Sample records for apicomplexan transcriptional regulons

  1. Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota

    PubMed Central

    Leyn, Semen A.; Rodionova, Irina A.; Li, Xiaoqing


    ABSTRACT Autotrophic microorganisms are able to utilize carbon dioxide as their only carbon source, or, alternatively, many of them can grow heterotrophically on organics. Different variants of autotrophic pathways have been identified in various lineages of the phylum Crenarchaeota. Aerobic members of the order Sulfolobales utilize the hydroxypropionate-hydroxybutyrate cycle (HHC) to fix inorganic carbon, whereas anaerobic Thermoproteales use the dicarboxylate-hydroxybutyrate cycle (DHC). Knowledge of transcriptional regulation of autotrophic pathways in Archaea is limited. We applied a comparative genomics approach to predict novel autotrophic regulons in the Crenarchaeota. We report identification of two novel DNA motifs associated with the autotrophic pathway genes in the Sulfolobales (HHC box) and Thermoproteales (DHC box). Based on genome context evidence, the HHC box regulon was attributed to a novel transcription factor from the TrmB family named HhcR. Orthologs of HhcR are present in all Sulfolobales genomes but were not found in other lineages. A predicted HHC box regulatory motif was confirmed by in vitro binding assays with the recombinant HhcR protein from Metallosphaera yellowstonensis. For the DHC box regulon, we assigned a different potential regulator, named DhcR, which is restricted to the order Thermoproteales. DhcR in Thermoproteus neutrophilus (Tneu_0751) was previously identified as a DNA-binding protein with high affinity for the promoter regions of two autotrophic operons. The global HhcR and DhcR regulons reconstructed by comparative genomics were reconciled with available omics data in Metallosphaera and Thermoproteus spp. The identified regulons constitute two novel mechanisms for transcriptional control of autotrophic pathways in the Crenarchaeota. IMPORTANCE Little is known about transcriptional regulation of carbon dioxide fixation pathways in Archaea. We previously applied the comparative genomics approach for reconstruction of DtxR family regulons in diverse lineages of Archaea. Here, we utilize similar computational approaches to identify novel regulatory motifs for genes that are autotrophically induced in microorganisms from two lineages of Crenarchaeota and to reconstruct the respective regulons. The predicted novel regulons in archaeal genomes control the majority of autotrophic pathway genes and also other carbon and energy metabolism genes. The HhcR regulon was experimentally validated by DNA-binding assays in Metallosphaera spp. Novel regulons described for the first time in this work provide a basis for understanding the mechanisms of transcriptional regulation of autotrophic pathways in Archaea. PMID:25939834

  2. Maltose-Dependent Transcriptional Regulation of the mal Regulon by MalR in Streptococcus pneumoniae

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Kuipers, Oscar P.


    The maltose regulon (mal regulon) has previously been shown to consist of the mal gene cluster (malMP, malXCD and malAR operons) in Streptococcus pneumoniae. In this study, we have further elucidated the complete mal regulon in S. pneumoniae D39 using microarray analyses and ?-galactosidase assays. In addition to the mal gene cluster, the complete mal regulon of S. pneumoniae D39 consists of a pullulanase (PulA), a glucosidase (DexB), a glucokinase (RokB), a PTS component (PtsG) and an amylase (AmyA2). Our microarray studies and ?-galactosidase assays further showed that the LacI-family transcriptional regulator MalR represses the expression of the mal regulon in the absence of maltose. Furthermore, the role of the pleiotropic transcriptional regulator CcpA in the regulation of the mal regulon in the presence of maltose was explored. Our microarray analysis with a ?ccpA strain showed that CcpA only represses the expression of the malXCD operon and the pulA gene in the presence of maltose. Hence, we extend the mal regulon now consisting of pulA, dexB, rokB, ptsG and amyA2 in addition to malMP, malXCD and malAR operons. PMID:26030923

  3. Comparative genomics and evolution of regulons of the LacI-family transcription factors

    PubMed Central

    Ravcheev, Dmitry A.; Khoroshkin, Matvei S.; Laikova, Olga N.; Tsoy, Olga V.; Sernova, Natalia V.; Petrova, Svetlana A.; Rakhmaninova, Aleksandra B.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.


    DNA-binding transcription factors (TFs) are essential components of transcriptional regulatory networks in bacteria. LacI-family TFs (LacI-TFs) are broadly distributed among certain lineages of bacteria. The majority of characterized LacI-TFs sense sugar effectors and regulate carbohydrate utilization genes. The comparative genomics approaches enable in silico identification of TF-binding sites and regulon reconstruction. To study the function and evolution of LacI-TFs, we performed genomics-based reconstruction and comparative analysis of their regulons. For over 1300 LacI-TFs from over 270 bacterial genomes, we predicted their cognate DNA-binding motifs and identified target genes. Using the genome context and metabolic subsystem analyses of reconstructed regulons, we tentatively assigned functional roles and predicted candidate effectors for 78 and 67% of the analyzed LacI-TFs, respectively. Nearly 90% of the studied LacI-TFs are local regulators of sugar utilization pathways, whereas the remaining 125 global regulators control large and diverse sets of metabolic genes. The global LacI-TFs include the previously known regulators CcpA in Firmicutes, FruR in Enterobacteria, and PurR in Gammaproteobacteria, as well as the three novel regulators—GluR, GapR, and PckR—that are predicted to control the central carbohydrate metabolism in three lineages of Alphaproteobacteria. Phylogenetic analysis of regulators combined with the reconstructed regulons provides a model of evolutionary diversification of the LacI protein family. The obtained genomic collection of in silico reconstructed LacI-TF regulons in bacteria is available in the RegPrecise database ( It provides a framework for future structural and functional classification of the LacI protein family and identification of molecular determinants of the DNA and ligand specificity. The inferred regulons can be also used for functional gene annotation and reconstruction of sugar catabolic networks in diverse bacterial lineages. PMID:24966856

  4. Transcriptional and functional analysis of the Neisseria gonorrhoeae fur regulon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To ensure survival in the host, bacteria have evolved strategies to acquire the essential element iron. In Neisseria gonorrhoeae, the ferric uptake regulator senses intracellular iron stores and acting as a repressor, directly regulates transcription of iron-responsive genes by binding to a conserve...

  5. Global transcriptional and proteomic analysis of the Sig1 heat shock regulon of Deinococcus radiodurans.


    Schmid, Amy K; Howell, Heather A; Battista, John R; Peterson, Scott N; Lidstrom, Mary E


    The sig1 gene, predicted to encode an extracytoplasmic function-type heat shock sigma factor of Deinococcus radiodurans, has been shown to play a central role in the positive regulation of the heat shock operons groESL and dnaKJ. To determine if Sig1 is required for the regulation of additional heat shock genes, we monitored the global transcriptional and proteomic profiles of a D. radiodurans R1 sig1 mutant and wild-type cells in response to elevated temperature stress. Thirty-one gene products were identified that showed heat shock induction in the wild type but not in the sig1 mutant. Quantitative real-time PCR experiments verified the transcriptional requirement of Sig1 for the heat shock induction of the mRNA of five of these genes-dnaK, groES, DR1314, pspA, and hsp20. hsp20 appears to encode a new member of the small heat shock protein superfamily, DR1314 is predicted to encode a hypothetical protein with no recognizable orthologs, and pspA is predicted to encode a protein involved in maintenance of membrane integrity. Deletion mutation analysis demonstrated the importance in heat shock protection of hsp20 and DR1314. The promoters of dnaKJE, groESL, DR1314, pspA, and hsp20 were mapped and, combined with computer-based pattern searches of the upstream regions of the 26 other Sig1 regulon members, these results suggested that Sig1 might recognize both sigma70-type and sigma(W)-type promoter consensus sequences. These results expand the D. radiodurans Sig1 heat shock regulon to include 31 potential new members, including not only factors with cytoplasmic functions, such as groES and dnaK, but also those with extracytoplasmic functions, like pspA. PMID:15866918

  6. Transcriptome analysis of differentiating trypanosomes reveals the existence of multiple post-transcriptional regulons

    PubMed Central

    Queiroz, Rafael; Benz, Corinna; Fellenberg, Kurt; Hoheisel, Jrg D; Clayton, Christine


    Background Trypanosome gene expression is regulated almost exclusively at the post-transcriptional level, with mRNA degradation playing a decisive role. When trypanosomes are transferred from the blood of a mammal to the midgut of a Tsetse fly, they transform to procyclic forms: gene expression is reprogrammed, changing the cell surface and switching the mode of energy metabolism. Within the blood, trypanosomes can pre-adapt for Tsetse transmission, becoming growth-arrested stumpy forms. We describe here the transitions in gene expression that occur during differentiation of in-vitro cultured bloodstream forms to procyclic forms. Results Some mRNAs showed changes within 30 min of cis-aconitate addition, whereas others responded 12-24 hours later. For the first 12 h after addition of cis-aconitate, cells accumulated at the G1 phase of the cell cycle, and showed decreases in mRNAs required for proliferation, mimicking the changes seen in stumpy forms: many mRNAs needed for ribosomal and flagellar biogenesis showed striking co-regulation. Other mRNAs encoding components of signal transduction pathways and potential regulators were specifically induced only during differentiation. Messenger RNAs encoding proteins required for individual metabolic pathways were often co-regulated. Conclusion Trypanosome genes form post-transcriptional regulons in which mRNAs with functions in particular pathways, or encoding components of protein complexes, show almost identical patterns of regulation. PMID:19857263

  7. Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon

    PubMed Central

    Rodionov, Dmitry A.; Li, Xiaoqing; Rodionova, Irina A.; Yang, Chen; Sorci, Leonardo; Dervyn, Etienne; Martynowski, Dariusz; Zhang, Hong; Gelfand, Mikhail S.; Osterman, Andrei L.


    A comparative genomic approach was used to reconstruct transcriptional regulation of NAD biosynthesis in bacteria containing orthologs of Bacillus subtilis gene yrxA, a previously identified niacin-responsive repressor of NAD de novo synthesis. Members of YrxA family (re-named here NiaR) are broadly conserved in the Bacillus/Clostridium group and in the deeply branching Fusobacteria and Thermotogales lineages. We analyzed upstream regions of genes associated with NAD biosynthesis to identify candidate NiaR-binding DNA motifs and assess the NiaR regulon content in these species. Representatives of the two distinct types of candidate NiaR-binding sites, characteristic of the Firmicutes and Thermotogales, were verified by an electrophoretic mobility shift assay. In addition to transcriptional control of the nadABC genes, the NiaR regulon in some species extends to niacin salvage (the pncAB genes) and includes uncharacterized membrane proteins possibly involved in niacin transport. The involvement in niacin uptake proposed for one of these proteins (re-named NiaP), encoded by the B. subtilis gene yceI, was experimentally verified. In addition to bacteria, members of the NiaP family are conserved in multicellular eukaryotes, including human, pointing to possible NaiP involvement in niacin utilization in these organisms. Overall, the analysis of the NiaR and NrtR regulons (described in the accompanying paper) revealed mechanisms of transcriptional regulation of NAD metabolism in nearly a hundred diverse bacteria. PMID:18276644

  8. Tolerance of deregulated G1/S transcription depends on critical G1/S regulon genes to prevent catastrophic genome instability.


    Caetano, Catia; Limbo, Oliver; Farmer, Sarah; Klier, Steffi; Dovey, Claire; Russell, Paul; de Bruin, Robertus Antonius Maria


    Expression of a G1/S regulon of genes that are required for DNA replication is a ubiquitous mechanism for controlling cell proliferation; moreover, the pathological deregulated expression of E2F-regulated G1/S genes is found in every type of cancer. Cellular tolerance of deregulated G1/S transcription is surprising because this regulon includes many dosage-sensitive proteins. Here, we used the fission yeast Schizosaccharomyces pombe to investigate this issue. We report that deregulating the MBF G1/S regulon by eliminating the Nrm1 corepressor increases replication errors. Homology-directed repair proteins, including MBF-regulated Ctp1(CtIP), are essential to prevent catastrophic genome instability. Surprisingly, the normally inconsequential MBF-regulated S-phase cyclin Cig2 also becomes essential in the absence of Nrm1. This requirement was traced to cyclin-dependent kinase inhibition of the MBF-regulated Cdc18(Cdc6) replication origin-licensing factor. Collectively, these results establish that, although deregulation of G1/S transcription is well tolerated by cells, nonessential G1/S target genes become crucial for preventing catastrophic genome instability. PMID:25533348

  9. Genome-Wide Transcriptional Profiles during Temperature and Oxidative Stress Reveal Coordinated Expression Patterns and Overlapping Regulons in Rice

    PubMed Central

    Mittal, Dheeraj; Madhyastha, Dinesh A.; Grover, Anil


    Genome wide transcriptional changes by cold stress, heat stress and oxidative stress in rice seedlings were analyzed. Heat stress resulted in predominant changes in transcripts of heat shock protein and heat shock transcription factor genes, as well as genes associated with synthesis of scavengers of reactive oxygen species and genes that control the level of sugars, metabolites and auxins. Cold stress treatment caused differential expression of transcripts of various transcription factors including desiccation response element binding proteins and different kinases. Transcripts of genes that are part of calcium signaling, reactive oxygen scavenging and diverse metabolic reactions were differentially expressed during cold stress. Oxidative stress induced by hydrogen peroxide treatment, resulted in significant up-regulation in transcript levels of genes related to redox homeostasis and down-regulation of transporter proteins. ROS homeostasis appeared to play central role in response to temperature extremes. The key transcription factors that may underlie the concerted transcriptional changes of specific components in various signal transduction networks involved are highlighted. Co-ordinated expression pattern and promoter architectures based analysis (promoter models and overrepresented transcription factor binding sites) suggested potential regulons involved in stress responses. A considerable overlap was noted at the level of transcription as well as in regulatory modules of differentially expressed genes. PMID:22815860

  10. The Cryptosporidium parvum ApiAP2 gene family: insights into the evolution of apicomplexan AP2 regulatory systems

    PubMed Central

    Oberstaller, Jenna; Pumpalova, Yoanna; Schieler, Ariel; Llins, Manuel; Kissinger, Jessica C.


    We provide the first comprehensive analysis of any transcription factor family in Cryptosporidium, a basal-branching apicomplexan that is the second leading cause of infant diarrhea globally. AP2 domain-containing proteins have evolved to be the major regulatory family in the phylum to the exclusion of canonical regulators. We show that apicomplexan and perkinsid AP2 domains cluster distinctly from other chromalveolate AP2s. Protein-binding specificity assays of C. parvum AP2 domains combined with motif conservation upstream of co-regulated gene clusters allowed the construction of putative AP2 regulons across the in vitro life cycle. Orthologous Apicomplexan AP2 (ApiAP2) expression has been rearranged relative to the malaria parasite P. falciparum, suggesting ApiAP2 network rewiring during evolution. C. hominis orthologs of putative C. parvum ApiAP2 proteins and target genes show greater than average variation. C. parvum AP2 domains display reduced binding diversity relative to P. falciparum, with multiple domains binding the 5?-TGCAT-3?, 5?-CACACA-3? and G-box motifs (5?-G[T/C]GGGG-3?). Many overrepresented motifs in C. parvum upstream regions are not AP2 binding motifs. We propose that C. parvum is less reliant on ApiAP2 regulators in part because it utilizes E2F/DP1 transcription factors. C. parvum may provide clues to the ancestral state of apicomplexan transcriptional regulation, pre-AP2 domination. PMID:24957599

  11. Construction and validation of a first-generation Bordetella bronchiseptica long-oligonucleotide microarray by transcriptional profiling the Bvg regulon

    PubMed Central

    Nicholson, Tracy L


    Background Bordetella bronchiseptica is a bacterial respiratory pathogen that infects a broad range of mammals, causing chronic and often subclinical infections. Gene expression in Bordetella is regulated by a two-component sensory transduction system, BvgAS, which controls the expression of a spectrum of phenotypic phases transitioning between a virulent (Bvg+) phase and a non-virulent (Bvg-) phase. Results Based on the genomic sequence and using the freely available software ArrayOligoSelector, a long oligonucleotide B. bronchiseptica microarray was designed and assembled. This long-oligonucleotide microarray was subsequently tested and validated by comparing changes in the global expression profiles between B. bronchiseptica RB50 and its Bvg- phase-locked derivative, RB54. Data from this microarray analysis revealed 1,668 Bvg-regulated genes, which greatly expands the BvgAS regulon defined in previous reports. For previously reported Bvg-regulated transcripts, the gene expression data presented here is congruent with prior findings. Additionally, quantitative real-time PCR data provided an independent verification of the microarray expression values. Conclusion The results presented here provide a comprehensive, genome-wide portrait of transcripts encompassing the BvgAS regulon, while also providing data validating the long-oligonucleotide microarray described here for studying gene expression in Bordetella bronchiseptica. PMID:17617915

  12. Defining the Bacillus subtilis sigma(W) regulon: a comparative analysis of promoter consensus search, run-off transcription/macroarray analysis (ROMA), and transcriptional profiling approaches.


    Cao, Min; Kobel, Phil A; Morshedi, Maud M; Wu, Ming Fang Winston; Paddon, Chris; Helmann, John D


    The Bacillus subtilis extracytoplasmic function (ECF) sigma factor sigma(W) controls a large regulon that is strongly induced by alkali shock. To define the physiological role of sigma(W) we have sought to identify the complete set of genes under sigma(W) control. Previously, we described a promoter consensus search procedure to identify sigma(W) controlled genes. Herein, we introduce a novel method to identify additional target promoters: run-off transcription followed by macroarray analysis (ROMA). We compare the resulting list of targets with those identified in conventional transcriptional profiling studies and using the consensus search approach. While transcriptional profiling identifies genes that are strongly dependent on sigma(W) for in vivo expression, some sigma(W)-dependent promoters are not detected due to the masking effects of other promoter elements, overlapping recognition with other ECF sigma factors, or both. Taken together, the consensus search, ROMA, and transcriptional profiling approaches establish a minimum of 30 promoter sites (controlling approximately 60 genes) as direct targets for activation by sigma(W). Significantly, no single approach identifies more than approximately 80% of the regulon so defined. We therefore suggest that a combination of two or more complementary approaches be employed in studies seeking to achieve maximal coverage when defining bacterial regulons. Our results indicate that sigma(W) controls genes that protect the cell against agents that impair cell wall biosynthesis but fail to reveal any connection to operons likely to function in adaptation to alkaline growth conditions. This is consistent with the observation that a sigW mutant is unaffected in its ability to survive alkali shock. We conclude that in B. subtilis sudden imposition of alkali stress activates the sigma(W) stress response, perhaps by impairing the ability of the cell wall biosynthetic machinery to function. PMID:11866510

  13. Cell division in apicomplexan parasites.


    Francia, Maria E; Striepen, Boris


    Toxoplasma gondii and Plasmodium falciparum are important human pathogens. These parasites and many of their apicomplexan relatives undergo a complex developmental process in the cells of their hosts, which includes genome replication, cell division and the assembly of new invasive stages. Apicomplexan cell cycle progression is both globally and locally regulated. Global regulation is carried out throughout the cytoplasm by diffusible factors that include cell cycle-specific kinases, cyclins and transcription factors. Local regulation acts on individual nuclei and daughter cells that are developing inside the mother cell. We propose that the centrosome is a master regulator that physically tethers cellular components and that provides spatial and temporal control of apicomplexan cell division. PMID:24384598

  14. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.


    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio


    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms. PMID:26194054

  15. The origins of apicomplexan sequence innovation

    PubMed Central

    Wasmuth, James; Daub, Jennifer; Peregrn-Alvarez, Jos Manuel; Finney, Constance A.M.; Parkinson, John


    The Apicomplexa are a group of phylogenetically related parasitic protists that include Plasmodium, Cryptosporidium, and Toxoplasma. Together they are a major global burden on human health and economics. To meet this challenge, several international consortia have generated vast amounts of sequence data for many of these parasites. Here, we exploit these data to perform a systematic analysis of protein family and domain incidence across the phylum. A total of 87,736 protein sequences were collected from 15 apicomplexan species. These were compared with three protein databases, including the partial genome database, PartiGeneDB, which increases the breadth of taxonomic coverage. From these searches we constructed taxonomic profiles that reveal the extent of apicomplexan sequence diversity. Sequences without a significant match outside the phylum were denoted as apicomplexan specialized. These were collated into 9134 discrete protein families and placed in the context of the apicomplexan phylogeny, identifying the putative origin of each family. Most apicomplexan families were associated with an individual genus or species. Interestingly, many genera-specific innovations were associated with specialized host cell invasion and/or parasite survival processes. Contrastingly, those families reflecting more ancestral relationships were enriched in generalized housekeeping functions such as translation and transcription, which have diverged within the apicomplexan lineage. Protein domain searches revealed 192 domains not previously reported in apicomplexans together with a number of novel domain combinations. We highlight domains that may be important to parasite survival. PMID:19363216

  16. The origins of apicomplexan sequence innovation.


    Wasmuth, James; Daub, Jennifer; Peregrn-Alvarez, Jos Manuel; Finney, Constance A M; Parkinson, John


    The Apicomplexa are a group of phylogenetically related parasitic protists that include Plasmodium, Cryptosporidium, and Toxoplasma. Together they are a major global burden on human health and economics. To meet this challenge, several international consortia have generated vast amounts of sequence data for many of these parasites. Here, we exploit these data to perform a systematic analysis of protein family and domain incidence across the phylum. A total of 87,736 protein sequences were collected from 15 apicomplexan species. These were compared with three protein databases, including the partial genome database, PartiGeneDB, which increases the breadth of taxonomic coverage. From these searches we constructed taxonomic profiles that reveal the extent of apicomplexan sequence diversity. Sequences without a significant match outside the phylum were denoted as apicomplexan specialized. These were collated into 9134 discrete protein families and placed in the context of the apicomplexan phylogeny, identifying the putative origin of each family. Most apicomplexan families were associated with an individual genus or species. Interestingly, many genera-specific innovations were associated with specialized host cell invasion and/or parasite survival processes. Contrastingly, those families reflecting more ancestral relationships were enriched in generalized housekeeping functions such as translation and transcription, which have diverged within the apicomplexan lineage. Protein domain searches revealed 192 domains not previously reported in apicomplexans together with a number of novel domain combinations. We highlight domains that may be important to parasite survival. PMID:19363216

  17. Activation of the iron regulon by the yeast Aft1/Aft2 transcription factors depends on mitochondrial but not cytosolic iron-sulfur protein biogenesis.


    Rutherford, Julian C; Ojeda, Luis; Balk, Janneke; Mhlenhoff, Ulrich; Lill, Roland; Winge, Dennis R


    Two transcriptional activators, Aft1 and Aft2, regulate iron homeostasis in Saccharomyces cerevisiae. These factors induce the expression of iron regulon genes in iron-deficient yeast but are inactivated in iron-replete cells. Iron inhibition of Aft1/Aft2 is abrogated in cells defective for Fe-S cluster biogenesis within the mitochondrial matrix (Chen, O. S., Crisp, R. J., Valachovic, M., Bard, M., Winge, D. R., and Kaplan, J. (2004) J. Biol. Chem. 279, 29513-29518). To determine whether iron sensing by Aft1/Aft2 requires the function of the mitochondrial Fe-S export and cytosolic Fe-S protein assembly systems, we evaluated the expression of the iron regulon in cells depleted of glutathione and in cells depleted of Atm1, Nar1, Cfd1, and Nbp35. The iron regulon is induced in cells depleted of Atm1 with Aft1 largely responsible for the induced gene expression. Aft2 is activated at a later time in Atm1-depleted cells. Likewise, the iron regulon is induced in cells depleted of glutathione. In contrast, repression of NAR1, CFD1, or NBP35 fails to induce the iron regulon despite strong inhibition of cytosolic/nuclear Fe-S protein assembly. Thus, iron sensing by Aft1/Aft2 is not linked to the maturation of cytosolic/nuclear Fe-S proteins, but the mitochondrial inner membrane transporter Atm1 is important to transport the inhibitory signal. Although Aft1 and Aft2 sense a signal emanating from the Fe-S cluster biogenesis pathway, there is no indication that the proteins are inhibited by direct binding of an Fe-S cluster. PMID:15649888

  18. Transcription factor family-based reconstruction of singleton regulons and study of the Crp/Fnr, ArsR, and GntR families in Desulfovibrionales genomes.


    Kazakov, Alexey E; Rodionov, Dmitry A; Price, Morgan N; Arkin, Adam P; Dubchak, Inna; Novichkov, Pavel S


    Accurate detection of transcriptional regulatory elements is essential for high-quality genome annotation, metabolic reconstruction, and modeling of regulatory networks. We developed a computational approach for reconstruction of regulons operated by transcription factors (TFs) from large protein families and applied this novel approach to three TF families in 10 Desulfovibrionales genomes. Phylogenetic analyses of 125 regulators from the ArsR, Crp/Fnr, and GntR families revealed that 65% of these regulators (termed reference TFs) are well conserved in Desulfovibrionales, while the remaining 35% of regulators (termed singleton TFs) are species specific and show a mosaic distribution. For regulon reconstruction in the group of singleton TFs, the standard orthology-based approach was inefficient, and thus, we developed a novel approach based on the simultaneous study of all homologous TFs from the same family in a group of genomes. As a result, we identified binding for 21 singleton TFs and for all reference TFs in all three analyzed families. Within each TF family we observed structural similarities between DNA-binding motifs of different reference and singleton TFs. The collection of reconstructed regulons is available at the RegPrecise database ( PMID:23086211

  19. RegulonDB version 7.0: transcriptional regulation of Escherichia coli K-12 integrated within genetic sensory response units (Gensor Units)

    PubMed Central

    Gama-Castro, Socorro; Salgado, Heladia; Peralta-Gil, Martin; Santos-Zavaleta, Alberto; Muiz-Rascado, Luis; Solano-Lira, Hilda; Jimenez-Jacinto, Vernica; Weiss, Verena; Garca-Sotelo, Jair S.; Lpez-Fuentes, Alejandra; Porrn-Sotelo, Liliana; Alquicira-Hernndez, Shirley; Medina-Rivera, Alejandra; Martnez-Flores, Irma; Alquicira-Hernndez, Kevin; Martnez-Adame, Ruth; Bonavides-Martnez, Csar; Miranda-Ros, Juan; Huerta, Araceli M.; Mendoza-Vargas, Alfredo; Collado-Torres, Leonardo; Taboada, Blanca; Vega-Alvarado, Leticia; Olvera, Maricela; Olvera, Leticia; Grande, Ricardo; Morett, Enrique; Collado-Vides, Julio


    RegulonDB ( is the primary reference database of the best-known regulatory network of any free-living organism, that of Escherichia coli K-12. The major conceptual change since 3 years ago is an expanded biological context so that transcriptional regulation is now part of a unit that initiates with the signal and continues with the signal transduction to the core of regulation, modifying expression of the affected target genes responsible for the response. We call these genetic sensory response units, or Gensor Units. We have initiated their high-level curation, with graphic maps and superreactions with links to other databases. Additional connectivity uses expandable submaps. RegulonDB has summaries for every transcription factor (TF) and TF-binding sites with internal symmetry. Several DNA-binding motifs and their sizes have been redefined and relocated. In addition to data from the literature, we have incorporated our own information on transcription start sites (TSSs) and transcriptional units (TUs), obtained by using high-throughput whole-genome sequencing technologies. A new portable drawing tool for genomic features is also now available, as well as new ways to download the data, including web services, files for several relational database manager systems and text files including BioPAX format. PMID:21051347

  20. Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

    PubMed Central

    Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.


    Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5?-GTTGCA-3?, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of ?1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

  1. Transcription Profiling of the mgrA Regulon in Staphylococcus aureus

    PubMed Central

    Luong, Thanh T.; Dunman, Paul M.; Murphy, Ellen; Projan, Steven J.; Lee, Chia Y.


    MgrA has been shown to affect multiple Staphylococcus aureus genes involved in virulence and antibiotic resistance. To comprehensively identify the target genes regulated by mgrA, we employed a microarray method to analyze the transcription profiles of S. aureus Newman, its isogeneic mgrA mutant, and an MgrA-overproducing derivative. We compared genes that were differentially expressed at exponential or early stationary growth phases. Our results showed that MgrA affected an impressive number of genes, 175 of which were positively regulated and 180 of which were negatively regulated in an mgrA-specific manner. The target genes included all functional categories. The microarray results were validated by real-time reverse transcription-PCR quantitation of a set of selected genes from different functional categories. Our data also indicate that mgrA regulates virulence factors in a fashion analogous to that of the accessory gene regulatory locus (agr). Accordingly, exoproteins are upregulated and surface proteins are downregulated by the regulator, suggesting that mgrA may function in concert with agr. The fact that a large number of genes are regulated by mgrA implies that MgrA is a major global regulator in S. aureus. PMID:16484201

  2. Streptococcus mutans copes with heat stress by multiple transcriptional regulons modulating virulence and energy metabolism

    PubMed Central

    Liu, Chengcheng; Niu, Yulong; Zhou, Xuedong; Zheng, Xin; Wang, Shida; Guo, Qiang; Li, Yuqing; Li, Mingyun; Li, Jiyao; Yang, Yi; Ding, Yi; Lamont, Richard J.; Xu, Xin


    Dental caries is closely associated with the virulence of Streptococcus mutans. The virulence expression of S. mutans is linked to its stress adaptation to the changes in the oral environment. In this work we used whole-genome microarrays to profile the dynamic transcriptomic responses of S. mutans during physiological heat stress. In addition, we evaluated the phenotypic changes, including, eDNA release, initial biofilm formation, extracellular polysaccharides generation, acid production/acid tolerance, and ATP turnover of S. mutans during heat stress. There were distinct patterns observed in the way that S. mutans responded to heat stress that included 66 transcription factors for the expression of functional genes being differentially expressed. Especially, response regulators of two component systems (TCSs), the repressors of heat shock proteins and regulators involved in sugar transporting and metabolism co-ordinated to enhance the cell’s survival and energy generation against heat stress in S. mutans. PMID:26251057

  3. Streptococcus mutans copes with heat stress by multiple transcriptional regulons modulating virulence and energy metabolism.


    Liu, Chengcheng; Niu, Yulong; Zhou, Xuedong; Zheng, Xin; Wang, Shida; Guo, Qiang; Li, Yuqing; Li, Mingyun; Li, Jiyao; Yang, Yi; Ding, Yi; Lamont, Richard J; Xu, Xin


    Dental caries is closely associated with the virulence of Streptococcus mutans. The virulence expression of S. mutans is linked to its stress adaptation to the changes in the oral environment. In this work we used whole-genome microarrays to profile the dynamic transcriptomic responses of S. mutans during physiological heat stress. In addition, we evaluated the phenotypic changes, including, eDNA release, initial biofilm formation, extracellular polysaccharides generation, acid production/acid tolerance, and ATP turnover of S. mutans during heat stress. There were distinct patterns observed in the way that S. mutans responded to heat stress that included 66 transcription factors for the expression of functional genes being differentially expressed. Especially, response regulators of two component systems (TCSs), the repressors of heat shock proteins and regulators involved in sugar transporting and metabolism co-ordinated to enhance the cell's survival and energy generation against heat stress in S. mutans. PMID:26251057

  4. The R2R3 MYB Transcription Factor DUO1 Activates a Male Germline-Specific Regulon Essential for Sperm Cell Differentiation in Arabidopsis[C][W

    PubMed Central

    Borg, Michael; Brownfield, Lynette; Khatab, Hoda; Sidorova, Anna; Lingaya, Melanie; Twell, David


    The male germline in flowering plants arises through asymmetric division of a haploid microspore. The resulting germ cell undergoes mitotic division and specialization to produce the two sperm cells required for double fertilization. The male germline-specific R2R3 MYB transcription factor DUO1 POLLEN1 (DUO1) plays an essential role in sperm cell specification by activating a germline-specific differentiation program. Here, we show that ectopic expression of DUO1 upregulates a significant number (~63) of germline-specific or enriched genes, including those required for fertilization. We validated 14 previously unknown DUO1 target genes by demonstrating DUO1-dependent promoter activity in the male germline. DUO1 is shown to directly regulate its target promoters through binding to canonical MYB sites, suggesting that the DUO1 target genes validated thus far are likely to be direct targets. This work advances knowledge of the DUO1 regulon that encompasses genes with a range of cellular functions, including transcription, protein fate, signaling, and transport. Thus, the DUO1 regulon has a major role in shaping the germline transcriptome and functions to commit progenitor germ cells to sperm cell differentiation. PMID:21285328

  5. Genome-wide profiling of Hfq-binding RNAs uncovers extensive post-transcriptional rewiring of major stress response and symbiotic regulons in Sinorhizobium meliloti

    PubMed Central

    Torres-Quesada, Omar; Reinkensmeier, Jan; Schlüter, Jan-Philip; Robledo, Marta; Peregrina, Alexandra; Giegerich, Robert; Toro, Nicolás; Becker, Anke; Jiménez-Zurdo, Jose I


    The RNA chaperone Hfq is a global post-transcriptional regulator in bacteria. Here, we used RNAseq to analyze RNA populations from the legume symbiont Sinorhizobium meliloti that were co-immunoprecipitated (CoIP-RNA) with a FLAG-tagged Hfq in five growth/stress conditions. Hfq-bound transcripts (1315) were largely identified in stressed bacteria and derived from small RNAs (sRNAs), both trans-encoded (6.4%) and antisense (asRNAs; 6.3%), and mRNAs (86%). Pull-down with Hfq recovered a small proportion of annotated S. meliloti sRNAs (14% of trans-sRNAs and 2% of asRNAs) suggesting a discrete impact of this protein in sRNA pathways. Nonetheless, Hfq selectively stabilized CoIP-enriched sRNAs, anticipating that these interactions are functionally significant. Transcription of 26 Hfq-bound sRNAs was predicted to occur from promoters recognized by the major stress σ factors σE2 or σH1/2. Recovery rates of sRNAs in each of the CoIP–RNA libraries suggest a large impact of Hfq-assisted riboregulation in S. meliloti osmoadaptation. Hfq directly targeted 18% of the predicted S. meliloti mRNAs, which encode functionally diverse proteins involved in transport and metabolism, σE2-dependent stress responses, quorum sensing, flagella biosynthesis, ribosome, and membrane assembly or symbiotic nitrogen fixation. Canonical targeting of the 5′ regions of two of the ABC transporter mRNAs by the homologous Hfq-binding AbcR1 and AbcR2 sRNAs leading to inhibition of protein synthesis was confirmed in vivo. We therefore provide a comprehensive resource for the systems-level deciphering of hitherto unexplored S. meliloti stress and symbiotic post-transcriptional regulons and the identification of Hfq-dependent sRNA–mRNA regulatory pairs. PMID:24786641

  6. Comprehensive Definition of the SigH Regulon of Mycobacterium tuberculosis Reveals Transcriptional Control of Diverse Stress Responses

    PubMed Central

    Park, Sang Tae; Lyubetskaya, Anna; Peterson, Matthew W.; Gomes, Antonio L. C.; Potluri, Lakshmi-Prasad; Raman, Sahadevan; Galagan, James E.; Husson, Robert N.


    Expression of SigH, one of 12 Mycobacterium tuberculosis alternative sigma factors, is induced by heat, oxidative and nitric oxide stresses. SigH activation has been shown to increase expression of several genes, including genes involved in maintaining redox equilibrium and in protein degradation. However, few of these are known to be directly regulated by SigH. The goal of this project is to comprehensively define the Mycobacterium tuberculosis genes and operons that are directly controlled by SigH in order to gain insight into the role of SigH in regulating M. tuberculosis physiology. We used ChIP-Seq to identify in vivo SigH binding sites throughout the M. tuberculosis genome, followed by quantification of SigH-dependent expression of genes linked to these sites and identification of SigH-regulated promoters. We identified 69 SigH binding sites, which are located both in intergenic regions and within annotated coding sequences in the annotated M. tuberculosis genome. 41 binding sites were linked to genes that showed greater expression following heat stress in a SigH-dependent manner. We identified several genes not previously known to be regulated by SigH, including genes involved in DNA repair, cysteine biosynthesis, translation, and genes of unknown function. Experimental and computational analysis of SigH-regulated promoter sequences within these binding sites identified strong consensus -35 and -10 promoter sequences, but with tolerance for non-consensus bases at specific positions. This comprehensive identification and validation of SigH-regulated genes demonstrates an extended SigH regulon that controls an unexpectedly broad range of stress response functions. PMID:27003599

  7. Convergent transcription in the butyrolactone regulon in Streptomyces coelicolor confers a bistable genetic switch for antibiotic biosynthesis.


    Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N; Hu, Wei-Shou


    cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor-amplifier proteins respectively, mediates the synthesis of a signaling molecule, the ?-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined. PMID:21765930

  8. Convergent Transcription in the Butyrolactone Regulon in Streptomyces coelicolor Confers a Bistable Genetic Switch for Antibiotic Biosynthesis

    PubMed Central

    Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N.; Hu, Wei-Shou


    cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressoramplifier proteins respectively, mediates the synthesis of a signaling molecule, the ?-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined. PMID:21765930

  9. Cytoskeleton of Apicomplexan Parasites

    PubMed Central

    Morrissette, Naomi S.; Sibley, L. David


    The Apicomplexa are a phylum of diverse obligate intracellular parasites including Plasmodium spp., the cause of malaria; Toxoplasma gondii and Cryptosporidium parvum, opportunistic pathogens of immunocompromised individuals; and Eimeria spp. and Theileria spp., parasites of considerable agricultural importance. These protozoan parasites share distinctive morphological features, cytoskeletal organization, and modes of replication, motility, and invasion. This review summarizes our current understanding of the cytoskeletal elements, the properties of cytoskeletal proteins, and the role of the cytoskeleton in polarity, motility, invasion, and replication. We discuss the unusual properties of actin and myosin in the Apicomplexa, the highly stereotyped microtubule populations in apicomplexans, and a network of recently discovered novel intermediate filament-like elements in these parasites. PMID:11875126

  10. Genome Scale Identification of Regulons

    SciTech Connect

    Mao, Linyong; Resat, Haluk


    The DNA sequences of organisms are becoming available at an increasing rate and the biological information derived from the genome sequence data has been proven to be very useful in improving our understanding of cellular regulatory patterns. Detection of transcription factor binding sites in the promoter regions of genes helps to identify the potential regulons of transcriptional regulators, and this information can be used to establish the regulatory networks of organisms. In this study, we apply a motif pattern searching technique to detect the possible DNA binding sites in the intergenic upstream sequences of the genes of a bacterium, Rhodobacter sphaeroides, to investigate the interplay between the three known transcription factors. In contrast to PpsR and FnrL, we find that the PrrA acts as a global regulator in controlling the gene transcription in the R. sphaeroides organism.

  11. The Redox-Sensitive Transcriptional Activator OxyR Regulates the Peroxide Response Regulon in the Obligate Anaerobe Bacteroides fragilis

    PubMed Central

    Rocha, Edson R.; Owens, Gary; Smith, C. Jeffrey


    The peroxide response-inducible genes ahpCF, dps, and katB in the obligate anaerobe Bacteroides fragilis are controlled by the redox-sensitive transcriptional activator OxyR. This is the first functional oxidative stress regulator identified and characterized in anaerobic bacteria. oxyR and dps were found to be divergently transcribed, with an overlap in their respective promoter regulatory regions. B. fragilis OxyR and Dps proteins showed high identity to homologues from a closely related anaerobe, Porphyromonas gingivalis. Northern blot analysis revealed that oxyR was expressed as a monocistronic 1-kb mRNA and that dps mRNA was approximately 500 bases in length. dps mRNA was induced over 500-fold by oxidative stress in the parent strain and was constitutively induced in the peroxide-resistant mutant IB263. The constitutive peroxide response in strain IB263 was shown to have resulted from a missense mutation at codon 202 (GAT to GGT) of the oxyR gene [oxyR(Con)] with a predicted D202G substitution in the OxyR protein. Transcriptional fusion analysis revealed that deletion of oxyR abolished the induction of ahpC and katB following treatment with hydrogen peroxide or oxygen exposure. However, dps expression was induced approximately fourfold by oxygen exposure in ?oxyR strains but not by hydrogen peroxide. This indicates that dps expression is also under the control of an oxygen-dependent OxyR-independent mechanism. Complementation of ?oxyR mutant strains with wild-type oxyR and oxyR(Con) restored the inducible peroxide response and the constitutive response of the ahpCF, katB, and dps genes, respectively. However, overexpression of OxyR abolished the catalase activity but not katB expression, suggesting that higher levels of intracellular OxyR may be involved in other physiological processes. Analysis of oxyR expression in the parents and in ?oxyR and overexpressing oxyR strains by Northern blotting and oxyR?::xylB fusions revealed that B. fragilis OxyR does not control its own expression. PMID:10960088

  12. Isoprenoid metabolism in apicomplexan parasites

    PubMed Central

    Imlay, Leah; Odom, Audrey R.


    Apicomplexan parasites include some of the most prevalent and deadly human pathogens. Novel antiparasitic drugs are urgently needed. Synthesis and metabolism of isoprenoids may present multiple targets for therapeutic intervention. The apicoplast-localized methylerythritol phosphate (MEP) pathway for isoprenoid precursor biosynthesis is distinct from the mevalonate (MVA) pathway used by the mammalian host, and this pathway is apparently essential in most Apicomplexa. In this review, we discuss the current field of research on production and metabolic fates of isoprenoids in apicomplexan parasites, including the acquisition of host isoprenoid precursors and downstream products. We describe recent work identifying the first MEP pathway regulator in apicomplexan parasites, and introduce several promising areas for ongoing research into this well-validated antiparasitic target. PMID:25893156

  13. Characterization of a cAMP responsive transcription factor, Cmr (Rv1675c), in TB complex mycobacteria reveals overlap with the DosR (DevR) dormancy regulon

    PubMed Central

    Ranganathan, Sridevi; Bai, Guangchun; Lyubetskaya, Anna; Knapp, Gwendowlyn S.; Peterson, Matthew W.; Gazdik, Michaela; C. Gomes, Antonio L.; Galagan, James E.; McDonough, Kathleen A.


    Mycobacterium tuberculosis (Mtb) Cmr (Rv1675c) is a CRP/FNR family transcription factor known to be responsive to cAMP levels and during macrophage infections. However, Cmr's DNA binding properties, cellular targets and overall role in tuberculosis (TB) complex bacteria have not been characterized. In this study, we used experimental and computational approaches to characterize Cmr's DNA binding properties and identify a putative regulon. Cmr binds a 16-bp palindromic site that includes four highly conserved nucleotides that are required for DNA binding. A total of 368 binding sites, distributed in clusters among ∼200 binding regions throughout the Mycobacterium bovis BCG genome, were identified using ChIP-seq. One of the most enriched Cmr binding sites was located upstream of the cmr promoter, and we demonstrated that expression of cmr is autoregulated. cAMP affected Cmr binding at a subset of DNA loci in vivo and in vitro, including multiple sites adjacent to members of the DosR (DevR) dormancy regulon. Our findings of cooperative binding of Cmr to these DNA regions and the regulation by Cmr of the DosR-regulated virulence gene Rv2623 demonstrate the complexity of Cmr-mediated gene regulation and suggest a role for Cmr in the biology of persistent TB infection. PMID:26358810

  14. Characterization of a cAMP responsive transcription factor, Cmr (Rv1675c), in TB complex mycobacteria reveals overlap with the DosR (DevR) dormancy regulon.


    Ranganathan, Sridevi; Bai, Guangchun; Lyubetskaya, Anna; Knapp, Gwendowlyn S; Peterson, Matthew W; Gazdik, Michaela; C Gomes, Antonio L; Galagan, James E; McDonough, Kathleen A


    Mycobacterium tuberculosis (Mtb) Cmr (Rv1675c) is a CRP/FNR family transcription factor known to be responsive to cAMP levels and during macrophage infections. However, Cmr's DNA binding properties, cellular targets and overall role in tuberculosis (TB) complex bacteria have not been characterized. In this study, we used experimental and computational approaches to characterize Cmr's DNA binding properties and identify a putative regulon. Cmr binds a 16-bp palindromic site that includes four highly conserved nucleotides that are required for DNA binding. A total of 368 binding sites, distributed in clusters among ?200 binding regions throughout the Mycobacterium bovis BCG genome, were identified using ChIP-seq. One of the most enriched Cmr binding sites was located upstream of the cmr promoter, and we demonstrated that expression of cmr is autoregulated. cAMP affected Cmr binding at a subset of DNA loci in vivo and in vitro, including multiple sites adjacent to members of the DosR (DevR) dormancy regulon. Our findings of cooperative binding of Cmr to these DNA regions and the regulation by Cmr of the DosR-regulated virulence gene Rv2623 demonstrate the complexity of Cmr-mediated gene regulation and suggest a role for Cmr in the biology of persistent TB infection. PMID:26358810

  15. Evolution of apicomplexan secretory organelles

    PubMed Central

    Gubbels, Marc-Jan; Duraisingh, Manoj T.


    The alveolate superphylum includes many free-living and parasitic organisms, which are united by the presence of alveolar sacs lying proximal to the plasma membrane, providing cell structure. All species comprising the apicomplexan group of alveolates are parasites and have adapted to the unique requirements of the parasitic lifestyle. Here the evolution of apicomplexan secretory organelles that are involved in the critical process of egress from one cell and invasion of another is explored. The variations within the Apicomplexa and how these relate to species-specific biology will be discussed. In addition, recent studies have identified specific calcium-sensitive molecules that coordinate the various events and regulate the release of these secretory organelles within apicomplexan parasites. Some aspects of this machinery are conserved outside the Apicomplexa, and are beginning to elucidate the conserved nature of the machinery. Briefly, the relationship of this secretion machinery within the Apicomplexa will be discussed, compared with free-living and predatory alveolates, and how these might have evolved from a common ancestor. PMID:23068912

  16. Toxoplasma gondii: the model apicomplexan

    PubMed Central

    Kim, Kami; Weiss, Louis M.


    Toxoplasma gondii is an obligate intracellular protozoan parasite which is a significant human and veterinary pathogen. Other members of the phylum Apicomplexa are also important pathogens including Plasmodium species (i.e. malaria), Eimeria species, Neospora, Babesia, Theileria and Cryptosporidium. Unlike most of these organisms, T. gondii is readily amenable to genetic manipulation in the laboratory. Cell biology studies are more readily performed in T. gondii due to the high efficiency of transient and stable transfection, the availability of many cell markers, and the relative ease with which the parasite can be studied using advanced microscopic techniques. Thus, for many experimental questions, T. gondii remains the best model system to study the biology of the Apicomplexa. Our understanding of the mechanisms of drug resistance, the biology of the apicoplast, and the process of host cell invasion has been advanced by studies in T. gondii. Heterologous expression of apicomplexan proteins in T. gondii has frequently facilitated further characterisation of proteins that could not be easily studied. Recent studies of Apicomplexa have been complemented by genome sequencing projects that have facilitated discovery of surprising differences in cell biology and metabolism between Apicomplexa. While results in T. gondii will not always be applicable to other Apicomplexa, T. gondii remains an important model system for understanding the biology of apicomplexan parasites. PMID:15003501

  17. The dual transcriptional regulator CysR in Corynebacterium glutamicum ATCC 13032 controls a subset of genes of the McbR regulon in response to the availability of sulphide acceptor molecules

    PubMed Central

    Rckert, Christian; Milse, Johanna; Albersmeier, Andreas; Koch, Daniel J; Phler, Alfred; Kalinowski, Jrn


    Background Regulation of sulphur metabolism in Corynebacterium glutamicum ATCC 13032 has been studied intensively in the last few years, due to its industrial as well as scientific importance. Previously, the gene cg0156 was shown to belong to the regulon of McbR, a global transcriptional repressor of sulphur metabolism in C. glutamicum. This gene encodes a putative ROK-type regulator, a paralogue of the activator of sulphonate utilisation, SsuR. Therefore, it is an interesting candidate for study to further the understanding of the regulation of sulphur metabolism in C. glutamicum. Results Deletion of cg0156, now designated cysR, results in the inability of the mutant to utilise sulphate and aliphatic sulphonates. DNA microarray hybridisations revealed 49 genes with significantly increased and 48 with decreased transcript levels in presence of the native CysR compared to a cysR deletion mutant. Among the genes positively controlled by CysR were the gene cluster involved in sulphate reduction, fpr2 cysIXHDNYZ, and ssuR. Gel retardation experiments demonstrated that binding of CysR to DNA depends in vitro on the presence of either O-acetyl-L-serine or O-acetyl-L-homoserine. Mapping of the transcription start points of five transcription units helped to identify a 10 bp inverted repeat as the possible CysR binding site. Subsequent in vivo tests proved this motif to be necessary for CysR-dependent transcriptional regulation. Conclusion CysR acts as the functional analogue of the unrelated LysR-type regulator CysB from Escherichia coli, controlling sulphide production in response to acceptor availability. In both bacteria, gene duplication events seem to have taken place which resulted in the evolution of dedicated regulators for the control of sulphonate utilisation. The striking convergent evolution of network topology indicates the strong selective pressure to control the metabolism of the essential but often toxic sulphur-containing (bio-)molecules. PMID:18854009

  18. σB-and PrfA-Dependent Transcription of Genes Previously Classified as Putative Constituents of the Listeria monocytogenes PrfA Regulon

    PubMed Central

    Ollinger, Juliane; Wiedmann, Martin


    Abstract Mounting evidence suggests that σB and PrfA coregulate transcription of multiple genes in Listeria monocytogenes, therefore, the relative contributions of σB and PrfA to transcript levels of genes identified previously as differentially regulated by PrfA were measured. Group I genes are recognized virulence genes that are positively regulated by PrfA; group II genes were reported previously as negatively regulated by PrfA; and multiple group III genes were proposed to be coregulated by σB and PrfA. Transcript levels for selected genes were measured by quantitative reverse transcriptase polymerase chain reaction (RT-PCR) in L. monocytogenes 10403S as well as in otherwise isogenic ΔsigB, ΔprfA, and ΔsigBΔprfA strains grown under conditions demonstrated to induce either PrfA activity (0.2% activated charcoal) or both PrfA and σB activity (stationary phase). Although the Group I gene plcA was positively regulated by PrfA, transcript levels for the group II genes lmo0278 and lmo0178 were not affected by the prfA deletion. While the sigB deletion significantly affected transcript levels for the selected group III genes (i.e., lmo0596, lmo0654, bsh, and opuCA), with lower transcript levels in the ΔsigB strains under all conditions tested, transcript levels for these genes were not significantly affected by the prfA deletion. Our results suggest that the regulatory interactions between PrfA and σB contribute to PrfA's predominant role as a direct regulator of virulence genes critical for invasion and intracellular survival in L. monocytogenes 10403S, while σB regulates a wider range of virulence and stress response genes. PMID:18564909

  19. A common red algal origin of the apicomplexan, dinoflagellate, and heterokont plastids

    PubMed Central

    Janoukovec, Jan; Hork, Ale; Obornk, Miroslav; Luke, Julius; Keeling, Patrick J.


    The discovery of a nonphotosynthetic plastid in malaria and other apicomplexan parasites has sparked a contentious debate about its evolutionary origin. Molecular data have led to conflicting conclusions supporting either its green algal origin or red algal origin, perhaps in common with the plastid of related dinoflagellates. This distinction is critical to our understanding of apicomplexan evolution and the evolutionary history of endosymbiosis and photosynthesis; however, the two plastids are nearly impossible to compare due to their nonoverlapping information content. Here we describe the complete plastid genome sequences and plastid-associated data from two independent photosynthetic lineages represented by Chromera velia and an undescribed alga CCMP3155 that we show are closely related to apicomplexans. These plastids contain a suite of features retained in either apicomplexan (four plastid membranes, the ribosomal superoperon, conserved gene order) or dinoflagellate plastids (form II Rubisco acquired by horizontal transfer, transcript polyuridylylation, thylakoids stacked in triplets) and encode a full collective complement of their reduced gene sets. Together with whole plastid genome phylogenies, these characteristics provide multiple lines of evidence that the extant plastids of apicomplexans and dinoflagellates were inherited by linear descent from a common red algal endosymbiont. Our phylogenetic analyses also support their close relationship to plastids of heterokont algae, indicating they all derive from the same endosymbiosis. Altogether, these findings support a relatively simple path of linear descent for the evolution of photosynthesis in a large proportion of algae and emphasize plastid loss in several lineages (e.g., ciliates, Cryptosporidium, and Phytophthora). PMID:20534454

  20. A common red algal origin of the apicomplexan, dinoflagellate, and heterokont plastids.


    Janouskovec, Jan; Horák, Ales; Oborník, Miroslav; Lukes, Julius; Keeling, Patrick J


    The discovery of a nonphotosynthetic plastid in malaria and other apicomplexan parasites has sparked a contentious debate about its evolutionary origin. Molecular data have led to conflicting conclusions supporting either its green algal origin or red algal origin, perhaps in common with the plastid of related dinoflagellates. This distinction is critical to our understanding of apicomplexan evolution and the evolutionary history of endosymbiosis and photosynthesis; however, the two plastids are nearly impossible to compare due to their nonoverlapping information content. Here we describe the complete plastid genome sequences and plastid-associated data from two independent photosynthetic lineages represented by Chromera velia and an undescribed alga CCMP3155 that we show are closely related to apicomplexans. These plastids contain a suite of features retained in either apicomplexan (four plastid membranes, the ribosomal superoperon, conserved gene order) or dinoflagellate plastids (form II Rubisco acquired by horizontal transfer, transcript polyuridylylation, thylakoids stacked in triplets) and encode a full collective complement of their reduced gene sets. Together with whole plastid genome phylogenies, these characteristics provide multiple lines of evidence that the extant plastids of apicomplexans and dinoflagellates were inherited by linear descent from a common red algal endosymbiont. Our phylogenetic analyses also support their close relationship to plastids of heterokont algae, indicating they all derive from the same endosymbiosis. Altogether, these findings support a relatively simple path of linear descent for the evolution of photosynthesis in a large proportion of algae and emphasize plastid loss in several lineages (e.g., ciliates, Cryptosporidium, and Phytophthora). PMID:20534454

  1. Quorum sensing transcriptional regulator QseA is essential for the expression of multiple virulence regulons of enterohemorrhagic Escherichia coli O157:H7

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction and Objectives: QseA is one of several transcriptional regulators that regulates the virulence gene expression in enterohemorrhagic Escherichia coli (EHEC) O157:H7 through quorum sensing. QseA has been shown to regulate the expression of the locus of enterocyte effacement (LEE), non-LEE...

  2. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses.


    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin


    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria. PMID:26975728

  3. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses

    PubMed Central

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin


    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria. PMID:26975728

  4. FliT Acts as an Anti-FlhD2C2 Factor in the Transcriptional Control of the Flagellar Regulon in Salmonella enterica Serovar Typhimurium

    PubMed Central

    Yamamoto, Shouji; Kutsukake, Kazuhiro


    Flagellar operons are divided into three classes with respect to their transcriptional hierarchy in Salmonella enterica serovar Typhimurium. The class 1 gene products FlhD and FlhC act together in an FlhD2C2 heterotetramer, which binds upstream of the class 2 promoters to facilitate binding of RNA polymerase. Class 2 expression is known to be enhanced by a disruption mutation in a flagellar gene, fliT. In this study, we purified FliT protein in a His-tagged form and showed that the protein prevented binding of FlhD2C2 to the class 2 promoter and inhibited FlhD2C2-dependent transcription. Pull-down and far-Western blotting analyses revealed that the FliT protein was capable of binding to FlhD2C2 and FlhC and not to FlhD alone. We conclude that FliT acts as an anti-FlhD2C2 factor, which binds to FlhD2C2 through interaction with the FlhC subunit and inhibits its binding to the class 2 promoter. PMID:16952964

  5. Oxidative Stress Control by Apicomplexan Parasites

    PubMed Central

    Izui, Natália M.; Schettert, Isolmar; Liebau, Eva


    Apicomplexan parasites cause infectious diseases that are either a severe public health problem or an economic burden. In this paper we will shed light on how oxidative stress can influence the host-pathogen relationship by focusing on three major diseases: babesiosis, coccidiosis, and toxoplasmosis. PMID:25722976

  6. Functional modules of sigma factor regulons guarantee adaptability and evolvability

    NASA Astrophysics Data System (ADS)

    Binder, Sebastian C.; Eckweiler, Denitsa; Schulz, Sebastian; Bielecka, Agata; Nicolai, Tanja; Franke, Raimo; Häussler, Susanne; Meyer-Hermann, Michael


    The focus of modern molecular biology turns from assigning functions to individual genes towards understanding the expression and regulation of complex sets of molecules. Here, we provide evidence that alternative sigma factor regulons in the pathogen Pseudomonas aeruginosa largely represent insulated functional modules which provide a critical level of biological organization involved in general adaptation and survival processes. Analysis of the operational state of the sigma factor network revealed that transcription factors functionally couple the sigma factor regulons and significantly modulate the transcription levels in the face of challenging environments. The threshold quality of newly evolved transcription factors was reached faster and more robustly in in silico testing when the structural organization of sigma factor networks was taken into account. These results indicate that the modular structures of alternative sigma factor regulons provide P. aeruginosa with a robust framework to function adequately in its environment and at the same time facilitate evolutionary change. Our data support the view that widespread modularity guarantees robustness of biological networks and is a key driver of evolvability.

  7. Functional modules of sigma factor regulons guarantee adaptability and evolvability

    PubMed Central

    Binder, Sebastian C.; Eckweiler, Denitsa; Schulz, Sebastian; Bielecka, Agata; Nicolai, Tanja; Franke, Raimo; Häussler, Susanne; Meyer-Hermann, Michael


    The focus of modern molecular biology turns from assigning functions to individual genes towards understanding the expression and regulation of complex sets of molecules. Here, we provide evidence that alternative sigma factor regulons in the pathogen Pseudomonas aeruginosa largely represent insulated functional modules which provide a critical level of biological organization involved in general adaptation and survival processes. Analysis of the operational state of the sigma factor network revealed that transcription factors functionally couple the sigma factor regulons and significantly modulate the transcription levels in the face of challenging environments. The threshold quality of newly evolved transcription factors was reached faster and more robustly in in silico testing when the structural organization of sigma factor networks was taken into account. These results indicate that the modular structures of alternative sigma factor regulons provide P. aeruginosa with a robust framework to function adequately in its environment and at the same time facilitate evolutionary change. Our data support the view that widespread modularity guarantees robustness of biological networks and is a key driver of evolvability. PMID:26915971

  8. Cold responsive gene transcription becomes more complex.


    Zhao, Chunzhao; Lang, Zhaobo; Zhu, Jian-Kang


    CBF transcription factors, which play important roles in cold acclimation, regulate the expression of approximately 170 cold-responsive genes, termed the CBF regulon. Recent work by Park et al. showed that CBF regulon genes and other cold-responsive genes are regulated by a complex network that involves many early cold-induced transcription factors. PMID:26072094

  9. Genome cartography: charting the apicomplexan genome

    PubMed Central

    Kissinger, Jessica C.; DeBarry, Jeremy


    Genes reside in particular genomic contexts that can be mapped at many levels. Historically, genetic maps were used primarily to locate genes. Recent technological advances in genome sequence determination have made the analysis and comparison of whole genomes possible and increasingly tractable. If we shift our focus from gene content (the inventory of genes contained within a genome), to genome composition and organization, what do we see? This review examines what has been learned about the evolution of the apicomplexan genome and the significance and impact of genomic location on our understanding of the eukaryotic genome and parasite biology. PMID:21764378

  10. The response of Bacillus licheniformis to heat and ethanol stress and the role of the SigB regulon.


    Voigt, Birgit; Schroeter, Rebecca; Jürgen, Britta; Albrecht, Dirk; Evers, Stefan; Bongaerts, Johannes; Maurer, Karl-Heinz; Schweder, Thomas; Hecker, Michael


    The heat and ethanol stress response of Bacillus licheniformis DSM13 was analyzed at the transcriptional and/or translational level. During heat shock, regulons known to be heat-induced in Bacillus subtilis 168 are upregulated in B. licheniformis, such as the HrcA, SigB, CtsR, and CssRS regulon. Upregulation of the SigY regulon and of genes controlled by other extracytoplasmic function (ECF) sigma factors indicates a cell-wall stress triggered by the heat shock. Furthermore, tryptophan synthesis enzymes were upregulated in heat stressed cells as well as regulons involved in usage of alternative carbon and nitrogen sources. Ethanol stress led to an induction of the SigB, HrcA, and CtsR regulons. As indicated by the upregulation of a SigM-dependent protein, ethanol also triggered a cell wall stress. To characterize the SigB regulon of B. licheniformis, we analyzed the heat stress response of a sigB mutant. It is shown that the B. licheniformis SigB regulon comprises additional genes, some of which do not exist in B. subtilis, such as BLi03885, encoding a hypothetical protein, the Na/solute symporter gene BLi02212, the arginase homolog-encoding gene BLi00198 and mcrA, encoding a protein with endonuclease activity. PMID:23592518

  11. Extracting regulatory networks of Escherichia coli from RegulonDB.


    Salgado, Heladia; Martnez-Flores, Irma; Lpez-Fuentes, Alejandra; Garca-Sotelo, Jair Santiago; Porrn-Sotelo, Liliana; Solano, Hilda; Muiz-Rascado, Luis; Collado-Vides, Julio


    RegulonDB contains the largest and currently best-known data set on transcriptional regulation in a single free-living organism, that of Escherichia coli K-12 (Gama-Castro et al. Nucleic Acids Res 36:D120-D124, 2008). This organized knowledge has been the gold standard for the implementation of bioinformatic predictive methods on gene regulation in bacteria (Collado-Vides et al. J Bacteriol 191:23-31, 2009). Given the complexity of different types of interactions, the difficulty of visualizing in a single figure of the whole network, and the different uses of this knowledge, we are making available different views of the genetic network. This chapter describes case studies about how to access these views, via precomputed files, web services and SQL, including sigma-gene relationships corresponding to transcription of alternative RNA polymerase holoenzyme promoters; as well as, transcription factor (TF)-genes, TF-operons, TF-TF, and TF-regulon interactions. 17. PMID:22144154

  12. The PlcR Virulence Regulon of Bacillus cereus

    PubMed Central

    Gohar, Michel; Faegri, Karoline; Perchat, Stéphane; Ravnum, Solveig; Økstad, Ole Andreas; Gominet, Myriam; Kolstø, Anne-Brit; Lereclus, Didier


    PlcR is a Bacillus cereus transcriptional regulator, which activates gene expression by binding to a nucleotidic sequence called the ‘PlcR box’. To build a list of all genes included in the PlcR regulon, a consensus sequence was identified by directed mutagenesis. The reference strain ATCC14579 sequenced genome was searched for occurrences of this consensus sequence to produce a virtual regulon. PlcR control of these genes was confirmed by comparing gene expression in the reference strain and its isogenic Δ-plcR strain using DNA microarrays, lacZ fusions and proteomics methods. The resulting list included 45 genes controlled by 28 PlcR boxes. Forty of the PlcR controlled proteins were exported, of which 22 were secreted in the extracellular medium and 18 were bound or attached to cell wall structures (membrane or peptidoglycan layer). The functions of these proteins were related to food supply (phospholipases, proteases, toxins), cell protection (bacteriocins, toxins, transporters, cell wall biogenesis) and environment-sensing (two-component sensors, chemotaxis proteins, GGDEF family regulators). Four genes coded for cytoplasmic regulators. The PlcR regulon appears to integrate a large range of environmental signals, including food deprivation and self cell-density, and regulate the transcription of genes designed to overcome obstacles that hinder B. cereus growth within the host: food supply, host barriers, host immune defenses, and competition with other bacterial species. PlcR appears to be a key component in the efficient adaptation of B. cereus to its host environment. PMID:18665214

  13. Tracking transmission of apicomplexan symbionts in diverse Caribbean corals.


    Kirk, Nathan L; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W; Fogarty, Nicole D; Santos, Scott R


    Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are consistent with those of other scleractinian coral symbionts. While this study furthers knowledge regarding these symbionts, numerous questions remain to be addressed, particularly in regard to the specific interaction(s) between these apicomplexans and their hosts. PMID:24260438

  14. Tracking Transmission of Apicomplexan Symbionts in Diverse Caribbean Corals

    PubMed Central

    Kirk, Nathan L.; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W.; Fogarty, Nicole D.; Santos, Scott R.


    Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are consistent with those of other scleractinian coral symbionts. While this study furthers knowledge regarding these symbionts, numerous questions remain to be addressed, particularly in regard to the specific interaction(s) between these apicomplexans and their hosts. PMID:24260438

  15. Characterization of the YdeO Regulon in Escherichia coli

    PubMed Central

    Yamanaka, Yuki; Oshima, Taku; Ishihama, Akira; Yamamoto, Kaneyoshi


    Enterobacteria are able to survive under stressful conditions within animals, such as acidic conditions in the stomach, bile salts during transfer to the intestine and anaerobic conditions within the intestine. The glutamate-dependent (GAD) system plays a major role in acid resistance in Escherichia coli, and expression of the GAD system is controlled by the regulatory cascade consisting of EvgAS > YdeO > GadE. To understand the YdeO regulon in vivo, we used ChIP-chip to interrogate the E. coli genome for candidate YdeO binding sites. All of the seven operons identified by ChIP-chip as being potentially regulated by YdeO were confirmed as being under the direct control of YdeO using RT-qPCR, EMSA, DNaseI-footprinting and reporter assays. Within this YdeO regulon, we identified four stress-response transcription factors, DctR, NhaR, GadE, and GadW and enzymes for anaerobic respiration. Both GadE and GadW are involved in regulation of the GAD system and NhaR is an activator for the sodium/proton antiporter gene. In conjunction with co-transcribed Slp, DctR is involved in protection against metabolic endoproducts under acidic conditions. Taken all together, we suggest that YdeO is a key regulator of E. coli survival in both acidic and anaerobic conditions. PMID:25375160

  16. Definition of the ?(W) regulon of Bacillus subtilis in the absence of stress.


    Zweers, Jessica C; Nicolas, Pierre; Wiegert, Thomas; van Dijl, Jan Maarten; Denham, Emma L


    Bacteria employ extracytoplasmic function (ECF) sigma factors for their responses to environmental stresses. Despite intensive research, the molecular dissection of ECF sigma factor regulons has remained a major challenge due to overlaps in the ECF sigma factor-regulated genes and the stimuli that activate the different ECF sigma factors. Here we have employed tiling arrays to single out the ECF ?(W) regulon of the Gram-positive bacterium Bacillus subtilis from the overlapping ECF ?(X), ?(Y), and ?(M) regulons. For this purpose, we profiled the transcriptome of a B. subtilis sigW mutant under non-stress conditions to select candidate genes that are strictly ?(W)-regulated. Under these conditions, ?(W) exhibits a basal level of activity. Subsequently, we verified the ?(W)-dependency of candidate genes by comparing their transcript profiles to transcriptome data obtained with the parental B. subtilis strain 168 grown under 104 different conditions, including relevant stress conditions, such as salt shock. In addition, we investigated the transcriptomes of rasP or prsW mutant strains that lack the proteases involved in the degradation of the ?(W) anti-sigma factor RsiW and subsequent activation of the ?(W)-regulon. Taken together, our studies identify 89 genes as being strictly ?(W)-regulated, including several genes for non-coding RNAs. The effects of rasP or prsW mutations on the expression of ?(W)-dependent genes were relatively mild, which implies that ?(W)-dependent transcription under non-stress conditions is not strictly related to RasP and PrsW. Lastly, we show that the pleiotropic phenotype of rasP mutant cells, which have defects in competence development, protein secretion and membrane protein production, is not mirrored in the transcript profile of these cells. This implies that RasP is not only important for transcriptional regulation via ?(W), but that this membrane protease also exerts other important post-transcriptional regulatory functions. PMID:23155385

  17. Microarray Analysis of the Ler Regulon in Enteropathogenic and Enterohaemorrhagic Escherichia coli Strains

    PubMed Central

    Shaw, Robert K.; Islam, Md. Shahidul; Patel, Mala; Snyder, Lori A. S.; Lee, David J.; Penn, Charles W.; Busby, Stephen J. W.; Pallen, Mark J.


    The type III protein secretion system is an important pathogenicity factor of enteropathogenic and enterohaemorrhagic Escherichia coli pathotypes. The genes encoding this apparatus are located on a pathogenicity island (the locus of enterocyte effacement) and are transcriptionally activated by the master regulator Ler. In each pathotype Ler is also known to regulate genes located elsewhere on the chromosome, but the full extent of the Ler regulon is unclear, especially for enteropathogenic E. coli. The Ler regulon was defined for two strains of E. coli: E2348/69 (enteropathogenic) and EDL933 (enterohaemorrhagic) in mid and late log phases of growth by DNA microarray analysis of the transcriptomes of wild-type and ler mutant versions of each strain. In both strains the Ler regulon is focused on the locus of enterocyte effacement all major transcriptional units of which are activated by Ler, with the sole exception of the LEE1 operon during mid-log phase growth in E2348/69. However, the Ler regulon does extend more widely and also includes unlinked pathogenicity genes: in E2348/69 more than 50 genes outside of this locus were regulated, including a number of known or potential pathogenicity determinants; in EDL933 only 4 extra-LEE genes, again including known pathogenicity factors, were activated. In E2348/69, where the Ler regulon is clearly growth phase dependent, a number of genes including the plasmid-encoded regulator operon perABC, were found to be negatively regulated by Ler. Negative regulation by Ler of PerC, itself a positive regulator of the ler promoter, suggests a negative feedback loop involving these proteins. PMID:24454682

  18. Defining bacterial regulons using ChIP-seq.


    Myers, Kevin S; Park, Dan M; Beauchene, Nicole A; Kiley, Patricia J


    Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is a powerful method that identifies protein-DNA binding sites in vivo. Recent studies have illustrated the value of ChIP-seq in studying transcription factor binding in various bacterial species under a variety of growth conditions. These results show that in addition to identifying binding sites, correlation of ChIP-seq data with expression data can reveal important information about bacterial regulons and regulatory networks. In this chapter, we provide an overview of the current state of knowledge about ChIP-seq methodology in bacteria, from sample preparation to raw data analysis. We also describe visualization and various bioinformatic analyses of processed ChIP-seq data. PMID:26032817

  19. Identification of an archaeal mercury regulon by chromatin immunoprecipitation.


    Rudrappa, Deepak; Yao, Andrew I; White, Derrick; Pavlik, Benjamin J; Singh, Raghuveer; Facciotti, Marc T; Blum, Paul


    Mercury is a heavy metal and toxic to all forms of life. Metal exposure can invoke a response to improve survival. In archaea, several components of a mercury response system have been identified, but it is not known whether metal transport is a member of this system. To identify such missing components, a peptide-tagged MerR transcription factor was used to localize enriched chromosome regions by chromosome immunoprecipitation combined with DNA sequence analysis. Such regions could serve as secondary regulatory binding sites to control the expression of additional genes associated with mercury detoxification. Among the 31 highly enriched loci, a subset of five was pursued as potential candidates based on their current annotations. Quantitative reverse transcription-PCR analysis of these regions with and without mercury treatment in WT and mutant strains lacking merR indicated significant regulatory responses under these conditions. Of these, a Family 5 extracellular solute-binding protein and the MarR transcription factor shown previously to control responses to oxidation were most strongly affected. Inactivation of the solute-binding protein by gene disruption increased the resistance of mutant cells to mercury challenge. Inductively coupled plasma-MS analysis of the mutant cell line following metal challenge indicated there was less intracellular mercury compared with the isogenic WT strain. Together, these regulated genes comprise new members of the archaeal MerR regulon and reveal a cascade of transcriptional control not previously demonstrated in this model organism. PMID:26408318

  20. The Regulation of the AdcR Regulon in Streptococcus pneumoniae Depends Both on Zn2+- and Ni2+-Availability

    PubMed Central

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P.


    By using a transcriptomic approach, we have elucidated the effect of Ni2+ on the global gene expression of S. pneumoniae D39 by identifying several differentially expressed genes/operons in the presence of a high extracellular concentration of Ni2+. The genes belonging to the AdcR regulon (adcRCBA, adcAII-phtD, phtA, phtB, and phtE) and the PsaR regulon (pcpA, prtA, and psaBCA) were highly upregulated in the presence of Ni2+. We have further studied the role of Ni2+ in the regulation of the AdcR regulon by using ICP-MS analysis, electrophoretic mobility shift assays and transcriptional lacZ-reporter studies, and demonstrate that Ni2+ is directly involved in the derepression of the AdcR regulon via the Zn2+-dependent repressor AdcR, and has an opposite effect on the expression of the AdcR regulon compared to Zn2+. PMID:26697415

  1. iRegulon: From a Gene List to a Gene Regulatory Network Using Large Motif and Track Collections

    PubMed Central

    Imrichová, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein


    Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from PMID:25058159

  2. iRegulon: from a gene list to a gene regulatory network using large motif and track collections.


    Janky, Rekin's; Verfaillie, Annelien; Imrichov, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein


    Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from PMID:25058159

  3. Diversity of extracellular proteins during the transition from the 'proto-apicomplexan' alveolates to the apicomplexan obligate parasites.


    Templeton, Thomas J; Pain, Arnab


    The recent completion of high-coverage draft genome sequences for several alveolate protozoans - namely, the chromerids, Chromera velia and Vitrella brassicaformis; the perkinsid Perkinsus marinus; the apicomplexan, Gregarina niphandrodes, as well as high coverage transcriptome sequence information for several colpodellids, allows for new genome-scale comparisons across a rich landscape of apicomplexans and other alveolates. Genome annotations can now be used to help interpret fine ultrastructure and cell biology, and guide new studies to describe a variety of alveolate life strategies, such as symbiosis or free living, predation, and obligate intracellular parasitism, as well to provide foundations to dissect the evolutionary transitions between these niches. This review focuses on the attempt to identify extracellular proteins which might mediate the physical interface of cell-cell interactions within the above life strategies, aided by annotation of the repertoires of predicted surface and secreted proteins encoded within alveolate genomes. In particular, we discuss what descriptions of the predicted extracellular proteomes reveal regarding a hypothetical last common ancestor of a pre-apicomplexan alveolate - guided by ultrastructure, life strategies and phylogenetic relationships - in an attempt to understand the evolution of obligate parasitism in apicomplexans. PMID:26585326

  4. Computational analysis of LexA regulons in Cyanobacteria

    PubMed Central


    Background The transcription factor LexA plays an important role in the SOS response in Escherichia coli and many other bacterial species studied. Although the lexA gene is encoded in almost every bacterial group with a wide range of evolutionary distances, its precise functions in each group/species are largely unknown. More recently, it has been shown that lexA genes in two cyanobacterial genomes Nostoc sp. PCC 7120 and Synechocystis sp. PCC 6803 might have distinct functions other than the regulation of the SOS response. To gain a general understanding of the functions of LexA and its evolution in cyanobacteria, we conducted the current study. Results Our analysis indicates that six of 33 sequenced cyanobacterial genomes do not harbor a lexA gene although they all encode the key SOS response genes, suggesting that LexA is not an indispensable transcription factor in these cyanobacteria, and that their SOS responses might be regulated by different mechanisms. Our phylogenetic analysis suggests that lexA was lost during the course of evolution in these six cyanobacterial genomes. For the 26 cyanobacterial genomes that encode a lexA gene, we have predicted their LexA-binding sites and regulons using an efficient binding site/regulon prediction algorithm that we developed previously. Our results show that LexA in most of these 26 genomes might still function as the transcriptional regulator of the SOS response genes as seen in E. coli and other organisms. Interestingly, putative LexA-binding sites were also found in some genomes for some key genes involved in a variety of other biological processes including photosynthesis, drug resistance, etc., suggesting that there is crosstalk between the SOS response and these biological processes. In particular, LexA in both Synechocystis sp. PCC6803 and Gloeobacter violaceus PCC7421 has largely diverged from those in other cyanobacteria in the sequence level. It is likely that LexA is no longer a regulator of the SOS response in Synechocystis sp. PCC6803. Conclusions In most cyanobacterial genomes that we analyzed, LexA appears to function as the transcriptional regulator of the key SOS response genes. There are possible couplings between the SOS response and other biological processes. In some cyanobacteria, LexA has adapted distinct functions, and might no longer be a regulator of the SOS response system. In some other cyanobacteria, lexA appears to have been lost during the course of evolution. The loss of lexA in these genomes might lead to the degradation of its binding sites. PMID:20920248

  5. In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements

    PubMed Central

    Maciąg, Anna; Peano, Clelia; Pietrelli, Alessandro; Egli, Thomas; De Bellis, Gianluca; Landini, Paolo


    Specific promoter recognition by bacterial RNA polymerase is mediated by σ subunits, which assemble with RNA polymerase core enzyme (E) during transcription initiation. However, σ70 (the housekeeping σ subunit) and σS (an alternative σ subunit mostly active during slow growth) recognize almost identical promoter sequences, thus raising the question of how promoter selectivity is achieved in the bacterial cell. To identify novel sequence determinants for selective promoter recognition, we performed run-off/microarray (ROMA) experiments with RNA polymerase saturated either with σ70 (Eσ70) or with σS (EσS) using the whole Escherichia coli genome as DNA template. We found that Eσ70, in the absence of any additional transcription factor, preferentially transcribes genes associated with fast growth (e.g. ribosomal operons). In contrast, EσS efficiently transcribes genes involved in stress responses, secondary metabolism as well as RNAs from intergenic regions with yet-unknown function. Promoter sequence comparison suggests that, in addition to different conservation of the −35 sequence and of the UP element, selective promoter recognition by either form of RNA polymerase can be affected by the A/T content in the −10/+1 region. Indeed, site-directed mutagenesis experiments confirmed that an A/T bias in the −10/+1 region could improve promoter recognition by EσS. PMID:21398637

  6. Characterization of the NifA-RpoN regulon in Rhizobium etli in free life and in symbiosis with Phaseolus vulgaris.


    Salazar, Emmanuel; Daz-Meja, J Javier; Moreno-Hagelsieb, Gabriel; Martnez-Batallar, Gabriel; Mora, Yolanda; Mora, Jaime; Encarnacin, Sergio


    The NifA-RpoN complex is a master regulator of the nitrogen fixation genes in alphaproteobacteria. Based on the complete Rhizobium etli genome sequence, we constructed an R. etli CFN42 oligonucleotide (70-mer) microarray and utilized this tool, reverse transcription (RT)-PCR analysis (transcriptomics), proteomics, and bioinformatics to decipher the NifA-RpoN regulon under microaerobic conditions (free life) and in symbiosis with bean plants. The R. etli NifA-RpoN regulon was determined to contain 78 genes, including the genes involved in nitrogen fixation, and the analyses revealed 42 new NifA-RpoN-dependent genes. More importantly, this study demonstrated that the NifA-RpoN regulon is composed of genes and proteins that have very diverse functions, that play fundamental and previously less appreciated roles in regulating the normal physiology of the cell, and that have important functions in providing adequate conditions for efficient nitrogen fixation in symbiosis. The R. etli NifA-RpoN regulon defined here has some components in common with other NifA-RpoN regulons described previously, but the vast majority of the components have been found only in the R. etli regulon, suggesting that they have a specific role in this bacterium and particular requirements during nitrogen fixation compared with other symbiotic bacterial models. PMID:20453139

  7. The Apicomplexan CDC/MACPF-like pore-forming proteins.


    Wade, Kristin R; Tweten, Rodney K


    Pore-forming proteins (PFPs) encompass a broad family of proteins that are used for virulence or immune defense. Members of the cholesterol-dependent cytolysins (CDCs) and membrane attack complex/perforin (MACPF) family of PFPs form large ?-barrel pores in the membrane. The CDC/MACPF proteins contain a characteristic four-stranded ?-sheet that is flanked by two ?-helical bundles, which unfold to form two transmembrane ?-hairpins. Apicomplexan eukaryotic parasites express CDC/MACPFs termed perforin-like proteins (PLPs). Here we review recent studies that provide key insights into the assembly and regulation of the Apicomplexan PLP (ApiMACPF) molecular pore-forming mechanisms, which are necessary for the osmotically driven rupture of the parasitophorous vacuole and host cell membrane, and cell traversal by these parasites. PMID:26025132

  8. Apicomplexan Energy Metabolism: Carbon Source Promiscuity and the Quiescence Hyperbole.


    Jacot, Damien; Waller, Ross F; Soldati-Favre, Dominique; MacPherson, Dougal A; MacRae, James I


    The nature of energy metabolism in apicomplexan parasites has been closely investigated in the recent years. Studies in Plasmodium spp. and Toxoplasma gondii in particular have revealed that these parasites are able to employ enzymes in non-traditional ways, while utilizing multiple anaplerotic routes into a canonical tricarboxylic acid (TCA) cycle to satisfy their energy requirements. Importantly, some life stages of these parasites previously considered to be metabolically quiescent are, in fact, active and able to adapt their carbon source utilization to survive. We compare energy metabolism across the life cycle of malaria parasites and consider how this varies in other apicomplexans and related organisms, while discussing how this can be exploited for therapeutic intervention in these diseases. PMID:26472327

  9. RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond

    PubMed Central

    Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muñiz-Rascado, Luis; García-Sotelo, Jair Santiago; Alquicira-Hernández, Kevin; Martínez-Flores, Irma; Pannier, Lucia; Castro-Mondragón, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martínez, César; Pérez-Rueda, Ernesto; Alquicira-Hernández, Shirley; Porrón-Sotelo, Liliana; López-Fuentes, Alejandra; Hernández-Koutoucheva, Anastasia; Moral-Chávez, Víctor Del; Rinaldi, Fabio; Collado-Vides, Julio


    RegulonDB ( is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for ‘neighborhood’ genes to known operons and regulons, and computational developments. PMID:26527724

  10. RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond.


    Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muiz-Rascado, Luis; Garca-Sotelo, Jair Santiago; Alquicira-Hernndez, Kevin; Martnez-Flores, Irma; Pannier, Lucia; Castro-Mondragn, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martnez, Csar; Prez-Rueda, Ernesto; Alquicira-Hernndez, Shirley; Porrn-Sotelo, Liliana; Lpez-Fuentes, Alejandra; Hernndez-Koutoucheva, Anastasia; Moral-Chvez, Vctor Del; Rinaldi, Fabio; Collado-Vides, Julio


    RegulonDB ( is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for 'neighborhood' genes to known operons and regulons, and computational developments. PMID:26527724

  11. Evidence classification of high-throughput protocols and confidence integration in RegulonDB

    PubMed Central

    Weiss, Verena; Medina-Rivera, Alejandra; Huerta, Araceli M.; Santos-Zavaleta, Alberto; Salgado, Heladia; Morett, Enrique; Collado-Vides, Julio


    RegulonDB provides curated information on the transcriptional regulatory network of Escherichia coli and contains both experimental data and computationally predicted objects. To account for the heterogeneity of these data, we introduced in version 6.0, a two-tier rating system for the strength of evidence, classifying evidence as either weak or strong (Gama-Castro,S., Jimenez-Jacinto,V., Peralta-Gil,M. et al. RegulonDB (Version 6.0): gene regulation model of Escherichia Coli K-12 beyond transcription, active (experimental) annotated promoters and textpresso navigation. Nucleic Acids Res., 2008;36:D120D124.). We now add to our classification scheme the classification of high-throughput evidence, including chromatin immunoprecipitation (ChIP) and RNA-seq technologies. To integrate these data into RegulonDB, we present two strategies for the evaluation of confidence, statistical validation and independent cross-validation. Statistical validation involves verification of ChIP data for transcription factor-binding sites, using tools for motif discovery and quality assessment of the discovered matrices. Independent cross-validation combines independent evidence with the intention to mutually exclude false positives. Both statistical validation and cross-validation allow to upgrade subsets of data that are supported by weak evidence to a higher confidence level. Likewise, cross-validation of strong confidence data extends our two-tier rating system to a three-tier system by introducing a third confidence score confirmed. Database URL: PMID:23327937

  12. Activation of the latent PlcR regulon in Bacillus anthracis.


    Sastalla, Inka; Maltese, Lauren M; Pomerantseva, Olga M; Pomerantsev, Andrei P; Keane-Myers, Andrea; Leppla, Stephen H


    Many genes in Bacillus cereus and Bacillus thuringiensis are under the control of the transcriptional regulator PlcR and its regulatory peptide, PapR. In Bacillus anthracis, the causative agent of anthrax, PlcR is inactivated by truncation, and consequently genes having PlcR binding sites are expressed at very low levels when compared with B. cereus. We found that activation of the PlcR regulon in B. anthracis by expression of a PlcR-PapR fusion protein does not alter sporulation in strains containing the virulence plasmid pXO1 and thereby the global regulator AtxA. Using comparative 2D gel electrophoresis, we showed that activation of the PlcR regulon in B. anthracis leads to upregulation of many proteins found in the secretome of B. cereus, including phospholipases and proteases, such as the putative protease BA1995. Transcriptional analysis demonstrated expression of BA1995 to be dependent on PlcR-PapR, even though the putative PlcR recognition site of the BA1995 gene does not exactly match the PlcR consensus sequence, explaining why this protein had escaped recognition as belonging to the PlcR regulon. Additionally, while transcription of major PlcR-dependent haemolysins, sphingomyelinase and anthrolysin O is enhanced in response to PlcR activation in B. anthracis, only anthrolysin O contributes significantly to lysis of human erythrocytes. In contrast, the toxicity of bacterial culture supernatants from a PlcR-positive strain towards murine macrophages occurred independently of anthrolysin O expression in vitro and in vivo. PMID:20688829

  13. An SOS Regulon under Control of a Noncanonical LexA-Binding Motif in the Betaproteobacteria

    PubMed Central

    Sanchez-Alberola, Neus; Campoy, Susana; Emerson, David; Barbé, Jordi


    ABSTRACT The SOS response is a transcriptional regulatory network governed by the LexA repressor that activates in response to DNA damage. In the Betaproteobacteria, LexA is known to target a palindromic sequence with the consensus sequence CTGT-N8-ACAG. We report the characterization of a LexA regulon in the iron-oxidizing betaproteobacterium Sideroxydans lithotrophicus. In silico and in vitro analyses show that LexA targets six genes by recognizing a binding motif with the consensus sequence GAACGaaCGTTC, which is strongly reminiscent of the Bacillus subtilis LexA-binding motif. We confirm that the closely related Gallionella capsiferriformans shares the same LexA-binding motif, and in silico analyses indicate that this motif is also conserved in the Nitrosomonadales and the Methylophilales. Phylogenetic analysis of LexA and the alpha subunit of DNA polymerase III (DnaE) reveal that the organisms harboring this noncanonical LexA form a compact taxonomic cluster within the Betaproteobacteria. However, their lexA gene is unrelated to the standard Betaproteobacteria lexA, and there is evidence of its spread through lateral gene transfer. In contrast to other reported cases of noncanonical LexA-binding motifs, the regulon of S. lithotrophicus is comparable in size and function to that of many other Betaproteobacteria, suggesting that a convergent SOS regulon has reevolved under the control of a new LexA protein. Analysis of the DNA-binding domain of S. lithotrophicus LexA reveals little sequence similarity with that of other LexA proteins targeting similar binding motifs, suggesting that network structure may limit site evolution or that structural constrains make the B. subtilis-type motif an optimal interface for multiple LexA sequences. IMPORTANCE Understanding the evolution of transcriptional systems enables us to address important questions in microbiology, such as the emergence and transfer potential of different regulatory systems to regulate virulence or mediate responses to stress. The results reported here constitute the first characterization of a noncanonical LexA protein regulating a standard SOS regulon. This is significant because it illustrates how a complex transcriptional program can be put under the control of a novel transcriptional regulator. Our results also reveal a substantial degree of plasticity in the LexA recognition domain, raising intriguing questions about the space of protein-DNA interfaces and the specific evolutionary constrains faced by these elements. PMID:25986903

  14. A novel sigma factor reveals a unique regulon controlling cell-specific recombination in Mycoplasma genitalium

    PubMed Central

    Torres-Puig, Sergi; Broto, Alicia; Querol, Enrique; Piñol, Jaume; Pich, Oscar Q.


    The Mycoplasma genitalium MG428 protein shows homology to members of the sigma-70 family of sigma factors. Herein, we found that MG428 activates transcription of recA, ruvA and ruvB as well as several genes with unknown function. Deletion of MG_428 or some of the up-regulated unknown genes led to severe recombination defects. Single cell analyses revealed that activation of the MG428-regulon is a rare event under laboratory growth conditions. A conserved sequence with sigma-70 promoter architecture (TTGTCA-N18/19-ATTWAT) was identified in the upstream region of all of the MG428-regulated genes or operons. Primer extension analyses demonstrated that transcription initiates immediately downstream of this sigma70-type promoter in a MG428-dependent manner. Furthermore, mutagenesis of the conserved −10 and −35 elements corroborated the requirement of these regions for promoter function. Therefore, a new mycoplasma promoter directs transcription of a unique recombination regulon. Additionally, MG428 was found to interact with the RNAP core enzyme, reinforcing the predicted role of this protein as an alternative sigma factor. Finally, our results indicate that MG428 contributes to the generation of genetic diversity in this model organism. Since recombination is an important mechanism to generate antigenic variation, MG428 emerges as a novel factor contributing to M. genitalium virulence. PMID:25925568

  15. A novel sigma factor reveals a unique regulon controlling cell-specific recombination in Mycoplasma genitalium.


    Torres-Puig, Sergi; Broto, Alicia; Querol, Enrique; Piol, Jaume; Pich, Oscar Q


    The Mycoplasma genitalium MG428 protein shows homology to members of the sigma-70 family of sigma factors. Herein, we found that MG428 activates transcription of recA, ruvA and ruvB as well as several genes with unknown function. Deletion of MG_428 or some of the up-regulated unknown genes led to severe recombination defects. Single cell analyses revealed that activation of the MG428-regulon is a rare event under laboratory growth conditions. A conserved sequence with sigma-70 promoter architecture (TTGTCA-N(18/19)-ATTWAT) was identified in the upstream region of all of the MG428-regulated genes or operons. Primer extension analyses demonstrated that transcription initiates immediately downstream of this sigma70-type promoter in a MG428-dependent manner. Furthermore, mutagenesis of the conserved -10 and -35 elements corroborated the requirement of these regions for promoter function. Therefore, a new mycoplasma promoter directs transcription of a unique recombination regulon. Additionally, MG428 was found to interact with the RNAP core enzyme, reinforcing the predicted role of this protein as an alternative sigma factor. Finally, our results indicate that MG428 contributes to the generation of genetic diversity in this model organism. Since recombination is an important mechanism to generate antigenic variation, MG428 emerges as a novel factor contributing to M. genitalium virulence. PMID:25925568

  16. Prevalence of encysted apicomplexans in muscles of raptors.


    Lindsay, D S; Blagburn, B L


    An acid-pepsin digestion technique was used to examine portions of breast muscle and heart from raptors for encysted protozoans. Apicomplexan zoites were present in 52 (45.6%) of the 114 samples examined: 11 of 12 (91.7%) red-shouldered hawks (Buteo lineatus), 20 of 34 (58.8%) red-tailed hawks (Buteo jamaicensis), two of seven (28.6%) Cooper's hawks (Accipiter cooperi), three of four (75%) sharp-shinned hawks (Accipiter striatus), one (100%) Mississippi kites (Ictinia misisippiensis), one of two (50%) American kestrels (Falco sparverius), one bald eagle (Haliaeetus leucocephalus), one of two (50%) golden eagles (Aquila chrysaetos), one of three (33%) turkey vultures (Cathartes aura), two of three (66.7%) black vultures (Coragyps atratus), three of six (50%) great-horned owls (Bubo virginianus), five of 15 (33.3%) barred owls (Strix varia), and one of 12 (8.3%) screech owls (Asio otus). Encysted protozoans were not observed in digests of tissues from three broad-winged hawks (Buteo platypterus), four ospreys (Pandion haliaetus), and five barn owls (Tyto alba). Apicomplexan cysts resembling Sarcocystis species were observed in tissue sections of muscles from 28 (37.8%) of 74 raptors. PMID:9950339

  17. Sterol Composition and Biosynthetic Genes of Vitrella brassicaformis, a Recently Discovered Chromerid: Comparison to Chromera velia and Phylogenetic Relationship with Apicomplexan Parasites.


    Khadka, Manoj; Salem, Mohamed; Leblond, Jeffrey D


    Vitrella brassicaformis is the second discovered species in the Chromerida, and first in the family Vitrellaceae. Chromera velia, the first discovered species, forms an independent photosynthetic lineage with V. brassicaformis, and both are closely related to peridinin-containing dinoflagellates and nonphotosynthetic apicomplexans; both also show phylogenetic closeness with red algal plastids. We have utilized gas chromatography/mass spectrometry to identify two free sterols, 24-ethylcholest-5-en-3?-ol, and a minor unknown sterol which appeared to be a C(28:4) compound. We have also used RNA Seq analysis to identify seven genes found in the nonmevalonate/methylerythritol pathway (MEP) for sterol biosynthesis. Subsequent genome analysis of V. brassicaformis showed the presence of two mevalonate (MVA) pathway genes, though the genes were not observed in the transcriptome analysis. Transcripts from four genes (dxr, ispf, ispd, and idi) were selected and translated into proteins to study the phylogenetic relationship of sterol biosynthesis in V. brassicaformis and C. velia to other groups of algae and apicomplexans. On the basis of our genomic and transcriptomic analyses, we hypothesize that the MEP pathway was the primary pathway that apicomplexans used for sterol biosynthesis before they lost their sterol biosynthesis ability, although contribution of the MVA pathway cannot be discounted. PMID:25996517

  18. Factors mediating plastid dependency and the origins of parasitism in apicomplexans and their close relatives

    PubMed Central

    Janoukovec, Jan; Tikhonenkov, Denis V.; Burki, Fabien; Howe, Alexis T.; Kolsko, Martin; Mylnikov, Alexander P.; Keeling, Patrick J.


    Apicomplexans are a major lineage of parasites, including causative agents of malaria and toxoplasmosis. How such highly adapted parasites evolved from free-living ancestors is poorly understood, particularly because they contain nonphotosynthetic plastids with which they have a complex metabolic dependency. Here, we examine the origin of apicomplexan parasitism by resolving the evolutionary distribution of several key characteristics in their closest free-living relatives, photosynthetic chromerids and predatory colpodellids. Using environmental sequence data, we describe the diversity of these apicomplexan-related lineages and select five species that represent this diversity for transcriptome sequencing. Phylogenomic analysis recovered a monophyletic lineage of chromerids and colpodellids as the sister group to apicomplexans, and a complex distribution of retention versus loss for photosynthesis, plastid genomes, and plastid organelles. Reconstructing the evolution of all plastid and cytosolic metabolic pathways related to apicomplexan plastid function revealed an ancient dependency on plastid isoprenoid biosynthesis, predating the divergence of apicomplexan and dinoflagellates. Similarly, plastid genome retention is strongly linked to the retention of two genes in the plastid genome, sufB and clpC, altogether suggesting a relatively simple model for plastid retention and loss. Lastly, we examine the broader distribution of a suite of molecular characteristics previously linked to the origins of apicomplexan parasitism and find that virtually all are present in their free-living relatives. The emergence of parasitism may not be driven by acquisition of novel components, but rather by loss and modification of the existing, conserved traits. PMID:25717057

  19. RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more

    PubMed Central

    Salgado, Heladia; Peralta-Gil, Martin; Gama-Castro, Socorro; Santos-Zavaleta, Alberto; Muiz-Rascado, Luis; Garca-Sotelo, Jair S.; Weiss, Verena; Solano-Lira, Hilda; Martnez-Flores, Irma; Medina-Rivera, Alejandra; Salgado-Osorio, Gerardo; Alquicira-Hernndez, Shirley; Alquicira-Hernndez, Kevin; Lpez-Fuentes, Alejandra; Porrn-Sotelo, Liliana; Huerta, Araceli M.; Bonavides-Martnez, Csar; Balderas-Martnez, Yalbi I.; Pannier, Lucia; Olvera, Maricela; Labastida, Aurora; Jimnez-Jacinto, Vernica; Vega-Alvarado, Leticia; del Moral-Chvez, Victor; Hernndez-Alvarez, Alfredo; Morett, Enrique; Collado-Vides, Julio


    This article summarizes our progress with RegulonDB ( during the past 2 years. We have kept up-to-date the knowledge from the published literature regarding transcriptional regulation in Escherichia coli K-12. We have maintained and expanded our curation efforts to improve the breadth and quality of the encoded experimental knowledge, and we have implemented criteria for the quality of our computational predictions. Regulatory phrases now provide high-level descriptions of regulatory regions. We expanded the assignment of quality to various sources of evidence, particularly for knowledge generated through high-throughput (HT) technology. Based on our analysis of most relevant methods, we defined rules for determining the quality of evidence when multiple independent sources support an entry. With this latest release of RegulonDB, we present a new highly reliable larger collection of transcription start sites, a result of our experimental HT genome-wide efforts. These improvements, together with several novel enhancements (the tracks display, uploading format and curational guidelines), address the challenges of incorporating HT-generated knowledge into RegulonDB. Information on the evolutionary conservation of regulatory elements is also available now. Altogether, RegulonDB version 8.0 is a much better home for integrating knowledge on gene regulation from the sources of information currently available. PMID:23203884

  20. A comparison of the low temperature transcriptomes and CBF regulons of three plant species that differ in freezing tolerance: Solanum commersonii, Solanum tuberosum, and Arabidopsis thaliana

    PubMed Central

    Pino, Mara-Teresa; Jekni?, Zoran; Zou, Cheng; Shiu, Shin-Han; Chen, Tony H. H.; Thomashow, Michael F.


    Solanum commersonii and Solanum tuberosum are closely related plant species that differ in their abilities to cold acclimate; whereas S. commersonii increases in freezing tolerance in response to low temperature, S. tuberosum does not. In Arabidopsis thaliana, cold-regulated genes have been shown to contribute to freezing tolerance, including those that comprise the CBF regulon, genes that are controlled by the CBF transcription factors. The low temperature transcriptomes and CBF regulons of S. commersonii and S. tuberosum were therefore compared to determine whether there might be differences that contribute to their differences in ability to cold acclimate. The results indicated that both plants alter gene expression in response to low temperature to similar degrees with similar kinetics and that both plants have CBF regulons composed of hundreds of genes. However, there were considerable differences in the sets of genes that comprised the low temperature transcriptomes and CBF regulons of the two species. Thus differences in cold regulatory programmes may contribute to the differences in freezing tolerance of these two species. However, 53 groups of putative orthologous genes that are cold-regulated in S. commersonii, S. tuberosum, and A. thaliana were identified. Given that the evolutionary distance between the two Solanum species and A. thaliana is 112156 million years, it seems likely that these conserved cold-regulated genesmany of which encode transcription factors and proteins of unknown functionhave fundamental roles in plant growth and development at low temperature. PMID:21511909

  1. Structural and Mechanistic Basis of Zinc Regulation Across the E. coli Zur Regulon

    PubMed Central

    Gilston, Benjamin A.; Wang, Suning; Marcus, Mason D.; Canalizo-Hernández, Mónica A.; Swindell, Elden P.; Xue, Yi; Mondragón, Alfonso; O'Halloran, Thomas V.


    Commensal microbes, whether they are beneficial or pathogenic, are sensitive to host processes that starve or swamp the prokaryote with large fluctuations in local zinc concentration. To understand how microorganisms coordinate a dynamic response to changes in zinc availability at the molecular level, we evaluated the molecular mechanism of the zinc-sensing zinc uptake regulator (Zur) protein at each of the known Zur-regulated genes in Escherichia coli. We solved the structure of zinc-loaded Zur bound to the PznuABC promoter and show that this metalloregulatory protein represses gene expression by a highly cooperative binding of two adjacent dimers to essentially encircle the core element of each of the Zur-regulated promoters. Cooperativity in these protein-DNA interactions requires a pair of asymmetric salt bridges between Arg52 and Asp49′ that connect otherwise independent dimers. Analysis of the protein-DNA interface led to the discovery of a new member of the Zur-regulon: pliG. We demonstrate this gene is directly regulated by Zur in a zinc responsive manner. The pliG promoter forms stable complexes with either one or two Zur dimers with significantly less protein-DNA cooperativity than observed at other Zur regulon promoters. Comparison of the in vitro Zur-DNA binding affinity at each of four Zur-regulon promoters reveals ca. 10,000-fold variation Zur-DNA binding constants. The degree of Zur repression observed in vivo by comparison of transcript copy number in wild-type and Δzur strains parallels this trend spanning a 100-fold difference. We conclude that the number of ferric uptake regulator (Fur)-family dimers that bind within any given promoter varies significantly and that the thermodynamic profile of the Zur-DNA interactions directly correlates with the physiological response at different promoters. PMID:25369000

  2. Divergence of the SigB regulon and pathogenesis of the Bacillus cereus sensu lato group

    PubMed Central


    Background The Bacillus cereus sensu lato group currently includes seven species (B. cereus, B. anthracis, B. mycoides, B. pseudomycoides, B. thuringiensis, B. weihenstephanensis and B. cytotoxicus) that recent phylogenetic and phylogenomic analyses suggest are likely a single species, despite their varied phenotypes. Although horizontal gene transfer and insertion-deletion events are clearly important for promoting divergence among these genomes, recent studies have demonstrated that a major basis for phenotypic diversity in these organisms may be differential regulation of the highly similar gene content shared by these organisms. To explore this hypothesis, we used an in silico approach to evaluate the relationship of pathogenic potential and the divergence of the SigB-dependent general stress response within the B. cereus sensu lato group, since SigB has been demonstrated to support pathogenesis in Bacillus, Listeria and Staphylococcus species. Results During the divergence of these organisms from a common “SigB-less” ancestor, the placement of SigB promoters at varied locations in the B. cereus sensu lato genomes predict alternative structures for the SigB regulon in different organisms. Predicted promoter changes suggesting differential transcriptional control of a common gene pool predominate over evidence of indels or horizontal gene transfer for explaining SigB regulon divergence. Conclusions Four lineages of the SigB regulon have arisen that encompass different gene contents and suggest different strategies for supporting pathogenesis. This is consistent with the hypothesis that divergence within the B. cereus sensu lato group rests in part on alternative strategies for regulation of a common gene pool. PMID:23088190

  3. MicroRNA regulons in tumor microenvironment

    PubMed Central

    Suzuki, H I; Katsura, A; Matsuyama, H; Miyazono, K


    Cancer initiation and progression are defined by the behavior of cancer cells per se and the development of tumor tissues, both of which are modulated by crosstalk between cancer cells and the surrounding microenvironment. Advances in cancer research have highlighted the significance of constant evolution of the tumor microenvironment, leading to tumor formation, metastasis and refractoriness to therapy. MicroRNAs (miRNAs) are small non-coding RNAs that function as major players of posttranscriptional gene regulation in diverse biological processes. They function as both tumor suppressors and promoters in many aspects of the autonomous behavior of cancer cells. Theoretically, dysfunction in the gene regulatory networks of cancer cells is one of the major driving forces for alterations of ostensibly normal surrounding cells. In this context, the core targets of miRNAs, termed miRNA regulons, are currently being expanded to include various modulators of the tumor microenvironment. Recent advances have highlighted two important roles played by miRNAs in the evolution of tumor microenvironments: miRNAs in tumor cells transform the microenvironment via non-cell-autonomous mechanisms, and miRNAs in neighboring cells stabilize cancer hallmark traits. These observations epitomize the distal and proximal functions of miRNAs in tumor microenvironments, respectively. Such regulation by miRNAs affects tumor angiogenesis, immune invasion and tumorstromal interactions. This review summarizes recent findings on the mechanisms of miRNA-mediated regulation of tumor microenvironments, with a perspective on the design of therapeutic interventions. PMID:25132266

  4. [The molecular mechanisms of erythrocyte invasion of Plasmodium spp. as a model organism of apicomplexan protozoa].


    ?ah?n, ?zzet; Yaman, Ozan; Hamamci, Berna; et?nkaya, lfet


    Apicomplexan protozoa are a phylum of parazites that includes medically and agriculturally important pathogens. They are named for their cell apex which contains a number of organelles (rhoptri, micronemes, conoid, apical polar ring, dense granules and apicoplast), important for their invasion and development within host cells. Among important apicomplexan parasites that affect human health directly or indirectly are Plasmodium spp., Toxoplasma gondii, Cryptosporodium, Eimeria, Babesia, and Theileria. Apicomplexan parasites move and actively enter host cells by substrate-dependent gliding motility. In these parasites, gliding motility and host cell invasion are driven by an actomyosin-based system (Glydeosome). A gliding motor machinery is embeded between the plasma membrane and inner membrane complex (IMC), a unique double membrane layer. A unique actomyosin motor powers both host cell invasion and locomotion of apicomplexan invasive stage. The cytoplasmic motor, a transmembrane bridge, and surface ligants essential for cell invasion are conserved among the main apicomplexan pathogens. In this review, erythrocytet invasion of Plasmodial merozit, which is a model organism of apicomplexan parasites, has been reviewed in detail. PMID:21391195

  5. iRegulon and i-cisTarget: Reconstructing Regulatory Networks Using Motif and Track Enrichment.


    Verfaillie, Annelien; Imrichova, Hana; Janky, Rekins; Aerts, Stein


    Gene expression profiling is often used to identify genes that are co-expressed in a biological process or disease. Downstream analyses of co-expressed gene sets using bioinformatics methods can reveal candidate transcription factors (TF) that co-regulate these genes, based on the presence of shared TF binding sites. Drawing gene regulatory networks that connect TFs to their predicted target genes can uncover gene modules that implement a particular function. Here, we describe several protocols to analyze any set of co-expressed genes using iRegulon and i-cisTarget. These tools perform regulatory sequence analysis (motif discovery) and integrate and mine large collections of existing regulatory data, such as ChIP-Seq, DHS-seq, and FAIRE-seq (track discovery). While iRegulon focuses on sets of co-expressed genes, i-cisTarget also analyses genomic regions as input. The following protocols describe how to install and use these tools, how to interpret the obtained results, and will thus help to create meaningful regulatory networks. 2015 by John Wiley & Sons, Inc. PMID:26678384

  6. In silico discovery of the dormancy regulons in a number of Actinobacteria genomes

    SciTech Connect

    Gerasimova, Anna; Dubchak, Inna; Arkin, Adam; Gelfand, Mikhail


    Mycobacterium tuberculosis is a dangerous Actinobacteria infecting nearly one third of the human population. It becomes dormant and phenotypically drug resistant in response to stresses. An important feature of the M. tuberculosis pathogenesis is the prevalence of latent infection without disease, making understanding of the mechanisms used by the bacteria to exist in this state and to switch to metabolically active infectious form a vital problem to consider. M. tuberculosis dormancy is regulated by the three-component regulatory system of two kinases (DosT and DevS) and transcriprional regulator (DevR). DevR activates transcription of a set of genes, which allow the bacteria to survive long periods of anaerobiosis, and may be important for long-term survival within the host during latent infection. The DevR-regulon is studied experimentally in M. tuberculosis and few other phylogenetically close Mycobacteria spp. As many other two-component systems, the devRS operon is autoregulated. However, the mechanism of the dormancy is not completely clear even for these bacteria and there is no data describing the dormancy regulons in other species.

  7. Characterization of the Ers Regulon of Enterococcus faecalis▿

    PubMed Central

    Riboulet-Bisson, Eliette; Sanguinetti, Maurizio; Budin-Verneuil, Aurélie; Auffray, Yanick; Hartke, Axel; Giard, Jean-Christophe


    Ers has been qualified as the PrfA-like transcriptional regulator of Enterococcus faecalis. In a previous study we reported that Ers is important for the survival within macrophages of this opportunist pathogenic bacterium. In the present work we have used proteomic and microarray expression profiling of E. faecalis JH2-2 and an ers-deleted mutant (Δers mutant) strains to define the Ers regulon. In addition to EF_0082 (encoding a putative facilitator family transporter), already known to be under Ers regulation, three genes or operons displayed a significant decrease (confirmed by reverse transcription quantitative PCR) in expression in the Δers mutant. The first locus corresponds to three genes: arcA, arcB, and arcC1 (arcABC). These genes are members of the ADI operon, encoding enzymes of the arginine deiminase system. The second is the EF_1459 gene, which encodes a hypothetical protein and is located within a putative phage genetic element. Lastly, Ef_3319 is annotated as the alpha subunit of the citrate lyase encoded by citF. citF is a member of a putative 12-gene operon involved in citrate catabolism. Moreover, the promoter sequence, similar to the “PrfA box” and found in the promoter regions of ers and EF_0082, has been shown to be included in the DNA segment recognized by Ers. Phenotypic analysis of the Δers mutant strain revealed a growth defect when cultured with arginine or citrate as the energy source; this was not seen for the wild type. As expected, similar results were obtained with mutants in which arcA and citF were inactivated. In addition, in the mouse peritonitis model of virulence, the Δers mutant appeared significantly less lethal than the JH2-2 wild-type strain. Taken together, these results indicate that the regulator Ers has a pleiotropic effect, especially in the cellular metabolism and virulence of E. faecalis. PMID:18426870

  8. Comparative genomics and functional analysis of rhamnose catabolic pathways and regulons in bacteria

    PubMed Central

    Rodionova, Irina A.; Li, Xiaoqing; Thiel, Vera; Stolyar, Sergey; Stanton, Krista; Fredrickson, James K.; Bryant, Donald A.; Osterman, Andrei L.; Best, Aaron A.; Rodionov, Dmitry A.


    L-rhamnose (L-Rha) is a deoxy-hexose sugar commonly found in nature. L-Rha catabolic pathways were previously characterized in various bacteria including Escherichia coli. Nevertheless, homology searches failed to recognize all the genes for the complete L-Rha utilization pathways in diverse microbial species involved in biomass decomposition. Moreover, the regulatory mechanisms of L-Rha catabolism have remained unclear in most species. A comparative genomics approach was used to reconstruct the L-Rha catabolic pathways and transcriptional regulons in the phyla Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Thermotogae. The reconstructed pathways include multiple novel enzymes and transporters involved in the utilization of L-Rha and L-Rha-containing polymers. Large-scale regulon inference using bioinformatics revealed remarkable variations in transcriptional regulators for L-Rha utilization genes among bacteria. A novel bifunctional enzyme, L-rhamnulose-phosphate aldolase (RhaE) fused to L-lactaldehyde dehydrogenase (RhaW), which is not homologous to previously characterized L-Rha catabolic enzymes, was identified in diverse bacteria including Chloroflexi, Bacilli, and Alphaproteobacteria. By using in vitro biochemical assays we validated both enzymatic activities of the purified recombinant RhaEW proteins from Chloroflexus aurantiacus and Bacillus subtilis. Another novel enzyme of the L-Rha catabolism, L-lactaldehyde reductase (RhaZ), was identified in Gammaproteobacteria and experimentally validated by in vitro enzymatic assays using the recombinant protein from Salmonella typhimurium. C. aurantiacus induced transcription of the predicted L-Rha utilization genes when L-Rha was present in the growth medium and consumed L-Rha from the medium. This study provided comprehensive insights to L-Rha catabolism and its regulation in diverse Bacteria. PMID:24391637

  9. A Novel Bipartite Centrosome Coordinates the Apicomplexan Cell Cycle

    PubMed Central

    Suvorova, Elena S.; Francia, Maria; Striepen, Boris; White, Michael W.


    Apicomplexan parasites can change fundamental features of cell division during their life cycles, suspending cytokinesis when needed and changing proliferative scale in different hosts and tissues. The structural and molecular basis for this remarkable cell cycle flexibility is not fully understood, although the centrosome serves a key role in determining when and how much replication will occur. Here we describe the discovery of multiple replicating core complexes with distinct protein composition and function in the centrosome of Toxoplasma gondii. An outer core complex distal from the nucleus contains the TgCentrin1/TgSfi1 protein pair, along with the cartwheel protein TgSas-6 and a novel Aurora-related kinase, while an inner core closely aligned with the unique spindle pole (centrocone) holds distant orthologs of the CEP250/C-Nap protein family. This outer/inner spatial relationship of centrosome cores is maintained throughout the cell cycle. When in metaphase, the duplicated cores align to opposite sides of the kinetochores in a linear array. As parasites transition into S phase, the cores sequentially duplicate, outer core first and inner core second, ensuring that each daughter parasite inherits one copy of each type of centrosome core. A key serine/threonine kinase distantly related to the MAPK family is localized to the centrosome, where it restricts core duplication to once per cycle and ensures the proper formation of new daughter parasites. Genetic analysis of the outer core in a temperature-sensitive mutant demonstrated this core functions primarily in cytokinesis. An inhibition of ts-TgSfi1 function at high temperature caused the loss of outer cores and a severe block to budding, while at the same time the inner core amplified along with the unique spindle pole, indicating the inner core and spindle pole are independent and co-regulated. The discovery of a novel bipartite organization in the parasite centrosome that segregates the functions of karyokinesis and cytokinesis provides an explanation for how cell cycle flexibility is achieved in apicomplexan life cycles. PMID:25734885

  10. Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis

    PubMed Central

    Mirouze, Nicolas; Bidnenko, Elena; Noirot, Philippe; Auger, Sandrine


    Under nitrogen limitation conditions, Bacillus subtilis induces a sophisticated network of adaptation responses. More precisely, the B. subtilis TnrA regulator represses or activates directly or indirectly the expression of a hundred genes in response to nitrogen availability. The global TnrA regulon have already been identified among which some directly TnrA-regulated genes have been characterized. However, a genome-wide mapping of invivo TnrA-binding sites was still needed to clearly define the set of genes directly regulated by TnrA. Using chromatin immunoprecipitation coupled with hybridization to DNA tiling arrays (ChIP-on-chip), we now provide invivo evidence that TnrA reproducibly binds to 42 regions on the chromosome. Further analysis with real-time invivo transcriptional profiling, combined with results from previous reports, allowed us to define the TnrA primary regulon. We identified 35 promoter regions fulfilling three criteria necessary to be part of this primary regulon: (i) TnrA binding in ChIP-on-chip experiments and/or in previous invitro studies; (ii) the presence of a TnrA box; (iii) TnrA-dependent expression regulation. In addition, the TnrA primary regulon delimitation allowed us to improve the TnrA box consensus. Finally, our results reveal new interconnections between the nitrogen regulatory network and other cellular processes. PMID:25755103

  11. A Comparative Genomics Approach to Prediction of New Members of Regulons

    PubMed Central

    Tan, Kai; Moreno-Hagelsieb, Gabriel; Collado-Vides, Julio; Stormo, Gary D.


    Identifying the complete transcriptional regulatory network for an organism is a major challenge. For each regulatory protein, we want to know all the genes it regulates, that is, its regulon. Examples of known binding sites can be used to estimate the binding specificity of the protein and to predict other binding sites. However, binding site predictions can be unreliable because determining the true specificity of the protein is difficult because of the considerable variability of binding sites. Because regulatory systems tend to be conserved through evolution, we can use comparisons between species to increase the reliability of binding site predictions. In this article, an approach is presented to evaluate the computational predicitions of regulatory sites. We combine the prediction of transcription units having orthologous genes with the prediction of transcription factor binding sites based on probabilistic models. We augment the sets of genes in Escherichia coli that are expected to be regulated by two transcription factors, the cAMP receptor protein and the fumarate and nitrate reduction regulatory protein, through a comparison with the Haemophilus influenzae genome. At the same time, we learned more about the regulatory networks of H. influenzae, a species with much less experimental knowledge than E. coli. By studying orthologous genes subject to regulation by the same transcription factor, we also gained understanding of the evolution of the entire regulatory systems. PMID:11282972

  12. A chemical potentiator of copper-accumulation used to investigate the iron-regulons of Saccharomyces cerevisiae

    PubMed Central

    Foster, Andrew W; Dainty, Samantha J; Patterson, Carl J; Pohl, Ehmke; Blackburn, Hannah; Wilson, Clare; Hess, Corinna R; Rutherford, Julian C; Quaranta, Laura; Corran, Andy; Robinson, Nigel J


    The extreme resistance of Saccharomyces cerevisiae to copper is overcome by 2-(6-benzyl-2-pyridyl)quinazoline (BPQ), providing a chemical-biology tool which has been exploited in two lines of discovery. First, BPQ is shown to form a red (BPQ)2Cu(I) complex and promote Ctr1-independent copper-accumulation in whole cells and in mitochondria isolated from treated cells. Multiple phenotypes, including loss of aconitase activity, are consistent with copper-BPQ mediated damage to mitochondrial ironsulphur clusters. Thus, a biochemical basis of copper-toxicity in S. cerevisiae is analogous to other organisms. Second, iron regulons controlled by Aft1/2, Cth2 and Yap5 that respond to mitochondrial ironsulphur cluster status are modulated by copper-BPQ causing iron hyper-accumulation via upregulated iron-import. Comparison of copper-BPQ treated, untreated and copper-only treated wild-type and fra2? by RNA-seq has uncovered a new candidate Aft1 target-gene (LSO1) and paralogous non-target (LSO2), plus nine putative Cth2 target-transcripts. Two lines of evidence confirm that Fra2 dominates basal repression of the Aft1/2 regulons in iron-replete cultures. Fra2-independent control of these regulons is also observed but CTH2 itself appears to be atypically Fra2-dependent. However, control of Cth2-target transcripts which is independent of CTH2 transcript abundance or of Fra2, is also quantified. Use of copper-BPQ supports a substantial contribution of metabolite repression to iron-regulation. PMID:24895027

  13. The Gac Regulon of Pseudomonas fluorescens SBW25

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptome analysis of Pseudomonas fluorescens SBW25 showed that 702 genes were differentially regulated (FC>4, P<0.0001) in a gacS::Tn5 mutant, with 300 and 402 genes up- and down-regulated, respectively. Similar to the Gac-regulon of four other Pseudomonas species, genes involved in motility, b...

  14. Eimeripain, a cathepsin B-like cysteine protease, expressed throughout sporulation of the apicomplexan parasite Eimeria tenella.


    Rieux, Anas; Gras, Simon; Lecaille, Fabien; Niepceron, Alisson; Katrib, Marilyn; Smith, Nicholas C; Lalmanach, Gilles; Brossier, Fabien


    The invasion and replication of Eimeria tenella in the chicken intestine is responsible for avian coccidiosis, a disease that has major economic impacts on poultry industries worldwide. E. tenella is transmitted to nave animals via shed unsporulated oocysts that need contact with air and humidity to form the infectious sporulated oocysts, which contain the first invasive form of the parasite, the sporozoite. Cysteine proteases (CPs) are major virulence factors expressed by protozoa. In this study, we show that E. tenella expresses five transcriptionally regulated genes encoding one cathepsin L, one cathepsin B and three cathepsin Cs. Biot-LC-LVG-CHN?, a cystatin derived probe, tagged eight polypeptides in unsporulated oocysts but only one in sporulated oocysts. CP-dependant activities were found against the fluorescent substrates, Z-FR-AMC and Z-LR-AMC, throughout the sporulation process. These activities corresponded to a cathepsin B-like enzyme since they were inhibited by CA-074, a specific cathepsin B inhibitor. A 3D model of the catalytic domain of the cathepsin B-like protease, based on its sequence homology with human cathepsin B, further confirmed its classification as a papain-like protease with similar characteristics to toxopain-1 from the related apicomplexan parasite, Toxoplasma gondii; we have, therefore, named the E. tenella cathepsin B, eimeripain. Following stable transfection of E. tenella sporozoites with a plasmid allowing the expression of eimeripain fused to the fluorescent protein mCherry, we demonstrated that eimeripain is detected throughout sporulation and has a punctate distribution in the bodies of extra- and intracellular parasites. Furthermore, CA-074 Me, the membrane-permeable derivative of CA-074, impairs invasion of epithelial MDBK cells by E. tenella sporozoites. This study represents the first characterization of CPs expressed by a parasite from the Eimeria genus. Moreover, it emphasizes the role of CPs in transmission and dissemination of exogenous stages of apicomplexan parasites. PMID:22457711

  15. The Yersinia enterocolitica Phospholipase Gene yplA Is Part of the Flagellar Regulon

    PubMed Central

    Schmiel, Deborah H.; Young, Glenn M.; Miller, Virginia L.


    Yersinia enterocolitica yplA encodes a phospholipase required for virulence. Virulence genes are often regulated in response to environmental signals; therefore, yplA expression was examined using a yplA::lacZY transcriptional fusion. Maximal yplA expression occurred between pH 6.5 and pH 7.5 and was induced in the mid-logarithmic growth phase. Potential Fnr, cyclic AMP (cAMP)-cAMP receptor protein (Crp), and ςF regulatory sites were identified in the nucleotide sequence. Reduction of yplA expression by aeration, addition of glucose and sucrose, and application of high temperature and salt is consistent with Fnr-, cAMP-Crp-, and ςF-mediated regulation, respectively. Expression of yplA was reduced in flhDC and fliA null strains, indicating that yplA is part of the flagellar regulon. PMID:10735878

  16. Ubiquitous associations and a peak fall prevalence between apicomplexan symbionts and reef corals in Florida and the Bahamas

    NASA Astrophysics Data System (ADS)

    Kirk, N. L.; Thornhill, D. J.; Kemp, D. W.; Fitt, W. K.; Santos, S. R.


    Although apicomplexans are a widely recognized and important parasitic group, little is known about those associated with invertebrates, such as reef-building scleractinian corals. To resolve the potential impact of apicomplexans on coral health, it is first necessary to further describe this group of putative parasites and determine their prevalence among host species. Here, it was hypothesized that apicomplexan prevalence would vary seasonally, similar to what occurs in other marine apicomplexans as well as some coral symbionts. To test this, Caribbean scleractinian species Porites astreoides, Montastraea (= Orbicella) annularis, M. (= O.) faveolata, and Siderastrea siderea were sampled seasonally from two reefs each in the Florida Keys and the Bahamas for 9- and 5.5-year periods, respectively. Utilizing a PCR-based screening assay, apicomplexan DNA was detected from most Floridian (80.1 %: n = 555/693) and Bahamian (90.7 %: n = 311/343) coral tissue samples collected over these multi-year periods. Furthermore, apicomplexan DNA was detected from nearly all (98.7 %: n = 78/79) single polyps sampled at multiple locations within six M. faveolata colonies, indicating little to no intracolonial variation in the screening assay. Mixed-model logistic regression was utilized to determine the effects of season, host species, and reef on apicomplexan prevalence. The model identified a significant seasonal effect, with the highest apicomplexan prevalence occurring during fall. There also was a large effect of host species, with apicomplexan prevalence significantly lower among S. siderea colonies relative to the other species. While reef did not have a significant effect in the full model, there was a significant difference in apicomplexan prevalence between Floridian and Bahamian reefs for S. siderea, implying regional differences in this host species. Despite seasonal and species-specific differences in prevalence, apicomplexans are ubiquitous constituents of these particular scleractinian coral species from Florida and the Bahamas.

  17. The Iron Stimulon and Fur Regulon of Geobacter sulfurreducens and Their Role in Energy Metabolism

    PubMed Central

    Embree, Mallory; Qiu, Yu; Shieu, Wendy; Nagarajan, Harish; O'Neil, Regina; Lovley, Derek


    Iron plays a critical role in the physiology of Geobacter species. It serves as both an essential component for proteins and cofactors and an electron acceptor during anaerobic respiration. Here, we investigated the iron stimulon and ferric uptake regulator (Fur) regulon of Geobacter sulfurreducens to examine the coordination between uptake of Fe(II) and the reduction of Fe(III) at the transcriptional level. Gene expression studies across a variety of different iron concentrations in both the wild type and a Δfur mutant strain were used to determine the iron stimulon. The stimulon consists of a broad range of gene products, ranging from iron-utilizing to central metabolism and iron reduction proteins. Integration of gene expression and chromatin immunoprecipitation (ChIP) data sets assisted in the identification of the Fur transcriptional regulatory network and Fur's role as a regulator of the iron stimulon. Additional physiological and transcriptional analyses of G. sulfurreducens grown with various Fe(II) concentrations revealed the depth of Fur's involvement in energy metabolism and the existence of redundancy within the iron-regulatory network represented by IdeR, an alternative iron transcriptional regulator. These characteristics enable G. sulfurreducens to thrive in environments with fluctuating iron concentrations by providing it with a robust mechanism to maintain tight and deliberate control over intracellular iron homeostasis. PMID:24584254

  18. Protococcidian Eleutheroschizon duboscqi, an Unusual Apicomplexan Interconnecting Gregarines and Cryptosporidia.


    Valigurov, Andrea; Paskerova, Gita G; Diakin, Andrei; Kov?ikov, Magdalna; Simdyanov, Timur G


    This study focused on the attachment strategy, cell structure and the host-parasite interactions of the protococcidian Eleutheroschizon duboscqi, parasitising the polychaete Scoloplos armiger. The attached trophozoites and gamonts of E. duboscqi were detected at different development stages. The parasite develops epicellularly, covered by a host cell-derived, two-membrane parasitophorous sac forming a caudal tipped appendage. Staining with Evans blue suggests that this tail is protein-rich, supported by the presence of a fibrous substance in this area. Despite the ultrastructural evidence for long filaments in the tail, it stained only weakly for F-actin, while spectrin seemed to accumulate in this area. The attachment apparatus consists of lobes arranged in one (trophozoites) or two (gamonts) circles, crowned by a ring of filamentous fascicles. During trophozoite maturation, the internal space between the parasitophorous sac and parasite turns translucent, the parasite trilaminar pellicle seems to reorganise and is covered by a dense fibrous glycocalyx. The parasite surface is organised in broad folds with grooves in between. Micropores are situated at the bottom of the grooves. A layer of filaments organised in bands, underlying the folds and ending above the attachment fascicles, was detected just beneath the pellicle. Confocal microscopy, along with the application of cytoskeletal drugs (jasplakinolide, cytochalasin D, oryzalin) confirmed the presence of actin and tubulin polymerised forms in both the parasitophorous sac and the parasite, while myosin labelling was restricted to the sac. Despite positive tubulin labelling, no microtubules were detected in mature stages. The attachment strategy of E. duboscqi shares features with that of cryptosporidia and gregarines, i.e. the parasite itself conspicuously resembles an epicellularly located gregarine, while the parasitophorous sac develops in a similar manner to that in cryptosporidia. This study provides a re-evaluation of epicellular development in other apicomplexans and directly compares their niche with that of E. duboscqi. PMID:25915503

  19. Protococcidian Eleutheroschizon duboscqi, an Unusual Apicomplexan Interconnecting Gregarines and Cryptosporidia

    PubMed Central

    Valigurov, Andrea; Paskerova, Gita G.; Diakin, Andrei; Kov?ikov, Magdalna; Simdyanov, Timur G.


    This study focused on the attachment strategy, cell structure and the host-parasite interactions of the protococcidian Eleutheroschizon duboscqi, parasitising the polychaete Scoloplos armiger. The attached trophozoites and gamonts of E. duboscqi were detected at different development stages. The parasite develops epicellularly, covered by a host cell-derived, two-membrane parasitophorous sac forming a caudal tipped appendage. Staining with Evans blue suggests that this tail is protein-rich, supported by the presence of a fibrous substance in this area. Despite the ultrastructural evidence for long filaments in the tail, it stained only weakly for F-actin, while spectrin seemed to accumulate in this area. The attachment apparatus consists of lobes arranged in one (trophozoites) or two (gamonts) circles, crowned by a ring of filamentous fascicles. During trophozoite maturation, the internal space between the parasitophorous sac and parasite turns translucent, the parasite trilaminar pellicle seems to reorganise and is covered by a dense fibrous glycocalyx. The parasite surface is organised in broad folds with grooves in between. Micropores are situated at the bottom of the grooves. A layer of filaments organised in bands, underlying the folds and ending above the attachment fascicles, was detected just beneath the pellicle. Confocal microscopy, along with the application of cytoskeletal drugs (jasplakinolide, cytochalasin D, oryzalin) confirmed the presence of actin and tubulin polymerised forms in both the parasitophorous sac and the parasite, while myosin labelling was restricted to the sac. Despite positive tubulin labelling, no microtubules were detected in mature stages. The attachment strategy of E. duboscqi shares features with that of cryptosporidia and gregarines, i.e. the parasite itself conspicuously resembles an epicellularly located gregarine, while the parasitophorous sac develops in a similar manner to that in cryptosporidia. This study provides a re-evaluation of epicellular development in other apicomplexans and directly compares their niche with that of E. duboscqi. PMID:25915503

  20. Re-emergence of the apicomplexan theileria equi in the United States: Elimination of persistent infection and transmission risk

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Arthropod-borne apicomplexan pathogens that cause asymptomatic persistent infections present a significant challenge due to their life-long transmission potential. Although anti-microbials have been used to ameliorate acute disease in animals and humans, chemotherapeutic efficacy for apicomplexan pa...

  1. A 1,3-1,4-β-Glucan Utilization Regulon in Paenibacillus sp. Strain JDR-2.


    Chow, Virginia; Kim, Young Sik; Rhee, Mun Su; Sawhney, Neha; St John, Franz J; Nong, Guang; Rice, John D; Preston, James F


    Paenibacillus sp. strain JDR-2 (Paenibacillus JDR-2) secretes a multimodular cell-associated glycoside hydrolase family 10 (GH10) endoxylanase (XynA10A1) that catalyzes the depolymerization of methylglucuronoxylan (MeGXn) and rapidly assimilates the products of depolymerization. Efficient utilization of MeGXn has been postulated to result from the coupling of the processes of exocellular depolymerization and assimilation of oligosaccharide products, followed by intracellular metabolism. Growth and substrate utilization patterns with barley glucan and laminarin similar to those observed with MeGXn as a substrate suggest similar processes for 1,3-1,4-β-glucan and 1,3-β-glucan depolymerization and product assimilation. The Paenibacillus JDR-2 genome includes a cluster of genes encoding a secreted multimodular GH16 β-glucanase (Bgl16A1) containing surface layer homology (SLH) domains, a secreted GH16 β-glucanase with only a catalytic domain (Bgl16A2), transporter proteins, and transcriptional regulators. Recombinant Bgl16A1 and Bgl16A2 catalyze the formation of trisaccharides, tetrasaccharides, and larger oligosaccharides from barley glucan and of mono-, di-, tri-, and tetrasaccharides and larger oligosaccharides from laminarin. The lack of accumulation of depolymerization products during growth and a marked preference for polymeric glucan over depolymerization products support a process coupling extracellular depolymerization, assimilation, and intracellular metabolism for β-glucans similar to that ascribed to the GH10/GH67 xylan utilization system in Paenibacillus JDR-2. Coordinate expression of genes encoding GH16 β-glucanases, transporters, and transcriptional regulators supports their role as a regulon for the utilization of soluble β-glucans. As in the case of the xylan utilization regulons, this soluble β-glucan regulon provides advantages in the growth rate and yields on polymeric substrates and may be exploited for the efficient conversion of plant-derived polysaccharides to targeted products. PMID:26746717

  2. Evidence for a Single Origin of the 35 kb Plastid DNA in Apicomplexans.


    Denny, P; Preiser, P; Williamson, D; Wilson, I


    Gene organization on three selected parts of the 35-kb plastid DNA of the malaria parasite Plasmodium falciparum was compared with that of two other apicomplexans, namely Toxoplasma gondii and Eimeria tenella. This comparison included the characteristic inverted ribosomal RNA repeat. A short segment of DNA from Theileria annulata also was included in a separate comparison. Criteria such as the presence or absence of particular genes, their map positions and their sequences, were used to assess whether the apicomplexan plastid DNAs originated from a single origin (a unitary hypothesis for the entire phylum), or whether disparate multiple events were more likely. The results provisionally favour a single origin although clearly this comparison of the apicomplexan plDNAs is still fragmentary. Contrary to the tendency towards homogeneity, evidence was found that the coccidian plastids may have evolved a suppressor mechanism for UGA stop codons. PMID:23196113

  3. Genome-wide definition of the SigF regulon in Mycobacterium tuberculosis.


    Hartkoorn, Ruben C; Sala, Claudia; Uplekar, Swapna; Busso, Philippe; Rougemont, Jacques; Cole, Stewart T


    In Mycobacterium tuberculosis the alternative sigma factor SigF controls the expression of a particular subset of genes by altering RNA polymerase specificity. Here, we utilize two genome-wide approaches to identify SigF-binding sites: chromatin immunoprecipitation (ChIP-on-chip) and microarray analysis of SigF-mediated transcripts. Since SigF is not an abundant protein in the logarithmic phase of growth, a pristinamyin IA-inducible system was used to control its expression. We identified 67 high-affinity SigF-binding sites and 16 loci where a SigF promoter directs the expression of a transcript. These loci include sigF itself, genes involved in lipid and intermediary metabolism and virulence, and at least one transcriptional regulator (Rv2884), possibly acting downstream of SigF. In addition, SigF was also found to direct the transcription of the gene for small RNA F6. Many loci were also found where SigF may be involved in antisense transcription, and in two cases (Rv1358 and Rv1870c) the SigF-dependent promoter was located within the predicted coding sequence. Quantitative PCR confirmed the microarray findings and 5'-rapid amplification of cDNA ends was used to map the SigF-specific transcriptional start points. A canonical SigF consensus promoter sequence GGTTT-N((15-17))-GGGTA was found prior to 11 genes. Together, these data help to define the SigF regulon and show that SigF not only governs expression of proteins such as the virulence factor, HbhA, but also impacts novel functions, such as noncoding RNAs and antisense transcripts. PMID:22307756

  4. Genome-Wide Definition of the SigF Regulon in Mycobacterium tuberculosis

    PubMed Central

    Hartkoorn, Ruben C.; Sala, Claudia; Uplekar, Swapna; Busso, Philippe; Rougemont, Jacques


    In Mycobacterium tuberculosis the alternative sigma factor SigF controls the expression of a particular subset of genes by altering RNA polymerase specificity. Here, we utilize two genome-wide approaches to identify SigF-binding sites: chromatin immunoprecipitation (ChIP-on-chip) and microarray analysis of SigF-mediated transcripts. Since SigF is not an abundant protein in the logarithmic phase of growth, a pristinamyin IA-inducible system was used to control its expression. We identified 67 high-affinity SigF-binding sites and 16 loci where a SigF promoter directs the expression of a transcript. These loci include sigF itself, genes involved in lipid and intermediary metabolism and virulence, and at least one transcriptional regulator (Rv2884), possibly acting downstream of SigF. In addition, SigF was also found to direct the transcription of the gene for small RNA F6. Many loci were also found where SigF may be involved in antisense transcription, and in two cases (Rv1358 and Rv1870c) the SigF-dependent promoter was located within the predicted coding sequence. Quantitative PCR confirmed the microarray findings and 5?-rapid amplification of cDNA ends was used to map the SigF-specific transcriptional start points. A canonical SigF consensus promoter sequence GGTTT-N(15-17)-GGGTA was found prior to 11 genes. Together, these data help to define the SigF regulon and show that SigF not only governs expression of proteins such as the virulence factor, HbhA, but also impacts novel functions, such as noncoding RNAs and antisense transcripts. PMID:22307756

  5. Hyperosmotic shock induces the sigma32 and sigmaE stress regulons of Escherichia coli.


    Bianchi, A A; Baneyx, F


    The rise in the levels of sigmaS that accompanies hyperosmotic shock plays an important role in Escherichia coli survival by increasing the transcription of genes involved in the synthesis and transport of osmoprotectants. To determine if other stress regulons collaborate with sigmaS in dealing with high osmolality, we used single copy fusions of lacZ to representative promoters induced by protein misfolding in the cytoplasm (dnaK and ibp ), extracytoplasmic stress [P3rpoH and htrA(degP )] and cold shock (cspA). Both the sigma32-dependent, dnaK and ibp, promoters, and the sigmaE-dependent, P3rpoH and htrA, promoters were rapidly but transiently induced when mid-exponential phase cells were treated with 0.464 M sucrose. The cspA promoter, however, did not respond to the same treatment. Overproduction of the cytoplasmic domain of the sigmaE anti-sigma factor, RseA, reduced the magnitude of osmotic induction in lambdaphi(P3rpoH:lacZ ) lysogens, but had no effect on the activation of the dnaK and ibp promoters. Similarly, induction of the dnaK:lacZ and ibp:lacZ fusions was not altered in either rpoS or ompR genetic backgrounds. Osmotic upshift led to a twofold increase in the enzymatic activity of the lambdaTLF247 rpoH:lacZ translational fusion whether or not the cells were treated with rifampicin, indicating that both heat shock and exposure to high osmolality trigger a transient increase in rpoH translation. Our results suggest that the sigma32, sigmaE and sigmaS regulons closely co-operate in the managment of hyperosmotic stress. Induction of the sigma32 and sigmaE regulons appears to be an emergency response required to repair protein misfolding and facilitate the proper folding of proteins that are rapidly synthesized following loss of turgor, while providing a mechanism to increase the activity of sigmaS, the primary stress factor in osmoadaptation. PMID:10594827

  6. Development of a Novel Method for Analyzing Pseudomonas aeruginosa Twitching Motility and Its Application to Define the AmrZ Regulon

    PubMed Central

    Xu, Binjie; Wozniak, Daniel J.


    Twitching motility is an important migration mechanism for the Gram-negative bacterium Pseudomonas aeruginosa. In the commonly used subsurface twitching assay, the sub-population of P. aeruginosa with active twitching motility is difficult to harvest for high-throughput studies. Here we describe the development of a novel method that allows efficient isolation of bacterial sub-populations conducting highly active twitching motility. The transcription factor AmrZ regulates multiple P. aeruginosa virulence factors including twitching motility, yet the mechanism of this activation remains unclear. We therefore set out to understand this mechanism by defining the AmrZ regulon using DNA microarrays in combination with the newly developed twitching motility method. We discovered 112 genes in the AmrZ regulon and many encode virulence factors. One gene of interest and the subsequent focus was lecB, which encodes a fucose-binding lectin. DNA binding assays revealed that AmrZ activates lecB transcription by directly binding to its promoter. The lecB gene was previously shown to be required for twitching motility in P. aeruginosa strain PAK; however, our lecB deletion had no effect on twitching motility in strain PAO1. Collectively, in this study a novel condition was developed for quantitative studies of twitching motility, under which the AmrZ regulon was defined. PMID:26309248

  7. Effect of database drift on network topology and enrichment analyses: a case study for RegulonDB

    PubMed Central

    Muskhelishvili, Georgi; Hütt, Marc-Thorsten


    RegulonDB is a database storing the biological information behind the transcriptional regulatory network (TRN) of the bacterium Escherichia coli. It is one of the key bioinformatics resources for Systems Biology investigations of bacterial gene regulation. Like most biological databases, the content drifts with time, both due to the accumulation of new information and due to refinements in the underlying biological concepts. Conclusions based on previous database versions may no longer hold. Here, we study the change of some topological properties of the TRN of E. coli, as provided by RegulonDB across 16 versions, as well as a simple index, digital control strength, quantifying the match between gene expression profiles and the transcriptional regulatory networks. While many of network characteristics change dramatically across the different versions, the digital control strength remains rather robust and in tune with previous results for this index. Our study shows that: (i) results derived from network topology should, when possible, be studied across a range of database versions, before detailed biological conclusions are derived, and (ii) resorting to simple indices, when interpreting high-throughput data from a network perspective, may help achieving a robustness of the findings against variation of the underlying biological information. Database URL: PMID:26980514

  8. Streptococcus mutans NADH Oxidase Lies at the Intersection of Overlapping Regulons Controlled by Oxygen and NAD+ Levels

    PubMed Central

    Baker, J. L.; Derr, A. M.; Karuppaiah, K.; MacGilvray, M. E.; Kajfasz, J. K.; Faustoferri, R. C.; Rivera-Ramos, I.; Bitoun, J. P.; Lemos, J. A.; Wen, Z. T.


    NADH oxidase (Nox, encoded by nox) is a flavin-containing enzyme used by the oral pathogen Streptococcus mutans to reduce diatomic oxygen to water while oxidizing NADH to NAD+. The critical nature of Nox is 2-fold: it serves to regenerate NAD+, a carbon cycle metabolite, and to reduce intracellular oxygen, preventing formation of destructive reactive oxygen species (ROS). As oxygen and NAD+ have been shown to modulate the activity of the global transcription factors Spx and Rex, respectively, Nox is potentially poised at a critical junction of two stress regulons. In this study, microarray data showed that either addition of oxygen or loss of nox resulted in altered expression of genes involved in energy metabolism and transport and the upregulation of genes encoding ROS-metabolizing enzymes. Loss of nox also resulted in upregulation of several genes encoding transcription factors and signaling molecules, including the redox-sensing regulator gene rex. Characterization of the nox promoter revealed that nox was regulated by oxygen, through SpxA, and by Rex. These data suggest a regulatory loop in which the roles of nox in reduction of oxygen and regeneration of NAD+ affect the activity levels of Spx and Rex, respectively, and their regulons, which control several genes, including nox, crucial to growth of S. mutans under conditions of oxidative stress. PMID:24682329

  9. Effect of database drift on network topology and enrichment analyses: a case study for RegulonDB.


    Beber, Moritz E; Muskhelishvili, Georgi; Hütt, Marc-Thorsten


    RegulonDB is a database storing the biological information behind the transcriptional regulatory network (TRN) of the bacterium Escherichia coli. It is one of the key bioinformatics resources for Systems Biology investigations of bacterial gene regulation. Like most biological databases, the content drifts with time, both due to the accumulation of new information and due to refinements in the underlying biological concepts. Conclusions based on previous database versions may no longer hold. Here, we study the change of some topological properties of the TRN of E. coli, as provided by RegulonDB across 16 versions, as well as a simple index, digital control strength, quantifying the match between gene expression profiles and the transcriptional regulatory networks. While many of network characteristics change dramatically across the different versions, the digital control strength remains rather robust and in tune with previous results for this index.Our study shows that: (i) results derived from network topology should, when possible, be studied across a range of database versions, before detailed biological conclusions are derived, and (ii) resorting to simple indices, when interpreting high-throughput data from a network perspective, may help achieving a robustness of the findings against variation of the underlying biological information.Database URL: PMID:26980514

  10. Microarray-Based Analysis of the Staphylococcus aureus σB Regulon

    PubMed Central

    Bischoff, Markus; Dunman, Paul; Kormanec, Jan; Macapagal, Daphne; Murphy, Ellen; Mounts, William; Berger-Bächi, Brigitte; Projan, Steven


    Microarray-based analysis of the transcriptional profiles of the genetically distinct Staphylococcus aureus strains COL, GP268, and Newman indicate that a total of 251 open reading frames (ORFs) are influenced by σB activity. While σB was found to positively control 198 genes by a factor of ≥2 in at least two of the three genetic lineages analyzed, 53 ORFs were repressed in the presence of σB. Gene products that were found to be influenced by σB are putatively involved in all manner of cellular processes, including cell envelope biosynthesis and turnover, intermediary metabolism, and signaling pathways. Most of the genes and/or operons identified as upregulated by σB were preceded by a nucleotide sequence that resembled the σB consensus promoter sequence of Bacillus subtilis. A conspicuous number of virulence-associated genes were identified as regulated by σB activity, with many adhesins upregulated and prominently represented in this group, while transcription of various exoproteins and toxins were repressed. The data presented here suggest that the σB of S. aureus controls a large regulon and is an important modulator of virulence gene expression that is likely to act conversely to RNAIII, the effector molecule of the agr locus. We propose that this alternative transcription factor may be of importance for the invading pathogen to fine-tune its virulence factor production in response to changing host environments. PMID:15205410

  11. Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.


    Bischoff, Markus; Dunman, Paul; Kormanec, Jan; Macapagal, Daphne; Murphy, Ellen; Mounts, William; Berger-Bchi, Brigitte; Projan, Steven


    Microarray-based analysis of the transcriptional profiles of the genetically distinct Staphylococcus aureus strains COL, GP268, and Newman indicate that a total of 251 open reading frames (ORFs) are influenced by sigmaB activity. While sigmaB was found to positively control 198 genes by a factor of > or =2 in at least two of the three genetic lineages analyzed, 53 ORFs were repressed in the presence of sigmaB. Gene products that were found to be influenced by sigmaB are putatively involved in all manner of cellular processes, including cell envelope biosynthesis and turnover, intermediary metabolism, and signaling pathways. Most of the genes and/or operons identified as upregulated by sigmaB were preceded by a nucleotide sequence that resembled the sigmaB consensus promoter sequence of Bacillus subtilis. A conspicuous number of virulence-associated genes were identified as regulated by sigmaB activity, with many adhesins upregulated and prominently represented in this group, while transcription of various exoproteins and toxins were repressed. The data presented here suggest that the sigmaB of S. aureus controls a large regulon and is an important modulator of virulence gene expression that is likely to act conversely to RNAIII, the effector molecule of the agr locus. We propose that this alternative transcription factor may be of importance for the invading pathogen to fine-tune its virulence factor production in response to changing host environments. PMID:15205410

  12. The Pho regulon: a huge regulatory network in bacteria

    PubMed Central

    Santos-Beneit, Fernando


    One of the most important achievements of bacteria is its capability to adapt to the changing conditions of the environment. The competition for nutrients with other microorganisms, especially in the soil, where nutritional conditions are more variable, has led bacteria to evolve a plethora of mechanisms to rapidly fine-tune the requirements of the cell. One of the essential nutrients that are normally found in low concentrations in nature is inorganic phosphate (Pi). Bacteria, as well as other organisms, have developed several systems to cope for the scarcity of this nutrient. To date, the unique mechanism responding to Pi starvation known in detail is the Pho regulon, which is normally controlled by a two component system and constitutes one of the most sensible and efficient regulatory mechanisms in bacteria. Many new members of the Pho regulon have emerged in the last years in several bacteria; however, there are still many unknown questions regarding the activation and function of the whole system. This review describes the most important findings of the last three decades in relation to Pi regulation in bacteria, including: the PHO box, the Pi signaling pathway and the Pi starvation response. The role of the Pho regulon in nutritional regulation cross-talk, secondary metabolite production, and pathogenesis is discussed in detail. PMID:25983732

  13. Prediction and overview of the RpoN-regulon in closely related species of the Rhizobiales

    PubMed Central

    Dombrecht, Bruno; Marchal, Kathleen; Vanderleyden, Jos; Michiels, Jan


    Background In the rhizobia, a group of symbiotic Gram-negative soil bacteria, RpoN (?54, ?N, NtrA) is best known as the sigma factor enabling transcription of the nitrogen fixation genes. Recent reports, however, demonstrate the involvement of RpoN in other symbiotic functions, although no large-scale effort has yet been undertaken to unravel the RpoN-regulon in rhizobia. We screened two complete rhizobial genomes (Mesorhizobium loti, Sinorhizobium meliloti) and four symbiotic regions (Rhizobium etli, Rhizobium sp. NGR234, Bradyrhizobium japonicum, M. loti) for the presence of the highly conserved RpoN-binding sites. A comparison was also made with two closely related non-symbiotic members of the Rhizobiales (Agrobacterium tumefaciens, Brucella melitensis). Results A highly specific weight-matrix-based screening method was applied to predict members of the RpoN-regulon, which were stored in a highly annotated and manually curated dataset. Possible enhancer-binding proteins (EBPs) controlling the expression of RpoN-dependent genes were predicted with a profile hidden Markov model. Conclusions The methodology used to predict RpoN-binding sites proved highly effective as nearly all known RpoN-controlled genes were identified. In addition, many new RpoN-dependent functions were found. The dependency of several of these diverse functions on RpoN seems species-specific. Around 30% of the identified genes are hypothetical. Rhizobia appear to have recruited RpoN for symbiotic processes, whereas the role of RpoN in A. tumefaciens and B. melitensis remains largely to be elucidated. All species screened possess at least one uncharacterized EBP as well as the usual ones. Lastly, RpoN could significantly broaden its working range by direct interfering with the binding of regulatory proteins to the promoter DNA. PMID:12537565

  14. Refinement of the Listeria monocytogenes σB regulon through quantitative proteomic analysis

    PubMed Central

    Mujahid, S.; Orsi, R. H.; Vangay, P.; Boor, K. J.


    σB is an alternative σ factor that regulates stress response and virulence genes in the foodborne pathogen Listeria monocytogenes. To gain further insight into σB-dependent regulatory mechanisms in L. monocytogenes, we (i) performed quantitative proteomic comparisons between the L. monocytogenes parent strain 10403S and an isogenic ΔsigB mutant and (ii) conducted a meta-analysis of published microarray studies on the 10403S σB regulon. A total of 134 genes were found to be significantly positively regulated by σB at the transcriptomic level with >75 % of these genes preceded by putative σB-dependent promoters; 21 of these 134 genes were also found to be positively regulated by σB through proteomics. In addition, 15 proteins were only found to be positively regulated by σB through proteomics analyses, including Lmo1349, a putative glycine cleavage system protein. The lmo1349 gene is preceded by a 5′ UTR that functions as a glycine riboswitch, which suggests regulation of glycine metabolism by σB in L. monocytogenes. Herein, we propose a model where σB upregulates pathways that facilitate biosynthesis and uptake of glycine, which may then activate this riboswitch. Our data also (i) identified a number of σB-dependent proteins that appear to be encoded by genes that are co-regulated by multiple transcriptional regulators, in particular PrfA, and (ii) found σB-dependent genes and proteins to be overrepresented in the ‘energy metabolism’ role category, highlighting contributions of the σB regulon to L. monocytogenes energy metabolism as well as a role of PrfA and σB interaction in regulating aspects of energy metabolism in L. monocytogenes. PMID:23618998

  15. Characterization of the oxidative stress stimulon and PerR regulon of Campylobacter jejuni

    PubMed Central

    Palyada, Kiran; Sun, Yi-Qian; Flint, Annika; Butcher, James; Naikare, Hemant; Stintzi, Alain


    Background During gut colonization, the enteric pathogen Campylobacter jejuni must surmount the toxic effects of reactive oxygen species produced by its own metabolism, the host immune system, and intestinal microflora. Elucidation of C. jejuni oxidative stress defense mechanisms is critical for understanding Campylobacter pathophysiology. Results The mechanisms of oxidative stress defense in C. jejuni were characterized by transcriptional profiling and phenotypic analysis of wild-type and mutant strains. To define the regulon of the peroxide-sensing regulator, PerR, we constructed an isogenic ?perR mutant and compared its transcriptome profile with that of the wild-type strain. Transcriptome profiling identified 104 genes that belonged to the PerR regulon. PerR appears to regulate gene expression in a manner that both depends on and is independent of the presence of iron and/or H2O2. Mutation of perR significantly reduced motility. A phenotypic analysis using the chick colonization model showed that the ?perR mutant exhibited attenuated colonization behavior. An analysis of changes in the transcriptome induced by exposure to H2O2, cumene hydroperoxide, or menadione revealed differential expression of genes belonging to a variety of biological pathways, including classical oxidative stress defense systems, heat shock response, DNA repair and metabolism, fatty acid biosynthesis, and multidrug efflux pumps. Mutagenic and phenotypic studies of the superoxide dismutase SodB, the alkyl-hydroxyperoxidase AhpC, and the catalase KatA, revealed a role for these proteins in oxidative stress defense and chick gut colonization. Conclusion This study reveals an interplay between PerR, Fur, iron metabolism and oxidative stress defense, and highlights the role of these elements in C. jejuni colonization of the chick cecum and/or subsequent survival. PMID:19835633

  16. Genome Sequence of Babesia bovis and Camparative Analysis of Apicomplexan Hemoprotozoa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related...

  17. Evolution of Chloroplast Transcript Processing in Plasmodium and Its Chromerid Algal Relatives

    PubMed Central

    Dorrell, Richard G.; Drew, James; Nisbet, R. Ellen R.; Howe, Christopher J.


    It is well understood that apicomplexan parasites, such as the malaria pathogen Plasmodium, are descended from free-living algae, and maintain a vestigial chloroplast that has secondarily lost all genes of photosynthetic function. Recently, two fully photosynthetic relatives of parasitic apicomplexans have been identified, the ‘chromerid’ algae Chromera velia and Vitrella brassicaformis, which retain photosynthesis genes within their chloroplasts. Elucidating the processes governing gene expression in chromerid chloroplasts might provide valuable insights into the origins of parasitism in the apicomplexans. We have characterised chloroplast transcript processing pathways in C. velia, V. brassicaformis and P. falciparum with a focus on the addition of an unusual, 3′ poly(U) tail. We demonstrate that poly(U) tails in chromerids are preferentially added to transcripts that encode proteins that are directly involved in photosynthetic electron transfer, over transcripts for proteins that are not involved in photosynthesis. To our knowledge, this represents the first chloroplast transcript processing pathway to be associated with a particular functional category of genes. In contrast, Plasmodium chloroplast transcripts are not polyuridylylated. We additionally present evidence that poly(U) tail addition in chromerids is involved in the alternative processing of polycistronic precursors covering multiple photosynthesis genes, and appears to be associated with high levels of transcript abundance. We propose that changes to the chloroplast transcript processing machinery were an important step in the loss of photosynthesis in ancestors of parasitic apicomplexans. PMID:24453981

  18. Plant-Type Trehalose Synthetic Pathway in Cryptosporidium and Some Other Apicomplexans

    PubMed Central

    Yu, Yonglan; Zhang, Haili; Zhu, Guan


    Background The trehalose synthetic pathway is present in bacteria, fungi, plants and invertebrate animals, but is absent in vertebrates. This disaccharide mainly functions as a stress protectant against desiccation, heat, cold and oxidation. Genes involved in trehalose synthesis have been observed in apicomplexan parasites, but little was known about these enzymes. Study on trehalose synthesis in apicomplexans would not only shed new light into the evolution of this pathway, but also provide data for exploring this pathway as novel drug target. Methodology/Principal Findings We have observed the presence of the trehalose synthetic pathway in Cryptosporidium and other apicomplexans and alveolates. Two key enzymes (trehalose 6-phosphate synthase [T6PS; EC] and trehalose phosphatase [TPase; EC] are present as Class II bifunctional proteins (T6PS-TPase) in the majority of apicomplexans with the exception of Plasmodium species. The enzyme for synthesizing the precursor (UDP-glucose) is homologous to dual-substrate UDP-galactose/glucose pyrophosphorylases (UGGPases), rather than the “classic” UDP-glucose pyrophosphorylase (UGPase). Phylogenetic recontructions indicate that both T6PS-TPases and UGGPases in apicomplexans and other alveolates are evolutionarily affiliated with stramenopiles and plants. The expression level of T6PS-TPase in C. parvum is highly elevated in the late intracellular developmental stage prior to or during the production of oocysts, implying that trehalose may be important in oocysts as a protectant against environmental stresses. Finally, trehalose has been detected in C. parvum oocysts, thus confirming the trehalose synthetic activity in this parasite. Conclusions/Significance A trehalose synthetic pathway is described in the majority of apicomplexan parasites including Cryptosporidium and the presence of trehalose was confirmed in the C. parvum oocyst. Key enzymes in the pathway (i.e., T6PS-TPase and UGGPase) are plant-type and absent in humans and animals, and may potentially serve as novel drug targets in the apicomplexans. PMID:20830297

  19. H-NS and StpA Proteins Stimulate Expression of the Maltose Regulon in Escherichia coli

    PubMed Central

    Johansson, Jörgen; Dagberg, Björn; Richet, Evelyne; Uhlin, Bernt Eric


    The nucleoid-associated protein H-NS is a major component of the chromosome-protein complex, and it is known to influence the regulation of many genes in Escherichia coli. Its role in gene regulation is manifested by the increased expression of several gene products in hns mutant strains. Here we report findings showing that H-NS and the largely homologous protein StpA play a positive role in the expression of genes in the maltose regulon. In studies with hns mutant strains and derivatives also deficient in the stpA gene, we found that expression of the LamB porin was decreased. Our results showed that the amounts of both LamB protein and lamB mRNA were greatly reduced in hns and hns-stpA mutant strains. The same results were obtained when we monitored the amount of transcription from the malEFG operon. The lamB gene is situated in the malKlamBmalM operon, which forms a divergent operon complex together with the malEFG operon. The activation of these genes depends on the action of the maltose regulon activator MalT and the global activator cyclic AMP receptor protein. Using a malT-lacZ translational fusion and antiserum raised against MalT to measure the expression of MalT, we detected reduced MalT expression in hns and hns-stpA mutant strains in comparison with the wild-type strain. Our results suggest that the H-NS and StpA proteins stimulate MalT translation and hence play a positive role in the control of the maltose regulon. PMID:9829919

  20. Transcriptional regulation of drought response: a tortuous network of transcriptional factors

    PubMed Central

    Singh, Dhriti; Laxmi, Ashverya


    Drought is one of the leading factors responsible for the reduction in crop yield worldwide. Due to climate change, in future, more areas are going to be affected by drought and for prolonged periods. Therefore, understanding the mechanisms underlying the drought response is one of the major scientific concerns for improving crop yield. Plants deploy diverse strategies and mechanisms to respond and tolerate drought stress. Expression of numerous genes is modulated in different plants under drought stress that help them to optimize their growth and development. Plant hormone abscisic acid (ABA) plays a major role in plant response and tolerance by regulating the expression of many genes under drought stress. Transcription factors being the major regulator of gene expression play a crucial role in stress response. ABA regulates the expression of most of the target genes through ABA-responsive element (ABRE) binding protein/ABRE binding factor (AREB/ABF) transcription factors. Genes regulated by AREB/ABFs constitute a regulon termed as AREB/ABF regulon. In addition to this, drought responsive genes are also regulated by ABA-independent mechanisms. In ABA-independent regulation, dehydration-responsive element binding protein (DREB), NAM, ATAF, and CUC regulons play an important role by regulating many drought-responsive genes. Apart from these major regulons, MYB/MYC, WRKY, and nuclear factor-Y (NF-Y) transcription factors are also involved in drought response and tolerance. Our understanding about transcriptional regulation of drought is still evolving. Recent reports have suggested the existence of crosstalk between different transcription factors operating under drought stress. In this article, we have reviewed various regulons working under drought stress and their crosstalk with each other. PMID:26579147

  1. Basal body structure and composition in the apicomplexans Toxoplasma and Plasmodium.


    Francia, Maria E; Dubremetz, Jean-Francois; Morrissette, Naomi S


    The phylum Apicomplexa encompasses numerous important human and animal disease-causing parasites, including the Plasmodium species, and Toxoplasma gondii, causative agents of malaria and toxoplasmosis, respectively. Apicomplexans proliferate by asexual replication and can also undergo sexual recombination. Most life cycle stages of the parasite lack flagella; these structures only appear on male gametes. Although male gametes (microgametes) assemble a typical 9+2 axoneme, the structure of the templating basal body is poorly defined. Moreover, the relationship between asexual stage centrioles and microgamete basal bodies remains unclear. While asexual stages of Plasmodium lack defined centriole structures, the asexual stages of Toxoplasma and closely related coccidian apicomplexans contain centrioles that consist of nine singlet microtubules and a central tubule. There are relatively few ultra-structural images of Toxoplasma microgametes, which only develop in cat intestinal epithelium. Only a subset of these include sections through the basal body: to date, none have unambiguously captured organization of the basal body structure. Moreover, it is unclear whether this basal body is derived from pre-existing asexual stage centrioles or is synthesized de novo. Basal bodies in Plasmodium microgametes are thought to be synthesized de novo, and their assembly remains ill-defined. Apicomplexan genomes harbor genes encoding ?- and ?-tubulin homologs, potentially enabling these parasites to assemble a typical triplet basal body structure. Moreover, the UNIMOD components (SAS6, SAS4/CPAP, and BLD10/CEP135) are conserved in these organisms. However, other widely conserved basal body and flagellar biogenesis elements are missing from apicomplexan genomes. These differences may indicate variations in flagellar biogenesis pathways and in basal body arrangement within the phylum. As apicomplexan basal bodies are distinct from their metazoan counterparts, it may be possible to selectively target parasite structures in order to inhibit microgamete motility which drives generation of genetic diversity in Toxoplasma and transmission for Plasmodium. PMID:26855772

  2. The Calcium Signaling Toolkit of the Apicomplexan Parasites Toxoplasma gondii and Plasmodium spp

    PubMed Central

    Lourido, Sebastian; Moreno, Silvia N.J.


    Apicomplexan parasites have complex life cycles, frequently split between different hosts and reliant on rapid responses as the parasites react to changing environmental conditions. Calcium ion (Ca2+) signaling is consequently essential for the cellular and developmental changes that support apicomplexan parasitism. Apicomplexan genomes reveal a rich repertoire of genes involved in calcium signaling, although many of the genes responsible for observed physiological changes remain unknown. There is evidence, for example, for the presence of a nifedipine-sensitive calcium entry mechanism in Toxoplasma, but the molecular components involved in Ca2+ entry in both Toxoplasma and Plasmodium, have not been identified. The major calcium stores are the endoplasmic reticulum (ER), the acidocalcisomes, and the plant-like vacuole in Toxoplasma, or the food vacuole in Plasmodium spp. Pharmacological evidence suggests that Ca2+ release from intracellular stores may be mediated by inositol 1,4,5-trisphosphate (IP3) or cyclic ADP ribose (cADPR) although there is no molecular evidence for the presence of receptors for these second messengers in the parasites. Several Ca2+-ATPases are present in apicomplexans and a putative mitochondrial Ca2+/H+ exchanger has been identified. Apicomplexan genomes contain numerous genes encoding Ca2+-binding proteins, with the notable expansion of calcium-dependent protein kinases (CDPKs), whose study has revealed novel roles in gliding motility, microneme secretion, host cell invasion and egress, and parasite differentiation. Microneme secretion has also been shown to depend on the C2 domain containing protein DOC2 in both Plasmodium spp. and Toxoplasma, providing further evidence for the complex transduction of Ca2+ signals in these organisms. The characterization of these pathways could lead to the discovery of novel drug targets and to a better understanding of the role of Ca2+ in these parasites. PMID:25605521

  3. Selective inhibition of yeast regulons by daunorubicin: A transcriptome-wide analysis

    PubMed Central

    Rojas, Marta; Casado, Marta; Portugal, Jos; Pia, Benjamin


    Background The antitumor drug daunorubicin exerts some of its cytotoxic effects by binding to DNA and inhibiting the transcription of different genes. We analysed this effect in vivo at the transcriptome level using the budding yeast Saccharomyces cerevisiae as a model and sublethal (IC40) concentrations of the drug to minimise general toxic effects. Results Daunorubicin affected a minor proportion (14%) of the yeast transcriptome, increasing the expression of 195 genes and reducing expression of 280 genes. Daunorubicin down-regulated genes included essentially all genes involved in the glycolytic pathway, the tricarboxylic acid cycle and alcohol metabolism, whereas transcription of ribosomal protein genes was not affected or even slightly increased. This pattern is consistent with a specific inhibition of glucose usage in treated cells, with only minor effects on proliferation or other basic cell functions. Analysis of promoters of down-regulated genes showed that they belong to a limited number of transcriptional regulatory units (regulons). Consistently, data mining showed that daunorubicin-induced changes in expression patterns were similar to those observed in yeast strains deleted for some transcription factors functionally related to the glycolysis and/or the cAMP regulatory pathway, which appeared to be particularly sensitive to daunorubicin. Conclusion The effects of daunorubicin treatment on the yeast transcriptome are consistent with a model in which this drug impairs binding of different transcription factors by competing for their DNA binding sequences, therefore limiting their effectiveness and affecting the corresponding regulatory networks. This proposed mechanism might have broad therapeutic implications against cancer cells growing under hypoxic conditions. PMID:18667070

  4. Effects of Enrichment on Expression of Key Nutrient Regulons in Extremophiles in Hydrothermal Springs at Yellowstone National Park

    NASA Astrophysics Data System (ADS)

    Knowlton, M.; Elser, J. J.; Poret-peterson, A. T.


    To cope with nutrient limitation, micro-organisms have evolved diverse means to increase acquisition of nutrients such as ammonium, nitrate, and phosphate and trace metals when they become limiting. These strategies typically involve production of compound-specific transporters (i.e., ammonium transporters) or extracellular enzymes (i.e., alkaline phosphatase). Genes that encode these proteins are often under the control of shared regulatory proteins called regulons. Regulons of genes for N, P, or Fe metabolism ultimately affect the transport of vital nutrients into and out of cells and thus help organisms deal with nutrient limitation. Regulons for N, P, and Fe have been found and studied ex situ for model organisms under various nutrient-limiting conditions but are relatively unstudied in the field, especially in hydrothermal systems. The aim of this study was to characterize transcription patterns of genes for N, P, and Fe processing under experimental nutrient enrichment in a complex microbial community from an alkaline hot spring located in Yellowstone National Park. Microbial mat samples and hot spring water were placed in bottles, subjected to a fully factorial manipulation of N (125 ?M N as ammonium nitrate), phosphorus (7.8 ?M P as sodium phosphate), and Fe (7.8 x 10-2 ?M Fe as ferric citrate), and incubated overnight at in situ temperatures. Following incubation, hot spring water was filtered and preserved for nutrient analyses and biomass subsamples were snap-frozen for molecular analysis. Chemical analysis showed a total removal of NH4 and PO4 from the water in all treatments. NO3 decreased slightly in most treatments (control, +N, +P, +Fe, +PFe, and +NPFe) but increased in the others (+NFe and +NP). Interestingly, Fe concentrations were lower in amended samples (+Fe, +NFe, +PFe, and +NPFe) than in unamended samples (control, +N, +P, +NP). To assess the transcriptional responses, primers were designed to target genes controlled by the ferric uptake regulator (Fur), phosphate-responsive signal transduction pathway (Pho), and the nitrogen transcriptional regulator TnrA. These genes-glnA, nrgAB, narB, yusV, asnRS, gltA, pstS, tagA, and phoA- have been successfully sequenced in our microbial mat community. Gene expression work is currently underway to determine if transcription of these genes is altered under single nutrient limitation and/or co-limitation, thus reflecting the results seen in the water chemistry data.

  5. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jess; Poza, Margarita; Shingu-Vzquez, Miguel; Corts, Pilar; Boyce, John D.; Adler, Ben; Barb, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  6. Toward the identification and regulation of the Arabidopsis thaliana ABI3 regulon

    PubMed Central

    Mnke, Gudrun; Seifert, Michael; Keilwagen, Jens; Mohr, Michaela; Grosse, Ivo; Hhnel, Urs; Junker, Astrid; Weisshaar, Bernd; Conrad, Udo; Bumlein, Helmut; Altschmied, Lothar


    The plant-specific, B3 domain-containing transcription factor ABSCISIC ACID INSENSITIVE3 (ABI3) is an essential component of the regulatory network controlling the development and maturation of the Arabidopsis thaliana seed. Genome-wide chromatin immunoprecipitation (ChIP-chip), transcriptome analysis, quantitative reverse transcriptasepolymerase chain reaction and a transient promoter activation assay have been combined to identify a set of 98 ABI3 target genes. Most of these presumptive ABI3 targets require the presence of abscisic acid for their activation and are specifically expressed during seed maturation. ABI3 target promoters are enriched for G-box-like and RY-like elements. The general occurrence of these cis motifs in non-ABI3 target promoters suggests the existence of as yet unidentified regulatory signals, some of which may be associated with epigenetic control. Several members of the ABI3 regulon are also regulated by other transcription factors, including the seed-specific, B3 domain-containing FUS3 and LEC2. The data strengthen and extend the notion that ABI3 is essential for the protection of embryonic structures from desiccation and raise pertinent questions regarding the specificity of promoter recognition. PMID:22730287

  7. Identification of the alternative sigma factor SigX regulon and its implications for Pseudomonas aeruginosa pathogenicity.


    Blanka, Andrea; Schulz, Sebastian; Eckweiler, Denitsa; Franke, Raimo; Bielecka, Agata; Nicolai, Tanja; Casilag, Fiordiligie; Düvel, Juliane; Abraham, Wolf-Rainer; Kaever, Volkhard; Häussler, Susanne


    Pseudomonas aeruginosa is distinguished by its broad metabolic diversity and its remarkable capability for adaptation, which relies on a large collection of transcriptional regulators and alternative sigma (σ) factors. The largest group of alternative σ factors is that of the extracytoplasmic function (ECF) σ factors, which control key transduction pathways for maintenance of envelope homeostasis in response to external stress and cell growth. In addition, there are specific roles of alternative σ factors in regulating the expression of virulence and virulence-associated genes. Here, we analyzed a deletion mutant of the ECF σ factor SigX and applied mRNA profiling to define the SigX-dependent regulon in P. aeruginosa in response to low-osmolarity-medium conditions. Furthermore, the combination of transcriptional data with chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) led to the identification of the DNA binding motif of SigX. Genome-wide mapping of SigX-binding regions revealed enrichment of downstream genes involved in fatty acid biosynthesis, type III secretion, swarming and cyclic di-GMP (c-di-GMP) signaling. In accordance, a sigX deletion mutant exhibited altered fatty acid composition of the cell membrane, reduced cytotoxicity, impaired swarming activity, elevated c-di-GMP levels, and increased biofilm formation. In conclusion, a combination of ChIP-seq with transcriptional profiling and bioinformatic approaches to define consensus DNA binding sequences proved to be effective for the elucidation of the regulon of the alternative σ factor SigX, revealing its role in complex virulence-associated phenotypes in P. aeruginosa. PMID:24187091

  8. Identification of the Alternative Sigma Factor SigX Regulon and Its Implications for Pseudomonas aeruginosa Pathogenicity

    PubMed Central

    Blanka, Andrea; Schulz, Sebastian; Eckweiler, Denitsa; Franke, Raimo; Bielecka, Agata; Nicolai, Tanja; Casilag, Fiordiligie; Düvel, Juliane; Abraham, Wolf-Rainer; Kaever, Volkhard


    Pseudomonas aeruginosa is distinguished by its broad metabolic diversity and its remarkable capability for adaptation, which relies on a large collection of transcriptional regulators and alternative sigma (σ) factors. The largest group of alternative σ factors is that of the extracytoplasmic function (ECF) σ factors, which control key transduction pathways for maintenance of envelope homeostasis in response to external stress and cell growth. In addition, there are specific roles of alternative σ factors in regulating the expression of virulence and virulence-associated genes. Here, we analyzed a deletion mutant of the ECF σ factor SigX and applied mRNA profiling to define the SigX-dependent regulon in P. aeruginosa in response to low-osmolarity-medium conditions. Furthermore, the combination of transcriptional data with chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) led to the identification of the DNA binding motif of SigX. Genome-wide mapping of SigX-binding regions revealed enrichment of downstream genes involved in fatty acid biosynthesis, type III secretion, swarming and cyclic di-GMP (c-di-GMP) signaling. In accordance, a sigX deletion mutant exhibited altered fatty acid composition of the cell membrane, reduced cytotoxicity, impaired swarming activity, elevated c-di-GMP levels, and increased biofilm formation. In conclusion, a combination of ChIP-seq with transcriptional profiling and bioinformatic approaches to define consensus DNA binding sequences proved to be effective for the elucidation of the regulon of the alternative σ factor SigX, revealing its role in complex virulence-associated phenotypes in P. aeruginosa. PMID:24187091

  9. Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium

    SciTech Connect

    Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond


    Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

  10. ApiDB: integrated resources for the apicomplexan bioinformatics resource center

    PubMed Central

    Aurrecoechea, Cristina; Heiges, Mark; Wang, Haiming; Wang, Zhiming; Fischer, Steve; Rhodes, Philippa; Miller, John; Kraemer, Eileen; Stoeckert, Christian J.; Roos, David S.; Kissinger, Jessica C.


    ApiDB () represents a unified entry point for the NIH-funded Apicomplexan Bioinformatics Resource Center (BRC) that integrates numerous database resources and multiple data types. The phylum Apicomplexa comprises numerous veterinary and medically important parasitic protozoa including human pathogenic species of the genera Cryptosporidium, Plasmodium and Toxoplasma. ApiDB serves not only as a database in its own right, but as a single web-based point of entry that unifies access to three major existing individual organism databases (, and, and integrates these databases with data available from additional sources. Through the ApiDB site, users may pose queries and search all available apicomplexan data and tools, or they may visit individual component organism databases. PMID:17098930

  11. Protein-targeting determinants in the secretory pathway of apicomplexan parasites.


    Kaasch, A J; Joiner, K A


    Apicomplexan parasites possess a highly specialized secretory apparatus. The timed secretion of proteins from three different organelles--micronemes, rhoptries and dense granules--serves to establish and maintain a parasitophorous vacuole inside the host cell in which the parasites can divide. Recent efforts have identified components that sort apicomplexan proteins to these unusual secretory organelles and have shown that this machinery is evolutionarily conserved across species. Concise amino acid sequences (e.g. tyrosine-based motifs) within the targeted protein determine their destination in Apicomplexa in a way similar to mammalian cells. Additionally, the parasite exploits new or unusual mechanisms of protein targeting (e.g. post-secretory membrane insertion). PMID:10972505

  12. Antigen Presentation of Vacuolated Apicomplexans - Two Gateways to a Vaccine Antigen.


    Jensen, Kirk D C


    For parasites that sequester themselves within a vacuole, new rules governing antigen presentation are coming into focus. Components of the host's autophagy machinery and the parasite's membranous nanotubular network within the parasitophorous vacuole play a major role in determining antigenicity of Toxoplasma proteins. As such, both parasite and vaccinologist may exploit these pathways to regulate the ever important CD8 T cell response to apicomplexan parasites. PMID:26733404

  13. Genetic Mapping Identifies Novel Highly Protective Antigens for an Apicomplexan Parasite

    PubMed Central

    Blake, Damer P.; Billington, Karen J.; Copestake, Susan L.; Oakes, Richard D.; Quail, Michael A.; Wan, Kiew-Lian; Shirley, Martin W.; Smith, Adrian L.


    Apicomplexan parasites are responsible for a myriad of diseases in humans and livestock; yet despite intensive effort, development of effective sub-unit vaccines remains a long-term goal. Antigenic complexity and our inability to identify protective antigens from the pool that induce response are serious challenges in the development of new vaccines. Using a combination of parasite genetics and selective barriers with population-based genetic fingerprinting, we have identified that immunity against the most important apicomplexan parasite of livestock (Eimeria spp.) was targeted against a few discrete regions of the genome. Herein we report the identification of six genomic regions and, within two of those loci, the identification of true protective antigens that confer immunity as sub-unit vaccines. The first of these is an Eimeria maxima homologue of apical membrane antigen-1 (AMA-1) and the second is a previously uncharacterised gene that we have termed ‘immune mapped protein-1’ (IMP-1). Significantly, homologues of the AMA-1 antigen are protective with a range of apicomplexan parasites including Plasmodium spp., which suggest that there may be some characteristic(s) of protective antigens shared across this diverse group of parasites. Interestingly, homologues of the IMP-1 antigen, which is protective against E. maxima infection, can be identified in Toxoplasma gondii and Neospora caninum. Overall, this study documents the discovery of novel protective antigens using a population-based genetic mapping approach allied with a protection-based screen of candidate genes. The identification of AMA-1 and IMP-1 represents a substantial step towards development of an effective anti-eimerian sub-unit vaccine and raises the possibility of identification of novel antigens for other apicomplexan parasites. Moreover, validation of the parasite genetics approach to identify effective antigens supports its adoption in other parasite systems where legitimate protective antigen identification is difficult. PMID:21347348

  14. Is an Apicomplexan Parasite Responsible for the Collapse of the Iceland Scallop (Chlamys islandica) Stock?

    PubMed Central

    Kristmundsson, Árni; Erlingsdóttir, Ásthildur; Freeman, Mark A.


    Due to the total and unexpected collapse of the Iceland scallop, Chlamys islandica, stocks around Iceland during the 2000s, a commercial fishing ban has been imposed on this valuable resource since 2003. Following the initial identification of an apicomplexan parasite in the scallops, a long-term surveillance program was established to evaluate the effect of the parasite on the population. The infections were highly prevalent in all shell sizes throughout the study. However, the parasite only impacts mature scallops where they cause severe macroscopic changes, characterized by an extensively diminished and abnormally coloured adductor muscle. A highly significant relationship was observed between infection intensity and gonad and adductor muscle indices. The first four years of the study, were characterized by high infection intensity and very poor condition of the adductor muscle and gonads, whilst during subsequent years, infections gradually decreased and the condition of the scallops improved. Histopathological changes were restricted to the presence of apicomplexan zoites which were widely distributed, causing varying degrees of pathology in all organs. In heavy infections, muscular and connective tissues were totally necrotized, destroying significant parts of numerous organs, especially the adductor muscle, digestive gland and gonads. The progression of the disease was in good synchrony with the mortality rates and the subsequent decline observed in the scallop stock and recruitment indices. Our findings strongly suggest that the apicomplexan parasite played a major role in the collapse of the Iceland scallop stock in Breidafjordur. In addition to causing mortality, the infections significantly impact gonad development which contributes further to the collapse of the stock in the form of lower larval recruitment. Furthermore, compelling evidence exists that this apicomplexan pathogen is causing serious disease outbreaks in other scallop populations. Similar abnormal adductor muscles and the parasite itself have been identified or observed in association with other mass mortality events in several different scallop species and commercial stocks in the northern hemisphere. PMID:26684810

  15. Two recently sequenced vertebrate genomes are contaminated with apicomplexan species of the Sarcocystidae family.


    Orosz, Ferenc


    This paper highlights a general problem, namely that host genome sequences can easily be contaminated with parasite sequences, thus careful isolation of genetic material and careful bioinformatics analysis are needed in all cases. Two recently published genomes are shown here to be contaminated with sequences of apicomplexan parasites which belong to the Sarcocystidae family. Sequences of the characteristic apicomplexan organelle, the apicoplast, were used as queries in BLASTN searches against nucleotide sequences of various animal groups looking for possible contamination. Draft genomes of a bird, Colinus virginianus (Halley et al., 2014), and a bat, Myotis davidii (Zhang et al., 2013) were found to contain at least six and 17 contigs, respectively, originating from the apicoplast of an apicomplexan species, and other genes specific to this phylum can also be found in the published genomes. Obviously, the sources of the genetic material, the muscle and the kidney of the animals, respectively, contained the parasitic cysts. Phylogenetic analyses using 18S rRNA and internal transcribed spacer 1 genes show that the parasite contaminating C. virginianus is a species of Sarcocystis related to ones known to cycle between avian and mammalian hosts. In the case of M. davidii it belongs to the Nephroisospora genus, the only member of which, Nephroisospora eptesici, has been recently identified from the kidney of big brown bats (Eptesicus fuscus). PMID:26264549

  16. Comparative Analysis of Apicoplast-Targeted Protein Extension Lengths in Apicomplexan Parasites

    PubMed Central

    Seliverstov, Alexandr V.; Zverkov, Oleg A.; Istomina, Svetlana N.; Pirogov, Sergey A.; Kitsis, Philip S.


    In general, the mechanism of protein translocation through the apicoplast membrane requires a specific extension of a functionally important region of the apicoplast-targeted proteins. The corresponding signal peptides were detected in many apicomplexans but not in the majority of apicoplast-targeted proteins in Toxoplasma gondii. In T. gondii signal peptides are either much diverged or their extension region is processed, which in either case makes the situation different from other studied apicomplexans. We propose a statistic method to compare extensions of the functionally important regions of apicoplast-targeted proteins. More specifically, we provide a comparison of extension lengths of orthologous apicoplast-targeted proteins in apicomplexan parasites. We focus on results obtained for the model species T. gondii, Neospora caninum, and Plasmodium falciparum. With our method, cross species comparisons demonstrate that, in average, apicoplast-targeted protein extensions in T. gondii are 1.5-fold longer than in N. caninum and 2-fold longer than in P. falciparum. Extensions in P. falciparum less than 87 residues in size are longer than the corresponding extensions in N. caninum and, reversely, are shorter if they exceed 88 residues. PMID:26114107

  17. Characterization and analysis of the Burkholderia pseudomallei BsaN virulence regulon

    PubMed Central


    Background Burkholderia pseudomallei is a facultative intracellular pathogen and the causative agent of melioidosis. A conserved type III secretion system (T3SS3) and type VI secretion system (T6SS1) are critical for intracellular survival and growth. The T3SS3 and T6SS1 genes are coordinately and hierarchically regulated by a TetR-type regulator, BspR. A central transcriptional regulator of the BspR regulatory cascade, BsaN, activates a subset of T3SS3 and T6SS1 loci. Results To elucidate the scope of the BsaN regulon, we used RNAseq analysis to compare the transcriptomes of wild-type B. pseudomallei KHW and a bsaN deletion mutant. The 60 genes positively-regulated by BsaN include those that we had previously identified in addition to a polyketide biosynthesis locus and genes involved in amino acid biosynthesis. BsaN was also found to repress the transcription of 51 genes including flagellar motility loci and those encoding components of the T3SS3 apparatus. Using a promoter-lacZ fusion assay in E. coli, we show that BsaN together with the chaperone BicA directly control the expression of the T3SS3 translocon, effector and associated regulatory genes that are organized into at least five operons (BPSS1516-BPSS1552). Using a mutagenesis approach, a consensus regulatory motif in the promoter regions of BsaN-regulated genes was shown to be essential for transcriptional activation. Conclusions BsaN/BicA functions as a central regulator of key virulence clusters in B. pseudomallei within a more extensive network of genetic regulation. We propose that BsaN/BicA controls a gene expression program that facilitates the adaption and intracellular survival of the pathogen within eukaryotic hosts. PMID:25085508

  18. Identification of the sigmaE regulon of Salmonella enterica serovar Typhimurium.


    Skovierova, Henrieta; Rowley, Gary; Rezuchova, Bronislava; Homerova, Dagmar; Lewis, Claire; Roberts, Mark; Kormanec, Jan


    The extracytoplasmic function sigma factor, sigma(E), has been shown to play a critical role in virulence of Salmonella enterica serovar Typhimurium (S. Typhimurium). The previously optimized two-plasmid system has been used to identify S. Typhimurium promoters recognized by RNA polymerase containing sigma(E). This method allowed identification of 34 sigma(E)-dependent promoters that direct expression of 62 genes in S. Typhimurium, 23 of which (including several specific for S. Typhimurium) have not been identified previously to be dependent upon sigma(E) in Escherichia coli. The promoters were confirmed in S. Typhimurium and transcriptional start points of the promoters were determined by S1-nuclease mapping. All the promoters contained sequences highly similar to the consensus sequence of sigma(E)-dependent promoters. The identified genes belonging to the S. Typhimurium sigma(E)-regulon encode proteins involved in primary metabolism, DNA repair systems and outer-membrane biogenesis, and regulatory proteins, periplasmic proteases and folding factors, proposed lipoproteins, and inner- and outer-membrane proteins with unknown functions. Several of these sigma(E)-dependent genes have been shown to play a role in virulence of S. Typhimurium. PMID:16622052

  19. The Rip1 Protease of Mycobacterium tuberculosis Controls the SigD Regulon

    PubMed Central

    Schneider, Jessica S.; Sklar, Joseph G.


    Regulated intramembrane proteolysis of membrane-embedded substrates by site-2 proteases (S2Ps) is a widespread mechanism of transmembrane signal transduction in bacteria and bacterial pathogens. We previously demonstrated that the Mycobacterium tuberculosis S2P Rip1 is required for full virulence in the mouse model of infection. Rip1 controls transcription in part through proteolysis of three transmembrane anti-sigma factors, anti-SigK, -L, and -M, but there are also Rip1-dependent, SigKLM-independent pathways. To determine the contribution of the sigma factors K, L, and M to the ?rip1 attenuation phenotype, we constructed an M. tuberculosis ?sigK? sigL ?sigM mutant and found that this strain fails to recapitulate the marked attenuation of ?rip1 in mice. In a search for additional pathways controlled by Rip1, we demonstrated that the SigD regulon is positively regulated by the Rip1 pathway. Rip1 cleavage of transmembrane anti-SigD is required for expression of SigD target genes. In the absence of Rip1, proteolytic maturation of RsdA is impaired. These findings identify RsdA/SigD as a fourth arm of the branched pathway controlled by Rip1 in M. tuberculosis. PMID:24816608

  20. Overlapping Alternative Sigma Factor Regulons in the Response to Singlet Oxygen in Rhodobacter sphaeroides?

    PubMed Central

    Nuss, Aaron M.; Glaeser, Jens; Berghoff, Bork A.; Klug, Gabriele


    Organisms performing photosynthesis in the presence of oxygen have to cope with the formation of highly reactive singlet oxygen (1O2) and need to mount an adaptive response to photooxidative stress. Here we show that the alternative sigma factors RpoHI and RpoHII are both involved in the 1O2 response and in the heat stress response in Rhodobacter sphaeroides. We propose RpoHII to be the major player in the 1O2 response, whereas RpoHI is more important for the heat stress response. Mapping of the 5? ends of RpoHII- and also RpoHI/RpoHII-dependent transcripts revealed clear differences in the ?10 regions of the putative promoter sequences. By using bioinformatic tools, we extended the RpoHII regulon, which includes genes induced by 1O2 exposure. These genes encode proteins which are, e.g., involved in methionine sulfoxide reduction and in maintaining the quinone pool. Furthermore, we identified small RNAs which depend on RpoHI and RpoHII and are likely to contribute to the defense against photooxidative stress and heat stress. PMID:20304993

  1. Global Transcriptional Response of Bacillus subtilis to Heat Shock

    PubMed Central

    Helmann, John D.; Wu, Ming Fang Winston; Kobel, Phil A.; Gamo, Francisco-Javier; Wilson, Michael; Morshedi, Maud M.; Navre, Marc; Paddon, Chris


    In response to heat stress, Bacillus subtilis activates the transcription of well over 100 different genes. Many of these genes are members of a general stress response regulon controlled by the secondary sigma factor, ςB, while others are under control of the HrcA or CtsR heat shock regulators. We have used DNA microarrays to monitor the global transcriptional response to heat shock. We find strong induction of known ςB-dependent genes with a characteristic rapid induction followed by a return to near prestimulus levels. The HrcA and CtsR regulons are also induced, but with somewhat slower kinetics. Analysis of DNA sequences proximal to newly identified heat-induced genes leads us to propose ∼70 additional members of the ςB regulon. We have also identified numerous heat-induced genes that are not members of known heat shock regulons. Notably, we observe very strong induction of arginine biosynthesis and transport operons. Induction of several genes was confirmed by quantitative reverse transcriptase PCR. In addition, the transcriptional responses measured by microarray hybridization compare favorably with the numerous previous studies of heat shock in this organism. Since many different conditions elicit both specific and general stress responses, knowledge of the heat-induced general stress response reported here will be helpful for interpreting future microarray studies of other stress responses. PMID:11717291

  2. Differences in LexA regulon structure among Proteobacteria through in vivo assisted comparative genomics

    PubMed Central

    Erill, Ivan; Jara, Mnica; Salvador, Noelia; Escribano, Marcos; Campoy, Susana; Barb, Jordi


    The LexA regulon encompasses an ensemble of genes involved in preserving cell viability under massive DNA damage and is present in most bacterial phyla. Up to date, however, the scope of this network had only been assessed in the Gamma Proteobacteria. Here, we report the structure of the LexA regulon in the Alpha Proteobacteria, using a combined approach that makes use of in vitro and in vivo techniques to assist and validate the comparative genomics in silico methodology. This leads to the first experimentally validated description of the LexA regulon in the Alpha Proteobacteria, and comparison of regulon core structures in both classes suggests that a least common multiple set of genes (recA, ssb, uvrA and ruvCAB) might be a defining property of the Proteobacteria LexA network. PMID:15604457

  3. Involvement of AtoSC two-component system in Escherichia coli flagellar regulon.


    Theodorou, Marina C; Theodorou, Evaggelos C; Kyriakidis, Dimitrios A


    The AtoSC two-component system in Escherichia coli is a key regulator of many physiological processes. We report here the contribution of AtoSC in E. coli motility and chemotaxis. AtoSC locus deletion in ?atoSC cells renders cells not motile or responsive against any chemoattractant or repellent independently of the AtoSC inducer's presence. AtoSC expression through plasmid complemented the ?atoSC phenotype. Cells expressing either AtoS or AtoC demonstrated analogous motility and chemotactic phenotypes as ?atoSC cells, independently of AtoSC inducer's presence. Mutations of AtoC phosphate-acceptor sites diminished or abrogated E. coli chemotaxis. trAtoC, the AtoC constitutive active form which lacks its receiver domain, up-regulated E. coli motility. AtoSC enhanced the transcription of the flhDC and fliAZY operons and to a lesser extent of the flgBCDEFGHIJKL operon. The AtoSC-mediated regulation of motility and chemotactic response required also the expression of the CheAY system. The AtoSC inducers enhanced the AtoSC-mediated motility and chemotaxis. Acetoacetate or spermidine further promoted the responses of only AtoSC-expressing cells, while Ca(2+) demonstrated its effects independently of AtoSC. Histamine regulated bacterial chemotaxis only in atoSC (+) cells in a concentration-dependent manner while reversed the AtoSC-mediated effects when added at high concentrations. The trAtoC-controlled motility effects were enhanced by acetoacetate or spermidine, but not by histamine. These data reveal that AtoSC system regulates the motility and chemotaxis of E. coli, participating in the transcriptional induction of the main promoters of the chemotactic regulon and modifying the motility and chemotactic phenotypes in an induction-dependent mechanism. PMID:22083893

  4. Genome-Wide Analysis of the Salmonella Fis Regulon and Its Regulatory Mechanism on Pathogenicity Islands

    PubMed Central

    Wang, Quan; Wang, Lei


    Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica. PMID:23717649

  5. Non-canonical CRP sites control competence regulons in Escherichia coli and many other ?-proteobacteria

    PubMed Central

    Cameron, Andrew D. S.; Redfield, Rosemary J.


    Escherichia coli's cAMP receptor protein (CRP), the archetypal bacterial transcription factor, regulates over a hundred promoters by binding 22 bp symmetrical sites with the consensus core half-site TGTGA. However, Haemophilus influenzae has two types of CRP sites, one like E.coli's and one with the core sequence TGCGA that regulates genes required for DNA uptake (natural competence). Only the latter CRP-S sites require both CRP and the coregulator Sxy for activation. To our knowledge, the TGTGA and TGCGA motifs are the first example of one transcription factor having two distinct binding-site motifs. Here we show that CRP-S promoters are widespread in the ?-proteobacteria and demonstrate their Sxy-dependence in E.coli. Orthologs of most H.influenzae CRP-S-regulated genes are ubiquitous in the five best-studied ?-proteobacteria families, Enterobacteriaceae, Pasteurellaceae, Pseudomonadaceae, Vibrionaceae and Xanthomonadaceae. Phylogenetic footprinting identified CRP-S sites in the promoter regions of the Enterobacteriaceae, Pasteurellaceae and Vibrionaceae orthologs, and canonical CRP sites in orthologs of genes known to be Sxy-independent in H.influenzae. Bandshift experiments confirmed that E.coli CRP-S sequences are low affinity binding sites for CRP, and mRNA analysis showed that they require CRP, cAMP (CRP's allosteric effector) and Sxy for gene induction. This work suggests not only that the ?-proteobacteria share a common DNA uptake mechanism, but also that, in the three best studied families, their competence regulons share both CRP-S specificity and Sxy dependence. PMID:17068078

  6. Genome-wide analysis of the salmonella Fis regulon and its regulatory mechanism on pathogenicity islands.


    Wang, Hui; Liu, Bin; Wang, Quan; Wang, Lei


    Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica. PMID:23717649

  7. Temporal transcriptomic analysis of the Listeria monocytogenes EGD-e σB regulon

    PubMed Central

    Hain, Torsten; Hossain, Hamid; Chatterjee, Som S; Machata, Silke; Volk, Ute; Wagner, Sandra; Brors, Benedikt; Haas, Stefan; Kuenne, Carsten T; Billion, Andre; Otten, Sonja; Pane-Farre, Jan; Engelmann, Susanne; Chakraborty, Trinad


    Background The opportunistic food-borne gram-positive pathogen Listeria monocytogenes can exist as a free-living microorganism in the environment and grow in the cytoplasm of vertebrate and invertebrate cells following infection. The general stress response, controlled by the alternative sigma factor, σB, has an important role for bacterial survival both in the environment and during infection. We used quantitative real-time PCR analysis and immuno-blot analysis to examine σB expression during growth of L. monocytogenes EGD-e. Whole genome-based transcriptional profiling was used to identify σB-dependent genes at different growth phases. Results We detected 105 σB-positively regulated genes and 111 genes which appeared to be under negative control of σB and validated 36 σB-positively regulated genes in vivo using a reporter gene fusion system. Conclusion Genes comprising the σB regulon encode solute transporters, novel cell-wall proteins, universal stress proteins, transcriptional regulators and include those involved in osmoregulation, carbon metabolism, ribosome- and envelope-function, as well as virulence and niche-specific survival genes such as those involved in bile resistance and exclusion. Ten of the σB-positively regulated genes of L. monocytogenes are absent in L. innocua. A total of 75 σB-positively regulated listerial genes had homologs in B. subtilis, but only 33 have been previously described as being σB-regulated in B. subtilis even though both species share a highly conserved σB-dependent consensus sequence. A low overlap of genes may reflects adaptation of these bacteria to their respective environmental conditions. PMID:18226246

  8. RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach

    SciTech Connect

    Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna


    RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at

  9. Global Analysis of the HrpL Regulon in the Plant Pathogen Pseudomonas syringae pv. tomato DC3000 Reveals New Regulon Members with Diverse Functions

    PubMed Central

    Lam, Hanh N.; Chakravarthy, Suma; Wei, Hai-Lei; BuiNguyen, HoangChuong; Stodghill, Paul V.; Collmer, Alan; Swingle, Bryan M.; Cartinhour, Samuel W.


    The type III secretion system (T3SS) is required for virulence in the gram-negative plant pathogen Pseudomonas syringae pv. tomato DC3000. The alternative sigma factor HrpL directly regulates expression of T3SS genes via a promoter sequence, often designated as the hrp promoter. Although the HrpL regulon has been extensively investigated in DC3000, it is not known whether additional regulon members remain to be found. To systematically search for HrpL-regulated genes, we used chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-Seq) and bulk mRNA sequencing (RNA-Seq) to identify HrpL-binding sites and likely hrp promoters. The analysis recovered 73 sites of interest, including 20 sites that represent new hrp promoters. The new promoters lie upstream of a diverse set of genes encoding potential regulators, enzymes and hypothetical proteins. PSPTO_5633 is the only new HrpL regulon member that is potentially an effector and is now designated HopBM1. Deletions in several other new regulon members, including PSPTO_5633, PSPTO_0371, PSPTO_2130, PSPTO_2691, PSPTO_2696, PSPTO_3331, and PSPTO_5240, in either DC3000 or ?hopQ1-1 backgrounds, do not affect the hypersensitive response or in planta growth of the resulting strains. Many new HrpL regulon members appear to be unrelated to the T3SS, and orthologs for some of these can be identified in numerous non-pathogenic bacteria. With the identification of 20 new hrp promoters, the list of HrpL regulon members is approaching saturation and most likely includes all DC3000 effectors. PMID:25170934

  10. Regulon and promoter analysis of the E. coli heat-shock factor, σ32, reveals a multifaceted cellular response to heat stress

    PubMed Central

    Nonaka, Gen; Blankschien, Matthew; Herman, Christophe; Gross, Carol A.; Rhodius, Virgil A.


    The heat-shock response (HSR), a universal cellular response to heat, is crucial for cellular adaptation. In Escherichia coli, the HSR is mediated by the alternative σ factor, σ32. To determine its role, we used genome-wide expression analysis and promoter validation to identify genes directly regulated by σ32 and screened ORF overexpression libraries to identify σ32 inducers. We triple the number of genes validated to be transcribed by σ32 and provide new insights into the cellular role of this response. Our work indicates that the response is propagated as the regulon encodes numerous global transcriptional regulators, reveals that σ70 holoenzyme initiates from 12% of σ32 promoters, which has important implications for global transcriptional wiring, and identifies a new role for the response in protein homeostasis, that of protecting complex proteins. Finally, this study suggests that the response protects the cell membrane and responds to its status: Fully 25% of σ32 regulon members reside in the membrane and alter its functionality; moreover, a disproportionate fraction of overexpressed proteins that induce the response are membrane localized. The intimate connection of the response to the membrane rationalizes why a major regulator of the response resides in that cellular compartment. PMID:16818608

  11. Exposure of Bacillus subtilis to Low Pressure (5 Kilopascals) Induces Several Global Regulons, Including Those Involved in the SigB-Mediated General Stress Response

    PubMed Central

    Waters, Samantha M.; Robles-Martnez, Jos A.


    Studies of how microorganisms respond to pressure have been limited mostly to the extreme high pressures of the deep sea (i.e., the piezosphere). In contrast, despite the fact that the growth of most bacteria is inhibited at pressures below ?2.5 kPa, little is known of microbial responses to low pressure (LP). To study the global LP response, we performed transcription microarrays on Bacillus subtilis cells grown under normal atmospheric pressure (?101 kPa) and a nearly inhibitory LP (5 kPa), equivalent to the pressure found at an altitude of ?20 km. Microarray analysis revealed altered levels of 363 transcripts belonging to several global regulons (AbrB, CcpA, CodY, Fur, IolR, ResD, Rok, SigH, Spo0A). Notably, the highest number of upregulated genes, 86, belonged to the SigB-mediated general stress response (GSR) regulon. Upregulation of the GSR by LP was confirmed by monitoring the expression of the SigB-dependent ctc-lacZ reporter fusion. Measuring transcriptome changes resulting from exposure of bacterial cells to LP reveals insights into cellular processes that may respond to LP exposure. PMID:24878601

  12. The Fur regulon in anaerobically grown Salmonella enterica sv. Typhimurium: identification of new Fur targets

    PubMed Central


    Background The Ferric uptake regulator (Fur) is a transcriptional regulator that controls iron homeostasis in bacteria. Although the regulatory role of Fur in Escherichia coli is well characterized, most of the studies were conducted under routine culture conditions, i.e., in ambient oxygen concentration. To reveal potentially novel aspects of the Fur regulon in Salmonella enterica serovar Typhimurium under oxygen conditions similar to that encountered in the host, we compared the transcriptional profiles of the virulent wild-type strain (ATCC 14028s) and its isogenic Δfur strain under anaerobic conditions. Results Microarray analysis of anaerobically grown Δfur S. Typhimurium identified 298 differentially expressed genes. Expression of several genes controlled by Fnr and NsrR appeared to be also dependent on Fur. Furthermore, Fur was required for the activity of the cytoplasmic superoxide disumutases (MnSOD and FeSOD). The regulation of FeSOD gene, sodB, occurred via small RNAs (i.e., the ryhB homologs, rfrA and rfrB) with the aid of the RNA chaperone Hfq. The transcription of sodA was increased in Δfur; however, the enzyme was inactive due to the incorporation of iron instead of manganese in SodA. Additionally, in Δfur, the expression of the gene coding for the ferritin-like protein (ftnB) was down-regulated, while the transcription of the gene coding for the nitric oxide (NO·) detoxifying flavohemoglobin (hmpA) was up-regulated. The promoters of ftnB and hmpA do not contain recognized Fur binding motifs, which indicated their probable indirect regulation by Fur. However, Fur activation of ftnB was independent of Fnr. In addition, the expression of the gene coding for the histone-like protein, H-NS (hns) was increased in Δfur. This may explain the observed down-regulation of the tdc operon, responsible for the anaerobic degradation of threonine, and ftnB in Δfur. Conclusions This study determined that Fur is a positive factor in ftnB regulation, while serving to repress the expression of hmpA. Furthermore, Fur is required for the proper expression and activation of the antioxidant enzymes, FeSOD and MnSOD. Finally, this work identified twenty-six new targets of Fur regulation, and demonstrates that H-NS repressed genes are down-regulated in Δfur. PMID:22017966

  13. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria


    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.


    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less

  14. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    SciTech Connect

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.


    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.

  15. Comparative Genomics of Transcriptional Regulation of Methionine Metabolism in Proteobacteria

    PubMed Central

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.


    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ∼200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria. PMID:25411846

  16. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus

    PubMed Central

    Khoroshkin, Matvei S.; Leyn, Semen A.; Van Sinderen, Douwe; Rodionov, Dmitry A.


    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics. PMID:26903998

  17. A Conserved Apicomplexan Microneme Protein Contributes to Toxoplasma gondii Invasion and Virulence

    PubMed Central

    Huynh, My-Hang; Boulanger, Martin J.


    The obligate intracellular parasite Toxoplasma gondii critically relies on host cell invasion during infection. Proteins secreted from the apical micronemes are central components for host cell recognition, invasion, egress, and virulence. Although previous work established that the sporozoite protein with an altered thrombospondin repeat (SPATR) is a micronemal protein conserved in other apicomplexan parasites, including Plasmodium, Neospora, and Eimeria, no genetic evidence of its contribution to invasion has been reported. SPATR contains a predicted epidermal growth factor domain and two thrombospondin type 1 repeats, implying a role in host cell recognition. In this study, we assess the contribution of T. gondii SPATR (TgSPATR) to T. gondii invasion by genetically ablating it and restoring its expression by genetic complementation. ?spatr parasites were ?50% reduced in invasion compared to parental strains, a defect that was reversed in the complemented strain. In mouse virulence assays, ?spatr parasites were significantly attenuated, with ?20% of mice surviving infection. Given the conservation of this protein among the Apicomplexa, we assessed whether the Plasmodium falciparum SPATR ortholog (PfSPATR) could complement the absence of the TgSPATR. Although PfSPATR showed correct micronemal localization, it did not reverse the invasion deficiency of ?spatr parasites, because of an apparent failure in secretion. Overall, the results suggest that TgSPATR contributes to invasion and virulence, findings that have implications for the many genera and life stages of apicomplexans that express SPATR. PMID:25092910

  18. An atomic-resolution view of neofunctionalization in the evolution of apicomplexan lactate dehydrogenases

    PubMed Central

    Boucher, Jeffrey I; Jacobowitz, Joseph R; Beckett, Brian C; Classen, Scott; Theobald, Douglas L


    Malate and lactate dehydrogenases (MDH and LDH) are homologous, core metabolic enzymes that share a fold and catalytic mechanism yet possess strict specificity for their substrates. In the Apicomplexa, convergent evolution of an unusual LDH from MDH produced a difference in specificity exceeding 12 orders of magnitude. The mechanisms responsible for this extraordinary functional shift are currently unknown. Using ancestral protein resurrection, we find that specificity evolved in apicomplexan LDHs by classic neofunctionalization characterized by long-range epistasis, a promiscuous intermediate, and few gain-of-function mutations of large effect. In canonical MDHs and LDHs, a single residue in the active-site loop governs substrate specificity: Arg102 in MDHs and Gln102 in LDHs. During the evolution of the apicomplexan LDH, however, specificity switched via an insertion that shifted the position and identity of this ‘specificity residue’ to Trp107f. Residues far from the active site also determine specificity, as shown by the crystal structures of three ancestral proteins bracketing the key duplication event. This work provides an unprecedented atomic-resolution view of evolutionary trajectories creating a nascent enzymatic function. DOI: PMID:24966208

  19. Shared elements of host-targeting pathways among apicomplexan parasites of differing lifestyles.


    Pell, Karell G; Jiang, Rays H Y; Mantel, Pierre-Yves; Xiao, Yu-Ping; Hjelmqvist, Daisy; Gallego-Lopez, Gina M; O T Lau, Audrey; Kang, Byung-Ho; Allred, David R; Marti, Matthias


    Apicomplexans are a diverse group of obligate parasites occupying different intracellular niches that require modification to meet the needs of the parasite. To efficiently manipulate their environment, apicomplexans translocate numerous parasite proteins into the host cell. Whereas some parasites remain contained within a parasitophorous vacuole membrane (PVM) throughout their developmental cycle, others do not, a difference that affects the machinery needed for protein export. A signal-mediated pathway for protein export into the host cell has been characterized in Plasmodium parasites, which maintain the PVM. Here, we functionally demonstrate an analogous host-targeting pathway involving organellar staging prior to secretion in the related bovine parasite, Babesia bovis, a parasite that destroys the PVM shortly after invasion. Taking into account recent identification of a similar signal-mediated pathway in the coccidian parasite Toxoplasma gondii, we suggest a model in which this conserved pathway has evolved in multiple steps from signal-mediated trafficking to specific secretory organelles for controlled secretion to a complex protein translocation process across the PVM. PMID:25996544

  20. The ins and outs of nuclear trafficking: unusual aspects in apicomplexan parasites.


    Frankel, Matthew B; Knoll, Laura J


    Apicomplexa is a phylum within the kingdom Protista that contains some of the most significant threats to public health. One of the members of this phylum, Toxoplasma gondii, is amenable to molecular genetic analyses allowing for the identification of factors critical for colonization and disease. A pathway found to be important for T. gondii pathogenesis is the Ran network of nuclear trafficking. Bioinformatics analysis of apicomplexan genomes shows that while Ran is well conserved, the key regulators of Ran--Regulator of Chromosome Condensation 1 and Ran GTPase activating protein--are either highly divergent or absent. Likewise, several import and export receptor molecules that are crucial for nuclear transport are either not present or have experienced genetic drift such that they are no longer recognizable by bioinformatics tools. In this minireview we describe the basics of nuclear trafficking and compare components within apicomplexans to defined systems in humans and yeast. A detailed analysis of the nuclear trafficking network in these eukaryotes is required to understand how this potentially unique cellular biological pathway contributes to host-parasite interactions. PMID:19348590

  1. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans

    PubMed Central

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada


    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191

  2. Apicomplexan parasites contain a single lipoic acid synthase located in the plastid.


    Thomsen-Zieger, Nadine; Schachtner, Joachim; Seeber, Frank


    Apicomplexan parasites contain a vestigial plastid called apicoplast which has been suggested to be a site of [Fe-S] cluster biogenesis. Here we report the cloning of lipoic acid synthase (LipA) from Toxoplasma gondii, a well known [Fe-S] protein. It is able to complement a LipA-deficient Escherichia coli strain, clearly demonstrating that the parasite protein is a functional LipA. The N-terminus of T. gondii LipA is unusual with respect to an internal signal peptide preceding an apicoplast targeting domain. Nevertheless, it efficiently targets a reporter protein to the apicoplast of T. gondii whereas co-localization with the fluorescently labeled mitochondrion was not detected. In silico analysis of several apicomplexan genomes indicates that the parasites, in addition to the presumably apicoplast-resident pyruvate dehydrogenase complex, contain three other mitochondrion-localized target proteins for lipoic acid attachment. We also identified single genes for lipoyl (octanoyl)-acyl carrier protein:protein transferase (LipB) and lipoate protein ligase (LplA) in these genomes. It thus appears that unlike plants, which have only two LipA and LipB isoenzymes in both the chloroplasts and the mitochondria, Apicomplexa seem to use the second known lipoylating activity, LplA, for lipoylation in their mitochondrion. PMID:12860390

  3. Identification of the Treponema pallidum subsp. pallidum TP0092 (RpoE) regulon and its implications for pathogen persistence in the host and syphilis pathogenesis.


    Giacani, Lorenzo; Denisenko, Oleg; Tompa, Martin; Centurion-Lara, Arturo


    Bacteria often respond to harmful environmental stimuli with the induction of extracytoplasmic function (ECF) sigma (σ) factors that in turn direct RNA polymerase to transcribe specific groups of response genes (or regulons) to minimize cellular damage and favor adaptation to the changed extracellular milieu. In Treponema pallidum subsp. pallidum, the agent of syphilis, the TP0092 gene is predicted to code for the pathogen's only annotated ECF σ factor, homologous to RpoE, known in Escherichia coli to control a key transduction pathway for maintenance of envelope homeostasis in response to external stress and cell growth. Here we have shown that TP0092 is highly transcribed during experimental syphilis. Furthermore, TP0092 transcription levels significantly increase as infection progresses toward immune clearance of the pathogen, suggesting a role for TP0092 in helping T. pallidum respond to harmful stimuli in the host environment. To investigate this hypothesis, we determined the TP0092 regulon at two different time points during infection using chromatin immunoprecipitation followed by high-throughput sequencing. A total of 22 chromosomal regions, all containing putative TP0092-binding sites and corresponding to as many T. pallidum genes, were identified. Noteworthy among them are the genes encoding desulfoferrodoxin and thioredoxin, involved in detoxification of reactive oxygen species (ROS). Because T. pallidum does not possess other enzymes for ROS detoxification, such as superoxide dismutase, catalase, or glutathione peroxidase, our results suggest that the TP0092 regulon is important in protecting the syphilis spirochete from damage caused by ROS produced at the site of infection during the inflammatory response. PMID:23243302

  4. The Aspergillus nidulans CREA protein mediates glucose repression of the ethanol regulon at various levels through competition with the ALCR-specific transactivator.

    PubMed Central

    Mathieu, M; Felenbok, B


    Carbon catabolite repression in Aspergillus nidulans is mediated by a negative-acting protein coded by the creA gene. We have investigated how CREA controls the expression of the ethanol regulon genes. CREA is a major component of the control of this regulon. Its presence in the cell results in a permanent, albeit partial, repression of the alc genes under all physiological growth conditions, even when the fungus is grown on carbon sources considered to be non-repressing. A crucial step in the control processes is the repression of the positive-acting specific regulatory gene alcR, by the binding of CREA on its cognate target sites on the alcR promoter. The removal of one of these targets, URSA, results in a 50% derepression of the alcR gene. Furthermore, the presence of this sequence contributes directly to the low alcR expression under nonrepressing conditions and reduces alcR promoter function by at least 100-fold. CREA acts both on the regulatory gene alcR and directly on the two structural genes alcA and aldA, as glucose repression of the latter genes occurs in strains where alcR transcription is driven by a strong constitutive and derepressed promoter. In vivo and in vitro competition experiments show that CREA acts by competing directly with the binding of the ALCR activator for the same region of the alcR promoter, a region which encompasses overlapping targets for both regulatory proteins. These data are consistent with a model in which the activating and repressing regulatory proteins compete to regulate expression of the ethanol regulon genes. Images PMID:8076597

  5. The Aspergillus nidulans CREA protein mediates glucose repression of the ethanol regulon at various levels through competition with the ALCR-specific transactivator.


    Mathieu, M; Felenbok, B


    Carbon catabolite repression in Aspergillus nidulans is mediated by a negative-acting protein coded by the creA gene. We have investigated how CREA controls the expression of the ethanol regulon genes. CREA is a major component of the control of this regulon. Its presence in the cell results in a permanent, albeit partial, repression of the alc genes under all physiological growth conditions, even when the fungus is grown on carbon sources considered to be non-repressing. A crucial step in the control processes is the repression of the positive-acting specific regulatory gene alcR, by the binding of CREA on its cognate target sites on the alcR promoter. The removal of one of these targets, URSA, results in a 50% derepression of the alcR gene. Furthermore, the presence of this sequence contributes directly to the low alcR expression under nonrepressing conditions and reduces alcR promoter function by at least 100-fold. CREA acts both on the regulatory gene alcR and directly on the two structural genes alcA and aldA, as glucose repression of the latter genes occurs in strains where alcR transcription is driven by a strong constitutive and derepressed promoter. In vivo and in vitro competition experiments show that CREA acts by competing directly with the binding of the ALCR activator for the same region of the alcR promoter, a region which encompasses overlapping targets for both regulatory proteins. These data are consistent with a model in which the activating and repressing regulatory proteins compete to regulate expression of the ethanol regulon genes. PMID:8076597

  6. Bacterial Regulon Evolution: Distinct Responses and Roles for the Identical OmpR Proteins of Salmonella Typhimurium and Escherichia coli in the Acid Stress Response

    PubMed Central

    Quinn, Heather J.; Cameron, Andrew D. S.; Dorman, Charles J.


    The evolution of new gene networks is a primary source of genetic innovation that allows bacteria to explore and exploit new niches, including pathogenic interactions with host organisms. For example, the archetypal DNA binding protein, OmpR, is identical between Salmonella Typhimurium serovar Typhimurium and Escherichia coli, but regulatory specialization has resulted in different environmental triggers of OmpR expression and largely divergent OmpR regulons. Specifically, ompR mRNA and OmpR protein levels are elevated by acid pH in S. Typhimurium but not in E. coli. This differential expression pattern is due to differences in the promoter regions of the ompR genes and the E. coli ompR orthologue can be made acid-inducible by introduction of the appropriate sequences from S. Typhimurium. The OmpR regulon in S. Typhimurium overlaps that of E. coli at only 15 genes and includes many horizontally acquired genes (including virulence genes) that E. coli does not have. We found that OmpR binds to its genomic targets in higher abundance when the DNA is relaxed, something that occurs in S. Typhimurium as a result of acid stress and which is a requirement for optimal expression of its virulence genes. The genomic targets of OmpR do not share a strong nucleotide sequence consensus: we propose that the ability of OmpR to recruit additional genes to its regulon arises from its modest requirements for specificity in its DNA targets with its preference for relaxed DNA allowing it to cooperate with DNA-topology-based allostery to modulate transcription in response to acid stress. PMID:24603618

  7. Characterization of the SOS Regulon of Caulobacter crescentus?

    PubMed Central

    da Rocha, Raquel Paes; de Miranda Paquola, Apu Csar; do Valle Marques, Marilis; Menck, Carlos Frederico Martins; Galhardo, Rodrigo S.


    The SOS regulon is a paradigm of bacterial responses to DNA damage. A wide variety of bacterial species possess homologs of lexA and recA, the central players in the regulation of the SOS circuit. Nevertheless, the genes actually regulated by the SOS have been determined only experimentally in a few bacterial species. In this work, we describe 37 genes regulated in a LexA-dependent manner in the alphaproteobacterium Caulobacter crescentus. In agreement with previous results, we have found that the direct repeat GTTCN7GTTC is the SOS operator of C. crescentus, which was confirmed by site-directed mutagenesis studies of the imuA promoter. Several potential promoter regions containing the SOS operator were identified in the genome, and the expression of the corresponding genes was analyzed for both the wild type and the lexA strain, demonstrating that the vast majority of these genes are indeed SOS regulated. Interestingly, many of these genes encode proteins with unknown functions, revealing the potential of this approach for the discovery of novel genes involved in cellular responses to DNA damage in prokaryotes, and illustrating the diversity of SOS-regulated genes among different bacterial species. PMID:18083815

  8. soxR, a locus governing a superoxide response regulon in Escherichia coli K-12.

    PubMed Central

    Tsaneva, I R; Weiss, B


    The nfo (endonuclease IV) gene of Escherichia coli is induced by superoxide generators such as paraquat (methyl viologen). An nfo'-lacZ operon fusion was used to isolate extragenic mutations affecting its expression. The mutations also affected the expression of glucose 6-phosphate dehydrogenase, Mn2(+)-superoxide dismutase (sodA), and three lacZ fusions to soi (superoxide-inducible) genes of unknown function. The mutations were located 2 kilobases clockwise of ssb at 92 min on the current linkage map. One set of mutations, in a new gene designated soxR, caused constitutive overexpression of nfo and the other genes. It included insertions or deletions affecting the carboxyl end of a 17-kilodalton polypeptide. In a soxR mutant, the expression of sodA, unlike that of nfo, was also regulated independently by oxygen tension. Two other mutants were isolated in which the target genes were noninducible; they had an increased sensitivity to killing by superoxide-generating compounds. One had a Tn10 insertion in or near soxR; the other had a multigene deletion encompassing soxR. Therefore, the region functions as a positive regulator because it encodes one or more products needed for the induction of nfo. Regulation is likely to be at the level of transcription because the mutations were able to affect the expression of an nfo'-lac operon fusion that contained the ribosome-binding site for lacZ. Some mutant plasmids that failed to suppress (or complement) constitutivity in trans had insertion mutations several hundred nucleotides upstream of soxR in the general region of a gene for a 13-kilodalton protein encoded by the opposite strand, raising the possibility of a second regulatory gene in this region. The result define a new regulon, controlled by soxR, mediating at least part of the global response to superoxide in E. coli. Images PMID:1695893

  9. A Bayesian Change point model for differential gene expression patterns of the DosR regulon of Mycobacterium tuberculosis

    PubMed Central

    Zhang, Yi; Hatch, Kim A; Wernisch, Lorenz; Bacon, Joanna


    Background Low oxygen availability has been shown previously to stimulate M. tuberculosis to establish non-replicative persistence in vitro. The two component sensor/regulator dosRS is a major mediator in the transcriptional response of M. tuberculosis to hypoxia and controls a regulon of approximately 50 genes that are induced under this condition. The aim of this study was to determine whether the induction of the entire DosR regulon is triggered as a synchronous event or if induction can unfold as a cascade of events as the differential expression of subsets of genes is stimulated by different oxygen availabilities. Results A novel aspect of our work is the use of chemostat cultures of M. tuberculosis which allowed us to control environmental conditions very tightly. We exposed M. tuberculosis to a sudden drop in oxygen availability in chemostat culture and studied the transcriptional response of the organism during the transition from a high oxygen level (10% dissolved oxygen tension or DOT) to a low oxygen level (0.2% DOT) using DNA microarrays. We developed a Bayesian change point analysis method that enabled us to detect subtle shifts in the timing of gene induction. It results in probabilities of a change in gene expression at certain time points. A computational analysis of potential binding sites upstream of the DosR-controlled genes shows how the transcriptional responses of these genes are influenced by the affinity of these binding sites to DosR. Our study also indicates that a subgroup of DosR-controlled genes is regulated indirectly. Conclusion The majority of the dosR-dependent genes were up-regulated at 0.2% DOT, which confirms previous findings that these genes are triggered by hypoxic environments. However, our change point analysis also highlights genes which were up-regulated earlier at levels of about 8% DOT indicating that they respond to small fluctuations in oxygen availability. Our analysis shows that there are pairs of divergent genes where one gene in the pair is up-regulated before the other, presumably for a flexible response to a constantly changing environment in the host. PMID:18294384

  10. Inference of the Transcriptional Regulatory Network in Staphylococcus aureus by Integration of Experimental and Genomics-Based Evidence▿†

    PubMed Central

    Ravcheev, Dmitry A.; Best, Aaron A.; Tintle, Nathan; DeJongh, Matthew; Osterman, Andrei L.; Novichkov, Pavel S.; Rodionov, Dmitry A.


    Transcriptional regulatory networks are fine-tuned systems that help microorganisms respond to changes in the environment and cell physiological state. We applied the comparative genomics approach implemented in the RegPredict Web server combined with SEED subsystem analysis and available information on known regulatory interactions for regulatory network reconstruction for the human pathogen Staphylococcus aureus and six related species from the family Staphylococcaceae. The resulting reference set of 46 transcription factor regulons contains more than 1,900 binding sites and 2,800 target genes involved in the central metabolism of carbohydrates, amino acids, and fatty acids; respiration; the stress response; metal homeostasis; drug and metal resistance; and virulence. The inferred regulatory network in S. aureus includes ∼320 regulatory interactions between 46 transcription factors and ∼550 candidate target genes comprising 20% of its genome. We predicted ∼170 novel interactions and 24 novel regulons for the control of the central metabolic pathways in S. aureus. The reconstructed regulons are largely variable in the Staphylococcaceae: only 20% of S. aureus regulatory interactions are conserved across all studied genomes. We used a large-scale gene expression data set for S. aureus to assess relationships between the inferred regulons and gene expression patterns. The predicted reference set of regulons is captured within the Staphylococcus collection in the RegPrecise database ( PMID:21531804

  11. Transfer activation of SXT/R391 integrative and conjugative elements: unraveling the SetCD regulon

    PubMed Central

    Poulin-Laprade, Dominic; Matteau, Dominick; Jacques, Pierre-tienne; Rodrigue, Sbastien; Burrus, Vincent


    Integrative and conjugative elements (ICEs) of the SXT/R391 family have been recognized as key drivers of antibiotic resistance dissemination in the seventh-pandemic lineage of Vibrio cholerae. SXT/R391 ICEs propagate by conjugation and integrate site-specifically into the chromosome of a wide range of environmental and clinical Gammaproteobacteria. SXT/R391 ICEs bear setC and setD, two conserved genes coding for a transcriptional activator complex that is essential for activation of conjugative transfer. We used chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) to characterize the SetCD regulon of three representative members of the SXT/R391 family. We also identified the DNA sequences bound by SetCD in MGIVflInd1, a mobilizable genomic island phylogenetically unrelated to SXT/R391 ICEs that hijacks the conjugative machinery of these ICEs to drive its own transfer. SetCD was found to bind a 19-bp sequence that is consistently located near the promoter ?35 element of SetCD-activated genes, a position typical of class II transcriptional activators. Furthermore, we refined our understanding of the regulation of excision from and integration into the chromosome for SXT/R391 ICEs and demonstrated that de novo expression of SetCD is crucial to allow integration of the incoming ICE DNA into a naive host following conjugative transfer. PMID:25662215

  12. Listeria monocytogenes Differential Transcriptome Analysis Reveals Temperature-Dependent Agr Regulation and Suggests Overlaps with Other Regulons

    PubMed Central

    Garmyn, Dominique; Augagneur, Yoann; Gal, Laurent; Vivant, Anne-Laure; Piveteau, Pascal


    Listeria monocytogenes is a ubiquitous, opportunistic pathogenic organism. Environmental adaptation requires constant regulation of gene expression. Among transcriptional regulators, AgrA is part of an auto-induction system. Temperature is an environmental cue critical for in vivo adaptation. In order to investigate how temperature may affect AgrA-dependent transcription, we compared the transcriptomes of the parental strain L. monocytogenes EGD-e and its ΔagrA mutant at the saprophytic temperature of 25°C and in vivo temperature of 37°C. Variations of transcriptome were higher at 37°C than at 25°C. Results suggested that AgrA may be involved in the regulation of nitrogen transport, amino acids, purine and pyrimidine biosynthetic pathways and phage-related functions. Deregulations resulted in a growth advantage at 37°C, but affected salt tolerance. Finally, our results suggest overlaps with PrfA, σB, σH and CodY regulons. These overlaps may suggest that through AgrA, Listeria monocytogenes integrates information on its biotic environment. PMID:23024744

  13. The Listeria monocytogenes σB Regulon and Its Virulence-Associated Functions Are Inhibited by a Small Molecule

    PubMed Central

    Palmer, M. Elizabeth; Chaturongakul, Soraya; Wiedmann, Martin; Boor, Kathryn J.


    ABSTRACT The stress-responsive alternative sigma factor σB is conserved across diverse Gram-positive bacterial genera. In Listeria monocytogenes, σB regulates transcription of >150 genes, including genes contributing to virulence and to bacterial survival under host-associated stress conditions, such as those encountered in the human gastrointestinal lumen. An inhibitor of L. monocytogenes σB activity was identified by screening ~57,000 natural and synthesized small molecules using a high-throughput cell-based assay. The compound fluoro-phenyl-styrene-sulfonamide (FPSS) (IC50 = 3.5 µM) downregulated the majority of genes previously identified as members of the σB regulon in L. monocytogenes 10403S, thus generating a transcriptional profile comparable to that of a 10403S ΔsigB strain. Specifically, of the 208 genes downregulated by FPSS, 75% had been identified previously as positively regulated by σB. Downregulated genes included key virulence and stress response genes, such as inlA, inlB, bsh, hfq, opuC, and bilE. From a functional perspective, FPSS also inhibited L. monocytogenes invasion of human intestinal epithelial cells and bile salt hydrolase activity. The ability of FPSS to inhibit σB activity in both L. monocytogenes and Bacillus subtilis indicates its utility as a specific inhibitor of σB across multiple Gram-positive genera. PMID:22128349

  14. The Rsm regulon of plant growth-promoting Pseudomonas fluorescens SS101: role of small RNAs in regulation of lipopeptide biosynthesis

    PubMed Central

    Song, Chunxu; van der Voort, Menno; van de Mortel, Judith; Hassan, Karl A; Elbourne, Liam D H; Paulsen, Ian T; Loper, Joyce E; Raaijmakers, Jos M


    The rhizobacterium Pseudomonas fluorescens SS101 inhibits growth of oomycete and fungal pathogens, and induces resistance in plants against pathogens and insects. To unravel regulatory pathways of secondary metabolite production in SS101, we conducted a genome-wide search for sRNAs and performed transcriptomic analyses to identify genes associated with the Rsm (repressor of secondary metabolites) regulon. In silico analysis led to the identification of 16 putative sRNAs in the SS101 genome. In frame deletion of the sRNAs rsmY and rsmZ showed that the Rsm system regulates the biosynthesis of the lipopeptide massetolide A and involves the two repressor proteins RsmA and RsmE, with the LuxR-type transcriptional regulator MassAR as their most likely target. Transcriptome analyses of the rsmYZ mutant further revealed that genes associated with iron acquisition, motility and chemotaxis were significantly upregulated, whereas genes of the type VI secretion system were downregulated. Comparative transcriptomic analyses showed that most, but not all, of the genes controlled by RsmY/RsmZ are also controlled by the GacS/GacA two-component system. We conclude that the Rsm regulon of P. fluorescens SS101 plays a critical role in the regulation of lipopeptide biosynthesis and controls the expression of other genes involved in motility, competition and survival in the plant rhizosphere. PMID:25488342

  15. Proteomic Analysis of the Quorum-Sensing Regulon in Pantoea stewartii and Identification of Direct Targets of EsaR

    PubMed Central

    Ramachandran, Revathy


    The proteobacterium Pantoea stewartii subsp. stewartii causes Stewart's wilt disease in maize when it colonizes the xylem and secretes large amounts of stewartan, an exopolysaccharide. The success of disease pathogenesis lies in the timing of bacterial virulence factor expression through the different stages of infection. Regulation is achieved through a quorum-sensing (QS) system consisting of the acyl-homoserine lactone (AHL) synthase, EsaI, and the transcription regulator EsaR. At low cell densities, EsaR represses transcription of itself and of rcsA, an activator of the stewartan biosynthesis operon; it also activates esaS, which encodes a small RNA (sRNA). Repression or activation ceases at high cell densities when EsaI synthesizes sufficient levels of the AHL ligand N-3-oxo-hexanoyl-l-homoserine lactone to bind and inactivate EsaR. This study aims to identify other genes activated or repressed by EsaR during the QS response. Proteomic analysis identified a QS regulon of more than 30 proteins. Electrophoretic mobility shift assays of promoters of genes encoding differentially expressed proteins distinguished direct targets of EsaR from indirect targets. Additional quantitative reverse transcription-PCR (qRT-PCR) and DNA footprinting analysis established that EsaR directly regulates the promoters of dkgA, glpF, and lrhA. The proteins encoded by dkgA, glpF, and lrhA are a 2,5-diketogluconate reductase, glycerol facilitator, and transcriptional regulator of chemotaxis and motility, respectively, indicating a more global QS response in P. stewartii than previously recognized. PMID:23913428

  16. Characterization of the CpxRA Regulon in Haemophilus ducreyi?

    PubMed Central

    Labandeira-Rey, Maria; Brautigam, Chad A.; Hansen, Eric J.


    The Haemophilus ducreyi 35000HP genome encodes a homolog of the CpxRA two-component cell envelope stress response system originally characterized in Escherichia coli. CpxR, the cytoplasmic response regulator, was shown previously to be involved in repression of the expression of the lspB-lspA2 operon (M. Labandeira-Rey, J. R. Mock, and E. J. Hansen, Infect. Immun. 77:3402-3411, 2009). In the present study, the H. ducreyi CpxR and CpxA proteins were shown to closely resemble those of other well-studied bacterial species. A cpxA deletion mutant and a CpxR-overexpressing strain were used to explore the extent of the CpxRA regulon. DNA microarray and real-time reverse transcriptase (RT) PCR analyses indicated several potential regulatory targets for the H. ducreyi CpxRA two-component regulatory system. Electrophoretic mobility shift assays (EMSAs) were used to prove that H. ducreyi CpxR interacted with the promoter regions of genes encoding both known and putative virulence factors of H. ducreyi, including the lspB-lspA2 operon, the flp operon, and dsrA. Interestingly, the use of EMSAs also indicated that H. ducreyi CpxR did not bind to the promoter regions of several genes predicted to encode factors involved in the cell envelope stress response. Taken together, these data suggest that the CpxRA system in H. ducreyi, in contrast to that in E. coli, may be involved primarily in controlling expression of genes not involved in the cell envelope stress response. PMID:20805330

  17. Analysis of the ArcA regulon in anaerobically grown Salmonella enterica sv. Typhimurium

    PubMed Central


    Background Salmonella enterica serovar Typhimurium (S. Typhimurium) is a Gram-negative pathogen that must successfully adapt to the broad fluctuations in the concentration of dissolved dioxygen encountered in the host. In Escherichia coli, ArcA (Aerobic Respiratory Control) helps the cells to sense and respond to the presence of dioxygen. The global role of ArcA in E. coli is well characterized; however, little is known about its role in anaerobically grown S. Typhimurium. Results We compared the transcriptional profiles of the virulent wild-type (WT) strain (ATCC 14028s) and its isogenic arcA mutant grown under anaerobic conditions. We found that ArcA directly or indirectly regulates 392 genes (8.5% of the genome); of these, 138 genes are poorly characterized. Regulation by ArcA in S. Typhimurium is similar, but distinct from that in E. coli. Thus, genes/operons involved in core metabolic pathways (e.g., succinyl-CoA, fatty acid degradation, cytochrome oxidase complexes, flagellar biosynthesis, motility, and chemotaxis) were regulated similarly in the two organisms. However, genes/operons present in both organisms, but regulated differently by ArcA in S. Typhimurium included those coding for ethanolamine utilization, lactate transport and metabolism, and succinate dehydrogenases. Salmonella-specific genes/operons regulated by ArcA included those required for propanediol utilization, flagellar genes (mcpAC, cheV), Gifsy-1 prophage genes, and three SPI-3 genes (mgtBC, slsA, STM3784). In agreement with our microarray data, the arcA mutant was non-motile, lacked flagella, and was as virulent in mice as the WT. Additionally, we identified a set of 120 genes whose regulation was shared with the anaerobic redox regulator, Fnr. Conclusion(s) We have identified the ArcA regulon in anaerobically grown S. Typhimurium. Our results demonstrated that in S. Typhimurium, ArcA serves as a transcriptional regulator coordinating cellular metabolism, flagella biosynthesis, and motility. Furthermore, ArcA and Fnr share in the regulation of 120 S. Typhimurium genes. PMID:21418628

  18. MicroRNAs in the Host-Apicomplexan Parasites Interactions: A Review of Immunopathological Aspects.


    Judice, Carla C; Bourgard, Catarina; Kayano, Ana C A V; Albrecht, Letusa; Costa, Fabio T M


    MicroRNAs (miRNAs), a class of small non-coding regulatory RNAs, have been detected in a variety of organisms ranging from ancient unicellular eukaryotes to mammals. They have been associated with numerous molecular mechanisms involving developmental, physiological and pathological changes of cells and tissues. Despite the fact that miRNA-silencing mechanisms appear to be absent in some Apicomplexan species, an increasing number of studies have reported a role for miRNAs in host-parasite interactions. Host miRNA expression can change following parasite infection and the consequences can lead, for instance, to parasite clearance. In this context, the immune system signaling appears to have a crucial role. PMID:26870701

  19. MicroRNAs in the Host-Apicomplexan Parasites Interactions: A Review of Immunopathological Aspects

    PubMed Central

    Judice, Carla C.; Bourgard, Catarina; Kayano, Ana C. A. V.; Albrecht, Letusa; Costa, Fabio T. M.


    MicroRNAs (miRNAs), a class of small non-coding regulatory RNAs, have been detected in a variety of organisms ranging from ancient unicellular eukaryotes to mammals. They have been associated with numerous molecular mechanisms involving developmental, physiological and pathological changes of cells and tissues. Despite the fact that miRNA-silencing mechanisms appear to be absent in some Apicomplexan species, an increasing number of studies have reported a role for miRNAs in host-parasite interactions. Host miRNA expression can change following parasite infection and the consequences can lead, for instance, to parasite clearance. In this context, the immune system signaling appears to have a crucial role. PMID:26870701

  20. The apicoplast: a review of the derived plastid of apicomplexan parasites.


    Waller, Ross F; McFadden, Geoffrey I


    The apicoplast is a plastid organelle, homologous to chloroplasts of plants, that is found in apicomplexan parasites such as the causative agents of Malaria Plasmodium spp. It occurs throughout the Apicomplexa and is an ancient feature of this group acquired by the process of endosymbiosis. Like plant chloroplasts, apicoplasts are semi-autonomous with their own genome and expression machinery. In addition, apicoplasts import numerous proteins encoded by nuclear genes. These nuclear genes largely derive from the endosymbiont through a process of intracellular gene relocation. The exact role of a plastid in parasites is uncertain but early clues indicate synthesis of lipids, heme and isoprenoids as possibilities. The various metabolic processes of the apicoplast are potentially excellent targets for drug therapy. PMID:15580780

  1. Overproduction of AcrR increases organic solvent tolerance mediated by modulation of SoxS regulon in Escherichia coli.


    Lee, Jae Ok; Cho, Kyung-Suk; Kim, Ok Bin


    Acriflavine resistance regulator (AcrR), a local transcription factor, regulates the expression of the acrRAB genes associated with the AcrAB-TolC multidrug efflux pump. Screening of organic solvent tolerance (OST) with the overexpression of 13 genes in Escherichia coli revealed that the overexpression of acrR improved OST. Overexpression of AcrR in a background strain of wild-type E. coli and in the OST strain LMB015 (?fadR ?marR; acrR (+) and ?fadR ?marR acrR (+) strain, respectively) significantly increased cell growth in the presence of n-hexane/cyclohexane, which attenuated the membrane reduction capacity of the wild-type strain below 50 % of the control level. This was recovered to control levels in the acrR (+) strain. Quantitative real-time PCR analysis of RNA from the wild-type, ?acrR, and acrR (+) strains showed that AcrR represses the transcription of marRAB and soxRS, and its own gene cluster, acrRAB. Electrophoretic mobility shift assay demonstrated that AcrR binds directly to the promoter region of acrRAB, marAB, and soxRS, indicating that AcrR acts on global regulators to affect mar-sox-rob regulon. In the acrR (+) strain, soxS expression was significantly upregulated compared with the wild-type. The OST of the acrR (+) strain was completely lost in the ?soxS acrR (+) strain, indicating that SoxS mediated OST improvement in the acrR (+) strain. The observation that all genes associated with marRAB and soxRS are upregulated in the ?acrR strain, and that there is only moderate induction of soxS (and marB) in the acrR (+) strain, provides insight into how acrR overexpression confers bacterial OST and the mar-sox-rob regulon control network. PMID:25176444

  2. Apicoplast and Endoplasmic Reticulum Cooperate in Fatty Acid Biosynthesis in Apicomplexan Parasite Toxoplasma gondii*

    PubMed Central

    Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Pujol, Franois M.; Brooks, Carrie F.; van Dooren, Giel G.; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.; McConville, Malcolm J.; Striepen, Boris


    Apicomplexan parasites are responsible for high impact human diseases such as malaria, toxoplasmosis, and cryptosporidiosis. These obligate intracellular pathogens are dependent on both de novo lipid biosynthesis as well as the uptake of host lipids for biogenesis of parasite membranes. Genome annotations and biochemical studies indicate that apicomplexan parasites can synthesize fatty acids via a number of different biosynthetic pathways that are differentially compartmentalized. However, the relative contribution of each of these biosynthetic pathways to total fatty acid composition of intracellular parasite stages remains poorly defined. Here, we use a combination of genetic, biochemical, and metabolomic approaches to delineate the contribution of fatty acid biosynthetic pathways in Toxoplasma gondii. Metabolic labeling studies with [13C]glucose showed that intracellular tachyzoites synthesized a range of long and very long chain fatty acids (C14:026:1). Genetic disruption of the apicoplast-localized type II fatty-acid synthase resulted in greatly reduced synthesis of saturated fatty acids up to 18 carbons long. Ablation of type II fatty-acid synthase activity resulted in reduced intracellular growth that was partially restored by addition of long chain fatty acids. In contrast, synthesis of very long chain fatty acids was primarily dependent on a fatty acid elongation system comprising three elongases, two reductases, and a dehydratase that were localized to the endoplasmic reticulum. The function of these enzymes was confirmed by heterologous expression in yeast. This elongase pathway appears to have a unique role in generating very long unsaturated fatty acids (C26:1) that cannot be salvaged from the host. PMID:22179608

  3. Regulation of Erwinia carotovora hrpL(Ecc) (sigma-L(Ecc)), which encodes an extracytoplasmic function subfamily of sigma factor required for expression of the HRP regulon.


    Chatterjee, Asita; Cui, Yaya; Chatterjee, Arun K


    In Erwinia carotovora subsp. carotovora (Ecc) strain 71 (Ecc71), HrpL(Ecc), an alternate sigma factor of the extracytoplasmic function subfamily, plays a central role in the expression of the hrp (hypersensitive reaction and pathogenicity) regulon. We document here that sigma-54 (RpoN) is required for full expression of hrpL(Ecc) and that HrpS, in conjunction with sigma-54, activates hrpL(Ecc) transcription. We also made the novel observation that integration host factor is required for the activation of the hrpL(Ecc) promoter. Our findings reveal that the RsmA/rsmB RNA-mediated post-transcriptional system, known to control extracellular enzyme and harpin production, affects hrpL(Ecc) expression as well. For example, hrpL(Ecc) RNA levels are barely detected in an RsmB- strain. Conversely, hrpL(Ecc) mRNA levels are much higher in RsmA- bacteria than in the RsmA+ parent. This effect is due to RsmA-promoted decay of hrpL(Ecc) RNA. Moreover, the following regulators known to control the production of either RsmA, rsmB RNA, or both also affect hrpL(Ecc) expression: GacA (response regulator of a two-component system), KdgR (an IcII type repressor), HexA (a LysR type repressor), RsmC (a putative transcriptional adapter). Based upon the data now available for Ecc and extrapolating from the evidence in other systems, we propose a tentative model that depicts the Hrp regulatory system of Ecc and explains the basis for coregulation of extracellular enzyme production and expression of the Hrp regulon. PMID:12236604

  4. Quantitative and temporal definition of the Mla transcriptional regulon during barley-powdery mildew interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Barley Mildew resistance locus a (Mla) is a major determinant of immunity to the powdery mildew pathogen, Blumeria graminis f. sp. hordei. Alleles of Mla encode cytoplasmic- and membrane-localized coiled-coil, nucleotide binding site, leucine-rich repeat proteins that mediate resistance when complem...

  5. Characterization of the RelBbu Regulon in Borrelia burgdorferi Reveals Modulation of Glycerol Metabolism by (p)ppGpp.


    Bugrysheva, Julia V; Pappas, Christopher J; Terekhova, Darya A; Iyer, Radha; Godfrey, Henry P; Schwartz, Ira; Cabello, Felipe C


    The bacterial stringent response is triggered by deficiencies of available nutrients and other environmental stresses. It is mediated by 5'-triphosphate-guanosine-3'-diphosphate and 5'-diphosphate-guanosine-3'-diphosphate (collectively (p)ppGpp) and generates global changes in gene expression and metabolism that enable bacteria to adapt to and survive these challenges. Borrelia burgdorferi encounters multiple stressors in its cycling between ticks and mammals that could trigger the stringent response. We have previously shown that the B. burgdorferi stringent response is mediated by a single enzyme, RelBbu, with both (p)ppGpp synthase and hydrolase activities, and that a B. burgdorferi 297 relBbu null deletion mutant was defective in adapting to stationary phase, incapable of down-regulating synthesis of rRNA and could not infect mice. We have now used this deletion mutant and microarray analysis to identify genes comprising the rel regulon in B. burgdorferi cultured at 34C, and found that transcription of genes involved in glycerol metabolism is induced by relBbu. Culture of the wild type parental strain, the relBbu deletion mutant and its complemented derivative at 34C and 25C in media containing glucose or glycerol as principal carbon sources revealed a growth defect in the mutant, most evident at the lower temperature. Transcriptional analysis of the glp operon for glycerol uptake and metabolism in these three strains confirmed that relBbu was necessary and sufficient to increase transcription of this operon in the presence of glycerol at both temperatures. These results confirm and extend previous findings regarding the stringent response in B. burgdorferi. They also demonstrate that the stringent response regulates glycerol metabolism in this organism and is likely crucial for its optimal growth in ticks. PMID:25688856

  6. Characterization of the RelBbu Regulon in Borrelia burgdorferi Reveals Modulation of Glycerol Metabolism by (p)ppGpp

    PubMed Central

    Bugrysheva, Julia V.; Pappas, Christopher J.; Terekhova, Darya A.; Iyer, Radha; Godfrey, Henry P.; Schwartz, Ira; Cabello, Felipe C.


    The bacterial stringent response is triggered by deficiencies of available nutrients and other environmental stresses. It is mediated by 5'-triphosphate-guanosine-3'-diphosphate and 5'-diphosphate-guanosine-3'-diphosphate (collectively (p)ppGpp) and generates global changes in gene expression and metabolism that enable bacteria to adapt to and survive these challenges. Borrelia burgdorferi encounters multiple stressors in its cycling between ticks and mammals that could trigger the stringent response. We have previously shown that the B. burgdorferi stringent response is mediated by a single enzyme, RelBbu, with both (p)ppGpp synthase and hydrolase activities, and that a B. burgdorferi 297 relBbu null deletion mutant was defective in adapting to stationary phase, incapable of down-regulating synthesis of rRNA and could not infect mice. We have now used this deletion mutant and microarray analysis to identify genes comprising the rel regulon in B. burgdorferi cultured at 34C, and found that transcription of genes involved in glycerol metabolism is induced by relBbu. Culture of the wild type parental strain, the relBbu deletion mutant and its complemented derivative at 34C and 25C in media containing glucose or glycerol as principal carbon sources revealed a growth defect in the mutant, most evident at the lower temperature. Transcriptional analysis of the glp operon for glycerol uptake and metabolism in these three strains confirmed that relBbu was necessary and sufficient to increase transcription of this operon in the presence of glycerol at both temperatures. These results confirm and extend previous findings regarding the stringent response in B. burgdorferi. They also demonstrate that the stringent response regulates glycerol metabolism in this organism and is likely crucial for its optimal growth in ticks. PMID:25688856

  7. Clustering of genes into regulons using integrated modeling-COGRIM

    PubMed Central

    Chen, Guang; Jensen, Shane T; Stoeckert, Christian J


    We present a Bayesian hierarchical model and Gibbs Sampling implementation that integrates gene expression, ChIP binding, and transcription factor motif data in a principled and robust fashion. COGRIM was applied to both unicellular and mammalian organisms under different scenarios of available data. In these applications, we demonstrate the ability to predict gene-transcription factor interactions with reduced numbers of false-positive findings and to make predictions beyond what is obtained when single types of data are considered. PMID:17204163

  8. Adaptation in bacterial flagellar and motility systems: from regulon members to 'foraging'-like behavior in E. coli.


    Zhao, Kai; Liu, Mingzhu; Burgess, Richard R


    Bacterial flagellar motility and chemotaxis help cells to reach the most favorable environments and to successfully compete with other micro-organisms in response to external stimuli. Escherichia coli is a motile gram-negative bacterium, and the flagellar regulon in E. coli is controlled by a master regulator FlhDC as well as a second regulator, flagellum-specific sigma factor, sigma(F). To define the physiological role of these two regulators, we carried out transcription profiling experiments to identify, on a genome-wide basis, genes under the control of these two regulators. In addition, the synchronized pattern of increasing CRP activity causing increasing FlhDC expression with decreasing carbon source quality, together with the apparent coupling of motility activity with the activation of motility and chemotaxis genes in poor quality carbon sources, highlights the importance of CRP activation in allowing E. coli to devote progressively more of its limited reserves to search out better conditions. In adaptation to a variety of carbon sources, the motile bacteria carry out tactical responses by increasing flagellar operation but restricting costly flagellar synthesis, indicating its capability of strategically using the precious energy in nutrient-poor environments for maximizing survival. PMID:17576668

  9. Adaptation in bacterial flagellar and motility systems: from regulon members to foraging-like behavior in E. coli

    PubMed Central

    Zhao, Kai; Liu, Mingzhu; Burgess, Richard R.


    Bacterial flagellar motility and chemotaxis help cells to reach the most favorable environments and to successfully compete with other micro-organisms in response to external stimuli. Escherichia coli is a motile gram-negative bacterium, and the flagellar regulon in E. coli is controlled by a master regulator FlhDC as well as a second regulator, flagellum-specific sigma factor, ?F. To define the physiological role of these two regulators, we carried out transcription profiling experiments to identify, on a genome-wide basis, genes under the control of these two regulators. In addition, the synchronized pattern of increasing CRP activity causing increasing FlhDC expression with decreasing carbon source quality, together with the apparent coupling of motility activity with the activation of motility and chemotaxis genes in poor quality carbon sources, highlights the importance of CRP activation in allowing E. coli to devote progressively more of its limited reserves to search out better conditions. In adaptation to a variety of carbon sources, the motile bacteria carry out tactical responses by increasing flagellar operation but restricting costly flagellar synthesis, indicating its capability of strategically using the precious energy in nutrient-poor environments for maximizing survival. PMID:17576668

  10. Role of the small RNA RyhB in the Fur regulon in mediating the capsular polysaccharide biosynthesis and iron acquisition systems in Klebsiella pneumoniae

    PubMed Central


    Background The capsular polysaccharide (CPS) and iron acquisition systems are important determinants of Klebsiella pneumoniae infections, and we have previously reported that the ferric uptake repressor (Fur) can play dual role in iron acquisition and CPS biosynthesis. In many bacteria, Fur negatively controls the transcription of the small non-coding RNA RyhB to modulate cellular functions and virulence. However, in K. pneumoniae, the role played by RyhB in the Fur regulon has not been characterised. This study investigated Fur regulation of ryhB transcription and the functional role of RyhB in K. pneumoniae. Results Deletion of fur from K. pneumoniae increased the transcription of ryhB; the electric mobility shift assay and the Fur-titration assay revealed that Fur could bind to the promoter region of ryhB, suggesting that Fur directly represses ryhB transcription. Additionally, in a Δfur strain with elevated CPS production, deletion of ryhB obviously reduced CPS production. The following promoter-reporter assay and quantitative real-time PCR of cps genes verified that RyhB activated orf1 and orf16 transcription to elevate CPS production. However, deletion of ryhB did not affect the mRNA levels of rcsA, rmpA, or rmpA2. These results imply that Fur represses the transcription of ryhB to mediate the biosynthesis of CPS, which is independent of RcsA, RmpA, and RmpA2. In addition, the Δfur strain’s high level of serum resistance was attenuated by the deletion of ryhB, indicating that RyhB plays a positive role in protecting the bacterium from serum killing. Finally, deletion of ryhB in Δfur reduced the expression of several genes corresponding to 3 iron acquisition systems in K. pneumoniae, and resulted in reduced siderophore production. Conclusions The regulation and functional role of RyhB in K. pneumoniae is characterized in this study. RyhB participates in Fur regulon to modulate the bacterial CPS biosynthesis and iron acquisition systems in K. pneumoniae. PMID:22827802

  11. Towards a molecular understanding of the apicomplexan actin motor: on a road to novel targets for malaria remedies?

    SciTech Connect

    Kumpula, Esa-Pekka; Kursula, Inari


    In this review, current structural understanding of the apicomplexan glideosome and actin regulation is described. Apicomplexan parasites are the causative agents of notorious human and animal diseases that give rise to considerable human suffering and economic losses worldwide. The most prominent parasites of this phylum are the malaria-causing Plasmodium species, which are widespread in tropical and subtropical regions, and Toxoplasma gondii, which infects one third of the world’s population. These parasites share a common form of gliding motility which relies on an actin–myosin motor. The components of this motor and the actin-regulatory proteins in Apicomplexa have unique features compared with all other eukaryotes. This, together with the crucial roles of these proteins, makes them attractive targets for structure-based drug design. In recent years, several structures of glideosome components, in particular of actins and actin regulators from apicomplexan parasites, have been determined, which will hopefully soon allow the creation of a complete molecular picture of the parasite actin–myosin motor and its regulatory machinery. Here, current knowledge of the function of this motor is reviewed from a structural perspective.

  12. Subcellular localization of acetyl-CoA carboxylase in the apicomplexan parasite Toxoplasma gondii

    PubMed Central

    Jelenska, J.; Crawford, M. J.; Harb, O. S.; Zuther, E.; Haselkorn, R.; Roos, D. S.; Gornicki, P.


    Apicomplexan parasites such as Toxoplasma gondii contain a primitive plastid, the apicoplast, whose genome consists of a 35-kb circular DNA related to the plastid DNA of plants. Plants synthesize fatty acids in their plastids. The first committed step in fatty acid synthesis is catalyzed by acetyl-CoA carboxylase (ACC). This enzyme is encoded in the nucleus, synthesized in the cytosol, and transported into the plastid. In the present work, two genes encoding ACC from T. gondii were cloned and the gene structure was determined. Both ORFs encode multidomain proteins, each with an N-terminal extension, compared with the cytosolic ACCs from plants. The N-terminal extension of one isozyme, ACC1, was shown to target green fluorescent protein to the apicoplast of T. gondii. In addition, the apicoplast contains a biotinylated protein, consistent with the assertion that ACC1 is localized there. The second ACC in T. gondii appears to be cytosolic. T. gondii mitochondria also contain a biotinylated protein, probably pyruvate carboxylase. These results confirm the essential nature of the apicoplast and explain the inhibition of parasite growth in cultured cells by herbicides targeting ACC. PMID:11226307

  13. Multiple determinants for selective inhibition of apicomplexan calcium-dependent protein kinase CDPK1.


    Larson, Eric T; Ojo, Kayode K; Murphy, Ryan C; Johnson, Steven M; Zhang, Zhongsheng; Kim, Jessica E; Leibly, David J; Fox, Anna M W; Reid, Molly C; Dale, Edward J; Perera, B Gayani K; Kim, Jae; Hewitt, Stephen N; Hol, Wim G J; Verlinde, Christophe L M J; Fan, Erkang; Van Voorhis, Wesley C; Maly, Dustin J; Merritt, Ethan A


    Diseases caused by the apicomplexan protozoans Toxoplasma gondii and Cryptosporidium parvum are a major health concern. The life cycle of these parasites is regulated by a family of calcium-dependent protein kinases (CDPKs) that have no direct homologues in the human host. Fortuitously, CDPK1 from both parasites contains a rare glycine gatekeeper residue adjacent to the ATP-binding pocket. This has allowed creation of a series of C3-substituted pyrazolopyrimidine compounds that are potent inhibitors selective for CDPK1 over a panel of human kinases. Here we demonstrate that selectivity is further enhanced by modification of the scaffold at the C1 position. The explanation for this unexpected result is provided by crystal structures of the inhibitors bound to CDPK1 and the human kinase c-SRC. Furthermore, the insight gained from these studies was applied to transform an alternative ATP-competitive scaffold lacking potency and selectivity for CDPK1 into a low nanomolar inhibitor of this enzyme with no activity against SRC. PMID:22369268

  14. Multiple determinants for selective inhibition of apicomplexan calcium-dependent protein kinase CDPK1

    PubMed Central

    Larson, Eric T.; Ojo, Kayode K.; Murphy, Ryan C.; Johnson, Steven M.; Zhang, Zhongsheng; Kim, Jessica E.; Leibly, David J.; Fox, Anna M. W.; Reid, Molly C.; Dale, Edward J.; Perera, B. Gayani K.; Kim, Jae; Hewitt, Stephen N.; Hol, Wim G. J.; Verlinde, Christophe L. M. J.; Fan, Erkang; Van Voorhis, Wesley C.; Maly, Dustin J.; Merritt, Ethan A.


    Diseases caused by the apicomplexan protozoans Toxoplasma gondii and Cryptosporidium parvum are a major health concern. The life cycle of these parasites is regulated by a family of calcium-dependent protein kinases (CDPKs) that have no direct homologs in the human host. Fortuitously, CDPK1 from both parasites contains a rare glycine gatekeeper residue adjacent to the ATP-binding pocket. This has allowed creation of a series of C3-substituted pyrazolopyrimidine compounds that are potent inhibitors selective for CDPK1 over a panel of human kinases. Here we demonstrate that selectivity is further enhanced by modification of the scaffold at the C1 position. The explanation for this unexpected result is provided by crystal structures of the inhibitors bound to CDPK1 and the human kinase c-SRC. Furthermore, the insight gained from these studies was applied to transform an alternative ATP-competitive scaffold lacking potency and selectivity for CDPK1 into a low nanomolar inhibitor of this enzyme with no activity against SRC. PMID:22369268

  15. Lipid Synthesis in Protozoan Parasites: a Comparison Between Kinetoplastids and Apicomplexans

    PubMed Central

    Ramakrishnan, Srinivasan; Serricchio, Mauro; Striepen, Boris; Bütikofer, Peter


    Lipid metabolism is of crucial importance for pathogens. Lipids serve as cellular building blocks, signalling molecules, energy stores, posttranslational modifiers, and pathogenesis factors. Parasites rely on a complex system of uptake and synthesis mechanisms to satisfy their lipid needs. The parameters of this system change dramatically as the parasite transits through the various stages of its life cycle. Here we discuss the tremendous recent advances that have been made in the understanding of the synthesis and uptake pathways for fatty acids and phospholipids in apicomplexan and kinetoplastid parasites, including Plasmodium, Toxoplasma, Cryptosporidium, Trypanosoma and Leishmania. Lipid synthesis differs in significant ways between parasites from both phyla and the human host. Parasites have acquired novel pathways through endosymbiosis, as in the case of the apicoplast, have dramatically reshaped substrate and product profiles, and have evolved specialized lipids to interact with or manipulate the host. These differences potentially provide opportunities for drug development. We outline the lipid pathways for key species in detail as they progress through the developmental cycle and highlight those that are of particular importance to the biology of the pathogens and/or are the most promising targets for parasite-specific treatment. PMID:23827884

  16. piggyBac Transposon-Mediated Transgenesis in the Apicomplexan Parasite Eimeria tenella

    PubMed Central

    Su, Huali; Liu, Xianyong; Yan, Wenchao; Shi, Tuanyuan; Zhao, Xinxin; Blake, Damer P.; Tomley, Fiona M.; Suo, Xun


    piggyBac, a type II transposon that is useful for efficient transgenesis and insertional mutagenesis, has been used for effective and stable transfection in a wide variety of organisms. In this study we investigate the potential use of the piggyBac transposon system for forward genetics studies in the apicomplexan parasite Eimeria tenella. Using the restriction enzyme-mediated integration (REMI) method, E. tenella sporozoites were electroporated with a donor plasmid containing the enhanced yellow fluorescent protein (EYFP) gene flanked by piggyBac inverted terminal repeats (ITRs), an Asc I-linearized helper plasmid containing the transposase gene and the restriction enzyme Asc I. Subsequently, electroporated sporozoites were inoculated into chickens via the cloacal route and transfected progeny oocysts expressing EYFP were sorted by flow cytometry. A transgenic E. tenella population was selected by successive in vivo passage. Southern-blotting analysis showed that exogenous DNA containing the EYFP gene was integrated into the parasite genome at a limited number of integration sites and that the inserted part of the donor plasmid was the fragment located between the 5′ and 3′ ITRs as indicated by primer-specific PCR screening. Genome walking revealed that the insertion sites were TTAA-specific, which is consistent with the transposition characteristics of piggyBac. PMID:22768223

  17. A large-scale proteogenomics study of apicomplexan pathogensToxoplasma gondii and Neospora caninum

    PubMed Central

    Krishna, Ritesh; Xia, Dong; Sanderson, Sanya; Shanmugasundram, Achchuthan; Vermont, Sarah; Bernal, Axel; Daniel-Naguib, Gianluca; Ghali, Fawaz; Brunk, Brian P; Roos, David S; Wastling, Jonathan M; Jones, Andrew R


    Proteomics data can supplement genome annotation efforts, for example being used to confirm gene models or correct gene annotation errors. Here, we present a large-scale proteogenomics study of two important apicomplexan pathogens: Toxoplasma gondii and Neospora caninum. We queried proteomics data against a panel of official and alternate gene models generated directly from RNASeq data, using several newly generated and some previously published MS datasets for this meta-analysis. We identified a total of 201 996 and 39 953 peptide-spectrum matches for T. gondii and N. caninum, respectively, at a 1% peptide FDR threshold. This equated to the identification of 30 494 distinct peptide sequences and 2921 proteins (matches to official gene models) for T. gondii, and 8911 peptides/1273 proteins for N. caninum following stringent protein-level thresholding. We have also identified 289 and 140 loci for T. gondii and N. caninum, respectively, which mapped to RNA-Seq-derived gene models used in our analysis and apparently absent from the official annotation (release 10 from EuPathDB) of these species. We present several examples in our study where the RNA-Seq evidence can help in correction of the current gene model and can help in discovery of potential new genes. The findings of this study have been integrated into the EuPathDB. The data have been deposited to the ProteomeXchange with identifiers PXD000297and PXD000298. PMID:25867681

  18. The apicoplast: a plastid in Plasmodium falciparum and other Apicomplexan parasites.


    Foth, Bernardo J; McFadden, Geoffrey I


    Apicomplexan parasites cause severe diseases such as malaria, toxoplasmosis, and coccidiosis (caused by Plasmodium spp., Toxoplasma, and Eimeria, respectively). These parasites contain a relict plastid-termed "apicoplast"--that originated from the engulfment of an organism of the red algal lineage. The apicoplast is indispensable but its exact role in parasites is unknown. The apicoplast has its own genome and expresses a small number of genes, but the vast majority of the apicoplast proteome is encoded in the nuclear genome. The products of these nuclear genes are posttranslationally targeted to the organelle via the secretory pathway courtesy of a bipartite N-terminal leader sequence. Apicoplasts are nonphotosynthetic but retain other typical plastid functions such as fatty acid, isoprenoid and heme synthesis, and products of these pathways might be exported from the apicoplast for use by the parasite. Apicoplast pathways are essentially prokaryotic and therefore excellent drug targets. Some antibiotics inhibiting these molecular processes are already in chemotherapeutic use, whereas many new drugs will hopefully spring from our growing understanding of this intriguing organelle. PMID:12722949

  19. Control site location and transcriptional regulation in Escherichia coli.

    PubMed Central

    Collado-Vides, J; Magasanik, B; Gralla, J D


    The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993

  20. Identification of the Candida albicans Cap1p regulon.


    Znaidi, Sadri; Barker, Katherine S; Weber, Sandra; Alarco, Anne-Marie; Liu, Teresa T; Boucher, Genevive; Rogers, P David; Raymond, Martine


    Cap1p, a transcription factor of the basic region leucine zipper family, regulates the oxidative stress response (OSR) in Candida albicans. Alteration of its C-terminal cysteine-rich domain (CRD) results in Cap1p nuclear retention and transcriptional activation. To better understand the function of Cap1p in C. albicans, we used genome-wide location profiling (chromatin immunoprecipitation-on-chip) to identify its transcriptional targets in vivo. A triple-hemagglutinin (HA(3)) epitope was introduced at the C terminus of wild-type Cap1p (Cap1p-HA(3)) or hyperactive Cap1p with an altered CRD (Cap1p-CSE-HA(3)). Location profiling using whole-genome oligonucleotide tiling microarrays identified 89 targets bound by Cap1p-HA(3) or Cap1p-CSE-HA(3) (the binding ratio was at least twofold; P < or = 0.01). Strikingly, Cap1p binding was detected not only at the promoter region of its target genes but also at their 3' ends and within their open reading frames, suggesting that Cap1p may associate with the transcriptional or chromatin remodeling machinery to exert its activity. Overrepresented functional groups of the Cap1p targets (P < or = 0.02) included 11 genes involved in the OSR (CAP1, GLR1, TRX1, SOD1, CAT1, and others), 13 genes involved in response to drugs (PDR16, MDR1, FLU1, YCF1, FCR1, and others), 4 genes involved in phospholipid transport (PDR16, GIT1, RTA2, and orf19.932), and 3 genes involved in the regulation of nitrogen utilization (GST3, orf19.2693, and orf19.3121), suggesting that Cap1p has other cellular functions in addition to the OSR. Bioinformatic analyses of the bound sequences suggest that Cap1p recognizes the DNA motif 5'-MTKASTMA. Finally, transcriptome analyses showed that increased expression generally accompanies Cap1p binding at its targets, indicating that Cap1p functions as a transcriptional activator. PMID:19395663

  1. The Zur regulon of Corynebacterium glutamicum ATCC 13032

    PubMed Central


    Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc-dependent manner the expression of nine genes organized in five transcription units. Accordingly, the Zur (Cg2502) protein is the key transcription regulator for genes involved in zinc homeostasis in C. glutamicum. PMID:20055984

  2. Transcriptomic profiling of Yersinia pseudotuberculosis reveals reprogramming of the Crp regulon by temperature and uncovers Crp as a master regulator of small RNAs.


    Nuss, Aaron M; Heroven, Ann Kathrin; Waldmann, Barbara; Reinkensmeier, Jan; Jarek, Michael; Beckstette, Michael; Dersch, Petra


    One hallmark of pathogenic yersiniae is their ability to rapidly adjust their life-style and pathogenesis upon host entry. In order to capture the range, magnitude and complexity of the underlying gene control mechanisms we used comparative RNA-seq-based transcriptomic profiling of the enteric pathogen Y. pseudotuberculosis under environmental and infection-relevant conditions. We identified 1151 individual transcription start sites, multiple riboswitch-like RNA elements, and a global set of antisense RNAs and previously unrecognized trans-acting RNAs. Taking advantage of these data, we revealed a temperature-induced and growth phase-dependent reprogramming of a large set of catabolic/energy production genes and uncovered the existence of a thermo-regulated 'acetate switch', which appear to prime the bacteria for growth in the digestive tract. To elucidate the regulatory architecture linking nutritional status to virulence we also refined the CRP regulon. We identified a massive remodelling of the CRP-controlled network in response to temperature and discovered CRP as a transcriptional master regulator of numerous conserved and newly identified non-coding RNAs which participate in this process. This finding highlights a novel level of complexity of the regulatory network in which the concerted action of transcriptional regulators and multiple non-coding RNAs under control of CRP adjusts the control of Yersinia fitness and virulence to the requirements of their environmental and virulent life-styles. PMID:25816203

  3. Transcriptomic Profiling of Yersinia pseudotuberculosis Reveals Reprogramming of the Crp Regulon by Temperature and Uncovers Crp as a Master Regulator of Small RNAs

    PubMed Central

    Nuss, Aaron M.; Heroven, Ann Kathrin; Waldmann, Barbara; Reinkensmeier, Jan; Jarek, Michael; Beckstette, Michael; Dersch, Petra


    One hallmark of pathogenic yersiniae is their ability to rapidly adjust their life-style and pathogenesis upon host entry. In order to capture the range, magnitude and complexity of the underlying gene control mechanisms we used comparative RNA-seq-based transcriptomic profiling of the enteric pathogen Y. pseudotuberculosis under environmental and infection-relevant conditions. We identified 1151 individual transcription start sites, multiple riboswitch-like RNA elements, and a global set of antisense RNAs and previously unrecognized trans-acting RNAs. Taking advantage of these data, we revealed a temperature-induced and growth phase-dependent reprogramming of a large set of catabolic/energy production genes and uncovered the existence of a thermo-regulated ‘acetate switch’, which appear to prime the bacteria for growth in the digestive tract. To elucidate the regulatory architecture linking nutritional status to virulence we also refined the CRP regulon. We identified a massive remodelling of the CRP-controlled network in response to temperature and discovered CRP as a transcriptional master regulator of numerous conserved and newly identified non-coding RNAs which participate in this process. This finding highlights a novel level of complexity of the regulatory network in which the concerted action of transcriptional regulators and multiple non-coding RNAs under control of CRP adjusts the control of Yersinia fitness and virulence to the requirements of their environmental and virulent life-styles. PMID:25816203

  4. Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene.

    PubMed Central

    Nunoshiba, T; Hidalgo, E; Ambile Cuevas, C F; Demple, B


    Escherichia coli responds to the redox stress imposed by superoxide-generating agents such as paraquat by activating the synthesis of as many as 80 polypeptides. Expression of a key group of these inducible proteins is controlled at the transcriptional level by the soxRS locus (the soxRS regulon). A two-stage control system was hypothesized for soxRS, in which an intracellular redox signal would trigger the SoxR protein as a transcriptional activator of the soxS gene and the resulting increased levels of SoxS protein would activate transcription of the various soxRS regulon genes (B. Demple and C.F. Ambile Cuevas, Cell 67:837-839, 1990). We have constructed operon fusions of the E. coli lac genes to the soxS promoter to monitor soxS transcription. Expression from the soxS promoter is strongly inducible by paraquat in a manner strictly dependent on a functional soxR gene. Several other superoxide-generating agents also trigger soxR(+)-dependent soxS expression, and the inductions by paraquat and phenazine methosulfate were dependent on the presence of oxygen. Numerous other oxidative stress agents (H2O2, gamma rays, heat shock, etc.) failed to induce soxS, while aerobic growth of superoxide dismutase-deficient bacteria triggered soxR-dependent soxS expression. These results indicate a specific redox signal for soxS induction. A direct role for SoxR protein in the activation of the soxS gene is indicated by band-shift and DNase I footprinting experiments that demonstrate specific binding of the SoxR protein in cell extracts to the soxS promoter. The mode of SoxR binding to DNA appears to be similar to that of its homolog MerR in that the SoxR footprint spans the -10 to -35 region of the soxS promoter. Images PMID:1400156

  5. Evolutionary and Functional Relationships of the dha Regulon by Genomic Context Analysis.


    Martins-Pinheiro, Marinalva; Lima, Wanessa C; Asif, Huma; Oller, Cláudio A; Menck, Carlos F M


    3-hydroxypropionaldehyde (3-HPA) and 1,3-propanediol (1,3-PD) are subproducts of glycerol degradation and of economical interest as they are used for polymers synthesis, such as polyesters and polyurethanes. Some few characterized bacterial species (mostly from Firmicutes and Gamma-proteobacteria groups) are able to catabolize these monomers from glycerol using the gene products from the dha regulon. To expand our knowledge and direct further experimental studies on the regulon and related genes for the anaerobic glycerol metabolism, an extensive genomic screening was performed to identify the presence of the dha genes in fully sequenced prokaryotic genomes. Interestingly, this work shows that although only few bacteria species are known to produce 3-HPA or 1,3-PD, the incomplete regulon is found in more than 100 prokaryotic genomes. However, the complete pathway is found only in a few dozen species belonging to five different taxonomic groups, including one Archaea species, Halalkalicoccus jeotgali. Phylogenetic analysis and conservation of both gene synteny and primary sequence similarity reinforce the idea that these genes have a common origin and were possibly acquired by lateral gene transfer (LGT). Besides the evolutionary aspect, the identification of homologs from several different organisms may predict potential alternative targets for faster or more efficient biological synthesis of 3-HPA or 1,3-PD. PMID:26938861

  6. Evolutionary and Functional Relationships of the dha Regulon by Genomic Context Analysis

    PubMed Central

    Martins-Pinheiro, Marinalva; Lima, Wanessa C.; Asif, Huma; Oller, Cláudio A.; Menck, Carlos F. M.


    3-hydroxypropionaldehyde (3-HPA) and 1,3-propanediol (1,3-PD) are subproducts of glycerol degradation and of economical interest as they are used for polymers synthesis, such as polyesters and polyurethanes. Some few characterized bacterial species (mostly from Firmicutes and Gamma-proteobacteria groups) are able to catabolize these monomers from glycerol using the gene products from the dha regulon. To expand our knowledge and direct further experimental studies on the regulon and related genes for the anaerobic glycerol metabolism, an extensive genomic screening was performed to identify the presence of the dha genes in fully sequenced prokaryotic genomes. Interestingly, this work shows that although only few bacteria species are known to produce 3-HPA or 1,3-PD, the incomplete regulon is found in more than 100 prokaryotic genomes. However, the complete pathway is found only in a few dozen species belonging to five different taxonomic groups, including one Archaea species, Halalkalicoccus jeotgali. Phylogenetic analysis and conservation of both gene synteny and primary sequence similarity reinforce the idea that these genes have a common origin and were possibly acquired by lateral gene transfer (LGT). Besides the evolutionary aspect, the identification of homologs from several different organisms may predict potential alternative targets for faster or more efficient biological synthesis of 3-HPA or 1,3-PD. PMID:26938861

  7. Functional analysis of Ralstonia solanacearum PrhG regulating the hrp regulon in host plants.


    Zhang, Yong; Chen, Li; Yoshimochi, Takeshi; Kiba, Akinori; Hikichi, Yasufumi; Ohnishi, Kouhei


    Genes in the hrp regulon encode component proteins of the type III secretion system and are essential for the pathogenicity of Ralstonia solanacearum. The hrp regulon is controlled by HrpB. We isolated several genes regulating hrpB expression from the Japanese strain OE1-1 using minitransposon mutagenesis. Among them, we mainly focused on two genes, hrpG and prhG, which are the positive regulators of hrpB. Although the global virulence regulator PhcA negatively regulated hrpG expression via prhIR, it positively regulated prhG expression. We further investigated the contrasting regulation of hrpG and prhG by PhcA and speculated that R. solanacearum may switch from HrpG to PrhG for hrpB activation in a cell density-dependent manner. Although the prhG mutant proliferated similarly to the wild-type in leaf intercellular spaces and in xylem vessels of the host plants, it was less virulent than the wild-type. The expression of the popA operon, which belongs to the hrp regulon, was significantly reduced in the prhG mutant by more than half in the leaf intercellular spaces and more than two-thirds in the xylem vessels when compared with the wild-type. PMID:23704782

  8. Stage-specific expression of protease genes in the apicomplexan parasite, Eimeria tenella

    PubMed Central


    Background Proteases regulate pathogenesis in apicomplexan parasites but investigations of proteases have been largely confined to the asexual stages of Plasmodium falciparum and Toxoplasma gondii. Thus, little is known about proteases in other Apicomplexa, particularly in the sexual stages. We screened the Eimeria tenella genome database for proteases, classified these into families and determined their stage specific expression. Results Over forty protease genes were identified in the E. tenella genome. These were distributed across aspartic (three genes), cysteine (sixteen), metallo (fourteen) and serine (twelve) proteases. Expression of at least fifteen protease genes was upregulated in merozoites including homologs of genes known to be important in host cell invasion, remodelling and egress in P. falciparum and/or T. gondii. Thirteen protease genes were specifically expressed or upregulated in gametocytes; five of these were in two families of serine proteases (S1 and S8) that are over-represented in the coccidian parasites, E. tenella and T. gondii, distinctive within the Apicomplexa because of their hard-walled oocysts. Serine protease inhibitors prevented processing of EtGAM56, a protein from E. tenella gametocytes that gives rise to tyrosine-rich peptides that are incorporated into the oocyst wall. Conclusion Eimeria tenella possesses a large number of protease genes. Expression of many of these genes is upregulated in asexual stages. However, expression of almost one-third of protease genes is upregulated in, or confined to gametocytes; some of these appear to be unique to the Coccidia and may play key roles in the formation of the oocyst wall, a defining feature of this group of parasites. PMID:23216867

  9. Inconsistencies of genome annotations in apicomplexan parasites revealed by 5'-end-one-pass and full-length sequences of oligo-capped cDNAs

    PubMed Central

    Wakaguri, Hiroyuki; Suzuki, Yutaka; Sasaki, Masahide; Sugano, Sumio; Watanabe, Junichi


    Background Apicomplexan parasites are causative agents of various diseases including malaria and have been targets of extensive genomic sequencing. We generated 5'-EST collections for six apicomplexa parasites using our full-length oligo-capping cDNA library method. To improve upon the current genome annotations, as well as to validate the importance for physical cDNA clone resources, we generated a large-scale collection of full-length cDNAs for several apicomplexa parasites. Results In this study, we used a total of 61,056 5'-end-single-pass cDNA sequences from Plasmodium falciparum, P. vivax, P. yoelii, P. berghei, Cryptosporidium parvum, and Toxoplasma gondii. We compared these partially sequenced cDNA sequences with the currently annotated gene models and observed significant inconsistencies between the two datasets. In particular, we found that on average 14% of the exons in the current gene models were not supported by any cDNA evidence, and that 16% of the current gene models may contain at least one mis-annotation and should be re-evaluated. We also identified a large number of transcripts that had been previously unidentified. For 732 cDNAs in T. gondii, the entire sequences were determined in order to evaluate the annotated gene models at the complete full-length transcript level. We found that 41% of the T. gondii gene models contained at least one inconsistency. We also identified and confirmed by RT-PCR 140 previously unidentified transcripts found in the intergenic regions of the current gene annotations. We show that the majority of these discrepancies are due to questionable predictions of one or two extra exons in the upstream or downstream regions of the genes. Conclusion Our data indicates that the current gene models are likely to still be incomplete and have much room for improvement. Our unique full-length cDNA information is especially useful for further refinement of the annotations for the genomes of apicomplexa parasites. PMID:19602295

  10. Babesia divergens and Neospora caninum apical membrane antigen 1 structures reveal selectivity and plasticity in apicomplexan parasite host cell invasion.


    Tonkin, Michelle L; Crawford, Joanna; Lebrun, Maryse L; Boulanger, Martin J


    Host cell invasion by the obligate intracellular apicomplexan parasites, including Plasmodium (malaria) and Toxoplasma (toxoplasmosis), requires a step-wise mechanism unique among known host-pathogen interactions. A key step is the formation of the moving junction (MJ) complex, a circumferential constriction between the apical tip of the parasite and the host cell membrane that traverses in a posterior direction to enclose the parasite in a protective vacuole essential for intracellular survival. The leading model of MJ assembly proposes that Rhoptry Neck Protein 2 (RON2) is secreted into the host cell and integrated into the membrane where it serves as the receptor for apical membrane antigen 1 (AMA1) on the parasite surface. We have previously demonstrated that the AMA1-RON2 interaction is an effective target for inhibiting apicomplexan invasion. To better understand the AMA1-dependant molecular recognition events that promote invasion, including the significant AMA1-RON2 interaction, we present the structural characterization of AMA1 from the apicomplexan parasites Babesia divergens (BdAMA1) and Neospora caninum (NcAMA1) by X-ray crystallography. These studies offer intriguing structural insight into the RON2-binding surface groove in the AMA1 apical domain, which shows clear evidence for receptor-ligand co-evolution, and the hyper variability of the membrane proximal domain, which in Plasmodium is responsible for direct binding to erythrocytes. By incorporating the structural analysis of BdAMA1 and NcAMA1 with existing AMA1 structures and complexes we were able to define conserved pockets in the AMA1 apical groove that could be targeted for the design of broadly reactive therapeutics. PMID:23169033

  11. Mitochondrial genome of Babesia orientalis, apicomplexan parasite of water buffalo (Bubalus babalis, Linnaeus, 1758) endemic in China

    PubMed Central


    Background Apicomplexan parasites of the genus Babesia, Theileria and Plasmodium are very closely related organisms. Interestingly, their mitochondrial (mt) genomes are highly divergent. Among Babesia, Babesia orientalis is a new species recently identified and specifically epidemic to the southern part of China, causing severe disease to water buffalo. However, no information on the mt genome of B. orientalis was available. Methods Four pairs of primers were designed based on the full genome sequence of B. orientalis (unpublished data) and by aligning reported mt genomes of B. bovis, B. bigemina, and T. parva. The entire mt genome was amplified by four sets of PCR. The obtained mt genome was annotated by aligning with published apicomplexan mt genomes and Artemis software v11. Phylogenetic analysis was performed by using cox1 and cob amino acid sequences. Results The complete mt genome of B. orientalis (Wuhan strain) was sequenced and characterized. The entire mt genome is 5996 bp in length with a linear form, containing three protein-coding genes including cytochrome c oxidase I (cox1), cytochrome b (cob) and cytochrome c oxidase III (cox3) and six rRNA large subunit gene fragments. The gene arrangement in B. orientalis mt genome is similar to those of B. bovis, B. gibsoni and Theileria parva, but different from those of T. orientalis, T. equi and Plasmodium falciparum. Comparative analysis indicated that cox1 and cob genes were more conserved than cox3. Phylogenetic analysis based on amino acid sequences of cox1, cob and cox1 + cob, respectively, revealed that B. orientalis fell into Babesia clade with the closest relationship to B. bovis. Conclusions The availability of the entire mt genome sequences of B. orientalis provides valuable information for future phylogenetic, population genetics and molecular epidemiological studies of apicomplexan parasites. PMID:24580772

  12. Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus

    SciTech Connect

    Rodionov, Dmitry A.; Novichkov, Pavel; Stavrovskaya, Elena D.; Rodionova, Irina A.; Li, Xiaoqing; Kazanov, Marat D.; Ravcheev, Dmitry A.; Gerasimova, Anna V.; Kazakov, Alexey E.; Kovaleva, Galina Y.; Permina, Elizabeth A.; Laikova, Olga N.; Overbeek, Ross; Romine, Margaret F.; Fredrickson, Jim K.; Arkin, Adam P.; Dubchak, Inna; Osterman, Andrei L.; Gelfand, Mikhail S.


    Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. Despite the growing number of genome-scale gene expression studies, our abilities to convert the results of these studies into accurate regulatory annotations and to project them from model to other organisms are extremely limited. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. However, even orthologous regulators with conserved DNA-binding motifs may control substantially different gene sets, revealing striking differences in regulatory strategies between the Shewanella spp. and E. coli. Multiple examples of regulatory network rewiring include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), and numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. NagR for N-acetylglucosamine catabolism and PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp).

  13. In the NadR Regulon, Adhesins and Diverse Meningococcal Functions Are Regulated in Response to Signals in Human Saliva

    PubMed Central

    Fagnocchi, Luca; Pigozzi, Eva; Scarlato, Vincenzo


    The Neisseria meningitidis regulator NadR was shown to repress expression of the NadA adhesin and play a major role in NadA phase-variable expression. In this study, we identified through microarray analysis over 30 genes coregulated with nadA in the NadR mutant and defined members of the NadR regulon through in vitro DNA-binding assays. Two distinct types of promoter architectures (I and II) were identified for NadR targets, differing in both the number and position of NadR-binding sites. All NadR-regulated genes investigated were found to respond to 4-hydroxyphenylacetic acid (4HPA), a small molecule secreted in human saliva, which was previously demonstrated to induce nadA expression by alleviating NadR-dependent repression. Interestingly, two types of NadR 4HPA responsive activities were found on different NadR targets corresponding to the two types of genes identified by different promoter architectures: while NadA and the majority of NadR targets (type I) are induced, only the MafA adhesins (type II) are corepressed in response to the same 4HPA signal. This alternate behavior of NadR was confirmed in a panel of strains in response to 4HPA and after incubation in saliva. The in vitro NadR binding activity at type I and type II promoter regions is differentially affected by 4HPA, suggesting that the nature of the NadR binding sites may define the regulation to which they will be subjected. We conclude that NadR coordinates a broad transcriptional response to signals present in human saliva, mimicked in vitro by 4HPA, enabling the meningococcus to adapt to the relevant host niche. PMID:22081399

  14. Activation of the SoxR regulon in Streptomyces coelicolor by the extracellular form of the pigmented antibiotic actinorhodin.


    Shin, Jung-Ho; Singh, Atul K; Cheon, Dong-Joo; Roe, Jung-Hye


    The redox-sensitive transcription factor SoxR in enteric bacteria senses and regulates the cellular response to superoxide and nitric oxide. In other bacterial groups, however, it may respond to redox-active small molecules, as demonstrated for pyocyanin sensing in pseudomonads. The antibiotic-producing soil bacterium Streptomyces coelicolor contains a gene for an SoxR homologue (SCO1697) whose DNA recognition helix is identical to that of Escherichia coli SoxR. Using the E. coli SoxR binding sequence, we predicted five candidate genes of the SoxR regulon and demonstrated that SoxR binds to their promoter regions and activates their expression concurrently with the production of the blue antibiotic actinorhodin (a benzoisochromanequinone). These genes encode a probable NADPH-dependent flavin reductase (SCO2478), an NADPH-dependent quinone reductase (SCO4266), an ABC transporter (SCO7008), a monooxygenase (SCO1909), and a hypothetical protein (SCO1178). Addition of actinorhodin to exponentially growing cells activated the expression of SoxR target genes in an SoxR-dependent manner. The secreted ?-actinorhodin was over 10-fold more effective in activation than the intracellular form of actinorhodin, suggesting that SoxR is specified to respond more to exogenous signals than to intracellular metabolites. The ?soxR mutant was not compromised in resistance against oxidants but was slow in forming aerial mycelium on R2YE medium with reduced sporulation, and its production of actinorhodin and undecylprodigiosin was lowered by about 50% and 30%, respectively, compared to that of the wild type. These results support the proposal that SoxR senses redox-active molecules, such as actinorhodin in S. coelicolor, and induces a protective function against them. It also functions to ensure that cells undergo optimal differentiation and secondary metabolite production. PMID:21037009

  15. Mathematical model of GAL regulon dynamics in Saccharomyces cerevisiae.


    Apostu, Raluca; Mackey, Michael C


    Genetic switches are prevalent in nature and provide cells with a strategy to adapt to changing environments. The GAL switch is an intriguing example which is not understood in all detail. The GAL switch allows organisms to metabolize galactose, and controls whether the machinery responsible for the galactose metabolism is turned on or off. Currently, it is not known exactly how the galactose signal is sensed by the transcriptional machinery. Here we utilize quantitative tools to understand the S. cerevisiae cell response to galactose challenge, and to analyze the plausible molecular mechanisms underlying its operation. We work at a population level to develop a dynamic model based on the interplay of the key regulatory proteins Gal4p, Gal80p, and Gal3p. To our knowledge, the model presented here is the first to reproduce qualitatively the bistable network behavior found experimentally. Given the current understanding of the GAL circuit induction (Wightman et al., 2008; Jiang et al., 2009), we propose that the most likely in vivo mechanism leading to the transcriptional activation of the GAL genes is the physical interaction between galactose-activated Gal3p and Gal80p, with the complex Gal3p-Gal80p remaining bound at the GAL promoters. Our mathematical model is in agreement with the flow cytometry profiles of wild type, gal3? and gal80? mutant strains from Acar et al. (2005), and involves a fraction of actively transcribing cells with the same qualitative features as in the data set collected by Acar et al. (2010). Furthermore, the computational modeling provides an explanation for the contradictory results obtained by independent laboratories when tackling experimentally the issue of binary versus graded response to galactose induction. PMID:22024631

  16. The Eimeria transcript DB: an integrated resource for annotated transcripts of protozoan parasites of the genus Eimeria.


    Rangel, Luiz Thibério; Novaes, Jeniffer; Durham, Alan M; Madeira, Alda Maria B N; Gruber, Arthur


    Parasites of the genus Eimeria infect a wide range of vertebrate hosts, including chickens. We have recently reported a comparative analysis of the transcriptomes of Eimeria acervulina, Eimeria maxima and Eimeria tenella, integrating ORESTES data produced by our group and publicly available Expressed Sequence Tags (ESTs). All cDNA reads have been assembled, and the reconstructed transcripts have been submitted to a comprehensive functional annotation pipeline. Additional studies included orthology assignment across apicomplexan parasites and clustering analyses of gene expression profiles among different developmental stages of the parasites. To make all this body of information publicly available, we constructed the Eimeria Transcript Database (EimeriaTDB), a web repository that provides access to sequence data, annotation and comparative analyses. Here, we describe the web interface, available sequence data sets and query tools implemented on the site. The main goal of this work is to offer a public repository of sequence and functional annotation data of reconstructed transcripts of parasites of the genus Eimeria. We believe that EimeriaTDB will represent a valuable and complementary resource for the Eimeria scientific community and for those researchers interested in comparative genomics of apicomplexan parasites. Database URL: PMID:23411718

  17. The Eimeria Transcript DB: an integrated resource for annotated transcripts of protozoan parasites of the genus Eimeria

    PubMed Central

    Rangel, Luiz Thibério; Novaes, Jeniffer; Durham, Alan M.; Madeira, Alda Maria B. N.; Gruber, Arthur


    Parasites of the genus Eimeria infect a wide range of vertebrate hosts, including chickens. We have recently reported a comparative analysis of the transcriptomes of Eimeria acervulina, Eimeria maxima and Eimeria tenella, integrating ORESTES data produced by our group and publicly available Expressed Sequence Tags (ESTs). All cDNA reads have been assembled, and the reconstructed transcripts have been submitted to a comprehensive functional annotation pipeline. Additional studies included orthology assignment across apicomplexan parasites and clustering analyses of gene expression profiles among different developmental stages of the parasites. To make all this body of information publicly available, we constructed the Eimeria Transcript Database (EimeriaTDB), a web repository that provides access to sequence data, annotation and comparative analyses. Here, we describe the web interface, available sequence data sets and query tools implemented on the site. The main goal of this work is to offer a public repository of sequence and functional annotation data of reconstructed transcripts of parasites of the genus Eimeria. We believe that EimeriaTDB will represent a valuable and complementary resource for the Eimeria scientific community and for those researchers interested in comparative genomics of apicomplexan parasites. Database URL: PMID:23411718

  18. Three-dimensional visualisation of developmental stages of an apicomplexan fish blood parasite in its invertebrate host

    PubMed Central


    Background Although widely used in medicine, the application of three-dimensional (3D) imaging to parasitology appears limited to date. In this study, developmental stages of a marine fish haemogregarine, Haemogregarina curvata (Apicomplexa: Adeleorina), were investigated in their leech vector, Zeylanicobdella arugamensis; this involved 3D visualisation of brightfield and confocal microscopy images of histological sections through infected leech salivary gland cells. Findings 3D assessment demonstrated the morphology of the haemogregarine stages, their spatial layout, and their relationship with enlarged host cells showing reduced cellular content. Haemogregarine meronts, located marginally within leech salivary gland cells, had small tail-like connections to the host cell limiting membrane; this parasite-host cell interface was not visible in two-dimensional (2D) light micrographs and no records of a similar connection in apicomplexan development have been traced. Conclusions This is likely the first account of the use of 3D visualisation to study developmental stages of an apicomplexan parasite in its invertebrate vector. Elucidation of the extent of development of the haemogregarine within the leech salivary cells, together with the unusual connections between meronts and the host cell membrane, illustrates the future potential of 3D visualisation in parasite-vector biology. PMID:22107751

  19. Disassembly activity of actin-depolymerizing factor (ADF) is associated with distinct cellular processes in apicomplexan parasites

    PubMed Central

    Haase, Silvia; Zimmermann, Dennis; Olshina, Maya A.; Wilkinson, Mark; Fisher, Fabio; Tan, Yan Hong; Stewart, Rebecca J.; Tonkin, Christopher J.; Wong, Wilson; Kovar, David R.; Baum, Jake


    Proteins of the actin-depolymerizing factor (ADF)/cofilin family have been shown to be crucial for the motility and survival of apicomplexan parasites. However, the mechanisms by which ADF proteins fulfill their function remain poorly understood. In this study, we investigate the comparative activities of ADF proteins from Toxoplasma gondii and Plasmodium falciparum, the human malaria parasite, using a conditional T. gondii ADF-knockout line complemented with ADF variants from either species. We show that P. falciparum ADF1 can fully restore native TgADF activity, demonstrating functional conservation between parasites. Strikingly, mutation of a key basic residue (Lys-72), previously implicated in disassembly in PfADF1, had no detectable phenotypic effect on parasite growth, motility, or development. In contrast, organelle segregation was severely impaired when complementing with a TgADF mutant lacking the corresponding residue (Lys-68). Biochemical analyses of each ADF protein confirmed the reduced ability of lysine mutants to mediate actin depolymerization via filament disassembly although not severing, in contrast to previous reports. These data suggest that actin filament disassembly is essential for apicomplexan parasite development but not for motility, as well as pointing to genus-specific coevolution between ADF proteins and their native actin. PMID:26157165

  20. Towards a molecular understanding of the apicomplexan actin motor: on a road to novel targets for malaria remedies?

    PubMed Central

    Kumpula, Esa-Pekka; Kursula, Inari


    Apicomplexan parasites are the causative agents of notorious human and animal diseases that give rise to considerable human suffering and economic losses worldwide. The most prominent parasites of this phylum are the malaria-causing Plasmodium species, which are widespread in tropical and subtropical regions, and Toxoplasma gondii, which infects one third of the worlds population. These parasites share a common form of gliding motility which relies on an actinmyosin motor. The components of this motor and the actin-regulatory proteins in Apicomplexa have unique features compared with all other eukaryotes. This, together with the crucial roles of these proteins, makes them attractive targets for structure-based drug design. In recent years, several structures of glideosome components, in particular of actins and actin regulators from apicomplexan parasites, have been determined, which will hopefully soon allow the creation of a complete molecular picture of the parasite actinmyosin motor and its regulatory machinery. Here, current knowledge of the function of this motor is reviewed from a structural perspective. PMID:25945702

  1. Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks

    SciTech Connect

    Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.; Alm, EricJ.; Gelfand, Mikhail S.


    Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the result, we demonstrate considerable interconnection between various nitrogen-oxides-responsive regulatory systems for the denitrification and NO detoxification genes and evolutionary plasticity of this transcriptional network.

  2. Nitrofurantoin, phenazopyridine, and the superoxide-response regulon soxRS of Escherichia coli.


    Amábile-Cuevas, Carlos F; Arredondo-García, José Luis


    Nitrofurantoin and phenazopyridine are two drugs commonly used against urinary tract infections. Both compounds exert oxidative damage in patients deficient in glucose-6-phosphate dehydrogenase. This study was done to assess the interactions of these drugs with the soxRS regulon of Escherichia coli, a superoxide-defense system (that includes a nitroreductase that yields the active metabolite of nitrofurantoin) involved in antibiotic multi-resistance. The effects of either nitrofurantoin or phenazopyridine, upon strains with different soxRS genotypes, were measured as minimum inhibitory concentrations (MICs) and growth curves. Also, the ability of these drugs to induce the expression of a soxS'::lacZ gene fusion was assessed. The effect of antibiotics in the presence of phenazopyridine, paraquat (a known soxRS inducer), or an efflux inhibitor, was measured using the disk diffusion method. A strain constitutively expressing the soxRS regulon was slightly more susceptible to nitrofurantoin, and more resistant to phenazopyridine, compared to wild-type and soxRS-deleted strains, during early treatment, but 24-h MICs were the same (8 mg/l nitrofurantoin, 1,000 mg/l phenazopyridine) for all strains. Both compounds were capable of inducing the expression of a soxS'::lacZ fusion, but less than paraquat. Subinhibitory concentrations of phenazopyridine increased the antimicrobial effect of ampicillin, chloramphenicol, tetracycline, and nitrofurantoin. The induction or constitutive expression of the soxRS regulon seems to be a disadvantage for E. coli during nitrofurantoin exposure; but might be an advantage during phenazopyridine exposure, indicating that the latter compound could act as a selective pressure for mutations related to virulence and antibiotic multi-resistance. PMID:23793794

  3. Global Regulatory Impact of ClpP Protease of Staphylococcus aureus on Regulons Involved in Virulence, Oxidative Stress Response, Autolysis, and DNA Repair†

    PubMed Central

    Michel, Antje; Agerer, Franziska; Hauck, Christof R.; Herrmann, Mathias; Ullrich, Joachim; Hacker, Jörg; Ohlsen, Knut


    Staphylococcus aureus is an important pathogen, causing a wide range of infections including sepsis, wound infections, pneumonia, and catheter-related infections. In several pathogens ClpP proteases were identified by in vivo expression technologies to be important for virulence. Clp proteolytic complexes are responsible for adaptation to multiple stresses by degrading accumulated and misfolded proteins. In this report clpP, encoding the proteolytic subunit of the ATP-dependent Clp protease, was deleted, and gene expression of ΔclpP was determined by global transcriptional analysis using DNA-microarray technology. The transcriptional profile reveals a strong regulatory impact of ClpP on the expression of genes encoding proteins that are involved in the pathogenicity of S. aureus and adaptation of the pathogen to several stresses. Expression of the agr system and agr-dependent extracellular virulence factors was diminished. Moreover, the loss of clpP leads to a complete transcriptional derepression of genes of the CtsR- and HrcA-controlled heat shock regulon and a partial derepression of genes involved in oxidative stress response, metal homeostasis, and SOS DNA repair controlled by PerR, Fur, MntR, and LexA. The levels of transcription of genes encoding proteins involved in adaptation to anaerobic conditions potentially regulated by an Fnr-like regulator were decreased. Furthermore, the expression of genes whose products are involved in autolysis was deregulated, leading to enhanced autolysis in the mutant. Our results indicate a strong impact of ClpP proteolytic activity on virulence, stress response, and physiology in S. aureus. PMID:16885446

  4. Evidence of tRNA cleavage in apicomplexan parasites: half-tRNAs as new potential regulatory molecules of Toxoplasma gondii and Plasmodium berghei

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several lines of evidence demonstrated that organisms ranging from bacteria to higher animals possess a regulated endonucleolytic cleavage pathway producing half-tRNA fragments. In the present study, we investigated the occurrence of this phenomenon in two distantly related apicomplexan parasites, T...

  5. Transcriptomic Analysis Reveals Evidence for a Cryptic Plastid in the Colpodellid Voromonas pontica, a Close Relative of Chromerids and Apicomplexan Parasites

    PubMed Central

    Gile, Gillian H.; Slamovits, Claudio H.


    Colpodellids are free-living, predatory flagellates, but their close relationship to photosynthetic chromerids and plastid-bearing apicomplexan parasites suggests they were ancestrally photosynthetic. Colpodellids may therefore retain a cryptic plastid, or they may have lost their plastids entirely, like the apicomplexan Cryptosporidium. To find out, we generated transcriptomic data from Voromonas pontica ATCC 50640 and searched for homologs of genes encoding proteins known to function in the apicoplast, the non-photosynthetic plastid of apicomplexans. We found candidate genes from multiple plastid-associated pathways including iron-sulfur cluster assembly, isoprenoid biosynthesis, and tetrapyrrole biosynthesis, along with a plastid-type phosphate transporter gene. Four of these sequences include the 5? end of the coding region and are predicted to encode a signal peptide and a transit peptide-like region. This is highly suggestive of targeting to a cryptic plastid. We also performed a taxon-rich phylogenetic analysis of small subunit ribosomal RNA sequences from colpodellids and their relatives, which suggests that photosynthesis was lost more than once in colpodellids, and independently in V. pontica and apicomplexans. Colpodellids therefore represent a valuable source of comparative data for understanding the process of plastid reduction in humanity's most deadly parasite. PMID:24797661

  6. DB-AT: a 2015 update to the Full-parasites database brings a multitude of new transcriptomic data for apicomplexan parasites.


    J?kalski, Marcin; Wakaguri, Hiroyuki; Kischka, Tabea G; Nishikawa, Yoshifumi; Kawazu, Shin-ichiro; Matsubayashi, Makoto; Kawahara, Fumiya; Tsuji, Naotoshi; Cao, Shinuo; Sunaga, Fujiko; Xuan, Xuenan; Okubo, Kazuhiro; Igarashi, Ikuo; Tuda, Josef; Mongan, Arthur E; Eshita, Yuki; Maeda, Ryuichiro; Maka?owski, Wojciech; Suzuki, Yutaka; Yamagishi, Junya


    The previous release of our Full-parasites database ( brought enhanced functionality, an expanded full-length cDNA content, and new RNA-Seq datasets from several important apicomplexan parasites. The 2015 update witnesses the major shift in the databases content with focus on diverse transcriptomes of the apicomplexan parasites. The content of the database was substantially enriched with transcriptome information for new apicomplexan parasites. The latest version covers a total of 17 species, with addition of our newly generated RNA-Seq data of a total of 909,150,388 tags. Moreover, we have generated and included two novel and unique datasets, which represent diverse nature of transcriptomes in individual parasites in vivo and in vitro. One is the data collected from 116 Indonesian patients infected with Plasmodium falciparum. The other is a series of transcriptome data collected from a total of 38 single cells of P. falciparum cultured in vitro. We believe that with the recent advances our database becomes an even better resource and a unique platform in the analysis of apicomplexan parasites and their interaction with their hosts. To adequately reflect the recent modifications and the current content we have changed the database name to DB-AT--DataBase of Apicomplexa Transcriptomes. PMID:25414358

  7. Transcriptomic analysis reveals evidence for a cryptic plastid in the colpodellid Voromonas pontica, a close relative of chromerids and apicomplexan parasites.


    Gile, Gillian H; Slamovits, Claudio H


    Colpodellids are free-living, predatory flagellates, but their close relationship to photosynthetic chromerids and plastid-bearing apicomplexan parasites suggests they were ancestrally photosynthetic. Colpodellids may therefore retain a cryptic plastid, or they may have lost their plastids entirely, like the apicomplexan Cryptosporidium. To find out, we generated transcriptomic data from Voromonas pontica ATCC 50640 and searched for homologs of genes encoding proteins known to function in the apicoplast, the non-photosynthetic plastid of apicomplexans. We found candidate genes from multiple plastid-associated pathways including iron-sulfur cluster assembly, isoprenoid biosynthesis, and tetrapyrrole biosynthesis, along with a plastid-type phosphate transporter gene. Four of these sequences include the 5' end of the coding region and are predicted to encode a signal peptide and a transit peptide-like region. This is highly suggestive of targeting to a cryptic plastid. We also performed a taxon-rich phylogenetic analysis of small subunit ribosomal RNA sequences from colpodellids and their relatives, which suggests that photosynthesis was lost more than once in colpodellids, and independently in V. pontica and apicomplexans. Colpodellids therefore represent a valuable source of comparative data for understanding the process of plastid reduction in humanity's most deadly parasite. PMID:24797661

  8. DB-AT: a 2015 update to the Full-parasites database brings a multitude of new transcriptomic data for apicomplexan parasites

    PubMed Central

    Jąkalski, Marcin; Wakaguri, Hiroyuki; Kischka, Tabea G.; Nishikawa, Yoshifumi; Kawazu, Shin-ichiro; Matsubayashi, Makoto; Kawahara, Fumiya; Tsuji, Naotoshi; Cao, Shinuo; Sunaga, Fujiko; Xuan, Xuenan; Okubo, Kazuhiro; Igarashi, Ikuo; Tuda, Josef; Mongan, Arthur E.; Eshita, Yuki; Maeda, Ryuichiro; Makałowski, Wojciech; Suzuki, Yutaka; Yamagishi, Junya


    The previous release of our Full-parasites database ( brought enhanced functionality, an expanded full-length cDNA content, and new RNA-Seq datasets from several important apicomplexan parasites. The 2015 update witnesses the major shift in the databases content with focus on diverse transcriptomes of the apicomplexan parasites. The content of the database was substantially enriched with transcriptome information for new apicomplexan parasites. The latest version covers a total of 17 species, with addition of our newly generated RNA-Seq data of a total of 909 150 388 tags. Moreover, we have generated and included two novel and unique datasets, which represent diverse nature of transcriptomes in individual parasites in vivo and in vitro. One is the data collected from 116 Indonesian patients infected with Plasmodium falciparum. The other is a series of transcriptome data collected from a total of 38 single cells of P. falciparum cultured in vitro. We believe that with the recent advances our database becomes an even better resource and a unique platform in the analysis of apicomplexan parasites and their interaction with their hosts. To adequately reflect the recent modifications and the current content we have changed the database name to DB-AT—DataBase of Apicomplexa Transcriptomes. PMID:25414358

  9. Mg(2+) signalling defines the group A streptococcal CsrRS (CovRS) regulon.


    Gryllos, Ioannis; Grifantini, Renata; Colaprico, Annalisa; Jiang, Shengmei; Deforce, Emelia; Hakansson, Anders; Telford, John L; Grandi, Guido; Wessels, Michael R


    CsrRS (or CovRS) is a two-component system implicated in the control of multiple virulence determinants in the important human pathogen, group A Streptococcus (GAS). Earlier studies suggested that extracellular Mg(2+) signalled through the presumed sensor histidine kinase, CsrS. We now confirm those findings, as complementation of a csrS mutant restored Mg(2+)-dependent gene regulation. Moreover, we present strong evidence that Mg(2+) signals through CsrS to regulate an extensive and previously undefined repertoire of GAS genes. The effect of Mg(2+) on regulation of global gene expression was evaluated using genomic microarrays in an M-type 3 strain of GAS and in an isogenic csrS mutant. Unexpectedly, of the 72 genes identified in the Mg(2+)-stimulated CsrRS regulon, 42 were absent from the CsrR regulon (the latter being defined by comparison of wild-type and CsrR mutant transcriptomes at low Mg(2+)). We observed CsrS-dependent regulation of 72 of the 73 genes whose expression changed in response to elevated extracellular Mg(2+) in wild-type bacteria, a result that identifies CsrS as the principal, if not exclusive, sensor for extracellular Mg(2+) in GAS. To our knowledge, this study is the first to characterize global gene regulation by a GAS two-component system in response to a specific environmental stimulus. PMID:17608796

  10. Characterization of the Fur Regulon in Pseudomonas syringae pv. tomato DC3000▿†

    PubMed Central

    Butcher, Bronwyn G.; Bronstein, Philip A.; Myers, Christopher R.; Stodghill, Paul V.; Bolton, James J.; Markel, Eric J.; Filiatrault, Melanie J.; Swingle, Bryan; Gaballa, Ahmed; Helmann, John D.; Schneider, David J.; Cartinhour, Samuel W.


    The plant pathogen Pseudomonas syringae pv. tomato DC3000 (DC3000) is found in a wide variety of environments and must monitor and respond to various environmental signals such as the availability of iron, an essential element for bacterial growth. An important regulator of iron homeostasis is Fur (ferric uptake regulator), and here we present the first study of the Fur regulon in DC3000. Using chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-seq), 312 chromosomal regions were highly enriched by coimmunoprecipitation with a C-terminally tagged Fur protein. Integration of these data with previous microarray and global transcriptome analyses allowed us to expand the putative DC3000 Fur regulon to include genes both repressed and activated in the presence of bioavailable iron. Using nonradioactive DNase I footprinting, we confirmed Fur binding in 41 regions, including upstream of 11 iron-repressed genes and the iron-activated genes encoding two bacterioferritins (PSPTO_0653 and PSPTO_4160), a ParA protein (PSPTO_0855), and a two-component system (TCS) (PSPTO_3382 to PSPTO_3380). PMID:21784947

  11. BCKDH: The Missing Link in Apicomplexan Mitochondrial Metabolism Is Required for Full Virulence of Toxoplasma gondii and Plasmodium berghei

    PubMed Central

    Oppenheim, Rebecca D.; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P.; Billker, Oliver; McConville, Malcolm J.; Soldati-Favre, Dominique


    While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens. PMID:25032958

  12. Biochemical characterization of FIKK8 – A unique protein kinase from the malaria parasite Plasmodium falciparum and other apicomplexans

    PubMed Central

    Osman, Khan T.; Lou, Hua Jane; Qiu, Wei; Brand, Verena; Edwards, Aled M.; Turk, Benjamin E.; Hui, Raymond


    FIKKs are protein kinases with distinctive sequence motifs found exclusively in Apicomplexa. Here, we report on the biochemical characterization of Plasmodium falciparum FIKK8 (PfFIKK8) and its Cryptosporidium parvum orthologue (CpFIKK) – the only member of the family predicted to be cytosolic and conserved amongst non-Plasmodium parasites. Recombinant protein samples of both were catalytically active. We characterized their phosphorylation ability using an enzymatic assay and substrate specificities using an arrayed positional scanning peptide library. Our results show that FIKK8 targets serine, preferably with arginine in the +3 and −3 positions. Furthermore, the soluble and active FIKK constructs in our experiments contained an N-terminal extension (NTE) conserved in FIKK8 orthologues from other apicomplexan species. Based on our results, we propose that this NTE is an integral feature of the FIKK subfamily. PMID:26112892

  13. The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.


    Chen, Y M; Zhu, Y; Lin, E C


    In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans. PMID:3325779

  14. TrxR, a New CovR-Repressed Response Regulator That Activates the Mga Virulence Regulon in Group A Streptococcus?

    PubMed Central

    Leday, Temekka V.; Gold, Kathryn M.; Kinkel, Traci L.; Roberts, Samantha A.; Scott, June R.; McIver, Kevin S.


    Coordinate regulation of virulence factors by the group A streptococcus (GAS) Streptococcus pyogenes is important in this pathogen's ability to cause disease. To further elucidate the regulatory network in this human pathogen, the CovR-repressed two-component system (TCS) trxSR was chosen for further analysis based on its homology to a virulence-related TCS in Streptococcus pneumoniae. In a murine skin infection model, an insertion mutation in the response regulator gene, trxR, led to a significant reduction in lesion size, lesion severity, and lethality. Curing the trxR mutation restored virulence comparable to the wild-type strain. The trxSR operon was defined in vivo, and CovR was found to directly repress its promoter in vitro. DNA microarray analysis established that TrxR activates transcription of Mga-regulated virulence genes, which may explain the virulence attenuation of the trxR mutant. This regulation appears to occur by activation of the mga promoter, Pmga, as demonstrated by analysis of a luciferase reporter fusion. Complementation of the trxR mutant with trxR on a plasmid restored expression of Mga regulon genes and restored virulence in the mouse model to wild-type levels. TrxR is the first TCS shown to regulate Mga expression. Because it is CovR repressed, TrxR defines a new pathway by which CovR can influence Mga to affect pathogenesis in the GAS. PMID:18678666

  15. The TviA auxiliary protein renders the Salmonella enterica serotype Typhi RcsB regulon responsive to changes in osmolarity

    PubMed Central

    Winter, Sebastian E.; Winter, Maria G.; Thiennimitr, Parameth; Gerriets, Valerie A.; Nuccio, Sean-Paul; Rüssmann, Holger; Bäumler, Andreas J.


    In response to osmolarity, Salmonella enterica serotype Typhi (S. Typhi) regulates genes required for Vi capsular antigen expression oppositely to those required for motility and invasion. Previous studies suggest that osmoregulation of motility, invasion and capsule expression is mediated through the RcsC/RcsD/RcsB phosphorelay system. Here we performed gene expression profiling and functional studies to determine the role of TviA, an auxiliary protein of the RcsB response regulator, in controlling virulence gene expression in S. Typhi. TviA repressed expression of genes encoding flagella and the invasion associated type III secretion system (T3SS-1) through repression of the flagellar regulators flhDC and fliZ, resulting in reduced invasion, reduced motility and reduced expression of FliC. Both RcsB and TviA repressed expression of flhDC, but only TviA altered flhDC expression in response to osmolarity. Introduction of tviA into S. enterica serotype Typhimurium rendered flhDC transcription sensitive to changes in osmolarity. These data suggest that the auxiliary TviA protein integrates a new regulatory input into the RcsB regulon of S. Typhi, thereby altering expression of genes encoding flagella, the Vi antigen and T3SS-1 in response to osmolarity. PMID:19703107

  16. Two-dimensional electrophoresis analysis of the extracellular proteome of Bacillus cereus reveals the importance of the PlcR regulon.


    Gohar, Michel; kstad, Ole Andreas; Gilois, Nathalie; Sanchis, Vincent; Kolst, Anne-Brit; Lereclus, Didier


    Many virulence factors are secreted by the gram-positive, spore forming bacterium Bacillus cereus. Most of them are regulated by the transcriptional activator, PlcR, which is maximally expressed at the beginning of the stationary phase. We used a proteomic approach to study the impact of the PlcR regulon on the secreted proteins of B. cereus, by comparing the extracellular proteomes of strains ATCC 14579 and ATCC 14579 Delta plcR, in which plcR has been disrupted. Our study indicated that, quantitatively, most of the proteins secreted at the onset of the stationary phase are putative virulence factors, all of which are regulated, directly or indirectly, by PlcR. The inactivation of plcR abolished the secretion of some of these virulence factors, and strongly decreased that of others. The genes encoding proteins that are not secreted in the DeltaplcR mutant possessed a regulatory sequence, the PlcR box, upstream from their coding sequence. These proteins include collagenase, phospholipases, haemolysins, proteases and enterotoxins. Proteins for which the secretion was strongly decreased, but not abolished, in the DeltaplcR mutant did not display the PlcR box upstream from their genes. These proteins include flagellins and InhA2. InhA2 is a homologue of InhA, a Bacillus thuringiensis metalloprotease that specifically degrades antibacterial peptides. The mechanism by which PlcR affects the production of flagellins and InhA2 is not known. PMID:12112862

  17. Zinc starvation induces a stress response in Saccharomyces cerevisiae that is mediated by the Msn2p and Msn4p transcriptional activators.


    Gauci, Victoria J; Beckhouse, Anthony G; Lyons, Victoria; Beh, Eric J; Rogers, Peter J; Dawes, Ian W; Higgins, Vincent J


    During the production of wine and beer, the yeast Saccharomyces cerevisiae can encounter an environment that is deficient in zinc, resulting in a 'sluggish' or a 'stuck' ferment. It has been shown that the Zap1p-transcription factor induces the expression of a regulon in response to zinc deficiency; however, it was evident that a separate regulon was also activated during zinc deficiency in a Zap1p-independent manner. This study discovered the Msn2p and Msn4p (Msn2/4p) transcriptional activator proteins to be an additional control mechanism inducing the stress response during zinc deficiency. Promoter sequence analysis identified the stress-response element (STRE) motif, recognized by Msn2/4p, and was significantly enriched in the promoters of genes induced by zinc deficiency. An investigation using genome-wide analyses revealed a distinct regulon consisting of STRE-containing genes whose zinc-responsive expression was abolished in an msn2 msn4 double mutant. An STRE-driven lacZ reporter construct confirmed that expression of the genes within this regulon was perturbed by the deletion of MSN2 and MSN4 and also implicated Hog1p as a contributing factor. This research provides a better understanding of the molecular mechanisms involved in the yeast response to zinc deficiency during fermentation. PMID:19702872

  18. Binding of Shewanella FadR to the fabA fatty acid biosynthetic gene: implications for contraction of the fad regulon.


    Zhang, Huimin; Zheng, Beiwen; Gao, Rongsui; Feng, Youjun


    The Escherichia coli fadR protein product, a paradigm/prototypical FadR regulator, positively regulates fabA and fabB, the two critical genes for unsaturated fatty acid (UFA) biosynthesis. However the scenario in the other ?-proteobacteria, such as Shewanella with the marine origin, is unusual in that Rodionov and coworkers predicted that only fabA (not fabB) has a binding site for FadR protein. It raised the possibility of fad regulon contraction. Here we report that this is the case. Sequence alignment of the FadR homologs revealed that the N-terminal DNA-binding domain exhibited remarkable similarity, whereas the ligand-accepting motif at C-terminus is relatively-less conserved. The FadR homologue of S. oneidensis (referred to FadR_she) was over-expressed and purified to homogeneity. Integrative evidence obtained by FPLC (fast protein liquid chromatography) and chemical cross-linking analyses elucidated that FadR_she protein can dimerize in solution, whose identity was determined by MALDI-TOF-MS. In vitro data from electrophoretic mobility shift assays suggested that FadR_she is almost functionally-exchangeable/equivalent to E. coli FadR (FadR_ec) in the ability of binding the E. coli fabA (and fabB) promoters. In an agreement with that of E. coli fabA, S. oneidensis fabA promoter bound both FadR_she and FadR_ec, and was disassociated specifically with the FadR regulatory protein upon the addition of long-chain acyl-CoA thioesters. To monitor in vivo effect exerted by FadR on Shewanella fabA expression, the native promoter of S. oneidensis fabA was fused to a LacZ reporter gene to engineer a chromosome fabA-lacZ transcriptional fusion in E. coli. As anticipated, the removal of fadR gene gave about 2-fold decrement of Shewanella fabA expression by ?-gal activity, which is almost identical to the inhibitory level by the addition of oleate. Therefore, we concluded that fabA is contracted to be the only one member of fad regulon in the context of fatty acid synthesis in the marine bacteria Shewanella genus. PMID:26050090

  19. Xylan Utilization Regulon in Xanthomonas citri pv. citri Strain 306: Gene Expression and Utilization of Oligoxylosides

    PubMed Central

    Chow, V.; Shantharaj, D.; Guo, Y.; Nong, G.; Minsavage, G. V.; Jones, J. B.


    Xanthomonas citri pv. citri strain 306 (Xcc306), a causative agent of citrus canker, produces endoxylanases that catalyze the depolymerization of cell wall-associated xylans. In the sequenced genomes of all plant-pathogenic xanthomonads, genes encoding xylanolytic enzymes are clustered in three adjacent operons. In Xcc306, these consecutive operons contain genes encoding the glycoside hydrolase family 10 (GH10) endoxylanases Xyn10A and Xyn10C, the agu67 gene, encoding a GH67 ?-glucuronidase (Agu67), the xyn43E gene, encoding a putative GH43 ?-l-arabinofuranosidase, and the xyn43F gene, encoding a putative ?-xylosidase. Recombinant Xyn10A and Xyn10C convert polymeric 4-O-methylglucuronoxylan (MeGXn) to oligoxylosides methylglucuronoxylotriose (MeGX3), xylotriose (X3), and xylobiose (X2). Xcc306 completely utilizes MeGXn predigested with Xyn10A or Xyn10C but shows little utilization of MeGXn. Xcc306 with a deletion in the gene encoding ?-glucuronidase (Xcc306 ?agu67) will not utilize MeGX3 for growth, demonstrating the role of Agu67 in the complete utilization of GH10-digested MeGXn. Preferential growth on oligoxylosides compared to growth on polymeric MeGXn indicates that GH10 xylanases, either secreted by Xcc306 in planta or produced by the plant host, generate oligoxylosides that are processed by Xyn10 xylanases and Agu67 residing in the periplasm. Coordinate induction by oligoxylosides of xyn10, agu67, cirA, the tonB receptor, and other genes within these three operons indicates that they constitute a regulon that is responsive to the oligoxylosides generated by the action of Xcc306 GH10 xylanases on MeGXn. The combined expression of genes in this regulon may allow scavenging of oligoxylosides derived from cell wall deconstruction, thereby contributing to the tissue colonization and/or survival of Xcc306 and, ultimately, to plant disease. PMID:25595763

  20. Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses

    SciTech Connect

    Gao, Haichun; Wang, Xiaohu; Yang, Zamin Koo; Palzkill, Timothy; Zhou, Jizhong


    The Arc two-component system is a global regulator controlling many genes involved in aerobic/anaerobic respiration and fermentative metabolism in Escherichia coli. Shewanella oneidensis MR-1 contains a gene encoding a putative ArcA homolog with {approx} 81% amino acid sequence identity to the E. coli ArcA protein but not a full-length arcB gene. To understand the role of ArcA in S. oneidensis, an arcA deletion strain was constructed and subjected to both physiological characterization and microarray analysis. Compared to the wild-type MR-1, the mutant exhibited impaired aerobic growth and a defect in utilizing DMSO in the absence of O{sub 2}. Microarray analyses on cells grown aerobically and anaerobically on fumarate revealed that expression of 1009 genes was significantly affected (p < 0.05) by the mutation. In contrast to E. coli ArcA, the protein appears to be dispensable in regulation of the TCA cycle in S. oneidensis. To further determine genes regulated by the Arc system, an ArcA recognition weight matrix from DNA-binding data and bioinformatics analysis was generated and used to produce an ArcA sequence affinity map. By combining both techniques, we identified an ArcA regulon of at least 50 operons, of which only 6 were found to be directly controlled by ArcA in E. coli. These results indicate that the Arc system in S. oneidensis differs from that in E. coli substantially in terms of its physiological function and regulon while their binding motif are strikingly similar.

  1. 1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon

    SciTech Connect

    I-Teh Tong; Hans H. Liao; Cameron, D.C. )


    The dha regulon in Klebsiella pneumoniae enables the organism to grown anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydoxyacetone and was screened for the production of 1, 3-PD. The cosmid pTC1 (42.5 kn total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycersol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1, 3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering.

  2. Probing the ArcA regulon under aerobic/ROS conditions in Salmonella enterica serovar Typhimurium

    PubMed Central


    Background Hydrogen peroxide (H2O2) is a reactive oxygen species (ROS), which is part of the oxidative burst encountered upon internalization of Salmonella enterica serovar Typhimurium (S. Typhimurium) by phagocytic cells. It has previously been established that, the ArcAB two-component system plays a critical role in ROS resistance, but the genes regulated by the system remained undetermined to date. We therefore investigated the ArcA regulon in aerobically growing S. Typhimurium before and after exposure to H2O2 by querying gene expression and other physiological changes in wild type and ΔarcA strains. Results In the ΔarcA strain, expression of 292 genes showed direct or indirect regulation by ArcA in response to H2O2, of which 141were also regulated in aerobiosis, but in the opposite direction. Gene set enrichment analysis (GSEA) of the expression data from WT and ΔarcA strains, revealed that, in response to H2O2 challenge in aerobically grown cells, ArcA down regulated multiple PEP-PTS and ABC transporters, while up regulating genes involved in glutathione and glycerolipid metabolism and nucleotide transport. Further biochemical analysis guided by GSEA results showed that deletion of arcA during aerobic growth lead to increased reactive oxygen species (ROS) production which was concomitant with an increased NADH/NAD+ ratio. In absence of ArcA under aerobic conditions, H2O2 exposure resulted in lower levels of glutathione reductase activity, leading to a decreased GSH (reduced glutathione)/GSSG (oxidized glutathione) ratio. Conclusion The ArcA regulon was defined in 2 conditions, aerobic growth and the combination of peroxide treatment and aerobic growth in S. Typhimurium. ArcA coordinates a response that involves multiple aspects of the carbon flux through central metabolism, which ultimately modulates the reducing potential of the cell. PMID:24044554

  3. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.


    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K


    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn?HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite. PMID:24923662

  4. Transcription Factors in Escherichia coli Prefer the Holo Conformation

    PubMed Central

    Balderas-Martnez, Yalbi Itzel; Savageau, Michael; Salgado, Heladia; Prez-Rueda, Ernesto; Morett, Enrique; Collado-Vides, Julio


    The transcriptional regulatory network of Escherichia coli K-12 is among the best studied gene networks of any living cell. Transcription factors bind to DNA either with their effector bound (holo conformation), or as a free protein (apo conformation) regulating transcription initiation. By using RegulonDB, the functional conformations (holo or apo) of transcription factors, and their mode of regulation (activator, repressor, or dual) were exhaustively analyzed. We report a striking discovery in the architecture of the regulatory network, finding a strong under-representation of the apo conformation (without allosteric metabolite) of transcription factors when binding to their DNA sites to activate transcription. This observation is supported at the level of individual regulatory interactions on promoters, even if we exclude the promoters regulated by global transcription factors, where three-quarters of the known promoters are regulated by a transcription factor in holo conformation. This genome-scale analysis enables us to ask what are the implications of these observations for the physiology and for our understanding of the ecology of E. coli. We discuss these ideas within the framework of the demand theory of gene regulation. PMID:23776535

  5. Construction and validation of a first-generation long-oligonulceotide microarray by transcriptional of the Bordetella bronchiseptica Bvg regulon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Bordetella bronchiseptica is a bacterial respiratory pathogen that infects a broad range of mammals, causing chronic and often subclinical infections. Gene expression in Bordetella is regulated by a two-component sensory transduction system, BvgAS, which controls the expression of a spec...

  6. Quantitative and qualitative stem rust resistance factors in barley are associated with transcriptional suppression of defense regulons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stem rust (Puccinia graminis f. sp. tritici; Pgt) is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99) is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known so...

  7. Fecundity reduction in the second gonotrophic cycle of Culex pipiens infected with the apicomplexan blood parasite, Hepatozoon sipedon.


    Ferguson, Laura V; Smith, Todd G


    Fecundity reduction is a well-recognized phenomenon of parasite infection in insects. Reduced production of eggs might increase longevity of a host and release nutrients to both host and parasite that would otherwise be used for oogenesis. The objective of this study was to assess effects on fecundity caused by Hepatozoon sipedon, an apicomplexan blood parasite of snakes, in its invertebrate host, the mosquito Culex pipiens. In the first gonotrophic cycle, the mean number of eggs laid by mosquitoes infected with H. sipedon did not differ significantly from those laid by uninfected mosquitoes. However, in the second gonotrophic cycle infected mosquitoes laid significantly fewer eggs than did uninfected mosquitoes, and fecundity was reduced by 100% in mosquitoes with parasite burdens of more than 60 oocysts. There was a significant negative correlation between parasite burden, or the number of oocysts, and the number of eggs produced in the second gonotrophic cycle. Significantly fewer viable larvae hatched from eggs laid by infected compared to uninfected mosquitoes in the second gonotrophic cycle. These data indicate that fecundity reduction occurs in this system, although the physiological mechanisms driving this phenotype are not yet known. PMID:24650105

  8. The Carbonic Anhydrase Inhibitor Ethoxzolamide Inhibits the Mycobacterium tuberculosis PhoPR Regulon and Esx-1 Secretion and Attenuates Virulence.


    Johnson, Benjamin K; Colvin, Christopher J; Needle, David B; Mba Medie, Felix; Champion, Patricia A DiGiuseppe; Abramovitch, Robert B


    Mycobacterium tuberculosis must sense and adapt to host environmental cues to establish and maintain an infection. The two-component regulatory system PhoPR plays a central role in sensing and responding to acidic pH within the macrophage and is required for M. tuberculosis intracellular replication and growth in vivo. Therefore, the isolation of compounds that inhibit PhoPR-dependent adaptation may identify new antivirulence therapies to treat tuberculosis. Here, we report that the carbonic anhydrase inhibitor ethoxzolamide inhibits the PhoPR regulon and reduces pathogen virulence. We show that treatment of M. tuberculosis with ethoxzolamide recapitulates phoPR mutant phenotypes, including downregulation of the core PhoPR regulon, altered accumulation of virulence-associated lipids, and inhibition of Esx-1 protein secretion. Quantitative single-cell imaging of a PhoPR-dependent fluorescent reporter strain demonstrates that ethoxzolamide inhibits PhoPR-regulated genes in infected macrophages and mouse lungs. Moreover, ethoxzolamide reduces M. tuberculosis growth in both macrophages and infected mice. Ethoxzolamide inhibits M. tuberculosis carbonic anhydrase activity, supporting a previously unrecognized link between carbonic anhydrase activity and PhoPR signaling. We propose that ethoxzolamide may be pursued as a new class of antivirulence therapy that functions by modulating expression of the PhoPR regulon and Esx-1-dependent virulence. PMID:25987613

  9. Towards in vivo regulon kinetics: PurR activation by 5-phosphoribosyl-?-1-pyrophosphate during purine depletion in Lactococcus lactis.


    Jendresen, Christian Bille; Dimitrov, Peter; Gautier, Laurent; Liu, Meng; Martinussen, Jan; Kilstrup, Mogens


    Short-term adaptation to changing environments relies on regulatory elements translating shifting metabolite concentrations into a specifically optimized transcriptome. So far the focus of analyses has been divided between regulatory elements identified in vivo and kinetic studies of small molecules interacting with the regulatory elements in vitro. Here we describe how in vivo regulon kinetics can describe a regulon through the effects of the metabolite controlling it, exemplified by temporal purine exhaustion in Lactococcus lactis. We deduced a causal relation between the pathway precursor 5-phosphoribosyl-?-1-pyrophosphate (PRPP) and individual mRNA levels, whereby unambiguous and homogeneous relations could be obtained for PurR regulated genes, thus linking a specific regulon to a specific metabolite. As PurR activates gene expression upon binding of PRPP, the pur mRNA curves reflect the in vivo kinetics of PurR PRPP binding and activation. The method singled out the xpt-pbuX operon as kinetically distinct, which was found to be caused by a guanine riboswitch whose regulation was overlaying the PurR regulation. Importantly, genes could be clustered according to regulatory mechanism and long-term consequences could be distinguished from transient changes--many of which would not be seen in a long-term adaptation to a new environment. The strategy outlined here can be adapted to analyse the individual effects of members from larger metabolomes in virtually any organism, for elucidating regulatory networks in vivo. PMID:24722907

  10. The W-Beijing Lineage of Mycobacterium tuberculosis Overproduces Triglycerides and Has the DosR Dormancy Regulon Constitutively Upregulated?

    PubMed Central

    Reed, Michael B.; Gagneux, Sebastien; DeRiemer, Kathryn; Small, Peter M.; Barry, Clifton E.


    The Beijing family of Mycobacterium tuberculosis strains has been associated with epidemic spread and an increased likelihood of developing drug resistance. The characteristics that predispose this family to such clinical outcomes have not been identified, although one potential candidate, the phenolic glycolipid PGL-tb, has been shown to mediate a fulminant lethal disease in mice and rabbits due to lipid-mediated immunosuppression. However, PGL-tb is not uniformly expressed throughout the Beijing lineage and may not be the only unique virulence trait associated with this family. In an attempt to define phenotypes common to all Beijing strains, we interrogated a carefully selected set of isolates representing the five extant lineages of the Beijing family. Comparison of lipid production in this set revealed that all Beijing strains accumulated large quantities of triacylglycerides in in vitro aerobic culture. This accumulation was found to be coincident with upregulation of Rv3130c, whose product was previously characterized as a triacylglyceride synthase. Rv3130c is a member of the DosR-controlled regulon of M. tuberculosis, and further examination revealed that several members of this regulon were upregulated throughout this strain family. The upregulation of the DosR regulon may confer an adaptive advantage for growth in microaerophilic or anaerobic environments encountered by the bacillus during infection and thus may be related to the epidemiological phenomena associated with this important strain lineage. PMID:17237171

  11. Mycobacterium tuberculosis DosR Regulon Gene Rv0079 Encodes a Putative, Dormancy Associated Translation Inhibitor (DATIN)

    PubMed Central

    Kumar, Ashutosh; Majid, Mohammad; Kunisch, Ralph; Rani, Pittu Sandhya; Qureshi, Insaf A.; Lewin, Astrid; Hasnain, Seyed E.; Ahmed, Niyaz


    Mycobacterium tuberculosis is a major human pathogen that has evolved survival mechanisms to persist in an immune-competent host under a dormant condition. The regulation of M. tuberculosis metabolism during latent infection is not clearly known. The dormancy survival regulon (DosR regulon) is chiefly responsible for encoding dormancy related functions of M. tuberculosis. We describe functional characterization of an important gene of DosR regulon, Rv0079, which appears to be involved in the regulation of translation through the interaction of its product with bacterial ribosomal subunits. The protein encoded by Rv0079, possibly, has an inhibitory role with respect to protein synthesis, as revealed by our experiments. We performed computational modelling and docking simulation studies involving the protein encoded by Rv0079 followed by in vitro translation and growth curve analysis experiments, involving recombinant E. coli and Bacille Calmette Gurin (BCG) strains that overexpressed Rv0079. Our observations concerning the interaction of the protein with the ribosomes are supportive of its role in regulation/inhibition of translation. We propose that the protein encoded by locus Rv0079 is a dormancy associated translation inhibitor or DATIN. PMID:22719925

  12. A cell-cell signaling peptide activates the PlcR virulence regulon in bacteria of the Bacillus cereus group.


    Slamti, Leyla; Lereclus, Didier


    PlcR is a pleiotropic regulator that activates the expression of genes encoding various virulence factors, such as phospholipases C, proteases and hemolysins, in Bacillus thuringiensis and Bacillus cereus. Here we show that the activation mechanism is under the control of a small peptide: PapR. The papR gene belongs to the PlcR regulon and is located 70 bp downstream from plcR. It encodes a 48-amino-acid peptide. Disruption of the papR gene abolished expression of the PlcR regulon, resulting in a large decrease in hemolysis and virulence in insect larvae. We demonstrated that the PapR polypeptide was secreted, then reimported via the oligopeptide permease Opp. Once inside the cell, a processed form of PapR, presumably a pentapeptide, activated the PlcR regulon by allowing PlcR to bind to its DNA target. This activating mechanism was found to be strain specific, with this specificity determined by the first residue of the penta peptide. PMID:12198157

  13. A cell–cell signaling peptide activates the PlcR virulence regulon in bacteria of the Bacillus cereus group

    PubMed Central

    Slamti, Leyla; Lereclus, Didier


    PlcR is a pleiotropic regulator that activates the expression of genes encoding various virulence factors, such as phospholipases C, proteases and hemolysins, in Bacillus thuringiensis and Bacillus cereus. Here we show that the activation mechanism is under the control of a small peptide: PapR. The papR gene belongs to the PlcR regulon and is located 70 bp downstream from plcR. It encodes a 48-amino-acid peptide. Disruption of the papR gene abolished expression of the PlcR regulon, resulting in a large decrease in hemolysis and virulence in insect larvae. We demonstrated that the PapR polypeptide was secreted, then reimported via the oligopeptide permease Opp. Once inside the cell, a processed form of PapR, presumably a pentapeptide, activated the PlcR regulon by allowing PlcR to bind to its DNA target. This activating mechanism was found to be strain specific, with this specificity determined by the first residue of the penta peptide. PMID:12198157

  14. Xylan utilization regulon in Xanthomonas citri pv. citri Strain 306: gene expression and utilization of oligoxylosides.


    Chow, V; Shantharaj, D; Guo, Y; Nong, G; Minsavage, G V; Jones, J B; Preston, J F


    Xanthomonas citri pv. citri strain 306 (Xcc306), a causative agent of citrus canker, produces endoxylanases that catalyze the depolymerization of cell wall-associated xylans. In the sequenced genomes of all plant-pathogenic xanthomonads, genes encoding xylanolytic enzymes are clustered in three adjacent operons. In Xcc306, these consecutive operons contain genes encoding the glycoside hydrolase family 10 (GH10) endoxylanases Xyn10A and Xyn10C, the agu67 gene, encoding a GH67 α-glucuronidase (Agu67), the xyn43E gene, encoding a putative GH43 α-l-arabinofuranosidase, and the xyn43F gene, encoding a putative β-xylosidase. Recombinant Xyn10A and Xyn10C convert polymeric 4-O-methylglucuronoxylan (MeGXn) to oligoxylosides methylglucuronoxylotriose (MeGX3), xylotriose (X3), and xylobiose (X2). Xcc306 completely utilizes MeGXn predigested with Xyn10A or Xyn10C but shows little utilization of MeGXn. Xcc306 with a deletion in the gene encoding α-glucuronidase (Xcc306 Δagu67) will not utilize MeGX3 for growth, demonstrating the role of Agu67 in the complete utilization of GH10-digested MeGXn. Preferential growth on oligoxylosides compared to growth on polymeric MeGXn indicates that GH10 xylanases, either secreted by Xcc306 in planta or produced by the plant host, generate oligoxylosides that are processed by Xyn10 xylanases and Agu67 residing in the periplasm. Coordinate induction by oligoxylosides of xyn10, agu67, cirA, the tonB receptor, and other genes within these three operons indicates that they constitute a regulon that is responsive to the oligoxylosides generated by the action of Xcc306 GH10 xylanases on MeGXn. The combined expression of genes in this regulon may allow scavenging of oligoxylosides derived from cell wall deconstruction, thereby contributing to the tissue colonization and/or survival of Xcc306 and, ultimately, to plant disease. PMID:25595763

  15. Comparative Proteomic Analysis of the PhoP Regulon in Salmonella enterica Serovar Typhi Versus Typhimurium

    PubMed Central

    Charles, Richelle C.; Harris, Jason B.; Chase, Michael R.; Lebrun, Lauren M.; Sheikh, Alaullah; LaRocque, Regina C.; Logvinenko, Tanya; Rollins, Sean M.; Tarique, Abdullah; Hohmann, Elizabeth L.; Rosenberg, Ian; Krastins, Bryan; Sarracino, David A.; Qadri, Firdausi; Calderwood, Stephen B.; Ryan, Edward T.


    Background S. Typhi, a human-restricted Salmonella enterica serovar, causes a systemic intracellular infection in humans (typhoid fever). In comparison, S. Typhimurium causes gastroenteritis in humans, but causes a systemic typhoidal illness in mice. The PhoP regulon is a well studied two component (PhoP/Q) coordinately regulated network of genes whose expression is required for intracellular survival of S. enterica. Methodology/Principal Findings Using high performance liquid chromatography mass spectrometry (HPLC-MS/MS), we examined the protein expression profiles of three sequenced S. enterica strains: S. Typhimurium LT2, S. Typhi CT18, and S. Typhi Ty2 in PhoP-inducing and non-inducing conditions in vitro and compared these results to profiles of phoP?/Q? mutants derived from S. Typhimurium LT2 and S. Typhi Ty2. Our analysis identified 53 proteins in S. Typhimurium LT2 and 56 proteins in S. Typhi that were regulated in a PhoP-dependent manner. As expected, many proteins identified in S. Typhi demonstrated concordant differential expression with a homologous protein in S. Typhimurium. However, three proteins (HlyE, STY1499, and CdtB) had no homolog in S. Typhimurium. HlyE is a pore-forming toxin. STY1499 encodes a stably expressed protein of unknown function transcribed in the same operon as HlyE. CdtB is a cytolethal distending toxin associated with DNA damage, cell cycle arrest, and cellular distension. Gene expression studies confirmed up-regulation of mRNA of HlyE, STY1499, and CdtB in S. Typhi in PhoP-inducing conditions. Conclusions/Significance This study is the first protein expression study of the PhoP virulence associated regulon using strains of Salmonella mutant in PhoP, has identified three Typhi-unique proteins (CdtB, HlyE and STY1499) that are not present in the genome of the wide host-range Typhimurium, and includes the first protein expression profiling of a live attenuated bacterial vaccine studied in humans (Ty800). PMID:19746165

  16. Model of transcriptional activation by MarA in Escherichia coli.


    Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G


    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond. PMID:20019803

  17. Model of transcriptional activation by MarA in escherichia coli

    SciTech Connect

    Wall, Michael E; Rosner, Judah L; Martin, Robert G


    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

  18. Genome-wide analysis of cell type-specific gene transcription during spore formation in Clostridium difficile.


    Saujet, Laure; Pereira, Fátima C; Serrano, Monica; Soutourina, Olga; Monot, Marc; Shelyakin, Pavel V; Gelfand, Mikhail S; Dupuy, Bruno; Henriques, Adriano O; Martin-Verstraete, Isabelle


    Clostridium difficile, a Gram positive, anaerobic, spore-forming bacterium is an emergent pathogen and the most common cause of nosocomial diarrhea. Although transmission of C. difficile is mediated by contamination of the gut by spores, the regulatory cascade controlling spore formation remains poorly characterized. During Bacillus subtilis sporulation, a cascade of four sigma factors, σ(F) and σ(G) in the forespore and σ(E) and σ(K) in the mother cell governs compartment-specific gene expression. In this work, we combined genome wide transcriptional analyses and promoter mapping to define the C. difficile σ(F), σ(E), σ(G) and σ(K) regulons. We identified about 225 genes under the control of these sigma factors: 25 in the σ(F) regulon, 97 σ(E)-dependent genes, 50 σ(G)-governed genes and 56 genes under σ(K) control. A significant fraction of genes in each regulon is of unknown function but new candidates for spore coat proteins could be proposed as being synthesized under σ(E) or σ(K) control and detected in a previously published spore proteome. SpoIIID of C. difficile also plays a pivotal role in the mother cell line of expression repressing the transcription of many members of the σ(E) regulon and activating sigK expression. Global analysis of developmental gene expression under the control of these sigma factors revealed deviations from the B. subtilis model regarding the communication between mother cell and forespore in C. difficile. We showed that the expression of the σ(E) regulon in the mother cell was not strictly under the control of σ(F) despite the fact that the forespore product SpoIIR was required for the processing of pro-σ(E). In addition, the σ(K) regulon was not controlled by σ(G) in C. difficile in agreement with the lack of pro-σ(K) processing. This work is one key step to obtain new insights about the diversity and evolution of the sporulation process among Firmicutes. PMID:24098137

  19. Boosting transcription by transcription: enhancer associated transcripts

    PubMed Central

    Darrow, Emily M.; Chadwick, Brian P.


    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review we focus on the possible functions of enhancer transcription by highlighting several recent eRNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression. PMID:24178450

  20. Large-Scale Mapping and Validation of Escherichia coli Transcriptional Regulation from a Compendium of Expression Profiles

    PubMed Central

    Thaden, Joshua T; Mogno, Ilaria; Wierzbowski, Jamey; Cottarel, Guillaume; Kasif, Simon; Collins, James J; Gardner, Timothy S


    Machine learning approaches offer the potential to systematically identify transcriptional regulatory interactions from a compendium of microarray expression profiles. However, experimental validation of the performance of these methods at the genome scale has remained elusive. Here we assess the global performance of four existing classes of inference algorithms using 445 Escherichia coli Affymetrix arrays and 3,216 known E. coli regulatory interactions from RegulonDB. We also developed and applied the context likelihood of relatedness (CLR) algorithm, a novel extension of the relevance networks class of algorithms. CLR demonstrates an average precision gain of 36% relative to the next-best performing algorithm. At a 60% true positive rate, CLR identifies 1,079 regulatory interactions, of which 338 were in the previously known network and 741 were novel predictions. We tested the predicted interactions for three transcription factors with chromatin immunoprecipitation, confirming 21 novel interactions and verifying our RegulonDB-based performance estimates. CLR also identified a regulatory link providing central metabolic control of iron transport, which we confirmed with real-time quantitative PCR. The compendium of expression data compiled in this study, coupled with RegulonDB, provides a valuable model system for further improvement of network inference algorithms using experimental data. PMID:17214507

  1. Binding motifs in bacterial gene promoters modulate transcriptional effects of global regulators CRP and ArcA

    SciTech Connect

    Leuze, Mike; Karpinets, Tatiana V.; Syed, Mustafa H.; Beliaev, Alex S.; Uberbacher, Edward


    Bacterial gene regulation involves transcription factors (TF) that bind to DNA recognition sequences in operon promoters. These recognition sequences, many of which are palindromic, are known as regulatory elements or transcription factor binding sites (TFBS). Some TFs are global regulators that can modulate the expression of hundreds of genes. In this study we examine global regulator half-sites, where a half-site, which we shall call a binding motif (BM), is one half of a palindromic TFBS. We explore the hypothesis that the number of BMs plays an important role in transcriptional regulation, examining empirical data from transcriptional profiling of the CRP and ArcA regulons. We compare the power of BM counts and of full TFBS characteristics to predict induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full TFBS quality or location.

  2. Comparative genomics of transcription factors and chromatin proteins in parasitic protists and other eukaryotes.


    Iyer, Lakshminarayan M; Anantharaman, Vivek; Wolf, Maxim Y; Aravind, L


    Comparative genomics of parasitic protists and their free-living relatives are profoundly impacting our understanding of the regulatory systems involved in transcription and chromatin dynamics. While some parts of these systems are highly conserved, other parts are rapidly evolving, thereby providing the molecular basis for the variety in the regulatory adaptations of eukaryotes. The gross number of specific transcription factors and chromatin proteins are positively correlated with proteome size in eukaryotes. However, the individual types of specific transcription factors show an enormous variety across different eukaryotic lineages. The dominant families of specific transcription factors even differ between sister lineages, and have been shaped by gene loss and lineage-specific expansions. Recognition of this principle has helped in identifying the hitherto unknown, major specific transcription factors of several parasites, such as apicomplexans, Entamoeba histolytica, Trichomonas vaginalis, Phytophthora and ciliates. Comparative analysis of predicted chromatin proteins from protists allows reconstruction of the early evolutionary history of histone and DNA modification, nucleosome assembly and chromatin-remodeling systems. Many key catalytic, peptide-binding and DNA-binding domains in these systems ultimately had bacterial precursors, but were put together into distinctive regulatory complexes that are unique to the eukaryotes. In the case of histone methylases, histone demethylases and SWI2/SNF2 ATPases, proliferation of paralogous families followed by acquisition of novel domain architectures, seem to have played a major role in producing a diverse set of enzymes that create and respond to an epigenetic code of modified histones. The diversification of histone acetylases and DNA methylases appears to have proceeded via repeated emergence of new versions, most probably via transfers from bacteria to different eukaryotic lineages, again resulting in lineage-specific diversity in epigenetic signals. Even though the key histone modifications are universal to eukaryotes, domain architectures of proteins binding post-translationally modified-histones vary considerably across eukaryotes. This indicates that the histone code might be "interpreted" differently from model organisms in parasitic protists and their relatives. The complexity of domain architectures of chromatin proteins appears to have increased during eukaryotic evolution. Thus, Trichomonas, Giardia, Naegleria and kinetoplastids have relatively simple domain architectures, whereas apicomplexans and oomycetes have more complex architectures. RNA-dependent post-transcriptional silencing systems, which interact with chromatin-level regulatory systems, show considerable variability across parasitic protists, with complete loss in many apicomplexans and partial loss in Trichomonas vaginalis. This evolutionary synthesis offers a robust scaffold for future investigation of transcription and chromatin structure in parasitic protists. PMID:17949725

  3. MicA sRNA links the PhoP regulon to cell envelope stress

    PubMed Central

    Coornaert, Audrey; Lu, Alisa; Mandin, Pierre; Springer, Mathias; Gottesman, Susan; Guillier, Maude


    Numerous small RNAs regulators of gene expression exist in bacteria. A large class of them binds to the RNA chaperone Hfq and act by base-pairing interactions with their target-mRNA, thereby affecting their translation and/or stability. They often have multiple direct targets, some of which may be regulators themselves, and production of a single sRNA can therefore affect the expression of dozens of genes. We show in this study that the synthesis of the E. coli pleiotropic PhoPQ two-component system is repressed by MicA, a ?E-dependent sRNA regulator of porin biogenesis. MicA directly pairs with phoPQ mRNA in the translation initiation region of phoP and presumably inhibits translation by competiting with ribosome binding. Consequently, MicA down-regulates several members of the PhoPQ regulon. By linking PhoPQ to ?E, our findings suggest that major cellular processes such as Mg2+ transport, virulence, LPS modification or resistance to antimicrobial peptides are modulated in response to envelope stress. In addition, we found that Hfq strongly affects the expression of phoP independently of MicA, raising the possibility that even more sRNAs, that remain to be identified, could regulate PhoPQ synthesis. PMID:20345657

  4. The roles of peroxide protective regulons in protecting Xanthomonas campestris pv. campestris from sodium hypochlorite stress.


    Charoenlap, Nisanart; Sornchuer, Phornphan; Piwkam, Anong; Srijaruskul, Kriangsuk; Mongkolsuk, Skorn; Vattanaviboon, Paiboon


    The exposure of Xanthomonas campestris pv. campestris to sublethal concentrations of a sodium hypochlorite (NaOCl) solution induced the expression of genes that encode peroxide scavenging enzymes within the OxyR and OhrR regulons. Sensitivity testing in various X. campestris mutants indicated that oxyR, katA, katG, ahpC, and ohr contributed to protection against NaOCl killing. The pretreatment of X. campestris cultures with oxidants, such as hydrogen peroxide (H2O2), t-butyl hydroperoxide, and the superoxide generator menadione, protected the bacteria from lethal concentrations of NaOCl in an OxyR-dependent manner. Treating the bacteria with a low concentration of NaOCl resulted in the adaptive protection from NaOCl killing and also provided cross-protection from H2O2 killing. Taken together, the results suggest that the toxicity of NaOCl is partially mediated by the generation of peroxides and other reactive oxygen species that are removed by primary peroxide scavenging enzymes, such as catalases and AhpC, as a part of an overall strategy that protects the bacteria from the lethal effects of NaOCl. PMID:25825971

  5. Characterization of the SigD Regulon of C. difficile and Its Positive Control of Toxin Production through the Regulation of tcdR

    PubMed Central

    El Meouche, Imane; Peltier, Johann; Monot, Marc; Soutourina, Olga; Pestel-Caron, Martine; Dupuy, Bruno; Pons, Jean-Louis


    Clostridium difficile intestinal disease is mediated largely by the actions of toxins A (TcdA) and B (TcdB), whose production occurs after the initial steps of colonization involving different surface or flagellar proteins. In B. subtilis, the sigma factor SigD controls flagellar synthesis, motility, and vegetative autolysins. A homolog of SigD encoding gene is present in the C.difficile 630 genome. We constructed a sigD mutant in C. difficile 630 ?erm to analyze the regulon of SigD using a global transcriptomic approach. A total of 103 genes were differentially expressed between the wild-type and the sigD mutant, including genes involved in motility, metabolism and regulation. In addition, the sigD mutant displayed decreased expression of genes involved in flagellar biosynthesis, and also of genes encoding TcdA and TcdB as well as TcdR, the positive regulator of the toxins. Genomic analysis and RACE-PCR experiments allowed us to characterize promoter sequences of direct target genes of SigD including tcdR and to identify the SigD consensus. We then established that SigD positively regulates toxin expression via direct control of tcdR transcription. Interestingly, the overexpression of FlgM, a putative anti-SigD factor, inhibited the positive regulation of motility and toxin synthesis by SigD. Thus, SigD appears to be the first positive regulator of the toxin synthesis in C. difficile. PMID:24358307

  6. Investigation of the Staphylococcus aureus GraSR Regulon Reveals Novel Links to Virulence, Stress Response and Cell Wall Signal Transduction Pathways

    PubMed Central

    Falord, Mlanie; Mder, Ulrike; Hiron, Aurlia; Dbarbouill, Michel; Msadek, Tarek


    The GraS/GraR two-component system has been shown to control cationic antimicrobial peptide (CAMP) resistance in the major human pathogen Staphylococcus aureus. We demonstrated that graX, also involved in CAMP resistance and cotranscribed with graRS, encodes a regulatory cofactor of the GraSR signaling pathway, effectively constituting a three-component system. We identified a highly conserved ten base pair palindromic sequence (5? ACAAA TTTGT 3?) located upstream from GraR-regulated genes (mprF and the dlt and vraFG operons), which we show to be essential for transcriptional regulation by GraR and induction in response to CAMPs, suggesting it is the likely GraR binding site. Genome-based predictions and transcriptome analysis revealed several novel GraR target genes. We also found that the GraSR TCS is required for growth of S. aureus at high temperatures and resistance to oxidative stress. The GraSR system has previously been shown to play a role in S. aureus pathogenesis and we have uncovered previously unsuspected links with the AgrCA peptide quorum-sensing system controlling virulence gene expression. We also show that the GraSR TCS controls stress reponse and cell wall metabolism signal transduction pathways, sharing an extensive overlap with the WalKR regulon. This is the first report showing a role for the GraSR TCS in high temperature and oxidative stress survival and linking this system to stress response, cell wall and pathogenesis control pathways. PMID:21765893

  7. Deep sequencing analyses expands the Pseudomonas aeruginosa AmpR regulon to include small RNA-mediated regulation of iron acquisition, heat shock and oxidative stress response

    PubMed Central

    Balasubramanian, Deepak; Kumari, Hansi; Jaric, Melita; Fernandez, Mitch; Turner, Keith H.; Dove, Simon L.; Narasimhan, Giri; Lory, Stephen; Mathee, Kalai


    Pathogenicity of Pseudomonas aeruginosa, a major cause of many acute and chronic human infections, is determined by tightly regulated expression of multiple virulence factors. Quorum sensing (QS) controls expression of many of these pathogenic determinants. Previous microarray studies have shown that the AmpC ?-lactamase regulator AmpR, a member of the LysR family of transcription factors, also controls non-?-lactam resistance and multiple virulence mechanisms. Using RNA-Seq and complementary assays, this study further expands the AmpR regulon to include diverse processes such as oxidative stress, heat shock and iron uptake. Importantly, AmpR affects many of these phenotypes, in part, by regulating expression of non-coding RNAs such as rgP32, asRgsA, asPrrF1 and rgRsmZ. AmpR positively regulates expression of the major QS regulators LasR, RhlR and MvfR, and genes of the Pseudomonas quinolone system. Chromatin immunoprecipitation (ChIP)-Seq and ChIPquantitative real-time polymerase chain reaction studies show that AmpR binds to the ampC promoter both in the absence and presence of ?-lactams. In addition, AmpR directly binds the lasR promoter, encoding the QS master regulator. Comparison of the AmpR-binding sequences from the transcriptome and ChIP-Seq analyses identified an AT-rich consensus-binding motif. This study further attests to the role of AmpR in regulating virulence and physiological processes in P. aeruginosa. PMID:24157832

  8. Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria

    PubMed Central


    Background Catabolite repression control (CRC) is an important global control system in Pseudomonas that fine tunes metabolism in order optimise growth and metabolism in a range of different environments. The mechanism of CRC in Pseudomonas spp. centres on the binding of a protein, Crc, to an A-rich motif on the 5' end of an mRNA resulting in translational down-regulation of target genes. Despite the identification of several Crc targets in Pseudomonas spp. the Crc regulon has remained largely unexplored. Results In order to predict direct targets of Crc, we used a bioinformatics approach based on detection of A-rich motifs near the initiation of translation of all protein-encoding genes in twelve fully sequenced Pseudomonas genomes. As expected, our data predict that genes related to the utilisation of less preferred nutrients, such as some carbohydrates, nitrogen sources and aromatic carbon compounds are targets of Crc. A general trend in this analysis is that the regulation of transporters is conserved across species whereas regulation of specific enzymatic steps or transcriptional activators are often conserved only within a species. Interestingly, some nucleoid associated proteins (NAPs) such as HU and IHF are predicted to be regulated by Crc. This finding indicates a possible role of Crc in indirect control over a subset of genes that depend on the DNA bending properties of NAPs for expression or repression. Finally, some virulence traits such as alginate and rhamnolipid production also appear to be regulated by Crc, which links nutritional status cues with the regulation of virulence traits. Conclusions Catabolite repression control regulates a broad spectrum of genes in Pseudomonas. Some targets are genus-wide and are typically related to central metabolism, whereas other targets are species-specific, or even unique to particular strains. Further study of these novel targets will enhance our understanding of how Pseudomonas bacteria integrate nutritional status cues with the regulation of traits that are of ecological, industrial and clinical importance. PMID:21108798

  9. Divergence of the mitochondrial genome structure in the apicomplexan parasites, Babesia and Theileria.


    Hikosaka, Kenji; Watanabe, Yoh-Ichi; Tsuji, Naotoshi; Kita, Kiyoshi; Kishine, Hiroe; Arisue, Nobuko; Palacpac, Nirianne Marie Q; Kawazu, Shin-Ichiro; Sawai, Hiromi; Horii, Toshihiro; Igarashi, Ikuo; Tanabe, Kazuyuki


    Mitochondrial (mt) genomes from diverse phylogenetic groups vary considerably in size, structure, and organization. The genus Plasmodium, causative agent of malaria, of the phylum Apicomplexa, has the smallest mt genome in the form of a circular and/or tandemly repeated linear element of 6 kb, encoding only three protein genes (cox1, cox3, and cob). The closely related genera Babesia and Theileria also have small mt genomes (6.6 kb) that are monomeric linear with an organization distinct from Plasmodium. To elucidate the structural divergence and evolution of mt genomes between Babesia/Theileria and Plasmodium, we determined five new sequences from Babesia bigemina, B. caballi, B. gibsoni, Theileria orientalis, and T. equi. Together with previously reported sequences of B. bovis, T. annulata, and T. parva, all eight Babesia and Theileria mt genomes are linear molecules with terminal inverted repeats (TIRs) on both ends containing three protein-coding genes (cox1, cox3, and cob) and six large subunit (LSU) ribosomal RNA (rRNA) gene fragments. The organization and transcriptional direction of protein-coding genes and the rRNA gene fragments were completely conserved in the four Babesia species. In contrast, notable variation occurred in the four Theileria species. Although the genome structures of T. annulata and T. parva were nearly identical to those of Babesia, an inversion in the 3-kb central region was found in T. orientalis. Moreover, the T. equi mt genome is the largest (8.2 kb) and most divergent with unusually long TIR sequences, in which cox3 and two LSU rRNA gene fragments are located. The T. equi mt genome showed little synteny to the other species. These results suggest that the Theileria mt genome is highly diverse with lineage-specific evolution in two Theileria species: genome inversion in T. orientalis and gene-embedded long TIR in T. equi. PMID:20034997

  10. Environmental conditions and transcriptional regulation in Escherichia coli: a physiological integrative approach.


    Martnez-Antonio, Agustino; Salgado, Heladia; Gama-Castro, Socorro; Gutirrez-Ros, Rosa Mara; Jimnez-Jacinto, Vernica; Collado-Vides, Julio


    Bacteria develop a number of devices for sensing, responding, and adapting to different environmental conditions. Understanding within a genomic perspective how the transcriptional machinery of bacteria is modulated, as a response for changing conditions, is a major challenge for biologists. Knowledge of which genes are turned on or turned off under specific conditions is essential for our understanding of cell behavior. In this study we describe how the information pertaining to gene expression and associated growth conditions (even with very little knowledge of the associated regulatory mechanisms) is gathered from the literature and incorporated into RegulonDB, a database on transcriptional regulation and operon organization in E. coli. The link between growth conditions, signal transduction, and transcriptional regulation is modeled in the database in a simple format that highlights biological relevant information. As far as we know, there is no other database that explicitly clarifies the effect of environmental conditions on gene transcription. We discuss how this knowledge constitutes a benchmark that will impact future research aimed at integration of regulatory responses in the cell; for instance, analysis of microarrays, predicting culture behavior in biotechnological processes, and comprehension of dynamics of regulatory networks. This integrated knowledge will contribute to the future goal of modeling the behavior of E. coli as an entire cell. The RegulonDB database can be accessed on the web at the URL: PMID:14708114

  11. Dissecting the interface between apicomplexan parasite and host cell: Insights from a divergent AMA-RON2 pair.


    Parker, Michelle L; Penarete-Vargas, Diana M; Hamilton, Phineas T; Guérin, Amandine; Dubey, Jitender P; Perlman, Steve J; Spano, Furio; Lebrun, Maryse; Boulanger, Martin J


    Plasmodium falciparum and Toxoplasma gondii are widely studied parasites in phylum Apicomplexa and the etiological agents of severe human malaria and toxoplasmosis, respectively. These intracellular pathogens have evolved a sophisticated invasion strategy that relies on delivery of proteins into the host cell, where parasite-derived rhoptry neck protein 2 (RON2) family members localize to the host outer membrane and serve as ligands for apical membrane antigen (AMA) family surface proteins displayed on the parasite. Recently, we showed that T. gondii harbors a novel AMA designated as TgAMA4 that shows extreme sequence divergence from all characterized AMA family members. Here we show that sporozoite-expressed TgAMA4 clusters in a distinct phylogenetic clade with Plasmodium merozoite apical erythrocyte-binding ligand (MAEBL) proteins and forms a high-affinity, functional complex with its coevolved partner, TgRON2L1. High-resolution crystal structures of TgAMA4 in the apo and TgRON2L1-bound forms complemented with alanine scanning mutagenesis data reveal an unexpected architecture and assembly mechanism relative to previously characterized AMA-RON2 complexes. Principally, TgAMA4 lacks both a deep surface groove and a key surface loop that have been established to govern RON2 ligand binding selectivity in other AMAs. Our study reveals a previously underappreciated level of molecular diversity at the parasite-host-cell interface and offers intriguing insight into the adaptation strategies underlying sporozoite invasion. Moreover, our data offer the potential for improved design of neutralizing therapeutics targeting a broad range of AMA-RON2 pairs and apicomplexan invasive stages. PMID:26712012

  12. Molecular systematics of marine gregarine apicomplexans from Pacific tunicates, with descriptions of five novel species of Lankesteria.


    Rueckert, Sonja; Wakeman, Kevin C; Jenke-Kodama, Holger; Leander, Brian S


    The eugregarines are a group of apicomplexan parasites that mostly infect the intestines of invertebrates. The high level of morphological variation found within and among species of eugregarines makes it difficult to find consistent and reliable traits that unite even closely related lineages. Based mostly on traits observed with light microscopy, the majority of described eugregarines from marine invertebrates has been classified into a single group, the Lecudinidae. Our understanding of the overall diversity and phylogenetic relationships of lecudinids is very poor, mainly because only a modest amount of exploratory research has been done on the group and very few species of lecudinids have been characterized at the molecular phylogenetic level. In an attempt to understand the diversity of marine gregarines better, we surveyed lecudinids that infect the intestines of Pacific ascidians (i.e. sea squirts) using ultrastructural and molecular phylogenetic approaches; currently, these species fall within one genus, Lankesteria. We collected lecudinid gregarines from six ascidian host species, and our data demonstrated that each host was infected by a different species of Lankesteria: (i) Lankesteria hesperidiiformis sp. nov., isolated from Distaplia occidentalis, (ii) Lankesteria metandrocarpae sp. nov., isolated from Metandrocarpa taylori, (iii) Lankesteria halocynthiae sp. nov., isolated from Halocynthia aurantium, (iv) Lankesteria herdmaniae sp. nov., isolated from Herdmania momus, (v) Lankesteria cf. ritterellae, isolated from Ritterella rubra, and (vi) Lankesteria didemni sp. nov., isolated from Didemnum vexillum. Visualization of the trophozoites with scanning electron microscopy showed that four of these species were covered with epicytic folds, whereas two of the species were covered with a dense pattern of epicytic knobs. The molecular phylogenetic data suggested that species of Lankesteria with surface knobs form a clade that is nested within a paraphyletic assemblage species of Lankesteria with epicytic folds. PMID:25985834

  13. Identification of a Salmonella ancillary copper detoxification mechanism by a comparative analysis of the genome-wide transcriptional response to copper and zinc excess

    PubMed Central

    Pontel, Lucas B.; Scampoli, Nadia L.; Porwollik, Steffen; Checa, Susana K.; McClelland, Michael


    Copper and zinc are essential metal ions, but toxic in excess. Bacteria have evolved different strategies to control their intracellular concentrations, ensuring proper supply while avoiding toxicity, including the induction of metal-specific as well as non-specific mechanisms. We compared the transcriptional profiles of Salmonella Typhimurium after exposure to either copper or zinc ions in both rich and minimal media. Besides metal-specific regulatory networks many global stress-response pathways react to an excess of either of these metal ions. Copper excess affects both zinc and iron homeostasis by inducing transcription of these metal-specific regulons. In addition to the control of zinc-specific regulons, zinc excess affects the Cpx regulon and the σE envelope-stress responses. Finally, novel metal-specific upregulated genes were detected including a new copper-detoxification pathway that involves the siderophore enterobactin and the outer-membrane protein TolC. This work sheds light onto the transcriptional landscape of Salmonella after copper or zinc overload, and discloses a new mechanism of copper detoxification. PMID:24858080

  14. Identification of a Salmonella ancillary copper detoxification mechanism by a comparative analysis of the genome-wide transcriptional response to copper and zinc excess.


    Pontel, Lucas B; Scampoli, Nadia L; Porwollik, Steffen; Checa, Susana K; McClelland, Michael; Soncini, Fernando C


    Copper and zinc are essential metal ions, but toxic in excess. Bacteria have evolved different strategies to control their intracellular concentrations, ensuring proper supply while avoiding toxicity, including the induction of metal-specific as well as non-specific mechanisms. We compared the transcriptional profiles of Salmonella Typhimurium after exposure to either copper or zinc ions in both rich and minimal media. Besides metal-specific regulatory networks many global stress-response pathways react to an excess of either of these metal ions. Copper excess affects both zinc and iron homeostasis by inducing transcription of these metal-specific regulons. In addition to the control of zinc-specific regulons, zinc excess affects the Cpx regulon and the σ(E) envelope-stress responses. Finally, novel metal-specific upregulated genes were detected including a new copper-detoxification pathway that involves the siderophore enterobactin and the outer-membrane protein TolC. This work sheds light onto the transcriptional landscape of Salmonella after copper or zinc overload, and discloses a new mechanism of copper detoxification. PMID:24858080

  15. Combined Amplicon Pyrosequencing Assays Reveal Presence of the Apicomplexan type-N (cf. Gemmocystis cylindrus) and Chromera velia on the Great Barrier Reef, Australia

    PubMed Central

    lapeta, Jan; Linares, Marjorie C.


    Background The coral is predominantly composed of the metabolically dependent coral host and the photosynthetic dinoflagellate Symbiodinium sp. The system as a whole interacts with symbiotic eukaryotes, bacteria and viruses. Gemmocystiscylindrus (cf. type-N symbiont) belonging to the obligatory parasitic phylum Apicomplexa (Alveolata) is ubiquitous in the Caribbean coral, but its presence in the Great Barrier Reef coral has yet to be documented. Approaches allowing identification of the healthy community from the pathogenic or saprobic organisms are needed for sustainable coral reef monitoring. Methods & Principal Findings We investigated the diversity of eukaryotes associated with a common reef-building corals from the southern Great Barrier Reef. We used three tag encoded 454 amplicon pyrosequencing assays targeting eukaryote small-subunit rRNA gene to demonstrate the presence of the apicomplexan type-N and a photosynthetic sister species to Apicomplexa - Chromeravelia. Amplicon pyrosequencing revealed presence of the small-subunit rRNA genes of known eukaryotic pathogens (Cryptosporidium and Cryptococcus). We therefore conducted bacterial tag encoded amplicon pyrosequencing assay for small-subunit rRNA gene to support effluent exposure of the coral. Bacteria of faecal origin (Enterobacteriales) formed 41% of total sequences in contrast to 0-2% of the coral-associated bacterial communities with and without C. velia, respectively. Significance This is the first time apicomplexan type-N has been detected in the Great Barrier Reef. Eukaryote tag encoded amplicon pyrosequencing assays demonstrate presence of apicomplexan type-N and C. Velia in total coral DNA. The data highlight the need for combined approaches for eukaryotic diversity studies coupled with bacterial community assessment to achieve a more realistic goals of defining the holobiont community and assessing coral disease. With increasing evidence of Apicomplexa in coral reef environments, it is important not only to understand the evolution of these organisms but also identify their potential as pathogens. PMID:24098768

  16. Rcs signaling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility

    PubMed Central

    Wang, Qingfeng; Harshey, Rasika M.


    Summary In Salmonella enterica, an activated Rcs signaling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes - fliPQR - located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signaling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

  17. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    SciTech Connect

    Leuze, Michael Rex; Karpinets, Tatiana V; Syed, Mustafa H; Beliaev, Alexander S; Uberbacher, Edward C


    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  18. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.


    Zhu, Y; Lin, E C


    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

  19. Transcriptional regulation of the carbohydrate utilization network in Thermotoga maritima

    PubMed Central

    Rodionov, Dmitry A.; Rodionova, Irina A.; Li, Xiaoqing; Ravcheev, Dmitry A.; Tarasova, Yekaterina; Portnoy, Vasiliy A.; Zengler, Karsten; Osterman, Andrei L.


    Hyperthermophilic bacteria from the Thermotogales lineage can produce hydrogen by fermenting a wide range of carbohydrates. Previous experimental studies identified a large fraction of genes committed to carbohydrate degradation and utilization in the model bacterium Thermotoga maritima. Knowledge of these genes enabled comprehensive reconstruction of biochemical pathways comprising the carbohydrate utilization network. However, transcriptional factors (TFs) and regulatory mechanisms driving this network remained largely unknown. Here, we used an integrated approach based on comparative analysis of genomic and transcriptomic data for the reconstruction of the carbohydrate utilization regulatory networks in 11 Thermotogales genomes. We identified DNA-binding motifs and regulons for 19 orthologous TFs in the Thermotogales. The inferred regulatory network in T. maritima contains 181 genes encoding TFs, sugar catabolic enzymes and ABC-family transporters. In contrast to many previously described bacteria, a transcriptional regulation strategy of Thermotoga does not employ global regulatory factors. The reconstructed regulatory network in T. maritima was validated by gene expression profiling on a panel of mono- and disaccharides and by in vitro DNA-binding assays. The observed upregulation of genes involved in catabolism of pectin, trehalose, cellobiose, arabinose, rhamnose, xylose, glucose, galactose, and ribose showed a strong correlation with the UxaR, TreR, BglR, CelR, AraR, RhaR, XylR, GluR, GalR, and RbsR regulons. Ultimately, this study elucidated the transcriptional regulatory network and mechanisms controlling expression of carbohydrate utilization genes in T. maritima. In addition to improving the functional annotations of associated transporters and catabolic enzymes, this research provides novel insights into the evolution of regulatory networks in Thermotogales. PMID:23986752

  20. Resolvase-in vivo expression technology analysis of the Salmonella enterica serovar Typhimurium PhoP and PmrA regulons in BALB/c mice.


    Merighi, Massimo; Ellermeier, Craig D; Slauch, James M; Gunn, John S


    Salmonella enterica modulates resistance to antimicrobial peptides in part via covalent modifications of the lipopolysaccharide (LPS). The two-component systems PhoP/PhoQ and PmrA/PmrB are activated during infection and regulate several genes involved in LPS modifications by responding to signals such as pH, iron, magnesium, and antimicrobial peptides. A recombination-based in vivo expression technology approach was adopted to analyze the spatial-temporal patterns of in vivo expression of genes of the PhoP and PmrA regulons and to identify the in vivo signals modulating their transcription. In vitro, we showed PhoP- and/or PmrA-dependent induction of pmrH (LPS aminoarabinose modification operon) by acidic pH, low levels of magnesium, or high levels of Fe(III). Upregulation in cultured J774A.1 macrophages was shown for pmrH, pagP (LPS palmitate addition), and ssaB (pathogenicity island II secretion) but not for prgH (pathogenicity island I secretion). Increased levels of pmrH, phoP, and prgH transcription but not ssaB were observed in bacteria isolated from the lumen of the distal ileum. Bacteria isolated from spleens of orally inoculated mice showed no further induction of prgH but had the highest expression of pmrH, pagP, and ssaB. In vivo induction of pmrH was fully dependent on pmrA and phoP, and buffering stomach acidity, iron chelation, or low-iron diets did not affect the expression of pmrH in the intestinal lumen. The observation of pmrH and pagP expression in the intestine refutes the paradigm of PhoP/PhoQ and PmrA/PmrB in vivo expression as solely intracellularly induced and supports previous data demonstrating peroral virulence attenuation of pmrH mutants. PMID:16237024

  1. Resolvase-In Vivo Expression Technology Analysis of the Salmonella enterica Serovar Typhimurium PhoP and PmrA Regulons in BALB/c Mice

    PubMed Central

    Merighi, Massimo; Ellermeier, Craig D.; Slauch, James M.; Gunn, John S.


    Salmonella enterica modulates resistance to antimicrobial peptides in part via covalent modifications of the lipopolysaccharide (LPS). The two-component systems PhoP/PhoQ and PmrA/PmrB are activated during infection and regulate several genes involved in LPS modifications by responding to signals such as pH, iron, magnesium, and antimicrobial peptides. A recombination-based in vivo expression technology approach was adopted to analyze the spatial-temporal patterns of in vivo expression of genes of the PhoP and PmrA regulons and to identify the in vivo signals modulating their transcription. In vitro, we showed PhoP- and/or PmrA-dependent induction of pmrH (LPS aminoarabinose modification operon) by acidic pH, low levels of magnesium, or high levels of Fe(III). Upregulation in cultured J774A.1 macrophages was shown for pmrH, pagP (LPS palmitate addition), and ssaB (pathogenicity island II secretion) but not for prgH (pathogenicity island I secretion). Increased levels of pmrH, phoP, and prgH transcription but not ssaB were observed in bacteria isolated from the lumen of the distal ileum. Bacteria isolated from spleens of orally inoculated mice showed no further induction of prgH but had the highest expression of pmrH, pagP, and ssaB. In vivo induction of pmrH was fully dependent on pmrA and phoP, and buffering stomach acidity, iron chelation, or low-iron diets did not affect the expression of pmrH in the intestinal lumen. The observation of pmrH and pagP expression in the intestine refutes the paradigm of PhoP/PhoQ and PmrA/PmrB in vivo expression as solely intracellularly induced and supports previous data demonstrating peroral virulence attenuation of pmrH mutants. PMID:16237024

  2. Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium

    PubMed Central


    Background The Salmonella PreA/PreB two-component system (TCS) is an ortholog of the QseBC TCS of Escherichia coli. In both Salmonella and E. coli, this system has been shown to affect motility and virulence in response to quorum-sensing and hormonal signals, and to affect the transcription of the Salmonella enterica serovar Typhimurium (S. Typhimurium) pmrAB operon, which encodes an important virulence-associated TCS. Results To determine the PreA/PreB regulon in S. Typhimurium, we performed DNA microarrays comparing the wild type strain and various preA and/or preB mutants in the presence of ectopically expressed preA (qseB). These data confirmed our previous findings of the negative effect of PreB on PreA gene regulation and identified candidate PreA-regulated genes. A proportion of the activated loci were previously identified as PmrA-activated genes (yibD, pmrAB, cptA, etc.) or were genes located in the local region around preA, including the preAB operon. The transcriptional units were defined in this local region by RT-PCR, suggesting three PreA activated operons composed of preA-preB, mdaB-ygiN, and ygiW-STM3175. Several putative virulence-related phenotypes were examined for preAB mutants, resulting in the observation of a host cell invasion and slight virulence defect of a preAB mutant. Contrary to previous reports on this TCS, we were unable to show a PreA/PreB-dependent effect of the quorum-sensing signal AI-2 or of epinephrine on S. Typhimurium with regard to bacterial motility. Conclusion This work further characterizes this unorthadox OmpR/EnvZ class TCS and provides novel candidate regulated genes for further study. This first in-depth study of the PreA/PreB regulatory system phenotypes and regulation suggests significant comparative differences to the reported function of the orthologous QseB/QseC in E. coli. PMID:19236707

  3. Multivariate PLS Modeling of Apicomplexan FabD-Ligand Interaction Space for Mapping Target-Specific Chemical Space and Pharmacophore Fingerprints

    PubMed Central

    Surolia, Avadhesha


    Biomolecular recognition underlying drug-target interactions is determined by both binding affinity and specificity. Whilst, quantification of binding efficacy is possible, determining specificity remains a challenge, as it requires affinity data for multiple targets with the same ligand dataset. Thus, understanding the interaction space by mapping the target space to model its complementary chemical space through computational techniques are desirable. In this study, active site architecture of FabD drug target in two apicomplexan parasites viz. Plasmodium falciparum (PfFabD) and Toxoplasma gondii (TgFabD) is explored, followed by consensus docking calculations and identification of fifteen best hit compounds, most of which are found to be derivatives of natural products. Subsequently, machine learning techniques were applied on molecular descriptors of six FabD homologs and sixty ligands to induce distinct multivariate partial-least square models. The biological space of FabD mapped by the various chemical entities explain their interaction space in general. It also highlights the selective variations in FabD of apicomplexan parasites with that of the host. Furthermore, chemometric models revealed the principal chemical scaffolds in PfFabD and TgFabD as pyrrolidines and imidazoles, respectively, which render target specificity and improve binding affinity in combination with other functional descriptors conducive for the design and optimization of the leads. PMID:26535573

  4. Transcriptional and posttranscriptional regulation of cyanobacterial photosynthesis.


    Wilde, Annegret; Hihara, Yukako


    Cyanobacteria are well established model organisms for the study of oxygenic photosynthesis, nitrogen metabolism, toxin biosynthesis, and salt acclimation. However, in comparison to other model bacteria little is known about regulatory networks, which allow cyanobacteria to acclimate to changing environmental conditions. The current work has begun to illuminate how transcription factors modulate expression of different photosynthetic regulons. During the past few years, the research on other regulatory principles like RNA-based regulation showed the importance of non-protein regulators for bacterial lifestyle. Investigations on modulation of photosynthetic components should elucidate the contributions of all factors within the context of a larger regulatory network. Here, we focus on regulation of photosynthetic processes including transcriptional and posttranscriptional mechanisms, citing examples from a limited number of cyanobacterial species. Though, the general idea holds true for most species, important differences exist between various organisms, illustrating diversity of acclimation strategies in the very heterogeneous cyanobacterial clade. This article is part of a Special Issue entitled Organization and dynamics of bioenergetic systems in bacteria, edited by Prof Conrad Mullineaux. PMID:26549130

  5. Global Analysis of Photosynthesis Transcriptional Regulatory Networks

    PubMed Central

    Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.


    Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ?34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ?FnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

  6. Global analysis of photosynthesis transcriptional regulatory networks.


    Imam, Saheed; Noguera, Daniel R; Donohue, Timothy J


    Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ?34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ?FnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

  7. Transcriptional control of quorum sensing and associated metabolic interactions in Pseudomonas syringae strain B728a.


    Scott, Russell A; Lindow, Steven E


    Pseudomonas syringae pv. syringae cell densities fluctuate regularly during host plant colonization. Previously we identified nine genes dependent on the quorum-sensing-associated luxR homolog ahlR during epiphytic and apoplastic stages of host colonization. Yet their contributions to host colonization remain obscure, despite ahlR regulon presence within and beyond the P. syringae pan-genome. To elucidate AhIR regulon member functions, we characterized their regulation, interactions with each other, and contributions to the metabolome. We report Psyr_1625, encoding a functional pyruvate deydrogenase-E1 subunit PdhQ, is required to prevent the accumulation of pyruvate in rich media. Furthermore it is exquisitely regulated by both repression of its own promoter by QrpR within a novel clade of the MarR regulator family, and co-transcription on a 5kb transcript originating from the AhlR-driven ahlI promoter, that reads over ahlR and qrpR. Metabolites accumulated during expression of the second AhlR-driven operon (Psyr_1620-1616, paoABCDE), only in a pdhQ mutant background, in addition to pyruvate, are herein associated with derepression of QrpR-repressed pdhQ. AHL signaling, QrpR, and transcriptional read-through events integrate to ensure AHL-dependent expression of a novel metabolism in anticipation of environmental stress, while minimizing endogenously generated cytotoxicity. PMID:26713670

  8. Transcription mechanisms.

    PubMed Central

    Blackwell, T Keith; Walker, Amy K


    Appropriate regulation of mRNA transcription is central to the differentiation and functions of eukaryotic cells, and to the development of complex organisms. mRNAs are synthesized by the coordinated action of a set of general transcription and mRNA modification factors. These factors and the fundamental mechanisms involved in transcription are conserved among eukaryotes, including C. elegans. Recent studies in various systems have revealed that this apparatus is not controlled through a simple on/off "switch" at the promoter, and that the factors and mechanisms involved in transcription are instead subject to regulation at a surprising number of different levels. In this chapter we will discuss examples in which regulation involving the general mRNA transcription apparatus or other transcription co-factors plays a central role in C. elegans development, and in which C. elegans studies have provided new insights into eukaryotic transcription mechanisms. Together, these studies have shown that regulatory mechanisms that involve the general Pol II machinery are a central participant in many aspects of C. elegans biology. PMID:18050436


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional regulatory network is an important component of the mechanisms that define the adaptive responses of plants to cold stress. In cold-acclimating plants, the centerpiece of such network is the CBF/DREB family of AP2-type transcription factors. In non-acclimating plants like rice, the n...

  10. Identification and characterization of transcription networks in environmentally significant species

    SciTech Connect

    Lawrence, Charles E.; McCue, Lee Ann


    Understanding the regulation of gene expression, transcription regulation in particular, is one of the grand challenges of molecular biology. Transcription regulation is arguably the most important foundation of cellular function, since it exerts the most fundamental control of the abundance of virtually all of a cell's functional macromolecules. Nevertheless, this process, perhaps because of its difficulty, has been the subject of only a limited number of genomic level analyses. We have undertaken bioinformatics projects to address this issue by developing (1) a cross-species comparison method (i.e. phylogenetic footprinting) for the identification of transcription factor binding sites, (2) a Bayesian clustering method to identify regulons, (3) an improved scanning algorithm that uses a position weight matrix and several related species sequence data to locate transcription factor binding sites, and (4) a method to predict cognate binding sites for transcription factors of unknown specificity. These bioinformatics methods were developed using the model proteobacterium Escherichia coli, with further applications to the genomes of environmentally significant microbes (Rhodopseudomonas palustris, Shewanella oneidensis) in later years of the grant.

  11. Cross-species comparison of the Burkholderia pseudomallei, Burkholderia thailandensis, and Burkholderia mallei quorum-sensing regulons.


    Majerczyk, Charlotte D; Brittnacher, Mitchell J; Jacobs, Michael A; Armour, Christopher D; Radey, Matthew C; Bunt, Richard; Hayden, Hillary S; Bydalek, Ryland; Greenberg, E Peter


    Burkholderia pseudomallei, Burkholderia thailandensis, and Burkholderia mallei (the Bptm group) are close relatives with very different lifestyles: B. pseudomallei is an opportunistic pathogen, B. thailandensis is a nonpathogenic saprophyte, and B. mallei is a host-restricted pathogen. The acyl-homoserine lactone quorum-sensing (QS) systems of these three species show a high level of conservation. We used transcriptome sequencing (RNA-seq) to define the quorum-sensing regulon in each species, and we performed a cross-species analysis of the QS-controlled orthologs. Our analysis revealed a core set of QS-regulated genes in all three species, as well as QS-controlled factors shared by only two species or unique to a given species. This global survey of the QS regulons of B. pseudomallei, B. thailandensis, and B. mallei serves as a platform for predicting which QS-controlled processes might be important in different bacterial niches and contribute to the pathogenesis of B. pseudomallei and B. mallei. PMID:25182491

  12. Ascorbic acid-dependent gene expression in Streptococcus pneumoniae and the activator function of the transcriptional regulator UlaR2

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P.


    In this study, we have explored the impact of ascorbic acid on the transcriptome of Streptococcus pneumoniae D39. The expression of several genes and operons, including the ula operon (which has been previously shown to be involved in ascorbic acid utilization), the AdcR regulon (which has been previously shown to be involved in zinc transport and virulence) and a PTS operon (which we denote here as ula2 operon) were altered in the presence of ascorbic acid. The ula2 operon consists of five genes, including the transcriptional activator ulaR2. Our ?-galactosidase assay data and transcriptome comparison of the ulaR2 mutant with the wild-type demonstrated that the transcriptional activator UlaR2 in the presence of ascorbic acid activates the expression of the ula2 operon. We further predict a 16-bp regulatory site (5?-ATATTGTGCTCAAATA-3?) for UlaR2 in the Pula2. Furthermore, we have explored the effect of ascorbic acid on the expression of the AdcR regulon. Our ICP-MS analysis showed that addition of ascorbic acid to the medium causes zinc starvation in the cell which leads to the activation of the AdcR regulon. PMID:25717320

  13. Two Calcium-Dependent Protein Kinases from Chlamydomonas reinhardtii are transcriptionally regulated by nutrient starvation

    PubMed Central

    Motiwalla, Mustafa J; Sequeira, Marilyn P; D'Souza, Jacinta S


    We report here, the transcriptional regulation of 2 Calcium Dependent Protein Kinases in response to nutrient starvation of Chlamydomonas reinhardtii vegetative cells. The CDPK proteins, CDPK1 and CDPK3; share 53% identity among themselves, a maximum of 57% and 52% to higher plants respectively and 42% to apicomplexan protozoans. We expressed a CDPK1-GFP fusion protein in the C. reinhardtii vegetative cells and showed its distribution both in the cell body and the membrane-matrix fraction of the flagella. The fusion protein exhibits mobility shift in the presence of Ca2+, confirming its Ca2+-binding properties. To the best of our knowledge, this is the first report of transcriptional regulation of CDPKs from a unicellular chlorophyte in response to nutrient starvation namely acetate (A), phosphorus (P), and nitrogen (N). PMID:24514873

  14. Elucidating the regulon of multidrug resistance regulator RarA in Klebsiella pneumoniae.


    De Majumdar, Shyamasree; Veleba, Mark; Finn, Sarah; Fanning, Samus; Schneiders, Thamarai


    RarA is an AraC-type regulator in Klebsiella pneumoniae, which, when overexpressed, confers a low-level multidrug-resistant (MDR) phenotype linked to the upregulation of both the acrAB and oqxAB efflux genes. Increased rarA expression has also been shown to be integral in the development of tigecycline resistance in the absence of ramA in K. pneumoniae. Given its phenotypic role in MDR, microarray analyses were performed to determine the RarA regulon. Transcriptome analysis was undertaken using strains Ecl8?rarA/pACrarA-2 (rarA-expressing construct) and Ecl8?rarA/pACYC184 (vector-only control) using bespoke microarray slides consisting of probes derived from the genomic sequences of K. pneumoniae MGH 78578 (NC_009648.1) and Kp342 (NC_011283.1). Our results show that rarA overexpression resulted in the differential expression of 66 genes (42 upregulated and 24 downregulated). Under the COG (clusters of orthologous groups) functional classification, the majority of affected genes belonged to the category of cell envelope biogenesis and posttranslational modification, along with genes encoding the previously uncharacterized transport proteins (e.g., KPN_03141, sdaCB, and leuE) and the porin OmpF. However, genes associated with energy production and conversion and amino acid transport/metabolism (e.g., nuoA, narJ, and proWX) were found to be downregulated. Biolog phenotype analyses demonstrated that rarA overexpression confers enhanced growth of the overexpresser in the presence of several antibiotic classes (i.e., beta-lactams and fluoroquinolones), the antifungal/antiprotozoal compound clioquinol, disinfectants (8-hydroxyquinoline), protein synthesis inhibitors (i.e., minocycline and puromycin), membrane biogenesis agents (polymyxin B and amitriptyline), DNA synthesis (furaltadone), and the cytokinesis inhibitor (sanguinarine). Both our transcriptome and phenotypic microarray data support and extend the role of RarA in the MDR phenotype of K. pneumoniae. PMID:23318802

  15. Use of a promiscuous, constitutively-active bacterial enhancer-binding protein to define the Sigma54 (RpoN) regulon of Salmonella Typhimurium LT2

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Sigma54, or RpoN, is an alternative s factor found widely in eubacteria. A significant complication in analysis of the global sigma54 regulon in a bacterium is that the sigma54 RNA polymerase holoenzyme requires interaction with an active bacterial enhancer-binding protein (bEBP) to init...

  16. Integration of a complex regulatory cascade involving the SirA/BarA and Csr global regulatory systems that controls expression of the Salmonella SPI-1 and SPI-2 virulence regulons through HilD.


    Martínez, Luary C; Yakhnin, Helen; Camacho, Martha I; Georgellis, Dimitris; Babitzke, Paul; Puente, José L; Bustamante, Víctor H


    Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2) play key roles in the pathogenesis of Salmonella enterica. Previously, we showed that when Salmonella grows in Luria-Bertani medium, HilD, encoded in SPI-1, first induces the expression of hilA, located in SPI-1, and subsequently of the ssrAB operon, located in SPI-2. These genes code for HilA and the SsrA/B two-component system, the positive regulators of the SPI-1 and SPI-2 regulons respectively. In this study, we demonstrate that CsrA, a global regulatory RNA binding protein, post-transcriptionally regulates hilD expression by directly binding near the Shine-Dalgarno and translation initiation codon sequences of the hilD mRNA, preventing its translation and leading to its accelerated turnover. Negative regulation is counteracted by the global SirA/BarA two-component system, which directly activates the expression of CsrB and CsrC, two non-coding regulatory RNAs that sequester CsrA, thereby preventing it from binding to its target mRNAs. Our results illustrate the integration of global and specific regulators into a multifactorial regulatory cascade controlling the expression of virulence genes acquired by horizontal transfer events. PMID:21518393

  17. Transcriptional regulation of NAD metabolism in bacteria: NrtR family of Nudix-related regulators

    PubMed Central

    De Ingeniis, Jessica; Mancini, Chiara; Cimadamore, Flavio; Zhang, Hong; Osterman, Andrei L.; Raffaelli, Nadia


    A novel family of transcription factors responsible for regulation of various aspects of NAD synthesis in a broad range of bacteria was identified by comparative genomics approach. Regulators of this family (here termed NrtR for Nudix-related transcriptional regulators), currently annotated as ADP-ribose pyrophosphatases from the Nudix family, are composed of an N-terminal Nudix-like effector domain and a C-terminal DNA-binding HTH-like domain. NrtR regulons were reconstructed in diverse bacterial genomes by identification and comparative analysis of NrtR-binding sites upstream of genes involved in NAD biosynthetic pathways. The candidate NrtR-binding DNA motifs showed significant variability between microbial lineages, although the common consensus sequence could be traced for most of them. Bioinformatics predictions were experimentally validated by gel mobility shift assays for two NrtR family representatives. ADP-ribose, the product of glycohydrolytic cleavage of NAD, was found to suppress the in vitro binding of NrtR proteins to their DNA target sites. In addition to a major role in the direct regulation of NAD homeostasis, some members of NrtR family appear to have been recruited for the regulation of other metabolic pathways, including sugar pentoses utilization and biogenesis of phosphoribosyl pyrophosphate. This work and the accompanying study of NiaR regulon demonstrate significant variability of regulatory strategies for control of NAD metabolic pathway in bacteria. PMID:18276643

  18. The functional landscape bound to the transcription factors of Escherichia coli K-12.


    Prez-Rueda, Ernesto; Tenorio-Salgado, Silvia; Huerta-Saquero, Alejandro; Balderas-Martnez, Yalbi I; Moreno-Hagelsieb, Gabriel


    Motivated by the experimental evidences accumulated in the last ten years and based on information deposited in RegulonDB, literature look up, and sequence analysis, we analyze the repertoire of 304 DNA-binding Transcription factors (TFs) in Escherichia coli K-12. These regulators were grouped in 78 evolutionary families and are regulating almost half of the total genes in this bacterium. In structural terms, 60% of TFs are composed by two-domains, 30% are monodomain, and 10% three- and four-structural domains. As previously noticed, the most abundant DNA-binding domain corresponds to the winged helix-turn-helix, with few alternative DNA-binding structures, resembling the hypothesis of successful protein structures with the emergence of new ones at low scales. In summary, we identified and described the characteristics associated to the DNA-binding TF in E. coli K-12. We also identified twelve functional modules based on a co-regulated gene matrix. Finally, diverse regulons were predicted based on direct associations between the TFs and potential regulated genes. This analysis should increase our knowledge about the gene regulation in the bacterium E. coli K-12, and provide more additional clues for comprehensive modelling of transcriptional regulatory networks in other bacteria. PMID:26094112

  19. Transcriptional regulation of NAD metabolism in bacteria: NrtR family of Nudix-related regulators.


    Rodionov, Dmitry A; De Ingeniis, Jessica; Mancini, Chiara; Cimadamore, Flavio; Zhang, Hong; Osterman, Andrei L; Raffaelli, Nadia


    A novel family of transcription factors responsible for regulation of various aspects of NAD synthesis in a broad range of bacteria was identified by comparative genomics approach. Regulators of this family (here termed NrtR for Nudix-related transcriptional regulators), currently annotated as ADP-ribose pyrophosphatases from the Nudix family, are composed of an N-terminal Nudix-like effector domain and a C-terminal DNA-binding HTH-like domain. NrtR regulons were reconstructed in diverse bacterial genomes by identification and comparative analysis of NrtR-binding sites upstream of genes involved in NAD biosynthetic pathways. The candidate NrtR-binding DNA motifs showed significant variability between microbial lineages, although the common consensus sequence could be traced for most of them. Bioinformatics predictions were experimentally validated by gel mobility shift assays for two NrtR family representatives. ADP-ribose, the product of glycohydrolytic cleavage of NAD, was found to suppress the in vitro binding of NrtR proteins to their DNA target sites. In addition to a major role in the direct regulation of NAD homeostasis, some members of NrtR family appear to have been recruited for the regulation of other metabolic pathways, including sugar pentoses utilization and biogenesis of phosphoribosyl pyrophosphate. This work and the accompanying study of NiaR regulon demonstrate significant variability of regulatory strategies for control of NAD metabolic pathway in bacteria. PMID:18276643

  20. Differential oxidative damage and expression of stress defence regulons in culturable and non-culturable Escherichia coli cells

    PubMed Central

    Desnues, Benoît; Cuny, Caroline; Grégori, Gérald; Dukan, Sam; Aguilaniu, Hugo; Nyström, Thomas


    Potentially pathogenic bacteria, such as Escherichia coli and Vibrio cholerae, become non-culturable during stasis. The analysis of such cells has been hampered by difficulties in studying bacterial population heterogeneity. Using in situ detection of protein oxidation in single E. coli cells, and using a density-gradient centrifugation technique to separate culturable and non-culturable cells, we show that the proteins in non-culturable cells show increased and irreversible oxidative damage, which affects various bacterial compartments and proteins. The levels of expression of specific stress regulons are higher in non-culturable cells, confirming increased defects relating to oxidative damage and the occurrence of aberrant, such as by amino-acid misincorporation, proteins. Our data suggest that non-culturable cells are produced due to stochastic deterioration, rather than an adaptive programme, and pinpoint oxidation management as the 'Achilles heel' of these cells. PMID:12671690

  1. Deciphering the Regulon of Streptomyces coelicolor AbrC3, a Positive Response Regulator of Antibiotic Production

    PubMed Central

    Rico, Sergio; Santamara, Ramn I.; Yepes, Ana; Rodrguez, Hctor; Laing, Emma; Bucca, Giselda; Smith, Colin P.


    The atypical two-component system (TCS) AbrC1/C2/C3 (encoded by SCO4598, SCO4597, and SCO4596), comprising two histidine kinases (HKs) and a response regulator (RR), is crucial for antibiotic production in Streptomyces coelicolor and for morphological differentiation under certain nutritional conditions. In this study, we demonstrate that deletion of the RR-encoding gene, abrC3 (SCO4596), results in a dramatic decrease in actinorhodin (ACT) and undecylprodiginine (RED) production and delays morphological development. In contrast, the overexpression of abrC3 in the parent strain leads to a 33% increase in ACT production in liquid medium. Transcriptomic analysis and chromatin immunoprecipitation with microarray technology (ChIP-chip) analysis of the ?abrC3 mutant and the parent strain revealed that AbrC3 directly controls ACT production by binding to the actII-ORF4 promoter region; this was independently verified by in vitro DNA-binding assays. This binding is dependent on the sequence 5?-GAASGSGRMS-3?. In contrast, the regulation of RED production is not due to direct binding of AbrC3 to either the redZ or redD promoter region. This study also revealed other members of the AbrC3 regulon: AbrC3 is a positive autoregulator which also binds to the promoter regions of SCO0736, bdtA (SCO3328), absR1 (SCO6992), and SCO6809. The direct targets share the 10-base consensus binding sequence and may be responsible for some of the phenotypes of the ?abrC3 mutant. The identification of the AbrC3 regulon as part of the complex regulatory network governing antibiotic production widens our knowledge regarding TCS involvement in control of antibiotic synthesis and may contribute to the rational design of new hyperproducer host strains through genetic manipulation of such systems. PMID:24509929

  2. Characterization of the Fur regulon in Pseudomonas syringae pv. tomato DC3000

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The plant pathogen Pseudomonas syringae pv. tomato DC3000 is found in a wide variety of environments and as a result must monitor and respond to various environmental signals. In previous studies, we investigated the transcriptional response of DC3000 to iron, an essential element for bacterial grow...

  3. Biological clocks and the coordination theory of RNA operons and regulons.


    Keene, J D


    One of the regulatory models of circadian rhythms involves the oscillation of transcription and translation. Although transcription factors have been widely examined during circadian processes, posttranscriptional mechanisms are less well-studied. Several laboratories have used microarrays to detect changes in mRNA expression throughout the circadian cycle and have found that mRNAs encoding the RNA-binding proteins (RBPs) nocturnin and butyrate response factor (BRF1) undergo rhythmic changes. Nocturnin is a deadenylation enzyme that removes poly(A) from the 3' ends of mRNAs, whereas BRF1 destabilizes mRNAs encoding early response gene (ERG) transcripts that contain AU-rich sequences in their 3'-untranslated regions (UTRs). Moroni and coworkers proposed that BRF1 functions as an oscillating posttranscriptional RNA operon (PTRO) that diurnally degrades ERG transcripts in peripheral organs (Keene and Tenenbaum 2002; Benjamin et al. 2006). The PTRO model posits that mRNAs can be members of one or more discrete functionally related subsets of mRNAs as determined by cis elements in mRNA and trans-acting RBPs or microRNAs that collectively recognize these cis elements (Keene 2007). This chapter describes the basis of posttranscriptional coordination by RNA operons and their potential for horizontal transfer among cells and discusses the potential for RBPs and microRNAs to participate in coordinating circadian rhythms and other biological clocks. PMID:18419273

  4. Candidate regulators of the cold stress response gene regulon of rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional regulation is an important aspect of the complex network of genes involved in plant responses to low temperature. At the seedling stage, most japonica cultivars can survive continuous exposure to as low as 10oC for up to 7 days better than most indica cultivars. Here we present a sna...

  5. Effects of triclocarban on the transcription of estrogen, androgen and aryl hydrocarbon receptor responsive genes in human breast cancer cells.


    Tarnow, Patrick; Tralau, Tewes; Hunecke, Danele; Luch, Andreas


    Triclocarban (TCC) is an antimicrobial agent that is used in detergents, soaps and other personal hygiene products. Similarly to triclosan the widespread use of TCC has raised concerns about its endocrine potential. In luciferase-based reporter assays TCC has been shown to enhance estrogenic and androgenic activities following cellular coexposure with estrogen or dihydrotestosterone, respectively. The present study demonstrates that although coexposure with TCC enhances the estrogenic and androgenic readout of luciferase-based reporter cell lines such as HeLa9908 and MDA-kb2, it fails to act as a xenoandrogen on transcriptional level, nor does it induce cell proliferation in the estrogen sensitive E-screen. In addition TCC did not alter the expression of estrogen responsive genes in human mammary carcinoma MCF-7 cells exposed to 17?-estradiol, bisphenol A, butylparaben or genistein. However, TCC was shown to interfere with the regulon of the aryl hydrocarbon receptor (AhR) as TCC showed a costimulatory effect on transcription of CYP1A1 and CYP1B1, effectively lowering the transcriptional threshold for both genes in the presence of estrogens. It thus seems, that while the induction of the respective luciferase reporter assays by TCC is an unspecific false positive signal caused by luciferase stabilisation, TCC has the potential to interfere with the regulatory crosstalk of the estrogen receptor (ER) and the AhR regulon. PMID:23524099

  6. Transcription elongation

    PubMed Central

    Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail


    Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity. PMID:25764114

  7. Transcription of two sigma 70 homologue genes, sigA and sigB, in stationary-phase Mycobacterium tuberculosis.


    Hu, Y; Coates, A R


    The sigA and sigB genes of Mycobacterium tuberculosis encode two sigma 70-like sigma factors of RNA polymerase. While transcription of the sigA gene is growth rate independent, sigB transcription is increased during entry into stationary phase. The sigA gene transcription is unresponsive to environmental stress but that of sigB is very responsive, more so in stationary-phase growth than in log-phase cultures. These data suggest that SigA is a primary sigma factor which, like sigma70, controls the transcription of the housekeeping type of promoters. In contrast, SigB, although showing some overlap in function with SigA, is more like the alternative sigma factor, sigmaS, which controls the transcription of the gearbox type of promoters. Primer extension analysis identified the RNA start sites for both genes as 129 nucleotides upstream to the GTG start codon of sigA and 27 nucleotides from the ATG start codon of sigB. The -10 promoter of sigA but not that of sigB was similar to the sigma70 promoter. The half-life of the sigA transcript was very long, and this is likely to play an important part in its regulation. In contrast, the half-life of the sigB transcript was short, about 2 min. These results demonstrate that the sigB gene may control the regulons of stationary phase and general stress resistance, while sigA may be involved in the housekeeping regulons. PMID:9882660

  8. The Evolutionary Rewiring of the Ribosomal Protein Transcription Pathway Modifies the Interaction of Transcription Factor Heteromer Ifh1-Fhl1 (Interacts with Forkhead 1-Forkhead-like 1) with the DNA-binding Specificity Element*

    PubMed Central

    Mallick, Jaideep; Whiteway, Malcolm


    The genes encoding the ribosomal proteins of fungi form a regulon whose expression is enhanced under good growth conditions and down-regulated under starvation conditions. The fungal pathogen Candida albicans contains an evolutionarily ancient control circuit for this regulon where a heteromer made up of the transcription regulators Ifh1 (interacts with Forkhead 1) and Fhl1 (Forkhead-like 1) is targeted to the ribosomal protein genes by the DNA binding factor Tbf1. In the more recently evolved circuit in the model yeast Saccharomyces cerevisiae (Sc), the generalist repressor-activator protein Rap1 now directs the Ifh1-Fhl1 module to the ribosomal protein genes. Even though overall sequence similarity is low for the respective Fhl1 and Ifh1 subunits, in both species, the Ifh1 protein links to the Forkhead-associated domain of Fhl1 through its FHB domain. Intriguingly, correlated with the transition to the Rap1-regulated circuit, the Sc-Ifh1 contains a Rap1 binding domain that is not present in the C. albicans protein. Because no extensive common sequences are found in Tbf1 and Rap1, it appears that these targeting proteins must connect to the Ifh1-Fhl1 module in distinct ways. Two-hybrid and co-immunoprecipitation analysis has been used to show that in C. albicans Tbf1 is linked to the heterodimer through direct association with Fhl1. By contrast, in S. cerevisiae, the linkage of the heteromer to Rap1 occurs through Ifh1. Thus, in the ascomycetes, the Ifh1-Fhl1 heterodimer has reconfigured its protein associations to remain connected to the ribosomal protein regulon despite rewiring of the targeting transcription factor from Tbf1 to Rap1. PMID:23625919

  9. Deep Sequencing Analysis of Small Noncoding RNA and mRNA Targets of the Global Post-Transcriptional Regulator, Hfq

    PubMed Central

    Sittka, Alexandra; Lucchini, Sacha; Papenfort, Kai; Sharma, Cynthia M.; Rolle, Katarzyna; Binnewies, Tim T.; Hinton, Jay C. D.; Vogel, Jrg


    Recent advances in high-throughput pyrosequencing (HTPS) technology now allow a thorough analysis of RNA bound to cellular proteins, and, therefore, of post-transcriptional regulons. We used HTPS to discover the Salmonella RNAs that are targeted by the common bacterial Sm-like protein, Hfq. Initial transcriptomic analysis revealed that Hfq controls the expression of almost a fifth of all Salmonella genes, including several horizontally acquired pathogenicity islands (SPI-1, -2, -4, -5), two sigma factor regulons, and the flagellar gene cascade. Subsequent HTPS analysis of 350,000 cDNAs, derived from RNA co-immunoprecipitation (coIP) with epitope-tagged Hfq or control coIP, identified 727 mRNAs that are Hfq-bound in vivo. The cDNA analysis discovered new, small noncoding RNAs (sRNAs) and more than doubled the number of sRNAs known to be expressed in Salmonella to 64; about half of these are associated with Hfq. Our analysis explained aspects of the pleiotropic effects of Hfq loss-of-function. Specifically, we found that the mRNAs of hilD (master regulator of the SPI-1 invasion genes) and flhDC (flagellar master regulator) were bound by Hfq. We predicted that defective SPI-1 secretion and flagellar phenotypes of the hfq mutant would be rescued by overexpression of HilD and FlhDC, and we proved this to be correct. The combination of epitope-tagging and HTPS of immunoprecipitated RNA detected the expression of many intergenic chromosomal regions of Salmonella. Our approach overcomes the limited availability of high-density microarrays that have impeded expression-based sRNA discovery in microorganisms. We present a generic strategy that is ideal for the systems-level analysis of the post-transcriptional regulons of RNA-binding proteins and for sRNA discovery in a wide range of bacteria. PMID:18725932

  10. Analysis of the σE Regulon in Crohn's Disease-Associated Escherichia coli Revealed Involvement of the waaWVL Operon in Biofilm Formation

    PubMed Central

    Garénaux, Estelle; Carriere, Jessica; Rolhion, Nathalie; Guérardel, Yann; Barnich, Nicolas; Darfeuille-Michaud, Arlette


    ABSTRACT Ileal lesions of patients with Crohn's disease are colonized by adherent-invasive Escherichia coli (AIEC), which is able to adhere to and to invade intestinal epithelial cells (IEC), to replicate within macrophages, and to form biofilms on the surface of the intestinal mucosa. Previous analyses indicated the involvement of the σE pathway in AIEC-IEC interaction, as well as in biofilm formation, with σE pathway inhibition leading to an impaired ability of AIEC to colonize the intestinal mucosa and to form biofilms. The aim of this study was to characterize the σE regulon of AIEC strain LF82 in order to identify members involved in AIEC phenotypes. Using comparative in silico analysis of the σE regulon, we identified the waaWVL operon as a new member of the σE regulon in reference AIEC strain LF82. We determined that the waaWVL operon is involved in AIEC lipopolysaccharide structure and composition, and the waaWVL operon was found to be essential for AIEC strains to produce biofilm and to colonize the intestinal mucosa. IMPORTANCE An increased prevalence of adherent-invasive Escherichia coli (AIEC) bacteria was previously observed in the intestinal mucosa of Crohn's disease (CD) patients, and clinical observations revealed bacterial biofilms associated with the mucosa of CD patients. Here, analysis of the σE regulon in AIEC and commensal E. coli identified 12 genes controlled by σE only in AIEC. Among them, WaaWVL factors were found to play an essential role in biofilm formation and mucosal colonization by AIEC. In addition to identifying molecular tools that revealed a pathogenic population of E. coli colonizing the mucosa of CD patients, these results indicate that targeting the waaWVL operon could be a potent therapeutic strategy to interfere with the ability of AIEC to form biofilms and to colonize the gut mucosa. PMID:25666140

  11. Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress

    PubMed Central


    Background Organisms of the genus Clostridium are Gram-positive endospore formers of great importance to the carbon cycle, human normo- and pathophysiology, but also in biofuel and biorefinery applications. Exposure of Clostridium organisms to chemical and in particular toxic metabolite stress is ubiquitous in both natural (such as in the human microbiome) and engineered environments, engaging both the general stress response as well as specialized programs. Yet, despite its fundamental and applied significance, it remains largely unexplored at the systems level. Results We generated a total of 96 individual sets of microarray data examining the transcriptional changes in C. acetobutylicum, a model Clostridium organism, in response to three levels of chemical stress from the native metabolites, butanol and butyrate. We identified 164 significantly differentially expressed transcriptional regulators and detailed the cellular programs associated with general and stressor-specific responses, many previously unexplored. Pattern-based, comparative genomic analyses enabled us, for the first time, to construct a detailed picture of the genetic circuitry underlying the stress response. Notably, a list of the regulons and DNA binding motifs of the stress-related transcription factors were identified: two heat-shock response regulators, HrcA and CtsR; the SOS response regulator LexA; the redox sensor Rex; and the peroxide sensor PerR. Moreover, several transcriptional regulators controlling stress-responsive amino acid and purine metabolism and their regulons were also identified, including ArgR (arginine biosynthesis and catabolism regulator), HisR (histidine biosynthesis regulator), CymR (cysteine metabolism repressor) and PurR (purine metabolism repressor). Conclusions Using an exceptionally large set of temporal transcriptional data and regulon analyses, we successfully built a STRING-based stress response network model integrating important players for the general and specialized metabolite stress response in C. acetobutylicum. Since the majority of the transcription factors and their target genes are highly conserved in other organisms of the Clostridium genus, this network would be largely applicable to other Clostridium organisms. The network informs the molecular basis of Clostridium responses to toxic metabolites in natural ecosystems and the microbiome, and will facilitate the construction of genome-scale models with added regulatory-network dimensions to guide the development of tolerant strains. PMID:24196194

  12. Microarray analysis identifies Salmonella genes belonging to the low-shear modeled microgravity regulon

    NASA Technical Reports Server (NTRS)

    Wilson, James W.; Ramamurthy, Rajee; Porwollik, Steffen; McClelland, Michael; Hammond, Timothy; Allen, Pat; Ott, C. Mark; Pierson, Duane L.; Nickerson, Cheryl A.


    The low-shear environment of optimized rotation suspension culture allows both eukaryotic and prokaryotic cells to assume physiologically relevant phenotypes that have led to significant advances in fundamental investigations of medical and biological importance. This culture environment has also been used to model microgravity for ground-based studies regarding the impact of space flight on eukaryotic and prokaryotic physiology. We have previously demonstrated that low-shear modeled microgravity (LSMMG) under optimized rotation suspension culture is a novel environmental signal that regulates the virulence, stress resistance, and protein expression levels of Salmonella enterica serovar Typhimurium. However, the mechanisms used by the cells of any species, including Salmonella, to sense and respond to LSMMG and identities of the genes involved are unknown. In this study, we used DNA microarrays to elucidate the global transcriptional response of Salmonella to LSMMG. When compared with identical growth conditions under normal gravity (1 x g), LSMMG differentially regulated the expression of 163 genes distributed throughout the chromosome, representing functionally diverse groups including transcriptional regulators, virulence factors, lipopolysaccharide biosynthetic enzymes, iron-utilization enzymes, and proteins of unknown function. Many of the LSMMG-regulated genes were organized in clusters or operons. The microarray results were further validated by RT-PCR and phenotypic analyses, and they indicate that the ferric uptake regulator is involved in the LSMMG response. The results provide important insight about the Salmonella LSMMG response and could provide clues for the functioning of known Salmonella virulence systems or the identification of uncharacterized bacterial virulence strategies.

  13. Elucidation of the RamA Regulon in Klebsiella pneumoniae Reveals a Role in LPS Regulation

    PubMed Central

    De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P.; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J.; Bengoechea, José; Gally, David L.; Fanning, Séamus; Elborn, Joseph S.; Schneiders, Thamarai


    Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

  14. RegR Virulence Regulon of Rabbit-Specific Enteropathogenic Escherichia coli Strain E22

    PubMed Central

    Srikhanta, Yogitha N.; Hocking, Dianna M.; Praszkier, Judyta; Wakefield, Matthew J.; Yang, Ji; Tauschek, Marija


    AraC-like regulators play a key role in the expression of virulence factors in enteric pathogens, such as enteropathogenic Escherichia coli (EPEC), enterotoxigenic E. coli, enteroaggregative E. coli, and Citrobacter rodentium. Bioinformatic analysis of the genome of rabbit-specific EPEC (REPEC) strain E22 (O103:H2) revealed the presence of a gene encoding an AraC-like regulatory protein, RegR, which shares 71% identity to the global virulence regulator, RegA, of C. rodentium. Microarray analysis demonstrated that RegR exerts 25- to 400-fold activation on transcription of several genes encoding putative virulence-associated factors, including a fimbrial operon (SEF14), a serine protease, and an autotransporter adhesin. These observations were confirmed by proteomic analysis of secreted and heat-extracted surface-associated proteins. The mechanism of RegR-mediated activation was investigated by using its most highly upregulated gene target, sefA. Transcriptional analyses and electrophoretic mobility shift assays showed that RegR activates the expression of sefA by binding to a region upstream of the sefA promoter, thereby relieving gene silencing by the global regulatory protein H-NS. Moreover, RegR was found to contribute significantly to virulence in a rabbit infection experiment. Taken together, our findings indicate that RegR controls the expression of a series of accessory adhesins that significantly enhance the virulence of REPEC strain E22. PMID:23340312

  15. Dehydrogenase GRD1 represents a novel component of the cellulase regulon in Trichoderma reesei (Hypocrea jecorina).


    Schuster, André; Kubicek, Christian P; Schmoll, Monika


    Trichoderma reesei (Hypocrea jecorina) is nowadays the most important industrial producer of cellulase and hemicellulase enzymes, which are used for pretreatment of cellulosic biomass for biofuel production. In this study, we introduce a novel component, GRD1 (glucose-ribitol dehydrogenase 1), which shows enzymatic activity on cellobiose and positively influences cellulase gene transcription, expression, and extracellular endo-1,4-β-D-glucanase activity. grd1 is differentially transcribed upon growth on cellulose and the induction of cellulase gene expression by sophorose. The transcription of grd1 is coregulated with that of cel7a (cbh1) under inducing conditions. GRD1 is further involved in carbon source utilization on several carbon sources, such as those involved in lactose and D-galactose catabolism, in several cases in a light-dependent manner. We conclude that GRD1 represents a novel enhancer of cellulase gene expression, which by coregulation with the major cellulase may act via optimization of inducing mechanisms. PMID:21602376

  16. Energetic Consequences of nitrite stress in Desulfovibrio vulgarisHildenborough, inferred from global transcriptional analysis

    SciTech Connect

    He, Qiang; Huang, Katherine H.; He, Zhili; Alm, Eric J.; Fields,Matthew W.; Hazen, Terry C.; Arkin, Adam P.; Wall, Judy D.; Zhou, Jizhong


    Many of the proteins that are candidates for bioenergetic pathways involved with sulfate respiration in Desulfovibrio spp. have been studied, but complete pathways and overall cell physiology remain to be resolved for many environmentally relevant conditions. In order to understand the metabolism of these microorganisms under adverse environmental conditions for improved bioremediation efforts, Desulfovibrio vulgaris Hildenborough was used as a model organism to study stress response to nitrite, an important intermediate in the nitrogen cycle. Previous physiological studies demonstrated that growth was inhibited by nitrite and that nitrite reduction was observed to be the primary mechanism of detoxification. Global transcriptional profiling with whole-genome microarrays revealed coordinated cascades of responses to nitrite in pathways of energy metabolism, nitrogen metabolism, oxidative stress response, and iron homeostasis. In agreement with previous observations, nitrite-stressed cells showed a decrease in the expression of genes encoding sulfate reduction functions in addition to respiratory oxidative phosphorylation and ATP synthase activity. Consequently, the stressed cells had decreased expression of the genes encoding ATP-dependent amino acid transporters and proteins involved in translation. Other genes up-regulated in response to nitrite include the genes in the Fur regulon, which is suggested to be involved in iron homeostasis, and genes in the Per regulon, which is predicted to be responsible for oxidative stress response.

  17. The transcriptional program underlying the physiology of clostridial sporulation

    PubMed Central

    Jones, Shawn W; Paredes, Carlos J; Tracy, Bryan; Cheng, Nathan; Sillers, Ryan; Senger, Ryan S; Papoutsakis, Eleftherios T


    Background Clostridia are ancient soil organisms of major importance to human and animal health and physiology, cellulose degradation, and the production of biofuels from renewable resources. Elucidation of their sporulation program is critical for understanding important clostridial programs pertaining to their physiology and their industrial or environmental applications. Results Using a sensitive DNA-microarray platform and 25 sampling timepoints, we reveal the genome-scale transcriptional basis of the Clostridium acetobutylicum sporulation program carried deep into stationary phase. A significant fraction of the genes displayed temporal expression in six distinct clusters of expression, which were analyzed with assistance from ontological classifications in order to illuminate all known physiological observations and differentiation stages of this industrial organism. The dynamic orchestration of all known sporulation sigma factors was investigated, whereby in addition to their transcriptional profiles, both in terms of intensity and differential expression, their activity was assessed by the average transcriptional patterns of putative canonical genes of their regulon. All sigma factors of unknown function were investigated by combining transcriptional data with predicted promoter binding motifs and antisense-RNA downregulation to provide a preliminary assessment of their roles in sporulation. Downregulation of two of these sigma factors, CAC1766 and CAP0167, affected the developmental process of sporulation and are apparently novel sporulation-related sigma factors. Conclusion This is the first detailed roadmap of clostridial sporulation, the most detailed transcriptional study ever reported for a strict anaerobe and endospore former, and the first reported holistic effort to illuminate cellular physiology and differentiation of a lesser known organism. PMID:18631379

  18. Identification and characterization of Toxoplasma?SIP, a conserved apicomplexan cytoskeleton protein involved in maintaining the shape, motility and virulence of the parasite.


    Lentini, Gaelle; Kong-Hap, Marie; El Hajj, Hiba; Francia, Maria; Claudet, Cyrille; Striepen, Boris; Dubremetz, Jean-Franois; Lebrun, Maryse


    Apicomplexa possess a complex pellicle that is composed of a plasma membrane and a closely apposed inner membrane complex (IMC) that serves as a support for the actin-myosin motor required for motility and host cell invasion. The IMC consists of longitudinal plates of flattened vesicles, fused together and lined on the cytoplasmic side by a subpellicular network of intermediate filament-like proteins. The spatial organization of the IMC has been well described by electron microscopy, but its composition and molecular organization is largely unknown. Here, we identify a novel protein of the IMC cytoskeletal network in Toxoplasma gondii, called TgSIP, and conserved among apicomplexan parasites. To finely pinpoint the localization of TgSIP, we used structured illumination super-resolution microscopy and revealed that it likely decorates the transverse sutures of the plates and the basal end of the IMC. This suggests that TgSIP might contribute to the organization or physical connection among the different components of the IMC. We generated a T.gondii?SIP deletion mutant and showed that parasites lacking TgSIP are significantly shorter than wild-type parasites and show defects in gliding motility, invasion and reduced infectivity in mice. PMID:25088010

  19. Identification and characterization of Toxoplasma SIP, a conserved apicomplexan cytoskeleton protein involved in maintaining the shape, motility and virulence of the parasite

    PubMed Central

    Lentini, Gaelle; Kong-Hap, Marie; El Hajj, Hiba; Francia, Maria; Claudet, Cyrille; Striepen, Boris; Dubremetz, Jean-François; Lebrun, Maryse


    Summary Apicomplexa possess a complex pellicle that is composed of a plasma membrane and a closely apposed inner membrane complex (IMC) that serves as a support for the actin-myosin motor required for motility and host cell invasion. The IMC consists of longitudinal plates of flattened vesicles, fused together and lined on the cytoplasmic side by a subpellicular network of intermediate filament-like proteins. The spatial organization of the IMC has been well described by electron microscopy, but its composition and molecular organization is largely unknown. Here, we identify a novel protein of the IMC cytoskeletal network in Toxoplasma gondii, called TgSIP, and conserved among apicomplexan parasites. To finely pinpoint the localization of TgSIP, we used structured illumination super resolution microscopy and revealed that it likely decorates the transverse sutures of the plates and the basal end of the IMC. This suggests that TgSIP might contribute to the organization or physical connection among the different components of the IMC. We generated a T. gondii SIP deletion mutant and showed that parasites lacking TgSIP are significantly shorter than wild-type parasites and show defects in gliding motility, invasion and reduced infectivity in mice. PMID:25088010

  20. Aminopeptidase N1 (EtAPN1), an M1 metalloprotease of the apicomplexan parasite Eimeria tenella, participates in parasite development.


    Gras, Simon; Byzia, Anna; Gilbert, Florence B; McGowan, Sheena; Drag, Marcin; Silvestre, Anne; Niepceron, Alisson; Lecaille, Fabien; Lalmanach, Gilles; Brossier, Fabien


    Aminopeptidases N are metalloproteases of the M1 family that have been reported in numerous apicomplexan parasites, including Plasmodium, Toxoplasma, Cryptosporidium, and Eimeria. While investigating the potency of aminopeptidases as therapeutic targets against coccidiosis, one of the most important avian diseases caused by the genus Eimeria, we identified and characterized Eimeria tenella aminopeptidase N1 (EtAPN1). Its inhibition by bestatin and amastatin, as well as its reactivation by divalent ions, is typical of zinc-dependent metalloproteases. EtAPN1 shared a similar sequence, three-dimensional structure, and substrate specificity and similar kinetic parameters with A-M1 from Plasmodium falciparum (PfA-M1), a validated target in the treatment of malaria. EtAPN1 is synthesized as a 120-kDa precursor and cleaved into 96-, 68-, and 38-kDa forms during sporulation. Further, immunolocalization assays revealed that, similar to PfA-M1, EtAPN1 is present during the intracellular life cycle stages in both the parasite cytoplasm and the parasite nucleus. The present results support the hypothesis of a conserved role between the two aminopeptidases, and we suggest that EtAPN1 might be a valuable target for anticoccidiosis drugs. PMID:24839124

  1. Aminopeptidase N1 (EtAPN1), an M1 Metalloprotease of the Apicomplexan Parasite Eimeria tenella, Participates in Parasite Development

    PubMed Central

    Gras, Simon; Byzia, Anna; Gilbert, Florence B.; McGowan, Sheena; Drag, Marcin; Niepceron, Alisson; Lecaille, Fabien; Lalmanach, Gilles; Brossier, Fabien


    Aminopeptidases N are metalloproteases of the M1 family that have been reported in numerous apicomplexan parasites, including Plasmodium, Toxoplasma, Cryptosporidium, and Eimeria. While investigating the potency of aminopeptidases as therapeutic targets against coccidiosis, one of the most important avian diseases caused by the genus Eimeria, we identified and characterized Eimeria tenella aminopeptidase N1 (EtAPN1). Its inhibition by bestatin and amastatin, as well as its reactivation by divalent ions, is typical of zinc-dependent metalloproteases. EtAPN1 shared a similar sequence, three-dimensional structure, and substrate specificity and similar kinetic parameters with A-M1 from Plasmodium falciparum (PfA-M1), a validated target in the treatment of malaria. EtAPN1 is synthesized as a 120-kDa precursor and cleaved into 96-, 68-, and 38-kDa forms during sporulation. Further, immunolocalization assays revealed that, similar to PfA-M1, EtAPN1 is present during the intracellular life cycle stages in both the parasite cytoplasm and the parasite nucleus. The present results support the hypothesis of a conserved role between the two aminopeptidases, and we suggest that EtAPN1 might be a valuable target for anticoccidiosis drugs. PMID:24839124

  2. Contribution of the Salmonella enterica KdgR Regulon to Persistence of the Pathogen in Vegetable Soft Rots.


    George, Andre S; Salas Gonzlez, Isai; Lorca, Graciela L; Teplitski, Max


    During their colonization of plants, human enteric pathogens, such as Salmonella enterica, are known to benefit from interactions with phytopathogens. At least in part, benefits derived by Salmonella from the association with a soft rot caused by Pectobacterium carotovorum were shown to be dependent on Salmonella KdgR, a regulator of genes involved in the uptake and utilization of carbon sources derived from the degradation of plant polymers. A Salmonella kdgR mutant was more fit in soft rots but not in the lesions caused by Xanthomonas spp. and Pseudomonas spp. Bioinformatic, phenotypic, and gene expression analyses demonstrated that the KdgR regulon included genes involved in uptake and metabolism of molecules resulting from pectin degradation as well as those central to the utilization of a number of other carbon sources. Mutant analyses indicated that the Entner-Doudoroff pathway, in part controlled by KdgR, was critical for the persistence within soft rots and likely was responsible for the kdgR phenotype. PMID:26682862

  3. Molecular Characterization of the Mg2+-Responsive PhoP-PhoQ Regulon in Salmonella enterica

    PubMed Central

    Lejona, Sergio; Aguirre, Andrés; Cabeza, María Laura; García Véscovi, Eleonora; Soncini, Fernando C.


    The PhoP/PhoQ two-component system controls the extracellular magnesium deprivation response in Salmonella enterica. In addition, several virulence-associated genes that are mainly required for intramacrophage survival during the infection process are under the control of its transcriptional regulation. Despite shared Mg2+ modulation of the expression of the PhoP-activated genes, no consensus sequence common to all of them could be detected in their promoter regions. We have investigated the transcriptional regulation and the interaction of the response regulator PhoP with the promoter regions of the PhoP-activated loci phoPQ, mgtA, slyB, pmrD, pcgL, phoN, pagC, and mgtCB. A direct repeat of the heptanucleotide sequence (G/T)GTTTA(A/T) was identified as the conserved motif recognized by PhoP to directly control the gene expression of the first five loci, among which the first four are ancestral to enterobacteria. On the other hand, no direct interaction of the response regulator with the promoter of phoN, pagC, or mgtCB was apparent by either in vitro or in vivo assays. These loci are Salmonella specific and were probably acquired by horizontal DNA transfer. Besides, sequence analysis of pag promoters revealed the presence of a conserved PhoP box in 6 out of the 12 genes analyzed. Our results strongly suggest that the expression of a set of Mg2+-controlled genes is driven by PhoP via unknown intermediate regulatory mechanisms that could also involve ancillary factors. PMID:14563863

  4. Transcriptome analysis of the ArgR regulon in Pseudomonas aeruginosa.


    Lu, Chung-Dar; Yang, Zhe; Li, Wei


    Arginine metabolism in pseudomonads with multiple catabolic pathways for its utilization as carbon and nitrogen sources is of particular interest as the model system to study control of metabolic integration. We performed transcriptome analyses to identify genes controlled by the arginine regulatory protein ArgR and to better understand arginine metabolic pathways of P. aeruginosa. We compared gene expression in wild-type strain PAO1 with that in argR mutant strain PAO501 grown in glutamate minimal medium in the presence and absence of arginine. Ten putative transcriptional units of 28 genes were inducible by ArgR and arginine, including all known ArgR-regulated operons under aerobic conditions. The newly identified genes include the putative adcAB operon, which encodes a catabolic arginine decarboxylase and an antiporter protein, and PA0328, which encodes a hypothetical fusion protein of a peptidase and a type IV autotransporter. Also identified as members of the arginine network are the following solute transport systems: PA1971 (braZ) for branched-chain amino acids permease; PA2042 for a putative sodium:serine symporter; PA3934, which belongs to the family of small oligopeptide transporters; and PA5152-5155, which encodes components of an ABC transporter for a putative opine uptake system. The effect of arginine on the expression of these genes was confirmed by lacZ fusion studies and by DNA binding studies with purified ArgR. Only five transcriptional units of nine genes were qualified as repressible by ArgR and arginine, with three operons (argF, carAB, and argG) in arginine biosynthesis and two operons (gltBD and gdhA) in glutamate biosynthesis. These results indicate that ArgR is important in control of arginine and glutamate metabolism and that arginine and ArgR may have a redundant effect in inducing the uptake systems of certain compounds. PMID:15175299

  5. Impact of Anaerobiosis on Expression of the Iron-Responsive Fur and RyhB Regulons

    PubMed Central

    Beauchene, Nicole A.; Myers, Kevin S.; Chung, Dongjun; Park, Dan M.; Weisnicht, Allison M.; Keleş, Sündüz


    ABSTRACT Iron, a major protein cofactor, is essential for most organisms. Despite the well-known effects of O2 on the oxidation state and solubility of iron, the impact of O2 on cellular iron homeostasis is not well understood. Here we report that in Escherichia coli K-12, the lack of O2 dramatically changes expression of genes controlled by the global regulators of iron homeostasis, the transcription factor Fur and the small RNA RyhB. Using chromatin immunoprecipitation sequencing (ChIP-seq), we found anaerobic conditions promote Fur binding to more locations across the genome. However, by expression profiling, we discovered that the major effect of anaerobiosis was to increase the magnitude of Fur regulation, leading to increased expression of iron storage proteins and decreased expression of most iron uptake pathways and several Mn-binding proteins. This change in the pattern of gene expression also correlated with an unanticipated decrease in Mn in anaerobic cells. Changes in the genes posttranscriptionally regulated by RyhB under aerobic and anaerobic conditions could be attributed to O2-dependent changes in transcription of the target genes: aerobic RyhB targets were enriched in iron-containing proteins associated with aerobic energy metabolism, whereas anaerobic RyhB targets were enriched in iron-containing anaerobic respiratory functions. Overall, these studies showed that anaerobiosis has a larger impact on iron homeostasis than previously anticipated, both by expanding the number of direct Fur target genes and the magnitude of their regulation and by altering the expression of genes predicted to be posttranscriptionally regulated by the small RNA RyhB under iron-limiting conditions. PMID:26670385

  6. Genes of the GadX-GadW regulon in Escherichia coli.


    Tucker, Don L; Tucker, Nancy; Ma, Zhuo; Foster, John W; Miranda, Regina L; Cohen, Paul S; Conway, Tyrrell


    Acid in the stomach is thought to be a barrier to bacterial colonization of the intestine. Escherichia coli, however, has three systems for acid resistance, which overcome this barrier. The most effective of these systems is dependent on transport and decarboxylation of glutamate. GadX regulates two genes that encode isoforms of glutamate decarboxylase critical to this system, but additional genes associated with the glutamate-dependent acid resistance system remained to be identified. The gadX gene and a second downstream araC-like transcription factor gene, gadW, were mutated separately and in combination, and the gene expression profiles of the mutants were compared to those of the wild-type strain grown in neutral and acidified media under conditions favoring induction of glutamate-dependent acid resistance. Cluster and principal-component analyses identified 15 GadX-regulated, acid-inducible genes. Reverse transcriptase mapping demonstrated that these genes are organized in 10 operons. Analysis of the strain lacking GadX but possessing GadW confirmed that GadX is a transcriptional activator under acidic growth conditions. Analysis of the strain lacking GadW but possessing GadX indicated that GadW exerts negative control over three GadX target genes. The strain lacking both GadX and GadW was defective in acid induction of most but not all GadX target genes, consistent with the roles of GadW as an inhibitor of GadX-dependent activation of some genes and an activator of other genes. Resistance to acid was decreased under certain conditions in a gadX mutant and even more so by combined mutation of gadX and gadW. However, there was no defect in colonization of the streptomycin-treated mouse model by the gadX mutant in competition with the wild type, and the gadX gadW mutant was a better colonizer than the wild type. Thus, E. coli colonization of the mouse does not appear to require glutamate-dependent acid resistance. PMID:12730179

  7. Analysis of the spatial and temporal arrangement of transcripts over intergenic regions in the human malarial parasite Plasmodium falciparum

    PubMed Central


    Background The ability of the human malarial parasite Plasmodium falciparum to invade, colonise and multiply within diverse host environments, as well as to manifest its virulence within the human host, are activities tightly linked to the temporal and spatial control of gene expression. Yet, despite the wealth of high throughput transcriptomic data available for this organism there is very little information regarding the location of key transcriptional landmarks or their associated cis-acting regulatory elements. Here we provide a systematic exploration of the size and organisation of transcripts within intergenic regions to yield surrogate information regarding transcriptional landmarks, and to also explore the spatial and temporal organisation of transcripts over these poorly characterised genomic regions. Results Utilising the transcript data for a cohort of 105 genes we demonstrate that the untranscribed regions of mRNA are large and apportioned predominantly to the 5? end of the open reading frame. Given the relatively compact size of the P. falciparum genome, we suggest that whilst transcriptional units are likely to spatially overlap, temporal co-transcription of adjacent transcriptional units is actually limited. Critically, the size of intergenic regions is directly dependent on the orientation of the two transcriptional units arrayed over them, an observation we extend to an analysis of the complete sequences of twelve additional organisms that share moderately compact genomes. Conclusions Our study provides a theoretical framework that extends our current understanding of the transcriptional landscape across the P. falciparum genome. Demonstration of a consensus gene-spacing rule that is shared between P. falciparum and ten other moderately compact genomes of apicomplexan parasites reveals the potential for our findings to have a wider impact across a phylum that contains many organisms important to human and veterinary health. PMID:23601558

  8. Iron-responsive Transcription Factor Aft1 Interacts with Kinetochore Protein Iml3 and Promotes Pericentromeric Cohesin*

    PubMed Central

    Hamza, Akil; Baetz, Kristin


    The Saccharomyces cerevisiae iron-responsive transcription factor, Aft1, has a well established role in regulating iron homeostasis through the transcriptional induction of iron-regulon genes. However, recent studies have implicated Aft1 in other cellular processes independent of iron regulation such as chromosome stability. In addition, chromosome spreads and two-hybrid data suggest that Aft1 interacts with and co-localizes with kinetochore proteins; however, the cellular implications of this have not been established. Here, we demonstrate that Aft1 associates with the kinetochore complex through Iml3. Furthermore, like Iml3, Aft1 is required for the increased association of cohesin with pericentric chromatin, which is required to resist microtubule tension, and aft1? cells display chromosome segregation defects in meiosis. Our work defines a new role for Aft1 in chromosome stability and transmission. PMID:22157760

  9. A class of genes in the HER2 regulon that is poised for transcription in breast cancer cell lines and expressed in human breast tumors

    PubMed Central

    Rahmatpanah, Farah B.; Jia, Zhenyu; Chen, Xin; Char, Jessica E.; Men, Bozhao; Franke, Anna-Clara; Jones, Frank E.; McClelland, Michael; Mercola, Dan


    HER2-positive breast cancer accounts for 25% of all cases and has a poor prognosis. Although progress has been made in understanding signal transduction, little is known of how HER2 achieves gene regulation. We performed whole genome expression analysis on a HER2+ and HER2? breast cancer cell lines and compared these results to expression in 812 primary tumors stratified by their HER2 expression level. Chip-on-chip with anti-RNA polymerase II was compared among breast cancer cell lines to identify genes that are potentially activated by HER2. The expression levels of these HER2-dependent POL II binding genes were determined for the 812 HER2+/? breast cancer tissues. Genes differentially expressed between HER2+/? cell lines were generally regulated in the same direction as in breast cancer tissues. We identified genes that had POLII binding in HER2+ cell lines, but without significant gene expression. Of 737 such genes poised for expression in cell lines, 113 genes were significantly differentially expressed in breast tumors in a HER2-dependent manner. Pathway analysis of these 113 genes revealed that a large group of genes were associated with stem cell and progenitor cell control as indicated by networks centered on NANOG, SOX2, OCT3/4. HER2 directs POL II binding to a large number of genes in breast cancer cells. A poised class of genes in HER2+ cell lines with POLII binding and low RNA expression but is differentially expressed in primary tumors, strongly suggests a role of the microenvironment and further suggests a role for stem cells proliferation in HER2-regulated breast cancer tissue. PMID:25428913

  10. The Inner Membrane Complex Sub-compartment Proteins Critical for Replication of the Apicomplexan Parasite Toxoplasma gondii Adopt a Pleckstrin Homology Fold*

    PubMed Central

    Tonkin, Michelle L.; Beck, Josh R.; Bradley, Peter J.; Boulanger, Martin J.


    Toxoplasma gondii, an apicomplexan parasite prevalent in developed nations, infects up to one-third of the human population. The success of this parasite depends on several unique structures including an inner membrane complex (IMC) that lines the interior of the plasma membrane and contains proteins important for gliding motility and replication. Of these proteins, the IMC sub-compartment proteins (ISPs) have recently been shown to play a role in asexual T. gondii daughter cell formation, yet the mechanism is unknown. Complicating mechanistic characterization of the ISPs is a lack of sequence identity with proteins of known structure or function. In support of elucidating the function of ISPs, we first determined the crystal structures of representative members TgISP1 and TgISP3 to a resolution of 2.10 and 2.32 ?, respectively. Structural analysis revealed that both ISPs adopt a pleckstrin homology fold often associated with phospholipid binding or protein-protein interactions. Substitution of basic for hydrophobic residues in the region that overlays with phospholipid binding in related pleckstrin homology domains, however, suggests that ISPs do not retain phospholipid binding activity. Consistent with this observation, biochemical assays revealed no phospholipid binding activity. Interestingly, mapping of conserved surface residues combined with crystal packing analysis indicates that TgISPs have functionally repurposed the phospholipid-binding site likely to coordinate protein partners. Recruitment of larger protein complexes may also be aided through avidity-enhanced interactions resulting from multimerization of the ISPs. Overall, we propose a model where TgISPs recruit protein partners to the IMC to ensure correct progression of daughter cell formation. PMID:24675080

  11. Quantitative proteomic analysis of the Hfq-regulon in Sinorhizobium meliloti 2011.


    Sobrero, Patricio; Schlüter, Jan-Philip; Lanner, Ulrike; Schlosser, Andreas; Becker, Anke; Valverde, Claudio


    Riboregulation stands for RNA-based control of gene expression. In bacteria, small non-coding RNAs (sRNAs) are a major class of riboregulatory elements, most of which act at the post-transcriptional level by base-pairing target mRNA genes. The RNA chaperone Hfq facilitates antisense interactions between target mRNAs and regulatory sRNAs, thus influencing mRNA stability and/or translation rate. In the α-proteobacterium Sinorhizobium meliloti strain 2011, the identification and detection of multiple sRNAs genes and the broadly pleitropic phenotype associated to the absence of a functional Hfq protein both support the existence of riboregulatory circuits controlling gene expression to ensure the fitness of this bacterium in both free living and symbiotic conditions. In order to identify target mRNAs subject to Hfq-dependent riboregulation, we have compared the proteome of an hfq mutant and the wild type S. meliloti by quantitative proteomics following protein labelling with (15)N. Among 2139 univocally identified proteins, a total of 195 proteins showed a differential abundance between the Hfq mutant and the wild type strain; 65 proteins accumulated ≥2-fold whereas 130 were downregulated (≤0.5-fold) in the absence of Hfq. This profound proteomic impact implies a major role for Hfq on regulation of diverse physiological processes in S. meliloti, from transport of small molecules to homeostasis of iron and nitrogen. Changes in the cellular levels of proteins involved in transport of nucleotides, peptides and amino acids, and in iron homeostasis, were confirmed with phenotypic assays. These results represent the first quantitative proteomic analysis in S. meliloti. The comparative analysis of the hfq mutant proteome allowed identification of novel strongly Hfq-regulated genes in S. meliloti. PMID:23119037

  12. Quantitative Proteomic Analysis of the Hfq-Regulon in Sinorhizobium meliloti 2011

    PubMed Central

    Sobrero, Patricio; Schlüter, Jan-Philip; Lanner, Ulrike; Schlosser, Andreas; Becker, Anke; Valverde, Claudio


    Riboregulation stands for RNA-based control of gene expression. In bacteria, small non-coding RNAs (sRNAs) are a major class of riboregulatory elements, most of which act at the post-transcriptional level by base-pairing target mRNA genes. The RNA chaperone Hfq facilitates antisense interactions between target mRNAs and regulatory sRNAs, thus influencing mRNA stability and/or translation rate. In the α-proteobacterium Sinorhizobium meliloti strain 2011, the identification and detection of multiple sRNAs genes and the broadly pleitropic phenotype associated to the absence of a functional Hfq protein both support the existence of riboregulatory circuits controlling gene expression to ensure the fitness of this bacterium in both free living and symbiotic conditions. In order to identify target mRNAs subject to Hfq-dependent riboregulation, we have compared the proteome of an hfq mutant and the wild type S. meliloti by quantitative proteomics following protein labelling with 15N. Among 2139 univocally identified proteins, a total of 195 proteins showed a differential abundance between the Hfq mutant and the wild type strain; 65 proteins accumulated ≥2-fold whereas 130 were downregulated (≤0.5-fold) in the absence of Hfq. This profound proteomic impact implies a major role for Hfq on regulation of diverse physiological processes in S. meliloti, from transport of small molecules to homeostasis of iron and nitrogen. Changes in the cellular levels of proteins involved in transport of nucleotides, peptides and amino acids, and in iron homeostasis, were confirmed with phenotypic assays. These results represent the first quantitative proteomic analysis in S. meliloti. The comparative analysis of the hfq mutant proteome allowed identification of novel strongly Hfq-regulated genes in S. meliloti. PMID:23119037

  13. Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363?

    PubMed Central

    Zomer, Aldert L.; Buist, Girbe; Larsen, Rasmus; Kok, Jan; Kuipers, Oscar P.


    Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363?ccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric ?35 sequence at an average position of ?56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative ?35 and ?10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical ?10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism. PMID:17028270

  14. Analysis of the Pseudomonas aeruginosa Regulon Controlled by the Sensor Kinase KinB and Sigma Factor RpoN

    PubMed Central

    Damron, F. Heath; Owings, Joshua P.; Okkotsu, Yuta; Varga, John J.; Schurr, Jill R.; Goldberg, Joanna B.; Schurr, Michael J.


    Alginate overproduction by Pseudomonas aeruginosa, also known as mucoidy, is associated with chronic endobronchial infections in cystic fibrosis. Alginate biosynthesis is initiated by the extracytoplasmic function sigma factor (?22; AlgU/AlgT). In the wild-type (wt) nonmucoid strains, such as PAO1, AlgU is sequestered to the cytoplasmic membrane by the anti-sigma factor MucA that inhibits alginate production. One mechanism underlying the conversion to mucoidy is mutation of mucA. However, the mucoid conversion can occur in wt mucA strains via the degradation of MucA by activated intramembrane proteases AlgW and/or MucP. Previously, we reported that the deletion of the sensor kinase KinB in PAO1 induces an AlgW-dependent proteolysis of MucA, resulting in alginate overproduction. This type of mucoid induction requires the alternate sigma factor RpoN (?54). To determine the RpoN-dependent KinB regulon, microarray and proteomic analyses were performed on a mucoid kinB mutant and an isogenic nonmucoid kinB rpoN double mutant. In the kinB mutant of PAO1, RpoN controlled the expression of approximately 20% of the genome. In addition to alginate biosynthetic and regulatory genes, KinB and RpoN also control a large number of genes including those involved in carbohydrate metabolism, quorum sensing, iron regulation, rhamnolipid production, and motility. In an acute pneumonia murine infection model, BALB/c mice exhibited increased survival when challenged with the kinB mutant relative to survival with PAO1 challenge. Together, these data strongly suggest that KinB regulates virulence factors important for the development of acute pneumonia and conversion to mucoidy. PMID:22210761

  15. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    PubMed Central

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.


    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  16. Overproduction of acetate kinase activates the phosphate regulon in the absence of the phoR and phoM functions in Escherichia coli.

    PubMed Central

    Lee, T Y; Makino, K; Shinagawa, H; Nakata, A


    A DNA fragment of Escherichia coli cloned on pBR322 elevated the production of alkaline phosphatase and phosphate-binding protein in a phoR phoM strain. Nucleotide sequence analysis and enzyme assays revealed that the DNA fragment contained the ackA gene, which codes for acetate kinase. A high gene dosage of ackA was needed to induce the production of alkaline phosphatase and phosphate-binding protein in this strain. Overexpression of ackA elevated the intracellular ATP concentration, an effect that might be related to activation of the phosphate regulon in the phoR phoM strain. Images PMID:2158965

  17. Nuclear Glycolytic Enzyme Enolase of Toxoplasma gondii Functions as a Transcriptional Regulator

    PubMed Central

    Mouveaux, Thomas; Oria, Gabrielle; Werkmeister, Elisabeth; Slomianny, Christian; Fox, Barbara A.; Bzik, David J.; Tomavo, Stanislas


    Apicomplexan parasites including Toxoplasma gondii have complex life cycles within different hosts and their infectivity relies on their capacity to regulate gene expression. However, little is known about the nuclear factors that regulate gene expression in these pathogens. Here, we report that T. gondii enolase TgENO2 is targeted to the nucleus of actively replicating parasites, where it specifically binds to nuclear chromatin in vivo. Using a ChIP-Seq technique, we provide evidence for TgENO2 enrichment at the 5′ untranslated gene regions containing the putative promoters of 241 nuclear genes. Ectopic expression of HA-tagged TgENO1 or TgENO2 led to changes in transcript levels of numerous gene targets. Targeted disruption of TgENO1 gene results in a decrease in brain cyst burden of chronically infected mice and in changes in transcript levels of several nuclear genes. Complementation of this knockout mutant with ectopic TgENO1-HA fully restored normal transcript levels. Our findings reveal that enolase functions extend beyond glycolytic activity and include a direct role in coordinating gene regulation in T. gondii. PMID:25153525

  18. Role of glutaredoxin-3 and glutaredoxin-4 in the iron regulation of the Aft1 transcriptional activator in Saccharomyces cerevisiae.


    Ojeda, Luis; Keller, Greg; Muhlenhoff, Ulrich; Rutherford, Julian C; Lill, Roland; Winge, Dennis R


    The transcription factors Aft1 and Aft2 from Saccharomyces cerevisiae regulate the expression of genes involved in iron homeostasis. These factors induce the expression of iron regulon genes in iron-deficient yeast but are inactivated in iron-replete cells. Iron inhibition of Aft1/Aft2 was previously shown to be dependent on mitochondrial components required for cytosolic iron sulfur protein biogenesis. We presently show that the nuclear monothiol glutaredoxins Grx3 and Grx4 are critical for iron inhibition of Aft1 in yeast cells. Cells lacking both glutaredoxins show constitutive expression of iron regulon genes. Overexpression of Grx4 attenuates wild type Aft1 activity. The thioredoxin-like domain in Grx3 and Grx4 is dispensable in mediating iron inhibition of Aft1 activity, whereas the conserved cysteine that is part of the conserved CGFS motif in monothiol glutaredoxins is essential for this function. Grx3 and Grx4 interact with Aft1 as shown by two-hybrid interactions and co-immunoprecipitation assays. The interaction between glutaredoxins and Aft1 is not modulated by the iron status of cells but is dependent on the conserved glutaredoxin domain Cys residue. Thus, Grx3 and Grx4 are novel components required for Aft1 iron regulation that most likely occurs in the nucleus. PMID:16648636

  19. Regulation of the phosphate regulon in Escherichia coli K-12: regulation of the negative regulatory gene phoU and identification of the gene product.

    PubMed Central

    Nakata, A; Amemura, M; Shinagawa, H


    The phoU gene is one of the negative regulatory genes of the pho regulon of Escherichia coli. The DNA fragment carrying phoU has been cloned on pBR322 (Amemura et al., J. Bacteriol. 152:692-701, 1982). Further subcloning, Tn1000 insertion inactivation, and complementation tests localized the phoU gene within a 1.1-kilobase region on the cloned DNA fragment. The gene product of phoU was identified by the maxicell method as a protein with an approximate molecular weight of 27,000. A hybrid plasmid that contains a phoU'-lac'Z fused gene was constructed in vitro. This plasmid enabled us to study phoU gene expression by measuring the beta-galactosidase level in the cells. The plasmid was introduced into various regulatory mutants related to the pho regulon, and phoU gene expression in these strains was studied under limited and excess phosphate conditions. It was found that phoU is expressed at a higher level when the cells are cultured under the excess phosphate condition. The higher phoU expression was observed in a phoB mutant and a phoR-phoM double mutant. The implications of these findings for the regulation of pho genes are discussed. Images PMID:6090402

  20. Decoding Biomass-Sensing Regulons of Clostridium thermocellum Alternative Sigma-I Factors in a Heterologous Bacillus subtilis Host System.


    Muoz-Gutirrez, Ivn; Ortiz de Ora, Lizett; Rozman Grinberg, Inna; Garty, Yuval; Bayer, Edward A; Shoham, Yuval; Lamed, Raphael; Borovok, Ilya


    The Gram-positive, anaerobic, cellulolytic, thermophile Clostridium (Ruminiclostridium) thermocellum secretes a multi-enzyme system called the cellulosome to solubilize plant cell wall polysaccharides. During the saccharolytic process, the enzymatic composition of the cellulosome is modulated according to the type of polysaccharide(s) present in the environment. C. thermocellum has a set of eight alternative RNA polymerase sigma (?) factors that are activated in response to extracellular polysaccharides and share sequence similarity to the Bacillus subtilis ?I factor. The aim of the present work was to demonstrate whether individual C. thermocellum ?I-like factors regulate specific cellulosomal genes, focusing on C. thermocellum ?I6 and ?I3 factors. To search for putative ?I6- and ?I3-dependent promoters, bioinformatic analysis of the upstream regions of the cellulosomal genes was performed. Because of the limited genetic tools available for C. thermocellum, the functionality of the predicted ?I6- and ?I3-dependent promoters was studied in B. subtilis as a heterologous host. This system enabled observation of the activation of 10 predicted ?I6-dependent promoters associated with the C. thermocellum genes: sigI6 (itself, Clo1313_2778), xyn11B (Clo1313_0522), xyn10D (Clo1313_0177), xyn10Z (Clo1313_2635), xyn10Y (Clo1313_1305), cel9V (Clo1313_0349), cseP (Clo1313_2188), sigI1 (Clo1313_2174), cipA (Clo1313_0627), and rsgI5 (Clo1313_0985). Additionally, we observed the activation of 4 predicted ?I3-dependent promoters associated with the C. thermocellum genes: sigI3 (itself, Clo1313_1911), pl11 (Clo1313_1983), ce12 (Clo1313_0693) and cipA. Our results suggest possible regulons of ?I6 and ?I3 in C. thermocellum, as well as the ?I6 and ?I3 promoter consensus sequences. The proposed -35 and -10 promoter consensus elements of ?I6 are CNNAAA and CGAA, respectively. Additionally, a less conserved CGA sequence next to the C in the -35 element and a highly conserved AT sequence three bases downstream of the -10 element were also identified as important nucleotides for promoter recognition. Regarding ?I3, the proposed -35 and -10 promoter consensus elements are CCCYYAAA and CGWA, respectively. The present study provides new clues for understanding these recently discovered alternative ?I factors. PMID:26731480

  1. Induction of the heat shock regulon of Escherichia coli markedly increases production of bacterial viruses at high temperatures.

    PubMed Central

    Wiberg, J S; Mowrey-McKee, M F; Stevens, E J


    Production of bacteriophages T2, T4, and T6 at 42.8 to 44 degrees C was increased from 8- to 260-fold by adapting the Escherichia coli host (grown at 30 degrees C) to growth at the high temperature for 8 min before infection; this increase was abolished if the host htpR (rpoH) gene was inactive. Others have shown that the htpR protein increases or activates the synthesis of at least 17 E. coli heat shock proteins upon raising the growth temperature above a certain level. At 43.8 to 44 degrees C in T4-infected, unadapted cells, the rates of RNA, DNA, and protein synthesis were about 100, 70, and 70%, respectively, of those in T4-infected, adapted cells. Production of the major processed capsid protein, gp23, was reduced significantly more than that of most other T4 proteins in unadapted cells relative to adapted cells. Only 4.6% of the T4 DNA made in unadapted cells was resistant to micrococcal nuclease, versus 50% in adapted cells. Thus, defective maturation of T4 heads appears to explain the failure of phage production in unadapted cells. Overproduction of the heat shock protein GroEL from plasmids restored T4 production in unadapted cells to about 50% of that seen in adapted cells. T4-infected, adapted E. coli B at around 44 degrees C exhibited a partial tryptophan deficiency; this correlated with reduced uptake of uracil that is probably caused by partial induction of stringency. Production of bacteriophage T7 at 44 degrees C was increased two- to fourfold by adapting the host to 44 degrees C before infection; evidence against involvement of the htpR (rpoH) gene is presented. This work and recent work with bacteriophage lambda (C. Waghorne and C.R. Fuerst, Virology 141:51-64, 1985) appear to represent the first demonstrations for any virus that expression of the heat shock regulon of a host is necessary for virus production at high temperature. Images PMID:2446014

  2. Decoding Biomass-Sensing Regulons of Clostridium thermocellum Alternative Sigma-I Factors in a Heterologous Bacillus subtilis Host System

    PubMed Central

    Rozman Grinberg, Inna; Garty, Yuval; Bayer, Edward A.; Shoham, Yuval; Lamed, Raphael; Borovok, Ilya


    The Gram-positive, anaerobic, cellulolytic, thermophile Clostridium (Ruminiclostridium) thermocellum secretes a multi-enzyme system called the cellulosome to solubilize plant cell wall polysaccharides. During the saccharolytic process, the enzymatic composition of the cellulosome is modulated according to the type of polysaccharide(s) present in the environment. C. thermocellum has a set of eight alternative RNA polymerase sigma (σ) factors that are activated in response to extracellular polysaccharides and share sequence similarity to the Bacillus subtilis σI factor. The aim of the present work was to demonstrate whether individual C. thermocellum σI-like factors regulate specific cellulosomal genes, focusing on C. thermocellum σI6 and σI3 factors. To search for putative σI6- and σI3-dependent promoters, bioinformatic analysis of the upstream regions of the cellulosomal genes was performed. Because of the limited genetic tools available for C. thermocellum, the functionality of the predicted σI6- and σI3-dependent promoters was studied in B. subtilis as a heterologous host. This system enabled observation of the activation of 10 predicted σI6-dependent promoters associated with the C. thermocellum genes: sigI6 (itself, Clo1313_2778), xyn11B (Clo1313_0522), xyn10D (Clo1313_0177), xyn10Z (Clo1313_2635), xyn10Y (Clo1313_1305), cel9V (Clo1313_0349), cseP (Clo1313_2188), sigI1 (Clo1313_2174), cipA (Clo1313_0627), and rsgI5 (Clo1313_0985). Additionally, we observed the activation of 4 predicted σI3-dependent promoters associated with the C. thermocellum genes: sigI3 (itself, Clo1313_1911), pl11 (Clo1313_1983), ce12 (Clo1313_0693) and cipA. Our results suggest possible regulons of σI6 and σI3 in C. thermocellum, as well as the σI6 and σI3 promoter consensus sequences. The proposed -35 and -10 promoter consensus elements of σI6 are CNNAAA and CGAA, respectively. Additionally, a less conserved CGA sequence next to the C in the -35 element and a highly conserved AT sequence three bases downstream of the -10 element were also identified as important nucleotides for promoter recognition. Regarding σI3, the proposed -35 and -10 promoter consensus elements are CCCYYAAA and CGWA, respectively. The present study provides new clues for understanding these recently discovered alternative σI factors. PMID:26731480

  3. Dynamics of transcriptional start site selection during nitrogen stress-induced cell differentiation in Anabaena sp. PCC7120.


    Mitschke, Jan; Vioque, Agustín; Haas, Fabian; Hess, Wolfgang R; Muro-Pastor, Alicia M


    The fixation of atmospheric N(2) by cyanobacteria is a major source of nitrogen in the biosphere. In Nostocales, such as Anabaena, this process is spatially separated from oxygenic photosynthesis and occurs in heterocysts. Upon nitrogen step-down, these specialized cells differentiate from vegetative cells in a process controlled by two major regulators: NtcA and HetR. However, the regulon controlled by these two factors is only partially defined, and several aspects of the differentiation process have remained enigmatic. Using differential RNA-seq, we experimentally define a genome-wide map of >10,000 transcriptional start sites (TSS) of Anabaena sp. PCC7120, a model organism for the study of prokaryotic cell differentiation and N(2) fixation. By analyzing the adaptation to nitrogen stress, our global TSS map provides insight into the dynamic changes that modify the transcriptional organization at a critical step of the differentiation process. We identify >900 TSS with minimum fold change in response to nitrogen deficiency of eight. From these TSS, at least 209 were under control of HetR, whereas at least 158 other TSS were potentially directly controlled by NtcA. Our analysis of the promoters activated during the switch to N(2) fixation adds hundreds of protein-coding genes and noncoding transcripts to the list of potentially involved factors. These data experimentally define the NtcA regulon and the DIF(+) motif, a palindrome at or close to position -35 that seems essential for heterocyst-specific expression of certain genes. PMID:22135468

  4. Dynamics of transcriptional start site selection during nitrogen stress-induced cell differentiation in Anabaena sp. PCC7120

    PubMed Central

    Mitschke, Jan; Vioque, Agustín; Haas, Fabian; Hess, Wolfgang R.; Muro-Pastor, Alicia M.


    The fixation of atmospheric N2 by cyanobacteria is a major source of nitrogen in the biosphere. In Nostocales, such as Anabaena, this process is spatially separated from oxygenic photosynthesis and occurs in heterocysts. Upon nitrogen step-down, these specialized cells differentiate from vegetative cells in a process controlled by two major regulators: NtcA and HetR. However, the regulon controlled by these two factors is only partially defined, and several aspects of the differentiation process have remained enigmatic. Using differential RNA-seq, we experimentally define a genome-wide map of >10,000 transcriptional start sites (TSS) of Anabaena sp. PCC7120, a model organism for the study of prokaryotic cell differentiation and N2 fixation. By analyzing the adaptation to nitrogen stress, our global TSS map provides insight into the dynamic changes that modify the transcriptional organization at a critical step of the differentiation process. We identify >900 TSS with minimum fold change in response to nitrogen deficiency of eight. From these TSS, at least 209 were under control of HetR, whereas at least 158 other TSS were potentially directly controlled by NtcA. Our analysis of the promoters activated during the switch to N2 fixation adds hundreds of protein-coding genes and noncoding transcripts to the list of potentially involved factors. These data experimentally define the NtcA regulon and the DIF+ motif, a palindrome at or close to position −35 that seems essential for heterocyst-specific expression of certain genes. PMID:22135468

  5. Transcription Factors That Defend Bacteria Against Reactive Oxygen Species.


    Imlay, James A


    Bacteria live in a toxic world in which their competitors excrete hydrogen peroxide or superoxide-generating redox-cycling compounds. They protect themselves by activating regulons controlled by the OxyR, PerR, and SoxR transcription factors. OxyR and PerR sense peroxide when it oxidizes key thiolate or iron moieties, respectively; they then induce overlapping sets of proteins that defend their vulnerable metalloenzymes. An additional role for OxyR in detecting electrophilic compounds is possible. In some nonenteric bacteria, SoxR appears to control the synthesis and export of redox-cycling compounds, whereas in the enteric bacteria it defends the cell against the same agents. When these compounds oxidize its iron-sulfur cluster, SoxR induces proteins that exclude, excrete, or modify them. It also induces enzymes that defend the cell against the superoxide that such compounds make. Recent work has brought new insight into the biochemistry and physiology of these responses, and comparative studies have clarified their evolutionary histories. PMID:26070785

  6. Transcription in archaea

    NASA Technical Reports Server (NTRS)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)


    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  7. GntR-Type Transcriptional Regulator PckR Negatively Regulates the Expression of Phosphoenolpyruvate Carboxykinase in Corynebacterium glutamicum

    PubMed Central

    Hyeon, Jeong Eun; Kang, Dae Hee; Kim, Young In; You, Seung Kyou


    The pck (cg3169) gene of Corynebacterium glutamicum encodes a phosphoenolpyruvate carboxykinase (PEPCK). Here, a candidate transcriptional regulator that binds to the promoter region of pck was detected using a DNA affinity purification approach. An isolated protein was identified to be PckR (Cg0196), a GntR family transcriptional regulator which consists of 253 amino acids with a mass of 27 kDa as measured by peptide mass fingerprinting. The results of electrophoretic mobility shift assays verified that PckR specifically binds to the pck promoter. The putative regulator binding region extended from position ?44 to ?27 (an 18-bp sequence) relative to the transcriptional start point of the pck gene. We measured the expression of pck in a pckR deletion mutant by using quantitative real-time reverse transcription-PCR. The expression level of pck in the pckR mutant was 7.6 times higher than that in wild-type cells grown in glucose. Comparative DNA microarray hybridizations and bioinformatic searches revealed the gene composition of the transcriptional regulon of C. glutamicum. Based on these results, PckR seemed to play an important role in the regulation of PEPCK in C. glutamicum grown in glucose. In particular, these assays revealed that PckR acts as a repressor of pck expression during glucose metabolism. PMID:22366416

  8. Involvement of the AtoSCDAEB regulon in the high molecular weight poly-(R)-3-hydroxybutyrate biosynthesis in phaCAB(+)Escherichia coli.


    Theodorou, Evaggelos C; Theodorou, Marina C; Kyriakidis, Dimitrios A


    AtoSC two-component system plays a pivotal role in many regulatory indispensable Escherichia coli processes. AtoSCDAEB regulon, comprising the AtoSC system and the atoDAEB operon, regulates the short-chain fatty acids catabolism. We report here, that AtoSC up-regulates the high-molecular weight PHB biosynthesis, in recombinant phaCAB(+)E. coli, with the Cupriavidus necator phaCAB operon. PHB accumulation was maximized upon the acetoacetate-mediated induction of AtoSC, under glucose 1% w/v, resulting in a yield of 1.73 g/l with a biopolymer content of 64.5% w/w. The deletion of the atoSC locus, in the ?atoSC strains, resulted in a 5 fold reduction of PHB accumulation, which was restored by the extrachromosomal introduction of the AtoSC system. The deletion of the atoDAEB operon triggered a significant decrease in PHB synthesis in ?atoDAEB strains. However, the acetoacetate-induced AtoSC system in those strains increased PHB to 1.55 g/l, while AtoC expression increased PHB to 1.4 g/l upon acetoacetate. The complementation of the ?atoDAEB phenotype was achieved by the extrachromosomal introduction of the atoSCDAEB regulon. The individual inhibition of ?-oxidation and mainly fatty-acid biosynthesis pathways by acrylic acid or cerulenin respectively, reduced PHB biosynthesis. Under those conditions the introduction of the atoSC locus or the atoSCDAEB regulon was capable to up-regulate the biopolymer accumulation. The concurrent inhibition of both the fatty acids metabolic pathways eliminated PHB production. PHB up-regulation in phaCAB(+)E. coli, by AtoSC signaling through atoDAEB operon and its participation in the fatty acids metabolism interplay, provide additional perceptions of AtoSC critical involvement in E. coli regulatory processes towards the biotechnologically improved polyhydroxyalkanoates biosynthesis. PMID:22484344

  9. Physiological and Transcriptional Responses of Saccharomyces cerevisiae to Zinc Limitation in Chemostat Cultures

    PubMed Central

    De Nicola, Raffaele; Hazelwood, Lucie A.; De Hulster, Erik A. F.; Walsh, Michael C.; Knijnenburg, Theo A.; Reinders, Marcel J. T.; Walker, Graeme M.; Pronk, Jack T.; Daran, Jean-Marc; Daran-Lapujade, Pascale


    Transcriptional responses of the yeast Saccharomyces cerevisiae to Zn availability were investigated at a fixed specific growth rate under limiting and abundant Zn concentrations in chemostat culture. To investigate the context dependency of this transcriptional response and eliminate growth rate-dependent variations in transcription, yeast was grown under several chemostat regimens, resulting in various carbon (glucose), nitrogen (ammonium), zinc, and oxygen supplies. A robust set of genes that responded consistently to Zn limitation was identified, and the set enabled the definition of the Zn-specific Zap1p regulon, comprised of 26 genes and characterized by a broader zinc-responsive element consensus (MHHAACCBYNMRGGT) than so far described. Most surprising was the Zn-dependent regulation of genes involved in storage carbohydrate metabolism. Their concerted down-regulation was physiologically relevant as revealed by a substantial decrease in glycogen and trehalose cellular content under Zn limitation. An unexpectedly large number of genes were synergistically or antagonistically regulated by oxygen and Zn availability. This combinatorial regulation suggested a more prominent involvement of Zn in mitochondrial biogenesis and function than hitherto identified. PMID:17933919

  10. A workflow for genome-wide mapping of archaeal transcription factors with ChIP-seq.


    Wilbanks, Elizabeth G; Larsen, David J; Neches, Russell Y; Yao, Andrew I; Wu, Chia-Ying; Kjolby, Rachel A S; Facciotti, Marc T


    Deciphering the structure of gene regulatory networks across the tree of life remains one of the major challenges in postgenomic biology. We present a novel ChIP-seq workflow for the archaea using the model organism Halobacterium salinarum sp. NRC-1 and demonstrate its application for mapping the genome-wide binding sites of natively expressed transcription factors. This end-to-end pipeline is the first protocol for ChIP-seq in archaea, with methods and tools for each stage from gene tagging to data analysis and biological discovery. Genome-wide binding sites for transcription factors with many binding sites (TfbD) are identified with sensitivity, while retaining specificity in the identification the smaller regulons (bacteriorhodopsin-activator protein). Chromosomal tagging of target proteins with a compact epitope facilitates a standardized and cost-effective workflow that is compatible with high-throughput immunoprecipitation of natively expressed transcription factors. The Pique package, an open-source bioinformatics method, is presented for identification of binding events. Relative to ChIP-Chip and qPCR, this workflow offers a robust catalog of protein-DNA binding events with improved spatial resolution and significantly decreased cost. While this study focuses on the application of ChIP-seq in H. salinarum sp. NRC-1, our workflow can also be adapted for use in other archaea and bacteria with basic genetic tools. PMID:22323522

  11. A workflow for genome-wide mapping of archaeal transcription factors with ChIP-seq

    PubMed Central

    Wilbanks, Elizabeth G.; Larsen, David J.; Neches, Russell Y.; Yao, Andrew I.; Wu, Chia-Ying; Kjolby, Rachel A. S.; Facciotti, Marc T.


    Deciphering the structure of gene regulatory networks across the tree of life remains one of the major challenges in postgenomic biology. We present a novel ChIP-seq workflow for the archaea using the model organism Halobacterium salinarum sp. NRC-1 and demonstrate its application for mapping the genome-wide binding sites of natively expressed transcription factors. This end-to-end pipeline is the first protocol for ChIP-seq in archaea, with methods and tools for each stage from gene tagging to data analysis and biological discovery. Genome-wide binding sites for transcription factors with many binding sites (TfbD) are identified with sensitivity, while retaining specificity in the identification the smaller regulons (bacteriorhodopsin-activator protein). Chromosomal tagging of target proteins with a compact epitope facilitates a standardized and cost-effective workflow that is compatible with high-throughput immunoprecipitation of natively expressed transcription factors. The Pique package, an open-source bioinformatics method, is presented for identification of binding events. Relative to ChIP-Chip and qPCR, this workflow offers a robust catalog of proteinDNA binding events with improved spatial resolution and significantly decreased cost. While this study focuses on the application of ChIP-seq in H. salinarum sp. NRC-1, our workflow can also be adapted for use in other archaea and bacteria with basic genetic tools. PMID:22323522

  12. Relationship of the superoxide dismutase genes, sodA and sodB, to the iron uptake (/ital fur/) regulon in /ital Escherichia coli/ K-12

    SciTech Connect

    Niederhoffer, E.C.; Naranjo, C.M.; Fee, J.A.


    Expression of sodA, as indicated by MnSod activity is normal in /ital fur/ mutants. This suggests that sodA is not a member of the /ital fur/ regulon and that the putative Fe-binding, regulatory protein of sodA, suggested by Moody and Hassan is not the Fur protein. by contrast, expression of sodB, as indicated by FeSod activity, is completely blocked in /ital fur/ mutants and the effect is restored by transformation with a plasmid having a normal /ital fur/ locus. The observations suggest that Fur, either directly or indirectly, controls SodB biosynthesis. Additional observations are described which indicate that SodB and Fur act together in a complicated fashion to control the biosynthesis of enterobactin. 26 refs., 3 tabs.

  13. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    PubMed Central

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.


    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by “top-down” and “guide-gene” approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via “top-down” approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by “guide-gene” approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice. Thus, the co-regulatory network analysis facilitated the identification of complex OsMYB regulatory networks, and candidate target regulon genes of selected guide MYB genes. The results contribute to the candidate gene screening, and experimentally testable hypotheses for potential regulatory MYB TFs, and their targets under stress conditions. PMID:26734052

  14. Regulons of the Pseudomonas syringae pv. tomato DC3000 iron starvation sigma factors PSPTO_0444, PSPTO_1209 and PSPTO_1286

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas syringae is a globally dispersed environmental bacteria that is well known for its ability to cause destructive plant diseases in agricultural and horticultural settings. The ability of bacteria to survive in diverse environments is correlated with a large number of transcription regulat...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The meristematic tissues of temperate woody perennials must acclimate to freezing temperatures to survive the winter and resume growth the following year. To determine whether the C-repeat binding factor (CBF) family of transcription factors contributing to this process in annual herbaceous species ...

  16. Control of Proteobacterial Central Carbon Metabolism by the HexR Transcriptional Regulator. A Case Study in Shewanella oneidensis

    SciTech Connect

    Leyn, Semen; Li, Xiaoqing; Zheng, Qijing; Novichkov, Pavel; Reed, Samantha B.; Romine, Margaret F.; Fredrickson, Jim K.; Yang, Chen; Osterman, Andrei L.; Rodionov, Dmitry A.


    Bacteria exploit multiple mechanisms for controlling central carbon metabolism (CCM). Thus, a bioinformatic analysis together with some experimental data implicated HexR transcriptional factor as a global CCM regulator in some lineages of Gammaproteobacteria operating as a functional replacement of Cra regulator characteristic of Enterobacteriales. In this study we combined a large-scale comparative genomic reconstruction of HexRcontrolled regulons in 87 species of Proteobacteria with the detailed experimental analysis of HexR regulatory network in Shewanella oneidensis model system. Although nearly all of the HexR-controlled genes are associated with CCM, remarkable variations were revealed in the scale (from 1-2 target operons in Enterobacteriales up to 20 operons in Aeromonadales) and gene content of HexR regulons between 11 compared lineages. A predicted 17-bp pseudo-palindrome with a consensus tTGTAATwwwATTACa, was confirmed as HexR-binding motif for 15 target operons (comprising 30 genes) by in vitro binding assays. The negative effect of the key CCM intermediate, 2-keto-3-deoxy-6- phosphogluconate, on the DNA-regulator complex formation was verified. A dual mode of HexR action on various target promoters, repression of genes involved in catabolic pathways and activation of gluconeogenic genes, was for the first time predicted by the bioinformatc analysis and experimentally verified by changed gene expression pattern in S. oneidensis AhexR mutant. Phenotypic profiling revealed the inability of this mutant to grow on lactate or pyruvate as a single carbon source. A comparative metabolic flux analysis of wild-type and mutant strains of S. oneidensis using 13Clactate labeling and GC-MS analysis confirmed the hypothesized HexR role as a master regulator of gluconeogenic flux from pyruvate via the transcriptional activation of phosphoenolpyruvate synthase (PpsA).

  17. A generic approach to identify Transcription Factor-specific operator motifs; Inferences for LacI-family mediated regulation in Lactobacillus plantarum WCFS1

    PubMed Central

    Francke, Christof; Kerkhoven, Robert; Wels, Michiel; Siezen, Roland J


    Background A key problem in the sequence-based reconstruction of regulatory networks in bacteria is the lack of specificity in operator predictions. The problem is especially prominent in the identification of transcription factor (TF) specific binding sites. More in particular, homologous TFs are abundant and, as they are structurally very similar, it proves difficult to distinguish the related operators by automated means. This also holds for the LacI-family, a family of TFs that is well-studied and has many members that fulfill crucial roles in the control of carbohydrate catabolism in bacteria including catabolite repression. To overcome the specificity problem, a comprehensive footprinting approach was formulated to identify TF-specific operator motifs and was applied to the LacI-family of TFs in the model gram positive organism, Lactobacillus plantarum WCFS1. The main premise behind the approach is that only orthologous sequences that share orthologous genomic context will share equivalent regulatory sites. Results When the approach was applied to the 12 LacI-family TFs of the model species, a specific operator motif was identified for each of them. With the TF-specific operator motifs, potential binding sites were found on the genome and putative minimal regulons could be defined. Moreover, specific inducers could in most cases be linked to the TFs through phylogeny, thereby unveiling the biological role of these regulons. The operator predictions indicated that the LacI-family TFs can be separated into two subfamilies with clearly distinct operator motifs. They also established that the operator related to the 'global' regulator CcpA is not inherently distinct from that of other LacI-family members, only more degenerate. Analysis of the chromosomal position of the identified putative binding sites confirmed that the LacI-family TFs are mostly auto-regulatory and relate mainly to carbohydrate uptake and catabolism. Conclusion Our approach to identify specific operator motifs for different TF-family members is specific and in essence generic. The data infer that, although the specific operator motifs can be used to identify minimal regulons, experimental knowledge on TF activity especially is essential to determine complete regulons as well as to estimate the overlap between TF affinities. PMID:18371204

  18. In vitro evidence that RNA Polymerase acetylation and acetyl phosphate-dependent CpxR phosphorylation affect cpxP transcription regulation.


    Lima, Bruno P; Lennon, Christopher W; Ross, Wilma; Gourse, Richard L; Wolfe, Alan J


    The central metabolite acetyl phosphate (acP) has long been proposed to influence transcription regulation by directly transferring its phosphoryl group to a number of response regulators in many bacterial species. Here, we provide in vitro evidence for this proposition and demonstrate, using an in vitro transcription system, that acP-dependent phosphorylation of aspartate 51 of CpxR induces transcription of one of its regulon members in E. coli, cpxP. We also used this in vitro transcription system to extend our previously reported in vivo data that hypothesized that acetylation of RNA polymerase (RNAP) influences acP-dependent cpxP transcription, using glutamine as a genetic mimic for acetylated arginine 291 of the carboxy-terminal domain of RNAP α subunit. The data we present here lend strong support to the hypothesis that acP has a direct effect on transcription regulation in E. coli via phosphorylation of CpxR, and that RNAP acetylation can modulate this response. PMID:26790713

  19. Morphology of nuclear transcription.


    Weipoltshammer, Klara; Schöfer, Christian


    Gene expression control is a fundamental determinant of cellular life with transcription being the most important step. The spatial nuclear arrangement of the transcription process driven by RNA polymerases II and III is nonrandomly organized in foci, which is believed to add another regulatory layer on gene expression control. RNA polymerase I transcription takes place within a specialized organelle, the nucleolus. Transcription of ribosomal RNA directly responds to metabolic requirements, which in turn is reflected in the architecture of nucleoli. It differs from that of the other polymerases with respect to the gene template organization, transcription rate, and epigenetic expression control, whereas other features are shared like the formation of DNA loops bringing genes and components of the transcription machinery in close proximity. In recent years, significant advances have been made in the understanding of the structural prerequisites of nuclear transcription, of the arrangement in the nuclear volume, and of the dynamics of these entities. Here, we compare ribosomal RNA and mRNA transcription side by side and review the current understanding focusing on structural aspects of transcription foci, of their constituents, and of the dynamical behavior of these components with respect to foci formation, disassembly, and cell cycle. PMID:26847177

  20. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf


    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  1. Quantification of CFTR transcripts.


    Ramalho, Anabela S; Clarke, Luka A; Amaral, Margarida D


    Quantification and analysis of CFTR transcripts is of crucial importance not only for cystic fibrosis (CF) diagnosis and prognosis, but also in evaluating the efficiency of various therapeutic approaches to CF, including gene therapy. Reverse transcription (RT) followed by quantitative polymerase chain reaction (qPCR) is at present the most sensitive method for transcript abundance measurement. Classical RNA-based methods require significant expression levels in target samples for appropriate analysis, thus PCR-based methods have evolved towards reliable quantification. In this chapter we describe and discuss several protocols for the quantitative analysis of CFTR transcripts, including those variants that result from alternative splicing. PMID:21594782

  2. Dissecting the expression patterns of transcription factors across conditions using an integrated network-based approach

    PubMed Central

    Janga, Sarath Chandra; Contreras-Moreira, Bruno


    In prokaryotes, regulation of gene expression is predominantly controlled at the level of transcription. Transcription in turn is mediated by a set of DNA-binding factors called transcription factors (TFs). In this study, we map the complete repertoire of ?300 TFs of the bacterial model, Escherichia coli, onto gene expression data for a number of nonredundant experimental conditions and show that TFs are generally expressed at a lower level than other gene classes. We also demonstrate that different conditions harbor varying number of active TFs, with an average of about 15% of the total repertoire, with certain stress and drug-induced conditions exhibiting as high as one-third of the collection of TFs. Our results also show that activators are more frequently expressed than repressors, indicating that activation of promoters might be a more common phenomenon than repression in bacteria. Finally, to understand the association of TFs with different conditions and to elucidate their dynamic interplay with other TFs, we develop a network-based framework to identify TFs which act as markers, defined as those which are responsible for condition-specific transcriptional rewiring. This approach allowed us to pinpoint several marker TFs as being central in various specialized conditions such as drug induction or growth condition variations, which we discuss in light of previously reported experimental findings. Further analysis showed that a majority of identified markers effectively control the expression of their regulons and, in general, transcriptional programs of most conditions can be effectively rewired by a very small number of TFs. It was also found that closeness is a key centrality measure which can aid in the successful identification of marker TFs in regulatory networks. Our results suggest the utility of the network-based approaches developed in this study to be applicable for understanding other interactomic data sets. PMID:20631006

  3. cse15, cse60, and csk22 are new members of mother-cell-specific sporulation regulons in Bacillus subtilis.

    PubMed Central

    Henriques, A O; Bryan, E M; Beall, B W; Moran, C P


    We report on the characterization of three new transcription units expressed during sporulation in Bacillus subtilis. Two of the units, cse15 and cse60, were mapped at about 123 degrees and 62 degrees on the genetic map, respectively. Their transcription commenced around h 2 of sporulation and showed an absolute requirement for sigmaE. Maximal expression of both cse15 and cse60 further depended on the DNA-binding protein SpoIIID. Primer extension results revealed -10 and -35 sequences upstream of the cse15 and cse60 coding sequences very similar to those utilized by sigmaE-containing RNA polymerase. Alignment of these and other regulatory regions led to a revised consensus sequence for sigmaE-dependent promoters. A third transcriptional unit, designated csk22, was localized at approximately 173 degrees on the chromosome. Transcription of csk22 was activated at h 4 of sporulation, required the late mother-cell regulator sigmaK, and was repressed by the GerE protein. Sequences in the csk22 promoter region were similar to those of other sigmaK-dependent promoters. The cse60 locus was deduced to encode an acidic product of only 60 residues. A 37.6-kDa protein apparently encoded by cse15 was weakly related to the heavy chain of myosins, as well as to other myosin-like proteins, and is predicted to contain a central, 100 residue-long coiled-coil domain. Finally, csk22 is inferred to encode a 18.2-kDa hydrophobic product with five possible membrane-spanning helices, which could function as a transporter. PMID:8990290

  4. Genome-scale co-expression network comparison across Escherichia coli and Salmonella enterica serovar Typhimurium reveals significant conservation at the regulon level of local regulators despite their dissimilar lifestyles.


    Zarrineh, Peyman; Snchez-Rodrguez, Aminael; Hosseinkhan, Nazanin; Narimani, Zahra; Marchal, Kathleen; Masoudi-Nejad, Ali


    Availability of genome-wide gene expression datasets provides the opportunity to study gene expression across different organisms under a plethora of experimental conditions. In our previous work, we developed an algorithm called COMODO (COnserved MODules across Organisms) that identifies conserved expression modules between two species. In the present study, we expanded COMODO to detect the co-expression conservation across three organisms by adapting the statistics behind it. We applied COMODO to study expression conservation/divergence between Escherichia coli, Salmonella enterica, and Bacillus subtilis. We observed that some parts of the regulatory interaction networks were conserved between E. coli and S. enterica especially in the regulon of local regulators. However, such conservation was not observed between the regulatory interaction networks of B. subtilis and the two other species. We found co-expression conservation on a number of genes involved in quorum sensing, but almost no conservation for genes involved in pathogenicity across E. coli and S. enterica which could partially explain their different lifestyles. We concluded that despite their different lifestyles, no significant rewiring have occurred at the level of local regulons involved for instance, and notable conservation can be detected in signaling pathways and stress sensing in the phylogenetically close species S. enterica and E. coli. Moreover, conservation of local regulons seems to depend on the evolutionary time of divergence across species disappearing at larger distances as shown by the comparison with B. subtilis. Global regulons follow a different trend and show major rewiring even at the limited evolutionary distance that separates E. coli and S. enterica. PMID:25101984

  5. Archaeal chromatin and transcription.


    Reeve, John N


    Archaea contain a variety of sequence-independent DNA binding proteins consistent with the evolution of several different, sometimes overlapping and exchangeable solutions to the problem of genome compaction. Some of these proteins undergo residue-specific post-translational lysine acetylation or methylation, hinting at analogues of the histone modifications that regulate eukaryotic chromatin structure and transcription. Archaeal transcription initiation most closely resembles the eukaryotic RNA polymerase II (RNAPII) system, but Archaea do not appear to have homologues of the multisubunit complexes that remodel eukaryotic chromatin and activate RNAPII initiation. In contrast, they have sequence-specific regulators that repress and perhaps activate archaeal transcription by mechanisms superficially similar to the bacterial paradigm of regulating promoter binding by RNAP. Repressors compete with archaeal TATA-box binding protein (TBP) and TFB for the TATA-box and TFB-recognition elements (BRE) of the archaeal promoter, or with archaeal RNAP for the site of transcription initiation. Transcript-specific regulation by repressors binding to sites of transcript initiation is consistent with such sites having very little sequence conservation. However, most Archaea have only one TBP and/or TFB that presumably must therefore bind to similar TATA-box and BRE sequences upstream of most genes. Repressors that function by competing with TBP and/or TFB binding must therefore also make additional contacts with transcript-specific regulatory sites adjacent or remote from the TATA-box/BRE region. The fate of the archaeal TBP and TFB following transcription initiation remains to be determined. Based on functional homology with their eukaryotic RNAPII-system counterparts, archaeal TBP and possibly also TFB should remain bound to the TATA-box/BRE region after transcription initiation. However, this seems unlikely as it might limit repressor competition at this site to only the first round of transcription initiation. PMID:12694606

  6. Global Transcriptional Responses of the Toxic Cyanobacterium, Microcystis aeruginosa, to Nitrogen Stress, Phosphorus Stress, and Growth on Organic Matter

    PubMed Central

    Harke, Matthew J.; Gobler, Christopher J.


    Whole transcriptome shotgun sequencing (RNA-seq) was used to assess the transcriptomic response of the toxic cyanobacterium Microcystis aeruginosa during growth with low levels of dissolved inorganic nitrogen (low N), low levels of dissolved inorganic phosphorus (low P), and in the presence of high levels of high molecular weight dissolved organic matter (HMWDOM). Under low N, one third of the genome was differentially expressed, with significant increases in transcripts observed among genes within the nir operon, urea transport genes (urtBCDE), and amino acid transporters while significant decreases in transcripts were observed in genes related to photosynthesis. There was also a significant decrease in the transcription of the microcystin synthetase gene set under low N and a significant decrease in microcystin content per Microcystis cell demonstrating that N supply influences cellular toxicity. Under low P, 27% of the genome was differentially expressed. The Pho regulon was induced leading to large increases in transcript levels of the alkaline phosphatase phoX, the Pst transport system (pstABC), and the sphX gene, and transcripts of multiple sulfate transporter were also significantly more abundant. While the transcriptional response to growth on HMWDOM was smaller (5–22% of genes differentially expressed), transcripts of multiple genes specifically associated with the transport and degradation of organic compounds were significantly more abundant within HMWDOM treatments and thus may be recruited by Microcystis to utilize these substrates. Collectively, these findings provide a comprehensive understanding of the nutritional physiology of this toxic, bloom-forming cyanobacterium and the role of N in controlling microcystin synthesis. PMID:23894552

  7. Regulation of Expression of the 2-Deoxy-d-Ribose Utilization Regulon, deoQKPX, from Salmonella enterica Serovar Typhimurium

    PubMed Central

    Christensen, Mette; Borza, Tudor; Dandanell, Gert; Gilles, Anne-Marie; Barzu, Octavian; Kelln, Rod A.; Neuhard, Jan


    Salmonella enterica, in contrast to Escherichia coli K12, can use 2-deoxy-d-ribose as the sole carbon source. The genetic determinants for this capacity in S. enterica serovar Typhimurium include four genes, of which three, deoK, deoP, and deoX, constitute an operon. The fourth, deoQ, is transcribed in the opposite direction. The deoK gene encodes deoxyribokinase. In silico analyses indicated that deoP encodes a permease and deoQ encodes a regulatory protein of the deoR family. The deoX gene product showed no match to known proteins in the databases. Deletion analyses showed that both a functional deoP gene and a functional deoX gene were required for optimal utilization of deoxyribose. Using gene fusion technology, we observed that deoQ and the deoKPX operon were transcribed from divergent promoters located in the 324-bp intercistronic region between deoQ and deoK. The deoKPX promoter was 10-fold stronger than the deoQ promoter, and expression was negatively regulated by DeoQ as well as by DeoR, the repressor of the deoxynucleoside catabolism operon. Transcription of deoKPX but not of deoQ was regulated by catabolite repression. Primer extension analysis identified the transcriptional start points of both promoters and showed that induction by deoxyribose occurred at the level of transcription initiation. Gel retardation experiments with purified DeoQ illustrated that it binds independently to tandem operator sites within the deoQ and deoK promoter regions with Kd values of 54 and 2.4 nM, respectively. PMID:14526015

  8. Regulation of poly-(R)-(3-hydroxybutyrate-co-3-hydroxyvalerate) biosynthesis by the AtoSCDAEB regulon in phaCAB+ Escherichia coli.


    Theodorou, Evangelos C; Theodorou, Marina C; Kyriakidis, Dimitrios A


    AtoSC two-component system (TCS) upregulates the high-molecular weight poly-(R)-3-hydroxybutyrate (PHB) biosynthesis in recombinant phaCAB (+) Escherichia coli strains, with the Cupriavidus necator phaCAB operon. We report here that AtoSC upregulates also the copolymer P(3HB-co-3HV) biosynthesis in phaCAB (+) E. coli. Acetoacetate-induced AtoSC maximized P(3HB-co-3HV) to 1.27g/l with a 3HV fraction of 25.5% wt. and biopolymer content of 75% w/w in a time-dependent process. The atoSC locus deletion in the ?atoSC strains resulted in 4.5-fold P(3HB-co-3HV) reduction, while the 3HV fraction of the copolymer was restricted to only 6.4% wt. The ?atoSC phenotype was restored by extrachromosomal introduction of AtoSC. Deletion of the atoDAEB operon triggered a significant decrease in P(3HB-co-3HV) synthesis and 3HV content in ?atoDAEB strains. However, the acetoacetate-induced AtoSC in those strains increased P(3HB-co-3HV) to 0.8g/l with 21% 3HV, while AtoC or AtoS expression increased P(3HB-co-3HV) synthesis 3.6- or 2.4-fold, respectively, upon acetoacetate. Complementation of the ?atoDAEB phenotype was achieved by the extrachromosomal introduction of the atoSCDAEB regulon. Individual inhibition of ?-oxidation and mainly fatty acid biosynthesis pathways by acrylic acid or cerulenin, respectively, reduced P(3HB-co-3HV) biosynthesis. Under those conditions, introduction of atoSC or atoSCDAEB regulon was capable of upregulating biopolymer accumulation. Concurrent inhibition of both the fatty acid metabolic pathways eliminated P(3HB-co-3HV) production. P(3HB-co-3HV) upregulation in phaCAB (+) E. coli by AtoSC signaling through atoDAEB operon and its participation in the fatty acids metabolism interplay provide additional perceptions of AtoSC critical involvement in E. coli regulatory processes towards biotechnologically improved polyhydroxyalkanoates biosynthesis. PMID:23546423

  9. ASTP Onboard Voice Transcription

    NASA Technical Reports Server (NTRS)


    The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

  10. Function of the Pseudomonas aeruginosa NrdR Transcription Factor: Global Transcriptomic Analysis and Its Role on Ribonucleotide Reductase Gene Expression.


    Crespo, Anna; Pedraz, Lucas; Torrents, Eduard


    Ribonucleotide reductases (RNRs) are a family of sophisticated enzymes responsible for the synthesis of the deoxyribonucleotides (dNTPs), the building blocks for DNA synthesis and repair. Although any living cell must contain one RNR activity to continue living, bacteria have the capacity to encode different RNR classes in the same genome, allowing them to adapt to different environments and growing conditions. Pseudomonas aeruginosa is well known for its adaptability and surprisingly encodes all three known RNR classes (Ia, II and III). There must be a complex transcriptional regulation network behind this RNR activity, dictating which RNR class will be expressed according to specific growing conditions. In this work, we aim to uncover the role of the transcriptional regulator NrdR in P. aeruginosa. We demonstrate that NrdR regulates all three RNR classes, being involved in differential control depending on whether the growth conditions are aerobic or anaerobic. Moreover, we also identify for the first time that NrdR is not only involved in controlling RNR expression but also regulates topoisomerase I (topA) transcription. Finally, to obtain the entire picture of NrdR regulon, we performed a global transcriptomic analysis comparing the transcription profile of wild-type and nrdR mutant strains. The results provide many new data about the regulatory network that controls P. aeruginosa RNR transcription, bringing us a step closer to the understanding of this complex system. PMID:25909779

  11. Function of the Pseudomonas aeruginosa NrdR Transcription Factor: Global Transcriptomic Analysis and Its Role on Ribonucleotide Reductase Gene Expression

    PubMed Central

    Crespo, Anna; Pedraz, Lucas; Torrents, Eduard


    Ribonucleotide reductases (RNRs) are a family of sophisticated enzymes responsible for the synthesis of the deoxyribonucleotides (dNTPs), the building blocks for DNA synthesis and repair. Although any living cell must contain one RNR activity to continue living, bacteria have the capacity to encode different RNR classes in the same genome, allowing them to adapt to different environments and growing conditions. Pseudomonas aeruginosa is well known for its adaptability and surprisingly encodes all three known RNR classes (Ia, II and III). There must be a complex transcriptional regulation network behind this RNR activity, dictating which RNR class will be expressed according to specific growing conditions. In this work, we aim to uncover the role of the transcriptional regulator NrdR in P. aeruginosa. We demonstrate that NrdR regulates all three RNR classes, being involved in differential control depending on whether the growth conditions are aerobic or anaerobic. Moreover, we also identify for the first time that NrdR is not only involved in controlling RNR expression but also regulates topoisomerase I (topA) transcription. Finally, to obtain the entire picture of NrdR regulon, we performed a global transcriptomic analysis comparing the transcription profile of wild-type and nrdR mutant strains. The results provide many new data about the regulatory network that controls P. aeruginosa RNR transcription, bringing us a step closer to the understanding of this complex system. PMID:25909779

  12. Characterization of the Escherichia coli σS core regulon by Chromatin Immunoprecipitation-sequencing (ChIP-seq) analysis

    PubMed Central

    Peano, Clelia; Wolf, Johannes; Demol, Julien; Rossi, Elio; Petiti, Luca; De Bellis, Gianluca; Geiselmann, Johannes; Egli, Thomas; Lacour, Stephan; Landini, Paolo


    In bacteria, selective promoter recognition by RNA polymerase is achieved by its association with σ factors, accessory subunits able to direct RNA polymerase “core enzyme” (E) to different promoter sequences. Using Chromatin Immunoprecipitation-sequencing (ChIP-seq), we searched for promoters bound by the σS-associated RNA polymerase form (EσS) during transition from exponential to stationary phase. We identified 63 binding sites for EσS overlapping known or putative promoters, often located upstream of genes (encoding either ORFs or non-coding RNAs) showing at least some degree of dependence on the σS-encoding rpoS gene. EσS binding did not always correlate with an increase in transcription level, suggesting that, at some σS-dependent promoters, EσS might remain poised in a pre-initiation state upon binding. A large fraction of EσS-binding sites corresponded to promoters recognized by RNA polymerase associated with σ70 or other σ factors, suggesting a considerable overlap in promoter recognition between different forms of RNA polymerase. In particular, EσS appears to contribute significantly to transcription of genes encoding proteins involved in LPS biosynthesis and in cell surface composition. Finally, our results highlight a direct role of EσS in the regulation of non coding RNAs, such as OmrA/B, RyeA/B and SibC. PMID:26020590

  13. Characterization of the Escherichia coli ?(S) core regulon by Chromatin Immunoprecipitation-sequencing (ChIP-seq) analysis.


    Peano, Clelia; Wolf, Johannes; Demol, Julien; Rossi, Elio; Petiti, Luca; De Bellis, Gianluca; Geiselmann, Johannes; Egli, Thomas; Lacour, Stephan; Landini, Paolo


    In bacteria, selective promoter recognition by RNA polymerase is achieved by its association with ? factors, accessory subunits able to direct RNA polymerase "core enzyme" (E) to different promoter sequences. Using Chromatin Immunoprecipitation-sequencing (ChIP-seq), we searched for promoters bound by the ?(S)-associated RNA polymerase form (E?(S)) during transition from exponential to stationary phase. We identified 63 binding sites for E?(S) overlapping known or putative promoters, often located upstream of genes (encoding either ORFs or non-coding RNAs) showing at least some degree of dependence on the ?(S)-encoding rpoS gene. E?(S) binding did not always correlate with an increase in transcription level, suggesting that, at some ?(S)-dependent promoters, E?(S) might remain poised in a pre-initiation state upon binding. A large fraction of E?(S)-binding sites corresponded to promoters recognized by RNA polymerase associated with ?(70) or other ? factors, suggesting a considerable overlap in promoter recognition between different forms of RNA polymerase. In particular, E?(S) appears to contribute significantly to transcription of genes encoding proteins involved in LPS biosynthesis and in cell surface composition. Finally, our results highlight a direct role of E?(S) in the regulation of non coding RNAs, such as OmrA/B, RyeA/B and SibC. PMID:26020590

  14. Transcription factor Rex in regulation of pathophysiology in oral pathogens.


    Bitoun, J P; Wen, Z T


    The NAD(+) and NADH-sensing transcriptional regulator Rex is widely conserved across gram-positive bacteria. Rex monitors cellular redox poise and controls the expression of genes/operons involved in diverse pathways including alternative fermentation, oxidative stress responses, and biofilm formation. The oral cavity undergoes frequent and drastic fluctuations in nutrient availability, pH, temperature, oxygen tension, saliva, and shear forces. The oral streptococci are major colonizers of oral mucosa and tooth surfaces and include commensals as well as opportunistic pathogens, including the primary etiological agent of dental caries, Streptococcus mutans. Current understanding of the Rex regulon in oral bacteria is mostly based on studies in S. mutans and endodontic pathogen Enterococcus faecalis. Indeed, other oral bacteria encode homologs of the Rex protein and much is to be gleaned from more in-depth studies. Our current understanding has Rex positioned at the interface of oxygen and energy metabolism. In biofilms, heterogeneous oxygen tension influences the ratio of intracellular NADH and NAD(+) , which is finely tuned through glycolysis and fermentation. In S. mutans, Rex regulates the expression of glycolytic enzyme NAD(+) -dependent glyceraldehyde 3-phosphate dehydrogenase, and NADH-dependent fermentation enzymes/complexes lactate dehydrogenase, pyruvate dehydrogenase, alcohol-acetaldehyde dehydrogenase, and fumarate reductase. In addition, Rex controls the expression of NADH oxidase, a major enzyme used to eliminate oxidative stress and regenerate NAD(+) . Here, we summarize recent studies carried out on the Rex regulators in S. mutans and E. faecalis. This research has important implications for understanding how Rex monitors redox balance and optimizes fermentation pathways for survival and subsequent pathogenicity. PMID:26172563

  15. Global transcriptional response of Caulobacter crescentus to iron availability

    PubMed Central


    Background In the alpha subclass of proteobacteria iron homeostasis is controlled by diverse iron responsive regulators. Caulobacter crescentus, an important freshwater ?-proteobacterium, uses the ferric uptake repressor (Fur) for such purpose. However, the impact of the iron availability on the C. crescentus transcriptome and an overall perspective of the regulatory networks involved remain unknown. Results In this work we report the identification of iron-responsive and Fur-regulated genes in C. crescentus using microarray-based global transcriptional analyses. We identified 42 genes that were strongly upregulated both by mutation of fur and by iron limitation condition. Among them, there are genes involved in iron uptake (four TonB-dependent receptor gene clusters, and feoAB), riboflavin biosynthesis and genes encoding hypothetical proteins. Most of these genes are associated with predicted Fur binding sites, implicating them as direct targets of Fur-mediated repression. These data were validated by ?-galactosidase and EMSA assays for two operons encoding putative transporters. The role of Fur as a positive regulator is also evident, given that 27 genes were downregulated both by mutation of fur and under low-iron condition. As expected, this group includes many genes involved in energy metabolism, mostly iron-using enzymes. Surprisingly, included in this group are also TonB-dependent receptors genes and the genes fixK, fixT and ftrB encoding an oxygen signaling network required for growth during hypoxia. Bioinformatics analyses suggest that positive regulation by Fur is mainly indirect. In addition to the Fur modulon, iron limitation altered expression of 113 more genes, including induction of genes involved in Fe-S cluster assembly, oxidative stress and heat shock response, as well as repression of genes implicated in amino acid metabolism, chemotaxis and motility. Conclusions Using a global transcriptional approach, we determined the C. crescentus iron stimulon. Many but not all of iron responsive genes were directly or indirectly controlled by Fur. The iron limitation stimulon overlaps with other regulatory systems, such as the RpoH and FixK regulons. Altogether, our results showed that adaptation of C. crescentus to iron limitation not only involves increasing the transcription of iron-acquisition systems and decreasing the production of iron-using proteins, but also includes novel genes and regulatory mechanisms. PMID:23941329

  16. The Agrobacterium tumefaciens vir gene transcriptional activator virG is transcriptionally induced by acid pH and other stress stimuli.

    PubMed Central

    Mantis, N J; Winans, S C


    A set of Agrobacterium tumefaciens operons required for pathogenesis is coordinately induced during plant infection by the VirA and VirG proteins. The intracellular concentration of VirG increases in response to acidic media, and this response was proposed to be regulated at the level of transcription at a promoter (P2) that resembles the Escherichia coli heat shock promoters. To test this hypothesis, we first constructed a virG-lacZ transcriptional fusion. A strain containing this fusion had higher levels of beta-galactosidase activity in acidic media than in media at neutral pH. Second, primer extension analysis of virG indicated that acidic media stimulated the transcription of this promoter. To determine whether P2 is a member of a heat shock-like regulon in A. tumefaciens, five agents that induce E. coli heat shock genes were tested for their abilities to induce a P2-lacZ fusion in A. tumefaciens. P2 was most strongly induced by low pH, was moderately stimulated by CdCl2 or mitomycin C, and was slightly induced by P2 as measured by beta-galactosidase activity and primer extension analysis. Induction by these treatments did not require any Ti plasmid-encoded function or the chromosomally encoded RecA protein. We also pulse-labeled cellular proteins after a shift to low pH and detected several proteins whose synthesis was induced by these conditions. We conclude that P2 is primarily induced by acid pH and secondarily by certain other stimuli, each of which is stressful to cell growth. This stress induction is at least partly independent of the heat shock and SOS responses. Images PMID:1735712

  17. Molecular Characterization of Transcriptional Regulation of rovA by PhoP and RovA in Yersinia pestis

    PubMed Central

    Wang, Li; Xiao, Xiao; Tan, Yafang; Guo, Zhaobiao; Zhou, Dongsheng; Yang, Ruifu


    Background Yersinia pestis is the causative agent of plague. The two transcriptional regulators, PhoP and RovA, are required for the virulence of Y. pestis through the regulation of various virulence-associated loci. They are the global regulators controlling two distinct large complexes of cellular pathways. Methodology/Principal Findings Based on the LacZ fusion, primer extension, gel mobility shift, and DNase I footprinting assays, RovA is shown to recognize both of the two promoters of its gene in Y. pestis. The autoregulation of RovA appears to be a conserved mechanism shared by Y. pestis and its closely related progenitor, Y. pseudotuberculosis. In Y. pestis, the PhoP regulator responds to low magnesium signals and then negatively controls only one of the two promoters of rovA through PhoP-promoter DNA association. Conclusions/Significance RovA is a direct transcriptional activator for its own gene in Y. pestis, while PhoP recognizes the promoter region of rovA to repress its transcription. The direct regulatory association between PhoP and RovA bridges the PhoP and RovA regulons in Y. pestis. PMID:21966533

  18. PtrBAM1, a β-amylase-coding gene of Poncirus trifoliata, is a CBF regulon member with function in cold tolerance by modulating soluble sugar levels.


    Peng, Ting; Zhu, Xiaofang; Duan, Nian; Liu, Ji-Hong


    β-Amylase (BAM) catalyses starch breakdown to generate maltose, which can be incorporated into sugar metabolism. However, the role of BAM genes in cold tolerance is less characterized. In this study, we report the isolation and functional characterization of a chloroplast-localizing BAM-encoding gene PtrBAM1 from Poncirus trifoliata. PtrBAM1 was induced by cold, dehydration and salt, but repressed by maltose. Overexpression of PtrBAM1 in tobacco (Nicotiana nudicaulis) increased BAM activity, promoted starch degradation and enhanced the contents of maltose and soluble sugars, whereas opposite changes were observed when PtrBAM1 homolog in lemon (Citrus lemon) was knocked down. The tobacco overexpressing lines exhibited enhanced tolerance to cold at chilling or freezing temperatures. Under cold stress, higher BAM activity and greater accumulation of maltose and soluble sugars were observed in the overexpressing lines when compared with the wild-type or empty vector transformants. Bioinformatics analysis demonstrated that PtrBAM1 promoter contained a CBF-recognizing element. Yeast one-hybrid assay demonstrated that PtrCBF could interact with the promoter fragment containing the element. Taken together, these results demonstrate that PtrBAM1 is a member of CBF regulon and plays an important role in cold tolerance by modulating the levels of soluble sugars acting as osmolytes or antioxidants. PMID:24905016

  19. The product of the Klebsiella pneumoniae nifX gene is a negative regulator of the nitrogen fixation (nif) regulon.

    PubMed Central

    Gosink, M M; Franklin, N M; Roberts, G P


    An insertional mutation was made in the nifX gene of Klebsiella pneumoniae. This mutation had little effect on the nitrogenase activity of the strain, as measured by acetylene reduction. However, on the addition of NH4+ or O2 (conditions which block nif protein synthesis by transcriptional and posttranscriptional mechanisms), the NifX- mutant synthesized nitrogenase proteins longer and had more accumulated nifHDKTY mRNA than did the wild-type K. pneumoniae at all time points tested. Conversely, overexpression of the wild-type nifX region blocked nif protein synthesis, protein accumulation, and nifHDKTY mRNA accumulation. These complementary results indicate that a product of the nifX region has a role in the negative regulation of nif regulation in response to NH4+ and O2. Images FIG. 3 FIG. 5 FIG. 6 FIG. 7 FIG. 8 FIG. 9 PMID:2155202

  20. The product of the Klebsiella pneumoniae nifX gene is a negative regulator of the nitrogen fixation (nif) regulon.


    Gosink, M M; Franklin, N M; Roberts, G P


    An insertional mutation was made in the nifX gene of Klebsiella pneumoniae. This mutation had little effect on the nitrogenase activity of the strain, as measured by acetylene reduction. However, on the addition of NH4+ or O2 (conditions which block nif protein synthesis by transcriptional and posttranscriptional mechanisms), the NifX- mutant synthesized nitrogenase proteins longer and had more accumulated nifHDKTY mRNA than did the wild-type K. pneumoniae at all time points tested. Conversely, overexpression of the wild-type nifX region blocked nif protein synthesis, protein accumulation, and nifHDKTY mRNA accumulation. These complementary results indicate that a product of the nifX region has a role in the negative regulation of nif regulation in response to NH4+ and O2. PMID:2155202

  1. Intersection of the stringent response and the CodY regulon in low GC Gram-positive bacteria.


    Geiger, Tobias; Wolz, Christiane


    Bacteria adapt efficiently to a wide range of nutritional environments. Therefore, they possess overlapping regulatory systems that detect intracellular pools of key metabolites. In low GC Gram-positive bacteria, two global regulators, the stringent response and the CodY repressor, respond to an intracellular decrease in amino acid content. Amino acid limitation leads to rapid synthesis of the alarmones pppGpp and ppGpp through the stringent response and inactivates the CodY repressor. Two cofactors, branched chain amino acids (BCAA) and GTP, are ligands for CodY and facilitate binding to the target DNA. Because (p)ppGpp synthesis and accumulation evidentially reduce the intracellular GTP pool, CodY is released from the DNA, and transcription of target genes is altered. Here, we focus on this intimate link between the stringent response and CodY regulation in different Gram-positive species. PMID:24462007

  2. DNA gyrase stimulates transcription.

    PubMed Central

    Akrigg, A; Cook, P R


    The nuclear DNA of HeLa cells can now be isolated unbroken and supercoiled. Using DNA gyrase and the untwisting enzyme, we have prepared an allomorphic series of templates derived from this nuclear DNA, and also from the circular DNA of the bacterial virus, PM2. We have then transcribed these templates using 2 different RNA polymerases--from wheat germ and Escherichia coli. Relaxed DNA is transcribed slowly by both polymerases. Supertwisting the naturally-supercoiled templates with gyrase slightly inhibits transcription by the bacterial polymerase but stimulates dramatically transcription by RNA polymerase II from wheat germ. PMID:6253926

  3. The Transcription Factor Encyclopedia

    PubMed Central


    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at PMID:22458515

  4. Inference of Expanded Lrp-Like Feast/Famine Transcription Factor Targets in a Non-Model Organism Using Protein Structure-Based Prediction

    PubMed Central

    Ashworth, Justin; Plaisier, Christopher L.; Lo, Fang Yin; Reiss, David J.; Baliga, Nitin S.


    Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer. PMID:25255272

  5. OpaR Controls a Network of Downstream Transcription Factors in Vibrio parahaemolyticus BB22OP

    PubMed Central

    Kernell Burke, Alison; Guthrie, Leah T. C.; Modise, Thero; Cormier, Guy; Jensen, Roderick V.; McCarter, Linda L.; Stevens, Ann M.


    Vibrio parahaemolyticus is an emerging world-wide human pathogen that is associated with food-borne gastroenteritis when raw or undercooked seafood is consumed. Expression of virulence factors in this organism is modulated by the phenomenon known as quorum sensing, which permits differential gene regulation at low versus high cell density. The master regulator of quorum sensing in V. parahaemolyticus is OpaR. OpaR not only controls virulence factor gene expression, but also the colony and cellular morphology associated with growth on a surface and biofilm formation. Whole transcriptome Next Generation sequencing (RNA-Seq) was utilized to determine the OpaR regulon by comparing strains BB22OP (opaR+, LM5312) and BB22TR (?opaR1, LM5674). This work, using the published V. parahaemolyticus BB22OP genome sequence, confirms and expands upon a previous microarray analysis for these two strains that used an Affymetrix GeneChip designed from the closely related V. parahaemolyticus RIMD2210633 genome sequence. Overall there was excellent correlation between the microarray and RNA-Seq data. Eleven transcription factors under OpaR control were identified by both methods and further confirmed by quantitative reverse transcription PCR (qRT-PCR) analysis. Nine of these transcription factors were demonstrated to be direct OpaR targets via in vitro electrophoretic mobility shift assays with purified hexahistidine-tagged OpaR. Identification of the direct and indirect targets of OpaR, including small RNAs, will enable the construction of a network map of regulatory interactions important for the switch between the nonpathogenic and pathogenic states. PMID:25901572

  6. Focus on Refugees. Transcript.

    ERIC Educational Resources Information Center

    Brandel, Sarah; And Others

    This is the transcript of the "Focus on Refugees," proqram conducted by the Overseas Development Council. Remarks from the following participants are included: (1) Sarah Brandel, Associate Fellow at the Overseas Development Council; (2) Gary Perkins, Chief of Mission of the Washington Office of the United Nations High Commissioner for Refugees

  7. Mapping Yeast Transcriptional Networks

    PubMed Central

    Hughes, Timothy R.; de Boer, Carl G.


    The term transcriptional network refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms. PMID:24018767

  8. Transcription of Vowels.

    ERIC Educational Resources Information Center

    Pollock, Karen E.; Berni, Mary C.


    This article addresses the special problems of transcribing vowels in the evaluation of speech samples. It reviews the International Phonetic Alphabet (IPA) symbols and diacritics for transcribing vowels and discusses their importance in the transcription of disordered speech and dialect variation. (Contains references.) (Author/DB)

  9. Transcript CONTU Meeting #10.

    ERIC Educational Resources Information Center

    National Commission on New Technological Uses of Copyrighted Works, Washington, DC.

    Testimony on the copyrightability of computer software was heard at the 10th Commission meeting held at the New York Public Library in November 1976. This transcript of the meeting also includes reports of the Commission subcommittees on photocopying, software, networks, and data bases. (Author/AP)

  10. Automatic Music Transcription

    NASA Astrophysics Data System (ADS)

    Klapuri, Anssi; Virtanen, Tuomas

    Written musical notation describes music in a symbolic form that is suitable for performing a piece using the available musical instruments. Traditionally, musical notation indicates the pitch, target instrument, timing, and duration of each sound to be played. The aim of music transcription either by humans or by a machine is to infer these musical parameters, given only the acoustic recording of a performance.

  11. Cationic antimicrobial peptides serve as activation signals for the Salmonella Typhimurium PhoPQ and PmrAB regulons in vitro and in vivo

    PubMed Central

    Richards, Susan M.; Strandberg, Kristi L.; Conroy, Megan; Gunn, John S.


    Salmonella enterica serovar Typhimurium uses two-component regulatory systems (TCRSs) to respond to environmental stimuli. Upon infection, the TCRSs PhoP-PhoQ (PhoPQ) and PmrA-PmrB (PmrAB) are activated by environmental signals detected in the lumen of the intestine and within host cells. TCRS-mediated gene expression leads to upregulation of genes involved in lipopolysaccharide (LPS) modification and cationic antimicrobial peptide (CAMP) resistance. This research expands on previous studies which have shown that CAMPs can activate Salmonella TCRSs in vitro. The focus of this work was to determine if CAMPs can act as environmental signals for PhoPQ- and PmrAB-mediated gene expression in vitro, during infection of macrophages and in a mouse model of infection. Monitoring of PhoPQ and PmrAB activation using recombinase-based in vivo expression technology (RIVET), alkaline phosphtase and β-galactosidase reporter fusion constructs demonstrated that S. Typhimurium PhoQ can sense CAMPs in vitro. In mouse macrophages, the cathelecidin CRAMP does not activate the PhoPQ regulon. Acidification of the Salmonella-containing vacuole activates PhoP- and PmrA-regulated loci but blocking acidification still does not reveal a role for CRAMP in TCRS activation in mouse macrophages. However, assays performed in susceptible wild type (WT), CRAMP knockout (KO), and matrilysin (a metalloproteinase necessary for activating murine α-defensins) KO mice suggest CRAMP, but not α-defensins, serve as a putative direct TCRS activation signal in the mouse intestine. These studies provide a better understanding of the in vivo environments that result in activation of these virulence-associated TCRSs. PMID:22919691

  12. Regulon Studies and In Planta Role of the BraI/R Quorum-Sensing System in the Plant-Beneficial Burkholderia Cluster

    PubMed Central

    Coutinho, Bruna G.; Mitter, Birgit; Talbi, Chouhra; Sessitsch, Angela; Bedmar, Eulogio J.; Halliday, Nigel; James, Euan K.; Cmara, Miguel


    The genus Burkholderia is composed of functionally diverse species, and it can be divided into several clusters. One of these, designated the plant-beneficial-environmental (PBE) Burkholderia cluster, is formed by nonpathogenic species, which in most cases have been found to be associated with plants. It was previously established that members of the PBE group share an N-acyl-homoserine lactone (AHL) quorum-sensing (QS) system, designated BraI/R, that produces and responds to 3-oxo-C14-HSL (OC14-HSL). Moreover, some of them also possess a second AHL QS system, designated XenI2/R2, producing and responding to 3-hydroxy-C8-HSL (OHC8-HSL). In the present study, we performed liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis to determine which AHL molecules are produced by each QS system of this group of bacteria. The results showed that XenI2/R2 is mainly responsible for the production of OHC8-HSL and that the BraI/R system is involved in the production of several different AHLs. This analysis also revealed that Burkholderia phymatum STM815 produces greater amounts of AHLs than the other species tested. Further studies showed that the BraR protein of B. phymatum is more promiscuous than other BraR proteins, responding equally well to several different AHL molecules, even at low concentrations. Transcriptome studies with Burkholderia xenovorans LB400 and B. phymatum STM815 revealed that the BraI/R regulon is species specific, with exopolysaccharide production being the only common phenotype regulated by this system in the PBE cluster. In addition, BraI/R was shown not to be important for plant nodulation by B. phymatum strains or for endophytic colonization and growth promotion of maize by B. phytofirmans PsJN. PMID:23686262

  13. The sigmaR regulon of Streptomyces coelicolor A32 reveals a key role in protein quality control during disulphide stress.


    Kallifidas, Dimitris; Thomas, Derek; Doughty, Phillip; Paget, Mark S B


    Diamide is an artificial disulphide-generating electrophile that mimics an oxidative shift in the cellular thiol-disulphide redox state (disulphide stress). The Gram-positive bacterium Streptomyces coelicolor senses and responds to disulphide stress through the sigma(R)-RsrA system, which comprises an extracytoplasmic function (ECF) sigma factor and a redox-active anti-sigma factor. Known targets that aid in the protection and recovery from disulphide stress include the thioredoxin system and genes involved in producing the major thiol buffer mycothiol. Here we determine the global response to diamide in wild-type and sigR mutant backgrounds to understand the role of sigma(R) in this response and to reveal additional regulatory pathways that allow cells to cope with disulphide stress. In addition to thiol oxidation, diamide was found to cause protein misfolding and aggregation, which elicited the induction of the HspR heat-shock regulon. Although this response is sigma(R)-independent, sigma(R) does directly control Clp and Lon ATP-dependent AAA(+) proteases, which may partly explain the reduced ability of a sigR mutant to resolubilize protein aggregates. sigma(R) also controls msrA and msrB methionine sulphoxide reductase genes, implying that sigma(R)-RsrA is responsible for the maintenance of both cysteine and methionine residues during oxidative stress. This work shows that the sigma(R)-RsrA system plays a more significant role in protein quality control than previously realized, and emphasizes the importance of controlling the cellular thiol-disulphide redox balance. PMID:20185507

  14. Computational Analysis and In silico Predictive Modeling for Inhibitors of PhoP Regulon in S. typhi on High-Throughput Screening Bioassay Dataset.


    Kaur, Harleen; Ahmad, Mohd; Scaria, Vinod


    There is emergence of multidrug-resistant Salmonella enterica serotype typhi in pandemic proportions throughout the world, and therefore, there is a necessity to speed up the discovery of novel molecules having different modes of action and also less influenced by the resistance formation that would be used as drug for the treatment of salmonellosis particularly typhoid fever. The PhoP regulon is well studied and has now been shown to be a critical regulator of number of gene expressions which are required for intracellular survival of S. enterica and pathophysiology of disease like typhoid. The evident roles of two-component PhoP-/PhoQ-regulated products in salmonella virulence have motivated attempts to target them therapeutically. Although the discovery process of biologically active compounds for the treatment of typhoid relies on hit-finding procedure, using high-throughput screening technology alone is very expensive, as well as time consuming when performed on large scales. With the recent advancement in combinatorial chemistry and contemporary technique for compounds synthesis, there are more and more compounds available which give ample growth of diverse compound library, but the time and endeavor required to screen these unfocused massive and diverse library have been slightly reduced in the past years. Hence, there is demand to improve the high-quality hits and success rate for high-throughput screening that required focused and biased compound library toward the particular target. Therefore, we still need an advantageous and expedient method to prioritize the molecules that will be utilized for biological screens, which saves time and is also inexpensive. In this concept, in silico methods like machine learning are widely applicable technique used to build computational model for high-throughput virtual screens to prioritize molecules for advance study. Furthermore, in computational analysis, we extended our study to identify the common enriched structural entities among the biologically active compound toward finding out the privileged scaffold. PMID:26298582

  15. Inventory and functional analysis of the large Hrp regulon in Ralstonia solanacearum: identification of novel effector proteins translocated to plant host cells through the type III secretion system.


    Cunnac, Sbastien; Occhialini, Alessandra; Barberis, Patrick; Boucher, Christian; Genin, Stphane


    The ability of Ralstonia solanacearum strain GMI1000 to cause disease on a wide range of host plants (including most Solanaceae and Arabidopsis thaliana) depends on genes activated by the regulatory gene hrpB. HrpB controls the expression of the type III secretion system (TTSS) and pathogenicity effectors transiting through this pathway. In order to establish the complete repertoire of TTSS-dependent effectors belonging to the Hrp regulon and to start their functional analysis, we developed a rapid method for insertional mutagenesis, which was used to monitor the expression of 71 candidate genes and disrupt 56 of them. This analysis yielded a total of 48 novel hrpB-regulated genes. Using the Bordetella pertussis calmodulin-dependent adenylate cyclase reporter fusion system, we provide direct biochemical evidence that five R. solanacearum effector proteins are translocated into plant host cells through the TTSS. Among these novel TTSS effectors, RipA and RipG both belong to multigenic families, RipG defining a novel class of leucine-rich-repeats harbouring proteins. The members of these multigenic families are differentially regulated, being composed of genes expressed in either an hrpB-dependent or an hrpB-independent manner. Pathogenicity assays of the 56 mutant strains on two host plants indicate that, with two exceptions, mutations in individual effectors have no effect on virulence, a probable consequence of genetic and functional redundancy. This large repertoire of HrpB-regulated genes, which comprises > 20 probable TTSS effector genes with no counterparts in other bacterial species, represents an important step towards a full-genome understanding of R. solanacearum virulence. PMID:15225308

  16. A proteomic analysis of the regulon of the NarP two-component regulatory system response regulator in the bovine pathogen Mannheimia haemolytica A1

    PubMed Central


    Background The response of the NarQP two-component signal transduction system regulon in response to the presence of nitrate for the bovine pathogen Mannheimia haemolytica A1 was investigated by proteomic analysis. Total proteins from a narP mutant and the parent SH1217 grown with or without NaNO3 supplement were examined by ISO-DALT 2D electrophoresis and liquid chromatography-mass spectrometry. Results Seventeen proteins were differentially expressed in the parent strain SH1217 in response to the addition of NaNO3 to the growth media. These responses were absent in the narP mutant, indicating that the altered production of these proteins is mediated by NarPMh. Interestingly, NarPMh mediated the increased production of some proteins which are not generally associated with nitrate respiration, such as the iron transporters FbpA and YfeA. The increased production of proteins such as superoxide dismutase, SodA, and GAPDH were also observed. The increased production of these iron-regulated proteins by NarPMh is thought to enhance the swift establishment of the nitrate respiration mechanism of M. haemolytica during pathogenesis. Conclusion The data suggested NarPMh acts as an important regulator which regulates the expression of a small set of proteins in response to nitrate availability. This may contribute to the prevalence of M. haemolytica A1 in its host during pathogenesis of BPP, through enhancing the effectiveness of nitrate respiration either directly or indirectly. PMID:22114901

  17. Transcriptional Profiling of Nitrogen Fixation and the Role of NifA in the Diazotrophic Endophyte Azoarcus sp. Strain BH72

    PubMed Central

    Sarkar, Abhijit; Reinhold-Hurek, Barbara


    Background The model endophyte Azoarcus sp. strain BH72 is known to contribute fixed nitrogen to its host Kallar grass and also expresses nitrogenase genes endophytically in rice seedlings. Availability of nitrogen is a signal regulating the transcription of nitrogenase genes. Therefore, we analysed global transcription in response to differences in the nitrogen source. Methodology/Principal Findings A DNA microarray, comprising 70-mer oligonucleotides representing 3989 open reading frames of the genome of strain BH72, was used for transcriptome studies. Transcription profiles of cells grown microaerobically on N2 versus ammonium were compared. Expression of 7.2% of the genes was significantly up-regulated, and 5.8% down-regulated upon N2 fixation, respectively. A parallel genome-wide prediction of ?54-type promoter elements mapped to the upstream region of 38 sequences of which 36 were modulated under the N2 response. In addition to modulation of genes related to N2 fixation, the expressions of gene clusters that might be related to plant-microbe interaction and of several transcription factors were significantly enhanced. While comparing under N2-fixation conditions the transcriptome of wild type with a nifLA? insertion mutant, NifA being the essential transcriptional activator for nif genes, 24.5% of the genome was found to be affected in expression. A genome-wide prediction of 29 NifA binding sequences matched to 25 of the target genes whose expression was differential during microarray analysis, some of which were putatively negatively regulated by NifA. For selected genes, differential expression was corroborated by real time RT-PCR studies. Conclusion/Significance Our data suggest that life under conditions of nitrogen fixation is an important part of the lifestyle of strain BH72 in roots, as a wide range of genes far beyond the nif regulon is modulated. Moreover, the NifA regulon in strain BH72 appears to encompass a wider range of cellular functions beyond the regulation of nif genes. PMID:24516534

  18. Fur-type transcriptional repressors and metal homeostasis in the cyanobacterium Synechococcus sp. PCC 7002

    PubMed Central

    Ludwig, Marcus; Chua, Tiing Tiing; Chew, Chyue Yie; Bryant, Donald A.


    Metal homeostasis is a crucial cellular function for nearly all organisms. Some heavy metals (e.g., Fe, Zn, Co, Mo) are essential because they serve as cofactors for enzymes or metalloproteins, and chlorophototrophs such as cyanobacteria have an especially high demand for iron. At excessive levels, however, metals become toxic to cyanobacteria. Therefore, a tight control mechanism is essential for metal homeostasis. Metal homeostasis in microorganisms comprises two elements: metal acquisition from the environment and detoxification or excretion of excess metal ions. Different families of metal-sensing regulators exist in cyanobacteria and each addresses a more or less specific set of target genes. In this study the regulons of three Fur-type and two ArsR-SmtB-type regulators were investigated in a comparative approach in the cyanobacterium Synechococcus sp. PCC 7002. One Fur-type regulator controls genes for iron acquisition (Fur); one controls genes for zinc acquisition (Zur); and the third controls two genes involved in oxidative stress (Per). Compared to other well-investigated cyanobacterial strains, however, the set of target genes for each regulator is relatively small. Target genes for the two ArsR-SmtB transcriptional repressors (SmtB (SYNPCC7002_A2564) and SYNPCC7002_A0590) are involved in zinc homeostasis in addition to Zur. Their target genes, however, are less specific for zinc and point to roles in a broader heavy metal detoxification response. PMID:26582412

  19. Transcription-coupled DNA supercoiling dictates the chromosomal arrangement of bacterial genes.


    Sobetzko, Patrick


    Over the recent decade, the central importance of DNA supercoiling in chromosome organization and global gene regulation of bacteria became more and more visible. With a regulon comprising more than 2000 genes in Escherichia coli, DNA supercoiling is among the most influential regulators of gene expression found in bacteria so far. However, the mechanism creating thousands of diverse temporal gene expression patterns coordinated by DNA supercoiling remains unclear. In this study we show that a specific chromosomal arrangement of genes modulates the local levels of DNA supercoiling at gene promoters via transcription-coupled DNA supercoiling (TCDS) in the model organism E. coli. Our findings provide a consistent explanation for the strong positive coupling of temporal gene expression patterns of neighboring genes. Using comparative genomics we are furthermore able to provide evidence that TCDS is a driving force for the evolution of chromosomal gene arrangement patterns in other Enterobacteriaceae. With the currently available data of promoter supercoiling sensitivity we prove that the same principle is applicable also for the evolutionary distant gram-positive pathogenic bacterium Streptococcus pneumoniae. Moreover, our findings are fully consistent with recent investigations concerning the regulatory impact of TCDS on gene pairs in eukaryots underpinning the broad applicability of our analysis. PMID:26783203

  20. Theoretical and empirical quality assessment of transcription factor-binding motifs

    PubMed Central

    Medina-Rivera, Alejandra; Abreu-Goodger, Cei; Thomas-Chollier, Morgane; Salgado, Heladia; Collado-Vides, Julio; van Helden, Jacques


    Position-specific scoring matrices (PSSMs) are routinely used to predict transcription factor (TF)-binding sites in genome sequences. However, their reliability to predict novel binding sites can be far from optimum, due to the use of a small number of training sites or the inappropriate choice of parameters when building the matrix or when scanning sequences with it. Measures of matrix quality such as E-value and information content rely on theoretical models, and may fail in the context of full genome sequences. We propose a method, implemented in the program matrix-quality, that combines theoretical and empirical score distributions to assess reliability of PSSMs for predicting TF-binding sites. We applied matrix-quality to estimate the predictive capacity of matrices for bacterial, yeast and mouse TFs. The evaluation of matrices from RegulonDB revealed some poorly predictive motifs, and allowed us to quantify the improvements obtained by applying multi-genome motif discovery. Interestingly, the method reveals differences between global and specific regulators. It also highlights the enrichment of binding sites in sequence sets obtained from high-throughput ChIP-chip (bacterial and yeast TFs), and ChIPseq and experiments (mouse TFs). The method presented here has many applications, including: selecting reliable motifs before scanning sequences; improving motif collections in TFs databases; evaluating motifs discovered using high-throughput data sets. PMID:20923783

  1. Novel sequence-based method for identifying transcription factor binding sites in prokaryotic genomes

    PubMed Central

    Sahota, Gurmukh; Stormo, Gary D.


    Motivation: Computational techniques for microbial genomic sequence analysis are becoming increasingly important. With next-generation sequencing technology and the human microbiome project underway, current sequencing capacity is significantly greater than the speed at which organisms of interest can be studied experimentally. Most related computational work has been focused on sequence assembly, gene annotation and metabolic network reconstruction. We have developed a method that will primarily use available sequence data in order to determine prokaryotic transcription factor (TF) binding specificities. Results: Specificity determining residues (critical residues) were identified from crystal structures of DNAprotein complexes and TFs with the same critical residues were grouped into specificity classes. The putative binding regions for each class were defined as the set of promoters for each TF itself (autoregulatory) and the immediately upstream and downstream operons. MEME was used to find putative motifs within each separate class. Tests on the LacI and TetR TF families, using RegulonDB annotated sites, showed the sensitivity of prediction 86% and 80%, respectively. Availability: Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20807838

  2. Global transcriptional control by glucose and carbon regulator CcpA in Clostridium difficile

    PubMed Central

    Antunes, Ana; Camiade, Emilie; Monot, Marc; Courtois, Emmanuelle; Barbut, Frédéric; Sernova, Natalia V.; Rodionov, Dmitry A.; Martin-Verstraete, Isabelle; Dupuy, Bruno


    The catabolite control protein CcpA is a pleiotropic regulator that mediates the global transcriptional response to rapidly catabolizable carbohydrates, like glucose in Gram-positive bacteria. By whole transcriptome analyses, we characterized glucose-dependent and CcpA-dependent gene regulation in Clostridium difficile. About 18% of all C. difficile genes are regulated by glucose, for which 50% depend on CcpA for regulation. The CcpA regulon comprises genes involved in sugar uptake, fermentation and amino acids metabolism, confirming the role of CcpA as a link between carbon and nitrogen pathways. Using combination of chromatin immunoprecipitation and genome sequence analysis, we detected 55 CcpA binding sites corresponding to ∼140 genes directly controlled by CcpA. We defined the C. difficile CcpA consensus binding site (creCD motif), that is, ‘RRGAAAANGTTTTCWW’. Binding of purified CcpA protein to 19 target creCD sites was demonstrated by electrophoretic mobility shift assay. CcpA also directly represses key factors in early steps of sporulation (Spo0A and SigF). Furthermore, the C. difficile toxin genes (tcdA and tcdB) and their regulators (tcdR and tcdC) are direct CcpA targets. Finally, CcpA controls a complex and extended regulatory network through the modulation of a large set of regulators. PMID:22989714

  3. Transcription-coupled DNA supercoiling dictates the chromosomal arrangement of bacterial genes

    PubMed Central

    Sobetzko, Patrick


    Over the recent decade, the central importance of DNA supercoiling in chromosome organization and global gene regulation of bacteria became more and more visible. With a regulon comprising more than 2000 genes in Escherichia coli, DNA supercoiling is among the most influential regulators of gene expression found in bacteria so far. However, the mechanism creating thousands of diverse temporal gene expression patterns coordinated by DNA supercoiling remains unclear. In this study we show that a specific chromosomal arrangement of genes modulates the local levels of DNA supercoiling at gene promoters via transcription-coupled DNA supercoiling (TCDS) in the model organism E. coli. Our findings provide a consistent explanation for the strong positive coupling of temporal gene expression patterns of neighboring genes. Using comparative genomics we are furthermore able to provide evidence that TCDS is a driving force for the evolution of chromosomal gene arrangement patterns in other Enterobacteriaceae. With the currently available data of promoter supercoiling sensitivity we prove that the same principle is applicable also for the evolutionary distant gram-positive pathogenic bacterium Streptococcus pneumoniae. Moreover, our findings are fully consistent with recent investigations concerning the regulatory impact of TCDS on gene pairs in eukaryots underpinning the broad applicability of our analysis. PMID:26783203

  4. Characterisation of a putative AraC transcriptional regulator from Mycobacterium smegmatis

    PubMed Central

    Evangelopoulos, Dimitrios; Gupta, Antima; Lack, Nathan A.; Maitra, Arundhati; ten Bokum, Annemieke M.C.; Kendall, Sharon; Sim, Edith; Bhakta, Sanjib


    Summary MSMEG_0307 is annotated as a transcriptional regulator belonging to the AraC protein family and is located adjacent to the arylamine N-acetyltransferase (nat) gene in Mycobacterium smegmatis, in a gene cluster, conserved in most environmental mycobacterial species. In order to elucidate the function of the AraC protein from the nat operon in M.smegmatis, two conserved palindromic DNA motifs were identified using bioinformatics and tested for protein binding using electrophoretic mobility shift assays with a recombinant form of the AraC protein. We identified the formation of a DNA:AraC protein complex with one of the motifs as well as the presence of this motif in 20 loci across the whole genome of M.smegmatis, supporting the existence of an AraC controlled regulon. To characterise the effects of AraC in the regulation of the nat operon genes, as well as to gain further insight into its function, we generated a ?araC mutant strain where the araC gene was replaced by a hygromycin resistance marker. The level of expression of the nat and MSMEG_0308 genes was down-regulated in the ?araC strain when compared to the wild type strain indicating an activator effect of the AraC protein on the expression of the nat operon genes. PMID:25443504

  5. Transcriptional profiling of CRP-regulated genes in deep-sea bacterium Shewanella piezotolerans WP3.


    Jian, Huahua; Hu, Jing; Xiao, Xiang


    The cAMP receptor protein (CRP) is a conserved regulator in bacteria and involved in regulation of energy metabolism, such as glucose, galactose, and citrate (Green et al., 2014 [1]). As an important catabolite activator protein, it has been well characterized in model microorganism such as Escherichia coli. However, our understanding of the roles of CRP in deep-sea bacteria is rather limited. To indentify the function of CRP, we performed whole genome transcriptional profiling using a custom designed microarray which contains 95% open reading frames of Shewanella piezotolerans WP3, which was isolated from West Pacific sediment at a depth of 1914 m (Xiao et al., 2007 [2]; Wang et al., 2008 [3]). Here we describe the experimental procedures and methods in detail to reproduce the results (available at Gene Expression Omnibus database under GSE67731 and GSE67732) and provide resource to be employed for comparative analyses of CRP regulon and the regulatory network of anaerobic respiration in microorganisms which inhabited in different environments, and thus broaden our understanding of mechanism of bacteria against various environment stresses. PMID:26484223

  6. Transcriptional profiling of CRP-regulated genes in deep-sea bacterium Shewanella piezotolerans WP3

    PubMed Central

    Jian, Huahua; Hu, Jing; Xiao, Xiang


    The cAMP receptor protein (CRP) is a conserved regulator in bacteria and involved in regulation of energy metabolism, such as glucose, galactose, and citrate (Green et al., 2014 [1]). As an important catabolite activator protein, it has been well characterized in model microorganism such as Escherichia coli. However, our understanding of the roles of CRP in deep-sea bacteria is rather limited. To indentify the function of CRP, we performed whole genome transcriptional profiling using a custom designed microarray which contains 95% open reading frames of Shewanella piezotolerans WP3, which was isolated from West Pacific sediment at a depth of 1914m (Xiao et al., 2007 [2]; Wang et al., 2008 [3]). Here we describe the experimental procedures and methods in detail to reproduce the results (available at Gene Expression Omnibus database under GSE67731 and GSE67732) and provide resource to be employed for comparative analyses of CRP regulon and the regulatory network of anaerobic respiration in microorganisms which inhabited in different environments, and thus broaden our understanding of mechanism of bacteria against various environment stresses. PMID:26484223

  7. RegPrecise web services interface: programmatic access to the transcriptional regulatory interactions in bacteria reconstructed by comparative genomics

    PubMed Central

    Novichkov, Pavel S.; Brettin, Thomas S.; Novichkova, Elena S.; Dehal, Paramvir S.; Arkin, Adam P.; Dubchak, Inna; Rodionov, Dmitry A.


    Web services application programming interface (API) was developed to provide a programmatic access to the regulatory interactions accumulated in the RegPrecise database (, a core resource on transcriptional regulation for the microbial domain of the Department of Energy (DOE) Systems Biology Knowledgebase. RegPrecise captures and visualize regulogs, sets of genes controlled by orthologous regulators in several closely related bacterial genomes, that were reconstructed by comparative genomics. The current release of RegPrecise 2.0 includes >1400 regulogs controlled either by protein transcription factors or by conserved ribonucleic acid regulatory motifs in >250 genomes from 24 taxonomic groups of bacteria. The reference regulons accumulated in RegPrecise can serve as a basis for automatic annotation of regulatory interactions in newly sequenced genomes. The developed API provides an efficient access to the RegPrecise data by a comprehensive set of 14 web service resources. The RegPrecise web services API is freely accessible at with no login requirements. PMID:22700702

  8. RegPrecise web services interface: programmatic access to the transcriptional regulatory interactions in bacteria reconstructed by comparative genomics.


    Novichkov, Pavel S; Brettin, Thomas S; Novichkova, Elena S; Dehal, Paramvir S; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A


    Web services application programming interface (API) was developed to provide a programmatic access to the regulatory interactions accumulated in the RegPrecise database (, a core resource on transcriptional regulation for the microbial domain of the Department of Energy (DOE) Systems Biology Knowledgebase. RegPrecise captures and visualize regulogs, sets of genes controlled by orthologous regulators in several closely related bacterial genomes, that were reconstructed by comparative genomics. The current release of RegPrecise 2.0 includes >1400 regulogs controlled either by protein transcription factors or by conserved ribonucleic acid regulatory motifs in >250 genomes from 24 taxonomic groups of bacteria. The reference regulons accumulated in RegPrecise can serve as a basis for automatic annotation of regulatory interactions in newly sequenced genomes. The developed API provides an efficient access to the RegPrecise data by a comprehensive set of 14 web service resources. The RegPrecise web services API is freely accessible at with no login requirements. PMID:22700702

  9. The novel transcriptional regulator SA1804 Is involved in mediating the invasion and cytotoxicity of Staphylococcus aureus.


    Yang, Junshu; Liang, Xudong; Ji, Yinduo


    The two-component regulatory system, SaeRS, controls expression of important virulence factors, including toxins and invasins, which contribute to the pathogenicity of Staphylococcus aureus. Previously, we conducted a transcriptomics study for identification of SaeRS regulon and found that inactivation of SaeRS dramatically enhances the transcription of a novel transcriptional regulator (SA1804). This led us to question whether SA1804 is involved in bacterial pathogenicity by regulating the expression of virulence factors. To address this question, we created sa1804, saeRS, and sa1804/saeRS double deletion mutants in a USA300 community-acquired MRSA strain, 923, and determined their impact on the pathogenicity. The deletion of sa1804 dramatically increased the cytotoxicity and enhanced the capacity of bacteria to invade into the epithelial cells (A549), whereas the deletion of saeRS eliminated the cytotoxicity and abolished the bacterial ability to invade into the epithelial cells. Moreover, the double deletions of sa1804 and saeRS appeared a similar phenotype with the saeRS null mutation. Furthermore, we determined the regulatory mechanism of SA1804 using qPCR and gel-shift approaches. Our data indicate that the novel virulence repressor SA1804 is dependent on the regulation of SaeRS. This study sheds light on the regulatory mechanism of virulence factors and allows for us further elucidate the molecular pathogenesis of S. aureus. PMID:25806024

  10. The novel transcriptional regulator SA1804 Is involved in mediating the invasion and cytotoxicity of Staphylococcus aureus

    PubMed Central

    Yang, Junshu; Liang, Xudong; Ji, Yinduo


    The two-component regulatory system, SaeRS, controls expression of important virulence factors, including toxins and invasins, which contribute to the pathogenicity of Staphylococcus aureus. Previously, we conducted a transcriptomics study for identification of SaeRS regulon and found that inactivation of SaeRS dramatically enhances the transcription of a novel transcriptional regulator (SA1804). This led us to question whether SA1804 is involved in bacterial pathogenicity by regulating the expression of virulence factors. To address this question, we created sa1804, saeRS, and sa1804/saeRS double deletion mutants in a USA300 community-acquired MRSA strain, 923, and determined their impact on the pathogenicity. The deletion of sa1804 dramatically increased the cytotoxicity and enhanced the capacity of bacteria to invade into the epithelial cells (A549), whereas the deletion of saeRS eliminated the cytotoxicity and abolished the bacterial ability to invade into the epithelial cells. Moreover, the double deletions of sa1804 and saeRS appeared a similar phenotype with the saeRS null mutation. Furthermore, we determined the regulatory mechanism of SA1804 using qPCR and gel-shift approaches. Our data indicate that the novel virulence repressor SA1804 is dependent on the regulation of SaeRS. This study sheds light on the regulatory mechanism of virulence factors and allows for us further elucidate the molecular pathogenesis of S. aureus. PMID:25806024

  11. Tailoring the Models of Transcription

    PubMed Central

    Pance, Alena


    Molecular biology is a rapidly evolving field that has led to the development of increasingly sophisticated technologies to improve our capacity to study cellular processes in much finer detail. Transcription is the first step in protein expression and the major point of regulation of the components that determine the characteristics, fate and functions of cells. The study of transcriptional regulation has been greatly facilitated by the development of reporter genes and transcription factor expression vectors, which have become versatile tools for manipulating promoters, as well as transcription factors in order to examine their function. The understanding of promoter complexity and transcription factor structure offers an insight into the mechanisms of transcriptional control and their impact on cell behaviour. This review focuses on some of the many applications of molecular cut-and-paste tools for the manipulation of promoters and transcription factors leading to the understanding of crucial aspects of transcriptional regulation. PMID:23567272

  12. Divergent transcription is associated with promoters of transcriptional regulators

    PubMed Central


    Background Divergent transcription is a wide-spread phenomenon in mammals. For instance, short bidirectional transcripts are a hallmark of active promoters, while longer transcripts can be detected antisense from active genes in conditions where the RNA degradation machinery is inhibited. Moreover, many described long non-coding RNAs (lncRNAs) are transcribed antisense from coding gene promoters. However, the general significance of divergent lncRNA/mRNA gene pair transcription is still poorly understood. Here, we used strand-specific RNA-seq with high sequencing depth to thoroughly identify antisense transcripts from coding gene promoters in primary mouse tissues. Results We found that a substantial fraction of coding-gene promoters sustain divergent transcription of long non-coding RNA (lncRNA)/mRNA gene pairs. Strikingly, upstream antisense transcription is significantly associated with genes related to transcriptional regulation and development. Their promoters share several characteristics with those of transcriptional developmental genes, including very large CpG islands, high degree of conservation and epigenetic regulation in ES cells. In-depth analysis revealed a unique GC skew profile at these promoter regions, while the associated coding genes were found to have large first exons, two genomic features that might enforce bidirectional transcription. Finally, genes associated with antisense transcription harbor specific H3K79me2 epigenetic marking and RNA polymerase II enrichment profiles linked to an intensified rate of early transcriptional elongation. Conclusions We concluded that promoters of a class of transcription regulators are characterized by a specialized transcriptional control mechanism, which is directly coupled to relaxed bidirectional transcription. PMID:24365181

  13. Control of Transcriptional Elongation

    PubMed Central

    Kwak, Hojoong; Lis, John T.


    Elongation is becoming increasingly recognized as a critically controlled step in transcriptional regulation. While traditional genetic and biochemical studies have identified major players of transcriptional elongation, our understanding of the importance and roles of these factors is evolving rapidly through the recent advances in genome-wide and single-molecule technologies. Here we focus on how elongation can modulate the transcriptional outcome through the rate-liming step of RNA polymerase II pausing near promoters, and how the participating factors were identified. Among the factors we describe are NELF and DSIF, the pausing factors, and P-TEFb, the key player in pause release. We also describe non-exclusive models for how pausing is achieved by making use of high resolution genome-wide mapping of paused Pol II relative to promoter elements and the first nucleosome. We also discuss Pol II elongation through the bodies of genes and the roles of FACT and Spt6, the factors that allow Pol II to move through nucleosomes. PMID:24050178

  14. Impulse control: Temporal dynamics in gene transcription

    PubMed Central

    Yosef, Nir; Regev, Aviv


    Regulatory circuits controlling gene expression constantly rewire to adapt to environmental stimuli, differentiation cues, and disease. We review our current understanding of the temporal dynamics of gene expression in eukaryotes and prokaryotes and the molecular mechanisms that shape them. We delineate several prototypical temporal patterns, including ‘impulse’ (single-pulse) patterns in response to transient environmental stimuli, sustained (state transitioning) patterns in response to developmental cues, and oscillating patterns. We focus on impulse responses and their higher-order temporal organization in regulons and cascades, and describe how core protein circuits and cis-regulatory sequences in promoters integrate with chromatin architecture to generate these responses. PMID:21414481

  15. Copper homeostasis-related genes in three separate transcriptional units regulated by CsoR in Corynebacterium glutamicum.


    Teramoto, Haruhiko; Yukawa, Hideaki; Inui, Masayuki


    In Corynebacterium glutamicum R, CsoR acts as a transcriptional repressor not only of the cognate copA-csoR operon but also of the copZ1-copB-cgR_0126 operon. It is predicted that copA and copB encode P-type ATPases for copper efflux and copZ1 encodes a metallochaperone. Here, a CsoR-binding motif was found upstream of another copZ-like gene, copZ2, and the in vitro binding of the CsoR protein to its promoter was confirmed. The monocistronic copZ2 transcript was upregulated by excess copper in a CsoR-dependent manner. Among the extended CsoR regulon, deletion of copA, but not of copB, copZ1, or copZ2, resulted in decreased resistance to copper, indicating a major role of the CopA copper exporter in the multilayered systems for copper homeostasis. A redundant role of copZ1 and copZ2 in copper resistance was also indicated by double deletion of these genes. The copper-dependent activation of the copA, copZ1, and copZ2 promoters was confirmed by lacZ reporter assays, consistent with the coordinated derepression of the three transcriptional units. The copZ1 promoter activity showed the highest responsiveness to copper and was also induced by excess zinc and nickel. Furthermore, zinc-inducible expression observed for the CsoR-regulated genes was independent of Zur, recently found to uniquely act as a transcriptional repressor of zinc efflux genes. These results implied complicated cross talk between homeostasis of multiple transition metals. PMID:25592736

  16. Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel


    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability. PMID:25607953

  17. The CRYPTOCHROME1-dependent response to excess light is mediated through the transcriptional activators ZINC FINGER PROTEIN EXPRESSED IN INFLORESCENCE MERISTEM LIKE1 and ZML2 in Arabidopsis.


    Shaikhali, Jehad; de Dios Barajas-Lopz, Juan; tvs, Krisztina; Kremnev, Dmitry; Garcia, Ana Snchez; Srivastava, Vaibhav; Wingsle, Gunnar; Bako, Laszlo; Strand, sa


    Exposure of plants to light intensities that exceed the electron utilization capacity of the chloroplast has a dramatic impact on nuclear gene expression. The photoreceptor Cryptochrome 1 (cry1) is essential to the induction of genes encoding photoprotective components in Arabidopsis thaliana. Bioinformatic analysis of the cry1 regulon revealed the putative cis-element CryR1 (GnTCKAG), and here we demonstrate an interaction between CryR1 and the zinc finger GATA-type transcription factors ZINC FINGER PROTEIN EXPRESSED IN INFLORESCENCE MERISTEM LIKE1 (ZML1) and ZML2. The ZML proteins specifically bind to the CryR1 cis-element as demonstrated in vitro and in vivo, and TCTAG was shown to constitute the core sequence required for ZML2 binding. In addition, ZML2 activated transcription of the yellow fluorescent protein reporter gene driven by the CryR1 cis-element in Arabidopsis leaf protoplasts. T-DNA insertion lines for ZML2 and its homolog ZML1 demonstrated misregulation of several cry1-dependent genes in response to excess light. Furthermore, the zml1 and zml2 T-DNA insertion lines displayed a high irradiance-sensitive phenotype with significant photoinactivation of photosystem II (PSII), indicated by reduced maximum quantum efficiency of PSII, and severe photobleaching. Thus, we identified the ZML2 and ZML1 GATA transcription factors as two essential components of the cry1-mediated photoprotective response. PMID:22786870

  18. The Salmonella Spi1 virulence regulatory protein HilD directly activates transcription of the flagellar master operon flhDC.


    Singer, Hanna M; Kühne, Caroline; Deditius, Julia A; Hughes, Kelly T; Erhardt, Marc


    Infection of intestinal epithelial cells is dependent on the Salmonella enterica serovar Typhimurium pathogenicity island 1 (Spi1)-encoded type III injectisome system and flagellar motility. Thus, the expression of virulence and flagellar genes is subject to tight regulatory control mechanisms in order to ensure the correct spatiotemporal production of the respective gene products. In this work, we reveal a new level of cross-regulation between the Spi1 and flagellar regulatory systems. Transposon mutagenesis identified a class of mutants that prevented flhDC autorepression by overexpressing HilD. HilD, HilC, RtsA, and HilA comprise a positive regulatory circuit for the expression of the Spi1 genes. Here, we report a novel transcriptional cross talk between the Spi1 and flagellar regulons where HilD transcriptionally activates flhDC gene expression by binding to nucleotides -68 to -24 upstream from the P5 transcriptional start site. We additionally show that, in contrast to the results of a previous report, HilA does not affect flagellar gene expression. Finally, we discuss a model of the cross-regulation network between Spi1 and the flagellar system and propose a regulatory mechanism via the Spi1 master regulator HilD that would prime flagellar genes for rapid reactivation during host infection. PMID:24488311

  19. The Salmonella Spi1 Virulence Regulatory Protein HilD Directly Activates Transcription of the Flagellar Master Operon flhDC

    PubMed Central

    Singer, Hanna M.; Khne, Caroline; Deditius, Julia A.


    Infection of intestinal epithelial cells is dependent on the Salmonella enterica serovar Typhimurium pathogenicity island 1 (Spi1)-encoded type III injectisome system and flagellar motility. Thus, the expression of virulence and flagellar genes is subject to tight regulatory control mechanisms in order to ensure the correct spatiotemporal production of the respective gene products. In this work, we reveal a new level of cross-regulation between the Spi1 and flagellar regulatory systems. Transposon mutagenesis identified a class of mutants that prevented flhDC autorepression by overexpressing HilD. HilD, HilC, RtsA, and HilA comprise a positive regulatory circuit for the expression of the Spi1 genes. Here, we report a novel transcriptional cross talk between the Spi1 and flagellar regulons where HilD transcriptionally activates flhDC gene expression by binding to nucleotides ?68 to ?24 upstream from the P5 transcriptional start site. We additionally show that, in contrast to the results of a previous report, HilA does not affect flagellar gene expression. Finally, we discuss a model of the cross-regulation network between Spi1 and the flagellar system and propose a regulatory mechanism via the Spi1 master regulator HilD that would prime flagellar genes for rapid reactivation during host infection. PMID:24488311

  20. The NifA-RpoN regulon of Mesorhizobium loti strain R7A and its symbiotic activation by a novel Lacl/GalR-family regulator

    SciTech Connect

    Sullivan, John T.; Brown, Steven D; Ronson, Professor Clive William


    Mesorhizobium loti is the microsymbiont of Lotus species, including the model legume L. japonicus. M. loti differs from other rhizobia in that it contains two copies of the key nitrogen fixation regulatory gene nifA, nifA1 and nifA2, both of which are located on the symbiosis island ICEMlSymR7A. M. loti R7A also contains two rpoN genes, rpoN1 located on the chromosome outside of ICEMlSymR7A and rpoN2 that is located on ICEMlSymR7A. The aims of the current work were to establish how nifA expression was activated in M. loti and to characterise the NifA-RpoN regulon. The nifA2 and rpoN2 genes were essential for nitrogen fixation whereas nifA1 and rpoN1 were dispensable. Expression of nifA2 was activated, possibly in response to an inositol derivative, by a novel regulator of the LacI/GalR family encoded by the fixV gene located upstream of nifA2. Other than the well-characterized nif/fix genes, most NifA2-regulated genes were not required for nitrogen fixation although they were strongly expressed in nodules. The NifA-regulated nifZ and fixU genes, along with nifQ which was not NifA-regulated, were required in M. loti for a fully effective symbiosis although they are not present in some other rhizobia. The NifA-regulated gene msi158 that encodes a porin was also required for a fully effective symbiosis. Several metabolic genes that lacked NifA-regulated promoters were strongly expressed in nodules in a NifA2-dependent manner but again mutants did not have an overt symbiotic phenotype. In summary, many genes encoded on ICEMlSymR7A were strongly expressed in nodules but not free-living rhizobia, but were not essential for symbiotic nitrogen fixation. It seems likely that some of these genes have functional homologues elsewhere in the genome and that bacteroid metabolism may be sufficiently plastic to adapt to loss of certain enzymatic functions.

  1. Analysis of the Activity and Regulon of the Two-Component Regulatory System Composed by Cjj81176_1484 and Cjj81176_1483 of Campylobacter jejuni

    PubMed Central

    Luethy, Paul M.; Huynh, Steven; Parker, Craig T.


    ABSTRACT Campylobacter jejuni is a leading cause of bacterial diarrheal disease and a frequent commensal of the intestinal tract in poultry and other animals. For optimal growth and colonization of hosts, C. jejuni employs two-component regulatory systems (TCSs) to monitor environmental conditions and promote proper expression of specific genes. We analyzed the potential of C. jejuni Cjj81176_1484 (Cjj1484) and Cjj81176_1483 (Cjj1483) to encode proteins of a cognate TCS that influences expression of genes possibly important for C. jejuni growth and colonization. Transcriptome analysis revealed that the regulons of the Cjj81176_1484 (Cjj1484) histidine kinase and the Cjj81176_1483 (Cjj1483) response regulator contain many common genes, suggesting that these proteins likely form a cognate TCS. We found that this TCS generally functions to repress expression of specific proteins with roles in metabolism, iron/heme acquisition, and respiration. Furthermore, the TCS repressed expression of Cjj81176_0438 and Cjj81176_0439, which had previously been found to encode a gluconate dehydrogenase complex required for commensal colonization of the chick intestinal tract. However, the TCS and other specific genes whose expression is repressed by the TCS were not required for colonization of chicks. We observed that the Cjj1483 response regulator binds target promoters in both unphosphorylated and phosphorylated forms and influences expression of some specific genes independently of the Cjj1484 histidine kinase. This work further expands the signaling mechanisms of C. jejuni and provides additional insights regarding the complex and multifactorial regulation of many genes involved in basic metabolism, respiration, and nutrient acquisition that the bacterium requires for optimal growth in different environments. IMPORTANCE Bacterial two-component regulatory systems (TCSs) link environmental cues to expression of specific genes that enable optimal bacterial growth or colonization of hosts. We found that the Campylobacter jejuni Cjj1484 histidine kinase and Cjj1483 response regulator function as a cognate TCS to largely repress expression of target genes encoding a gluconate dehydrogenase complex required for commensal colonization of the chick intestinal tract, as well as other genes encoding proteins for heme or iron acquisition, metabolism, and respiration. We also discovered different modes by which Cjj1483 may mediate repression with and without Cjj1484. This work provides insight into the signal transduction mechanisms of a leading cause of bacterial diarrheal disease and emphasizes the multifactorial and complex regulation of specific biological processes in C. jejuni. PMID:25691530

  2. Characterization of PmfR, the Transcriptional Activator of the pAO1-Borne purU-mabO-folD Operon of Arthrobacter nicotinovorans

    PubMed Central

    Chiribau, Calin B.; Sandu, Cristinel; Igloi, Gabor L.; Brandsch, Roderich


    Nicotine catabolism by Arthrobacter nicotinovorans is linked to the presence of the megaplasmid pAO1. Genes involved in this catabolic pathway are arranged on the plasmid into gene modules according to function. During nicotine degradation ?-N-methylaminobutyrate is formed from the pyrrolidine ring of nicotine. Analysis of the pAO1 open reading frames (ORF) resulted in identification of the gene encoding a demethylating ?-N-methylaminobutyrate oxidase (mabO). This gene was shown to form an operon with purU- and folD-like genes. Only in bacteria grown in the presence of nicotine could transcripts of the purU-mabO-folD operon be detected, demonstrating that this operon constitutes part of the pAO1 nicotine regulon. Its transcriptional start site was determined by primer extension analysis. Transcription of the operon was shown to be controlled by a new transcriptional regulator, PmfR, the product of a gene that is transcribed divergently from the purU, mabO, and folD genes. PmfR was purified, and electromobility shift assays and DNase I-nuclease digestion experiments were used to determine that its DNA binding site is located between ?48 and ?88 nucleotides upstream of the transcriptional start site of the operon. Disruption of pmfR by homologous recombination with a chloramphenicol resistance cassette demonstrated that PmfR acts in vivo as a transcriptional activator. Mutagenesis of the PmfR target DNA suggested that the sequence GTTT-14 bp-AAAC is the core binding site of the regulator upstream of the ?35 promoter region of the purU-mabO-folD operon. PMID:15838033

  3. Single Molecule Transcription Elongation

    PubMed Central

    Galburt, Eric A.; Grill, Stephan W.; Bustamante, Carlos


    Single molecule optical trapping assays have now been applied to a great number of macromolecular systems including DNA, RNA, cargo motors, restriction enzymes, DNA helicases, chromosome remodelers, DNA polymerases and both viral and bacterial RNA polymerases. The advantages of the technique are the ability to observe dynamic, unsynchronized molecular processes, to determine the distributions of experimental quantities and to apply force to the system while monitoring the response over time. Here, we describe the application of these powerful techniques to study the dynamics of transcription elongation by RNA polymerase II from Saccharomyces cerevisiae. PMID:19426807

  4. Natural antisense transcripts

    PubMed Central

    Khorkova, Olga; Myers, Amanda J.; Hsiao, Jane; Wahlestedt, Claes


    Recent years have seen the increasing understanding of the crucial role of RNA in the functioning of the eukaryotic genome. These discoveries, fueled by the achievements of the FANTOM, and later GENCODE and ENCODE consortia, led to the recognition of the important regulatory roles of natural antisense transcripts (NATs) arising from what was previously thought to be junk DNA. Roughly defined as non-coding regulatory RNA transcribed from the opposite strand of a coding gene locus, NATs are proving to be a heterogeneous group with high potential for therapeutic application. Here, we attempt to summarize the rapidly growing knowledge about this important non-coding RNA subclass. PMID:24838284

  5. Binding and transcriptional activation of non-flagellar genes by the Escherichia coli flagellar master regulator FlhD2C2

    PubMed Central

    Stafford, Graham P.; Ogi, Tomoo; Hughes, Colin


    The gene hierarchy directing biogenesis of peritrichous flagella on the surface of Escherichia coli and other enterobacteria is controlled by the heterotetrameric master transcriptional regulator FlhD2C2. To assess the extent to which FlhD2C2 directly activates promoters of a wider regulon, a computational screen of the E. coli genome was used to search for gene-proximal DNA sequences similar to the 42–44 bp inverted repeat FlhD2C2 binding consensus. This identified the binding sequences upstream of all eight flagella class II operons, and also putative novel FlhD2C2 binding sites in the promoter regions of 39 non-flagellar genes. Nine representative non-flagellar promoter regions were all bound in vitro by active reconstituted FlhD2C2 over the KD range 38–356 nM, and of the nine corresponding chromosomal promoter–lacZ fusions, those of the four genes b1904, b2446, wzzfepE and gltI showed up to 50-fold dependence on FlhD2C2​ in vivo. In comparison, four representative flagella class II promoters bound FlhD2C2 in the KD range 12–43 nM and were upregulated in vivo 30- to 990-fold. The FlhD2C2-binding sites of the four regulated non-flagellar genes overlap by 1 or 2 bp the predicted −35 motif of the FlhD2C2-activated σ70 promoters, as is the case with FlhD2C2-dependent class II flagellar promoters. The data indicate a wider FlhD2C2 regulon, in which non-flagellar genes are bound and activated directly, albeit less strongly, by the same mechanism as that regulating the flagella gene hierarchy. PMID:15941987

  6. New Family of Tungstate-Responsive Transcriptional Regulators in Sulfate-Reducing Bacteria

    PubMed Central

    Rajeev, Lara; Luning, Eric G.; Zane, Grant M.; Siddartha, Kavya; Rodionov, Dmitry A.; Dubchak, Inna; Arkin, Adam P.; Wall, Judy D.; Mukhopadhyay, Aindrila


    The trace elements molybdenum and tungsten are essential components of cofactors of many metalloenzymes. However, in sulfate-reducing bacteria, high concentrations of molybdate and tungstate oxyanions inhibit growth, thus requiring the tight regulation of their homeostasis. By a combination of bioinformatic and experimental techniques, we identified a novel regulator family, tungstate-responsive regulator (TunR), controlling the homeostasis of tungstate and molybdate in sulfate-reducing deltaproteobacteria. The effector-sensing domains of these regulators are similar to those of the known molybdate-responsive regulator ModE, while their DNA-binding domains are homologous to XerC/XerD site-specific recombinases. Using a comparative genomics approach, we identified DNA motifs and reconstructed regulons for 40 TunR family members. Positional analysis of TunR sites and putative promoters allowed us to classify most TunR proteins into two groups: (i) activators of modABC genes encoding a high-affinity molybdenum and tungsten transporting system and (ii) repressors of genes for toluene sulfonate uptake (TSUP) family transporters. The activation of modA and modBC genes by TunR in Desulfovibrio vulgaris Hildenborough was confirmed in vivo, and we discovered that the activation was diminished in the presence of tungstate. A predicted 30-bp TunR-binding motif was confirmed by in vitro binding assays. A novel TunR family of bacterial transcriptional factors controls tungstate and molybdate homeostasis in sulfate-reducing deltaproteobacteria. We proposed that TunR proteins participate in protection of the cells from the inhibition by these oxyanions. To our knowledge, this is a unique case of a family of bacterial transcriptional factors evolved from site-specific recombinases. PMID:23913324

  7. Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution

    PubMed Central

    Maguire, Sarah L.; Wang, Can; Holland, Linda M.; Brunel, François; Neuvéglise, Cécile; Nicaud, Jean-Marc; Zavrel, Martin; White, Theodore C.; Wolfe, Kenneth H.; Butler, Geraldine


    In most eukaryotes, including the majority of fungi, expression of sterol biosynthesis genes is regulated by Sterol-Regulatory Element Binding Proteins (SREBPs), which are basic helix-loop-helix transcription activators. However, in yeasts such as Saccharomyces cerevisiae and Candida albicans sterol synthesis is instead regulated by Upc2, an unrelated transcription factor with a Gal4-type zinc finger. The SREBPs in S. cerevisiae (Hms1) and C. albicans (Cph2) have lost a domain, are not major regulators of sterol synthesis, and instead regulate filamentous growth. We report here that rewiring of the sterol regulon, with Upc2 taking over from SREBP, likely occurred in the common ancestor of all Saccharomycotina. Yarrowia lipolytica, a deep-branching species, is the only genome known to contain intact and full-length orthologs of both SREBP (Sre1) and Upc2. Deleting YlUPC2, but not YlSRE1, confers susceptibility to azole drugs. Sterol levels are significantly reduced in the YlUPC2 deletion. RNA-seq analysis shows that hypoxic regulation of sterol synthesis genes in Y. lipolytica is predominantly mediated by Upc2. However, YlSre1 still retains a role in hypoxic regulation; growth of Y. lipolytica in hypoxic conditions is reduced in a Ylupc2 deletion and is abolished in a Ylsre1/Ylupc2 double deletion, and YlSre1 regulates sterol gene expression during hypoxia adaptation. We show that YlSRE1, and to a lesser extent YlUPC2, are required for switching from yeast to filamentous growth in hypoxia. Sre1 appears to have an ancestral role in the regulation of filamentation, which became decoupled from its role in sterol gene regulation by the arrival of Upc2 in the Saccharomycotina. PMID:24453983

  8. Transients in chloroplast gene transcription

    SciTech Connect

    Puthiyaveetil, Sujith; Allen, John F.


    Transcriptional regulation of chloroplast genes is demonstrated by Quantitative Polymerase Chain Reaction (qPCR). These genes encode apoproteins of the reaction centres of photosystem I and photosystem II. Their transcription is regulated by changes in wavelength of light selectively absorbed by photosystem I and photosystem II, and therefore by the redox state of an electron carrier located between the two photosystems. Chloroplast transcriptional redox regulation is shown to have greater amplitude, and the kinetics of transcriptional changes are more complex, than suggested by previous experiments using only DNA probes in Northern blot experiments. Redox effects on chloroplast transcription appear to be superimposed on an endogenous rhythm of mRNA abundance. The functional significance of these transients in chloroplast gene transcription is discussed.

  9. Ubiquitin and Proteasomes in Transcription

    PubMed Central

    Geng, Fuqiang; Wenzel, Sabine; Tansey, William P.


    Regulation of gene transcription is vitally important for the maintenance of normal cellular homeostasis. Failure to correctly regulate gene expression, or to deal with problems that arise during the transcription process, can lead to cellular catastrophe and disease. One of the ways cells cope with the challenges of transcription is by making extensive use of the proteolytic and nonproteolytic activities of the ubiquitin-proteasome system (UPS). Here, we review recent evidence showing deep mechanistic connections between the transcription and ubiquitin-proteasome systems. Our goal is to leave the reader with a sense that just about every step in transcription—from transcription initiation through to export of mRNA from the nucleus—is influenced by the UPS and that all major arms of the system—from the first step in ubiquitin (Ub) conjugation through to the proteasome—are recruited into transcriptional processes to provide regulation, directionality, and deconstructive power. PMID:22404630

  10. Regulation of Expression and Evolution of Genes in Plastids of Rhodophytic Branch.


    Zverkov, Oleg Anatolyevich; Seliverstov, Alexandr Vladislavovich; Lyubetsky, Vassily Alexandrovich


    A novel algorithm and original software were used to cluster all proteins encoded in plastids of 72 species of the rhodophytic branch. The results are publicly available at in a database that allows fast identification of clusters (protein families) both by a fragment of an amino acid sequence and by a phylogenetic profile of a protein. No such integral clustering with the corresponding functions can be found in the public domain. The putative regulons of the transcription factors Ycf28 and Ycf29 encoded in the plastids were identified using the clustering and the database. A regulation of translation initiation was proposed for the ycf24 gene in plastids of certain red algae and apicomplexans as well as a regulation of a putative gene in apicoplasts of Babesia spp. and Theileria parva. The conserved regulation of the ycf24 gene expression and specificity alternation of the transcription factor Ycf28 were shown in the plastids. A phylogenetic tree of plastids was generated for the rhodophytic branch. The hypothesis of the origin of apicoplasts from the common ancestor of all apicomplexans from plastids of red algae was confirmed. PMID:26840333

  11. Dynamic regulation of chloroplast transcription

    SciTech Connect

    Mullet, J.E. )


    This paper examines the coordinated expression of plastid and nuclear genes for chlorplast development and provides an opportunity to understand how plants sense and alter gene expression in response to light. Topic areas covered include the following: changing perspectives of plastid transcription; plastid genome organization; protein stoichiometry, mRNA abundance, and transcription rates; significance of plastid mRNA stability; overall dynamics of chloroplast transcription; differential transcription during chloroplast development;special role for a nuclear-encoded plastid-localized RNA polymerase. 27 refs., 1 fig., 1 tab.

  12. GATA Transcription Factors in Pregnancy

    PubMed Central

    chen, Ying; Wang, Kai; Leach, Richard


    GATA transcription factors are Zinc finger members which perform a variety of important functions within the 3-germ layers as well as in extra embryonic endoderm during embryonic development. Distinct roles for GATA transcription factors have previously been identified in hematopoietic, the cardiac vascular system, the central neural system, as well as respiratory and intestinal systems. However, the role of GATA transcription factors in trophoblast lineage and placental development is far more complete. This review focuses on the roles of GATA transcription factors during pregnancy: the establishment of trophoblast lineage, trophoectoderm maintenance, trophoblast differentiation and the pathogenesis of placenta-related diseases of pregnancy. PMID:25664333

  13. Promoter-mediated Transcriptional Dynamics

    PubMed Central

    Zhang, Jiajun; Zhou, Tianshou


    Genes in eukaryotic cells are typically regulated by complex promoters containing multiple binding sites for a variety of transcription factors, but how promoter dynamics affect transcriptional dynamics has remained poorly understood. In this study, we analyze gene models at the transcriptional regulation level, which incorporate the complexity of promoter structure (PS) defined as transcriptional exits (i.e., ON states of the promoter) and the transition pattern (described by a matrix consisting of transition rates among promoter activity states). We show that multiple exits of transcription are the essential origin of generating multimodal distributions of mRNA, but promoters with the same transition pattern can lead to multimodality of different modes, depending on the regulation of transcriptional factors. In turn, for similar mRNA distributions in the models, the mean ON or OFF time distributions may exhibit different characteristics, thus providing the supplemental information on PS. In addition, we demonstrate that the transcriptional noise can be characterized by a nonlinear function of mean ON and OFF times. These results not only reveal essential characteristics of promoter-mediated transcriptional dynamics but also provide signatures useful for inferring PS based on characteristics of transcriptional outputs. PMID:24461023

  14. Transcriptional Regulation: a Genomic Overview

    PubMed Central

    Riechmann, José Luis


    The availability of the Arabidopsis thaliana genome sequence allows a comprehensive analysis of transcriptional regulation in plants using novel genomic approaches and methodologies. Such a genomic view of transcription first necessitates the compilation of lists of elements. Transcription factors are the most numerous of the different types of proteins involved in transcription in eukaryotes, and the Arabidopsis genome codes for more than 1,500 of them, or approximately 6% of its total number of genes. A genome-wide comparison of transcription factors across the three eukaryotic kingdoms reveals the evolutionary generation of diversity in the components of the regulatory machinery of transcription. However, as illustrated by Arabidopsis, transcription in plants follows similar basic principles and logic to those in animals and fungi. A global view and understanding of transcription at a cellular and organismal level requires the characterization of the Arabidopsis transcriptome and promoterome, as well as of the interactome, the localizome, and the phenome of the proteins involved in transcription. PMID:22303220

  15. DNA topology and transcription

    PubMed Central

    Kouzine, Fedor; Levens, David; Baranello, Laura


    Chromatin is a complex assembly that compacts DNA inside the nucleus while providing the necessary level of accessibility to regulatory factors conscripted by cellular signaling systems. In this superstructure, DNA is the subject of mechanical forces applied by variety of molecular motors. Rather than being a rigid stick, DNA possesses dynamic structural variability that could be harnessed during critical steps of genome functioning. The strong relationship between DNA structure and key genomic processes necessitates the study of physical constrains acting on the double helix. Here we provide insight into the source, dynamics, and biology of DNA topological domains in the eukaryotic cells and summarize their possible involvement in gene transcription. We emphasize recent studies that might inspire and impact future experiments on the involvement of DNA topology in cellular functions. PMID:24755522

  16. The Acid-Inducible asr Gene in Escherichia coli: Transcriptional Control by the phoBR Operon†

    PubMed Central

    Sužiedėlienė, Edita; Sužiedėlis, Kęstutis; Garbenčiūtė, Vaida; Normark, Staffan


    Escherichia coli responds to external acidification (pH 4.0 to 5.0) by synthesizing a newly identified, ∼450-nucleotide RNA component. At maximal levels of induction it is one of the most abundant small RNAs in the cell and is relatively stable bacterial RNA. The acid-inducible RNA was purified, and the gene encoding it, designated asr (for acid shock RNA), mapped at 35.98 min on the E. coli chromosome. Analysis of the asr DNA sequence revealed an open reading frame coding for a 111-amino-acid polypeptide with a deduced molecular mass of approximately 11.6 kDa. According to computer-assisted analysis, the predicted polypeptide contains a typical signal sequence of 30 amino acids and might represent either a periplasmic or an outer membrane protein. The asr gene cloned downstream from a T7 promoter was translated in vivo after transcription using a T7 RNA polymerase transcription system. Expression of a plasmid-encoded asr::lacZ fusion under a native asr promoter was reduced ∼15-fold in a complex medium, such as Luria-Bertani medium, versus the minimal medium. Transcription of the chromosomal asr was abolished in the presence of a phoB-phoR (a two-component regulatory system, controlling the pho regulon inducible by phosphate starvation) deletion mutant. Acid-mediated induction of the asr gene in the Δ(phoB-phoR) mutant strain was restored by introduction of the plasmid with cloned phoB-phoR genes. Primer extension analysis of the asr transcript revealed a region similar to the Pho box (the consensus sequence found in promoters transcriptionally activated by the PhoB protein) upstream from the determined transcription start. The asr promoter DNA region was demonstrated to bind PhoB protein in vitro. We discuss our results in terms of how bacteria might employ the phoB-phoR regulatory system to sense an external acidity and regulate transcription of the asr gene. PMID:10094685

  17. Mastering Transcription: Multiplexed Analysis of Transcription Start Site Sequences.


    Hochschild, Ann


    In this issue of Molecular Cell, Vvedenskaya etal. (2015) describe a high-throughput sequencing-based methodology for the massively parallel analysis of transcription from a high-complexity barcoded template library both invitro and invivo, providing a powerful new tool for the study of transcription. PMID:26687597

  18. Study of the in vivo role of Mce2R, the transcriptional regulator of mce2 operon in Mycobacterium tuberculosis

    PubMed Central


    Background Tuberculosis is one of the leading causes of mortality throughout the world. Mycobacterium tuberculosis, the agent of human tuberculosis, has developed strategies involving proteins and other compounds called virulence factors to subvert human host defences and damage and invade the human host. Among these virulence-related proteins are the Mce proteins, which are encoded in the mce1, mce2, mce3 and mce4 operons of M. tuberculosis. The expression of the mce2 operon is negatively regulated by the Mce2R transcriptional repressor. Here we evaluated the role of Mce2R during the infection of M. tuberculosis in mice and macrophages and defined the genes whose expression is in vitro regulated by this transcriptional repressor. Results We used a specialized transduction method for generating a mce2R mutant of M. tuberculosis H37Rv. Although we found equivalent replication of the Mt?mce2R mutant and the wild type strains in mouse lungs, overexpression of Mce2R in the complemented strain (Mt?mce2RComp) significantly impaired its replication. During in vitro infection of macrophages, we observed a significantly increased association of the late endosomal marker LAMP-2 to Mt?mce2RComp-containing phagosomes as compared to Mt?mce2R and the wild type strains. Whole transcriptional analysis showed that Mce2R regulates mainly the expression of the mce2 operon, in the in vitro conditions studied. Conclusions The findings of the current study indicate that Mce2R weakly represses the in vivo expression of the mce2 operon in the studied conditions and argue for a role of the proteins encoded in Mce2R regulon in the arrest of phagosome maturation induced by M. tuberculosis. PMID:24007602

  19. Output Targets and Transcriptional Regulation by a Cyclic Dimeric GMP-Responsive Circuit in the Vibrio parahaemolyticus Scr Network

    PubMed Central

    Ferreira, Rosana B. R.; Chodur, Daniel M.; Antunes, Luis Caetano M.; Trimble, Michael J.


    The Vibrio parahaemolyticus Scr system modulates decisions pertinent to surface colonization by affecting the cellular level of cyclic dimeric GMP (c-di-GMP). In this work, we explore the scope and mechanism of this regulation. Transcriptome comparison of ?scrABC and wild-type strains revealed expression differences with respect to ?100 genes. Elevated c-di-GMP repressed genes in the surface-sensing regulon, including those encoding the lateral flagellar and type III secretion systems and N-acetylglucosamine-binding protein GpbA while inducing genes encoding other cell surface molecules and capsular polysaccharide. The transcription of a few regulatory genes was also affected, and the role of one was characterized. Mutations in cpsQ suppressed the sticky phenotype of scr mutants. cpsQ encodes one of four V. parahaemolyticus homologs in the CsgD/VpsT family, members of which have been implicated in c-di-GMP signaling. Here, we demonstrate that CpsQ is a c-di-GMP-binding protein. By using a combination of mutant and reporter analyses, CpsQ was found to be the direct, positive regulator of cpsA transcription. This c-di-GMP-responsive regulatory circuit could be reconstituted in Escherichia coli, where a low level of this nucleotide diminished the stability of CpsQ. The molecular interplay of additional known cps regulators was defined by establishing that CpsS, another CsgD family member, repressed cpsR, and the transcription factor CpsR activated cpsQ. Thus, we are developing a connectivity map of the Scr decision-making network with respect to its wiring and output strategies for colonizing surfaces and interaction with hosts; in doing so, we have isolated and reproduced a c-di-GMP-sensitive regulatory module in the circuit. PMID:22194449

  20. Community signaling between Streptococcus gordonii and Porphyromonas gingivalis is controlled by the transcriptional regulator CdhR

    PubMed Central

    Chawla, Aarti; Hirano, Takanori; Bainbridge, Brian W.; Demuth, Donald R.; Xie, Hua; Lamont, Richard J.


    Summary Interspecies signaling between P. gingivalis and S. gordonii serves to constrain development of dual species communities. Contact with S. gordonii propagates a tyrosine phosphorylation dependent signal within P. gingivalis that culminates in reduced transcription of adhesin and signaling genes. Here we demonstrate the involvement of the P. gingivalis orphan LuxR family transcription factor PGN_1373, which we designate CdhR, in this control pathway. Expression of cdhR is elevated following contact with S. gordonii; however, regulation of cdhR did not occur in a mutant lacking the tyrosine phosphatase Ltp1, indicating that CdhR and Ltp1 are components of the same regulon. Contact between S. gordonii and a CdhR mutant resulted in increased transcription of mfa, encoding the subunit of the short fimbriae, along with higher levels of Mfa protein. Expression of luxS, encoding AI-2 synthase, was also increased in the cdhR mutant after contact with S. gordonii. The Mfa adhesive function and AI-2-dependent signaling participate in the formation and development of dual species communities, and consistent with this the cdhR mutant displayed elevated accumulation on a substratum of S. gordonii. Recombinant CdhR protein bound to upstream regulatory regions of both mfa and luxS, indicating that CdhR has a direct effect on gene expression. LuxS was also found to participate in a positive feedback loop that suppresses CdhR expression. Interaction of Mfa fimbriae with S. gordonii is necessary to initiate signaling through CdhR. These results reveal CdhR to be an effector molecule in a negative regulatory network that controls P. gingivalis-S. gordonii heterotypic communities. PMID:21143321

  1. Blue and Red Light Modulates SigB-Dependent Gene Transcription, Swimming Motility and Invasiveness in Listeria monocytogenes

    PubMed Central

    Ondrusch, Nicolai; Kreft, Jürgen


    Background In a number of gram-positive bacteria, including Listeria, the general stress response is regulated by the alternative sigma factor B (SigB). Common stressors which lead to the activation of SigB and the SigB-dependent regulon are high osmolarity, acid and several more. Recently is has been shown that also blue and red light activates SigB in Bacillus subtilis. Methodology/Principal Findings By qRT-PCR we analyzed the transcriptional response of the pathogen L. monocytogenes to blue and red light in wild type bacteria and in isogenic deletion mutants for the putative blue-light receptor Lmo0799 and the stress sigma factor SigB. It was found that both blue (455 nm) and red (625 nm) light induced the transcription of sigB and SigB-dependent genes, this induction was completely abolished in the SigB mutant. The blue-light effect was largely dependent on Lmo0799, proving that this protein is a genuine blue-light receptor. The deletion of lmo0799 enhanced the red-light effect, the underlying mechanism as well as that of SigB activation by red light remains unknown. Blue light led to an increased transcription of the internalin A/B genes and of bacterial invasiveness for Caco-2 enterocytes. Exposure to blue light also strongly inhibited swimming motility of the bacteria in a Lmo0799- and SigB-dependent manner, red light had no effect there. Conclusions/Significance Our data established that visible, in particular blue light is an important environmental signal with an impact on gene expression and physiology of the non-phototrophic bacterium L. monocytogenes. In natural environments these effects will result in sometimes random but potentially also cyclic fluctuations of gene activity, depending on the light conditions prevailing in the respective habitat. PMID:21264304

  2. Phonetic Transcription of Disordered Speech.

    ERIC Educational Resources Information Center

    Powell, Thomas W.


    This article reviews major approaches to the transcription of disordered speech using the International Alphabet (IPA). Application of selected symbols for transcribing non-English sounds is highlighted in clinical examples, as are commonly used diacritic symbols. Included is an overview of the IPA extensions for transcription of atypical speech,…

  3. Transcription of ncDNA

    PubMed Central

    Hainer, Sarah J


    Transcription of ncDNA occurs throughout eukaryotic genomes, generating a wide array of ncRNAs. One large class of ncRNAs includes those transcribed over the promoter regions of nearby protein coding genes. Recent studies, primarily focusing on individual genes have uncovered multiple mechanisms by which promoter-associated transcriptional activity locally alters gene expression. PMID:21826282

  4. Characterization of Mutants Deficient in the l,d-Carboxypeptidase (DacB) and WalRK (VicRK) Regulon, Involved in Peptidoglycan Maturation of Streptococcus pneumoniae Serotype 2 Strain D39?

    PubMed Central

    Barendt, Skye M.; Sham, Lok-To; Winkler, Malcolm E.


    Peptidoglycan (PG) hydrolases play critical roles in the remodeling of bacterial cell walls during division. PG hydrolases have been studied extensively in several bacillus species, such as Escherichia coli and Bacillus subtilis, but remain relatively uncharacterized in ovococcus species, such as Streptococcus pneumoniae (pneumococcus). In this work, we identified genes that encode proteins with putative PG hydrolytic domains in the genome of S. pneumoniae strain D39. Knockout mutations in these genes were constructed, and the resulting mutants were characterized in comparison with the parent strain for growth, cell morphology, PG peptide incorporation, and in some cases, PG peptide composition. In addition, we characterized deletion mutations in nonessential genes of unknown function in the WalRKSpn two-component system regulon, which also contains the essential pcsB cell division gene. Several mutants did not show overt phenotypes, which is perhaps indicative of redundancy. In contrast, two new mutants showed distinct defects in PG biosynthesis. One mutation was in a gene designated dacB (spd_0549), which we showed encodes an l,d-carboxypeptidase involved in PG maturation. Notably, dacB mutants, similar to dacA (d,d-carboxypeptidase) mutants, exhibited defects in cell shape and septation, consistent with the idea that the availability of PG peptide precursors is important for proper PG biosynthesis. Epistasis analysis indicated that DacA functions before DacB in d-Ala removal, and immunofluorescence microscopy showed that DacA and DacB are located over the entire surface of pneumococcal cells. The other mutation was in WalRKSpn regulon gene spd_0703, which encodes a putative membrane protein that may function as a type of conserved streptococcal shape, elongation, division, and sporulation (SEDS) protein. PMID:21378199

  5. RNA duplexes in transcriptional regulation.


    Swaminathan, Sanjay; Hood, Chantelle L; Suzuki, Kazuo; Kelleher, Anthony D


    Transcriptional regulation by small RNA molecules, including small interfering RNA and microRNA, has emerged as an important gene expression modulator. The regulatory pathways controlling gene expression, post-transcriptional gene silencing and transcriptional gene silencing (TGS) have been demonstrated in yeast, plants and more recently in human cells. In this review, we discuss the currents models of transcriptional regulation and the main components of the RNA-induced silencing complex and RNA-induced transcriptional silencing complex machinery, as well as confounding off-target effects and gene activation. We also discuss RNA-mediated TGS within the NF-κB motif of the human immunodeficiency virus type 1 5' long tandem repeat promoter region and the associated epigenetic modifications. Finally, we outline the current RNA interference (RNAi) delivery methods and describe the current status of human trials investigating potential RNAi therapeutics for several human diseases. PMID:25962003

  6. Gene regulation by antisense transcription.


    Pelechano, Vicent; Steinmetz, Lars M


    Antisense transcription, which was initially considered by many as transcriptional noise, is increasingly being recognized as an important regulator of gene expression. It is widespread among all kingdoms of life and has been shown to influence - either through the act of transcription or through the non-coding RNA that is produced - almost all stages of gene expression, from transcription and translation to RNA degradation. Antisense transcription can function as a fast evolving regulatory switch and a modular scaffold for protein complexes, and it can 'rewire' regulatory networks. The genomic arrangement of antisense RNAs opposite sense genes indicates that they might be part of self-regulatory circuits that allow genes to regulate their own expression. PMID:24217315

  7. Structural basis of transcription elongation.


    Martinez-Rucobo, Fuensanta W; Cramer, Patrick


    For transcription elongation, all cellular RNA polymerases form a stable elongation complex (EC) with the DNA template and the RNA transcript. Since the millennium, a wealth of structural information and complementary functional studies provided a detailed three-dimensional picture of the EC and many of its functional states. Here we summarize these studies that elucidated EC structure and maintenance, nucleotide selection and addition, translocation, elongation inhibition, pausing and proofreading, backtracking, arrest and reactivation, processivity, DNA lesion-induced stalling, lesion bypass, and transcriptional mutagenesis. In the future, additional structural and functional studies of elongation factors that control the EC and their possible allosteric modes of action should result in a more complete understanding of the dynamic molecular mechanisms underlying transcription elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation. PMID:22982352

  8. Transcriptional profiling of Bordetella pertussis reveals requirement of RNA chaperone Hfq for Type III secretion system functionality

    PubMed Central

    Bibova, Ilona; Hot, David; Keidel, Kristina; Amman, Fabian; Slupek, Stephanie; Cerny, Ondrej; Gross, Roy; Vecerek, Branislav


    Bordetella pertussis, the causative agent of human whooping cough (pertussis) produces a complex array of virulence factors in order to establish efficient infection in the host. The RNA chaperone Hfq and small regulatory RNAs are key players in posttranscriptional regulation in bacteria and have been shown to play an essential role in virulence of a broad spectrum of bacterial pathogens. This study represents the first attempt to characterize the Hfq regulon of the human pathogen B. pertussis under laboratory conditions as well as upon passage in the host and indicates that loss of Hfq has a profound effect on gene expression in B. pertussis. Comparative transcriptional profiling revealed that Hfq is required for expression of several virulence factors in B. pertussis cells including the Type III secretion system (T3SS). In striking contrast to the wt strain, T3SS did not become operational in the hfq mutant passaged either through mice or macrophages thereby proving that Hfq is required for the functionality of the B. pertussis T3SS. Likewise, expression of virulence factors vag8 and tcfA encoding autotransporter and tracheal colonization factor, respectively, was strongly reduced in the hfq mutant. Importantly, for the first time we demonstrate that B. pertussis T3SS can be activated upon contact with macrophage cells in vitro. PMID:25674816

  9. Contributions of ATP, GTP, and Redox State to Nutritional Stress Activation of the Bacillus subtilis σB Transcription Factor

    PubMed Central

    Zhang, Shuyu; Haldenwang, W. G.


    The general stress regulon of Bacillus subtilis is induced by activation of the σB transcription factor. σB activation occurs when one of two phosphatases responds to physical or nutritional stress to activate a positive σB regulator by dephosphorylation. The signal that triggers the nutritional stress phosphatase (RsbP) is unknown; however, RsbP activation occurs under culture conditions (glucose/phosphate starvation, azide or decoyinine treatment) that reduce the cell's levels of ATP and/or GTP. Variances in nucleotide levels in these instances may be coincidental rather than causal. RsbP carries a domain (PAS) that in some regulatory systems can respond directly to changes in electron transport, proton motive force, or redox potential, changes that typically precede shifts in high-energy nucleotide levels. The current work uses Bacillus subtilis with mutations in the oxidative phosphorylation and purine nucleotide biosynthetic pathways in conjunction with metabolic inhibitors to better define the inducing signal for RsbP activation. The data argue that a drop in ATP, rather than changes in GTP, proton motive force, or redox state, is the key to triggering σB activation. PMID:16267279

  10. The unified ICE-CBF pathway provides a transcriptional feedback control of freezing tolerance during cold acclimation in Arabidopsis.


    Kim, Ye Seul; Lee, Minyoung; Lee, Jae-Hyung; Lee, Hyo-Jun; Park, Chung-Mo


    During cold acclimation, C-repeat binding factors (CBFs) activate downstream targets, such as cold-regulated genes, leading to the acquisition of freezing tolerance in plants. Inducer of CBF expression 1 (ICE1) plays a key role by activating CBF3 expression in shaping the cold-induced transcriptome. While the ICE1-CBF3 regulon constitutes a major cold acclimation pathway, gene regulatory networks governing the CBF signaling are poorly understood. Here, we demonstrated that ICE1 and its paralog ICE2 induce CBF1, CBF2, and CBF3 by binding to the gene promoters. ICE2, like ICE1, was ubiquitinated by the high expression of osmotically responsive gene 1 (HOS1) E3 ubiquitin ligase. Whereas ICE2-defective ice2-2 mutant did not exhibit any discernible freezing-sensitive phenotypes, ice1-2 ice2-2/+ plant, which is defective in ICE1 and has a heterozygotic ice2 mutation, exhibited significantly reduced freezing tolerance. Accordingly, all three CBF genes were markedly down-regulated in the ice1-2 ice2-2/+ plant, indicating that ICE1 and ICE2 are functionally redundant with different implementations in inducing CBF genes. Together with the negative regulation of CBF3 by CBF2, we propose that the unified ICE-CBF pathway provides a transcriptional feedback of freezing tolerance to sustain plant development and survival during cold acclimation. PMID:26311645

  11. Action of multiple intra-QTL genes concerted around a co-localized transcription factor underpins a large effect QTL

    PubMed Central

    Dixit, Shalabh; Kumar Biswal, Akshaya; Min, Aye; Henry, Amelia; Oane, Rowena H.; Raorane, Manish L.; Longkumer, Toshisangba; Pabuayon, Isaiah M.; Mutte, Sumanth K.; Vardarajan, Adithi R.; Miro, Berta; Govindan, Ganesan; Albano-Enriquez, Blesilda; Pueffeld, Mandy; Sreenivasulu, Nese; Slamet-Loedin, Inez; Sundarvelpandian, Kalaipandian; Tsai, Yuan-Ching; Raghuvanshi, Saurabh; Hsing, Yue-Ie C.; Kumar, Arvind; Kohli, Ajay


    Sub-QTLs and multiple intra-QTL genes are hypothesized to underpin large-effect QTLs. Known QTLs over gene families, biosynthetic pathways or certain traits represent functional gene-clusters of genes of the same gene ontology (GO). Gene-clusters containing genes of different GO have not been elaborated, except in silico as coexpressed genes within QTLs. Here we demonstrate the requirement of multiple intra-QTL genes for the full impact of QTL qDTY12.1 on rice yield under drought. Multiple evidences are presented for the need of the transcription factor ‘no apical meristem’ (OsNAM12.1) and its co-localized target genes of separate GO categories for qDTY12.1 function, raising a regulon-like model of genetic architecture. The molecular underpinnings of qDTY12.1 support its effectiveness in further improving a drought tolerant genotype and for its validity in multiple genotypes/ecosystems/environments. Resolving the combinatorial value of OsNAM12.1 with individual intra-QTL genes notwithstanding, identification and analyses of qDTY12.1has fast-tracked rice improvement towards food security. PMID:26507552

  12. Identification of base and backbone contacts used for DNA sequence recognition and high-affinity binding by LAC9, a transcription activator containing a C6 zinc finger

    SciTech Connect

    Halvorsen, Yuan-Di C.; Nandabalan, K.; Dickson, R.C. )


    The LAC9 protein of Kluyveromyces lactis is a transcriptional regulator of genes in the lactose-galactose regulon. To regulate transcription, LAC9 must bind to 17-bp upstream activator sequences (UASs) located in front of each target gene. LAC9 is homologous to the GAL4 protein of Saccharomyces cerevisiae, and the two proteins must bind DNA in a very similar manner. In this paper the authors show that high-affinity, sequence-specific binding by LAC9 dimers is mediated primarily by 3 bp at each end of the UAS. In addition, at least one half of the UAS must have a GC or CG base pair at position 1 for high-affinity binding; LAC9k binds preferentially to the half containing the GC base pair. Hydroxyl radical footprinting shows that a LAC9 dimer binds an unusually broad region on one face of the DNA helix. Because of the data, they suggest that LAC9 contacts positions 6, 7, and 8, both plus and minus, of the UAS, which are separated by more than one turn of the DNA helix, and twists part way around the DNA, thus protecting the broad region of the minor groove between the major-groove contacts.

  13. XbmR, a new transcription factor involved in the regulation of chemotaxis, biofilm formation and virulence in Xanthomonas citri subsp. citri.


    Yaryura, Pablo M; Conforte, Valeria P; Malamud, Florencia; Roeschlin, Roxana; de Pino, Vernica; Castagnaro, Atilio P; McCarthy, Yvonne; Dow, J Maxwell; Marano, Mara R; Vojnov, Adrin A


    Xanthomonas citri subsp. citri (Xcc) is the causal agent of citrus canker. Biofilm formation on citrus leaves plays an important role in epiphytic survival of Xcc. Biofilm formation is affected by transposon insertion in XAC3733, which encodes a transcriptional activator of the NtrC family, not linked to a gene encoding a sensor protein, thus could be considered as an 'orphan' regulator whose function is poorly understood in Xanthomonas spp. Here we show that mutation of XAC3733 (named xbmR) resulted in impaired structural development of the Xcc biofilm, loss of chemotaxis and reduced virulence in grapefruit plants. All defective phenotypes were restored to wild-type levels by the introduction of PA2567 from Pseudomonas aeruginosa, which encodes a phosphodiesterase active in the degradation of cyclic diguanosine monophosphate (c-di-GMP). A knockout of xbmR led to a substantial downregulation of fliA that encodes a ?(28) transcription factor, as well as fliC and XAC0350 which are potential member of the ?(28) regulon. XAC0350 encodes an HD-GYP domain c-di-GMP phosphodiesterase. These findings suggest that XbmR is a key regulator of flagellar-dependent motility and chemotaxis exerting its action through a regulatory pathway that involves FliA and c-di-GMP. PMID:25346091

  14. The enhancin-like metalloprotease from the Bacillus cereus group is regulated by the pleiotropic transcriptional activator PlcR but is not essential for larvicidal activity.


    Hajaij-Ellouze, Myriam; Fedhila, Sinda; Lereclus, Didier; Nielsen-LeRoux, Christina


    Bacillus cereus group bacteria produce virulence factors. Many of these are regulated by the pleiotropic transcriptional activator PlcR, which is implicated in insect virulence. In silico analysis of the B. cereus strain ATCC14579 genome showed an enhancin-like gene preceded by a typical PlcR binding sequence. The gene is predicted to encode a polypeptide showing 23-25% identity with enhancins from several baculoviruses and 31% with that of Yersinia pestis. Viral enhancin acts after oral infection and degrades the peritrophic matrix of various Lepidopteran larvae. To rule out a possible implication of Bacillus enhancin in insect virulence, we sequenced the enhancin gene from the Bacillus thuringiensis 407-crystal minus strain and investigated its gene regulation and larvicidal activity. A typical metalloprotease zinc-binding domain (HEIAH) was detected and the gene was named mpbE (metalloprotease bacillus enhancin). An mpbE'-lacZ transcriptional fusion demonstrated that mpbE belongs to the PlcR regulon. The mpbE mutant was fed to Galleria mellonella larvae, and no significant reduction in virulence was observed. However, this may not exclude MpbE from a role in pathogenesis. PMID:16790012

  15. Human CMV transcripts: an overview.


    Ma, Yanping; Wang, Ning; Li, Mali; Gao, Shuang; Wang, Lin; Zheng, Bo; Qi, Ying; Ruan, Qiang


    The human CMV (HCMV) genome consists of an approximately 230-kb dsDNA and is predicted to contain over 165 open reading frames. Although the entire sequence of the laboratory-adapted AD169 strain of HCMV was first available in 1991, the precise number and nature of viral genes and gene products are still unclear. Fewer than 100 predicted genes have been convincingly elucidated with respect to their expression patterns, transcript structure and transcription characteristics. The high gene number of HCMV creates a crowded genome with many overlapping transcriptional units. 3- or 5-coterminal overlapping polycistronic transcripts could use a common promoter element or a poly-A signal. 3-coterminal monocistronic transcripts could encode 'nested' open reading frames, which possess different initiation but the same termination sites. As a virus with eukaryotic cells as the host, HCMV has the capacity to splice out introns during transcription. Major alternately spliced mRNA species of HCMV originate primarily, but not exclusively, from the immediate early gene regions. Alternate splicing patterns of the mRNAs could encode a number of gene products with different sizes. In recent years, some antisense and noncoding transcripts of HCMV have been reported. These RNAs probably have functions in genomic replication or the regulation of gene expression. PMID:22568714

  16. A transcript perspective on evolution.


    Christinat, Yann; Moret, Bernard M E


    Alternative splicing is now recognized as a major mechanism for transcriptome and proteome diversity in higher eukaryotes, yet its evolution is poorly understood. Most studies focus on the evolution of exons and introns at the gene level, while only few consider the evolution of transcripts. In this paper, we present a framework for transcript phylogenies where ancestral transcripts evolve along the gene tree by gains, losses, and mutation. We demonstrate the usefulness of our method on a set of 805 genes and two different topics. First, we improve a method for transcriptome reconstruction from ESTs (ASPic), then we study the evolution of function in transcripts. The use of transcript phylogenies allows us to double the precision of ASPic, whereas results on the functional study reveal that conserved transcripts are more likely to share protein domains than functional sites. These studies validate our framework for the study of evolution in large collections of organisms from the perspective of transcripts; for this purpose, we developed and provide a new tool, TrEvoR. PMID:24407299

  17. A Transcript Perspective on Evolution.


    Christinat, Yann; Moret, Bernard M E


    Alternative splicing is now recognized as a major mechanism for transcriptome and proteome diversity in higher eukaryotes. Yet, its evolution is poorly understood. Most studies focus on the evolution of exons and introns at the gene level, while only few consider the evolution of transcripts. In this paper, we present a framework for transcript phylogenies where ancestral transcripts evolve along the gene tree by gains, losses, and mutation. We demonstrate the usefulness of our method on a set of 805 genes and two different topics. First, we improve a method for transcriptome reconstruction from ESTs (ASPic), then we study the evolution of function in transcripts. The use of transcript phylogenies allows us to double the specificity of ASPic, whereas results on the functional study reveal that conserved transcripts are more likely to share protein domains than functional sites. These studies validate our framework for the study of evolution in large collections of organisms from the perspective of transcripts; for this purpose, we developed and provide a new tool, TrEvoR. PMID:23209053

  18. Transcription of Trypanosoma brucei maxicircles

    SciTech Connect

    Michelotti, E.F.; Hajduk, S.L.


    Trypanosoma brucei is a protozoan parasite which developmentally regulates mitochondrial activity. In the mammal T. brucei produces ATP entirely by glycolysis while cytochrome mediated respiration resumes in the life-stage in the midgut of the insect vector. Using quantitative S1 nuclease protection assays two types of regulation of the steady state levels of the mitochondrial transcripts were found. Transcription of cytochrome b, cytochrome oxidase, and the rRNA genes is repressed in early bloodstream developmental stages, undergoes dramatic activation in later bloodstream stages, and finally a lesser activation in the insect developmental stage. Transcription of NADH dehydrogenase genes, however, is unregulated. Mitochondrial transcripts with a 5' triphosphate terminus, representing the site of transcription initiation, were capped using guanylyl transferase. The in vitro capped RNA hybridized to only one of eight mitochondrial restriction fragments on a Southern blot, however, hybridization of Southern blots with RNA from ..cap alpha..-/sup 32/P-UTP pulsed mitochondria labelled all restriction fragments equally. These results suggest that each DNA strand has a single promoter which directs the transcription of a full-length RNA which is subsequently processed. Different mitochondrial genes, despite being expressed on the same precursor RNA molecule, are independently regulated by both transcription initiation and RNA processing.

  19. Pervasive transcription - Lessons from yeast.


    Tisseur, Mathieu; Kwapisz, Marta; Morillon, Antonin


    Pervasive transcription is now accepted to be a general feature of eukaryotic genomes, generating short and long non-coding RNAs (ncRNAs). Growing number of exampl