperature. Images PMID:2446014

  5. Transcription factors that defend bacteria against reactive oxygen species

    PubMed Central

    Imlay, James A.

    2015-01-01

    Bacteria live in a toxic world in which their competitors excrete hydrogen peroxide or superoxide-generating redox-cycling compounds. They protect themselves by activating regulons controlled by the OxyR, PerR, and SoxR transcription factors. OxyR and PerR sense peroxide when it oxidizes key thiolate or iron moieties, respectively; they then induce overlapping sets of proteins that defend their vulnerable metalloenzymes. An additional role for OxyR in detecting electrophilic compounds is possible. In some non-enteric bacteria SoxR appears to control the synthesis and export of redox-cycling compounds, whereas in the enteric bacteria it defends the cell against the same agents. When these compounds oxidize its iron-sulfur cluster, SoxR induces proteins that exclude, excrete, or modify them. It also induces enzymes that defend the cell against the superoxide that such compounds make. Recent work has brought new insight to the biochemistry and physiology of these responses, and comparative studies have clarified their evolutionary histories. PMID:26070785

  6. Transcription in archaea

    NASA Technical Reports Server (NTRS)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)

    1999-01-01

    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  7. Relationship of the superoxide dismutase genes, sodA and sodB, to the iron uptake (/ital fur/) regulon in /ital Escherichia coli/ K-12

    SciTech Connect

    Niederhoffer, E.C.; Naranjo, C.M.; Fee, J.A.

    1988-01-01

    Expression of sodA, as indicated by MnSod activity is normal in /ital fur/ mutants. This suggests that sodA is not a member of the /ital fur/ regulon and that the putative Fe-binding, regulatory protein of sodA, suggested by Moody and Hassan is not the Fur protein. by contrast, expression of sodB, as indicated by FeSod activity, is completely blocked in /ital fur/ mutants and the effect is restored by transformation with a plasmid having a normal /ital fur/ locus. The observations suggest that Fur, either directly or indirectly, controls SodB biosynthesis. Additional observations are described which indicate that SodB and Fur act together in a complicated fashion to control the biosynthesis of enterobactin. 26 refs., 3 tabs.

  8. Regulons of the Pseudomonas syringae pv. tomato DC3000 iron starvation sigma factors PSPTO_0444, PSPTO_1209 and PSPTO_1286

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas syringae is a globally dispersed environmental bacteria that is well known for its ability to cause destructive plant diseases in agricultural and horticultural settings. The ability of bacteria to survive in diverse environments is correlated with a large number of transcription regulat...

  9. MalT, the regulatory protein of the Escherichia coli maltose system, is an ATP-dependent transcriptional activator.

    PubMed

    Richet, E; Raibaud, O

    1989-03-01

    We show that MalT, the transcriptional activator of the Escherichia coli maltose regulon, specifically binds ATP and dATP with a high affinity (Kd = 0.4 microM) and exhibits a weak ATPase activity. Using an abortive initiation assay, we further show that activation of open complex formation by MalT depends on the presence of ATP in addition to that of maltotriose, the inducer of the maltose system. Similar experiments in which ATP was replaced by ADP or AMP-PNP, a non-hydrolysable analogue of ATP, demonstrate that this reaction does not require ATP hydrolysis. As revealed by DNase I footprinting, both ATP and maltotriose are required for the binding of the MalT protein to the mal promoter DNA. PMID:2524384

  10. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    PubMed Central

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.

    2015-01-01

    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by “top-down” and “guide-gene” approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via “top-down” approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by “guide-gene” approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  11. Structural determinants of DNA binding by a P. falciparum ApiAP2 transcriptional regulator

    PubMed Central

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.; Llinás, Manuel

    2009-01-01

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan AP2 (ApiAP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical ApiAP2 protein, PF14_0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14_0633 AP2 domain bound to DNA reveals a β-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent α-helix supports the β-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened or eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14_0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the α-helices of the AP2 domains pack against the β-sheets of the dimer mates. DNA-induced dimerization of PF14_0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multi-site binding mode, at least two copies of the consensus sequence recognized by PF14_0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation. PMID:19913037

  12. Transcription Regulation in Archaea.

    PubMed

    Gehring, Alexandra M; Walker, Julie E; Santangelo, Thomas J

    2016-07-15

    The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495

  13. Control of Proteobacterial Central Carbon Metabolism by the HexR Transcriptional Regulator. A Case Study in Shewanella oneidensis

    SciTech Connect

    Leyn, Semen; Li, Xiaoqing; Zheng, Qijing; Novichkov, Pavel; Reed, Samantha B.; Romine, Margaret F.; Fredrickson, Jim K.; Yang, Chen; Osterman, Andrei L.; Rodionov, Dmitry A.

    2011-08-17

    Bacteria exploit multiple mechanisms for controlling central carbon metabolism (CCM). Thus, a bioinformatic analysis together with some experimental data implicated HexR transcriptional factor as a global CCM regulator in some lineages of Gammaproteobacteria operating as a functional replacement of Cra regulator characteristic of Enterobacteriales. In this study we combined a large-scale comparative genomic reconstruction of HexRcontrolled regulons in 87 species of Proteobacteria with the detailed experimental analysis of HexR regulatory network in Shewanella oneidensis model system. Although nearly all of the HexR-controlled genes are associated with CCM, remarkable variations were revealed in the scale (from 1-2 target operons in Enterobacteriales up to 20 operons in Aeromonadales) and gene content of HexR regulons between 11 compared lineages. A predicted 17-bp pseudo-palindrome with a consensus tTGTAATwwwATTACa, was confirmed as HexR-binding motif for 15 target operons (comprising 30 genes) by in vitro binding assays. The negative effect of the key CCM intermediate, 2-keto-3-deoxy-6- phosphogluconate, on the DNA-regulator complex formation was verified. A dual mode of HexR action on various target promoters, repression of genes involved in catabolic pathways and activation of gluconeogenic genes, was for the first time predicted by the bioinformatc analysis and experimentally verified by changed gene expression pattern in S. oneidensis AhexR mutant. Phenotypic profiling revealed the inability of this mutant to grow on lactate or pyruvate as a single carbon source. A comparative metabolic flux analysis of wild-type and mutant strains of S. oneidensis using 13Clactate labeling and GC-MS analysis confirmed the hypothesized HexR role as a master regulator of gluconeogenic flux from pyruvate via the transcriptional activation of phosphoenolpyruvate synthase (PpsA).

  14. The TyrR transcription factor regulates the divergent akr-ipdC operons of Enterobacter cloacae UW5.

    PubMed

    Coulson, Thomas J D; Patten, Cheryl L

    2015-01-01

    The TyrR transcription factor regulates genes involved in the uptake and biosynthesis of aromatic amino acids in Enterobacteriaceae. Genes may be positively or negatively regulated depending on the presence or absence of each aromatic amino acid, all three of which function as cofactors for TyrR. In this report we detail the transcriptional control of two divergently transcribed genes, akr and ipdC, by TyrR, elucidated by promoter fusion expression assays and electrophoretic mobility shift assays to assess protein-DNA interactions. Expression of both genes was shown to be controlled by TyrR via interactions with two TyrR boxes located within the akr-ipdC intergenic region. Expression of ipdC required TyrR bound to the proximal strong box, and is strongly induced by phenylalanine, and to a lesser extent by tryptophan and tyrosine. Down-regulation of akr was reliant on interactions with the weak box, and may also require a second, as yet unidentified protein for further repression. Tyrosine enhanced repression of akr. Electrophoretic mobility shift assays demonstrated that TyrR interacts with both the strong and weak boxes, and that binding of the weak box in vitro requires an intact adjacent strong box. While the strong box shows a high degree of conservation with the TyrR binding site consensus sequence, the weak box has atypical spacing of the two half sites comprising the palindromic arms. Site-directed mutagenesis demonstrated sequence-specific interaction between TyrR and the weak box. This is the first report of TyrR-controlled expression of two divergent protein-coding genes, transcribed from independent promoters. Moreover, the identification of a predicted aldo-keto reductase as a member of the TyrR regulon further extends the function of the TyrR regulon. PMID:25811953

  15. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  16. Plant transcription factors.

    PubMed

    Meshi, T; Iwabuchi, M

    1995-12-01

    Transcriptional regulation of gene expression relies on the recognition of promoter elements by transcription factors. In the past several years, a considerable number of (putative) transcription factors have been identified in plants. Some genes coding for these factors were isolated by south-western screening with oligonucleotides as a probe or by homology-based screening, and others were initially isolated by genetic means and subsequently identified as the genes for transcription factors. These transcription factors often form families of structurally related proteins with similar DNA-binding specificities and in addition, they are sometimes involved in related phenomena. Some groups of factors homo- and/or heterodimerize to increase the length and variability of the target sequences. Transcriptional activators, in general, comprise a modular activation domain. The activities of the transcription factors are controlled by post-translational modification, like phosphorylation and glycosylation, as well as at the levels of nuclear transport, oligomerization, etc. In this review, we will summarize the current knowledge of plant transcription factors to help understand the mechanistic aspects of the transcriptional regulation of genes. PMID:8589926

  17. Transcriptional activators in yeast

    PubMed Central

    2006-01-01

    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  18. ATP-dependent RecG Helicase Is Required for the Transcriptional Regulator OxyR Function in Pseudomonas species*

    PubMed Central

    Yeom, Jinki; Lee, Yunho; Park, Woojun

    2012-01-01

    The oxyR gene appears to reside in an operon with the recG helicase gene in many bacteria, including pathogenic Pseudomonas aeruginosa and Pseudomonas putida. Analysis of P. putida transcriptomes shows that many OxyR-controlled genes are regulated by the ATP-dependent RecG helicase and that RecG alone modulates the expression of many genes. We found that purified RecG binds to the promoters of many OxyR-controlled genes and that expression of these genes was not induced under conditions of oxidative stress in recG mutants of P. aeruginosa, P. putida, and Escherichia coli. In vitro data revealed that promoters containing palindromic sequences are essential for RecG binding and that single-strand binding proteins and ATP are also needed for RecG to promote transcription, whereas a magnesium ion has the opposite effect. The OxyR tetramer preferentially binds to promoters after RecG has generated linear DNA in the presence of ATP; otherwise, the OxyR dimer has higher affinity. This study provides new insights into the mechanism of bacterial transcription by demonstrating that RecG might be required for the induction of the OxyR regulon by unwinding palindromic DNA for transcription. This work describes a novel bacterial transcriptional function by RecG helicase with OxyR and may provide new targets for controlling Pseudomonas species pathogen. PMID:22621928

  19. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

    PubMed Central

    Damienikan, Aliaksandr U.

    2016-01-01

    The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  20. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals.

    PubMed

    Nikolaichik, Yevgeny; Damienikan, Aliaksandr U

    2016-01-01

    The majority of bacterial genome annotations are currently automated and based on a 'gene by gene' approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn't fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  1. The yeast Aft2 transcription factor determines selenite toxicity by controlling the low affinity phosphate transport system.

    PubMed

    Pérez-Sampietro, María; Serra-Cardona, Albert; Canadell, David; Casas, Celia; Ariño, Joaquín; Herrero, Enrique

    2016-01-01

    The yeast Saccharomyces cerevisiae is employed as a model to study the cellular mechanisms of toxicity and defense against selenite, the most frequent environmental selenium form. We show that yeast cells lacking Aft2, a transcription factor that together with Aft1 regulates iron homeostasis, are highly sensitive to selenite but, in contrast to aft1 mutants, this is not rescued by iron supplementation. The absence of Aft2 strongly potentiates the transcriptional responses to selenite, particularly for DNA damage- and oxidative stress-responsive genes, and results in intracellular hyperaccumulation of selenium. Overexpression of PHO4, the transcriptional activator of the PHO regulon under low phosphate conditions, partially reverses sensitivity and hyperaccumulation of selenite in a way that requires the presence of Spl2, a Pho4-controlled protein responsible for post-transcriptional downregulation of the low-affinity phosphate transporters Pho87 and Pho90. SPL2 expression is strongly downregulated in aft2 cells, especially upon selenite treatment. Selenite hypersensitivity of aft2 cells is fully rescued by deletion of PHO90, suggesting a major role for Pho90 in selenite uptake. We propose that the absence of Aft2 leads to enhanced Pho90 function, involving both Spl2-dependent and independent events and resulting in selenite hyperaccumulation and toxicity. PMID:27618952

  2. cse15, cse60, and csk22 are new members of mother-cell-specific sporulation regulons in Bacillus subtilis.

    PubMed Central

    Henriques, A O; Bryan, E M; Beall, B W; Moran, C P

    1997-01-01

    We report on the characterization of three new transcription units expressed during sporulation in Bacillus subtilis. Two of the units, cse15 and cse60, were mapped at about 123 degrees and 62 degrees on the genetic map, respectively. Their transcription commenced around h 2 of sporulation and showed an absolute requirement for sigmaE. Maximal expression of both cse15 and cse60 further depended on the DNA-binding protein SpoIIID. Primer extension results revealed -10 and -35 sequences upstream of the cse15 and cse60 coding sequences very similar to those utilized by sigmaE-containing RNA polymerase. Alignment of these and other regulatory regions led to a revised consensus sequence for sigmaE-dependent promoters. A third transcriptional unit, designated csk22, was localized at approximately 173 degrees on the chromosome. Transcription of csk22 was activated at h 4 of sporulation, required the late mother-cell regulator sigmaK, and was repressed by the GerE protein. Sequences in the csk22 promoter region were similar to those of other sigmaK-dependent promoters. The cse60 locus was deduced to encode an acidic product of only 60 residues. A 37.6-kDa protein apparently encoded by cse15 was weakly related to the heavy chain of myosins, as well as to other myosin-like proteins, and is predicted to contain a central, 100 residue-long coiled-coil domain. Finally, csk22 is inferred to encode a 18.2-kDa hydrophobic product with five possible membrane-spanning helices, which could function as a transporter. PMID:8990290

  3. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  4. Divergent RNA transcription

    PubMed Central

    Naughton, Catherine; Corless, Samuel; Gilbert, Nick

    2013-01-01

    New approaches using biotinylated-psoralen as a probe for investigating DNA structure have revealed new insights into the relationship between DNA supercoiling, transcription and chromatin compaction. We explore a hypothesis that divergent RNA transcription generates negative supercoiling at promoters facilitating initiation complex formation and subsequent promoter clearance. PMID:23863199

  5. Global Transcriptional Responses of the Toxic Cyanobacterium, Microcystis aeruginosa, to Nitrogen Stress, Phosphorus Stress, and Growth on Organic Matter

    PubMed Central

    Harke, Matthew J.; Gobler, Christopher J.

    2013-01-01

    Whole transcriptome shotgun sequencing (RNA-seq) was used to assess the transcriptomic response of the toxic cyanobacterium Microcystis aeruginosa during growth with low levels of dissolved inorganic nitrogen (low N), low levels of dissolved inorganic phosphorus (low P), and in the presence of high levels of high molecular weight dissolved organic matter (HMWDOM). Under low N, one third of the genome was differentially expressed, with significant increases in transcripts observed among genes within the nir operon, urea transport genes (urtBCDE), and amino acid transporters while significant decreases in transcripts were observed in genes related to photosynthesis. There was also a significant decrease in the transcription of the microcystin synthetase gene set under low N and a significant decrease in microcystin content per Microcystis cell demonstrating that N supply influences cellular toxicity. Under low P, 27% of the genome was differentially expressed. The Pho regulon was induced leading to large increases in transcript levels of the alkaline phosphatase phoX, the Pst transport system (pstABC), and the sphX gene, and transcripts of multiple sulfate transporter were also significantly more abundant. While the transcriptional response to growth on HMWDOM was smaller (5–22% of genes differentially expressed), transcripts of multiple genes specifically associated with the transport and degradation of organic compounds were significantly more abundant within HMWDOM treatments and thus may be recruited by Microcystis to utilize these substrates. Collectively, these findings provide a comprehensive understanding of the nutritional physiology of this toxic, bloom-forming cyanobacterium and the role of N in controlling microcystin synthesis. PMID:23894552

  6. The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis

    PubMed Central

    2004-01-01

    Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: σE, σK, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The σE factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the σE regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of σK. Next, σK activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by σK while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

  7. Control of transcription of gal repressor and isorepressor genes in Escherichia coli.

    PubMed

    Weickert, M J; Adhya, S

    1993-01-01

    Two regulatory proteins, Gal repressor and isorepressor, control the expression of the gal and mgl operons in Escherichia coli. The transcription start sites for galR and galS, the genes for the repressor and isorepressor, were determined by primer extension of in vivo transcripts. Study of the promoter-lacZ gene fusions introduced into the chromosome indicated that galS expression was elevated in cells in which the normal galS gene was interrupted, but not in cells in which the galR gene was deleted. When both genes were disrupted, galS expression was further elevated. Expression from the galS promoter was stimulated by the addition of D-fucose, repressed by glucose, and dependent on cyclic AMP receptor protein (CRP). Expression of a similar gene fusion of the galR promoter to lacZ was unregulated. Both galR and galS genes contain two potential operator sites (OE and OI) and a CRP-binding site. The arrangement of OE, OI, and the CRP-binding site in the galS gene is analogous to the arrangement in the gal and mgl promoters, but the arrangement in galR is atypical. The increased concentration of the isorepressor when inducer is present may facilitate early shutoff of the isorepressor-regulated genes of the gal regulon when inducer (substrate) concentration falls. PMID:8416900

  8. ASTP Onboard Voice Transcription

    NASA Technical Reports Server (NTRS)

    1975-01-01

    The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

  9. Two stress sensor proteins for the expression of sigmaE regulon: DegS and RseB.

    PubMed

    Kim, Dong Young

    2015-05-01

    In E. coli, sigmaE-dependent transcription is controlled by regulated-proteolysis of RseA. RseA, which holds sigmaE as an anti-sigma factor, is sequentially digested by DegS, RseP and cytoplasmic proteases to liberate sigmaE in response to dysfunction in outer-membrane biogenesis. Additionally, the sequential proteolysis is regulated by RseB binding to RseA (Fig. 1A). Direct interaction between RseA and RseB inhibits RseA-cleavage by DegS. Both proteolytic activation of DegS and binding disruption of RseB are thus required to initiate sigmaE-stress response. For the induction of sigmaEstress response, DegS and RseB recognize the states of OMP and LPS for outer-membrane biogenesis. DegS is activated by binding of unfolded OMPs and RseB binding to RseA is antagonized by LPS accumulated in periplasm. In this regard, DegS and RseB are proposed to be stress sensor proteins for sigmaE signal transduction. Interestingly, biogenesis of OMP and LPS appears to cross-talk with each other, indicating that dysfunction of either OMP or LPS can initiate RseA proteolysis. This review aims to briefly introduce two stress sensor proteins, DegS and RseB, which regulate sigmaEdependent transcription. PMID:25935301

  10. Characterization of the Escherichia coli σS core regulon by Chromatin Immunoprecipitation-sequencing (ChIP-seq) analysis

    PubMed Central

    Peano, Clelia; Wolf, Johannes; Demol, Julien; Rossi, Elio; Petiti, Luca; De Bellis, Gianluca; Geiselmann, Johannes; Egli, Thomas; Lacour, Stephan; Landini, Paolo

    2015-01-01

    In bacteria, selective promoter recognition by RNA polymerase is achieved by its association with σ factors, accessory subunits able to direct RNA polymerase “core enzyme” (E) to different promoter sequences. Using Chromatin Immunoprecipitation-sequencing (ChIP-seq), we searched for promoters bound by the σS-associated RNA polymerase form (EσS) during transition from exponential to stationary phase. We identified 63 binding sites for EσS overlapping known or putative promoters, often located upstream of genes (encoding either ORFs or non-coding RNAs) showing at least some degree of dependence on the σS-encoding rpoS gene. EσS binding did not always correlate with an increase in transcription level, suggesting that, at some σS-dependent promoters, EσS might remain poised in a pre-initiation state upon binding. A large fraction of EσS-binding sites corresponded to promoters recognized by RNA polymerase associated with σ70 or other σ factors, suggesting a considerable overlap in promoter recognition between different forms of RNA polymerase. In particular, EσS appears to contribute significantly to transcription of genes encoding proteins involved in LPS biosynthesis and in cell surface composition. Finally, our results highlight a direct role of EσS in the regulation of non coding RNAs, such as OmrA/B, RyeA/B and SibC. PMID:26020590

  11. Cryptosporidium parvum: functional complementation of a parasite transcriptional coactivator CpMBF1 in yeast.

    PubMed

    Zhu, G; LaGier, M J; Hirose, S; Keithly, J S

    2000-12-01

    We report here the identification of a novel multiprotein bridging factor type 1 from the apicomplexan Cryptosporidium parvum (CpMBF1), one of the opportunistic pathogens in AIDS patients. In slime molds, insects, and humans, MBF1-regulated systems have been associated with cell differentiation, which indicates that CpMBF1 could be responsible for the activation of similar systems in C. parvum during its complex life cycle. Because of the difficulties and high cost in obtaining sufficient and purified C. parvum material for molecular and biochemical analyses, well-characterized yeast genetic systems may be useful for investigating the functions of C. parvum genes. In this study, the function of CpMBF1 as an interconnecting element between a DNA-binding regulator and TATA-box-binding protein (TBP) was confirmed using a yeast complementation assay. Under conditions of histidine starvation, an MBF1-deficient strain of Saccharomyces cerevisiae was unable to activate the HIS3 gene, which encodes imidazoleglycerol-phosphate dehydratase (IGPDH), and thus became sensitive to 3-amino triazole, an inhibitor of this enzyme. Upon introduction of parasite CpMBF1 into S. cerevisiae, 3-amino triazole resistance of the MBF1-deficient strain was restored to wild-type levels, and Northern blot analysis revealed that CpMBF1 was able to activate HIS3 transcription in response to histidine starvation. PMID:11162372

  12. Function of the Pseudomonas aeruginosa NrdR Transcription Factor: Global Transcriptomic Analysis and Its Role on Ribonucleotide Reductase Gene Expression

    PubMed Central

    Crespo, Anna; Pedraz, Lucas; Torrents, Eduard

    2015-01-01

    Ribonucleotide reductases (RNRs) are a family of sophisticated enzymes responsible for the synthesis of the deoxyribonucleotides (dNTPs), the building blocks for DNA synthesis and repair. Although any living cell must contain one RNR activity to continue living, bacteria have the capacity to encode different RNR classes in the same genome, allowing them to adapt to different environments and growing conditions. Pseudomonas aeruginosa is well known for its adaptability and surprisingly encodes all three known RNR classes (Ia, II and III). There must be a complex transcriptional regulation network behind this RNR activity, dictating which RNR class will be expressed according to specific growing conditions. In this work, we aim to uncover the role of the transcriptional regulator NrdR in P. aeruginosa. We demonstrate that NrdR regulates all three RNR classes, being involved in differential control depending on whether the growth conditions are aerobic or anaerobic. Moreover, we also identify for the first time that NrdR is not only involved in controlling RNR expression but also regulates topoisomerase I (topA) transcription. Finally, to obtain the entire picture of NrdR regulon, we performed a global transcriptomic analysis comparing the transcription profile of wild-type and nrdR mutant strains. The results provide many new data about the regulatory network that controls P. aeruginosa RNR transcription, bringing us a step closer to the understanding of this complex system. PMID:25909779

  13. Transcription factor Rex in regulation of pathophysiology in oral pathogens.

    PubMed

    Bitoun, J P; Wen, Z T

    2016-04-01

    The NAD(+) and NADH-sensing transcriptional regulator Rex is widely conserved across gram-positive bacteria. Rex monitors cellular redox poise and controls the expression of genes/operons involved in diverse pathways including alternative fermentation, oxidative stress responses, and biofilm formation. The oral cavity undergoes frequent and drastic fluctuations in nutrient availability, pH, temperature, oxygen tension, saliva, and shear forces. The oral streptococci are major colonizers of oral mucosa and tooth surfaces and include commensals as well as opportunistic pathogens, including the primary etiological agent of dental caries, Streptococcus mutans. Current understanding of the Rex regulon in oral bacteria is mostly based on studies in S. mutans and endodontic pathogen Enterococcus faecalis. Indeed, other oral bacteria encode homologs of the Rex protein and much is to be gleaned from more in-depth studies. Our current understanding has Rex positioned at the interface of oxygen and energy metabolism. In biofilms, heterogeneous oxygen tension influences the ratio of intracellular NADH and NAD(+) , which is finely tuned through glycolysis and fermentation. In S. mutans, Rex regulates the expression of glycolytic enzyme NAD(+) -dependent glyceraldehyde 3-phosphate dehydrogenase, and NADH-dependent fermentation enzymes/complexes lactate dehydrogenase, pyruvate dehydrogenase, alcohol-acetaldehyde dehydrogenase, and fumarate reductase. In addition, Rex controls the expression of NADH oxidase, a major enzyme used to eliminate oxidative stress and regenerate NAD(+) . Here, we summarize recent studies carried out on the Rex regulators in S. mutans and E. faecalis. This research has important implications for understanding how Rex monitors redox balance and optimizes fermentation pathways for survival and subsequent pathogenicity. PMID:26172563

  14. Basal Body Structures Differentially Affect Transcription of RpoN- and FliA-Dependent Flagellar Genes in Helicobacter pylori

    PubMed Central

    Tsang, Jennifer

    2015-01-01

    basal body proteins may interact directly with regulatory proteins that control transcription of the H. pylori RpoN regulon, a hypothesis that can be tested by examining protein-protein interactions in vitro. PMID:25825427

  15. A putative nitroreductase from the DosR regulon of Mycobacterium tuberculosis induces pro-inflammatory cytokine expression via TLR2 signaling pathway.

    PubMed

    Peddireddy, Vidyullatha; Doddam, Sankara Narayana; Qureshi, Insaf A; Yerra, Priyadarshini; Ahmed, Niyaz

    2016-01-01

    Tuberculosis caused by Mycobacterium tuberculosis is a global encumbrance and it is estimated that nearly one third population of the world acts as a reservoir for this pathogen without any symptoms. In this study, we attempted to characterise one of the genes of DosR regulon, Rv3131, a FMN binding nitroreductase domain containing protein, for its ability to alter cytokine profile, an essential feature of M. tuberculosis latency. Recombinant Rv3131 stimulated pro-inflammatory cytokines in THP-1 cells and human peripheral blood mononuclear cells in a time and dose dependent manner. In silico analyses using docking and simulations indicated that Rv3131 could strongly interact with TLR2 via a non-covalent bonding which was further confirmed using cell based colorimetric assay. In THP-1 cells treated with Rv3131 protein, a significant upsurge in the surface expression, overall induction and expression of mRNA of TLR2 was observed when analysed by flow cytometry, western blotting and real time PCR, respectively. Activation of TLR2 by Rv3131 resulted in the phosphorylation of NF- κβ. Results of this study indicate a strong immunogenic capability of Rv3131 elicited via the activation of TLR2 signalling pathway. Therefore, it can be surmised that cytokine secretion induced by Rv3131 might contribute to establishment of M. tuberculosis in the granulomas. PMID:27094446

  16. A putative nitroreductase from the DosR regulon of Mycobacterium tuberculosis induces pro-inflammatory cytokine expression via TLR2 signaling pathway

    PubMed Central

    Peddireddy, Vidyullatha; Doddam, Sankara Narayana; Qureshi, Insaf A.; Yerra, Priyadarshini; Ahmed, Niyaz

    2016-01-01

    Tuberculosis caused by Mycobacterium tuberculosis is a global encumbrance and it is estimated that nearly one third population of the world acts as a reservoir for this pathogen without any symptoms. In this study, we attempted to characterise one of the genes of DosR regulon, Rv3131, a FMN binding nitroreductase domain containing protein, for its ability to alter cytokine profile, an essential feature of M. tuberculosis latency. Recombinant Rv3131 stimulated pro-inflammatory cytokines in THP-1 cells and human peripheral blood mononuclear cells in a time and dose dependent manner. In silico analyses using docking and simulations indicated that Rv3131 could strongly interact with TLR2 via a non-covalent bonding which was further confirmed using cell based colorimetric assay. In THP-1 cells treated with Rv3131 protein, a significant upsurge in the surface expression, overall induction and expression of mRNA of TLR2 was observed when analysed by flow cytometry, western blotting and real time PCR, respectively. Activation of TLR2 by Rv3131 resulted in the phosphorylation of NF- κβ. Results of this study indicate a strong immunogenic capability of Rv3131 elicited via the activation of TLR2 signalling pathway. Therefore, it can be surmised that cytokine secretion induced by Rv3131 might contribute to establishment of M. tuberculosis in the granulomas. PMID:27094446

  17. Decoding genome-wide GadEWX-transcriptional regulatory networks reveals multifaceted cellular responses to acid stress in Escherichia coli.

    PubMed

    Seo, Sang Woo; Kim, Donghyuk; O'Brien, Edward J; Szubin, Richard; Palsson, Bernhard O

    2015-01-01

    The regulators GadE, GadW and GadX (which we refer to as GadEWX) play a critical role in the transcriptional regulation of the glutamate-dependent acid resistance (GDAR) system in Escherichia coli K-12 MG1655. However, the genome-wide regulatory role of GadEWX is still unknown. Here we comprehensively reconstruct the genome-wide GadEWX transcriptional regulatory network and RpoS involvement in E. coli K-12 MG1655 under acidic stress. Integrative data analysis reveals that GadEWX regulons consist of 45 genes in 31 transcription units and 28 of these genes were associated with RpoS-binding sites. We demonstrate that GadEWX directly and coherently regulate several proton-generating/consuming enzymes with pairs of negative-feedback loops for pH homeostasis. In addition, GadEWX regulate genes with assorted functions, including molecular chaperones, acid resistance, stress response and other regulatory activities. These results show how GadEWX simultaneously coordinate many cellular processes to produce the overall response of E. coli to acid stress. PMID:26258987

  18. Decoding genome-wide GadEWX-transcriptional regulatory networks reveals multifaceted cellular responses to acid stress in Escherichia coli

    PubMed Central

    Seo, Sang Woo; Kim, Donghyuk; O'Brien, Edward J.; Szubin, Richard; Palsson, Bernhard O.

    2015-01-01

    The regulators GadE, GadW and GadX (which we refer to as GadEWX) play a critical role in the transcriptional regulation of the glutamate-dependent acid resistance (GDAR) system in Escherichia coli K-12 MG1655. However, the genome-wide regulatory role of GadEWX is still unknown. Here we comprehensively reconstruct the genome-wide GadEWX transcriptional regulatory network and RpoS involvement in E. coli K-12 MG1655 under acidic stress. Integrative data analysis reveals that GadEWX regulons consist of 45 genes in 31 transcription units and 28 of these genes were associated with RpoS-binding sites. We demonstrate that GadEWX directly and coherently regulate several proton-generating/consuming enzymes with pairs of negative-feedback loops for pH homeostasis. In addition, GadEWX regulate genes with assorted functions, including molecular chaperones, acid resistance, stress response and other regulatory activities. These results show how GadEWX simultaneously coordinate many cellular processes to produce the overall response of E. coli to acid stress. PMID:26258987

  19. The Transcription Factor Encyclopedia

    PubMed Central

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  20. The transcription factor encyclopedia.

    PubMed

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  1. Inference of expanded Lrp-like feast/famine transcription factor targets in a non-model organism using protein structure-based prediction.

    PubMed

    Ashworth, Justin; Plaisier, Christopher L; Lo, Fang Yin; Reiss, David J; Baliga, Nitin S

    2014-01-01

    Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer. PMID:25255272

  2. Robust optimization for nonlinear time-delay dynamical system of dha regulon with cost sensitivity constraint in batch culture

    NASA Astrophysics Data System (ADS)

    Yuan, Jinlong; Zhang, Xu; Liu, Chongyang; Chang, Liang; Xie, Jun; Feng, Enmin; Yin, Hongchao; Xiu, Zhilong

    2016-09-01

    Time-delay dynamical systems, which depend on both the current state of the system and the state at delayed times, have been an active area of research in many real-world applications. In this paper, we consider a nonlinear time-delay dynamical system of dha-regulonwith unknown time-delays in batch culture of glycerol bioconversion to 1,3-propanediol induced by Klebsiella pneumonia. Some important properties and strong positive invariance are discussed. Because of the difficulty in accurately measuring the concentrations of intracellular substances and the absence of equilibrium points for the time-delay system, a quantitative biological robustness for the concentrations of intracellular substances is defined by penalizing a weighted sum of the expectation and variance of the relative deviation between system outputs before and after the time-delays are perturbed. Our goal is to determine optimal values of the time-delays. To this end, we formulate an optimization problem in which the time delays are decision variables and the cost function is to minimize the biological robustness. This optimization problem is subject to the time-delay system, parameter constraints, continuous state inequality constraints for ensuring that the concentrations of extracellular and intracellular substances lie within specified limits, a quality constraint to reflect operational requirements and a cost sensitivity constraint for ensuring that an acceptable level of the system performance is achieved. It is approximated as a sequence of nonlinear programming sub-problems through the application of constraint transcription and local smoothing approximation techniques. Due to the highly complex nature of this optimization problem, the computational cost is high. Thus, a parallel algorithm is proposed to solve these nonlinear programming sub-problems based on the filled function method. Finally, it is observed that the obtained optimal estimates for the time-delays are highly satisfactory

  3. Mapping Yeast Transcriptional Networks

    PubMed Central

    Hughes, Timothy R.; de Boer, Carl G.

    2013-01-01

    The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms. PMID:24018767

  4. Automatic Music Transcription

    NASA Astrophysics Data System (ADS)

    Klapuri, Anssi; Virtanen, Tuomas

    Written musical notation describes music in a symbolic form that is suitable for performing a piece using the available musical instruments. Traditionally, musical notation indicates the pitch, target instrument, timing, and duration of each sound to be played. The aim of music transcription either by humans or by a machine is to infer these musical parameters, given only the acoustic recording of a performance.

  5. Rewiring of the Ppr1 Zinc Cluster Transcription Factor from Purine Catabolism to Pyrimidine Biogenesis in the Saccharomycetaceae.

    PubMed

    Tebung, Walters Aji; Choudhury, Baharul I; Tebbji, Faiza; Morschhäuser, Joachim; Whiteway, Malcolm

    2016-07-11

    Metabolic pathways are largely conserved in eukaryotes, but the transcriptional regulation of these pathways can sometimes vary between species; this has been termed "rewiring." Recently, it has been established that in the Saccharomyces lineage starting from Naumovozyma castellii, genes involved in allantoin breakdown have been genomically relocated to form the DAL cluster. The formation of the DAL cluster occurred along with the loss of urate permease (UAP) and urate oxidase (UOX), reducing the requirement for oxygen and bypassing the candidate Ppr1 inducer, uric acid. In Saccharomyces cerevisiae, this allantoin catabolism cluster is regulated by the transcription factor Dal82, which is not present in many of the pre-rearrangement fungal species. We have used ChIP-chip analysis, transcriptional profiling of an activated Ppr1 protein, bioinformatics, and nitrogen utilization studies to establish that in Candida albicans the zinc cluster transcription factor Ppr1 controls this allantoin catabolism regulon. Intriguingly, in S. cerevisiae, the Ppr1 ortholog binds the same DNA motif (CGG(N6)CCG) as in C. albicans but serves as a regulator of pyrimidine biosynthesis. This transcription factor rewiring appears to have taken place at the same phylogenetic step as the formation of the rearranged DAL cluster. This transfer of the control of allantoin degradation from Ppr1 to Dal82, together with the repositioning of Ppr1 to the regulation of pyrimidine biosynthesis, may have resulted from a switch to a metabolism that could exploit hypoxic conditions in the lineage leading to N. castellii and S. cerevisiae. PMID:27321996

  6. The transcriptional regulator SsuR activates expression of the Corynebacterium glutamicum sulphonate utilization genes in the absence of sulphate.

    PubMed

    Koch, Daniel J; Rückert, Christian; Albersmeier, Andreas; Hüser, Andrea T; Tauch, Andreas; Pühler, Alfred; Kalinowski, Jörn

    2005-10-01

    In a recent study, the putative regulatory gene cg0012 was shown to belong to the regulon of McbR, a global transcriptional regulator of sulphur metabolism in Corynebacterium glutamicum ATCC 13032. A deletion of cg0012, now designated ssuR (sulphonate sulphur utilization regulator), led to the mutant strain C. glutamicum DK100, which was shown to be blocked in the utilization of sulphonates as sulphur sources. According to DNA microarray hybridizations, transcription of the ssu and seu genes, encoding the sulphonate utilization system of C. glutamicum, was considerably decreased in C. glutamicum DK100 when compared with the wild-type strain. Electrophoretic mobility shift assays with purified SsuR protein demonstrated that the upstream regions of ssuI, seuABC, ssuD2 and ssuD1CBA contain SsuR binding sites. A nucleotide sequence alignment of the four DNA fragments containing the SsuR binding sites revealed a common 21 bp motif consisting of T-, GC- and A-rich domains. Mapping of the transcriptional start sites in front of ssuI, seuABC, ssuD2 and ssuD1CBA indicated that the SsuR binding sites are located directly upstream of identified promoter sequences and that the ssu genes are expressed by leaderless transcripts. Binding of the SsuR protein to its operator was shown to be diminished in vitro by the effector substance sulphate and its direct assimilation products adenosine 5'-phosphosulphate, sulphite and sulphide. Real-time reverse transcription polymerase chain reaction experiments verified that the expression of the ssu and seu genes was also repressed in vivo by the presence of sulphate or sulphite. Therefore, the regulatory protein SsuR activates the expression of the ssu and seu genes in C. glutamicum in the absence of the preferred sulphur source sulphate. PMID:16194234

  7. OpaR Controls a Network of Downstream Transcription Factors in Vibrio parahaemolyticus BB22OP

    PubMed Central

    Kernell Burke, Alison; Guthrie, Leah T. C.; Modise, Thero; Cormier, Guy; Jensen, Roderick V.; McCarter, Linda L.; Stevens, Ann M.

    2015-01-01

    Vibrio parahaemolyticus is an emerging world-wide human pathogen that is associated with food-borne gastroenteritis when raw or undercooked seafood is consumed. Expression of virulence factors in this organism is modulated by the phenomenon known as quorum sensing, which permits differential gene regulation at low versus high cell density. The master regulator of quorum sensing in V. parahaemolyticus is OpaR. OpaR not only controls virulence factor gene expression, but also the colony and cellular morphology associated with growth on a surface and biofilm formation. Whole transcriptome Next Generation sequencing (RNA-Seq) was utilized to determine the OpaR regulon by comparing strains BB22OP (opaR+, LM5312) and BB22TR (∆opaR1, LM5674). This work, using the published V. parahaemolyticus BB22OP genome sequence, confirms and expands upon a previous microarray analysis for these two strains that used an Affymetrix GeneChip designed from the closely related V. parahaemolyticus RIMD2210633 genome sequence. Overall there was excellent correlation between the microarray and RNA-Seq data. Eleven transcription factors under OpaR control were identified by both methods and further confirmed by quantitative reverse transcription PCR (qRT-PCR) analysis. Nine of these transcription factors were demonstrated to be direct OpaR targets via in vitro electrophoretic mobility shift assays with purified hexahistidine-tagged OpaR. Identification of the direct and indirect targets of OpaR, including small RNAs, will enable the construction of a network map of regulatory interactions important for the switch between the nonpathogenic and pathogenic states. PMID:25901572

  8. Regulon Studies and In Planta Role of the BraI/R Quorum-Sensing System in the Plant-Beneficial Burkholderia Cluster

    PubMed Central

    Coutinho, Bruna G.; Mitter, Birgit; Talbi, Chouhra; Sessitsch, Angela; Bedmar, Eulogio J.; Halliday, Nigel; James, Euan K.; Cámara, Miguel

    2013-01-01

    The genus Burkholderia is composed of functionally diverse species, and it can be divided into several clusters. One of these, designated the plant-beneficial-environmental (PBE) Burkholderia cluster, is formed by nonpathogenic species, which in most cases have been found to be associated with plants. It was previously established that members of the PBE group share an N-acyl-homoserine lactone (AHL) quorum-sensing (QS) system, designated BraI/R, that produces and responds to 3-oxo-C14-HSL (OC14-HSL). Moreover, some of them also possess a second AHL QS system, designated XenI2/R2, producing and responding to 3-hydroxy-C8-HSL (OHC8-HSL). In the present study, we performed liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis to determine which AHL molecules are produced by each QS system of this group of bacteria. The results showed that XenI2/R2 is mainly responsible for the production of OHC8-HSL and that the BraI/R system is involved in the production of several different AHLs. This analysis also revealed that Burkholderia phymatum STM815 produces greater amounts of AHLs than the other species tested. Further studies showed that the BraR protein of B. phymatum is more promiscuous than other BraR proteins, responding equally well to several different AHL molecules, even at low concentrations. Transcriptome studies with Burkholderia xenovorans LB400 and B. phymatum STM815 revealed that the BraI/R regulon is species specific, with exopolysaccharide production being the only common phenotype regulated by this system in the PBE cluster. In addition, BraI/R was shown not to be important for plant nodulation by B. phymatum strains or for endophytic colonization and growth promotion of maize by B. phytofirmans PsJN. PMID:23686262

  9. Conjugational hyperrecombination achieved by derepressing the LexA regulon, altering the properties of RecA protein and inactivating mismatch repair in Escherichia coli K-12.

    PubMed Central

    Lanzov, Vladislav A; Bakhlanova, Irina V; Clark, Alvin J

    2003-01-01

    The frequency of recombinational exchanges (FRE) that disrupt co-inheritance of transferred donor markers in Escherichia coli Hfr by F(-) crosses differs by up to a factor of two depending on physiological factors and culture conditions. Under standard conditions we found FRE to be 5.01 +/- 0.43 exchanges per 100-min units of DNA length for wild-type strains of the AB1157 line. Using these conditions we showed a cumulative effect of various mutations on FRE. Constitutive SOS expression by lexA gene inactivation (lexA71::Tn5) and recA gene mutation (recA730) showed, respectively, approximately 4- and 7-fold increases of FRE. The double lexA71 recA730 combination gave an approximately 17-fold increase in FRE. Addition of mutS215::Tn10, inactivating the mismatch repair system, to the double lexA recA mutant increased FRE to approximately 26-fold above wild-type FRE. Finally, we showed that another recA mutation produced as much SOS expression as recA730 but increased FRE only 3-fold. We conclude that three factors contribute to normally low FRE under standard conditions: repression of the LexA regulon, the properties of wild-type RecA protein, and a functioning MutSHL mismatch repair system. We discuss mechanisms by which the lexA, recA, and mutS mutations may elevate FRE cumulatively to obtain hyperrecombination. PMID:12702672

  10. A role for the PhoP/Q regulon in inhibition of fusion between lysosomes and Salmonella-containing vacuoles in macrophages.

    PubMed

    Garvis, S G; Beuzón, C R; Holden, D W

    2001-11-01

    After uptake by murine macrophages, Salmonella typhimurium is able to survive and replicate within specialized phagosomes called Salmonella-containing vacuoles (SCVs), which are segregated from the late endocytic pathway. The molecular basis of this process and the virulence factors required are not fully understood. In this study, we used confocal fluorescence microscopy to evaluate interactions between the endocytic pathway of the murine macrophage cell line RAW 264.7 and different S. typhimurium strains. The analysis was carried out using the fluid-phase marker Texas red-ovalbumin and antibodies against the lysosomal enzyme cathepsin D, the late endosomal lipid lysobisphosphatidic acid and the adaptor proteins AP-1 and AP-3. Less than 10% of wild-type SCVs were associated with these markers at 24 h after uptake by macrophages. A similar low level of association was observed for vacuoles containing mutant strains affected in the function of the Salmonella pathogenicity island (SPI)-2 type III secretion system or the virulence plasmid spv operon. However, at this time point, the proportion of vacuoles containing phoP-mutant bacteria that were associated with each of the markers ranged from 25% to 50%. These results show that the regulon controlled by the PhoP/Q two-component system makes a major contribution to trafficking of the SCV in macrophages. Segregation of SCVs from the endocytic pathway was also found to be dependent on bacterial proteins synthesized between 15 min and 4 h after uptake into macrophages. However, after this time, protein synthesis was not required to maintain the segregation of SCVs from late endosomes and lysosomes. PMID:11696033

  11. Computational Analysis and In silico Predictive Modeling for Inhibitors of PhoP Regulon in S. typhi on High-Throughput Screening Bioassay Dataset.

    PubMed

    Kaur, Harleen; Ahmad, Mohd; Scaria, Vinod

    2016-03-01

    There is emergence of multidrug-resistant Salmonella enterica serotype typhi in pandemic proportions throughout the world, and therefore, there is a necessity to speed up the discovery of novel molecules having different modes of action and also less influenced by the resistance formation that would be used as drug for the treatment of salmonellosis particularly typhoid fever. The PhoP regulon is well studied and has now been shown to be a critical regulator of number of gene expressions which are required for intracellular survival of S. enterica and pathophysiology of disease like typhoid. The evident roles of two-component PhoP-/PhoQ-regulated products in salmonella virulence have motivated attempts to target them therapeutically. Although the discovery process of biologically active compounds for the treatment of typhoid relies on hit-finding procedure, using high-throughput screening technology alone is very expensive, as well as time consuming when performed on large scales. With the recent advancement in combinatorial chemistry and contemporary technique for compounds synthesis, there are more and more compounds available which give ample growth of diverse compound library, but the time and endeavor required to screen these unfocused massive and diverse library have been slightly reduced in the past years. Hence, there is demand to improve the high-quality hits and success rate for high-throughput screening that required focused and biased compound library toward the particular target. Therefore, we still need an advantageous and expedient method to prioritize the molecules that will be utilized for biological screens, which saves time and is also inexpensive. In this concept, in silico methods like machine learning are widely applicable technique used to build computational model for high-throughput virtual screens to prioritize molecules for advance study. Furthermore, in computational analysis, we extended our study to identify the common enriched

  12. The kil-kor regulon of broad-host-range plasmid RK2: nucleotide sequence, polypeptide product, and expression of regulatory gene korC.

    PubMed Central

    Kornacki, J A; Burlage, R S; Figurski, D H

    1990-01-01

    Broad-host-range plasmid RK2 encodes several kil operons (kilA, kilB, kilC, kilE) whose expression is potentially lethal to Escherichia coli host cells. The kil operons and the RK2 replication initiator gene (trfA) are coregulated by various combinations of kor genes (korA, korB, korC, korE). This regulatory network is called the kil-kor regulon. Presented here are studies on the structure, product, and expression of korC. Genetic mapping revealed the precise location of korC in a region near transposon Tn1. We determined the nucleotide sequence of this region and identified the korC structural gene by analysis of korC mutants. Sequence analysis predicts the korC product to be a polypeptide of 85 amino acids with a molecular mass of 9,150 daltons. The KorC polypeptide was identified in vivo by expressing wild-type and mutant korC alleles from a bacteriophage T7 RNA polymerase-dependent promoter. The predicted structure of KorC polypeptide has a net positive charge and a helix-turn-helix region similar to those of known DNA-binding proteins. These properties are consistent with the repressorlike function of KorC protein, and we discuss the evidence that KorA and KorC proteins act as corepressors in the control of the kilC and kilE operons. Finally, we show that korC is expressed from the bla promoters within the upstream transposon Tn1, suggesting that insertion of Tn1 interrupted a plasmid operon that may have originally included korC and kilC. Images PMID:2160936

  13. Cationic antimicrobial peptides serve as activation signals for the Salmonella Typhimurium PhoPQ and PmrAB regulons in vitro and in vivo

    PubMed Central

    Richards, Susan M.; Strandberg, Kristi L.; Conroy, Megan; Gunn, John S.

    2012-01-01

    Salmonella enterica serovar Typhimurium uses two-component regulatory systems (TCRSs) to respond to environmental stimuli. Upon infection, the TCRSs PhoP-PhoQ (PhoPQ) and PmrA-PmrB (PmrAB) are activated by environmental signals detected in the lumen of the intestine and within host cells. TCRS-mediated gene expression leads to upregulation of genes involved in lipopolysaccharide (LPS) modification and cationic antimicrobial peptide (CAMP) resistance. This research expands on previous studies which have shown that CAMPs can activate Salmonella TCRSs in vitro. The focus of this work was to determine if CAMPs can act as environmental signals for PhoPQ- and PmrAB-mediated gene expression in vitro, during infection of macrophages and in a mouse model of infection. Monitoring of PhoPQ and PmrAB activation using recombinase-based in vivo expression technology (RIVET), alkaline phosphtase and β-galactosidase reporter fusion constructs demonstrated that S. Typhimurium PhoQ can sense CAMPs in vitro. In mouse macrophages, the cathelecidin CRAMP does not activate the PhoPQ regulon. Acidification of the Salmonella-containing vacuole activates PhoP- and PmrA-regulated loci but blocking acidification still does not reveal a role for CRAMP in TCRS activation in mouse macrophages. However, assays performed in susceptible wild type (WT), CRAMP knockout (KO), and matrilysin (a metalloproteinase necessary for activating murine α-defensins) KO mice suggest CRAMP, but not α-defensins, serve as a putative direct TCRS activation signal in the mouse intestine. These studies provide a better understanding of the in vivo environments that result in activation of these virulence-associated TCRSs. PMID:22919691

  14. Transcriptional Profiling of Nitrogen Fixation and the Role of NifA in the Diazotrophic Endophyte Azoarcus sp. Strain BH72

    PubMed Central

    Sarkar, Abhijit; Reinhold-Hurek, Barbara

    2014-01-01

    Background The model endophyte Azoarcus sp. strain BH72 is known to contribute fixed nitrogen to its host Kallar grass and also expresses nitrogenase genes endophytically in rice seedlings. Availability of nitrogen is a signal regulating the transcription of nitrogenase genes. Therefore, we analysed global transcription in response to differences in the nitrogen source. Methodology/Principal Findings A DNA microarray, comprising 70-mer oligonucleotides representing 3989 open reading frames of the genome of strain BH72, was used for transcriptome studies. Transcription profiles of cells grown microaerobically on N2 versus ammonium were compared. Expression of 7.2% of the genes was significantly up-regulated, and 5.8% down-regulated upon N2 fixation, respectively. A parallel genome-wide prediction of σ54-type promoter elements mapped to the upstream region of 38 sequences of which 36 were modulated under the N2 response. In addition to modulation of genes related to N2 fixation, the expressions of gene clusters that might be related to plant-microbe interaction and of several transcription factors were significantly enhanced. While comparing under N2-fixation conditions the transcriptome of wild type with a nifLA− insertion mutant, NifA being the essential transcriptional activator for nif genes, 24.5% of the genome was found to be affected in expression. A genome-wide prediction of 29 NifA binding sequences matched to 25 of the target genes whose expression was differential during microarray analysis, some of which were putatively negatively regulated by NifA. For selected genes, differential expression was corroborated by real time RT-PCR studies. Conclusion/Significance Our data suggest that life under conditions of nitrogen fixation is an important part of the lifestyle of strain BH72 in roots, as a wide range of genes far beyond the nif regulon is modulated. Moreover, the NifA regulon in strain BH72 appears to encompass a wider range of cellular functions

  15. AraR, an l-Arabinose-Responsive Transcriptional Regulator in Corynebacterium glutamicum ATCC 31831, Exerts Different Degrees of Repression Depending on the Location of Its Binding Sites within the Three Target Promoter Regions

    PubMed Central

    Kuge, Takayuki; Teramoto, Haruhiko

    2015-01-01

    ABSTRACT In Corynebacterium glutamicum ATCC 31831, a LacI-type transcriptional regulator AraR, represses the expression of l-arabinose catabolism (araBDA), uptake (araE), and the regulator (araR) genes clustered on the chromosome. AraR binds to three sites: one (BSB) between the divergent operons (araBDA and galM-araR) and two (BSE1 and BSE2) upstream of araE. l-Arabinose acts as an inducer of the AraR-mediated regulation. Here, we examined the roles of these AraR-binding sites in the expression of the AraR regulon. BSB mutation resulted in derepression of both araBDA and galM-araR operons. The effects of BSE1 and/or BSE2 mutation on araE expression revealed that the two sites independently function as the cis elements, but BSE1 plays the primary role. However, AraR was shown to bind to these sites with almost the same affinity in vitro. Taken together, the expression of araBDA and araE is strongly repressed by binding of AraR to a single site immediately downstream of the respective transcriptional start sites, whereas the binding site overlapping the −10 or −35 region of the galM-araR and araE promoters is less effective in repression. Furthermore, downregulation of araBDA and araE dependent on l-arabinose catabolism observed in the BSB mutant and the AraR-independent araR promoter identified within galM-araR add complexity to regulation of the AraR regulon derepressed by l-arabinose. IMPORTANCE Corynebacterium glutamicum has a long history as an industrial workhorse for large-scale production of amino acids. An important aspect of industrial microorganisms is the utilization of the broad range of sugars for cell growth and production process. Most C. glutamicum strains are unable to use a pentose sugar l-arabinose as a carbon source. However, genes for l-arabinose utilization and its regulation have been recently identified in C. glutamicum ATCC 31831. This study elucidates the roles of the multiple binding sites of the transcriptional repressor AraR in the

  16. Global transcriptional control by glucose and carbon regulator CcpA in Clostridium difficile

    PubMed Central

    Antunes, Ana; Camiade, Emilie; Monot, Marc; Courtois, Emmanuelle; Barbut, Frédéric; Sernova, Natalia V.; Rodionov, Dmitry A.; Martin-Verstraete, Isabelle; Dupuy, Bruno

    2012-01-01

    The catabolite control protein CcpA is a pleiotropic regulator that mediates the global transcriptional response to rapidly catabolizable carbohydrates, like glucose in Gram-positive bacteria. By whole transcriptome analyses, we characterized glucose-dependent and CcpA-dependent gene regulation in Clostridium difficile. About 18% of all C. difficile genes are regulated by glucose, for which 50% depend on CcpA for regulation. The CcpA regulon comprises genes involved in sugar uptake, fermentation and amino acids metabolism, confirming the role of CcpA as a link between carbon and nitrogen pathways. Using combination of chromatin immunoprecipitation and genome sequence analysis, we detected 55 CcpA binding sites corresponding to ∼140 genes directly controlled by CcpA. We defined the C. difficile CcpA consensus binding site (creCD motif), that is, ‘RRGAAAANGTTTTCWW’. Binding of purified CcpA protein to 19 target creCD sites was demonstrated by electrophoretic mobility shift assay. CcpA also directly represses key factors in early steps of sporulation (Spo0A and SigF). Furthermore, the C. difficile toxin genes (tcdA and tcdB) and their regulators (tcdR and tcdC) are direct CcpA targets. Finally, CcpA controls a complex and extended regulatory network through the modulation of a large set of regulators. PMID:22989714

  17. Global transcriptional control by glucose and carbon regulator CcpA in Clostridium difficile.

    PubMed

    Antunes, Ana; Camiade, Emilie; Monot, Marc; Courtois, Emmanuelle; Barbut, Frédéric; Sernova, Natalia V; Rodionov, Dmitry A; Martin-Verstraete, Isabelle; Dupuy, Bruno

    2012-11-01

    The catabolite control protein CcpA is a pleiotropic regulator that mediates the global transcriptional response to rapidly catabolizable carbohydrates, like glucose in Gram-positive bacteria. By whole transcriptome analyses, we characterized glucose-dependent and CcpA-dependent gene regulation in Clostridium difficile. About 18% of all C. difficile genes are regulated by glucose, for which 50% depend on CcpA for regulation. The CcpA regulon comprises genes involved in sugar uptake, fermentation and amino acids metabolism, confirming the role of CcpA as a link between carbon and nitrogen pathways. Using combination of chromatin immunoprecipitation and genome sequence analysis, we detected 55 CcpA binding sites corresponding to ∼140 genes directly controlled by CcpA. We defined the C. difficile CcpA consensus binding site (cre(CD) motif), that is, 'RRGAAAANGTTTTCWW'. Binding of purified CcpA protein to 19 target cre(CD) sites was demonstrated by electrophoretic mobility shift assay. CcpA also directly represses key factors in early steps of sporulation (Spo0A and SigF). Furthermore, the C. difficile toxin genes (tcdA and tcdB) and their regulators (tcdR and tcdC) are direct CcpA targets. Finally, CcpA controls a complex and extended regulatory network through the modulation of a large set of regulators. PMID:22989714

  18. Transcription-coupled DNA supercoiling dictates the chromosomal arrangement of bacterial genes

    PubMed Central

    Sobetzko, Patrick

    2016-01-01

    Over the recent decade, the central importance of DNA supercoiling in chromosome organization and global gene regulation of bacteria became more and more visible. With a regulon comprising more than 2000 genes in Escherichia coli, DNA supercoiling is among the most influential regulators of gene expression found in bacteria so far. However, the mechanism creating thousands of diverse temporal gene expression patterns coordinated by DNA supercoiling remains unclear. In this study we show that a specific chromosomal arrangement of genes modulates the local levels of DNA supercoiling at gene promoters via transcription-coupled DNA supercoiling (TCDS) in the model organism E. coli. Our findings provide a consistent explanation for the strong positive coupling of temporal gene expression patterns of neighboring genes. Using comparative genomics we are furthermore able to provide evidence that TCDS is a driving force for the evolution of chromosomal gene arrangement patterns in other Enterobacteriaceae. With the currently available data of promoter supercoiling sensitivity we prove that the same principle is applicable also for the evolutionary distant gram-positive pathogenic bacterium Streptococcus pneumoniae. Moreover, our findings are fully consistent with recent investigations concerning the regulatory impact of TCDS on gene pairs in eukaryots underpinning the broad applicability of our analysis. PMID:26783203

  19. Identification of a Transcription Factor That Regulates Host Cell Exit and Virulence of Mycobacterium tuberculosis

    PubMed Central

    Srinivasan, Lalitha; Gurses, Serdar A.; Hurley, Benjamin E.; Miller, Jessica L.; Karakousis, Petros C.; Briken, Volker

    2016-01-01

    The interaction of Mycobacterium tuberculosis (Mtb) with host cell death signaling pathways is characterized by an initial anti-apoptotic phase followed by a pro-necrotic phase to allow for host cell exit of the bacteria. The bacterial modulators regulating necrosis induction are poorly understood. Here we describe the identification of a transcriptional repressor, Rv3167c responsible for regulating the escape of Mtb from the phagosome. Increased cytosolic localization of MtbΔRv3167c was accompanied by elevated levels of mitochondrial reactive oxygen species and reduced activation of the protein kinase Akt, and these events were critical for the induction of host cell necrosis and macroautophagy. The increase in necrosis led to an increase in bacterial virulence as reflected in higher bacterial burden and reduced survival of mice infected with MtbΔRv3167c. The regulon of Rv3167c thus contains the bacterial mediators involved in escape from the phagosome and host cell necrosis induction, both of which are crucial steps in the intracellular lifecycle and virulence of Mtb. PMID:27191591

  20. DNA binding by Corynebacterium glutamicum TetR-type transcription regulator AmtR

    PubMed Central

    Muhl, Daniela; Jeßberger, Nadja; Hasselt, Kristin; Jardin, Christophe; Sticht, Heinrich; Burkovski, Andreas

    2009-01-01

    Background The TetR family member AmtR is the central regulator of nitrogen starvation response in Corynebacterium glutamicum. While the AmtR regulon was physiologically characterized in great detail up to now, mechanistic questions of AmtR binding were not addressed. This study presents a characterization of functionally important amino acids in the DNA binding domain of AmtR and of crucial nucleotides in the AmtR recognition motif. Results Site-directed mutagenesis, the characterization of corresponding mutant proteins by gel retardation assays and surface plasmon resonance and molecular modelling revealed several amino acids, which are directly involved in DNA binding, while others have more structural function. Furthermore, we could show that the spacing of the binding motif half sites is crucial for repression of transcription by AmtR. Conclusion Although the DNA binding domain of TetR-type repressors is highly conserved and a core binding motif was identified for AmtR and TetR(D), the AmtR binding domain shows individual properties compared to other TetR proteins. Besides by distinct amino acids of AmtR, DNA binding is influenced by nucleotides not only of the conserved binding motif but also by spacing nucleotides in C. glutamicum. PMID:19627583

  1. Orthologous transcription factors in bacteria have differentfunctions and regulate different genes

    SciTech Connect

    Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.

    2007-07-25

    Transcription factors (TFs) form large paralogous genefamilies and have complex evolutionary histories. Here, we ask whetherputative orthologs of TFs, from bidirectional best BLAST hits (BBHs), areevolutionary orthologs with conserved functions. We show that BBHs of TFsfrom distantly related bacteria are usually not evolutionary orthologs.Furthermore, the false orthologs usually respond to different signals andregulate distinct pathways, while the few BBHs that are evolutionaryorthologs do have conserved functions. To test the conservation ofregulatory interactions, we analyze expression patterns. We find thatregulatory relationships between TFs and their regulated genes areusually not conserved for BBHs in Escherichia coli K12 and Bacillussubtilis. Even in the much more closely related bacteria Vibrio choleraeand Shewanella oneidensis MR-1, predicting regulation from E. coli BBHshas high error rates. Using gene-regulon correlations, we identify geneswhose expression pattern differs between E. coli and S. oneidensis. Usingliterature searches and sequence analysis, we show that these changes inexpression patterns reflect changes ingene regulation, even forevolutionary orthologs. We conclude that the evolution of bacterialregulation should be analyzed with phylogenetic trees, rather than BBHs,and that bacterial regulatory networks evolve more rapidly thanpreviously thought.

  2. Transcriptional Profiling Analysis of Bacillus subtilis in Response to High Levels of Fe(3.).

    PubMed

    Yu, Wen-Bang; Ye, Bang-Ce

    2016-06-01

    Iron is essential to microorganisms for its important biological function but could be highly toxic in excess. We have used genome-wide transcriptional analysis in Fe(3+)-treated (4 mM) Bacillus subtilis to reveal the effect of excess Fe(3+) on B. subtilis and characterized the potential pathways involved in Fe(3+) stress tolerance. A total of 366 and 400 genes were identified as significantly up-regulated and down-regulated, respectively. We found excess Fe(3+) had four major influences on B. subtilis: Fe(3+) resulted in oxidative stress and induced genes involved in oxidative stress resistance including the SigB-regulated genes, but the PerR regulon was not inducible in Fe(3+)-mediated oxidative stress except zosA; Fe(3+) significantly disturbed homeostasis of Mn(2+) and Zn(2+), and the mechanism was proposed in this article; the acidity of Fe(3+)-induced genes involved in acid consuming and production of bases and shifted B. subtilis to carbon starvation state; Fe(3+)-induced genes related to membrane remodeling (bkd operon), which prevents Fe(3+)'s incorporation to membrane lipids. Moreover, Fe(3+) repressed the stringent control response, consistent with the induction of stringent control in iron limitation, demonstrating that iron might be a signal in stringent control of B. subtilis. This study was the first to provide a comprehensive overview of the genetic response of B. subtilis to ecxess Fe(3+). PMID:26858131

  3. Vaccinia virus transcription.

    PubMed

    Broyles, Steven S

    2003-09-01

    Vaccinia virus replication takes place in the cytoplasm of the host cell. The nearly 200 kbp genome owes part of its complexity to encoding most of the proteins involved in genome and mRNA synthesis. The multisubunit vaccinia virus RNA polymerase requires a separate set of virus-encoded proteins for the transcription of the early, intermediate and late classes of genes. Cell fractionation studies have provided evidence for a role for host cell proteins in the initiation and termination of vaccinia virus intermediate and late gene transcription. Vaccinia virus resembles nuclear DNA viruses in the integration of viral and host proteins for viral mRNA synthesis, yet is markedly less reliant on host proteins than its nuclear counterparts. PMID:12917449

  4. Intrinsic disorder in transcription factors†

    PubMed Central

    Liu, Jiangang; Perumal, Narayanan B.; Oldfield, Christopher J.; Su, Eric W.; Uversky, Vladimir N.; Dunker, A. Keith

    2008-01-01

    Intrinsic disorder (ID) is highly abundant in eukaryotes, which reflect the greater need for disorder-associated signaling and transcriptional regulation in nucleated cells. Although several well-characterized examples of intrinsically disordered proteins in transcriptional regulation have been reported, no systematic analysis has been reported so far. To test for a general prevalence of intrinsic disorder in transcriptional regulation, we used the Predictor Of Natural Disorder Regions (PONDR) to analyze the abundance of intrinsic disorder in three transcription factor datasets and two control sets. This analysis revealed that from 94.13% to 82.63% of transcription factors posses extended regions of intrinsic disorder, relative to 54.51% and 18.64% of the proteins in two control datasets, which indicates the significant prevalence of intrinsic disorder in transcription factors. This propensity of transcription factors for intrinsic disorder was confirmed by cumulative distribution function analysis and charge-hydropathy plots. The amino acid composition analysis showed that all three transcription factor datasets were substantially depleted in order-promoting residues, and significantly enriched in disorder-promoting residues. Our analysis of the distribution of disorder within the transcription factor datasets revealed that: (a) The AT-hooks and basic regions of transcription factor DNA-binding domains are highly disordered; (b) The degree of disorder in transcription factor activation regions is much higher than that in DNA-binding domains; (c) The degree of disorder is significantly higher in eukaryotic transcription factors than in prokaryotic transcription factors; (d) The level of α-MoRFs (molecular recognition feature) prediction is much higher in transcription factors. Overall, our data reflected the fact that the eukaryotes with well-developed gene transcription machinery require transcription factor flexibility to be more efficient. PMID:16734424

  5. A large family of antivirulence regulators modulates the effects of transcriptional activators in Gram-negative pathogenic bacteria.

    PubMed

    Santiago, Araceli E; Ruiz-Perez, Fernando; Jo, Noah Y; Vijayakumar, Vidhya; Gong, Mei Q; Nataro, James P

    2014-05-01

    We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44-100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family. PMID:24875828

  6. A Large Family of Antivirulence Regulators Modulates the Effects of Transcriptional Activators in Gram-negative Pathogenic Bacteria

    PubMed Central

    Santiago, Araceli E.; Ruiz-Perez, Fernando; Jo, Noah Y.; Vijayakumar, Vidhya; Gong, Mei Q.; Nataro, James P.

    2014-01-01

    We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44–100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family. PMID:24875828

  7. Self-association of the Escherichia coli transcription activator MalT in the presence of maltotriose and ATP.

    PubMed

    Schreiber, V; Richet, E

    1999-11-19

    MalT, the transcriptional activator of the Escherichia coli maltose regulon, binds the MalT-dependent promoters and activates transcription initiation only in the presence of maltotriose and ATP (or adenylyl imidodiphosphate (AMP-PNP)). Cooperative binding of MalT to the array of cognate sites present in the MalT-dependent promoters suggests that promoter binding involves MalT oligomerization. Gel filtration and sedimentation experiments were used to analyze the quaternary structure of MalT in solution in the absence or presence of maltotriose and/or AMP-PNP, ATP, or ADP. The protein is monomeric in the absence of ligands and in the presence of ADP. In the presence of maltotriose, AMP-PNP, or ATP only, the protein self-associates, but a large fraction of the protein remains monomeric. In the presence of both maltotriose and AMP-PNP (ATP or ADP), the protein is essentially oligomeric, with the difference being that the oligomerization is less favored in the presence of ADP + maltotriose than in the presence of AMP-PNP + maltotriose. We present evidence that the association pathway comprises the following steps: monomers --> dimers --> (MalT)(n) --> aggregates, where 3

  8. RegPrecise web services interface: programmatic access to the transcriptional regulatory interactions in bacteria reconstructed by comparative genomics.

    PubMed

    Novichkov, Pavel S; Brettin, Thomas S; Novichkova, Elena S; Dehal, Paramvir S; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A

    2012-07-01

    Web services application programming interface (API) was developed to provide a programmatic access to the regulatory interactions accumulated in the RegPrecise database (http://regprecise.lbl.gov), a core resource on transcriptional regulation for the microbial domain of the Department of Energy (DOE) Systems Biology Knowledgebase. RegPrecise captures and visualize regulogs, sets of genes controlled by orthologous regulators in several closely related bacterial genomes, that were reconstructed by comparative genomics. The current release of RegPrecise 2.0 includes >1400 regulogs controlled either by protein transcription factors or by conserved ribonucleic acid regulatory motifs in >250 genomes from 24 taxonomic groups of bacteria. The reference regulons accumulated in RegPrecise can serve as a basis for automatic annotation of regulatory interactions in newly sequenced genomes. The developed API provides an efficient access to the RegPrecise data by a comprehensive set of 14 web service resources. The RegPrecise web services API is freely accessible at http://regprecise.lbl.gov/RegPrecise/services.jsp with no login requirements. PMID:22700702

  9. Dual-function regulators: the cAMP receptor protein and the CytR regulator can act either to repress or to activate transcription depending on the context.

    PubMed Central

    Rasmussen, P B; Holst, B; Valentin-Hansen, P

    1996-01-01

    Studies of gene regulation have revealed that several transcriptional regulators can switch between activator and repressor depending upon both the promoter and the cellular context. A relatively simple prokaryotic example is illustrated by the Escherichia coli CytR regulon. In this system, the cAMP receptor protein (CRP) assists the binding of RNA polymerase as well as a specific negative regulator, CytR. Thus, CRP functions either as an activator or as a corepressor. Here we show that, depending on promoter architecture, the CRP/CytR nucleoprotein complex has opposite effects on transcription. When acting from a site close to the DNA target for RNA polymerase, CytR interacts with CRP to repress transcription, whereas an interaction with CRP from appropriately positioned upstream binding sites can result in formation of a huge preinitiation complex and transcriptional activation. Based on recent results about CRP-mediated regulation of transcription initiation and the finding that CRP possesses discrete surface-exposed patches for protein-protein interaction with RNA polymerase and CytR, a molecular model for this dual regulation is discussed. Images Fig. 1 Fig. 4 Fig. 5 Fig. 6 PMID:8816767

  10. Inducer responses of BenM, a LysR-type transcriptional regulator from Acinetobacter baylyi ADP1

    SciTech Connect

    Craven, Sarah H.; Ezezika, Obidimma C.; Haddad, Sandra; Hall, Ruth A.; Momany, Cory; Neidle, Ellen L.; Georgia

    2009-06-25

    BenM and CatM control transcription of a complex regulon for aromatic compound degradation. These Acinetobacter baylyi paralogues belong to the largest family of prokaryotic transcriptional regulators, the LysR-type proteins. Whereas BenM activates transcription synergistically in response to two effectors, benzoate and cis,cis-muconate, CatM responds only to cis,cis-muconate. Here, site-directed mutagenesis was used to determine the physiological significance of an unexpected benzoate-binding pocket in BenM discovered during structural studies. Residues in BenM were changed to match those of CatM in this hydrophobic pocket. Two BenM residues, R160 and Y293, were found to mediate the response to benzoate. Additionally, alteration of these residues caused benzoate to inhibit activation by cis,cis-muconate, positioned in a separate primary effector-binding site of BenM. The location of the primary site, in an interdomain cleft, is conserved in diverse LysR-type regulators. To improve understanding of this important family, additional regulatory mutants were analysed. The atomic-level structures were characterized of the effector-binding domains of variants that do not require inducers for activation, CatM(R156H) and BenM(R156H,T157S). These structures clearly resemble those of the wild-type proteins in their activated muconate-bound complexes. Amino acid replacements that enable activation without effectors reside at protein interfaces that may impact transcription through effects on oligomerization.

  11. Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

    SciTech Connect

    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

    2015-01-21

    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.

  12. Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

    DOE PAGESBeta

    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

    2015-01-21

    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involvedmore » in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.« less

  13. Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

    2015-01-01

    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability. PMID:25607953

  14. Analysis of the Activity and Regulon of the Two-Component Regulatory System Composed by Cjj81176_1484 and Cjj81176_1483 of Campylobacter jejuni

    PubMed Central

    Luethy, Paul M.; Huynh, Steven; Parker, Craig T.

    2015-01-01

    ABSTRACT Campylobacter jejuni is a leading cause of bacterial diarrheal disease and a frequent commensal of the intestinal tract in poultry and other animals. For optimal growth and colonization of hosts, C. jejuni employs two-component regulatory systems (TCSs) to monitor environmental conditions and promote proper expression of specific genes. We analyzed the potential of C. jejuni Cjj81176_1484 (Cjj1484) and Cjj81176_1483 (Cjj1483) to encode proteins of a cognate TCS that influences expression of genes possibly important for C. jejuni growth and colonization. Transcriptome analysis revealed that the regulons of the Cjj81176_1484 (Cjj1484) histidine kinase and the Cjj81176_1483 (Cjj1483) response regulator contain many common genes, suggesting that these proteins likely form a cognate TCS. We found that this TCS generally functions to repress expression of specific proteins with roles in metabolism, iron/heme acquisition, and respiration. Furthermore, the TCS repressed expression of Cjj81176_0438 and Cjj81176_0439, which had previously been found to encode a gluconate dehydrogenase complex required for commensal colonization of the chick intestinal tract. However, the TCS and other specific genes whose expression is repressed by the TCS were not required for colonization of chicks. We observed that the Cjj1483 response regulator binds target promoters in both unphosphorylated and phosphorylated forms and influences expression of some specific genes independently of the Cjj1484 histidine kinase. This work further expands the signaling mechanisms of C. jejuni and provides additional insights regarding the complex and multifactorial regulation of many genes involved in basic metabolism, respiration, and nutrient acquisition that the bacterium requires for optimal growth in different environments. IMPORTANCE Bacterial two-component regulatory systems (TCSs) link environmental cues to expression of specific genes that enable optimal bacterial growth or colonization of

  15. The NifA-RpoN regulon of Mesorhizobium loti strain R7A and its symbiotic activation by a novel Lacl/GalR-family regulator

    SciTech Connect

    Sullivan, John T.; Brown, Steven D; Ronson, Professor Clive William

    2013-01-01

    Mesorhizobium loti is the microsymbiont of Lotus species, including the model legume L. japonicus. M. loti differs from other rhizobia in that it contains two copies of the key nitrogen fixation regulatory gene nifA, nifA1 and nifA2, both of which are located on the symbiosis island ICEMlSymR7A. M. loti R7A also contains two rpoN genes, rpoN1 located on the chromosome outside of ICEMlSymR7A and rpoN2 that is located on ICEMlSymR7A. The aims of the current work were to establish how nifA expression was activated in M. loti and to characterise the NifA-RpoN regulon. The nifA2 and rpoN2 genes were essential for nitrogen fixation whereas nifA1 and rpoN1 were dispensable. Expression of nifA2 was activated, possibly in response to an inositol derivative, by a novel regulator of the LacI/GalR family encoded by the fixV gene located upstream of nifA2. Other than the well-characterized nif/fix genes, most NifA2-regulated genes were not required for nitrogen fixation although they were strongly expressed in nodules. The NifA-regulated nifZ and fixU genes, along with nifQ which was not NifA-regulated, were required in M. loti for a fully effective symbiosis although they are not present in some other rhizobia. The NifA-regulated gene msi158 that encodes a porin was also required for a fully effective symbiosis. Several metabolic genes that lacked NifA-regulated promoters were strongly expressed in nodules in a NifA2-dependent manner but again mutants did not have an overt symbiotic phenotype. In summary, many genes encoded on ICEMlSymR7A were strongly expressed in nodules but not free-living rhizobia, but were not essential for symbiotic nitrogen fixation. It seems likely that some of these genes have functional homologues elsewhere in the genome and that bacteroid metabolism may be sufficiently plastic to adapt to loss of certain enzymatic functions.

  16. Single Molecule Transcription Elongation

    PubMed Central

    Galburt, Eric A.; Grill, Stephan W.; Bustamante, Carlos

    2009-01-01

    Single molecule optical trapping assays have now been applied to a great number of macromolecular systems including DNA, RNA, cargo motors, restriction enzymes, DNA helicases, chromosome remodelers, DNA polymerases and both viral and bacterial RNA polymerases. The advantages of the technique are the ability to observe dynamic, unsynchronized molecular processes, to determine the distributions of experimental quantities and to apply force to the system while monitoring the response over time. Here, we describe the application of these powerful techniques to study the dynamics of transcription elongation by RNA polymerase II from Saccharomyces cerevisiae. PMID:19426807

  17. Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution

    PubMed Central

    Maguire, Sarah L.; Wang, Can; Holland, Linda M.; Brunel, François; Neuvéglise, Cécile; Nicaud, Jean-Marc; Zavrel, Martin; White, Theodore C.; Wolfe, Kenneth H.; Butler, Geraldine

    2014-01-01

    In most eukaryotes, including the majority of fungi, expression of sterol biosynthesis genes is regulated by Sterol-Regulatory Element Binding Proteins (SREBPs), which are basic helix-loop-helix transcription activators. However, in yeasts such as Saccharomyces cerevisiae and Candida albicans sterol synthesis is instead regulated by Upc2, an unrelated transcription factor with a Gal4-type zinc finger. The SREBPs in S. cerevisiae (Hms1) and C. albicans (Cph2) have lost a domain, are not major regulators of sterol synthesis, and instead regulate filamentous growth. We report here that rewiring of the sterol regulon, with Upc2 taking over from SREBP, likely occurred in the common ancestor of all Saccharomycotina. Yarrowia lipolytica, a deep-branching species, is the only genome known to contain intact and full-length orthologs of both SREBP (Sre1) and Upc2. Deleting YlUPC2, but not YlSRE1, confers susceptibility to azole drugs. Sterol levels are significantly reduced in the YlUPC2 deletion. RNA-seq analysis shows that hypoxic regulation of sterol synthesis genes in Y. lipolytica is predominantly mediated by Upc2. However, YlSre1 still retains a role in hypoxic regulation; growth of Y. lipolytica in hypoxic conditions is reduced in a Ylupc2 deletion and is abolished in a Ylsre1/Ylupc2 double deletion, and YlSre1 regulates sterol gene expression during hypoxia adaptation. We show that YlSRE1, and to a lesser extent YlUPC2, are required for switching from yeast to filamentous growth in hypoxia. Sre1 appears to have an ancestral role in the regulation of filamentation, which became decoupled from its role in sterol gene regulation by the arrival of Upc2 in the Saccharomycotina. PMID:24453983

  18. New family of tungstate-responsive transcriptional regulators in sulfate-reducing bacteria.

    PubMed

    Kazakov, Alexey E; Rajeev, Lara; Luning, Eric G; Zane, Grant M; Siddartha, Kavya; Rodionov, Dmitry A; Dubchak, Inna; Arkin, Adam P; Wall, Judy D; Mukhopadhyay, Aindrila; Novichkov, Pavel S

    2013-10-01

    The trace elements molybdenum and tungsten are essential components of cofactors of many metalloenzymes. However, in sulfate-reducing bacteria, high concentrations of molybdate and tungstate oxyanions inhibit growth, thus requiring the tight regulation of their homeostasis. By a combination of bioinformatic and experimental techniques, we identified a novel regulator family, tungstate-responsive regulator (TunR), controlling the homeostasis of tungstate and molybdate in sulfate-reducing deltaproteobacteria. The effector-sensing domains of these regulators are similar to those of the known molybdate-responsive regulator ModE, while their DNA-binding domains are homologous to XerC/XerD site-specific recombinases. Using a comparative genomics approach, we identified DNA motifs and reconstructed regulons for 40 TunR family members. Positional analysis of TunR sites and putative promoters allowed us to classify most TunR proteins into two groups: (i) activators of modABC genes encoding a high-affinity molybdenum and tungsten transporting system and (ii) repressors of genes for toluene sulfonate uptake (TSUP) family transporters. The activation of modA and modBC genes by TunR in Desulfovibrio vulgaris Hildenborough was confirmed in vivo, and we discovered that the activation was diminished in the presence of tungstate. A predicted 30-bp TunR-binding motif was confirmed by in vitro binding assays. A novel TunR family of bacterial transcriptional factors controls tungstate and molybdate homeostasis in sulfate-reducing deltaproteobacteria. We proposed that TunR proteins participate in protection of the cells from the inhibition by these oxyanions. To our knowledge, this is a unique case of a family of bacterial transcriptional factors evolved from site-specific recombinases. PMID:23913324

  19. Genome-Wide Transcriptional Profiling of the Escherichia coli Responses to Superoxide Stress and Sodium Salicylate

    PubMed Central

    Pomposiello, Pablo J.; Bennik, Marjon H. J.; Demple, Bruce

    2001-01-01

    Escherichia coli responds to oxidative stress by activating sets of coregulated genes that help the cell to maintain homeostasis. Identified previously by genetic and biochemical approaches, the soxRS system mediates the induction of 18 of these redox-inducible genes (including the soxS gene itself). An overlapping set of genes is activated by an assortment of structurally unrelated molecules with antibiotic activities; many genes in this response are controlled by the marRAB system. The activation of either the soxRS or the marRAB system results in enhanced resistance to both superoxide-generating agents and multiple antibiotics. In order to probe the extent of these regulatory networks, we have measured whole-genome transcriptional profiles of the E. coli response to the superoxide-generating agent paraquat (PQ), an inducer of the soxRS system, and to the weak acid salt sodium salicylate (NaSal), an inducer of the marRA system. A total of 112 genes was modulated in response to PQ, while 134 genes were modulated in response to NaSal. We have also obtained transcriptional profiles of the SoxS and MarA regulons in the absence of global stress, in order to establish the regulatory hierarchies within the global responses. Several previously unrelated genes were shown to be under SoxS or MarA control. The genetic responses to both environmental insults revealed several common themes, including the activation of genes coding for functions that replenish reducing potential; regulate iron transport and storage; and participate in sugar and amino acid transport, detoxification, protein modification, osmotic protection, and peptidoglycan synthesis. A large number of PQ- and NaSal-responsive genes have no known function, suggesting that many adaptive metabolic changes that ensue after stress remain uncharacterized. PMID:11395452

  20. Imaging Transcription in Living Cells

    PubMed Central

    Darzacq, Xavier; Yao, Jie; Larson, Daniel R.; Causse, Sebastien Z.; Bosanac, Lana; de Turris, Valeria; Ruda, Vera M.; Lionnet, Timothee; Zenklusen, Daniel; Guglielmi, Benjamin; Tjian, Robert; Singer, Robert H.

    2011-01-01

    The advent of new technologies for the imaging of living cells has made it possible to determine the properties of transcription, the kinetics of polymerase movement, the association of transcription factors, and the progression of the polymerase on the gene. We report here the current state of the field and the progress necessary to achieve a more complete understanding of the various steps in transcription. Our Consortium is dedicated to developing and implementing the technology to further this understanding. PMID:19416065

  1. Transcriptional Regulation: a Genomic Overview

    PubMed Central

    Riechmann, José Luis

    2002-01-01

    The availability of the Arabidopsis thaliana genome sequence allows a comprehensive analysis of transcriptional regulation in plants using novel genomic approaches and methodologies. Such a genomic view of transcription first necessitates the compilation of lists of elements. Transcription factors are the most numerous of the different types of proteins involved in transcription in eukaryotes, and the Arabidopsis genome codes for more than 1,500 of them, or approximately 6% of its total number of genes. A genome-wide comparison of transcription factors across the three eukaryotic kingdoms reveals the evolutionary generation of diversity in the components of the regulatory machinery of transcription. However, as illustrated by Arabidopsis, transcription in plants follows similar basic principles and logic to those in animals and fungi. A global view and understanding of transcription at a cellular and organismal level requires the characterization of the Arabidopsis transcriptome and promoterome, as well as of the interactome, the localizome, and the phenome of the proteins involved in transcription. PMID:22303220

  2. Deregulated transcription factors in leukemia.

    PubMed

    Shima, Yutaka; Kitabayashi, Issay

    2011-08-01

    Specific chromosomal translocations and other mutations associated with acute myeloblastic leukemia (AML) often involve transcription factors and transcriptional coactivators. Such target genes include AML1, C/EBPα, RARα, MOZ, p300/CBP, and MLL, all of which are important in the regulation of hematopoiesis. The resultant fusion or mutant proteins deregulate the transcription of the affected genes and disrupt their essential role in hematopoiesis, causing differentiation block and abnormal proliferation and/or survival. This review focuses on such transcription factors and coactivators, and describes their roles in leukemogenesis and hematopoiesis. PMID:21823042

  3. Regulation of Expression and Evolution of Genes in Plastids of Rhodophytic Branch.

    PubMed

    Zverkov, Oleg Anatolyevich; Seliverstov, Alexandr Vladislavovich; Lyubetsky, Vassily Alexandrovich

    2016-01-01

    A novel algorithm and original software were used to cluster all proteins encoded in plastids of 72 species of the rhodophytic branch. The results are publicly available at http://lab6.iitp.ru/ppc/redline72/ in a database that allows fast identification of clusters (protein families) both by a fragment of an amino acid sequence and by a phylogenetic profile of a protein. No such integral clustering with the corresponding functions can be found in the public domain. The putative regulons of the transcription factors Ycf28 and Ycf29 encoded in the plastids were identified using the clustering and the database. A regulation of translation initiation was proposed for the ycf24 gene in plastids of certain red algae and apicomplexans as well as a regulation of a putative gene in apicoplasts of Babesia spp. and Theileria parva. The conserved regulation of the ycf24 gene expression and specificity alternation of the transcription factor Ycf28 were shown in the plastids. A phylogenetic tree of plastids was generated for the rhodophytic branch. The hypothesis of the origin of apicoplasts from the common ancestor of all apicomplexans from plastids of red algae was confirmed. PMID:26840333

  4. Regulation of Expression and Evolution of Genes in Plastids of Rhodophytic Branch

    PubMed Central

    Zverkov, Oleg Anatolyevich; Seliverstov, Alexandr Vladislavovich; Lyubetsky, Vassily Alexandrovich

    2016-01-01

    A novel algorithm and original software were used to cluster all proteins encoded in plastids of 72 species of the rhodophytic branch. The results are publicly available at http://lab6.iitp.ru/ppc/redline72/ in a database that allows fast identification of clusters (protein families) both by a fragment of an amino acid sequence and by a phylogenetic profile of a protein. No such integral clustering with the corresponding functions can be found in the public domain. The putative regulons of the transcription factors Ycf28 and Ycf29 encoded in the plastids were identified using the clustering and the database. A regulation of translation initiation was proposed for the ycf24 gene in plastids of certain red algae and apicomplexans as well as a regulation of a putative gene in apicoplasts of Babesia spp. and Theileria parva. The conserved regulation of the ycf24 gene expression and specificity alternation of the transcription factor Ycf28 were shown in the plastids. A phylogenetic tree of plastids was generated for the rhodophytic branch. The hypothesis of the origin of apicoplasts from the common ancestor of all apicomplexans from plastids of red algae was confirmed. PMID:26840333

  5. Study of the in vivo role of Mce2R, the transcriptional regulator of mce2 operon in Mycobacterium tuberculosis

    PubMed Central

    2013-01-01

    Background Tuberculosis is one of the leading causes of mortality throughout the world. Mycobacterium tuberculosis, the agent of human tuberculosis, has developed strategies involving proteins and other compounds called virulence factors to subvert human host defences and damage and invade the human host. Among these virulence-related proteins are the Mce proteins, which are encoded in the mce1, mce2, mce3 and mce4 operons of M. tuberculosis. The expression of the mce2 operon is negatively regulated by the Mce2R transcriptional repressor. Here we evaluated the role of Mce2R during the infection of M. tuberculosis in mice and macrophages and defined the genes whose expression is in vitro regulated by this transcriptional repressor. Results We used a specialized transduction method for generating a mce2R mutant of M. tuberculosis H37Rv. Although we found equivalent replication of the MtΔmce2R mutant and the wild type strains in mouse lungs, overexpression of Mce2R in the complemented strain (MtΔmce2RComp) significantly impaired its replication. During in vitro infection of macrophages, we observed a significantly increased association of the late endosomal marker LAMP-2 to MtΔmce2RComp-containing phagosomes as compared to MtΔmce2R and the wild type strains. Whole transcriptional analysis showed that Mce2R regulates mainly the expression of the mce2 operon, in the in vitro conditions studied. Conclusions The findings of the current study indicate that Mce2R weakly represses the in vivo expression of the mce2 operon in the studied conditions and argue for a role of the proteins encoded in Mce2R regulon in the arrest of phagosome maturation induced by M. tuberculosis. PMID:24007602

  6. Mechanosensitive mechanisms in transcriptional regulation

    PubMed Central

    Mammoto, Akiko; Mammoto, Tadanori; Ingber, Donald E.

    2012-01-01

    Summary Transcriptional regulation contributes to the maintenance of pluripotency, self-renewal and differentiation in embryonic cells and in stem cells. Therefore, control of gene expression at the level of transcription is crucial for embryonic development, as well as for organogenesis, functional adaptation, and regeneration in adult tissues and organs. In the past, most work has focused on how transcriptional regulation results from the complex interplay between chemical cues, adhesion signals, transcription factors and their co-regulators during development. However, chemical signaling alone is not sufficient to explain how three-dimensional (3D) tissues and organs are constructed and maintained through the spatiotemporal control of transcriptional activities. Accumulated evidence indicates that mechanical cues, which include physical forces (e.g. tension, compression or shear stress), alterations in extracellular matrix (ECM) mechanics and changes in cell shape, are transmitted to the nucleus directly or indirectly to orchestrate transcriptional activities that are crucial for embryogenesis and organogenesis. In this Commentary, we review how the mechanical control of gene transcription contributes to the maintenance of pluripotency, determination of cell fate, pattern formation and organogenesis, as well as how it is involved in the control of cell and tissue function throughout embryogenesis and adult life. A deeper understanding of these mechanosensitive transcriptional control mechanisms should lead to new approaches to tissue engineering and regenerative medicine. PMID:22797927

  7. Involvement of Outer Membrane Protein TolC, a Possible Member of the mar-sox Regulon, in Maintenance and Improvement of Organic Solvent Tolerance of Escherichia coli K-12

    PubMed Central

    Aono, Rikizo; Tsukagoshi, Norihiko; Yamamoto, Mami

    1998-01-01

    Escherichia coli mutants with improved organic solvent tolerance levels showed high levels of outer membrane protein TolC and inner membrane protein AcrA. The TolC level was regulated positively by MarA, Rob, or SoxS. A possible mar-rob-sox box sequence was found upstream of the tolC gene. These findings suggest that tolC is a member of the mar-sox regulon responsive to stress conditions. When a defective tolC gene was transferred to n-hexane- or cyclohexane-tolerant strains by P1 transduction, the organic solvent tolerance level was lowered dramatically to the decane-tolerant and nonane-sensitive level. The tolerance level was restored by transformation of the transductants with a wild-type tolC gene. Therefore, it is evident that TolC is essential for E. coli to maintain organic solvent tolerance. PMID:9473050

  8. Structural basis of transcription activation.

    PubMed

    Feng, Yu; Zhang, Yu; Ebright, Richard H

    2016-06-10

    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. PMID:27284196

  9. Mitotic bookmarking by transcription factors

    PubMed Central

    2013-01-01

    Mitosis is accompanied by dramatic changes in chromatin organization and nuclear architecture. Transcription halts globally and most sequence-specific transcription factors and co-factors are ejected from mitotic chromatin. How then does the cell maintain its transcriptional identity throughout the cell division cycle? It has become clear that not all traces of active transcription and gene repression are erased within mitotic chromatin. Many histone modifications are stable or only partially diminished throughout mitosis. In addition, some sequence-specific DNA binding factors have emerged that remain bound to select sites within mitotic chromatin, raising the possibility that they function to transmit regulatory information through the transcriptionally silent mitotic phase, a concept that has been termed “mitotic bookmarking.” Here we review recent approaches to studying potential bookmarking factors with regards to their mitotic partitioning, and summarize emerging ideas concerning the in vivo functions of mitotically bound nuclear factors. PMID:23547918

  10. Characterization of Mutants Deficient in the l,d-Carboxypeptidase (DacB) and WalRK (VicRK) Regulon, Involved in Peptidoglycan Maturation of Streptococcus pneumoniae Serotype 2 Strain D39▿†

    PubMed Central

    Barendt, Skye M.; Sham, Lok-To; Winkler, Malcolm E.

    2011-01-01

    Peptidoglycan (PG) hydrolases play critical roles in the remodeling of bacterial cell walls during division. PG hydrolases have been studied extensively in several bacillus species, such as Escherichia coli and Bacillus subtilis, but remain relatively uncharacterized in ovococcus species, such as Streptococcus pneumoniae (pneumococcus). In this work, we identified genes that encode proteins with putative PG hydrolytic domains in the genome of S. pneumoniae strain D39. Knockout mutations in these genes were constructed, and the resulting mutants were characterized in comparison with the parent strain for growth, cell morphology, PG peptide incorporation, and in some cases, PG peptide composition. In addition, we characterized deletion mutations in nonessential genes of unknown function in the WalRKSpn two-component system regulon, which also contains the essential pcsB cell division gene. Several mutants did not show overt phenotypes, which is perhaps indicative of redundancy. In contrast, two new mutants showed distinct defects in PG biosynthesis. One mutation was in a gene designated dacB (spd_0549), which we showed encodes an l,d-carboxypeptidase involved in PG maturation. Notably, dacB mutants, similar to dacA (d,d-carboxypeptidase) mutants, exhibited defects in cell shape and septation, consistent with the idea that the availability of PG peptide precursors is important for proper PG biosynthesis. Epistasis analysis indicated that DacA functions before DacB in d-Ala removal, and immunofluorescence microscopy showed that DacA and DacB are located over the entire surface of pneumococcal cells. The other mutation was in WalRKSpn regulon gene spd_0703, which encodes a putative membrane protein that may function as a type of conserved streptococcal shape, elongation, division, and sporulation (SEDS) protein. PMID:21378199

  11. RNA polymerase and the regulation of transcription

    SciTech Connect

    Reznikoff, W.S.; Gross, C.A.; Burgess, R.R.; Record, M.T.; Dahlberg, J.E.; Wickens, M.P.

    1987-01-01

    This book consists of eight sections, each containing several papers. The section titles are: RNA Polymerases; Transcription Initiation - Bacterial; Regulation of Bacterial Transcription Initiation; Stable RNA Synthesis in Eukaryotes: Chromatin Structure; Promoters; Enhancers; and the Global Control of Eukaryotic Transcription; Specific Eukaryotic Transcription Factors; Termination of Transcription; and Short Communications.

  12. Action of multiple intra-QTL genes concerted around a co-localized transcription factor underpins a large effect QTL.

    PubMed

    Dixit, Shalabh; Kumar Biswal, Akshaya; Min, Aye; Henry, Amelia; Oane, Rowena H; Raorane, Manish L; Longkumer, Toshisangba; Pabuayon, Isaiah M; Mutte, Sumanth K; Vardarajan, Adithi R; Miro, Berta; Govindan, Ganesan; Albano-Enriquez, Blesilda; Pueffeld, Mandy; Sreenivasulu, Nese; Slamet-Loedin, Inez; Sundarvelpandian, Kalaipandian; Tsai, Yuan-Ching; Raghuvanshi, Saurabh; Hsing, Yue-Ie C; Kumar, Arvind; Kohli, Ajay

    2015-01-01

    Sub-QTLs and multiple intra-QTL genes are hypothesized to underpin large-effect QTLs. Known QTLs over gene families, biosynthetic pathways or certain traits represent functional gene-clusters of genes of the same gene ontology (GO). Gene-clusters containing genes of different GO have not been elaborated, except in silico as coexpressed genes within QTLs. Here we demonstrate the requirement of multiple intra-QTL genes for the full impact of QTL qDTY12.1 on rice yield under drought. Multiple evidences are presented for the need of the transcription factor 'no apical meristem' (OsNAM12.1) and its co-localized target genes of separate GO categories for qDTY12.1 function, raising a regulon-like model of genetic architecture. The molecular underpinnings of qDTY12.1 support its effectiveness in further improving a drought tolerant genotype and for its validity in multiple genotypes/ecosystems/environments. Resolving the combinatorial value of OsNAM12.1 with individual intra-QTL genes notwithstanding, identification and analyses of qDTY12.1has fast-tracked rice improvement towards food security. PMID:26507552

  13. The unified ICE-CBF pathway provides a transcriptional feedback control of freezing tolerance during cold acclimation in Arabidopsis.

    PubMed

    Kim, Ye Seul; Lee, Minyoung; Lee, Jae-Hyung; Lee, Hyo-Jun; Park, Chung-Mo

    2015-09-01

    During cold acclimation, C-repeat binding factors (CBFs) activate downstream targets, such as cold-regulated genes, leading to the acquisition of freezing tolerance in plants. Inducer of CBF expression 1 (ICE1) plays a key role by activating CBF3 expression in shaping the cold-induced transcriptome. While the ICE1-CBF3 regulon constitutes a major cold acclimation pathway, gene regulatory networks governing the CBF signaling are poorly understood. Here, we demonstrated that ICE1 and its paralog ICE2 induce CBF1, CBF2, and CBF3 by binding to the gene promoters. ICE2, like ICE1, was ubiquitinated by the high expression of osmotically responsive gene 1 (HOS1) E3 ubiquitin ligase. Whereas ICE2-defective ice2-2 mutant did not exhibit any discernible freezing-sensitive phenotypes, ice1-2 ice2-2/+ plant, which is defective in ICE1 and has a heterozygotic ice2 mutation, exhibited significantly reduced freezing tolerance. Accordingly, all three CBF genes were markedly down-regulated in the ice1-2 ice2-2/+ plant, indicating that ICE1 and ICE2 are functionally redundant with different implementations in inducing CBF genes. Together with the negative regulation of CBF3 by CBF2, we propose that the unified ICE-CBF pathway provides a transcriptional feedback of freezing tolerance to sustain plant development and survival during cold acclimation. PMID:26311645

  14. Action of multiple intra-QTL genes concerted around a co-localized transcription factor underpins a large effect QTL

    PubMed Central

    Dixit, Shalabh; Kumar Biswal, Akshaya; Min, Aye; Henry, Amelia; Oane, Rowena H.; Raorane, Manish L.; Longkumer, Toshisangba; Pabuayon, Isaiah M.; Mutte, Sumanth K.; Vardarajan, Adithi R.; Miro, Berta; Govindan, Ganesan; Albano-Enriquez, Blesilda; Pueffeld, Mandy; Sreenivasulu, Nese; Slamet-Loedin, Inez; Sundarvelpandian, Kalaipandian; Tsai, Yuan-Ching; Raghuvanshi, Saurabh; Hsing, Yue-Ie C.; Kumar, Arvind; Kohli, Ajay

    2015-01-01

    Sub-QTLs and multiple intra-QTL genes are hypothesized to underpin large-effect QTLs. Known QTLs over gene families, biosynthetic pathways or certain traits represent functional gene-clusters of genes of the same gene ontology (GO). Gene-clusters containing genes of different GO have not been elaborated, except in silico as coexpressed genes within QTLs. Here we demonstrate the requirement of multiple intra-QTL genes for the full impact of QTL qDTY12.1 on rice yield under drought. Multiple evidences are presented for the need of the transcription factor ‘no apical meristem’ (OsNAM12.1) and its co-localized target genes of separate GO categories for qDTY12.1 function, raising a regulon-like model of genetic architecture. The molecular underpinnings of qDTY12.1 support its effectiveness in further improving a drought tolerant genotype and for its validity in multiple genotypes/ecosystems/environments. Resolving the combinatorial value of OsNAM12.1 with individual intra-QTL genes notwithstanding, identification and analyses of qDTY12.1has fast-tracked rice improvement towards food security. PMID:26507552

  15. Transcription of Trypanosoma brucei maxicircles

    SciTech Connect

    Michelotti, E.F.; Hajduk, S.L.

    1987-05-01

    Trypanosoma brucei is a protozoan parasite which developmentally regulates mitochondrial activity. In the mammal T. brucei produces ATP entirely by glycolysis while cytochrome mediated respiration resumes in the life-stage in the midgut of the insect vector. Using quantitative S1 nuclease protection assays two types of regulation of the steady state levels of the mitochondrial transcripts were found. Transcription of cytochrome b, cytochrome oxidase, and the rRNA genes is repressed in early bloodstream developmental stages, undergoes dramatic activation in later bloodstream stages, and finally a lesser activation in the insect developmental stage. Transcription of NADH dehydrogenase genes, however, is unregulated. Mitochondrial transcripts with a 5' triphosphate terminus, representing the site of transcription initiation, were capped using guanylyl transferase. The in vitro capped RNA hybridized to only one of eight mitochondrial restriction fragments on a Southern blot, however, hybridization of Southern blots with RNA from ..cap alpha..-/sup 32/P-UTP pulsed mitochondria labelled all restriction fragments equally. These results suggest that each DNA strand has a single promoter which directs the transcription of a full-length RNA which is subsequently processed. Different mitochondrial genes, despite being expressed on the same precursor RNA molecule, are independently regulated by both transcription initiation and RNA processing.

  16. AthaMap, integrating transcriptional and post-transcriptional data

    PubMed Central

    Bülow, Lorenz; Engelmann, Stefan; Schindler, Martin; Hehl, Reinhard

    2009-01-01

    The AthaMap database generates a map of predicted transcription factor binding sites (TFBS) for the whole Arabidopsis thaliana genome. AthaMap has now been extended to include data on post-transcriptional regulation. A total of 403 173 genomic positions of small RNAs have been mapped in the A. thaliana genome. These identify 5772 putative post-transcriptionally regulated target genes. AthaMap tools have been modified to improve the identification of common TFBS in co-regulated genes by subtracting post-transcriptionally regulated genes from such analyses. Furthermore, AthaMap was updated to the TAIR7 genome annotation, a graphic display of gene analysis results was implemented, and the TFBS data content was increased. AthaMap is freely available at http://www.athamap.de/. PMID:18842622

  17. AthaMap, integrating transcriptional and post-transcriptional data.

    PubMed

    Bülow, Lorenz; Engelmann, Stefan; Schindler, Martin; Hehl, Reinhard

    2009-01-01

    The AthaMap database generates a map of predicted transcription factor binding sites (TFBS) for the whole Arabidopsis thaliana genome. AthaMap has now been extended to include data on post-transcriptional regulation. A total of 403,173 genomic positions of small RNAs have been mapped in the A. thaliana genome. These identify 5772 putative post-transcriptionally regulated target genes. AthaMap tools have been modified to improve the identification of common TFBS in co-regulated genes by subtracting post-transcriptionally regulated genes from such analyses. Furthermore, AthaMap was updated to the TAIR7 genome annotation, a graphic display of gene analysis results was implemented, and the TFBS data content was increased. AthaMap is freely available at http://www.athamap.de/. PMID:18842622

  18. PTS regulation domain-containing transcriptional activator CelR and sigma factor σ(54) control cellobiose utilization in Clostridium acetobutylicum.

    PubMed

    Nie, Xiaoqun; Yang, Bin; Zhang, Lei; Gu, Yang; Yang, Sheng; Jiang, Weihong; Yang, Chen

    2016-04-01

    The phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS) regulation domain (PRD)-containing enhancer binding proteins (EBPs) are an important class of σ(54) -interacting transcriptional activators. Although PRD-containing EBPs are present in many Firmicutes, most of their regulatory functions remain unclear. In this study, the transcriptional regulons of about 50 PRD-containing EBPs in diverse Firmicutes species are reconstructed by using a comparative genomic approach, which contain the genes associated with utilization of β-glucosides, fructose/levan, mannose/glucose, pentitols, and glucosamine/fructosamine. We then present experimental evidence that the cel operon involved in cellobiose utilization is directly regulated by CelR and σ(54) (SigL) in Clostridium acetobutylicum. The predicted three CelR-binding sites and σ(54) promoter elements upstream of the cel operon are verified by in vitro binding assays. We show that CelR has an ATPase activity, which is strongly stimulated by the presence of DNA containing the CelR-binding sites. Moreover, mutations in any one of the three CelR-binding sites significantly decreased the cel promoter activity probably due to the need for all three DNA sites for maximal ATPase activity of CelR. It is suggested that CelR is regulated by PTS-mediated phosphorylation at His-551 and His-829, which exerts a positive effect and an inhibitory effect, respectively, on the CelR activity. PMID:26691835

  19. Identification of host transcriptional networks showing concentration-dependent regulation by HPV16 E6 and E7 proteins in basal cervical squamous epithelial cells

    PubMed Central

    Smith, Stephen P.; Scarpini, Cinzia G.; Groves, Ian J.; Odle, Richard I.; Coleman, Nicholas

    2016-01-01

    Development of cervical squamous cell carcinoma requires increased expression of the major high-risk human-papillomavirus (HPV) oncogenes E6 and E7 in basal cervical epithelial cells. We used a systems biology approach to identify host transcriptional networks in such cells and study the concentration-dependent changes produced by HPV16-E6 and -E7 oncoproteins. We investigated sample sets derived from the W12 model of cervical neoplastic progression, for which high quality phenotype/genotype data were available. We defined a gene co-expression matrix containing a small number of highly-connected hub nodes that controlled large numbers of downstream genes (regulons), indicating the scale-free nature of host gene co-expression in W12. We identified a small number of ‘master regulators’ for which downstream effector genes were significantly associated with protein levels of HPV16 E6 (n = 7) or HPV16 E7 (n = 5). We validated our data by depleting E6/E7 in relevant cells and by functional analysis of selected genes in vitro. We conclude that the network of transcriptional interactions in HPV16-infected basal-type cervical epithelium is regulated in a concentration-dependent manner by E6/E7, via a limited number of central master-regulators. These effects are likely to be significant in cervical carcinogenesis, where there is competitive selection of cells with elevated expression of virus oncoproteins. PMID:27457222

  20. XbmR, a new transcription factor involved in the regulation of chemotaxis, biofilm formation and virulence in Xanthomonas citri subsp. citri.

    PubMed

    Yaryura, Pablo M; Conforte, Valeria P; Malamud, Florencia; Roeschlin, Roxana; de Pino, Verónica; Castagnaro, Atilio P; McCarthy, Yvonne; Dow, J Maxwell; Marano, María R; Vojnov, Adrián A

    2015-11-01

    Xanthomonas citri subsp. citri (Xcc) is the causal agent of citrus canker. Biofilm formation on citrus leaves plays an important role in epiphytic survival of Xcc. Biofilm formation is affected by transposon insertion in XAC3733, which encodes a transcriptional activator of the NtrC family, not linked to a gene encoding a sensor protein, thus could be considered as an 'orphan' regulator whose function is poorly understood in Xanthomonas spp. Here we show that mutation of XAC3733 (named xbmR) resulted in impaired structural development of the Xcc biofilm, loss of chemotaxis and reduced virulence in grapefruit plants. All defective phenotypes were restored to wild-type levels by the introduction of PA2567 from Pseudomonas aeruginosa, which encodes a phosphodiesterase active in the degradation of cyclic diguanosine monophosphate (c-di-GMP). A knockout of xbmR led to a substantial downregulation of fliA that encodes a σ(28) transcription factor, as well as fliC and XAC0350 which are potential member of the σ(28) regulon. XAC0350 encodes an HD-GYP domain c-di-GMP phosphodiesterase. These findings suggest that XbmR is a key regulator of flagellar-dependent motility and chemotaxis exerting its action through a regulatory pathway that involves FliA and c-di-GMP. PMID:25346091

  1. Analysis of Activator and Repressor Functions Reveals the Requirements for Transcriptional Control by LuxR, the Master Regulator of Quorum Sensing in Vibrio harveyi

    PubMed Central

    van Kessel, Julia C.; Ulrich, Luke E.; Zhulin, Igor B.; Bassler, Bonnie L.

    2013-01-01

    ABSTRACT LuxR-type transcription factors are the master regulators of quorum sensing in vibrios. LuxR proteins are unique members of the TetR superfamily of transcription factors because they activate and repress large regulons of genes. Here, we used chromatin immunoprecipitation and nucleotide sequencing (ChIP-seq) to identify LuxR binding sites in the Vibrio harveyi genome. Bioinformatics analyses showed that the LuxR consensus binding site at repressed promoters is a symmetric palindrome, whereas at activated promoters it is asymmetric and contains only half of the palindrome. Using a genetic screen, we isolated LuxR mutants that separated activation and repression functions at representative promoters. These LuxR mutants exhibit sequence-specific DNA binding defects that restrict activation or repression activity to subsets of target promoters. Altering the LuxR DNA binding site sequence to one more closely resembling the ideal LuxR consensus motif can restore in vivo function to a LuxR mutant. This study provides a mechanistic understanding of how a single protein can recognize a variety of binding sites to differentially regulate gene expression. PMID:23839217

  2. Identification of host transcriptional networks showing concentration-dependent regulation by HPV16 E6 and E7 proteins in basal cervical squamous epithelial cells.

    PubMed

    Smith, Stephen P; Scarpini, Cinzia G; Groves, Ian J; Odle, Richard I; Coleman, Nicholas

    2016-01-01

    Development of cervical squamous cell carcinoma requires increased expression of the major high-risk human-papillomavirus (HPV) oncogenes E6 and E7 in basal cervical epithelial cells. We used a systems biology approach to identify host transcriptional networks in such cells and study the concentration-dependent changes produced by HPV16-E6 and -E7 oncoproteins. We investigated sample sets derived from the W12 model of cervical neoplastic progression, for which high quality phenotype/genotype data were available. We defined a gene co-expression matrix containing a small number of highly-connected hub nodes that controlled large numbers of downstream genes (regulons), indicating the scale-free nature of host gene co-expression in W12. We identified a small number of 'master regulators' for which downstream effector genes were significantly associated with protein levels of HPV16 E6 (n = 7) or HPV16 E7 (n = 5). We validated our data by depleting E6/E7 in relevant cells and by functional analysis of selected genes in vitro. We conclude that the network of transcriptional interactions in HPV16-infected basal-type cervical epithelium is regulated in a concentration-dependent manner by E6/E7, via a limited number of central master-regulators. These effects are likely to be significant in cervical carcinogenesis, where there is competitive selection of cells with elevated expression of virus oncoproteins. PMID:27457222

  3. Zooming in on Transcription Preinitiation.

    PubMed

    Gupta, Kapil; Sari-Ak, Duygu; Haffke, Matthias; Trowitzsch, Simon; Berger, Imre

    2016-06-19

    Class II gene transcription commences with the assembly of the Preinitiation Complex (PIC) from a plethora of proteins and protein assemblies in the nucleus, including the General Transcription Factors (GTFs), RNA polymerase II (RNA pol II), co-activators, co-repressors, and more. TFIID, a megadalton-sized multiprotein complex comprising 20 subunits, is among the first GTFs to bind the core promoter. TFIID assists in nucleating PIC formation, completed by binding of further factors in a highly regulated stepwise fashion. Recent results indicate that TFIID itself is built from distinct preformed submodules, which reside in the nucleus but also in the cytosol of cells. Here, we highlight recent insights in transcription factor assembly and the regulation of transcription preinitiation. PMID:27067110

  4. The transcriptional foundation of pluripotency.

    PubMed

    Chambers, Ian; Tomlinson, Simon R

    2009-07-01

    A fundamental goal in biology is to understand the molecular basis of cell identity. Pluripotent embryonic stem (ES) cell identity is governed by a set of transcription factors centred on the triumvirate of Oct4, Sox2 and Nanog. These proteins often bind to closely localised genomic sites. Recent studies have identified additional transcriptional modulators that bind to chromatin near sites occupied by Oct4, Sox2 and Nanog. This suggests that the combinatorial control of gene transcription might be fundamental to the ES cell state. Here we discuss how these observations advance our understanding of the transcription factor network that controls pluripotent identity and highlight unresolved issues that arise from these studies. PMID:19542351

  5. Transcriptional Regulation of Hepatic Lipogenesis

    PubMed Central

    Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

    2016-01-01

    Fatty acid and fat synthesis in liver is a highly regulated metabolic pathway critical for energy distribution. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcription level. Transcription factors, such as USF, SREBP-1c, LXR and ChREBP play critical roles in this process. Recently, insights have been gained into how various signaling pathways regulate these transcription factors. After feeding, high blood glucose and insulin induce lipogenic genes through several pathways, including DNA-PK, aPKC and Akt-mTOR. Various transcription factors and coregulators undergo specific modifications, such as phosphorylation, acetylation, or ubiquitination, which affect their function, stability, or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance. PMID:26490400

  6. RNA-guided transcriptional regulation

    DOEpatents

    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.

    2016-02-23

    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  7. Forcing FAK into Transcriptional Activity.

    PubMed

    Lietha, Daniel

    2016-08-01

    Focal adhesion kinase (FAK) has known signaling roles in cytoplasmic adhesion structures, but was recently shown to act as a transcriptional regulator in the nucleus. In this issue of Structure, Cardoso et al. (2016) report that mechanical forces translocate FAK to the nucleus of cardiomyocytes, and provide structural insights into how FAK interacts with the MEF2 transcription factor to control cardiac hypertrophy. PMID:27486913

  8. A direct link between the global regulator PhoP and the Csr regulon in Y. pseudotuberculosis through the small regulatory RNA CsrC.

    PubMed

    Nuss, Aaron M; Schuster, Franziska; Kathrin Heroven, Ann; Heine, Wiebke; Pisano, Fabio; Dersch, Petra

    2014-01-01

    In this study we investigated the influence of the global response regulator PhoP on the complex regulatory cascade controlling expression of early stage virulence genes of Yersinia pseudotuberculosis via the virulence regulator RovA. Our analysis revealed the following novel features: (1) PhoP activates expression of the CsrC RNA in Y. pseudotuberculosis, leading to activation of RovA synthesis through the CsrABC-RovM cascade, (2) activation of csrC transcription is direct and PhoP is shown to bind to two separate PhoP box-like sites, (3) PhoP-mediated activation results in transcription from two different promoters closely downstream of the PhoP binding sites, leading to two distinct CsrC RNAs, and (4) the stability of the CsrC RNAs differs significantly between the Y. pseudotuberculosis strains YPIII and IP32953 due to a 20 nucleotides insertion in CsrC(IP32953), which renders the transcript more susceptible to degradation. In summary, our study showed that PhoP-mediated influence on the regulatory cascade controlling the Csr system and RovA in Y. pseudotuberculosis varies within the species, suggesting that the Csr system is a focal point to readjust and adapt the genus to different hosts and reservoirs. PMID:24786463

  9. The transcriptional activator LdtR from 'Candidatus Liberibacter asiaticus' mediates osmotic stress tolerance.

    PubMed

    Pagliai, Fernando A; Gardner, Christopher L; Bojilova, Lora; Sarnegrim, Amanda; Tamayo, Cheila; Potts, Anastasia H; Teplitski, Max; Folimonova, Svetlana Y; Gonzalez, Claudio F; Lorca, Graciela L

    2014-04-01

    The causal agent of Huanglongbing disease, 'Candidatus Liberibacter asiaticus', is a non-culturable, gram negative, phloem-limited α-proteobacterium. Current methods to control the spread of this disease are still limited to the removal and destruction of infected trees. In this study, we identified and characterized a regulon from 'Ca. L. asiaticus' involved in cell wall remodeling, that contains a member of the MarR family of transcriptional regulators (ldtR), and a predicted L,D-transpeptidase (ldtP). In Sinorhizobium meliloti, mutation of ldtR resulted in morphological changes (shortened rod-type phenotype) and reduced tolerance to osmotic stress. A biochemical approach was taken to identify small molecules that modulate LdtR activity. The LdtR ligands identified by thermal shift assays were validated using DNA binding methods. The biological impact of LdtR inactivation by the small molecules was then examined in Sinorhizobium meliloti and Liberibacter crescens, where a shortened-rod phenotype was induced by growth in presence of the ligands. A new method was also developed to examine the effects of small molecules on the viability of 'Ca. Liberibacter asiaticus', using shoots from HLB-infected orange trees. Decreased expression of ldtRLas and ldtPLas was observed in samples taken from HLB-infected shoots after 6 h of incubation with the LdtR ligands. These results provide strong proof of concept for the use of small molecules that target LdtR, as a potential treatment option for Huanglongbing disease. PMID:24763829

  10. The Transcriptional Activator LdtR from ‘Candidatus Liberibacter asiaticus’ Mediates Osmotic Stress Tolerance

    PubMed Central

    Bojilova, Lora; Sarnegrim, Amanda; Tamayo, Cheila; Potts, Anastasia H.; Teplitski, Max; Folimonova, Svetlana Y.; Gonzalez, Claudio F.; Lorca, Graciela L.

    2014-01-01

    The causal agent of Huanglongbing disease, ‘Candidatus Liberibacter asiaticus’, is a non-culturable, gram negative, phloem-limited α-proteobacterium. Current methods to control the spread of this disease are still limited to the removal and destruction of infected trees. In this study, we identified and characterized a regulon from ‘Ca. L. asiaticus’ involved in cell wall remodeling, that contains a member of the MarR family of transcriptional regulators (ldtR), and a predicted L,D-transpeptidase (ldtP). In Sinorhizobium meliloti, mutation of ldtR resulted in morphological changes (shortened rod-type phenotype) and reduced tolerance to osmotic stress. A biochemical approach was taken to identify small molecules that modulate LdtR activity. The LdtR ligands identified by thermal shift assays were validated using DNA binding methods. The biological impact of LdtR inactivation by the small molecules was then examined in Sinorhizobium meliloti and Liberibacter crescens, where a shortened-rod phenotype was induced by growth in presence of the ligands. A new method was also developed to examine the effects of small molecules on the viability of ‘Ca. Liberibacter asiaticus’, using shoots from HLB-infected orange trees. Decreased expression of ldtRLas and ldtPLas was observed in samples taken from HLB-infected shoots after 6 h of incubation with the LdtR ligands. These results provide strong proof of concept for the use of small molecules that target LdtR, as a potential treatment option for Huanglongbing disease. PMID:24763829

  11. TATA-binding protein and transcription factor IIB induce transcript slipping during early transcription by RNA polymerase II.

    PubMed

    Gilman, Benjamin; Drullinger, Linda F; Kugel, Jennifer F; Goodrich, James A

    2009-04-01

    To better understand the mechanism of steps in early transcription by RNA polymerase II (pol II), we investigated the molecular determinants of transcript slipping within complexes assembled on promoters containing a pre-melted transcription bubble from -9 to +3. Transcript slippage occurs when an RNA transcript contains a repetitive sequence that allows the transcript to slip back and pair with the template strand of the DNA at a new register before transcription continues. We established the contributions of individual transcription factors, DNA elements, and RNA length to slipping on a heteroduplex template using a highly purified human pol II transcription system. We found that transcripts slip at a very defined point in the transcription reaction, after pol II completes phosphodiester bond synthesis at register +5. This point is set by the position of the polymerase active site on the DNA template, as opposed to the length of the transcript, as well as by a repetitive CUCU sequence that must occur from +2 to +5. Interestingly, slipping at this juncture is induced by TATA-binding protein and transcription factor IIB and requires a TATA box but not a transcription factor IIB recognition sequence. We propose a model in which transcribing complexes, upon completing phosphodiester bond synthesis at register +5, enter one of two branches in which they either complete productive synthesis of the transcript or undergo multiple rounds of transcript slipping. PMID:19193635

  12. Phylogenetic and Transcription Analysis of Chrysanthemum WRKY Transcription Factors

    PubMed Central

    Song, Aiping; Li, Peiling; Jiang, Jiafu; Chen, Sumei; Li, Huiyun; Zeng, Jun; Shao, Yafeng; Zhu, Lu; Zhang, Zhaohe; Chen, Fadi

    2014-01-01

    WRKY transcription factors are known to function in a number of plant processes. Here we have characterized 15 WRKY family genes of the important ornamental species chrysanthemum (Chrysanthemum morifolium). A total of 15 distinct sequences were isolated; initially internal fragments were amplified based on transcriptomic sequence, and then the full length cDNAs were obtained using RACE (rapid amplification of cDNA ends) PCR. The transcription of these 15 genes in response to a variety of phytohormone treatments and both biotic and abiotic stresses was characterized. Some of the genes behaved as would be predicted based on their homology with Arabidopsis thaliana WRKY genes, but others showed divergent behavior. PMID:25196345

  13. Transcriptional gene silencing in humans.

    PubMed

    Weinberg, Marc S; Morris, Kevin V

    2016-08-19

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  14. Creating small transcription activating RNAs.

    PubMed

    Chappell, James; Takahashi, Melissa K; Lucks, Julius B

    2015-03-01

    We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

  15. Circadian Control of Global Transcription

    PubMed Central

    Li, Shujing; Zhang, Luoying

    2015-01-01

    Circadian rhythms exist in most if not all organisms on the Earth and manifest in various aspects of physiology and behavior. These rhythmic processes are believed to be driven by endogenous molecular clocks that regulate rhythmic expression of clock-controlled genes (CCGs). CCGs consist of a significant portion of the genome and are involved in diverse biological pathways. The transcription of CCGs is tuned by rhythmic actions of transcription factors and circadian alterations in chromatin. Here, we review the circadian control of CCG transcription in five model organisms that are widely used, including cyanobacterium, fungus, plant, fruit fly, and mouse. Comparing the similarity and differences in the five organisms could help us better understand the function of the circadian clock, as well as its output mechanisms adapted to meet the demands of diverse environmental conditions. PMID:26682214

  16. Dnmt1/Transcription Factor Interactions

    PubMed Central

    Hervouet, Eric; Vallette, François M.; Cartron, Pierre-François

    2010-01-01

    DNA methylation inheritance is the process of copying, via the DNA methyltransferase 1 (Dnmt1), the pre-existing methylation patterns onto the new DNA strand during DNA replication. Experiments of chromatin immunoprecipitation, measurement of maintenance methyltransferase activity, proximity ligation in situ assays (P-LISA, Duolink/Olink), and transcription factor arrays demonstrate that Dnmt1 interacts with transcription factors to promote site-specific DNA methylation inheritance, while the Dnmt1-PCNA-UHRF1 complex promotes the DNA methylation inheritance without site preference. We also show that the Dnmt1-PCNA-UHRF1 and Dnmt1/transcription factor complexes methylate DNA by acting as a single player or in cooperation. Thus, our data establish that the copying of the pre-existing methylation pattern is governed by the orchestration of the untargeted and the targeted mechanisms of DNA methylation inheritance, which are themselves dictated by the partners of Dnmt1. PMID:21779454

  17. Transcriptional Landscape of Cardiomyocyte Maturation

    PubMed Central

    Uosaki, Hideki; Cahan, Patrick; Lee, Dong I.; Wang, Songnan; Miyamoto, Matthew; Fernandez, Laviel; Kass, David A.; Kwon, Chulan

    2015-01-01

    SUMMARY Decades of progress in developmental cardiology has advanced our understanding of the early aspects of heart development, including cardiomyocyte (CM) differentiation. However, control of CM maturation which is subsequently required to generate adult myocytes, remains elusive. Here, we analyzed over 200 microarray datasets from early embryonic to adult hearts and identified a large number of genes whose expression shifts gradually and continuously during maturation. We generated an atlas of integrated gene expression, biological pathways, transcriptional regulators, and gene regulatory networks (GRNs), which show discrete sets of key transcriptional regulators and pathways activated or suppressed during CM maturation. We developed a GRN-based program named MatStatCM that indexes CM maturation status. MatStatCM reveals that pluripotent stem cell-derived CMs mature early in culture, but are arrested at the late embryonic stage with aberrant regulation of key transcription factors. Our study provides a foundation for understanding CM maturation. PMID:26586429

  18. Structures of the Porphyromonas gingivalis OxyR regulatory domain explain differences in expression of the OxyR regulon in Escherichia coli and P. gingivalis

    SciTech Connect

    Svintradze, David V.; Peterson, Darrell L.; Collazo-Santiago, Evys A.; Lewis, Janina P.; Wright, H. Tonie

    2013-10-01

    Differences in OxyR regulated expression of oxidative stress genes between Escherichia coli and Porphyromonas gingivalis are explained by very minor differences in structure and amino-acid sequence of the respective oxidized and reduced OxyR regulatory domains. These differences affect OxyR quaternary structures and are predicted from model building of full length OxyR–DNA complexes to confer distinct modes of DNA binding on this transcriptional regulator. OxyR transcriptionally regulates Escherichia coli oxidative stress response genes through a reversibly reducible cysteine disulfide biosensor of cellular redox status. Structural changes induced by redox changes in these cysteines are conformationally transmitted to the dimer subunit interfaces, which alters dimer and tetramer interactions with DNA. In contrast to E. coli OxyR regulatory-domain structures, crystal structures of Porphyromonas gingivalis OxyR regulatory domains show minimal differences in dimer configuration on changes in cysteine disulfide redox status. This locked configuration of the P. gingivalis OxyR regulatory-domain dimer closely resembles the oxidized (activating) form of the E. coli OxyR regulatory-domain dimer. It correlates with the observed constitutive activation of some oxidative stress genes in P. gingivalis and is attributable to a single amino-acid insertion in P. gingivalis OxyR relative to E. coli OxyR. Modelling of full-length P. gingivalis, E. coli and Neisseria meningitidis OxyR–DNA complexes predicts different modes of DNA binding for the reduced and oxidized forms of each.

  19. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K

    1999-01-01

    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  20. Making Sense of Transcription Networks

    PubMed Central

    Sorrells, Trevor R; Johnson, Alexander D

    2015-01-01

    When transcription regulatory networks are compared among distantly related eukaryotes, a number of striking similarities are observed: a larger-than-expected number of genes, extensive overlapping connections, and an apparently high degree of functional redundancy. It is often assumed that the complexity of these networks represents optimized solutions, precisely sculpted by natural selection; their common features are often asserted to be adaptive. Here, we discuss support for an alternative hypothesis: the common structural features of transcription networks arise from evolutionary trajectories of “least resistance,” that is, the relative ease by which certain types of network structures are formed during their evolution. PMID:25957680

  1. Transcription rates in DNA brushes.

    PubMed

    Yamamoto, Tetsuya; Safran, S A

    2015-04-21

    We theoretically predict the rate of transcription (TX) in DNA brushes by introducing the concept of TX dipoles that takes into account the unidirectional motion of enzymes (RNAP) along DNA during transcription as correlated pairs of sources and sinks in the relevant diffusion equation. Our theory predicts that the TX rates dramatically change upon the inversion of the orientation of the TX dipoles relative to the substrate because TX dipoles modulate the concentrations of RNAP in the solution. Comparing our theory with experiments suggests that, in some cases, DNA chain segments are relatively uniformly distributed in the brush, in contrast to the parabolic profile expected for flexible polymer brushes. PM