Note: This page contains sample records for the topic apicomplexan transcriptional regulons from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: August 15, 2014.
1

Transcriptional analysis of the flagellar regulon of Salmonella typhimurium.  

PubMed

In Salmonella typhimurium, nearly 50 genes are involved in flagellar formation and function and constitute at least 13 different operons. In this study, we examined the transcriptional interaction among the flagellar operons by combined use of Mu d1(Apr Lac) cts62 and Tn10 insertion mutants in the flagellar genes. The results showed that the flagellar operons can be divided into three classes: class I contains only the flhD operon, which is controlled by the cAMP-CAP complex and is required for expression of all of the other flagellar operons; class II contains seven operons, flgA, flgB, flhB, fliA, fliE, fliF, and fliL, which are under control of class I and are required for the expression of class III; class III contains five operons, flgK, fliD fliC, motA, and tar. This ordered cascade of transcription closely parallels the assembly of the flagellar structure. In addition, we found that the fliD defect enhanced expression of the class III operons. This suggests that the fliD gene product may be responsible for repression of the class III operons in the mutants in the class II genes. These results are compared with the cascade model of the flagellar regulon of Escherichia coli proposed previously (Y. Komeda, J. Bacteriol. 170:1575-1581, 1982). PMID:2404955

Kutsukake, K; Ohya, Y; Iino, T

1990-02-01

2

Comparative genomics and evolution of regulons of the LacI-family transcription factors.  

PubMed

DNA-binding transcription factors (TFs) are essential components of transcriptional regulatory networks in bacteria. LacI-family TFs (LacI-TFs) are broadly distributed among certain lineages of bacteria. The majority of characterized LacI-TFs sense sugar effectors and regulate carbohydrate utilization genes. The comparative genomics approaches enable in silico identification of TF-binding sites and regulon reconstruction. To study the function and evolution of LacI-TFs, we performed genomics-based reconstruction and comparative analysis of their regulons. For over 1300 LacI-TFs from over 270 bacterial genomes, we predicted their cognate DNA-binding motifs and identified target genes. Using the genome context and metabolic subsystem analyses of reconstructed regulons, we tentatively assigned functional roles and predicted candidate effectors for 78 and 67% of the analyzed LacI-TFs, respectively. Nearly 90% of the studied LacI-TFs are local regulators of sugar utilization pathways, whereas the remaining 125 global regulators control large and diverse sets of metabolic genes. The global LacI-TFs include the previously known regulators CcpA in Firmicutes, FruR in Enterobacteria, and PurR in Gammaproteobacteria, as well as the three novel regulators-GluR, GapR, and PckR-that are predicted to control the central carbohydrate metabolism in three lineages of Alphaproteobacteria. Phylogenetic analysis of regulators combined with the reconstructed regulons provides a model of evolutionary diversification of the LacI protein family. The obtained genomic collection of in silico reconstructed LacI-TF regulons in bacteria is available in the RegPrecise database (http://regprecise.lbl.gov). It provides a framework for future structural and functional classification of the LacI protein family and identification of molecular determinants of the DNA and ligand specificity. The inferred regulons can be also used for functional gene annotation and reconstruction of sugar catabolic networks in diverse bacterial lineages. PMID:24966856

Ravcheev, Dmitry A; Khoroshkin, Matvei S; Laikova, Olga N; Tsoy, Olga V; Sernova, Natalia V; Petrova, Svetlana A; Rakhmaninova, Aleksandra B; Novichkov, Pavel S; Gelfand, Mikhail S; Rodionov, Dmitry A

2014-01-01

3

Comparative genomics and evolution of regulons of the LacI-family transcription factors  

PubMed Central

DNA-binding transcription factors (TFs) are essential components of transcriptional regulatory networks in bacteria. LacI-family TFs (LacI-TFs) are broadly distributed among certain lineages of bacteria. The majority of characterized LacI-TFs sense sugar effectors and regulate carbohydrate utilization genes. The comparative genomics approaches enable in silico identification of TF-binding sites and regulon reconstruction. To study the function and evolution of LacI-TFs, we performed genomics-based reconstruction and comparative analysis of their regulons. For over 1300 LacI-TFs from over 270 bacterial genomes, we predicted their cognate DNA-binding motifs and identified target genes. Using the genome context and metabolic subsystem analyses of reconstructed regulons, we tentatively assigned functional roles and predicted candidate effectors for 78 and 67% of the analyzed LacI-TFs, respectively. Nearly 90% of the studied LacI-TFs are local regulators of sugar utilization pathways, whereas the remaining 125 global regulators control large and diverse sets of metabolic genes. The global LacI-TFs include the previously known regulators CcpA in Firmicutes, FruR in Enterobacteria, and PurR in Gammaproteobacteria, as well as the three novel regulators—GluR, GapR, and PckR—that are predicted to control the central carbohydrate metabolism in three lineages of Alphaproteobacteria. Phylogenetic analysis of regulators combined with the reconstructed regulons provides a model of evolutionary diversification of the LacI protein family. The obtained genomic collection of in silico reconstructed LacI-TF regulons in bacteria is available in the RegPrecise database (http://regprecise.lbl.gov). It provides a framework for future structural and functional classification of the LacI protein family and identification of molecular determinants of the DNA and ligand specificity. The inferred regulons can be also used for functional gene annotation and reconstruction of sugar catabolic networks in diverse bacterial lineages.

Ravcheev, Dmitry A.; Khoroshkin, Matvei S.; Laikova, Olga N.; Tsoy, Olga V.; Sernova, Natalia V.; Petrova, Svetlana A.; Rakhmaninova, Aleksandra B.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.

2014-01-01

4

Molecular cloning, structure, promoters and regulatory elements for transcription of the Bacillus licheniformis encoded regulon for xylose utilization  

Microsoft Academic Search

In this article we describe the cloning of the xyl regulon encoding xylose utilization from Bacillus licheniformis by complementation of a xyl mutant of B. subtilis. The xylose isomerase encoding gene, xylA, was sequenced and identified by its extensive homology to other xylose isomerases. The expression of xylA is regulated on the level of transcription by a repressor protein encoded

A. Scheler; T. Rygus; R. Allmansberger; W. Hillen

1991-01-01

5

RegulonDB (version 3.0): transcriptional regulation and operon organization in Escherichia coli K-12  

Microsoft Academic Search

RegulonDB is a database on transcription regulation and operon organization in Escherichia coli. The current version describes regulatory signals of tran- scription initiation, promoters, regulatory binding sites of specific regulators, ribosome binding sites and terminators, as well as information on genes clustered in operons. These specific annotations have been gathered from a constant search in the literature, as well as

Heladia Salgado; Alberto Santos-zavaleta; Socorro Gama-castro; Dulce Millán-zárate; Frederick R. Blattner; Julio Collado-vides

2000-01-01

6

RegulonDB (version 4.0): transcriptional regulation, operon organization and growth conditions in Escherichia coli K-12  

PubMed Central

RegulonDB is the primary database of the major international maintained curation of original literature with experimental knowledge about the elements and interactions of the network of transcriptional regulation in Escherichia coli K-12. This includes mechanistic information about operon organization and their decomposition into transcription units (TUs), promoters and their ? type, binding sites of specific transcriptional regulators (TRs), their organization into ‘regulatory phrases’, active and inactive conformations of TRs, as well as terminators and ribosome binding sites. The database is complemented with clearly marked computational predictions of TUs, promoters and binding sites of TRs. The current version has been expanded to include information beyond specific mechanisms aimed at gathering different growth conditions and the associated induced and/or repressed genes. RegulonDB is now linked with Swiss-Prot, with microarray databases, and with a suite of programs to analyze and visualize microarray experiments. We provide a summary of the biological knowledge contained in RegulonDB and describe the major changes in the design of the database. RegulonDB can be accessed on the web at the URL: http://www.cifn.unam.mx/Computational_Biology/regulondb/.

Salgado, Heladia; Gama-Castro, Socorro; Martinez-Antonio, Agustino; Diaz-Peredo, Edgar; Sanchez-Solano, Fabiola; Peralta-Gil, Martin; Garcia-Alonso, Delfino; Jimenez-Jacinto, Veronica; Santos-Zavaleta, Alberto; Bonavides-Martinez, Cesar; Collado-Vides, Julio

2004-01-01

7

RegulonDB (version 3.2): transcriptional regulation and operon organization in Escherichia coli K-12  

Microsoft Academic Search

RegulonDB is a database on mechanisms of transcription regulation and operon organization in Escherichia coli K-12. The current version has considerably increased numbers of regulatory elements such as promoters, binding sites and terminators. The complete repertoire of known and predicted DNA-binding transcriptional regulators can be considered to be included in this version. The database now distinguishes different allosteric conformations of

Heladia Salgado; Alberto Santos-zavaleta; Socorro Gama-castro; Dulce Millán-zárate; Edgar Díaz-peredo; Fabiola Sánchez-solano; Ernesto Pérez-rueda; César Bonavides-martínez; Julio Collado-vides

2001-01-01

8

Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon  

PubMed Central

A comparative genomic approach was used to reconstruct transcriptional regulation of NAD biosynthesis in bacteria containing orthologs of Bacillus subtilis gene yrxA, a previously identified niacin-responsive repressor of NAD de novo synthesis. Members of YrxA family (re-named here NiaR) are broadly conserved in the Bacillus/Clostridium group and in the deeply branching Fusobacteria and Thermotogales lineages. We analyzed upstream regions of genes associated with NAD biosynthesis to identify candidate NiaR-binding DNA motifs and assess the NiaR regulon content in these species. Representatives of the two distinct types of candidate NiaR-binding sites, characteristic of the Firmicutes and Thermotogales, were verified by an electrophoretic mobility shift assay. In addition to transcriptional control of the nadABC genes, the NiaR regulon in some species extends to niacin salvage (the pncAB genes) and includes uncharacterized membrane proteins possibly involved in niacin transport. The involvement in niacin uptake proposed for one of these proteins (re-named NiaP), encoded by the B. subtilis gene yceI, was experimentally verified. In addition to bacteria, members of the NiaP family are conserved in multicellular eukaryotes, including human, pointing to possible NaiP involvement in niacin utilization in these organisms. Overall, the analysis of the NiaR and NrtR regulons (described in the accompanying paper) revealed mechanisms of transcriptional regulation of NAD metabolism in nearly a hundred diverse bacteria.

Rodionov, Dmitry A.; Li, Xiaoqing; Rodionova, Irina A.; Yang, Chen; Sorci, Leonardo; Dervyn, Etienne; Martynowski, Dariusz; Zhang, Hong; Gelfand, Mikhail S.; Osterman, Andrei L.

2008-01-01

9

Global Phenotypic Analysis and Transcriptional Profiling Defines the Weak Acid Stress Response Regulon in Saccharomyces cerevisiae  

PubMed Central

Weak organic acids such as sorbate are potent fungistatic agents used in food preservation, but their intracellular targets are poorly understood. We thus searched for potential target genes and signaling components in the yeast genome using contemporary genome-wide functional assays as well as DNA microarray profiling. Phenotypic screening of the EUROSCARF collection revealed the existence of numerous sorbate-sensitive strains. Sorbate hypersensitivity was detected in mutants of the shikimate biosynthesis pathway, strains lacking the PDR12 efflux pump or WAR1, a transcription factor mediating stress induction of PDR12. Using DNA microarrays, we also analyzed the genome-wide response to acute sorbate stress, allowing for the identification of more than 100 genes rapidly induced by weak acid stress. Moreover, a novel War1p- and Msn2p/4p-independent regulon that includes HSP30 was identified. Although induction of the majority of sorbate-induced genes required Msn2p/4p, weak acid tolerance was unaffected by a lack of Msn2p/4p. Ectopic expression of PDR12 from the GAL1-10 promoter fully restored sorbate resistance in a strain lacking War1p, demonstrating that PDR12 is the major target of War1p under sorbic acid stress. Interestingly, comparison of microarray data with results from the phenotypic screening revealed that PDR12 remained as the only gene, which is both stress inducible and required for weak acid resistance. Our results suggest that combining functional assays with transcriptome profiling allows for the identification of key components in large datasets such as those generated by global microarray analysis.

Schuller, Christoph; Mamnun, Yasmine M.; Mollapour, Mehdi; Krapf, Gerd; Schuster, Michael; Bauer, Bettina E.; Piper, Peter W.; Kuchler, Karl

2004-01-01

10

Regulon organization of Arabidopsis  

PubMed Central

Background Despite the mounting research on Arabidopsis transcriptome and the powerful tools to explore biology of this model plant, the organization of expression of Arabidopsis genome is only partially understood. Here, we create a coexpression network from a 22,746 Affymetrix probes dataset derived from 963 microarray chips that query the transcriptome in response to a wide variety of environmentally, genetically, and developmentally induced perturbations. Results Markov chain graph clustering of the coexpression network delineates 998 regulons ranging from one to 1623 genes in size. To assess the significance of the clustering results, the statistical over-representation of GO terms is averaged over this set of regulons and compared to the analogous values for 100 randomly-generated sets of clusters. The set of regulons derived from the experimental data scores significantly better than any of the randomly-generated sets. Most regulons correspond to identifiable biological processes and include a combination of genes encoding related developmental, metabolic pathway, and regulatory functions. In addition, nearly 3000 genes of unknown molecular function or process are assigned to a regulon. Only five regulons contain plastomic genes; four of these are exclusively plastomic. In contrast, expression of the mitochondrial genome is highly integrated with that of nuclear genes; each of the seven regulons containing mitochondrial genes also incorporates nuclear genes. The network of regulons reveals a higher-level organization, with dense local neighborhoods articulated for photosynthetic function, genetic information processing, and stress response. Conclusion This analysis creates a framework for generation of experimentally testable hypotheses, gives insight into the concerted functions of Arabidopsis at the transcript level, and provides a test bed for comparative systems analysis.

Mentzen, Wieslawa I; Wurtele, Eve Syrkin

2008-01-01

11

RegulonDB (version 6.0): gene regulation model of Escherichia coli K-12 beyond transcription, active (experimental) annotated promoters and Textpresso navigation  

Microsoft Academic Search

RegulonDB (http:\\/\\/regulondb.ccg.unam.mx\\/) is the primary reference database offering curated knowl- edge of the transcriptional regulatory network of Escherichia coli K12, currently the best-known electronically encoded database of the genetic regulatory network of any free-living organism. This paper summarizes the improvements, new biology and new features available in version 6.0. Curation of original literature is, from now on, up to date

Socorro Gama-castro; Verónica Jiménez-jacinto; Martín Peralta-gil; Alberto Santos-zavaleta; Mónica I. Peńaloza-spínola; Bruno Contreras-moreira; Juan Segura-salazar; Luis Muńiz-rascado; Irma Martínez-flores; Heladia Salgado; César Bonavides-martínez; Cei Abreu-goodger; Carlos Rodríguez Penagos; Juan Miranda-ríos; Enrique Morett; Enrique Merino; Araceli M. Huerta; Luis Trevińo-quintanilla; Julio Collado-vides

2008-01-01

12

RegulonDB (version 6.0): gene regulation model of Escherichia coli K-12 beyond transcription, active (experimental) annotated promoters and Textpresso navigation  

PubMed Central

RegulonDB (http://regulondb.ccg.unam.mx/) is the primary reference database offering curated knowledge of the transcriptional regulatory network of Escherichia coli K12, currently the best-known electronically encoded database of the genetic regulatory network of any free-living organism. This paper summarizes the improvements, new biology and new features available in version 6.0. Curation of original literature is, from now on, up to date for every new release. All the objects are supported by their corresponding evidences, now classified as strong or weak. Transcription factors are classified by origin of their effectors and by gene ontology class. We have now computational predictions for ?54 and five different promoter types of the ?70 family, as well as their corresponding ?10 and ?35 boxes. In addition to those curated from the literature, we added about 300 experimentally mapped promoters coming from our own high-throughput mapping efforts. RegulonDB v.6.0 now expands beyond transcription initiation, including RNA regulatory elements, specifically riboswitches, attenuators and small RNAs, with their known associated targets. The data can be accessed through overviews of correlations about gene regulation. RegulonDB associated original literature, together with more than 4000 curation notes, can now be searched with the Textpresso text mining engine.

Gama-Castro, Socorro; Jimenez-Jacinto, Veronica; Peralta-Gil, Martin; Santos-Zavaleta, Alberto; Penaloza-Spinola, Monica I.; Contreras-Moreira, Bruno; Segura-Salazar, Juan; Muniz-Rascado, Luis; Martinez-Flores, Irma; Salgado, Heladia; Bonavides-Martinez, Cesar; Abreu-Goodger, Cei; Rodriguez-Penagos, Carlos; Miranda-Rios, Juan; Morett, Enrique; Merino, Enrique; Huerta, Araceli M.; Trevino-Quintanilla, Luis; Collado-Vides, Julio

2008-01-01

13

Transcription factor family-based reconstruction of singleton regulons and study of the Crp/Fnr, ArsR, and GntR families in Desulfovibrionales genomes.  

PubMed

Accurate detection of transcriptional regulatory elements is essential for high-quality genome annotation, metabolic reconstruction, and modeling of regulatory networks. We developed a computational approach for reconstruction of regulons operated by transcription factors (TFs) from large protein families and applied this novel approach to three TF families in 10 Desulfovibrionales genomes. Phylogenetic analyses of 125 regulators from the ArsR, Crp/Fnr, and GntR families revealed that 65% of these regulators (termed reference TFs) are well conserved in Desulfovibrionales, while the remaining 35% of regulators (termed singleton TFs) are species specific and show a mosaic distribution. For regulon reconstruction in the group of singleton TFs, the standard orthology-based approach was inefficient, and thus, we developed a novel approach based on the simultaneous study of all homologous TFs from the same family in a group of genomes. As a result, we identified binding for 21 singleton TFs and for all reference TFs in all three analyzed families. Within each TF family we observed structural similarities between DNA-binding motifs of different reference and singleton TFs. The collection of reconstructed regulons is available at the RegPrecise database (http://regprecise.lbl.gov/RegPrecise/Desulfovibrionales.jsp). PMID:23086211

Kazakov, Alexey E; Rodionov, Dmitry A; Price, Morgan N; Arkin, Adam P; Dubchak, Inna; Novichkov, Pavel S

2013-01-01

14

Analyses of the DNA-binding and transcriptional activation properties of ExsA, the transcriptional activator of the Pseudomonas aeruginosa exoenzyme S regulon.  

PubMed Central

ExsA has been implicated as a central regulator of exoenzyme S production by Pseudomonas aeruginosa. In this study, the DNA-binding and transcriptional activation properties of ExsA were investigated. ExsA was produced and purified as a fusion protein, MALA3A2, which was shown to bind specifically to promoter regions that regulated transcription of the exoenzyme S trans-regulatory locus (pC) and a locus located directly downstream of exsA (pD). Previously, MALA3A2 was shown to bind the exoS 5' PstI-NsiI region, which contained two independent but coordinately regulated (ExsA-mediated) promoters, pS' (now termed pORF1) and pS. DNase I footprint analysis of the promoter regions bound by ExsA revealed a common protected consensus sequence of TXAAAAXA. The consensus sequence was located -51 to -52 bp upstream of the transcriptional start sites for pD, pS, and pORF1. Promoter fusion, DNA-binding, and mutagenesis analysis indicated that the consensus sequence was important for transcriptional activation. Each ExsA-controlled promoter region contained at least two consensus sites in close proximity, similar to the arrangement of half-sites seen in AraC-controlled (Escherichia coli) or VirF-controlled (Yersinia enterocolitica) promoters. However, the results of this study suggested that only one consensus site was required in the exoenzyme S (pS) or ORF1 promoter (pORF1) to initiate transcription. These data suggest that members of the exoenzyme S regulon can be defined as possessing an ExsA consensus element which maps at bp -51 or -52 relative to the transcriptional start site.

Hovey, A K; Frank, D W

1995-01-01

15

The PurR regulon in Lactococcus lactis - transcriptional regulation of the purine nucleotide metabolism and translational machinery.  

PubMed

Purine nucleotides are either synthesized de novo from 5-phosphoribosyl-1-pyrophosphate (PRPP) or salvaged from the environment. In Lactococcus lactis, transcription of the de novo synthesis operons, purCSQLF and purDEK, has genetically been shown to be activated by the PurR protein when bound to a conserved PurBox motif present on the DNA at a fixed distance from the promoter -10 element. PurR contains a PRPP-binding site, and activation occurs when the intracellular PRPP pool is high as a consequence of low exogenous purine nucleotide pools. By an iterative approach of bioinformatics searches and motif optimization, 21 PurR-regulated genes were identified and used in a redefinition of the PurBox consensus sequence. In the process a new motif, the double-PurBox, which is present in a number of promoters and contains two partly overlapping PurBox motifs, was established. Transcriptional fusions were used to analyse wild-type promoters and promoters with inactivating PurBox mutations to confirm the relevance of the PurBox motifs as PurR-binding sites. The promoters of several operons were shown to be devoid of any -35 sequence, and found to be completely dependent on PurR-mediated activation. This suggests that binding of the PurR protein to the PurBox takes over the role of the -35 sequence. The study has expanded the PurR regulon to include promoters in nucleotide metabolism, C(1) compound metabolism, phosphonate transport, pyrophosphatase activity, (p)ppGpp metabolism, and translation-related functions. Of special interest is the presence of PurBox motifs in rrn promoters, suggesting a novel connection between nucleotide availability and the translational machinery. PMID:22679106

Jendresen, Christian Bille; Martinussen, Jan; Kilstrup, Mogens

2012-08-01

16

Acidocalcisomes in Apicomplexan parasites.  

PubMed

Acidocalcisomes are acidic calcium stores found in diverse organisms, being conserved from bacteria to man. They posses an acidic matrix that contains several cations bound to phosphates, mainly present in the form of short and long polyphosphate chains. Their matrix is acidified through the action of proton pumps such as a vacuolar proton ATPase and a vacuolar proton pyrophosphatase. The calcium uptake occurs through a Ca2+/H+ counter transporting ATPase located in the membrane of the organelle. Acidocalcisomes have been identified in a variety of microorganisms, including Apicomplexan parasites such as Plasmodium and Eimeria species, and in Toxoplasma gondii. In this paper, we review the structural, biochemical and physiological aspects of acidocalcisomes in Apicomplexan parasites and discuss their functional roles in the maintenance of intracellular ion homeostasis. PMID:17761167

Miranda, Kildare; de Souza, Wanderley; Plattner, Helmut; Hentschel, Joachim; Kawazoe, Urara; Fang, Jianmin; Moreno, Silvia N J

2008-01-01

17

Global Transcriptional and Proteomic Analysis of the Sig1 Heat Shock Regulon of Deinococcus radiodurans  

Microsoft Academic Search

The sig1 gene, predicted to encode an extracytoplasmic function-type heat shock sigma factor of Deinococcus radiodurans, has been shown to play a central role in the positive regulation of the heat shock operons groESL and dnaKJ. To determine if Sig1 is required for the regulation of additional heat shock genes, we monitored the global transcriptional and proteomic profiles of a

Amy K. Schmid; Heather A. Howell; John R. Battista; Scott N. Peterson; Mary E. Lidstrom

2005-01-01

18

RegulonDB version 7.0: transcriptional regulation of Escherichia coli K-12 integrated within genetic sensory response units (Gensor Units)  

PubMed Central

RegulonDB (http://regulondb.ccg.unam.mx/) is the primary reference database of the best-known regulatory network of any free-living organism, that of Escherichia coli K-12. The major conceptual change since 3 years ago is an expanded biological context so that transcriptional regulation is now part of a unit that initiates with the signal and continues with the signal transduction to the core of regulation, modifying expression of the affected target genes responsible for the response. We call these genetic sensory response units, or Gensor Units. We have initiated their high-level curation, with graphic maps and superreactions with links to other databases. Additional connectivity uses expandable submaps. RegulonDB has summaries for every transcription factor (TF) and TF-binding sites with internal symmetry. Several DNA-binding motifs and their sizes have been redefined and relocated. In addition to data from the literature, we have incorporated our own information on transcription start sites (TSSs) and transcriptional units (TUs), obtained by using high-throughput whole-genome sequencing technologies. A new portable drawing tool for genomic features is also now available, as well as new ways to download the data, including web services, files for several relational database manager systems and text files including BioPAX format.

Gama-Castro, Socorro; Salgado, Heladia; Peralta-Gil, Martin; Santos-Zavaleta, Alberto; Muniz-Rascado, Luis; Solano-Lira, Hilda; Jimenez-Jacinto, Veronica; Weiss, Verena; Garcia-Sotelo, Jair S.; Lopez-Fuentes, Alejandra; Porron-Sotelo, Liliana; Alquicira-Hernandez, Shirley; Medina-Rivera, Alejandra; Martinez-Flores, Irma; Alquicira-Hernandez, Kevin; Martinez-Adame, Ruth; Bonavides-Martinez, Cesar; Miranda-Rios, Juan; Huerta, Araceli M.; Mendoza-Vargas, Alfredo; Collado-Torres, Leonardo; Taboada, Blanca; Vega-Alvarado, Leticia; Olvera, Maricela; Olvera, Leticia; Grande, Ricardo; Morett, Enrique; Collado-Vides, Julio

2011-01-01

19

Genome-wide analysis of 3?-untranslated regions supports the existence of post-transcriptional regulons controlling gene expression in trypanosomes  

PubMed Central

In eukaryotic cells, a group of messenger ribonucleic acids (mRNAs) encoding functionally interrelated proteins together with the trans-acting factors that coordinately modulate their expression is termed a post-transcriptional regulon, due to their partial analogy to a prokaryotic polycistron. This mRNA clustering is organized by sequence-specific RNA-binding proteins (RBPs) that bind cis-regulatory elements in the noncoding regions of genes, and mediates the synchronized control of their fate. These recognition motifs are often characterized by conserved sequences and/or RNA structures, and it is likely that various classes of cis-elements remain undiscovered. Current evidence suggests that RNA regulons govern gene expression in trypanosomes, unicellular parasites which mainly use post-transcriptional mechanisms to control protein synthesis. In this study, we used motif discovery tools to test whether groups of functionally related trypanosomatid genes contain a common cis-regulatory element. We obtained conserved structured RNA motifs statistically enriched in the noncoding region of 38 out of 53 groups of metabolically related transcripts in comparison with a random control. These motifs have a hairpin loop structure, a preferred sense orientation and are located in close proximity to the open reading frames. We found that 15 out of these 38 groups represent unique motifs in which most 3?-UTR signature elements were group-specific. Two extensively studied Trypanosoma cruzi RBPs, TcUBP1 and TcRBP3 were found associated with a few candidate RNA regulons. Interestingly, 13 motifs showed a strong correlation with clusters of developmentally co-expressed genes and six RNA elements were enriched in gene clusters affected after hyperosmotic stress. Here we report a systematic genome-wide in silico screen to search for novel RNA-binding sites in transcripts, and describe an organized network of several coordinately regulated cohorts of mRNAs in T. cruzi. Moreover, we found that structured RNA elements are also conserved in other human pathogens. These results support a model of regulation of gene expression by multiple post-transcriptional regulons in trypanosomes.

Carmona, Santiago J.; Aguero, Fernan; Frasch, Alberto C.

2013-01-01

20

Genome-wide analysis of 3'-untranslated regions supports the existence of post-transcriptional regulons controlling gene expression in trypanosomes.  

PubMed

In eukaryotic cells, a group of messenger ribonucleic acids (mRNAs) encoding functionally interrelated proteins together with the trans-acting factors that coordinately modulate their expression is termed a post-transcriptional regulon, due to their partial analogy to a prokaryotic polycistron. This mRNA clustering is organized by sequence-specific RNA-binding proteins (RBPs) that bind cis-regulatory elements in the noncoding regions of genes, and mediates the synchronized control of their fate. These recognition motifs are often characterized by conserved sequences and/or RNA structures, and it is likely that various classes of cis-elements remain undiscovered. Current evidence suggests that RNA regulons govern gene expression in trypanosomes, unicellular parasites which mainly use post-transcriptional mechanisms to control protein synthesis. In this study, we used motif discovery tools to test whether groups of functionally related trypanosomatid genes contain a common cis-regulatory element. We obtained conserved structured RNA motifs statistically enriched in the noncoding region of 38 out of 53 groups of metabolically related transcripts in comparison with a random control. These motifs have a hairpin loop structure, a preferred sense orientation and are located in close proximity to the open reading frames. We found that 15 out of these 38 groups represent unique motifs in which most 3'-UTR signature elements were group-specific. Two extensively studied Trypanosoma cruzi RBPs, TcUBP1 and TcRBP3 were found associated with a few candidate RNA regulons. Interestingly, 13 motifs showed a strong correlation with clusters of developmentally co-expressed genes and six RNA elements were enriched in gene clusters affected after hyperosmotic stress. Here we report a systematic genome-wide in silico screen to search for novel RNA-binding sites in transcripts, and describe an organized network of several coordinately regulated cohorts of mRNAs in T. cruzi. Moreover, we found that structured RNA elements are also conserved in other human pathogens. These results support a model of regulation of gene expression by multiple post-transcriptional regulons in trypanosomes. PMID:23904995

De Gaudenzi, Javier G; Carmona, Santiago J; Agüero, Fernán; Frasch, Alberto C

2013-01-01

21

The R2R3 MYB Transcription Factor DUO1 Activates a Male Germline-Specific Regulon Essential for Sperm Cell Differentiation in Arabidopsis[C][W  

PubMed Central

The male germline in flowering plants arises through asymmetric division of a haploid microspore. The resulting germ cell undergoes mitotic division and specialization to produce the two sperm cells required for double fertilization. The male germline-specific R2R3 MYB transcription factor DUO1 POLLEN1 (DUO1) plays an essential role in sperm cell specification by activating a germline-specific differentiation program. Here, we show that ectopic expression of DUO1 upregulates a significant number (~63) of germline-specific or enriched genes, including those required for fertilization. We validated 14 previously unknown DUO1 target genes by demonstrating DUO1-dependent promoter activity in the male germline. DUO1 is shown to directly regulate its target promoters through binding to canonical MYB sites, suggesting that the DUO1 target genes validated thus far are likely to be direct targets. This work advances knowledge of the DUO1 regulon that encompasses genes with a range of cellular functions, including transcription, protein fate, signaling, and transport. Thus, the DUO1 regulon has a major role in shaping the germline transcriptome and functions to commit progenitor germ cells to sperm cell differentiation.

Borg, Michael; Brownfield, Lynette; Khatab, Hoda; Sidorova, Anna; Lingaya, Melanie; Twell, David

2011-01-01

22

Differential Transcription of the tcpPH Operon Confers Biotype-Specific Control of the Vibrio cholerae ToxR Virulence Regulon  

PubMed Central

Epidemic strains of Vibrio cholerae O1 are divided into two biotypes, classical and El Tor. In both biotypes, regulation of virulence gene expression depends on a cascade in which ToxR activates expression of ToxT, and ToxT activates expression of cholera toxin and other virulence genes. In the classical biotype, maximal expression of this ToxR regulon in vitro occurs at 30°C at pH 6.5 (ToxR-inducing conditions), whereas in the El Tor biotype, production of these virulence genes only occurs under very limited conditions and not in response to temperature and pH; this difference between biotypes is mediated at the level of toxT transcription. In the classical biotype, two other proteins, TcpP and TcpH, are needed for maximal toxT transcription. Transcription of tcpPH in the classical biotype is regulated by pH and temperature independently of ToxR or ToxT, suggesting that TcpP and TcpH couple environmental signals to transcription of toxT. In this study, we show a near absence of tcpPH message in the El Tor biotype under ToxR-inducing conditions of temperature and pH. However, once expressed, El Tor TcpP and TcpH appear to be as effective as classical TcpP and TcpH in activating toxT transcription. These results suggest that differences in regulation of virulence gene expression between the biotypes of V. cholerae primarily result from differences in expression of tcpPH message in response to environmental signals. We present an updated model for control of the ToxR virulence regulon in V. cholerae.

Murley, Yvette M.; Carroll, Patricia A.; Skorupski, Karen; Taylor, Ronald K.; Calderwood, Stephen B.

1999-01-01

23

The global transcriptional response of Bacillus subtilis to manganese involves the MntR, Fur, TnrA and sigmaB regulons.  

PubMed

We have used DNA microarrays to monitor the global transcriptional response of Bacillus subtilis to changes in manganese availability. Mn(II) leads to the MntR-dependent repression of both the mntH and mntABCD operons encoding Mn(II) uptake systems. Mn(II) also represses the Fur regulon. This repression is unlikely to be a direct effect of Mn(II) on Fur as repression is sensitive to 2,2'-dipyridyl, an iron-selective chelator. We suggest that elevated Mn(II) displaces iron from cellular-binding sites and the resulting rise in free iron levels leads to repression of the Fur regulon. Many of the genes induced by Mn(II) are activated by sigmaB or TnrA. Both of these regulators are controlled by Mn(II)-dependent enzymes. Induction of the sigmaB-dependent general stress response by Mn(II) is largely dependent on RsbU, a Mn(II)-dependent phosphatase that dephosphorylates RsbV, ultimately leading to release of active sigmaB from its antisigma, RsbW. The activity of TnrA is inhibited when it forms an inactive complex with feedback-inhibited glutamine synthetase. Elevated Mn(II) reduces the sensitivity of glutamine synthetase to feedback inhibitors, and we suggest that this leads to the observed increase in TnrA activity. In sum, three distinct mechanisms can account for most of the transcriptional effects elicited by manganese: (i) direct binding of Mn(II) to metalloregulators such as MntR, (ii) perturbation of cellular iron pools leading to increased Fur activity and (iii) altered activity of Mn(II)-dependent enzymes that regulate the activity of sigmaB and TnrA. PMID:12950915

Guedon, Emmanuel; Moore, Charles M; Que, Qiang; Wang, Tao; Ye, Rick W; Helmann, John D

2003-09-01

24

Global Analysis of the Regulon of the Transcriptional Repressor LexA, a Key Component of SOS Response in Mycobacterium tuberculosis*  

PubMed Central

The DNA damage response is crucial for bacterial survival. The transcriptional repressor LexA is a key component of the SOS response, the main mechanism for the regulation of DNA repair genes in many bacteria. In contrast, in mycobacteria gene induction by DNA damage is carried out by two mechanisms; a relatively small number of genes are thought to be regulated by LexA, and a larger number by an alternate, independent mechanism. In this study we have used ChIP-seq analysis to identify 25 in vivo LexA-binding sites, including nine regulating genes not previously known to be part of this regulon. Some of these binding sites were found to be internal to the predicted open reading frame of the gene they are thought to regulate; experimental analysis has confirmed that these LexA-binding sites regulate the expression of the expected genes, and transcriptional start site analysis has found that their apparent relative location is due to misannotation of these genes. We have also identified novel binding sites for LexA in the promoters of genes that show no apparent DNA damage induction, show positive regulation by LexA, and those encoding small RNAs.

Smollett, Katherine L.; Smith, Kimberley M.; Kahramanoglou, Christina; Arnvig, Kristine B.; Buxton, Roger S.; Davis, Elaine O.

2012-01-01

25

The dual transcriptional regulator CysR in Corynebacterium glutamicum ATCC 13032 controls a subset of genes of the McbR regulon in response to the availability of sulphide acceptor molecules  

Microsoft Academic Search

BACKGROUND: Regulation of sulphur metabolism in Corynebacterium glutamicum ATCC 13032 has been studied intensively in the last few years, due to its industrial as well as scientific importance. Previously, the gene cg0156 was shown to belong to the regulon of McbR, a global transcriptional repressor of sulphur metabolism in C. glutamicum. This gene encodes a putative ROK-type regulator, a paralogue

Christian Rückert; Johanna Milse; Andreas Albersmeier; Daniel J Koch; Alfred Pühler; Jörn Kalinowski

2008-01-01

26

Quantitative and Qualitative Stem Rust Resistance Factors in Barley Are Associated with Transcriptional Suppression of Defense Regulons  

PubMed Central

Stem rust (Puccinia graminis f. sp. tritici; Pgt) is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99) is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known source of qualitative resistance to this aggressive Pgt race. Segregation for resistance observed on seedlings of the Q21861 × SM89010 (QSM) doubled-haploid (DH) population was found to be predominantly qualitative, with little of the remaining variance explained by loci other than Rpg-TTKSK. In contrast, analysis of adult QSM DH plants infected by field inoculum of Pgt race TTKSK in Njoro, Kenya, revealed several additional quantitative trait loci that contribute to resistance. To molecularly characterize these loci, Barley1 GeneChips were used to measure the expression of 22,792 genes in the QSM population after inoculation with Pgt race TTKSK or mock-inoculation. Comparison of expression Quantitative Trait Loci (eQTL) between treatments revealed an inoculation-dependent expression polymorphism implicating Actin depolymerizing factor3 (within the Rpg-TTKSK locus) as a candidate susceptibility gene. In parallel, we identified a chromosome 2H trans-eQTL hotspot that co-segregates with an enhancer of Rpg-TTKSK-mediated, adult plant resistance discovered through the Njoro field trials. Our genome-wide eQTL studies demonstrate that transcript accumulation of 25% of barley genes is altered following challenge by Pgt race TTKSK, but that few of these genes are regulated by the qualitative Rpg-TTKSK on chromosome 5H. It is instead the chromosome 2H trans-eQTL hotspot that orchestrates the largest inoculation-specific responses, where enhanced resistance is associated with transcriptional suppression of hundreds of genes scattered throughout the genome. Hence, the present study associates the early suppression of genes expressed in this host–pathogen interaction with enhancement of R-gene mediated resistance.

Moscou, Matthew J.; Lauter, Nick; Steffenson, Brian; Wise, Roger P.

2011-01-01

27

Probing key DNA contacts in AraR-mediated transcriptional repression of the Bacillus subtilis arabinose regulon  

PubMed Central

In the absence of arabinose, the AraR transcription factor represses the expression of genes involved in the utilization of arabinose, xylose and galactose in Bacillus subtilis. AraR exhibits a chimeric organization: the N-terminal DNA-binding region belongs to the GntR family and the C-terminal effector-binding domain is homologous to the GalR/LacI family. Here, the AraR–DNA-binding interactions were characterized in vivo and in vitro. The effect of residue substitutions in the AraR N-terminal domain and of base-pair exchanges into an AraR–DNA-binding operator site were examined by assaying for AraR-mediated regulatory activity in vivo and DNA-binding activity in vitro. The results showed that residues K4, R45 and Q61, located in or near the winged-helix DNA-binding motif, were the most critical amino acids required for AraR function. In addition, the analysis of the various mutations in an AraR palindromic operator sequence indicated that bases G9, A11 and T16 are crucial for AraR binding. Moreover, an AraR mutant M34T was isolated that partially suppressed the effect of mutations in the regulatory cis-elements. Together, these findings extend the knowledge on the nature of AraR nucleoprotein complexes and provide insight into the mechanism that underlies the mode of action of AraR and its orthologues.

Franco, Irina Saraiva; Mota, Luis Jaime; Soares, Claudio Manuel; de Sa-Nogueira, Isabel

2007-01-01

28

The PlcR Virulence Regulon of Bacillus cereus  

Microsoft Academic Search

PlcR is a Bacillus cereus transcriptional regulator, which activates gene expression by binding to a nucleotidic sequence called the 'PlcR box'. To build a list of all genes included in the PlcR regulon, a consensus sequence was identified by directed mutagenesis. The reference strain ATCC14579 sequenced genome was searched for occurrences of this consensus sequence to produce a virtual regulon.

Michel Gohar; Karoline Faegri; Stéphane Perchat; Solveig Ravnum; Ole Andreas Řkstad; Myriam Gominet; Anne-Brit Kolstř; Didier Lereclus

2008-01-01

29

Genetic complementation in apicomplexan parasites  

PubMed Central

A robust forward genetic model for Apicomplexa could greatly enhance functional analysis of genes in these important protozoan pathogens. We have developed and successfully tested a genetic complementation strategy based on genomic insertion in Toxoplasma gondii. Adapting recombination cloning to genomic DNA, we show that complementing sequences can be shuttled between parasite genome and bacterial plasmid, providing an efficient tool for the recovery and functional assessment of candidate genes. We show complementation, gene cloning, and biological verification with a mutant parasite lacking hypoxanthine-xanthine-guanine phosphoribosyltransferase and a T. gondii cDNA library. We also explored the utility of this approach to clone genes based on function from other apicomplexan parasites using Toxoplasma as a surrogate. A heterologous library containing Cryptosporidium parvum genomic DNA was generated, and we identified a C. parvum gene coding for inosine 5-monophosphate-dehydrogenase (IMPDH). Interestingly, phylogenetic analysis demonstrates a clear eubacterial origin of this gene and strongly suggests its lateral transfer from ?-proteobacteria. The prokaryotic origin of this enzyme might make it a promising target for therapeutics directed against Cryptosporidium.

Striepen, Boris; White, Michael W.; Li, Catherine; Guerini, Michael N.; Malik, S.-Banoo; Logsdon, John M.; Liu, Chang; Abrahamsen, Mitchell S.

2002-01-01

30

Jumbled genomes: missing Apicomplexan synteny.  

PubMed

Whole-genome comparisons provide insight into genome evolution by informing on gene repertoires, gene gains/losses, and genome organization. Most of our knowledge about eukaryotic genome evolution is derived from studies of multicellular model organisms. The eukaryotic phylum Apicomplexa contains obligate intracellular protist parasites responsible for a wide range of human and veterinary diseases (e.g., malaria, toxoplasmosis, and theileriosis). We have developed an in silico protein-encoding gene based pipeline to investigate synteny across 12 apicomplexan species from six genera. Genome rearrangement between lineages is extensive. Syntenic regions (conserved gene content and order) are rare between lineages and appear to be totally absent across the phylum, with no group of three genes found on the same chromosome and in the same order within 25 kb up- and downstream of any orthologous genes. Conserved synteny between major lineages is limited to small regions in Plasmodium and Theileria/Babesia species, and within these conserved regions, there are a number of proteins putatively targeted to organelles. The observed overall lack of synteny is surprising considering the divergence times and the apparent absence of transposable elements (TEs) within any of the species examined. TEs are ubiquitous in all other groups of eukaryotes studied to date and have been shown to be involved in genomic rearrangements. It appears that there are different criteria governing genome evolution within the Apicomplexa relative to other well-studied unicellular and multicellular eukaryotes. PMID:21504890

DeBarry, Jeremy D; Kissinger, Jessica C

2011-10-01

31

A common red algal origin of the apicomplexan, dinoflagellate, and heterokont plastids.  

PubMed

The discovery of a nonphotosynthetic plastid in malaria and other apicomplexan parasites has sparked a contentious debate about its evolutionary origin. Molecular data have led to conflicting conclusions supporting either its green algal origin or red algal origin, perhaps in common with the plastid of related dinoflagellates. This distinction is critical to our understanding of apicomplexan evolution and the evolutionary history of endosymbiosis and photosynthesis; however, the two plastids are nearly impossible to compare due to their nonoverlapping information content. Here we describe the complete plastid genome sequences and plastid-associated data from two independent photosynthetic lineages represented by Chromera velia and an undescribed alga CCMP3155 that we show are closely related to apicomplexans. These plastids contain a suite of features retained in either apicomplexan (four plastid membranes, the ribosomal superoperon, conserved gene order) or dinoflagellate plastids (form II Rubisco acquired by horizontal transfer, transcript polyuridylylation, thylakoids stacked in triplets) and encode a full collective complement of their reduced gene sets. Together with whole plastid genome phylogenies, these characteristics provide multiple lines of evidence that the extant plastids of apicomplexans and dinoflagellates were inherited by linear descent from a common red algal endosymbiont. Our phylogenetic analyses also support their close relationship to plastids of heterokont algae, indicating they all derive from the same endosymbiosis. Altogether, these findings support a relatively simple path of linear descent for the evolution of photosynthesis in a large proportion of algae and emphasize plastid loss in several lineages (e.g., ciliates, Cryptosporidium, and Phytophthora). PMID:20534454

Janouskovec, Jan; Horák, Ales; Oborník, Miroslav; Lukes, Julius; Keeling, Patrick J

2010-06-15

32

DNA topoisomerases in apicomplexan parasites: promising targets for drug discovery  

PubMed Central

The phylum Apicomplexa includes a large group of protozoan parasites responsible for a wide range of animal and human diseases. Destructive pathogens, such as Plasmodium falciparum and Plasmodium vivax, causative agents of human malaria, Cryptosporidium parvum, responsible of childhood diarrhoea, and Toxoplasma gondii, responsible for miscarriages and abortions in humans, are frequently associated with HIV immunosuppression in AIDS patients. The lack of effective vaccines, along with years of increasing pressure to eradicate outbreaks with the use of drugs, has favoured the formation of multi-drug resistant strains in endemic areas. Almost all apicomplexan of medical interest contain two endosymbiotic organelles that contain their own mitochondrial and apicoplast DNA. Apicoplast is an attractive target for drug testing because in addition to harbouring singular metabolic pathways absent in the host, it also has its own transcription and translation machinery of bacterial origin. Accordingly, apicomplexan protozoa contain an interesting mixture of enzymes to unwind DNA from eukaryotic and prokaryotic origins. On the one hand, the main mechanism of DNA unwinding includes the scission of one—type I—or both DNA strands—type II eukaryotic topoisomerases, establishing transient covalent bonds with the scissile end. These enzymes are targeted by camptothecin and etoposide, respectively, two natural drugs whose semisynthetic derivatives are currently used in cancer chemotherapy. On the other hand, DNA gyrase is a bacterial-borne type II DNA topoisomerase that operates within the apicoplast and is effectively targeted by bacterial antibiotics like fluoroquinolones and aminocoumarins. The present review is an update on the new findings concerning topoisomerases in apicomplexan parasites and the role of these enzymes as targets for therapeutic agents.

Garcia-Estrada, Carlos; Prada, Christopher Fernandez; Fernandez-Rubio, Celia; Rojo-Vazquez, Francisco; Balana-Fouce, Rafael

2010-01-01

33

PePPER: a webserver for prediction of prokaryote promoter elements and regulons  

PubMed Central

Background Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison algorithms are currently available for identifying transcription factor binding sites (TFBSs) and their accompanying TFs and regulon members. Results We here extend the current databases of TFs, TFBSs and regulons with our knowledge on Lactococcus lactis and developed a webserver for prediction, mining and visualization of prokaryote promoter elements and regulons via a novel concept. This new approach includes an all-in-one method of data mining for TFs, TFBSs, promoters, and regulons for any bacterial genome via a user-friendly webserver. We demonstrate the power of this method by mining WalRK regulons in Lactococci and Streptococci and, vice versa, use L. lactis regulon data (CodY) to mine closely related species. Conclusions The PePPER webserver offers, besides the all-in-one analysis method, a toolbox for mining for regulons, promoters and TFBSs and accommodates a new L. lactis regulon database in addition to already existing regulon data. Identification of putative regulons and full annotation of intergenic regions in any bacterial genome on the basis of existing knowledge on a related organism can now be performed by biologists and it can be done for a wide range of regulons. On the basis of the PePPER output, biologist can design experiments to further verify the existence and extent of the proposed regulons. The PePPER webserver is freely accessible at http://pepper.molgenrug.nl.

2012-01-01

34

Characterization of the GbdR Regulon in Pseudomonas aeruginosa  

PubMed Central

Pseudomonas aeruginosa displays tremendous metabolic diversity, controlled in part by the abundance of transcription regulators in the genome. We have been investigating P. aeruginosa's response to the host, particularly changes regulated by the host-derived quaternary amines choline and glycine betaine (GB). We previously identified GbdR as an AraC family transcription factor that directly regulates choline acquisition from host phospholipids (via binding to plcH and pchP promoters), is required for catabolism of the choline metabolite GB, and is an activator that induces transcription in response to GB or dimethylglycine. Our goal was to characterize the GbdR regulon in P. aeruginosa by using genetics and chemical biology in combination with transcriptomics and in vitro DNA-binding assays. Here we show that GbdR activation regulates transcription of 26 genes from 12 promoters, 11 of which have measureable binding to GbdR in vitro. The GbdR regulon includes the genes encoding GB, dimethylglycine, sarcosine, glycine, and serine catabolic enzymes and the BetX and CbcXWV quaternary amine transport proteins. We characterized the GbdR consensus binding site and used it to identify that the recently characterized acetylcholine esterase gene, choE (PA4921), is also regulated by GbdR. The regulon member not directly controlled by GbdR is the secreted lipase gene lipA, which was also the only regulon member repressed under GbdR-activating conditions. Determination of the GbdR regulon provides deeper understanding of how GbdR links bacterial metabolism and virulence. Additionally, identification of two uncharacterized regulon members suggests roles for these proteins in response to choline metabolites.

Hampel, Ken J.; LaBauve, Annette E.; Meadows, Jamie A.; Fitzsimmons, Liam F.; Nock, Adam M.

2014-01-01

35

Transcript analysis reveals an extended regulon and the importance of protein-protein co-operativity for the Escherichia coli methionine repressor  

PubMed Central

We have used DNA arrays to investigate the effects of knocking out the methionine repressor gene, metJ, on the Escherichia coli transcriptome. We assayed the effects in the knockout strain of supplying wild-type or mutant MetJ repressors from an expression plasmid, thus establishing a rapid assay for in vivo effects of mutations characterized previously in vitro. Repression is largely restricted to known genes involved in the biosynthesis and uptake of methionine. However, we identified a number of additional genes that are significantly up-regulated in the absence of repressor. Sequence analysis of the 5? promoter regions of these genes identified plausible matches to met-box sequences for three of these, and subsequent electrophoretic mobility-shift assay analysis showed that for two such loci their repressor affinity is higher than or comparable with the known metB operator, suggesting that they are directly regulated. This can be rationalized for one of the loci, folE, by the metabolic role of its encoded enzyme; however, the links to the other regulated loci are unclear, suggesting both an extension to the known met regulon and additional complexity to the role of the repressor. The plasmid gene replacement system has been used to examine the importance of protein–protein co-operativity in operator saturation using the structurally characterized mutant repressor, Q44K. In vivo, there are detectable reductions in the levels of regulation observed, demonstrating the importance of balancing protein–protein and protein–DNA affinity.

Marincs, Ferenc; Manfield, Iain W.; Stead, Jonathan A.; Mcdowall, Kenneth J.; Stockley, Peter G.

2006-01-01

36

Horizontal gene transfer of epigenetic machinery and evolution of parasitism in the malaria parasite Plasmodium falciparum and other apicomplexans  

PubMed Central

Background The acquisition of complex transcriptional regulatory abilities and epigenetic machinery facilitated the transition of the ancestor of apicomplexans from a free-living organism to an obligate parasite. The ability to control sophisticated gene expression patterns enabled these ancient organisms to evolve several differentiated forms, invade multiple hosts and evade host immunity. How these abilities were acquired remains an outstanding question in protistan biology. Results In this work, we study SET domain bearing genes that are implicated in mediating immune evasion, invasion and cytoadhesion pathways of modern apicomplexans, including malaria parasites. We provide the first conclusive evidence of a horizontal gene transfer of a Histone H4 Lysine 20 (H4K20) modifier, Set8, from an animal host to the ancestor of apicomplexans. Set8 is known to contribute to the coordinated expression of genes involved in immune evasion in modern apicomplexans. We also show the likely transfer of a H3K36 methyltransferase (Ashr3 from plants), possibly derived from algal endosymbionts. These transfers appear to date to the transition from free-living organisms to parasitism and coincide with the proposed horizontal acquisition of cytoadhesion domains, the O-glycosyltransferase that modifies these domains, and the primary family of transcription factors found in apicomplexan parasites. Notably, phylogenetic support for these conclusions is robust and the genes clearly are dissimilar to SET sequences found in the closely related parasite Perkinsus marinus, and in ciliates, the nearest free-living organisms with complete genome sequences available. Conclusions Animal and plant sources of epigenetic machinery provide new insights into the evolution of parasitism in apicomplexans. Along with the horizontal transfer of cytoadhesive domains, O-linked glycosylation and key transcription factors, the acquisition of SET domain methyltransferases marks a key transitional event in the evolution to parasitism in this important protozoan lineage.

2013-01-01

37

Library of Apicomplexan Metabolic Pathways: a manually curated database for metabolic pathways of apicomplexan parasites  

PubMed Central

The Library of Apicomplexan Metabolic Pathways (LAMP, http://www.llamp.net) is a web database that provides near complete mapping from genes to the central metabolic functions for some of the prominent intracellular parasites of the phylum Apicomplexa. This phylum includes the causative agents of malaria, toxoplasmosis and theileriosis—diseases with a huge economic and social impact. A number of apicomplexan genomes have been sequenced, but the accurate annotation of gene function remains challenging. We have adopted an approach called metabolic reconstruction, in which genes are systematically assigned to functions within pathways/networks for Toxoplasma gondii, Neospora caninum, Cryptosporidium and Theileria species, and Babesia bovis. Several functions missing from pathways have been identified, where the corresponding gene for an essential process appears to be absent from the current genome annotation. For each species, LAMP contains interactive diagrams of each pathway, hyperlinked to external resources and annotated with detailed information, including the sources of evidence used. We have also developed a section to highlight the overall metabolic capabilities of each species, such as the ability to synthesize or the dependence on the host for a particular metabolite. We expect this new database will become a valuable resource for fundamental and applied research on the Apicomplexa.

Shanmugasundram, Achchuthan; Gonzalez-Galarza, Faviel F.; Wastling, Jonathan M.; Vasieva, Olga; Jones, Andrew R.

2013-01-01

38

Tracking Transmission of Apicomplexan Symbionts in Diverse Caribbean Corals  

PubMed Central

Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are consistent with those of other scleractinian coral symbionts. While this study furthers knowledge regarding these symbionts, numerous questions remain to be addressed, particularly in regard to the specific interaction(s) between these apicomplexans and their hosts.

Kirk, Nathan L.; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W.; Fogarty, Nicole D.; Santos, Scott R.

2013-01-01

39

Tracking transmission of apicomplexan symbionts in diverse Caribbean corals.  

PubMed

Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are consistent with those of other scleractinian coral symbionts. While this study furthers knowledge regarding these symbionts, numerous questions remain to be addressed, particularly in regard to the specific interaction(s) between these apicomplexans and their hosts. PMID:24260438

Kirk, Nathan L; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W; Fogarty, Nicole D; Santos, Scott R

2013-01-01

40

Environmental distribution of coral-associated relatives of apicomplexan parasites  

PubMed Central

A lineage of plastid-bearing eukaryotic microbes that is closely related to apicomplexan parasites was recently found in a specific association with coral reefs (apicomplexan-related lineage-V, or ARL-V). Here, we address the possible nature of this association using plastid ‘contamination' in fine-scale bacterial sequence surveys. In a transect between corals and associated macroalgae, ARL-V is specifically associated with the coral, in contrast to all microalgal types (including diatoms, haptophytes, pelagophytes and photosynthetic apicomplexan relatives, Chromera and Vitrella), which are associated with macroalgae. ARL-V is associated with at least 20 species of symbiotic corals through extended time periods and large geographic distances. It is significantly enriched in healthy coral tissue and shallow reef depths. Altogether, the evidence points to a specific relationship between ARL-V and corals, and is suggestive of symbiosis, perhaps based on photosynthesis.

Janouskovec, Jan; Horak, Ales; Barott, Katie L; Rohwer, Forest L; Keeling, Patrick J

2013-01-01

41

Directing differentiation in Theileria annulata: old methods and new possibilities for control of apicomplexan parasites  

Microsoft Academic Search

Apicomplexan parasites are major pathogens of humans and domesticated animals. The ability of these organisms to evade the host immune response and the emergence of drug-resistant parasites indicates a need for the identification of novel control strategies. Ideally, selected targets should be shared by a range of apicomplexans and fundamental to parasite biology. One process of apicomplexan biology which may

Brian Shiels; David Swan; Sue McKellar; Nasreen Aslam; Caroline Dando; Mark Fox; Leila Ben-Miled; Jane Kinnaird

1998-01-01

42

Targeting Purine and Pyrimidine Metabolism in Human Apicomplexan Parasites  

PubMed Central

Synthesis de novo, acquisition by salvage and interconversion of purines and pyrimidines represent the fundamental requirements for their eventual assembly into nucleic acids as nucleotides and the deployment of their derivatives in other biochemical pathways. A small number of drugs targeted to nucleotide metabolism, by virtue of their effect on folate biosynthesis and recycling, have been successfully used against apicomplexan parasites such as Plasmodium and Toxoplasma for many years, although resistance is now a major problem in the prevention and treatment of malaria. Many targets not involving folate metabolism have also been explored at the experimental level. However, the unravelling of the genome sequences of these eukaryotic unicellular organisms, together with increasingly sophisticated molecular analyses, opens up possibilities of introducing new drugs that could interfere with these processes. This review examines the status of established drugs of this type and the potential for further exploiting the vulnerability of apicomplexan human pathogens to inhibition of this key area of metabolism.

Hyde, John E.

2009-01-01

43

Apicomplexan parasites of red foxes ( Vulpes vulpes ) in northeastern Poland  

Microsoft Academic Search

Molecular detection of apicomplexan parasites in splenic samples of red foxes collected from northeastern Poland was conducted\\u000a by PCR amplification of a fragment of the 18S rRNA spanning the V4 gene region of Apicomplexa. Positive PCR products were\\u000a further analysed by restriction fragment length polymorphism (RFLP) and sequencing to identify species. One hundred and eleven\\u000a red foxes (Vulpes vulpes) were

Grzegorz Karbowiak; Viktória Majláthová; Joanna Hapunik; Branislav Pet’ko; Irena Wita

2010-01-01

44

A Novel Candidate Vaccine for Cytauxzoonosis Inferred from Comparative Apicomplexan Genomics  

PubMed Central

Cytauxzoonosis is an emerging infectious disease of domestic cats (Felis catus) caused by the apicomplexan protozoan parasite Cytauxzoon felis. The growing epidemic, with its high morbidity and mortality points to the need for a protective vaccine against cytauxzoonosis. Unfortunately, the causative agent has yet to be cultured continuously in vitro, rendering traditional vaccine development approaches beyond reach. Here we report the use of comparative genomics to computationally and experimentally interpret the C. felis genome to identify a novel candidate vaccine antigen for cytauxzoonosis. As a starting point we sequenced, assembled, and annotated the C. felis genome and the proteins it encodes. Whole genome alignment revealed considerable conserved synteny with other apicomplexans. In particular, alignments with the bovine parasite Theileria parva revealed that a C. felis gene, cf76, is syntenic to p67 (the leading vaccine candidate for bovine theileriosis), despite a lack of significant sequence similarity. Recombinant subdomains of cf76 were challenged with survivor-cat antiserum and found to be highly seroreactive. Comparison of eleven geographically diverse samples from the south-central and southeastern USA demonstrated 91–100% amino acid sequence identity across cf76, including a high level of conservation in an immunogenic 226 amino acid (24 kDa) carboxyl terminal domain. Using in situ hybridization, transcription of cf76 was documented in the schizogenous stage of parasite replication, the life stage that is believed to be the most important for development of a protective immune response. Collectively, these data point to identification of the first potential vaccine candidate antigen for cytauxzoonosis. Further, our bioinformatic approach emphasizes the use of comparative genomics as an accelerated path to developing vaccines against experimentally intractable pathogens.

Tarigo, Jaime L.; Scholl, Elizabeth H.; Bird, David McK.; Brown, Corrie C.; Cohn, Leah A.; Dean, Gregg A.; Levy, Michael G.; Doolan, Denise L.; Trieu, Angela; Nordone, Shila K.; Felgner, Philip L.; Vigil, Adam; Birkenheuer, Adam J.

2013-01-01

45

Identification of the CRE-1 Cellulolytic Regulon in Neurospora crassa  

PubMed Central

Background In filamentous ascomycete fungi, the utilization of alternate carbon sources is influenced by the zinc finger transcription factor CreA/CRE-1, which encodes a carbon catabolite repressor protein homologous to Mig1 from Saccharomyces cerevisiae. In Neurospora crassa, deletion of cre-1 results in increased secretion of amylase and ?-galactosidase. Methodology/Principal Findings Here we show that a strain carrying a deletion of cre-1 has increased cellulolytic activity and increased expression of cellulolytic genes during growth on crystalline cellulose (Avicel). Constitutive expression of cre-1 complements the phenotype of a N. crassa ?cre-1 strain grown on Avicel, and also results in stronger repression of cellulolytic protein secretion and enzyme activity. We determined the CRE-1 regulon by investigating the secretome and transcriptome of a ?cre-1 strain as compared to wild type when grown on Avicel versus minimal medium. Chromatin immunoprecipitation-PCR of putative target genes showed that CRE-1 binds to only some adjacent 5?-SYGGRG-3? motifs, consistent with previous findings in other fungi, and suggests that unidentified additional regulatory factors affect CRE-1 binding to promoter regions. Characterization of 30 mutants containing deletions in genes whose expression level increased in a ?cre-1 strain under cellulolytic conditions identified novel genes that affect cellulase activity and protein secretion. Conclusions/Significance Our data provide comprehensive information on the CRE-1 regulon in N. crassa and contribute to deciphering the global role of carbon catabolite repression in filamentous ascomycete fungi during plant cell wall deconstruction.

Sun, Jianping; Glass, N. Louise

2011-01-01

46

N-Acetylgalactosamine Utilization Pathway and Regulon in Proteobacteria  

PubMed Central

We used a comparative genomics approach to reconstruct the N-acetyl-d-galactosamine (GalNAc) and galactosamine (GalN) utilization pathways and transcriptional regulons in Proteobacteria. The reconstructed GalNAc/GalN utilization pathways include multiple novel genes with specific functional roles. Most of the pathway variations were attributed to the amino sugar transport, phosphorylation, and deacetylation steps, whereas the downstream catabolic enzymes in the pathway were largely conserved. The predicted GalNAc kinase AgaK, the novel variant of GalNAc-6-phosphate deacetylase AgaAII and the GalN-6-phosphate deaminase AgaS from Shewanella sp. ANA-3 were validated in vitro using individual enzymatic assays and reconstitution of the three-step pathway. By using genetic techniques, we confirmed that AgaS but not AgaI functions as the main GalN-6-P deaminase in the GalNAc/GalN utilization pathway in Escherichia coli. Regulons controlled by AgaR repressors were reconstructed by bioinformatics in most proteobacterial genomes encoding GalNAc pathways. Candidate AgaR-binding motifs share a common sequence with consensus CTTTC that was found in multiple copies and arrangements in regulatory regions of aga genes. This study provides comprehensive insights into the common and distinctive features of the GalNAc/GalN catabolism and its regulation in diverse Proteobacteria.

Leyn, Semen A.; Gao, Fang; Yang, Chen; Rodionov, Dmitry A.

2012-01-01

47

Definition of the ?W Regulon of Bacillus subtilis in the Absence of Stress  

PubMed Central

Bacteria employ extracytoplasmic function (ECF) sigma factors for their responses to environmental stresses. Despite intensive research, the molecular dissection of ECF sigma factor regulons has remained a major challenge due to overlaps in the ECF sigma factor-regulated genes and the stimuli that activate the different ECF sigma factors. Here we have employed tiling arrays to single out the ECF ?W regulon of the Gram-positive bacterium Bacillus subtilis from the overlapping ECF ?X, ?Y, and ?M regulons. For this purpose, we profiled the transcriptome of a B. subtilis sigW mutant under non-stress conditions to select candidate genes that are strictly ?W-regulated. Under these conditions, ?W exhibits a basal level of activity. Subsequently, we verified the ?W-dependency of candidate genes by comparing their transcript profiles to transcriptome data obtained with the parental B. subtilis strain 168 grown under 104 different conditions, including relevant stress conditions, such as salt shock. In addition, we investigated the transcriptomes of rasP or prsW mutant strains that lack the proteases involved in the degradation of the ?W anti-sigma factor RsiW and subsequent activation of the ?W-regulon. Taken together, our studies identify 89 genes as being strictly ?W-regulated, including several genes for non-coding RNAs. The effects of rasP or prsW mutations on the expression of ?W-dependent genes were relatively mild, which implies that ?W-dependent transcription under non-stress conditions is not strictly related to RasP and PrsW. Lastly, we show that the pleiotropic phenotype of rasP mutant cells, which have defects in competence development, protein secretion and membrane protein production, is not mirrored in the transcript profile of these cells. This implies that RasP is not only important for transcriptional regulation via ?W, but that this membrane protease also exerts other important post-transcriptional regulatory functions.

Zweers, Jessica C.; Nicolas, Pierre; Wiegert, Thomas; van Dijl, Jan Maarten; Denham, Emma L.

2012-01-01

48

Species- and Strain-Specific Control of a Complex, Flexible Regulon by Bordetella BvgAS†  

PubMed Central

The Bordetella master virulence regulatory system, BvgAS, controls a spectrum of gene expression states, including the virulent Bvg+ phase, the avirulent Bvg? phase, and at least one Bvg-intermediate (Bvgi) phase. We set out to define the species- and strain-specific features of this regulon based on global gene expression profiling. Rather than functioning as a switch, Bvg controls a remarkable continuum of gene expression states, with hundreds of genes maximally expressed in intermediate phases between the Bvg+ and Bvg? poles. Comparative analysis of Bvg regulation in B. pertussis and B. bronchiseptica revealed a relatively conserved Bvg+ phase transcriptional program and identified previously uncharacterized candidate virulence factors. In contrast, control of Bvg?- and Bvgi-phase genes diverged substantially between species; regulation of metabolic, transporter, and motility loci indicated an increased capacity in B. bronchiseptica, compared to B. pertussis, for ex vivo adaptation. Strain comparisons also demonstrated variation in gene expression patterns within species. Among the genes with the greatest variability in patterns of expression, predicted promoter sequences were nearly identical. Our data suggest that the complement of transcriptional regulators is largely responsible for transcriptional diversity. In support of this hypothesis, many putative transcriptional regulators that were Bvg regulated in B. bronchiseptica were deleted, inactivated, or unregulated by BvgAS in B. pertussis. We propose the concept of a “flexible regulon.” This flexible regulon may prove to be important for pathogen evolution and the diversification of host range specificity.

Cummings, C. A.; Bootsma, H. J.; Relman, D. A.; Miller, J. F.

2006-01-01

49

Microarray Analysis of the Ler Regulon in Enteropathogenic and Enterohaemorrhagic Escherichia coli Strains  

PubMed Central

The type III protein secretion system is an important pathogenicity factor of enteropathogenic and enterohaemorrhagic Escherichia coli pathotypes. The genes encoding this apparatus are located on a pathogenicity island (the locus of enterocyte effacement) and are transcriptionally activated by the master regulator Ler. In each pathotype Ler is also known to regulate genes located elsewhere on the chromosome, but the full extent of the Ler regulon is unclear, especially for enteropathogenic E. coli. The Ler regulon was defined for two strains of E. coli: E2348/69 (enteropathogenic) and EDL933 (enterohaemorrhagic) in mid and late log phases of growth by DNA microarray analysis of the transcriptomes of wild-type and ler mutant versions of each strain. In both strains the Ler regulon is focused on the locus of enterocyte effacement – all major transcriptional units of which are activated by Ler, with the sole exception of the LEE1 operon during mid-log phase growth in E2348/69. However, the Ler regulon does extend more widely and also includes unlinked pathogenicity genes: in E2348/69 more than 50 genes outside of this locus were regulated, including a number of known or potential pathogenicity determinants; in EDL933 only 4 extra-LEE genes, again including known pathogenicity factors, were activated. In E2348/69, where the Ler regulon is clearly growth phase dependent, a number of genes including the plasmid-encoded regulator operon perABC, were found to be negatively regulated by Ler. Negative regulation by Ler of PerC, itself a positive regulator of the ler promoter, suggests a negative feedback loop involving these proteins.

Shaw, Robert K.; Islam, Md. Shahidul; Patel, Mala; Snyder, Lori A. S.; Lee, David J.; Penn, Charles W.; Busby, Stephen J. W.; Pallen, Mark J.

2014-01-01

50

Conservation of the Pho regulon in Pseudomonas fluorescens Pf0-1  

PubMed Central

The Pho regulon integrates the sensing of environmental inorganic phosphate (Pi) availability with coregulation of gene expression, mediating an adaptive response to Pi limitation. Many aspects of the Pho regulon have been addressed in studies of Escherichia coli; however, it is unclear how transferable this knowledge is to other bacterial systems. Here, we report work to discern the conservation of the Pho regulon in Pseudomonas fluorescens Pf0-1. We demonstrate by mutational studies that PhoB/PhoR and the Pst system have conserved functions in the regulation of Pi-induced phosphatase activities, as well as expression of other Pi-regulated genes. A genetic screen was carried out to isolate factors that affect Pho-regulated phosphatase activity. We identified the Pho-regulated phosphatases PhoX and PhoD and present evidence that these enzymes are exported via the Tat system. The phoX and phoD genes were shown to be members of the Pho regulon by reverse transcription-PCR, as well as by functional assessment of putative PhoB binding sites (Pho boxes). Our data also suggested that at least one other non-Tat-secreted Pho-regulated phosphatase exists. From the genetic screen, numerous siderophore mutants that displayed severe defects in Pho-activated phosphatase activity were isolated. Subsequently, iron was shown to be important for modulating the activity of Pho-regulated phosphatases, but it does not regulate this activity at the level of transcription. We also identify and demonstrate a novel role in siderophore production and Pho-regulated phosphatase activity for ApaH, the hydrolase for the nucleotide-signaling molecule AppppA. Finally, numerous mutations in multiple cellular pathways were recovered that may be required for maximal induction of the Pho regulon under Pi-limiting conditions.

Monds, Russell D.; Newell, Peter D.; Schwartzman, Julia A.; O'Toole, George A.

2006-01-01

51

Anaerobic adaptation in Pseudomonas aeruginosa: definition of the Anr and Dnr regulons.  

PubMed

The anaerobic metabolism of the opportunistic pathogen Pseudomonas aeruginosa is important for growth and biofilm formation during persistent infections. The two Fnr-type transcription factors Anr and Dnr regulate different parts of the underlying network in response to oxygen tension and NO. Little is known about all members of the Anr and Dnr regulons and the mediated immediate response to oxygen depletion. Comprehensive transcriptome and bioinformatics analyses in combination with a limited proteome analyses were used for the investigation of the P. aeruginosa response to an immediate oxygen depletion and for definition of the corresponding Anr and Dnr regulons. We observed at first the activation of fermentative pathways for immediate energy generation followed by induction of alternative respiratory chains. A solid position weight matrix model was deduced from the experimentally identified Anr boxes and used for identification of 170 putative Anr boxes in potential P. aeruginosa promoter regions. The combination with the experimental data unambiguously identified 130 new members for the Anr and Dnr regulons. The basis for the understanding of two regulons of P. aeruginosa central to biofilm formation and infection is now defined. PMID:20553552

Trunk, Katharina; Benkert, Beatrice; Quäck, Nicole; Münch, Richard; Scheer, Maurice; Garbe, Julia; Jänsch, Lothar; Trost, Matthias; Wehland, Jürgen; Buer, Jan; Jahn, Martina; Schobert, Max; Jahn, Dieter

2010-06-01

52

Genome Sequence of Babesia bovis and Comparative Analysis of Apicomplexan Hemoprotozoa  

Microsoft Academic Search

Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related apicomplexan hemoprotozoa Theileria parva and Plasmodium falciparum. At 8.2 Mbp, the B. bovis genome is similar in size

Kelly A. Brayton; Audrey O. T. Lau; David R. Herndon; Linda Hannick; Lowell S. Kappmeyer; Shawn J. Berens; Shelby L. Bidwell; Wendy C. Brown; Jonathan Crabtree; Doug Fadrosh; Tamara Feldblum; Heather A. Forberger; Brian J. Haas; Jeanne M. Howell; Hoda Khouri; Hean Koo; David J. Mann; Junzo Norimine; Ian T. Paulsen; Diana Radune; Qinghu Ren; Roger K. Smith Jr; Carlos E. Suarez; Owen White; Jennifer R. Wortman; Donald P. Knowles Jr; Terry F. McElwain; Vishvanath M. Nene

2007-01-01

53

DNA Microarray and Proteomic Analyses of the RpoS Regulon in Geobacter sulfurreducens  

Microsoft Academic Search

The regulon of the sigma factor RpoS was defined in Geobacter sulfurreducens by using a combination of DNA microarray expression profiles and proteomics. An rpoS mutant was examined under steady-state conditions with acetate as an electron donor and fumarate as an electron acceptor and with additional transcriptional profiling using Fe(III) as an electron acceptor. Expression analysis revealed that RpoS acts

Cinthia Nunez; Abraham Esteve-Nunez; Carol Giometti; Sandra Tollaksen; Tripti Khare; Winston Lin; Derek R. Lovley; Barbara A. Methe

2006-01-01

54

Evidence classification of high-throughput protocols and confidence integration in RegulonDB  

PubMed Central

RegulonDB provides curated information on the transcriptional regulatory network of Escherichia coli and contains both experimental data and computationally predicted objects. To account for the heterogeneity of these data, we introduced in version 6.0, a two-tier rating system for the strength of evidence, classifying evidence as either ‘weak’ or ‘strong’ (Gama-Castro,S., Jimenez-Jacinto,V., Peralta-Gil,M. et al. RegulonDB (Version 6.0): gene regulation model of Escherichia Coli K-12 beyond transcription, active (experimental) annotated promoters and textpresso navigation. Nucleic Acids Res., 2008;36:D120–D124.). We now add to our classification scheme the classification of high-throughput evidence, including chromatin immunoprecipitation (ChIP) and RNA-seq technologies. To integrate these data into RegulonDB, we present two strategies for the evaluation of confidence, statistical validation and independent cross-validation. Statistical validation involves verification of ChIP data for transcription factor-binding sites, using tools for motif discovery and quality assessment of the discovered matrices. Independent cross-validation combines independent evidence with the intention to mutually exclude false positives. Both statistical validation and cross-validation allow to upgrade subsets of data that are supported by weak evidence to a higher confidence level. Likewise, cross-validation of strong confidence data extends our two-tier rating system to a three-tier system by introducing a third confidence score ‘confirmed’. Database URL: http://regulondb.ccg.unam.mx/

Weiss, Verena; Medina-Rivera, Alejandra; Huerta, Araceli M.; Santos-Zavaleta, Alberto; Salgado, Heladia; Morett, Enrique; Collado-Vides, Julio

2013-01-01

55

Identification of the operator of the lux regulon from the Vibrio fischeri strain ATCC7744.  

PubMed Central

Escherichia coli that carry a recombinant plasmid bearing the Vibrio fischeri lux regulon express luminescence that mimics the luminescence of V. fischeri. The lux regulon consists of two divergently transcribed operons, the rightward operon (luxICDABE genes) and the leftward operon (luxR gene). The luxR and luxI genes and the control region separating the two operons supply the primary regulatory control over the lux regulon; the regulatory mechanisms result in a dramatic increase in the rate of luciferase synthesis after induction, apparently due to a unique autoregulatory positive feedback mechanism, and in an enormous difference (greater than 10(4] in levels of luminescence in cells before and after induction. The generally accepted model of primary regulation of bioluminescence in V. fischeri involves the interaction of the product of the luxR gene and N-(3-oxohexanoyl)homoserine lactone, the autoinducer produced by the enzyme encoded by luxI, the first gene of the rightward operon, with an operator sequence within the control region to stimulate transcription of the rightward operon in a positive feedback loop. We have used deletion mapping of a transcription reporter vector to determine the approximate location of the operator. By site-directed mutagenesis of the presumed operator, we have demonstrated that the 20-base-pair inverted repeat ACCTGTAGGA/TCGTA CAGGT (where the vertical line is the center of symmetry), which bears striking similarity to the recognition sequence for the pleiotropic repressor protein LexA, is the operator of the lux regulon. We also found that deletion of sequences upstream of the palindrome leads to increased transcription from the rightward promoter (PR), indicative of a cis-acting element that represses transcription in the absence of the LuxR-autoinducer complex. Modifications of the palindrome that eliminate stimulation by LuxR-autoinducer of transcription from PR have no effect on repression by the cis-acting mechanism(s), suggesting that the palindrome is not necessary for repression of the rightward operon. Thus, it appears that the large increase in transcription upon induction of the lux regulon is the result of at least two independent mechanisms, one positive and the other negative.

Devine, J H; Shadel, G S; Baldwin, T O

1989-01-01

56

Unique Roles of DosT and DosS in DosR Regulon Induction and Mycobacterium tuberculosis Dormancy ? †  

PubMed Central

In Mycobacterium tuberculosis, the sensor kinases DosT and DosS activate the transcriptional regulator DosR, resulting in the induction of the DosR regulon, which is important for anaerobic survival and perhaps latent infection. The individual and collective roles of these sensors have been postulated biochemically, but their roles in vivo have remained unclear. This work demonstrates distinct and additive roles for each sensor during anaerobic dormancy. Both sensors are necessary for wild-type levels of DosR regulon induction, and concomitantly, full induction of the regulon is required for wild-type anaerobic survival. In the anaerobic model, DosT plays an early role, responding to hypoxia. DosT then induces the regulon and with it DosS, which sustains and further induces the regulon. DosT then loses its functionality as oxygen becomes limited, and DosS alone maintains induction of the genes from that point forward. Thus, M. tuberculosis has evolved a system whereby it responds to hypoxic conditions in a stepwise fashion as it enters an anaerobic state.

Honaker, Ryan W.; Leistikow, Rachel L.; Bartek, Iona L.; Voskuil, Martin I.

2009-01-01

57

Unique roles of DosT and DosS in DosR regulon induction and Mycobacterium tuberculosis dormancy.  

PubMed

In Mycobacterium tuberculosis, the sensor kinases DosT and DosS activate the transcriptional regulator DosR, resulting in the induction of the DosR regulon, which is important for anaerobic survival and perhaps latent infection. The individual and collective roles of these sensors have been postulated biochemically, but their roles in vivo have remained unclear. This work demonstrates distinct and additive roles for each sensor during anaerobic dormancy. Both sensors are necessary for wild-type levels of DosR regulon induction, and concomitantly, full induction of the regulon is required for wild-type anaerobic survival. In the anaerobic model, DosT plays an early role, responding to hypoxia. DosT then induces the regulon and with it DosS, which sustains and further induces the regulon. DosT then loses its functionality as oxygen becomes limited, and DosS alone maintains induction of the genes from that point forward. Thus, M. tuberculosis has evolved a system whereby it responds to hypoxic conditions in a stepwise fashion as it enters an anaerobic state. PMID:19487478

Honaker, Ryan W; Leistikow, Rachel L; Bartek, Iona L; Voskuil, Martin I

2009-08-01

58

iRegulon: From a Gene List to a Gene Regulatory Network Using Large Motif and Track Collections  

PubMed Central

Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from http://iregulon.aertslab.org.

Imrichova, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein

2014-01-01

59

The parasite specific substitution matrices improve the annotation of apicomplexan proteins  

PubMed Central

Background A number of apicomplexan genomes have been sequenced successfully in recent years and this would help in understanding the biology of apicomplexan parasites. The members of the phylum Apicomplexa are important protozoan parasites (Plasmodium, Toxoplasma and Cryptosporidium etc) that cause some of the deadly diseases in humans and animals. In our earlier studies, we have shown that the standard BLOSUM matrices are not suitable for compositionally biased apicomplexan proteins. So we developed a novel series (SMAT and PfFSmat60) of substitution matrices which performed better in comparison to standard BLOSUM matrices and developed ApicoAlign, a sequence search and alignment tool for apicomplexan proteins. In this study, we demonstrate the higher specificity of these matrices and make an attempt to improve the annotation of apicomplexan kinases and proteases. Results The ROC curves proved that SMAT80 performs best for apicomplexan proteins followed by compositionally adjusted BLOSUM62 (PSI-BLAST searches), BLOSUM90 and BLOSUM62 matrices in terms of detecting true positives. The poor E-values and/or bit scores given by SMAT80 matrix for the experimentally identified coccidia-specific oocyst wall proteins against hematozoan (non-coccidian) parasites further supported the higher specificity of the same. SMAT80 uniquely detected (missed by BLOSUM) orthologs for 1374 apicomplexan hypothetical proteins against SwissProt database and predicted 70 kinases and 17 proteases. Further analysis confirmed the conservation of functional residues of kinase domain in one of the SMAT80 detected kinases. Similarly, one of the SMAT80 detected proteases was predicted to be a rhomboid protease. Conclusions The parasite specific substitution matrices have higher specificity for apicomplexan proteins and are helpful in detecting the orthologs missed by BLOSUM matrices and thereby improve the annotation of apicomplexan proteins which are hypothetical or with unknown function.

2012-01-01

60

How Apicomplexan Parasites Move In and Out of Cells  

PubMed Central

Summary Apicomplexan parasites utilize a unique form of “gliding motility” to traverse across substrates, migrate through tissues, and invade into and finally egress from their vertebrate host cells. Parasite gliding relies on the tread milling of surface adhesins linked to short actin filaments that are translocated rearward by a stationary small myosin motor. New details reveal mechanistic insight into the coordinated release and processing of adhesins, the complexity of adhesin-substrate interactions, the regulation of the actin-myosin motor complex, and the formation of a novel junction at the host-parasite interface. These activities are carefully orchestrated to provide an efficient process for motility that is essential for parasite survival. The parasite-specific nature of many of these steps reveals several essential points that may be targeted for intervention.

Sibley, L. David

2010-01-01

61

Computational analysis of LexA regulons in Cyanobacteria  

PubMed Central

Background The transcription factor LexA plays an important role in the SOS response in Escherichia coli and many other bacterial species studied. Although the lexA gene is encoded in almost every bacterial group with a wide range of evolutionary distances, its precise functions in each group/species are largely unknown. More recently, it has been shown that lexA genes in two cyanobacterial genomes Nostoc sp. PCC 7120 and Synechocystis sp. PCC 6803 might have distinct functions other than the regulation of the SOS response. To gain a general understanding of the functions of LexA and its evolution in cyanobacteria, we conducted the current study. Results Our analysis indicates that six of 33 sequenced cyanobacterial genomes do not harbor a lexA gene although they all encode the key SOS response genes, suggesting that LexA is not an indispensable transcription factor in these cyanobacteria, and that their SOS responses might be regulated by different mechanisms. Our phylogenetic analysis suggests that lexA was lost during the course of evolution in these six cyanobacterial genomes. For the 26 cyanobacterial genomes that encode a lexA gene, we have predicted their LexA-binding sites and regulons using an efficient binding site/regulon prediction algorithm that we developed previously. Our results show that LexA in most of these 26 genomes might still function as the transcriptional regulator of the SOS response genes as seen in E. coli and other organisms. Interestingly, putative LexA-binding sites were also found in some genomes for some key genes involved in a variety of other biological processes including photosynthesis, drug resistance, etc., suggesting that there is crosstalk between the SOS response and these biological processes. In particular, LexA in both Synechocystis sp. PCC6803 and Gloeobacter violaceus PCC7421 has largely diverged from those in other cyanobacteria in the sequence level. It is likely that LexA is no longer a regulator of the SOS response in Synechocystis sp. PCC6803. Conclusions In most cyanobacterial genomes that we analyzed, LexA appears to function as the transcriptional regulator of the key SOS response genes. There are possible couplings between the SOS response and other biological processes. In some cyanobacteria, LexA has adapted distinct functions, and might no longer be a regulator of the SOS response system. In some other cyanobacteria, lexA appears to have been lost during the course of evolution. The loss of lexA in these genomes might lead to the degradation of its binding sites.

2010-01-01

62

Reconstruction of xylose utilization pathway and regulons in Firmicutes  

PubMed Central

Background Many Firmicutes bacteria, including solvent-producing clostridia such as Clostridium acetobutylicum, are able to utilize xylose, an abundant carbon source in nature. Nevertheless, homology searches failed to recognize all the genes for the complete xylose and xyloside utilization pathway in most of them. Moreover, the regulatory mechanisms of xylose catabolism in many Firmicutes except Bacillus spp. still remained unclear. Results A comparative genomic approach was used to reconstruct the xylose and xyloside utilization pathway and analyze its regulatory mechanisms in 24 genomes of the Firmicutes. A novel xylose isomerase that is not homologous to previously characterized xylose isomerase, was identified in C. acetobutylicum and several other Clostridia species. The candidate genes for the xylulokinase, xylose transporters, and the transcriptional regulator of xylose metabolism (XylR), were unambiguously assigned in all of the analyzed species based on the analysis of conserved chromosomal gene clustering and regulons. The predicted functions of these genes in C. acetobutylicum were experimentally confirmed through a combination of genetic and biochemical techniques. XylR regulons were reconstructed by identification and comparative analysis of XylR-binding sites upstream of xylose and xyloside utilization genes. A novel XylR-binding DNA motif, which is exceptionally distinct from the DNA motif known for Bacillus XylR, was identified in three Clostridiales species and experimentally validated in C. acetobutylicum by an electrophoretic mobility shift assay. Conclusions This study provided comprehensive insights to the xylose catabolism and its regulation in diverse Firmicutes bacteria especially Clostridia species, and paved ways for improving xylose utilization capability in C. acetobutylicum by genetic engineering in the future.

2010-01-01

63

Genome Sequence of Babesia bovis and Comparative Analysis of Apicomplexan Hemoprotozoa  

PubMed Central

Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related apicomplexan hemoprotozoa Theileria parva and Plasmodium falciparum. At 8.2 Mbp, the B. bovis genome is similar in size to that of Theileria spp. Structural features of the B. bovis and T. parva genomes are remarkably similar, and extensive synteny is present despite several chromosomal rearrangements. In contrast, B. bovis and P. falciparum, which have similar clinical and pathological features, have major differences in genome size, chromosome number, and gene complement. Chromosomal synteny with P. falciparum is limited to microregions. The B. bovis genome sequence has allowed wide scale analyses of the polymorphic variant erythrocyte surface antigen protein (ves1 gene) family that, similar to the P. falciparum var genes, is postulated to play a role in cytoadhesion, sequestration, and immune evasion. The ?150 ves1 genes are found in clusters that are distributed throughout each chromosome, with an increased concentration adjacent to a physical gap on chromosome 1 that contains multiple ves1-like sequences. ves1 clusters are frequently linked to a novel family of variant genes termed smorfs that may themselves contribute to immune evasion, may play a role in variant erythrocyte surface antigen protein biology, or both. Initial expression analysis of ves1 and smorf genes indicates coincident transcription of multiple variants. B. bovis displays a limited metabolic potential, with numerous missing pathways, including two pathways previously described for the P. falciparum apicoplast. This reduced metabolic potential is reflected in the B. bovis apicoplast, which appears to have fewer nuclear genes targeted to it than other apicoplast containing organisms. Finally, comparative analyses have identified several novel vaccine candidates including a positional homolog of p67 and SPAG-1, Theileria sporozoite antigens targeted for vaccine development. The genome sequence provides a greater understanding of B. bovis metabolism and potential avenues for drug therapies and vaccine development.

Brayton, Kelly A; Lau, Audrey O. T; Herndon, David R; Hannick, Linda; Kappmeyer, Lowell S; Berens, Shawn J; Bidwell, Shelby L; Brown, Wendy C; Crabtree, Jonathan; Fadrosh, Doug; Feldblum, Tamara; Forberger, Heather A; Haas, Brian J; Howell, Jeanne M; Khouri, Hoda; Koo, Hean; Mann, David J; Norimine, Junzo; Paulsen, Ian T; Radune, Diana; Ren, Qinghu; Smith, Roger K; Suarez, Carlos E; White, Owen; Wortman, Jennifer R; Knowles, Donald P; McElwain, Terry F; Nene, Vishvanath M

2007-01-01

64

The Gac regulon of Pseudomonas fluorescens SBW25.  

PubMed

Transcriptome analysis of Pseudomonas fluorescens SBW25 showed that 702 genes were differentially regulated in a gacS::Tn5 mutant, with 300 and 402 genes up- and downregulated respectively. Similar to the Gac regulon of other Pseudomonas species, genes involved in motility, biofilm formation, siderophore biosynthesis and oxidative stress were differentially regulated in the gacS mutant of SBW25. Our analysis also revealed, for the first time, that transcription of 19 rhizosphere-induced genes and of genes involved in type II secretion, (exo)polysaccharide and pectate lyase biosynthesis, twitching motility and an orphan non-ribosomal peptide synthetase (NRPS) were significantly affected in the gacS mutant. Furthermore, the gacS mutant inhibited growth of oomycete, fungal and bacterial pathogens significantly more than wild type SBW25. Since RP-HPLC analysis did not reveal any potential candidate metabolites, we focused on the Gac-regulated orphan NRPS gene cluster that was predicted to encode an eight-amino-acid ornicorrugatin-like peptide. Site-directed mutagenesis indicated that the encoded peptide is not involved in the enhanced antimicrobial activity of the gacS mutant but may function as a siderophore. Collectively, this genome-wide analysis revealed that a mutation in the GacS/A two-component regulatory system causes major transcriptional changes in SBW25 and significantly enhances its antimicrobial activities by yet unknown mechanisms. PMID:23864577

Cheng, Xu; de Bruijn, Irene; van der Voort, Menno; Loper, Joyce E; Raaijmakers, Jos M

2013-08-01

65

Evolutionary aspects of a genetic network: studying the lactose/galactose regulon of Kluyveromyces lactis.  

PubMed

The budding yeast Kluyveromyces lactis has diverged from the Saccharomyces lineage before the whole-genome duplication and its genome sequence reveals lower redundancy of many genes. Moreover, it shows lower preference for fermentative carbon metabolism and a broader substrate spectrum making it a particularly rewarding system for comparative and evolutionary studies of carbon-regulated genetic networks. The lactose/galactose regulon of K. lactis, which is regulated by the prototypic transcription activator Gal4 exemplifies important aspects of network evolution when compared with the model GAL regulon of Saccharomyces cerevisiae. Differences in physiology relate to different subcellular compartmentation of regulatory components and, importantly, to quantitative differences in protein-protein interactions rather than major differences in network architecture. Here, we introduce genetic and biochemical tools to study K. lactis in general and the lactose/galactose regulon in particular. We present methods to quantify relevant protein-protein interactions in that network and to visualize such differences in simple plate assays allowing for genetic approaches in further studies. PMID:21468994

Anders, Alexander; Breunig, Karin D

2011-01-01

66

Cohabitation of two different lexA regulons in Pseudomonas putida.  

PubMed

In contrast to the vast majority of the members of the domain Bacteria, several Pseudomonas and Xanthomonas species have two lexA genes, whose products have been shown to recognize different LexA binding motifs, making them an interesting target for studying the interplay between cohabiting LexA regulons in a single species. Here we report an analysis of the genetic composition of the two LexA regulons of Pseudomonas putida KT2440 performed with a genomic microarray. The data obtained indicate that one of the two LexA proteins (LexA1) seems to be in control of the conventional Escherichia coli-like SOS response, while the other LexA protein (LexA2) regulates only its own transcriptional unit, which includes the imuA, imuB, and dnaE2 genes, and a gene (PP_3901) from a resident P. putida prophage. Furthermore, PP_3901 is also regulated by LexA1 and is required for DNA damage-mediated induction of several P. putida resident prophage genes. In silico searches suggested that this marked asymmetry in regulon contents also occurs in other Pseudomonas species with two lexA genes, and the implications of this asymmetry in the evolution of the SOS network are discussed. PMID:17933893

Abella, Marc; Campoy, Susana; Erill, Ivan; Rojo, Fernando; Barbé, Jordi

2007-12-01

67

Cloning and characterization of the 82 kDa tyrosine-rich sexual stage glycoprotein, GAM82, and its role in oocyst wall formation in the apicomplexan parasite, Eimeria maxima  

Microsoft Academic Search

The sexual (macrogamete\\/macrogametocyte) stage antigen, GAM82, in the apicomplexan parasite Eimeria maxima, has an apparent molecular mass of 82 kDa, and has been implicated in protective immunity against coccidiosis in poultry. The gene encoding this protein, gam82, was cloned and sequenced. It is a single-copy, intronless gene, which localizes to a 2145 bp transcript, and is first detected at 130

Sabina I Belli; Michael G Wallach; Nicholas C Smith

2003-01-01

68

Transcription analysis of the Bacillus subtilis PucR regulon and identification of a cis-acting sequence required for PucR-regulated expression of genes involved in purine catabolism.  

PubMed

The PucR protein of Bacillus subtilis has previously been suggested to regulate the expression of 15 genes, pucABCDE, pucFG, pucH, pucI, pucJKLM, pucR, and gde, all of which encode proteins involved in purine catabolism. When cells are grown under nitrogen-limiting conditions, the expression of these genes is induced and intermediary compounds of the purine catabolic pathway affect this expression. By using pucR deletion mutants, we have found that PucR induces the expression of pucFG, pucH, pucI, pucJKLM, and gde while it represses the expression of pucR and pucABCDE. Deletions in the promoters of the five induced operons and genes combined with bioinformatic analysis suggested a conserved upstream activating sequence, 5'-WWWCNTTGGTTAA-3', now named the PucR box. Potential PucR boxes overlapping the -35 and -10 regions of the pucABCDE promoter and located downstream of the pucR transcription start point were also found. The positions of these PucR boxes are consistent with PucR acting as a negative regulator of pucABCDE and pucR expression. Site-directed mutations in the PucR box upstream of pucH and pucI identified positions that are essential for the induction of pucH and pucI expression, respectively. Mutants with decreased pucH or increased pucR expression obtained from a library of clones containing random mutations in the pucH-to-pucR intercistronic region all contained mutations in or near the PucR box. The induction of pucR expression under nitrogen-limiting conditions was found to be mediated by the global nitrogen-regulatory protein TnrA. In other gram-positive bacteria, we have found open reading frames that encode proteins similar to PucR located next to other open reading frames encoding proteins with similarity to purine catabolic enzymes. Hence, the PucR homologues are likely to exert the same function in other gram-positive bacteria as PucR does in B. subtilis. PMID:12029039

Beier, Lars; Nygaard, Per; Jarmer, Hanne; Saxild, Hans H

2002-06-01

69

Genomic reconstruction of the transcriptional regulatory network in Bacillus subtilis.  

PubMed

The adaptation of microorganisms to their environment is controlled by complex transcriptional regulatory networks (TRNs), which are still only partially understood even for model species. Genome scale annotation of regulatory features of genes and TRN reconstruction are challenging tasks of microbial genomics. We used the knowledge-driven comparative-genomics approach implemented in the RegPredict Web server to infer TRN in the model Gram-positive bacterium Bacillus subtilis and 10 related Bacillales species. For transcription factor (TF) regulons, we combined the available information from the DBTBS database and the literature with bioinformatics tools, allowing inference of TF binding sites (TFBSs), comparative analysis of the genomic context of predicted TFBSs, functional assignment of target genes, and effector prediction. For RNA regulons, we used known RNA regulatory motifs collected in the Rfam database to scan genomes and analyze the genomic context of new RNA sites. The inferred TRN in B. subtilis comprises regulons for 129 TFs and 24 regulatory RNA families. First, we analyzed 66 TF regulons with previously known TFBSs in B. subtilis and projected them to other Bacillales genomes, resulting in refinement of TFBS motifs and identification of novel regulon members. Second, we inferred motifs and described regulons for 28 experimentally studied TFs with previously unknown TFBSs. Third, we discovered novel motifs and reconstructed regulons for 36 previously uncharacterized TFs. The inferred collection of regulons is available in the RegPrecise database (http://regprecise.lbl.gov/) and can be used in genetic experiments, metabolic modeling, and evolutionary analysis. PMID:23504016

Leyn, Semen A; Kazanov, Marat D; Sernova, Natalia V; Ermakova, Ekaterina O; Novichkov, Pavel S; Rodionov, Dmitry A

2013-06-01

70

Activation of the latent PlcR regulon in Bacillus anthracis  

PubMed Central

Many genes in Bacillus cereus and Bacillus thuringiensis are under the control of the transcriptional regulator PlcR and its regulatory peptide, PapR. In Bacillus anthracis, the causative agent of anthrax, PlcR is inactivated by truncation, and consequently genes having PlcR binding sites are expressed at very low levels when compared with B. cereus. We found that activation of the PlcR regulon in B. anthracis by expression of a PlcR–PapR fusion protein does not alter sporulation in strains containing the virulence plasmid pXO1 and thereby the global regulator AtxA. Using comparative 2D gel electrophoresis, we showed that activation of the PlcR regulon in B. anthracis leads to upregulation of many proteins found in the secretome of B. cereus, including phospholipases and proteases, such as the putative protease BA1995. Transcriptional analysis demonstrated expression of BA1995 to be dependent on PlcR–PapR, even though the putative PlcR recognition site of the BA1995 gene does not exactly match the PlcR consensus sequence, explaining why this protein had escaped recognition as belonging to the PlcR regulon. Additionally, while transcription of major PlcR-dependent haemolysins, sphingomyelinase and anthrolysin O is enhanced in response to PlcR activation in B. anthracis, only anthrolysin O contributes significantly to lysis of human erythrocytes. In contrast, the toxicity of bacterial culture supernatants from a PlcR-positive strain towards murine macrophages occurred independently of anthrolysin O expression in vitro and in vivo.

Sastalla, Inka; Maltese, Lauren M.; Pomerantseva, Olga M.; Pomerantsev, Andrei P.; Keane-Myers, Andrea; Leppla, Stephen H.

2010-01-01

71

Quorum Sensing but Not Autoinduction of Ti Plasmid Conjugal Transfer Requires Control by the Opine Regulon and the Antiactivator TraM  

Microsoft Academic Search

was detected only after the donors had reached a population level of 10 7 cells per cm 2 . Donors incubated with the opines and AAI transferred their Ti plasmids at population levels about 10-fold lower than those incubated with opines only. Transcription of the tra regulon, as assessed by monitoring a traA::lacZ reporter, showed a similar dependence on the

KEVIN R. PIPER; STEPHEN K. FARRAND

2000-01-01

72

An Expression-Driven Approach to the Prediction of Carbohydrate Transport and Utilization Regulons in the Hyperthermophilic Bacterium Thermotoga maritima  

Microsoft Academic Search

Comprehensive analysis of genome-wide expression patterns during growth of the hyperthermophilic bac- terium Thermotoga maritima on 14 monosaccharide and polysaccharide substrates was undertaken with the goal of proposing carbohydrate specificities for transport systems and putative transcriptional regulators. Saccharide-induced regulons were predicted through the complementary use of comparative genomics, mixed- model analysis of genome-wide microarray expression data, and examination of upstream

Shannon B. Conners; Clemente I. Montero; Donald A. Comfort; Keith R. Shockley; Matthew R. Johnson; Swapnil R. Chhabra; Robert M. Kelly

2005-01-01

73

A small RNA serving both the Hfq and CsrA regulons.  

PubMed

The abundant RNA-binding proteins CsrA and Hfq each impact bacterial physiology by working in conjunction with small RNAs to control large post-transcriptional regulons. The small RNAs involved were considered mechanistically distinct, regulating mRNAs either directly through Hfq-mediated base-pairing or indirectly by sequestering the global translational repressor CsrA. In this issue of Genes & Development, Jřrgensen and colleagues (pp. 1132-1145) blur these distinctions with a dual-mechanism small RNA that acts through both Hfq and CsrA to regulate the formation of bacterial biofilms. PMID:23699406

Holmqvist, Erik; Vogel, Jörg

2013-05-15

74

A small RNA serving both the Hfq and CsrA regulons  

PubMed Central

The abundant RNA-binding proteins CsrA and Hfq each impact bacterial physiology by working in conjunction with small RNAs to control large post-transcriptional regulons. The small RNAs involved were considered mechanistically distinct, regulating mRNAs either directly through Hfq-mediated base-pairing or indirectly by sequestering the global translational repressor CsrA. In this issue of Genes & Development, Jřrgensen and colleagues (pp. 1132–1145) blur these distinctions with a dual-mechanism small RNA that acts through both Hfq and CsrA to regulate the formation of bacterial biofilms.

Holmqvist, Erik; Vogel, Jorg

2013-01-01

75

Use of an inducible regulatory protein to identify members of a regulon: application to the regulon controlled by the leucine-responsive regulatory protein (Lrp) in Escherichia coli.  

PubMed Central

Procedures were developed to facilitate the identification of genes that belong to a given regulon and characterization of their responses to the regulator. The regulon controlled by the Escherichia coli leucine-responsive regulatory protein (Lrp) was studied by isolating random transcriptional fusions to lacZ, using lambda placMu53 and a strain in which lrp is under isopropylthio-beta-D-galactopyranoside (IPTG)-inducible control. Fusions exhibiting IPTG-responsive beta-galactosidase activity were cloned by integrating the suicide vector pIVET1 via homologous recombination at lacZ, followed by self-ligating digested chromosomal DNA. We verified the patterns of lacZ expression after using the plasmid clones to generate merodiploid strains with interrupted and uninterrupted copies of the same sequence. If the merodiploid expression pattern was unchanged from that shown by the original fusion strain, then the cloned fusion was responsible for the regulatory pattern of interest; a difference in the expression pattern could indicate that the original strain carried multiple fusions or that there were autogenous effects of having interrupted the fused gene. Using these procedures, we generated a fusion library of approximately 5 x 10(6) strains; approximately 3,000 of these strains were screened, yielding 84 Lrp-responsive fusions, and 10 of the 84 were phenotypically stable and were characterized. The responses of different fusions in a given operon to in vivo Lrp titrations revealed variations in expression with the position of insertion. Among the newly identified members of the regulon is an open reading frame (orf3) between rpiA and serA. Also, expression of a fusion just downstream of dinF was found to be Lrp dependent only in stationary phase.

Bhagwat, S P; Rice, M R; Matthews, R G; Blumenthal, R M

1997-01-01

76

Use of a promiscuous, constitutively-active bacterial enhancer-binding protein to define the ?54 (RpoN) regulon of Salmonella Typhimurium LT2  

PubMed Central

Background Sigma54, or RpoN, is an alternative ? factor found widely in eubacteria. A significant complication in analysis of the global ?54 regulon in a bacterium is that the ?54 RNA polymerase holoenzyme requires interaction with an active bacterial enhancer-binding protein (bEBP) to initiate transcription at a ?54-dependent promoter. Many bacteria possess multiple bEBPs, which are activated by diverse environmental stimuli. In this work, we assess the ability of a promiscuous, constitutively-active bEBP—the AAA+ ATPase domain of DctD from Sinorhizobium meliloti—to activate transcription from all ?54-dependent promoters for the characterization of the ?54 regulon of Salmonella Typhimurium LT2. Results The AAA+?ATPase domain of DctD was able to drive transcription from nearly all previously characterized or predicted ?54-dependent promoters in Salmonella under a single condition. These promoters are controlled by a variety of native activators and, under the condition tested, are not transcribed in the absence of the DctD AAA+?ATPase domain. We also identified a novel ?54-dependent promoter upstream of STM2939, a homolog of the cas1 component of a CRISPR system. ChIP-chip analysis revealed at least 70 ?54 binding sites in the chromosome, of which 58% are located within coding sequences. Promoter-lacZ fusions with selected intragenic ?54 binding sites suggest that many of these sites are capable of functioning as ?54-dependent promoters. Conclusion Since the DctD AAA+?ATPase domain proved effective in activating transcription from the diverse ?54-dependent promoters of the S. Typhimurium LT2 ?54 regulon under a single growth condition, this approach is likely to be valuable for examining ?54 regulons in other bacterial species. The S. Typhimurium ?54 regulon included a high number of intragenic ?54 binding sites/promoters, suggesting that ?54 may have multiple regulatory roles beyond the initiation of transcription at the start of an operon.

2013-01-01

77

Comparative genomics of the KdgR regulon in Erwinia chrysanthemi 3937 and other gamma-proteobacteria.  

PubMed

In the plant-pathogenic enterobacterium Erwinia chrysanthemi, almost all known genes involved in pectin catabolism are controlled by the transcriptional regulator KdgR. In this study, the comparative genomics approach was used to analyse the KdgR regulon in completely sequenced genomes of eight enterobacteria, including Erw. chrysanthemi, and two Vibrio species. Application of a signal recognition procedure complemented by operon structure and protein sequence analysis allowed identification of new candidate genes of the KdgR regulon. Most of these genes were found to be controlled by the cAMP-receptor protein, a global regulator of catabolic genes. At the next step, regulation of these genes in Erw. chrysanthemi was experimentally verified using in vivo transcriptional fusions and an attempt was made to clarify the functional role of the predicted genes in pectin catabolism. Interestingly, it was found that the KdgR protein, previously known as a repressor, positively regulates expression of two new members of the regulon, phosphoenolpyruvate synthase gene ppsA and an adjacent gene, ydiA, of unknown function. Other predicted regulon members, namely chmX, dhfX, gntB, pykF, spiX, sotA, tpfX, yeeO and yjgK, were found to be subject to classical negative regulation by KdgR. Possible roles of newly identified members of the Erw. chrysanthemi KdgR regulon, chmX, dhfX, gntDBMNAC, spiX, tpfX, ydiA, yeeO, ygjV and yjgK, in pectin catabolism are discussed. Finally, complete reconstruction of the KdgR regulons in various gamma-proteobacteria yielded a metabolic map reflecting a globally conserved pathway for the catabolism of pectin and its derivatives with variability in transport and enzymic capabilities among species. In particular, possible non-orthologous substitutes of isomerase KduI and a new oligogalacturonide transporter in the Vibrio species were detected. PMID:15528647

Rodionov, Dmitry A; Gelfand, Mikhail S; Hugouvieux-Cotte-Pattat, Nicole

2004-11-01

78

Growth Phase-Dependent Activation of the DccRS Regulon of Campylobacter jejuni?  

PubMed Central

Two-component systems are widespread prokaryotic signal transduction devices which allow the regulation of cellular functions in response to changing environmental conditions. The two-component system DccRS (Cj1223c-Cj1222c) of Campylobacter jejuni is important for the colonization of chickens. Here, we dissect the DccRS system in more detail and provide evidence that the sensor DccS selectively phosphorylates the cognate effector, DccR. Microarray expression profiling, real-time reverse transcription-PCR (RT-PCR), electrophoretic mobility shift assay, and primer extension analyses revealed that the DccRS regulon of strain 81116 consists of five promoter elements, all containing the consensus direct repeat sequence WTTCAC-N6-TTCACW covering the putative ?35 promoter regions. One of these promoters is located in front of an operon encoding a putative macrolide efflux pump while the others are in front of genes coding for putative periplasmic or membrane proteins. The DccRS-regulated genes in C. jejuni strain 81116 are needed to enhance early in vivo growth of C. jejuni in 7-day-old chickens. The DccRS system is activated in the late stationary bacterial growth phase, probably by released metabolic products. Whole-genome mRNA profiling and real-time RT-PCR analysis under these conditions demonstrated that the system has no influence on the transcription of genes outside the DccRS regulon.

Wosten, Marc M. S. M.; van Dijk, Linda; Parker, Craig T.; Guilhabert, Magalie R.; van der Meer-Janssen, Ynske P. M.; Wagenaar, Jaap A.; van Putten, Jos P. M.

2010-01-01

79

Triclosan inhibits the growth of Plasmodium falciparum and Toxoplasma gondii by inhibition of Apicomplexan Fab I  

Microsoft Academic Search

Fab I, enoyl acyl carrier protein reductase (ENR), is an enzyme used in fatty acid synthesis. It is a single chain polypeptide in plants, bacteria, and mycobacteria, but is part of a complex polypeptide in animals and fungi. Certain other enzymes in fatty acid synthesis in apicomplexan parasites appear to have multiple forms, homologous to either a plastid, plant-like single

Rima McLeod; Stephen P Muench; John B Rafferty; Dennis E Kyle; Ernest J Mui; Michael J Kirisits; Douglas G Mack; Craig W Roberts; Benjamin U Samuel; Russell E Lyons; Mark Dorris; Wilbur K Milhous; David W Rice

2001-01-01

80

Genome-scale protein expression and structural biology of Plasmodium falciparum and related Apicomplexan organisms  

Microsoft Academic Search

Parasites from the protozoan phylum Apicomplexa are responsible for diseases, such as malaria, toxoplasmosis and cryptosporidiosis, all of which have significantly higher rates of mortality and morbidity in economically underdeveloped regions of the world. Advances in vaccine development and drug discovery are urgently needed to control these diseases and can be facilitated by production of purified recombinant proteins from Apicomplexan

Masoud Vedadi; Jocelyne Lew; Jennifer Artz; Mehrnaz Amani; Yong Zhao; Aiping Dong; Gregory A. Wasney; Mian Gao; Tanya Hills; Stephen Brokx; Wei Qiu; Sujata Sharma; Angelina Diassiti; Zahoor Alam; Michelle Melone; Anne Mulichak; Amy Wernimont; James Bray; Peter Loppnau; Olga Plotnikova; Kate Newberry; Emayavaram Sundararajan; Simon Houston; John Walker; Wolfram Tempel; Alexey Bochkarev; Ivona Kozieradzki; Aled Edwards; Cheryl Arrowsmith; David Roos; Kevin Kain; Raymond Hui

2007-01-01

81

Distinct molecular mechanisms involved in carbon catabolite repression of the arabinose regulon in Bacillus subtilis.  

PubMed

The Bacillus subtilis proteins involved in the utilization of L-arabinose are encoded by the araABDLMNPQ-abfA metabolic operon and by the araE/araR divergent unit. Transcription from the ara operon, araE transport gene and araR regulatory gene is induced by L-arabinose and negatively controlled by AraR. Additionally, expression of both the ara operon and the araE gene is regulated at the transcriptional level by glucose repression. Here, by transcriptional fusion analysis in different mutant backgrounds, it is shown that CcpA most probably complexed with HPr-Ser46-P plays the major role in carbon catabolite repression of the ara regulon by glucose and glycerol. Site-directed mutagenesis and deletion analysis indicate that two catabolite responsive elements (cres) present in the ara operon (cre araA and cre araB) and one cre in the araE gene (cre araE) are implicated in this mechanism. Furthermore, cre araA located between the promoter region of the ara operon and the araA gene, and cre araB placed 2 kb downstream within the araB gene are independently functional and both contribute to glucose repression. In Northern blot analysis, in the presence of glucose, a CcpA-dependent transcript consistent with a message stopping at cre araB was detected, suggesting that transcription 'roadblocking' of RNA polymerase elongation is the most likely mechanism operating in this system. Glucose exerts an additional repression of the ara regulon, which requires a functional araR. PMID:12949161

Inácio, José Manuel; Costa, Carla; de Sá-Nogueira, Isabel

2003-09-01

82

RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more  

PubMed Central

This article summarizes our progress with RegulonDB (http://regulondb.ccg.unam.mx/) during the past 2 years. We have kept up-to-date the knowledge from the published literature regarding transcriptional regulation in Escherichia coli K-12. We have maintained and expanded our curation efforts to improve the breadth and quality of the encoded experimental knowledge, and we have implemented criteria for the quality of our computational predictions. Regulatory phrases now provide high-level descriptions of regulatory regions. We expanded the assignment of quality to various sources of evidence, particularly for knowledge generated through high-throughput (HT) technology. Based on our analysis of most relevant methods, we defined rules for determining the quality of evidence when multiple independent sources support an entry. With this latest release of RegulonDB, we present a new highly reliable larger collection of transcription start sites, a result of our experimental HT genome-wide efforts. These improvements, together with several novel enhancements (the tracks display, uploading format and curational guidelines), address the challenges of incorporating HT-generated knowledge into RegulonDB. Information on the evolutionary conservation of regulatory elements is also available now. Altogether, RegulonDB version 8.0 is a much better home for integrating knowledge on gene regulation from the sources of information currently available.

Salgado, Heladia; Peralta-Gil, Martin; Gama-Castro, Socorro; Santos-Zavaleta, Alberto; Muniz-Rascado, Luis; Garcia-Sotelo, Jair S.; Weiss, Verena; Solano-Lira, Hilda; Martinez-Flores, Irma; Medina-Rivera, Alejandra; Salgado-Osorio, Gerardo; Alquicira-Hernandez, Shirley; Alquicira-Hernandez, Kevin; Lopez-Fuentes, Alejandra; Porron-Sotelo, Liliana; Huerta, Araceli M.; Bonavides-Martinez, Cesar; Balderas-Martinez, Yalbi I.; Pannier, Lucia; Olvera, Maricela; Labastida, Aurora; Jimenez-Jacinto, Veronica; Vega-Alvarado, Leticia; del Moral-Chavez, Victor; Hernandez-Alvarez, Alfredo; Morett, Enrique; Collado-Vides, Julio

2013-01-01

83

The Apicomplexan Pathogen Neospora caninum Inhibits Host Cell Apoptosis in the Absence of Discernible NF-?B Activation?  

PubMed Central

Neospora caninum, a causative agent of bovine abortions, is an apicomplexan parasite that is closely related to the human pathogen Toxoplasma gondii. Since a number of intracellular parasites, including T. gondii, have been shown to modulate host cell apoptosis, the present study was conducted to establish whether N. caninum is similarly capable of subverting apoptotic pathways in its host cells. Our results indicated that death receptor-mediated apoptosis is repressed during N. caninum infection, and the data further showed that the executioner caspase, caspase 3, does not become activated in the infected cells. Surprisingly, nuclear translocation of the NF-?B subunit p65 was not detected in N. caninum-infected cells, although this host transcription factor has been shown to upregulate prosurvival genes in cells infected with T. gondii. Consistent with these findings, the distinct accumulation of phosphorylated I?B that is seen at the parasitophorous vacuole membrane (PVM) of T. gondii was not apparent on the N. caninum PVM. Although a putative I?B kinase activity was detected in N. caninum extracts, thereby implying that this parasite is capable of modulating NF-?B translocation into the host cell nucleus, the data collectively suggest that a profound and sustained activation of the NF-?B pathway is not central to the ability of N. caninum to prevent apoptosis of their host cells.

Herman, Rebecca K.; Molestina, Robert E.; Sinai, Anthony P.; Howe, Daniel K.

2007-01-01

84

In silico discovery of the dormancy regulons in a number of Actinobacteria genomes  

SciTech Connect

Mycobacterium tuberculosis is a dangerous Actinobacteria infecting nearly one third of the human population. It becomes dormant and phenotypically drug resistant in response to stresses. An important feature of the M. tuberculosis pathogenesis is the prevalence of latent infection without disease, making understanding of the mechanisms used by the bacteria to exist in this state and to switch to metabolically active infectious form a vital problem to consider. M. tuberculosis dormancy is regulated by the three-component regulatory system of two kinases (DosT and DevS) and transcriprional regulator (DevR). DevR activates transcription of a set of genes, which allow the bacteria to survive long periods of anaerobiosis, and may be important for long-term survival within the host during latent infection. The DevR-regulon is studied experimentally in M. tuberculosis and few other phylogenetically close Mycobacteria spp. As many other two-component systems, the devRS operon is autoregulated. However, the mechanism of the dormancy is not completely clear even for these bacteria and there is no data describing the dormancy regulons in other species.

Gerasimova, Anna; Dubchak, Inna; Arkin, Adam; Gelfand, Mikhail

2010-11-16

85

ROMA: an in vitro approach to defining target genes for transcription regulators.  

PubMed

We describe an in vitro transcription-based method called ROMA (run-off transcription-microarray analysis) for the genome-wide analysis of transcription regulated by sigma factors and other transcriptional regulators. ROMA uses purified RNA polymerase with and without a regulatory protein to monitor products of transcription from a genomic DNA template. Transcribed RNA is converted to cDNA and hybridized to gene arrays allowing for the identification of genes that are specifically activated by the regulator. We discuss the use of ROMA to define sigma factor regulons in Bacillus subtilis and its broad application to defining regulons for other transcriptional regulators in various species. PMID:18948201

Maclellan, Shawn R; Eiamphungporn, Warawan; Helmann, John D

2009-01-01

86

Lack of immune responses to Mycobacterium tuberculosis DosR regulon proteins following Mycobacterium bovis BCG vaccination.  

PubMed

Mycobacterium bovis BCG is widely used as a vaccine against tuberculosis (TB), despite its variable protective efficacy. Relatively little is known about the immune response profiles following BCG vaccination in relation to protection against TB. Here we tested whether BCG vaccination results in immune responses to DosR (Rv3133c) regulon-encoded proteins. These so-called TB latency antigens are targeted by the immune system during persistent Mycobacterium tuberculosis infection and have been associated with immunity against latent M. tuberculosis infection. In silico analysis of the DosR regulon in BCG and M. tuberculosis showed at least 97% amino acid sequence homology, with 41 out of 48 genes being identical. Transcriptional profiling of 14 different BCG strains, under hypoxia and nitric oxide exposure in vitro, revealed a functional DosR regulon similar to that observed in M. tuberculosis. Next, we assessed human immune responses to a series of immunodominant TB latency antigens and found that BCG vaccination fails to induce significant responses to latency antigens. Similar results were obtained with BCG-vaccinated BALB/c mice. In contrast, responses to latency antigens were observed in individuals with suspected exposure to TB (as indicated by positive gamma interferon responses to TB-specific antigens ESAT-6 and CFP-10) and in mice vaccinated with plasmid DNA encoding selected latency antigens. Since immune responses to TB latency antigens have been associated with control of latent M. tuberculosis infection, our findings support the development of vaccination strategies incorporating DosR regulon antigens to complement and improve the current BCG vaccine. PMID:17502400

Lin, May Young; Geluk, Annemieke; Smith, Steven G; Stewart, Amanda L; Friggen, Annemieke H; Franken, Kees L M C; Verduyn, Marleen J C; van Meijgaarden, Krista E; Voskuil, Martin I; Dockrell, Hazel M; Huygen, Kris; Ottenhoff, Tom H M; Klein, Michčl R

2007-07-01

87

Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium  

SciTech Connect

Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond (Toronto); (WU-MED)

2010-09-21

88

Restriction enzyme-mediated transfection improved transfection efficiency in vitro in Apicomplexan parasite Eimeria tenella.  

PubMed

Genetic manipulation of Apicomplexan parasite Eimeria tenella is only in its earliest stages. In the current study, transfection of E. tenella was conducted by electroporating sporozoites along with linear or circular plasmid DNA, and with or without restriction enzyme. Transfection system containing both linear DNA and restriction enzyme resulted in a transfection efficiency of 2.2x10(-3)in vitro, which is 200-fold higher than that using circular plasmid DNA alone. In another transfection strategy, PCR amplicons of expression cassette, instead of whole plasmid DNA, were subjected to transfection, and it was also found successful. These results suggest that linear DNA and restriction enzyme together in the transfection system greatly improve the transfection efficiency of E. tenella. The high transfection efficiency makes possible the establishment of stable transfection in vivo; and the success of PCR-based, restriction enzyme-mediated transfection will further simplify the transfection process for E. tenella and other Apicomplexan parasites. PMID:18606196

Liu, Xianyong; Shi, Tuanyuan; Ren, Huaibin; Su, Huali; Yan, Wenchao; Suo, Xun

2008-09-01

89

Genetic Mapping Identifies Novel Highly Protective Antigens for an Apicomplexan Parasite  

PubMed Central

Apicomplexan parasites are responsible for a myriad of diseases in humans and livestock; yet despite intensive effort, development of effective sub-unit vaccines remains a long-term goal. Antigenic complexity and our inability to identify protective antigens from the pool that induce response are serious challenges in the development of new vaccines. Using a combination of parasite genetics and selective barriers with population-based genetic fingerprinting, we have identified that immunity against the most important apicomplexan parasite of livestock (Eimeria spp.) was targeted against a few discrete regions of the genome. Herein we report the identification of six genomic regions and, within two of those loci, the identification of true protective antigens that confer immunity as sub-unit vaccines. The first of these is an Eimeria maxima homologue of apical membrane antigen-1 (AMA-1) and the second is a previously uncharacterised gene that we have termed ‘immune mapped protein-1’ (IMP-1). Significantly, homologues of the AMA-1 antigen are protective with a range of apicomplexan parasites including Plasmodium spp., which suggest that there may be some characteristic(s) of protective antigens shared across this diverse group of parasites. Interestingly, homologues of the IMP-1 antigen, which is protective against E. maxima infection, can be identified in Toxoplasma gondii and Neospora caninum. Overall, this study documents the discovery of novel protective antigens using a population-based genetic mapping approach allied with a protection-based screen of candidate genes. The identification of AMA-1 and IMP-1 represents a substantial step towards development of an effective anti-eimerian sub-unit vaccine and raises the possibility of identification of novel antigens for other apicomplexan parasites. Moreover, validation of the parasite genetics approach to identify effective antigens supports its adoption in other parasite systems where legitimate protective antigen identification is difficult.

Blake, Damer P.; Billington, Karen J.; Copestake, Susan L.; Oakes, Richard D.; Quail, Michael A.; Wan, Kiew-Lian; Shirley, Martin W.; Smith, Adrian L.

2011-01-01

90

Isoprenoid precursor biosynthesis offers potential targets for drug discovery against diseases caused by apicomplexan parasites  

PubMed Central

Two, simple, C5 compounds, dimethylally diphosphate and isopentenyl diphosphate, are the universal precursors of isoprenoids, a large family of natural products involved in numerous important biological processes. Two distinct biosynthetic pathways have evolved to supply these precursors. Humans use the mevalonate route whilst many species of bacteria including important pathogens, plant chloroplasts and apicomplexan parasites exploit the non-mevalonate pathway. The absence from humans, combined with genetic and chemical validation suggests that the non-mevalonate pathway holds the potential to support new drug discovery programmes targeting Gram-negative bacteria and the apicomplexan parasites responsible for causing serious human diseases, and also infections of veterinary importance. The non-mevalonate pathway relies on eight enzyme-catalyzed stages exploiting a range of cofactors and metal ions. A wealth of structural and mechanistic data, mainly derived from studies of bacterial enzymes, now exists for most components of the pathway and these will be described. Particular attention will be paid to how these data inform on the apicomplexan orthologues concentrating on the enzymes from Plasmodium spp.; these cause malaria, one the most important parasitic diseases in the world today.

Hunter, William N.

2012-01-01

91

The sigmaB regulon in Staphylococcus aureus and its regulation.  

PubMed

The Staphylococcus aureus genome codes for a sigma factor that shows close sequence similarity to the alternative sigma factor sigmaB of Bacillus subtilis. However, of the proteins controlling the activity of sigmaB in B. subtilis only RsbU, RsbV, and RsbW are encoded in the staphylococcal genome. Therefore, the regulation of the sigmaB activity must differ between these two bacterial species. The present study was designed (i) to describe the sigmaB regulon and (ii) to identify stimuli leading to an activation of sigmaB-dependent transcription. All conditions under which sigmaB was activated in S. aureus (heat shock, addition of MnCl2 or NaCl, alkaline shock) required the presence of RsbU, a positive regulator of sigmaB. In contrast to B. subtilis, a drop in the cellular ATP level caused by the addition of carbonyl cyanide m-chlorophenylhydrazone did not lead to an activation of sigmaB in S. aureus. Moreover, ethanol, a strong inductor of sigmaB activity in B. subtilis, also failed to induce sigmaB in S. aureus. Expression of sigB and sigmaB-dependent genes was enhanced following entry into stationary phase of cells grown in complex medium (LB medium). Our DNA microarray data indicated that 122 genes are positively regulated by sigmaB under alkaline stress conditions. Interestingly, only 12% of these genes have an orthologue in the B. subtilis sigmaB regulon, suggesting that the function of the sigmaB regulon in S. aureus is different from that in B. subtilis. We could show that sigmaB of S. aureus, in contrast to B. subtilis, may have a function in more basic cellular processes such as cell envelope composition, membrane transport processes and intermediary metabolism. sigmaB-dependent genes identified by the DNA microarray approach were subjected to detailed transcriptional analyses using primer extension and Northern blot techniques. These analyses confirmed our DNA microarray data and furthermore revealed different regulatory groups of sigmaB-dependent genes. PMID:16644280

Pané-Farré, Jan; Jonas, Beate; Förstner, Konrad; Engelmann, Susanne; Hecker, Michael

2006-08-01

92

Determination of the regulon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA.  

PubMed

One of the prokaryotic post-transcriptional regulatory mechanisms involves the CsrA/RsmA family of proteins that act by modulating translation initiation at target mRNAs. In this study, we identified the regulon of RsmA of the Pseudomonas aeruginosa PAK strain by using cultures in the stationary phase of growth. The RsmA regulon includes over 500 genes, of which approximately one-third were affected by an rsmA mutation negatively, while the rest were affected positively. By isolating RsmA/mRNA complexes, analysing transcriptional and translational fusions, and performing gel-shift analyses, we identified 40 genes in six operons that are regulated by RsmA directly at the level of translation. All of these genes were affected by RsmA negatively and include genes encoding the type VI secretion system HSI-I, which has been implicated in the P. aeruginosa chronic infections. On the other hand, we were unable to demonstrate a direct interaction of RsmA with transcripts that are positively affected by this protein, including mRNAs encoding the type III secretion system and the type IV pili genes. Our work supports a model in which RsmA acts as a negative translational regulator, and where its positive effects are achieved indirectly by RsmA-mediated interference with translation of specific regulatory factors. PMID:19426209

Brencic, Anja; Lory, Stephen

2009-05-01

93

Modulation of Toxin Production by the Flagellar Regulon in Clostridium difficile  

PubMed Central

We show in this study that toxin production in Clostridium difficile is altered in cells which can no longer form flagellar filaments. The impact of inactivation of fliC, CD0240, fliF, fliG, fliM, and flhB-fliR flagellar genes upon toxin levels in culture supernatants was assessed using cell-based cytotoxicity assay, proteomics, immunoassay, and immunoblotting approaches. Each of these showed that toxin levels in supernatants were significantly increased in a fliC mutant compared to that in the C. difficile 630 parent strain. In contrast, the toxin levels in supernatants secreted from other flagellar mutants were significantly reduced compared with that in the parental C. difficile 630 strain. Transcriptional analysis of the pathogenicity locus genes (tcdR, tcdB, tcdE, and tcdA) revealed a significant increase of all four genes in the fliC mutant strain, while transcription of all four genes was significantly reduced in fliM, fliF, fliG, and flhB-fliR mutants. These results demonstrate that toxin transcription in C. difficile is modulated by the flagellar regulon. More significantly, mutant strains showed a corresponding change in virulence compared to the 630 parent strain when tested in a hamster model of C. difficile infection. This is the first demonstration of differential flagellum-related transcriptional regulation of toxin production in C. difficile and provides evidence for elaborate regulatory networks for virulence genes in C. difficile.

Aubry, Annie; Hussack, Greg; Chen, Wangxue; KuoLee, Rhonda; Twine, Susan M.; Fulton, Kelly M.; Foote, Simon; Carrillo, Catherine D.; Tanha, Jamshid

2012-01-01

94

Modulation of toxin production by the flagellar regulon in Clostridium difficile.  

PubMed

We show in this study that toxin production in Clostridium difficile is altered in cells which can no longer form flagellar filaments. The impact of inactivation of fliC, CD0240, fliF, fliG, fliM, and flhB-fliR flagellar genes upon toxin levels in culture supernatants was assessed using cell-based cytotoxicity assay, proteomics, immunoassay, and immunoblotting approaches. Each of these showed that toxin levels in supernatants were significantly increased in a fliC mutant compared to that in the C. difficile 630 parent strain. In contrast, the toxin levels in supernatants secreted from other flagellar mutants were significantly reduced compared with that in the parental C. difficile 630 strain. Transcriptional analysis of the pathogenicity locus genes (tcdR, tcdB, tcdE, and tcdA) revealed a significant increase of all four genes in the fliC mutant strain, while transcription of all four genes was significantly reduced in fliM, fliF, fliG, and flhB-fliR mutants. These results demonstrate that toxin transcription in C. difficile is modulated by the flagellar regulon. More significantly, mutant strains showed a corresponding change in virulence compared to the 630 parent strain when tested in a hamster model of C. difficile infection. This is the first demonstration of differential flagellum-related transcriptional regulation of toxin production in C. difficile and provides evidence for elaborate regulatory networks for virulence genes in C. difficile. PMID:22851750

Aubry, Annie; Hussack, Greg; Chen, Wangxue; KuoLee, Rhonda; Twine, Susan M; Fulton, Kelly M; Foote, Simon; Carrillo, Catherine D; Tanha, Jamshid; Logan, Susan M

2012-10-01

95

RsbV-independent induction of the SigB-dependent general stress regulon of Bacillus subtilis during growth at high temperature.  

PubMed

General stress proteins protect Bacillus subtilis cells against a variety of environmental insults. This adaptive response is particularly important for nongrowing cells, to which it confers a multiple, nonspecific, and preemptive stress resistance. Induction of the general stress response relies on the alternative transcription factor, SigB, whose activity is controlled by a partner switching mechanism that also involves the anti-sigma factor, RsbW, and the antagonist protein, RsbV. Recently, the SigB regulon has been shown to be continuously induced and functionally important in cells actively growing at low temperature. With the exception of this chill induction, all SigB-activating stimuli identified so far trigger a transient expression of the SigB regulon that depends on RsbV. Through a proteome analysis and Northern blot and gene fusion experiments, we now show that the SigB regulon is continuously induced in cells growing actively at 51 degrees C, close to the upper growth limit of B. subtilis. This heat induction of SigB-dependent genes requires the environmental stress-responsive phosphatase RsbU, but not the metabolic stress-responsive phosphatase RsbP. RsbU dependence of SigB activation by heat is overcome in mutants that lack RsbV. In addition, loss of RsbV alone or in combination with RsbU triggers a hyperactivation of the general stress regulon exclusively at high temperatures detrimental for cell growth. These new facets of heat induction of the SigB regulon indicate that the current view of the complex genetic and biochemical regulation of SigB activity is still incomplete and that SigB perceives signals independent of the RsbV-mediated signal transduction pathways under heat stress conditions. PMID:15342585

Holtmann, Gudrun; Brigulla, Matthias; Steil, Leif; Schütz, Alexandra; Barnekow, Karsta; Völker, Uwe; Bremer, Erhard

2004-09-01

96

The pH-Responsive Regulon of HP0244 (FlgS), the Cytoplasmic Histidine Kinase of Helicobacter pylori?  

PubMed Central

Helicobacter pylori colonizes the acidic gastric environment, in contrast to all other neutralophiles, whose acid resistance and tolerance responses allow only gastric transit. This acid adaptation is dependent on regulation of gene expression in response to pH changes in the periplasm and cytoplasm. The cytoplasmic histidine kinase, HP0244, which until now was thought only to regulate flagellar gene expression via its cognate response regulator, HP0703, was found to generate a response to declining medium pH. Although not required for survival at pH 4.5, HP0244 is required for survival at pH 2.5 with 10 mM urea after 30 min. Transcriptional profiling of a HP0244 deletion mutant grown at pH 7.4 confirmed the contribution of HP0244 to ?54 activation via HP0703 to coordinate flagellar biosynthesis by a pH-independent regulon that includes 14 flagellar genes. Microarray analysis of cells grown at pH 4.5 without urea revealed an additional 22 genes, including 4 acid acclimation genes (ureA, ureB, ureI, and amiE) that are positively regulated by HP0244. Additionally, 86 differentially expressed genes, including 3 acid acclimation genes (ureF, rocF [arginase], and ansB [asparaginase]), were found in cells grown at pH 2.5 with 30 mM urea. Hence, HP0244 has, in addition to the pH-independent flagellar regulon, a pH-dependent regulon, which allows adaptation to a wider range of environmental acid conditions. An acid survival study using an HP0703 mutant and an electrophoretic mobility shift assay with in vitro-phosphorylated HP0703 showed that HP0703 does not contribute to acid survival and does not bind to the promoter regions of several genes in the HP0244 pH-dependent regulon, suggesting that there is a pathway outside the HP0703 regulon which transduces the acid-responsive signal sensed by HP0244.

Wen, Yi; Feng, Jing; Scott, David R.; Marcus, Elizabeth A; Sachs, George

2009-01-01

97

Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry  

PubMed Central

We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 ?M exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB.

Jha, Ramesh K.; Kern, Theresa L.; Fox, David T.; M. Strauss, Charlie E.

2014-01-01

98

Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry.  

PubMed

We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 ?M exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB. PMID:24861620

Jha, Ramesh K; Kern, Theresa L; Fox, David T; M Strauss, Charlie E

2014-08-01

99

Characterization of the Cpx Regulon in Escherichia coli Strain MC4100 ?  

PubMed Central

The Cpx two-component signal transduction pathway of Escherichia coli mediates adaptation to envelope protein misfolding. However, there is experimental evidence that at least 50 genes in 34 operons are part of the Cpx regulon and many have functions that are undefined or unrelated to envelope protein maintenance. No comprehensive analysis of the Cpx regulon has been presented to date. In order to identify strongly Cpx-regulated genes that might play an important role(s) in envelope protein folding and/or to further define the role of the Cpx response and to gain insight into what makes a gene subject to strong Cpx regulation, we have carried out a uniform characterization of a Cpx-regulated lux reporter library in a single-strain background. Strongly Cpx-regulated genes encode proteins that are directly linked to envelope protein folding, localized to the envelope but uncharacterized, or involved in limiting the cellular concentration of noxious molecules. Moderately Cpx-regulated gene clusters encode products implicated in biofilm formation. An analysis of CpxR binding sites in strongly regulated genes indicates that while neither a consensus match nor their orientation predicts the strength of Cpx regulation, most genes contain a CpxR binding site within 100 bp of the transcriptional start site. Strikingly, we found that while there appears to be little overlap between the Cpx and Bae envelope stress responses, the ?E and Cpx responses reciprocally regulate a large group of strongly Cpx-regulated genes, most of which are uncharacterized.

Price, Nancy L.; Raivio, Tracy L.

2009-01-01

100

Characterization of the oxidative stress stimulon and PerR regulon of Campylobacter jejuni  

PubMed Central

Background During gut colonization, the enteric pathogen Campylobacter jejuni must surmount the toxic effects of reactive oxygen species produced by its own metabolism, the host immune system, and intestinal microflora. Elucidation of C. jejuni oxidative stress defense mechanisms is critical for understanding Campylobacter pathophysiology. Results The mechanisms of oxidative stress defense in C. jejuni were characterized by transcriptional profiling and phenotypic analysis of wild-type and mutant strains. To define the regulon of the peroxide-sensing regulator, PerR, we constructed an isogenic ?perR mutant and compared its transcriptome profile with that of the wild-type strain. Transcriptome profiling identified 104 genes that belonged to the PerR regulon. PerR appears to regulate gene expression in a manner that both depends on and is independent of the presence of iron and/or H2O2. Mutation of perR significantly reduced motility. A phenotypic analysis using the chick colonization model showed that the ?perR mutant exhibited attenuated colonization behavior. An analysis of changes in the transcriptome induced by exposure to H2O2, cumene hydroperoxide, or menadione revealed differential expression of genes belonging to a variety of biological pathways, including classical oxidative stress defense systems, heat shock response, DNA repair and metabolism, fatty acid biosynthesis, and multidrug efflux pumps. Mutagenic and phenotypic studies of the superoxide dismutase SodB, the alkyl-hydroxyperoxidase AhpC, and the catalase KatA, revealed a role for these proteins in oxidative stress defense and chick gut colonization. Conclusion This study reveals an interplay between PerR, Fur, iron metabolism and oxidative stress defense, and highlights the role of these elements in C. jejuni colonization of the chick cecum and/or subsequent survival.

Palyada, Kiran; Sun, Yi-Qian; Flint, Annika; Butcher, James; Naikare, Hemant; Stintzi, Alain

2009-01-01

101

Apicomplexan Parasite, Eimeria falciformis, Co-opts Host Tryptophan Catabolism for Life Cycle Progression in Mouse*  

PubMed Central

The obligate intracellular apicomplexan parasites, e.g. Toxoplasma gondii and Plasmodium species, induce an IFN?-driven induction of host indoleamine 2,3-dioxygenase (IDO), the first and rate-limiting enzyme of tryptophan catabolism in the kynurenine pathway. Induction of IDO1 supposedly depletes cellular levels of tryptophan in host cells, which is proposed to inhibit the in vitro growth of auxotrophic pathogens. In vivo function of IDO during infections, however, is not clear, let alone controversial. We show that Eimeria falciformis, an apicomplexan parasite infecting the mouse caecum, induces IDO1 in the epithelial cells of the organ, and the enzyme expression coincides with the parasite development. The absence or inhibition of IDO1/2 and of two downstream enzymes in infected animals is detrimental to the Eimeria growth. The reduced parasite yield is not due to a lack of an immunosuppressive effect of IDO1 in the parasitized IDO1?/? or inhibitor-treated mice because they did not show an accentuated Th1 and IFN? response. Noticeably, the parasite development is entirely rescued by xanthurenic acid, a by-product of tryptophan catabolism inducing exflagellation in male gametes of Plasmodium in the mosquito mid-gut. Our data demonstrate a conceptual subversion of the host defense (IFN?, IDO) by an intracellular pathogen for progression of its natural life cycle. Besides, we show utility of E. falciformis, a monoxenous parasite of a well appreciated host, i.e. mouse, to identify in vivo factors underlying the parasite-host interactions.

Schmid, Manuela; Lehmann, Maik J.; Lucius, Richard; Gupta, Nishith

2012-01-01

102

Biogenesis of iron-sulphur clusters in amitochondriate and apicomplexan protists.  

PubMed

During the last 4 years there has been an enormous interest in the question how iron-sulphur ([Fe-S]) clusters, which are essential building blocks for life, are synthesised and assembled into apo-proteins, both in prokaryotes and in eukaryotes. The emerging picture is that the basic mechanism of this pathway has been well conserved during evolution. In yeast and probably all other eukaryotes the mitochondrion is the place where [Fe-S] clusters are synthesised, even for extramitochondrial [Fe-S] cluster-containing proteins, and a number of proteins have been functionally characterised to a certain extent within this pathway. However, almost nothing is known about this aspect in parasitic protists, although recent studies of amitochondriate protists and on the plastid-like organelle of apicomplexan parasites, the apicoplast, have started to change this. In this article I will summarise the current view of [Fe-S] cluster biogenesis in eukaryotes and discuss its implications for amitochondriate protists and for the plastid-like organelle of apicomplexan parasites. PMID:12204220

Seeber, Frank

2002-09-01

103

Sphingolipid synthesis and scavenging in the intracellular apicomplexan parasite, Toxoplasma gondii.  

PubMed

Sphingolipids are essential components of eukaryotic cell membranes, particularly the plasma membrane, and are involved in a diverse array of signal transduction pathways. Mammals produce sphingomyelin (SM) as the primary complex sphingolipid via the well characterised SM synthase. In contrast yeast, plants and some protozoa utilise an evolutionarily related inositol phosphorylceramide (IPC) synthase to synthesise IPC. This activity has no mammalian equivalent and IPC synthase has been proposed as a target for anti-fungals and anti-protozoals. However, detailed knowledge of the sphingolipid biosynthetic pathway of the apicomplexan protozoan parasites was lacking. In this study bioinformatic analyses indicated a single copy orthologue of the putative SM synthase from the apicomplexan Plasmodium falciparum (the causative agent of malaria) was a bona fide sphingolipid synthase in the related model parasite, Toxoplasma gondii (TgSLS). Subsequently, TgSLS was indicated, by complementation of a mutant cell line, to be a functional orthologue of the yeast IPC synthase (AUR1p), demonstrating resistance to the well characterised AUR1p inhibitor aureobasidin A. In vitro, recombinant TgSLS exhibited IPC synthase activity and, for the first time, the presence of IPC was demonstrated in T. gondii lipid extracts by mass spectrometry. Furthermore, host sphingolipid biosynthesis was indicated to influence, but be non-essential for, T. gondii proliferation, suggesting that whilst scavenging does take place de novo sphingolipid synthesis may be important for parasitism. PMID:23246819

Pratt, Steven; Wansadhipathi-Kannangara, Nilu K; Bruce, Catherine R; Mina, John G; Shams-Eldin, Hosam; Casas, Josefina; Hanada, Kentaro; Schwarz, Ralph T; Sonda, Sabrina; Denny, Paul W

2013-01-01

104

In vitro culture systems for the study of apicomplexan parasites in farm animals.  

PubMed

In vitro culture systems represent powerful tools for the study of apicomplexan parasites such as Cryptosporidium, Eimeria, Sarcocystis, Neospora, Toxoplasma, Besnoitia, Babesia and Theileria, all with high relevance for farm animals. Proliferative stages of these parasites have been cultured in vitro employing a large variety of cell culture and explant approaches. For some, such as Cryptosporidium and Eimeria, the sexual development has been reproduced in cell cultures, while for others, animal experimentation is required to fulfill the life cycle. In vitro cultures have paved the way to exploit the basic biology of these organisms, and had a major impact on the development of tools for diagnostic purposes. With the aid of in vitro cultivation, studies on host-parasite interactions, on factors involved in innate resistance, stage conversion and differentiation, genetics and transfection technology, vaccine candidates and drug effectiveness could be carried out. The use of transgenic parasites has facilitated high-throughput screening of anti-microbial compounds that are active against the proliferative stages. Here, we review the basic features of cell culture-based in vitro systems for apicomplexan parasites that are relevant for farm animals, and discuss their applications with a focus on drug identification and studies of stage differentiation. PMID:23000674

Müller, Joachim; Hemphill, Andrew

2013-02-01

105

The ins and outs of nuclear trafficking: unusual aspects in apicomplexan parasites.  

PubMed

Apicomplexa is a phylum within the kingdom Protista that contains some of the most significant threats to public health. One of the members of this phylum, Toxoplasma gondii, is amenable to molecular genetic analyses allowing for the identification of factors critical for colonization and disease. A pathway found to be important for T. gondii pathogenesis is the Ran network of nuclear trafficking. Bioinformatics analysis of apicomplexan genomes shows that while Ran is well conserved, the key regulators of Ran--Regulator of Chromosome Condensation 1 and Ran GTPase activating protein--are either highly divergent or absent. Likewise, several import and export receptor molecules that are crucial for nuclear transport are either not present or have experienced genetic drift such that they are no longer recognizable by bioinformatics tools. In this minireview we describe the basics of nuclear trafficking and compare components within apicomplexans to defined systems in humans and yeast. A detailed analysis of the nuclear trafficking network in these eukaryotes is required to understand how this potentially unique cellular biological pathway contributes to host-parasite interactions. PMID:19348590

Frankel, Matthew B; Knoll, Laura J

2009-06-01

106

Convergence of Ser/Thr and two-component signaling to coordinate expression of the dormancy regulon in Mycobacterium tuberculosis.  

PubMed

Signal transduction in Mycobacterium tuberculosis is mediated primarily by the Ser/Thr protein kinases and the two-component systems. The Ser/Thr kinase PknH has been shown to regulate growth of M. tuberculosis in a mouse model and in response to NO stress in vitro. Comparison of a pknH deletion mutant (?pknH) with its parental M. tuberculosis H37Rv strain using iTRAQ enabled us to quantify >700 mycobacterial proteins. Among these, members of the hypoxia- and NO-inducible dormancy (DosR) regulon were disregulated in the ?pknH mutant. Using kinase assays, protein-protein interactions, and mass spectrometry analysis, we demonstrated that the two-component response regulator DosR is a substrate of PknH. PknH phosphorylation of DosR mapped to Thr(198) and Thr(205) on the key regulatory helix ?10 involved in activation and dimerization of DosR. PknH Thr phosphorylation and DosS Asp phosphorylation of DosR cooperatively enhanced DosR binding to cognate DNA sequences. Transcriptional analysis comparing ?pknH and parental M. tuberculosis revealed that induction of the DosR regulon was subdued in the ?pknH mutant in response to NO. Together, these results indicate that PknH phosphorylation of DosR is required for full induction of the DosR regulon and demonstrate convergence of the two major signal transduction systems for the first time in M. tuberculosis. PMID:20630871

Chao, Joseph D; Papavinasasundaram, Kadamba G; Zheng, Xingji; Chávez-Steenbock, Ana; Wang, Xuetao; Lee, Guinevere Q; Av-Gay, Yossef

2010-09-17

107

Prediction of transcription regulatory sites in Archaea by a comparative genomic approach  

PubMed Central

Intragenomic and intergenomic comparisons of upstream nucleotide sequences of archaeal genes were performed with the goal of predicting transcription regulatory sites (operators) and identifying likely regulons. Learning sets for the detection of regulatory sites were constructed using the available experimental data on archaeal transcription regulation or by analogy with known bacterial regulons, and further analysis was performed using iterative profile searches. The information content of the candidate signals detected by this method is insufficient for reliable predictions to be made. Therefore, this approach has to be complemented by examination of evolutionary conservation in different archaeal genomes. This combined strategy resulted in the prediction of a conserved heat shock regulon in all euryarchaea, a nitrogen fixation regulon in the methanogens Methanococcus jannaschii and Methanobacterium thermoautotrophicum and an aromatic amino acid regulon in M.thermoautotrophicum. Unexpectedly, the heat shock regulatory site was detected not only for genes that encode known chaperone proteins but also for archaeal histone genes. This suggests a possible function for archaeal histones in stress-related changes in DNA condensation. In addition, comparative analysis of the genomes of three Pyrococcus species resulted in the prediction of their purine metabolism and transport regulon. The results demonstrate the feasibility of prediction of at least some transcription regulatory sites by comparing poorly characterized prokaryotic genomes, particularly when several closely related genome sequences are available.

Gelfand, M. S.; Koonin, E. V.; Mironov, A. A.

2000-01-01

108

Deletion of a previously uncharacterized flagellar-hook-length control gene fliK modulates the sigma54-dependent regulon in Campylobacter jejuni.  

PubMed

A previously unannotated, putative fliK gene was identified in the Campylobacter jejuni genome based on sequence analysis; deletion mutants in this gene had a 'polyhook' phenotype characteristic of fliK mutants in other genera. The mutants greatly overexpressed the sigma(54)-dependent flagellar hook protein FlgE, to form unusual filamentous structures resembling straight flagella in addition to polyhooks. The genome sequence reveals only one gene predicted to encode an orthologue of the NtrC-family activator required for sigma(54)-dependent transcription. Hence, all sigma(54)-dependent genes in the genome would be overexpressed in the fliK mutant together with flgE. Microarray analysis of genome-wide transcription in the mutant showed increased transcription of a subset of genes, often downstream of sigma(54)-dependent promoters identified by a quality-predictive algorithm applied to the whole genome. Assessment of genome-wide transcription in deletion mutants in rpoN, encoding sigma(54), and in the sigma(54)-activator gene flgR, showed reciprocally reduced transcription of genes that were overexpressed in the fliK mutant. The fliA (sigma(28))-dependent regulon was also analysed. Together the data clearly define the roles of the alternative sigma factors RpoN and FliA in flagellar biogenesis in C. jejuni, and identify additional putative members of their respective regulons. PMID:17768253

Kamal, Nahid; Dorrell, Nick; Jagannathan, Aparna; Turner, Susan M; Constantinidou, Chrystala; Studholme, David J; Marsden, Gemma; Hinds, Jason; Laing, Ken G; Wren, Brendan W; Penn, Charles W

2007-09-01

109

Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii  

PubMed Central

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.

Aranda, Jesus; Poza, Margarita; Shingu-Vazquez, Miguel; Cortes, Pilar; Boyce, John D.; Adler, Ben; Barbe, Jordi

2013-01-01

110

The NsrR Regulon in Nitrosative Stress Resistance of Salmonella enterica serovar Typhimurium  

PubMed Central

SUMMARY Nitric oxide (NO·) is an important mediator of innate immunity. The facultative intracellular pathogen Salmonella has evolved mechanisms to detoxify and evade the antimicrobial actions of host-derived NO· produced during infection. Expression of the NO·-detoxifying flavohemoglobin Hmp is controlled by the NO·-sensing transcriptional repressor NsrR and is required for Salmonella virulence. In this study we show that NsrR responds to very low NO· concentrations, suggesting that it plays a primary role in the nitrosative stress response. Additionally, we have defined the NsrR regulon in Salmonella enterica sv. Typhimurium 14028s using transcriptional microarray, qRT-PCR and in silico methods. A novel NsrR-regulated gene designated STM1808 has been identified, along with hmp, hcp-hcr, yeaR-yoaG, ygbA and ytfE. STM1808 and ygbA are important for S. Typhimurium growth during nitrosative stress, and the hcp-hcr locus plays a supportive role in NO· detoxification. ICP-MS analysis of purified STM1808 suggests that it is a zinc metalloprotein, with histidine residues H32 and H82 required for NO· resistance and zinc binding. Moreover, STM1808 and ytfE promote Salmonella growth during systemic infection of mice. Collectively, these findings demonstrate that NsrR-regulated genes in addition to hmp are important for NO· detoxification, nitrosative stress resistance and Salmonella virulence.

Karlinsey, Joyce E.; Bang, Iel-Soo; Becker, Lynne A.; Frawley, Elaine R.; Porwollik, Steffen; Robbins, Hannah F.; Thomas, Vinai Chittezham; Urbano, Rodolfo; McClelland, Michael; Fang, Ferric C.

2012-01-01

111

Toward the identification and regulation of the Arabidopsis thaliana ABI3 regulon  

PubMed Central

The plant-specific, B3 domain-containing transcription factor ABSCISIC ACID INSENSITIVE3 (ABI3) is an essential component of the regulatory network controlling the development and maturation of the Arabidopsis thaliana seed. Genome-wide chromatin immunoprecipitation (ChIP-chip), transcriptome analysis, quantitative reverse transcriptase–polymerase chain reaction and a transient promoter activation assay have been combined to identify a set of 98 ABI3 target genes. Most of these presumptive ABI3 targets require the presence of abscisic acid for their activation and are specifically expressed during seed maturation. ABI3 target promoters are enriched for G-box-like and RY-like elements. The general occurrence of these cis motifs in non-ABI3 target promoters suggests the existence of as yet unidentified regulatory signals, some of which may be associated with epigenetic control. Several members of the ABI3 regulon are also regulated by other transcription factors, including the seed-specific, B3 domain-containing FUS3 and LEC2. The data strengthen and extend the notion that ABI3 is essential for the protection of embryonic structures from desiccation and raise pertinent questions regarding the specificity of promoter recognition.

Monke, Gudrun; Seifert, Michael; Keilwagen, Jens; Mohr, Michaela; Grosse, Ivo; Hahnel, Urs; Junker, Astrid; Weisshaar, Bernd; Conrad, Udo; Baumlein, Helmut; Altschmied, Lothar

2012-01-01

112

Computational identification of the Spo0A-phosphate regulon that is essential for the cellular differentiation and development in Gram-positive spore-forming bacteria  

PubMed Central

Spo0A-phosphate is essential for the initiation of cellular differentiation and developmental processes in Gram-positive spore-forming bacteria. Here we combined comparative genomics with analyses of microarray expression profiles to identify the Spo0A-phosphate regulon in Bacillus subtilis. The consensus Spo0A-phosphate DNA-binding motif identified from the training set based on different computational algorithms is an 8 bp sequence, TTGTCGAA. The same motif was identified by aligning the upstream regulatory sequences of spo0A-dependent genes obtained from the expression profile of Sad67 (a constitutively active form of Spo0A) and their orthologs. After the transcription units (TUs) having putative Spo0A-phosphate binding sites were obtained, conservation of regulons among the genomes of B.subtilis, Bacillus halodurans and Bacillus anthracis, and expression profiles were employed to identify the most confident predictions. Besides genes already known to be directly under the control of Spo0A-phosphate, 276 novel members (organized in 109 TUs) of the Spo0A-phosphate regulon in B.subtilis are predicted in this study. The sensitivity and specificity of our predictions are estimated based on known sites and combinations of different types of evidence. Further characterization of the novel candidates will provide information towards understanding the role of Spo0A-phosphate in the sporulation process, as well as the entire genetic network governing cellular differentiation and developmental processes in B.subtilis.

Liu, Jiajian; Tan, Kai; Stormo, Gary D.

2003-01-01

113

Pondering the puzzle of PML (promyelocytic leukemia) nuclear bodies: Can we fit the pieces together using an RNA regulon?  

PubMed Central

Summary The promyelocytic leukemia protein PML and its associated nuclear bodies are hot topics of investigation. This interest arises for multiple reasons including the tight link between the integrity of PML nuclear bodies and several disease states and the impact of the PML protein and PML nuclear bodies on proliferation, apoptosis and viral infection. Unfortunately, an understanding of the molecular underpinnings of PML nuclear body function remains elusive. Here, a general overview of the PML field is provided and is extended to discuss whether some of the basic tenets of “PML-ology” are still valid. For instance, recent findings suggest that some components of PML nuclear bodies form bodies in the absence of the PML protein. Also, a new model for PML nuclear body function is proposed which provides a unifying framework for its effects on diverse biochemical pathways such as Akt signaling and the p53-Mdm2 axis. In this model, the PML protein acts as an inhibitor of gene expression post-transcriptionally via inhibiting a network node in the eIF4E RNA regulon. An example is given for how the PML RNA regulon model provided the basis for the development of a new anti-cancer strategy being tested in the clinic.

Borden, Katherine L.B.

2008-01-01

114

Focus on the ringleader: the role of AMA1 in apicomplexan invasion and replication  

PubMed Central

Apicomplexan parasites exhibit an unusual mechanism of host cell penetration. A central player in this process is the protein apical membrane antigen 1 (AMA1). Although essential for invasion, the precise functional roles AMA1 plays have been unclear. Several recent studies have provided important, functional insight into its role within the multiprotein complex that comprises the moving junction (MJ). Initially formed at the apical tip of the invading parasite, the MJ represents a ring-like region of contact between the surfaces of the invading parasite and host cell, even as the invaginated host plasma membrane is forced inward by the penetrating parasite. This review discusses these and other recent insights into AMA1 with a particular emphasis on studies conducted in Plasmodium and Toxoplasma.

Tyler, Jessica S.; Treeck, Moritz; Boothroyd, John C.

2011-01-01

115

Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti.  

PubMed

We have sequenced the genome of the emerging human pathogen Babesia microti and compared it with that of other protozoa. B. microti has the smallest nuclear genome among all Apicomplexan parasites sequenced to date with three chromosomes encoding ?3500 polypeptides, several of which are species specific. Genome-wide phylogenetic analyses indicate that B. microti is significantly distant from all species of Babesidae and Theileridae and defines a new clade in the phylum Apicomplexa. Furthermore, unlike all other Apicomplexa, its mitochondrial genome is circular. Genome-scale reconstruction of functional networks revealed that B. microti has the minimal metabolic requirement for intraerythrocytic protozoan parasitism. B. microti multigene families differ from those of other protozoa in both the copy number and organization. Two lateral transfer events with significant metabolic implications occurred during the evolution of this parasite. The genomic sequencing of B. microti identified several targets suitable for the development of diagnostic assays and novel therapies for human babesiosis. PMID:22833609

Cornillot, Emmanuel; Hadj-Kaddour, Kamel; Dassouli, Amina; Noel, Benjamin; Ranwez, Vincent; Vacherie, Benoît; Augagneur, Yoann; Brčs, Virginie; Duclos, Aurelie; Randazzo, Sylvie; Carcy, Bernard; Debierre-Grockiego, Françoise; Delbecq, Stéphane; Moubri-Ménage, Karina; Shams-Eldin, Hosam; Usmani-Brown, Sahar; Bringaud, Frédéric; Wincker, Patrick; Vivarčs, Christian P; Schwarz, Ralph T; Schetters, Theo P; Krause, Peter J; Gorenflot, André; Berry, Vincent; Barbe, Valérie; Ben Mamoun, Choukri

2012-10-01

116

Apicomplexan parasite, Eimeria falciformis, co-opts host tryptophan catabolism for life cycle progression in mouse.  

PubMed

The obligate intracellular apicomplexan parasites, e.g. Toxoplasma gondii and Plasmodium species, induce an IFN?-driven induction of host indoleamine 2,3-dioxygenase (IDO), the first and rate-limiting enzyme of tryptophan catabolism in the kynurenine pathway. Induction of IDO1 supposedly depletes cellular levels of tryptophan in host cells, which is proposed to inhibit the in vitro growth of auxotrophic pathogens. In vivo function of IDO during infections, however, is not clear, let alone controversial. We show that Eimeria falciformis, an apicomplexan parasite infecting the mouse caecum, induces IDO1 in the epithelial cells of the organ, and the enzyme expression coincides with the parasite development. The absence or inhibition of IDO1/2 and of two downstream enzymes in infected animals is detrimental to the Eimeria growth. The reduced parasite yield is not due to a lack of an immunosuppressive effect of IDO1 in the parasitized IDO1(-/-) or inhibitor-treated mice because they did not show an accentuated Th1 and IFN? response. Noticeably, the parasite development is entirely rescued by xanthurenic acid, a by-product of tryptophan catabolism inducing exflagellation in male gametes of Plasmodium in the mosquito mid-gut. Our data demonstrate a conceptual subversion of the host defense (IFN?, IDO) by an intracellular pathogen for progression of its natural life cycle. Besides, we show utility of E. falciformis, a monoxenous parasite of a well appreciated host, i.e. mouse, to identify in vivo factors underlying the parasite-host interactions. PMID:22535959

Schmid, Manuela; Lehmann, Maik J; Lucius, Richard; Gupta, Nishith

2012-06-01

117

Identification of the Alternative Sigma Factor SigX Regulon and Its Implications for Pseudomonas aeruginosa Pathogenicity  

PubMed Central

Pseudomonas aeruginosa is distinguished by its broad metabolic diversity and its remarkable capability for adaptation, which relies on a large collection of transcriptional regulators and alternative sigma (?) factors. The largest group of alternative ? factors is that of the extracytoplasmic function (ECF) ? factors, which control key transduction pathways for maintenance of envelope homeostasis in response to external stress and cell growth. In addition, there are specific roles of alternative ? factors in regulating the expression of virulence and virulence-associated genes. Here, we analyzed a deletion mutant of the ECF ? factor SigX and applied mRNA profiling to define the SigX-dependent regulon in P. aeruginosa in response to low-osmolarity-medium conditions. Furthermore, the combination of transcriptional data with chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) led to the identification of the DNA binding motif of SigX. Genome-wide mapping of SigX-binding regions revealed enrichment of downstream genes involved in fatty acid biosynthesis, type III secretion, swarming and cyclic di-GMP (c-di-GMP) signaling. In accordance, a sigX deletion mutant exhibited altered fatty acid composition of the cell membrane, reduced cytotoxicity, impaired swarming activity, elevated c-di-GMP levels, and increased biofilm formation. In conclusion, a combination of ChIP-seq with transcriptional profiling and bioinformatic approaches to define consensus DNA binding sequences proved to be effective for the elucidation of the regulon of the alternative ? factor SigX, revealing its role in complex virulence-associated phenotypes in P. aeruginosa.

Blanka, Andrea; Schulz, Sebastian; Eckweiler, Denitsa; Franke, Raimo; Bielecka, Agata; Nicolai, Tanja; Casilag, Fiordiligie; Duvel, Juliane; Abraham, Wolf-Rainer; Kaever, Volkhard

2013-01-01

118

Genetic characterization of the HrpL regulon of the fire blight pathogen Erwinia amylovora reveals novel virulence factors.  

PubMed

The bacterial pathogen Erwinia amylovora is the causal agent of fire blight, an economically significant disease of apple and pear. Disease initiation by E. amylovora requires the translocation of effector proteins into host cells via the hypersensitive response and pathogenicity (hrp) type III secretion system (T3SS). The alternative sigma factor HrpL positively regulates the transcription of structural and translocated components of the T3SS via hrp promoter elements. To characterize genome-wide HrpL-dependent gene expression in E. amylovora Ea1189, wild-type and Ea1189?hrpL strains were cultured in hrp-inducing minimal medium, and total RNA was compared using a custom microarray designed to represent the annotated genes of E. amylovora ATCC 49946. The results revealed 24 genes differentially regulated in Ea1189?hrpL relative to Ea1189 with fold-change expression ratios greater than 1.5; of these, 19 genes exhibited decreased transcript abundance and five genes showed increased transcript abundance relative to Ea1189. To expand our understanding of the HrpL regulon and to elucidate direct versus indirect HrpL-mediated effects on gene expression, the genome of E. amylovora ATCC 49946 was examined in silico using a hidden Markov model assembled from known Erwinia spp. hrp promoters. This technique identified 15 putative type III novel hrp promoters, seven of which were validated with quantitative polymerase chain reaction based on expression analyses. It was found that HrpL-regulated genes encode all known components of the hrp T3SS, as well as five putative type III effectors. Eight genes displayed apparent indirect HrpL regulation, suggesting that the HrpL regulon is connected to downstream signalling networks. The construction of deletion mutants of three novel HrpL-regulated genes resulted in the identification of additional virulence factors as well as mutants displaying abnormal motility and biofilm phenotypes. PMID:21831138

McNally, R Ryan; Toth, Ian K; Cock, Peter J A; Pritchard, Leighton; Hedley, Pete E; Morris, Jenny A; Zhao, Youfu; Sundin, George W

2012-02-01

119

The CBF1-dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp.  

PubMed

The meristematic tissues of temperate woody perennials must acclimate to freezing temperatures to survive the winter and resume growth the following year. To determine whether the C-repeat binding factor (CBF) family of transcription factors contributing to this process in annual herbaceous species also functions in woody perennials, we investigated the changes in phenotype and transcript profile of transgenic Populus constitutively expressing CBF1 from Arabidopsis (AtCBF1). Ectopic expression of AtCBF1 was sufficient to significantly increase the freezing tolerance of non-acclimated leaves and stems relative to wild-type plants. cDNA microarray experiments identified genes up-regulated by ectopic AtCBF1 expression in Populus, demonstrated a strong conservation of the CBF regulon between Populus and Arabidopsis and identified differences between leaf and stem regulons. We studied the induction kinetics and tissue specificity of four CBF paralogues identified from the Populus balsamifera subsp. trichocarpa genome sequence (PtCBFs). All four PtCBFs are cold-inducible in leaves, but only PtCBF1 and PtCBF3 show significant induction in stems. Our results suggest that the central role played by the CBF family of transcriptional activators in cold acclimation of Arabidopsis has been maintained in Populus. However, the differential expression of the PtCBFs and differing clusters of CBF-responsive genes in annual (leaf) and perennial (stem) tissues suggest that the perennial-driven evolution of winter dormancy may have given rise to specific roles for these 'master-switches' in the different annual and perennial tissues of woody species. PMID:17080948

Benedict, Catherine; Skinner, Jeffrey S; Meng, Rengong; Chang, Yongjian; Bhalerao, Rishikesh; Huner, Norman P A; Finn, Chad E; Chen, Tony H H; Hurry, Vaughan

2006-07-01

120

Regulation of Rugosity and Biofilm Formation in Vibrio cholerae: Comparison of VpsT and VpsR Regulons and Epistasis Analysis of vpsT, vpsR, and hapR  

Microsoft Academic Search

Vibrio cholerae undergoes phenotypic variation that generates two morphologically different variants, termed smooth and rugose. The transcriptional profiles of the two variants differ greatly, and many of the differentially regulated genes are controlled by a complex regulatory circuitry that includes the transcrip- tional regulators VpsR, VpsT, and HapR. In this study, we identified the VpsT regulon and compared the VpsT

Sinem Beyhan; Kivanc Bilecen; Sofie R. Salama; Catharina Casper-Lindley; Fitnat H. Yildiz

2007-01-01

121

Mycobacterium tuberculosis growth following aerobic expression of the DosR regulon.  

PubMed

The Mycobacterium tuberculosis regulator DosR is induced by multiple stimuli including hypoxia, nitric oxide and redox stress. Overlap of these stimuli with conditions thought to promote latency in infected patients fuels a model in which DosR regulon expression is correlated with bacteriostasis in vitro and a proxy for latency in vivo. Here, we find that inducing the DosR regulon to wildtype levels in aerobic, replicating M. tuberculosis does not alter bacterial growth kinetics. We conclude that DosR regulon expression alone is insufficient for bacterial latency, but rather is expressed during a range of growth states in a dynamic environment. PMID:22558276

Minch, Kyle; Rustad, Tige; Sherman, David R

2012-01-01

122

PTS Phosphorylation of Mga Modulates Regulon Expression and Virulence in the Group A Streptococcus  

PubMed Central

SUMMARY The ability of a bacterial pathogen to monitor available carbon sources in host tissues provides a clear fitness advantage. In the group A streptococcus (GAS), the virulence regulator Mga contains homology to phosphotransferase system (PTS) regulatory domains (PRDs) found in sugar operon regulators. Here we show that Mga was phosphorylated in vitro by the PTS components EI/HPr at conserved PRD histidines. A ?ptsI (EI-deficient) GAS mutant exhibited decreased Mga activity. However, PTS-mediated phosphorylation inhibited Mga-dependent transcription of emm in vitro. Using alanine (unphosphorylated) and aspartate (phosphomimetic) mutations of PRD histidines, we establish that a doubly phosphorylated PRD1 phosphomimetic (D/DMga4) is completely inactive in vivo, shutting down expression of the Mga regulon. Although D/DMga4 is still able to bind DNA in vitro, homo-multimerization of Mga is disrupted and the protein is unable to activate trancription. PTS- mediated regulation of Mga activity appears to be important for pathogenesis, as bacteria expressing either nonphosphorylated (A/A) or phosphomimetic (D/D) PRD1 Mga mutants were attenuated in a model of GAS invasive skin disease. Thus, PTS-mediated phosphorylation of Mga may allow the bacteria to modulate virulence gene expression in response to carbohydrate status. Furthermore, PRD-containing virulence regulators (PCVRs) appear to be widespread in Gram-positive pathogens.

Hondorp, Elise R.; Hou, Sherry C.; Hause, Lara L.; Gera, Kanika; Lee, Ching-En; McIver, Kevin S.

2013-01-01

123

The Rip1 Protease of Mycobacterium tuberculosis Controls the SigD Regulon.  

PubMed

Regulated intramembrane proteolysis of membrane-embedded substrates by site-2 proteases (S2Ps) is a widespread mechanism of transmembrane signal transduction in bacteria and bacterial pathogens. We previously demonstrated that the Mycobacterium tuberculosis S2P Rip1 is required for full virulence in the mouse model of infection. Rip1 controls transcription in part through proteolysis of three transmembrane anti-sigma factors, anti-SigK, -L, and -M, but there are also Rip1-dependent, SigKLM-independent pathways. To determine the contribution of the sigma factors K, L, and M to the ?rip1 attenuation phenotype, we constructed an M. tuberculosis ?sigK? sigL ?sigM mutant and found that this strain fails to recapitulate the marked attenuation of ?rip1 in mice. In a search for additional pathways controlled by Rip1, we demonstrated that the SigD regulon is positively regulated by the Rip1 pathway. Rip1 cleavage of transmembrane anti-SigD is required for expression of SigD target genes. In the absence of Rip1, proteolytic maturation of RsdA is impaired. These findings identify RsdA/SigD as a fourth arm of the branched pathway controlled by Rip1 in M. tuberculosis. PMID:24816608

Schneider, Jessica S; Sklar, Joseph G; Glickman, Michael S

2014-07-15

124

Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus  

PubMed Central

Background Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. Results To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. Multiple variations in regulatory strategies between the Shewanella spp. and E. coli include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp). Conclusions We tentatively defined the first reference collection of ~100 transcriptional regulons in 16 Shewanella genomes. The resulting regulatory network contains ~600 regulated genes per genome that are mostly involved in metabolism of carbohydrates, amino acids, fatty acids, vitamins, metals, and stress responses. Several reconstructed regulons including NagR for N-acetylglucosamine catabolism were experimentally validated in S. oneidensis MR-1. Analysis of correlations in gene expression patterns helps to interpret the reconstructed regulatory network. The inferred regulatory interactions will provide an additional regulatory constrains for an integrated model of metabolism and regulation in S. oneidensis MR-1.

2011-01-01

125

Genome-Wide Analysis of the Salmonella Fis Regulon and Its Regulatory Mechanism on Pathogenicity Islands  

PubMed Central

Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica.

Wang, Quan; Wang, Lei

2013-01-01

126

Global Analysis of the Mycobacterium tuberculosis Zur (FurB) Regulon?  

PubMed Central

The proteins belonging to the Fur family are global regulators of gene expression involved in the response to several environmental stresses and to the maintenance of divalent cation homeostasis. The Mycobacterium tuberculosis genome encodes two Fur-like proteins, FurA and a protein formerly annotated FurB. Since in this paper we show that it represents a zinc uptake regulator, we refer to it as Zur. The gene encoding Zur is found in an operon together with the gene encoding a second transcriptional regulator (Rv2358). In a previous work we demonstrated that Rv2358 is responsible for the zinc-dependent repression of the Rv2358-zur operon, favoring the hypothesis that these genes represent key regulators of zinc homeostasis. In this study we generated a zur mutant in M. tuberculosis, examined its phenotype, and characterized the Zur regulon by DNA microarray analysis. Thirty-two genes, presumably organized in 16 operons, were found to be upregulated in the zur mutant. Twenty-four of them belonged to eight putative transcriptional units preceded by a conserved 26-bp palindrome. Electrophoretic mobility shift experiments demonstrated that Zur binds to this palindrome in a zinc-dependent manner, suggesting its direct regulation of these genes. The proteins encoded by Zur-regulated genes include a group of ribosomal proteins, three putative metal transporters, the proteins belonging to early secretory antigen target 6 (ESAT-6) cluster 3, and three additional proteins belonging to the ESAT-6/culture filtrate protein 10 (CFP-10) family known to contain immunodominant epitopes in the T-cell response to M. tuberculosis infection.

Maciag, Anna; Dainese, Elisa; Rodriguez, G. Marcela; Milano, Anna; Provvedi, Roberta; Pasca, Maria R.; Smith, Issar; Palu, Giorgio; Riccardi, Giovanna; Manganelli, Riccardo

2007-01-01

127

Genome-wide analysis of the salmonella Fis regulon and its regulatory mechanism on pathogenicity islands.  

PubMed

Fis, one of the most important nucleoid-associated proteins, functions as a global regulator of transcription in bacteria that has been comprehensively studied in Escherichia coli K12. Fis also influences the virulence of Salmonella enterica and pathogenic E. coli by regulating their virulence genes, however, the relevant mechanism is unclear. In this report, using combined RNA-seq and chromatin immunoprecipitation (ChIP)-seq technologies, we first identified 1646 Fis-regulated genes and 885 Fis-binding targets in the S. enterica serovar Typhimurium, and found a Fis regulon different from that in E. coli. Fis has been reported to contribute to the invasion ability of S. enterica. By using cell infection assays, we found it also enhances the intracellular replication ability of S. enterica within macrophage cell, which is of central importance for the pathogenesis of infections. Salmonella pathogenicity islands (SPI)-1 and SPI-2 are crucial for the invasion and survival of S. enterica in host cells. Using mutation and overexpression experiments, real-time PCR analysis, and electrophoretic mobility shift assays, we demonstrated that Fis regulates 63 of the 94 Salmonella pathogenicity island (SPI)-1 and SPI-2 genes, by three regulatory modes: i) binds to SPI regulators in the gene body or in upstream regions; ii) binds to SPI genes directly to mediate transcriptional activation of themselves and downstream genes; iii) binds to gene encoding OmpR which affects SPI gene expression by controlling SPI regulators SsrA and HilD. Our results provide new insights into the impact of Fis on SPI genes and the pathogenicity of S. enterica. PMID:23717649

Wang, Hui; Liu, Bin; Wang, Quan; Wang, Lei

2013-01-01

128

Non-canonical CRP sites control competence regulons in Escherichia coli and many other ?-proteobacteria  

PubMed Central

Escherichia coli's cAMP receptor protein (CRP), the archetypal bacterial transcription factor, regulates over a hundred promoters by binding 22 bp symmetrical sites with the consensus core half-site TGTGA. However, Haemophilus influenzae has two types of CRP sites, one like E.coli's and one with the core sequence TGCGA that regulates genes required for DNA uptake (natural competence). Only the latter ‘CRP-S’ sites require both CRP and the coregulator Sxy for activation. To our knowledge, the TGTGA and TGCGA motifs are the first example of one transcription factor having two distinct binding-site motifs. Here we show that CRP-S promoters are widespread in the ?-proteobacteria and demonstrate their Sxy-dependence in E.coli. Orthologs of most H.influenzae CRP-S-regulated genes are ubiquitous in the five best-studied ?-proteobacteria families, Enterobacteriaceae, Pasteurellaceae, Pseudomonadaceae, Vibrionaceae and Xanthomonadaceae. Phylogenetic footprinting identified CRP-S sites in the promoter regions of the Enterobacteriaceae, Pasteurellaceae and Vibrionaceae orthologs, and canonical CRP sites in orthologs of genes known to be Sxy-independent in H.influenzae. Bandshift experiments confirmed that E.coli CRP-S sequences are low affinity binding sites for CRP, and mRNA analysis showed that they require CRP, cAMP (CRP's allosteric effector) and Sxy for gene induction. This work suggests not only that the ?-proteobacteria share a common DNA uptake mechanism, but also that, in the three best studied families, their competence regulons share both CRP-S specificity and Sxy dependence.

Cameron, Andrew D. S.; Redfield, Rosemary J.

2006-01-01

129

EmaxDB: Availability of a first draft genome sequence for the apicomplexan Eimeria maxima.  

PubMed

Apicomplexan parasites are serious pathogens of animals and man that cause diseases including coccidiosis, malaria and toxoplasmosis. The importance of these parasites has prompted the establishment of genomic resources in support of developing effective control strategies. For the Eimeria species resources have developed most rapidly for the reference Eimeria tenella Houghton strain (http://www.genedb.org/Homepage/Etenella). The value of these resources can be enhanced by comparison with related parasites. The well characterised immunogenicity and genetic diversity associated with Eimeria maxima promote its use in genetics-led studies on coccidiosis and recommended its selection for sequencing. Using a combination of sequencing technologies a first draft assembly and annotation has been produced for an E. maxima Houghton strain-derived clone (EmaxDB; http://www.genomemalaysia.gov.my/emaxdb/). The assembly of a draft genome sequence for E. maxima provides a resource for comparative studies with Eimeria and related parasites as demonstrated here through the identification of genes predicted to encode microneme proteins in E. maxima. PMID:22465442

Blake, Damer P; Alias, Halimah; Billington, Karen J; Clark, Emily L; Mat-Isa, Mohd-Noor; Mohamad, Ahmad-Fuad-Hilmi; Mohd-Amin, Mohd-Rashdi; Tay, Yea-Ling; Smith, Adrian L; Tomley, Fiona M; Wan, Kiew-Lian

2012-07-01

130

Lipid synthesis in protozoan parasites: a comparison between kinetoplastids and apicomplexans.  

PubMed

Lipid metabolism is of crucial importance for pathogens. Lipids serve as cellular building blocks, signalling molecules, energy stores, posttranslational modifiers, and pathogenesis factors. Parasites rely on a complex system of uptake and synthesis mechanisms to satisfy their lipid needs. The parameters of this system change dramatically as the parasite transits through the various stages of its life cycle. Here we discuss the tremendous recent advances that have been made in the understanding of the synthesis and uptake pathways for fatty acids and phospholipids in apicomplexan and kinetoplastid parasites, including Plasmodium, Toxoplasma, Cryptosporidium, Trypanosoma and Leishmania. Lipid synthesis differs in significant ways between parasites from both phyla and the human host. Parasites have acquired novel pathways through endosymbiosis, as in the case of the apicoplast, have dramatically reshaped substrate and product profiles, and have evolved specialized lipids to interact with or manipulate the host. These differences potentially provide opportunities for drug development. We outline the lipid pathways for key species in detail as they progress through the developmental cycle and highlight those that are of particular importance to the biology of the pathogens and/or are the most promising targets for parasite-specific treatment. PMID:23827884

Ramakrishnan, Srinivasan; Serricchio, Mauro; Striepen, Boris; Bütikofer, Peter

2013-10-01

131

Multiple determinants for selective inhibition of apicomplexan calcium-dependent protein kinase CDPK1.  

PubMed

Diseases caused by the apicomplexan protozoans Toxoplasma gondii and Cryptosporidium parvum are a major health concern. The life cycle of these parasites is regulated by a family of calcium-dependent protein kinases (CDPKs) that have no direct homologues in the human host. Fortuitously, CDPK1 from both parasites contains a rare glycine gatekeeper residue adjacent to the ATP-binding pocket. This has allowed creation of a series of C3-substituted pyrazolopyrimidine compounds that are potent inhibitors selective for CDPK1 over a panel of human kinases. Here we demonstrate that selectivity is further enhanced by modification of the scaffold at the C1 position. The explanation for this unexpected result is provided by crystal structures of the inhibitors bound to CDPK1 and the human kinase c-SRC. Furthermore, the insight gained from these studies was applied to transform an alternative ATP-competitive scaffold lacking potency and selectivity for CDPK1 into a low nanomolar inhibitor of this enzyme with no activity against SRC. PMID:22369268

Larson, Eric T; Ojo, Kayode K; Murphy, Ryan C; Johnson, Steven M; Zhang, Zhongsheng; Kim, Jessica E; Leibly, David J; Fox, Anna M W; Reid, Molly C; Dale, Edward J; Perera, B Gayani K; Kim, Jae; Hewitt, Stephen N; Hol, Wim G J; Verlinde, Christophe L M J; Fan, Erkang; Van Voorhis, Wesley C; Maly, Dustin J; Merritt, Ethan A

2012-03-22

132

Multiple determinants for selective inhibition of apicomplexan calcium-dependent protein kinase CDPK1  

PubMed Central

Diseases caused by the apicomplexan protozoans Toxoplasma gondii and Cryptosporidium parvum are a major health concern. The life cycle of these parasites is regulated by a family of calcium-dependent protein kinases (CDPKs) that have no direct homologs in the human host. Fortuitously, CDPK1 from both parasites contains a rare glycine gatekeeper residue adjacent to the ATP-binding pocket. This has allowed creation of a series of C3-substituted pyrazolopyrimidine compounds that are potent inhibitors selective for CDPK1 over a panel of human kinases. Here we demonstrate that selectivity is further enhanced by modification of the scaffold at the C1 position. The explanation for this unexpected result is provided by crystal structures of the inhibitors bound to CDPK1 and the human kinase c-SRC. Furthermore, the insight gained from these studies was applied to transform an alternative ATP-competitive scaffold lacking potency and selectivity for CDPK1 into a low nanomolar inhibitor of this enzyme with no activity against SRC.

Larson, Eric T.; Ojo, Kayode K.; Murphy, Ryan C.; Johnson, Steven M.; Zhang, Zhongsheng; Kim, Jessica E.; Leibly, David J.; Fox, Anna M. W.; Reid, Molly C.; Dale, Edward J.; Perera, B. Gayani K.; Kim, Jae; Hewitt, Stephen N.; Hol, Wim G. J.; Verlinde, Christophe L. M. J.; Fan, Erkang; Van Voorhis, Wesley C.; Maly, Dustin J.; Merritt, Ethan A.

2012-01-01

133

The DosR regulon of M. tuberculosis and antibacterial tolerance.  

PubMed

Adaptation of Mycobacterium tuberculosis to an anaerobic dormant state that is tolerant to several antibacterials is mediated largely by a set of highly expressed genes controlled by DosR. A DosR mutant was constructed to investigate whether the DosR regulon is involved in antibacterial tolerance. We demonstrate that induction of the regulon is not required for drug tolerance either in vivo during a mouse infection or in vitro during anaerobic dormancy. Thus, drug tolerance observed in these models is due to other mechanisms such as the bacilli simply being in a non-replicating or low metabolic state. Our data also demonstrate that the DosR regulon is not essential for virulence during chronic murine infection. However, decreased lung pathology was observed in the DosR mutant. We also show that the DosR regulon genes are more highly conserved in environmental mycobacteria, than in pathogenic mycobacteria lacking a latent phase or environmental reservoir. It is possible that the DosR regulon could contribute to drug tolerance in human infections; however, it is not the only mechanism and not the primary mechanism for tolerance during a mouse infection. These data suggest that the regulon evolved not for pathogenesis or drug tolerance but for adaptation to anaerobic conditions in the environment and has been adapted by M. tuberculosis for survival during latent infection. PMID:19577518

Bartek, I L; Rutherford, R; Gruppo, V; Morton, R A; Morris, R P; Klein, M R; Visconti, K C; Ryan, G J; Schoolnik, G K; Lenaerts, A; Voskuil, M I

2009-07-01

134

The DosR regulon of M. tuberculosis and antibacterial tolerance  

PubMed Central

Summary Adaptation of Mycobacterium tuberculosis to an anaerobic dormant state that is tolerant to several antibacterials is mediated largely by a set of highly expressed genes controlled by DosR. A DosR mutant was constructed to investigate whether the DosR regulon is involved in antibacterial tolerance. We demonstrate that induction of the regulon is not required for drug tolerance either in vivo during a mouse infection or in vitro during anaerobic dormancy. Thus, drug tolerance observed in these models is due to other mechanisms such as the bacilli simply being in a non-replicating or low metabolic state. Our data also demonstrate that the DosR regulon is not essential for virulence during chronic murine infection. However, decreased lung pathology was observed in the DosR mutant. We also show that the DosR regulon genes are more highly conserved in environmental mycobacteria, than in pathogenic mycobacteria lacking a latent phase or environmental reservoir. It is possible that the DosR regulon could contribute to drug tolerance in human infections; however, it is not the only mechanism and not the primary mechanism for tolerance during a mouse infection. These data suggest that the regulon evolved not for pathogenesis or drug tolerance but for adaptation to anaerobic conditions in the environment and has been adapted by M. tuberculosis for survival during latent infection.

Bartek, I.L.; Rutherford, R.; Gruppo, V.; Morton, R.A.; Morris, R.P.; Klein, M.R.; Visconti, K.C.; Ryan, G.J.; Schoolnik, G.K.; Lenaerts, A.; Voskuil, M.I.

2009-01-01

135

Genome-wide analysis of transcriptional hierarchy and feedback regulation in the flagellar system of Helicobacter pylori.  

PubMed

The flagellar system of Helicobacter pylori, which comprises more than 40 mostly unclustered genes, is essential for colonization of the human stomach mucosa. In order to elucidate the complex transcriptional circuitry of flagellar biosynthesis in H. pylori and its link to other cell functions, mutants in regulatory genes governing flagellar biosynthesis (rpoN, flgR, flhA, flhF, HP0244) and whole-genome microarray technology were used in this study. The regulon controlled by RpoN, its activator FlgR (FleR) and the cognate histidine kinase HP0244 (FleS) was characterized on a genome-wide scale for the first time. Seven novel genes (HP1076, HP1233, HP1154/1155, HP0366/367, HP0869) were identified as belonging to RpoN-associated flagellar regulons. The hydrogenase accessory gene HP0869 was the only annotated non-flagellar gene in the RpoN regulon. Flagellar basal body components FlhA and FlhF were characterized as functional equivalents to master regulators in H. pylori, as their absence led to a general reduction of transcripts in the RpoN (class 2) and FliA (class 3) regulons, and of 24 genes newly attributed to intermediate regulons, under the control of two or more promoters. FlhA- and FlhF-dependent regulons comprised flagellar and non-flagellar genes. Transcriptome analysis revealed that negative feedback regulation of the FliA regulon was dependent on the antisigma factor FlgM. FlgM was also involved in FlhA- but not FlhF-dependent feedback control of the RpoN regulon. In contrast to other bacteria, chemotaxis and flagellar motor genes were not controlled by FliA or RpoN. A true master regulator of flagellar biosynthesis is absent in H. pylori, consistent with the essential role of flagellar motility and chemotaxis for this organism. PMID:15130117

Niehus, Eike; Gressmann, Helga; Ye, Fang; Schlapbach, Ralph; Dehio, Michaela; Dehio, Christoph; Stack, Allison; Meyer, Thomas F; Suerbaum, Sebastian; Josenhans, Christine

2004-05-01

136

Regulon and promoter analysis of the E. coli heat-shock factor, sigma32, reveals a multifaceted cellular response to heat stress.  

PubMed

The heat-shock response (HSR), a universal cellular response to heat, is crucial for cellular adaptation. In Escherichia coli, the HSR is mediated by the alternative sigma factor, sigma32. To determine its role, we used genome-wide expression analysis and promoter validation to identify genes directly regulated by sigma32 and screened ORF overexpression libraries to identify sigma32 inducers. We triple the number of genes validated to be transcribed by sigma32 and provide new insights into the cellular role of this response. Our work indicates that the response is propagated as the regulon encodes numerous global transcriptional regulators, reveals that sigma70 holoenzyme initiates from 12% of sigma32 promoters, which has important implications for global transcriptional wiring, and identifies a new role for the response in protein homeostasis, that of protecting complex proteins. Finally, this study suggests that the response protects the cell membrane and responds to its status: Fully 25% of sigma32 regulon members reside in the membrane and alter its functionality; moreover, a disproportionate fraction of overexpressed proteins that induce the response are membrane localized. The intimate connection of the response to the membrane rationalizes why a major regulator of the response resides in that cellular compartment. PMID:16818608

Nonaka, Gen; Blankschien, Matthew; Herman, Christophe; Gross, Carol A; Rhodius, Virgil A

2006-07-01

137

Exposure of Bacillus subtilis to Low Pressure (5 Kilopascals) Induces Several Global Regulons, Including Those Involved in the SigB-Mediated General Stress Response.  

PubMed

Studies of how microorganisms respond to pressure have been limited mostly to the extreme high pressures of the deep sea (i.e., the piezosphere). In contrast, despite the fact that the growth of most bacteria is inhibited at pressures below ?2.5 kPa, little is known of microbial responses to low pressure (LP). To study the global LP response, we performed transcription microarrays on Bacillus subtilis cells grown under normal atmospheric pressure (?101 kPa) and a nearly inhibitory LP (5 kPa), equivalent to the pressure found at an altitude of ?20 km. Microarray analysis revealed altered levels of 363 transcripts belonging to several global regulons (AbrB, CcpA, CodY, Fur, IolR, ResD, Rok, SigH, Spo0A). Notably, the highest number of upregulated genes, 86, belonged to the SigB-mediated general stress response (GSR) regulon. Upregulation of the GSR by LP was confirmed by monitoring the expression of the SigB-dependent ctc-lacZ reporter fusion. Measuring transcriptome changes resulting from exposure of bacterial cells to LP reveals insights into cellular processes that may respond to LP exposure. PMID:24878601

Waters, Samantha M; Robles-Martínez, José A; Nicholson, Wayne L

2014-08-15

138

The FurA regulon in Anabaena sp. PCC 7120: in silico prediction and experimental validation of novel target genes  

PubMed Central

In the filamentous cyanobacterium Anabaena sp. PCC 7120, the ferric uptake regulator FurA functions as a global transcriptional regulator. Despite several analyses have focused on elucidating the FurA-regulatory network, the number of target genes described for this essential transcription factor is limited to a handful of examples. In this article, we combine an in silico genome-wide predictive approach with experimental determinations to better define the FurA regulon. Predicted FurA-binding sites were identified upstream of 215 genes belonging to diverse functional categories including iron homeostasis, photosynthesis and respiration, heterocyst differentiation, oxidative stress defence and light-dependent signal transduction mechanisms, among others. The probabilistic model proved to be effective at discerning FurA boxes from non-cognate sequences, while subsequent electrophoretic mobility shift assay experiments confirmed the in vitro specific binding of FurA to at least 20 selected predicted targets. Gene-expression analyses further supported the dual role of FurA as transcriptional modulator that can act both as repressor and as activator. In either role, the in vitro affinity of the protein to its target sequences is strongly dependent on metal co-regulator and reducing conditions, suggesting that FurA couples in vivo iron homeostasis and the response to oxidative stress to major physiological processes in cyanobacteria.

Gonzalez, Andres; Angarica, Vladimir Espinosa; Sancho, Javier; Fillat, Maria F.

2014-01-01

139

The FurA regulon in Anabaena sp. PCC 7120: in silico prediction and experimental validation of novel target genes.  

PubMed

In the filamentous cyanobacterium Anabaena sp. PCC 7120, the ferric uptake regulator FurA functions as a global transcriptional regulator. Despite several analyses have focused on elucidating the FurA-regulatory network, the number of target genes described for this essential transcription factor is limited to a handful of examples. In this article, we combine an in silico genome-wide predictive approach with experimental determinations to better define the FurA regulon. Predicted FurA-binding sites were identified upstream of 215 genes belonging to diverse functional categories including iron homeostasis, photosynthesis and respiration, heterocyst differentiation, oxidative stress defence and light-dependent signal transduction mechanisms, among others. The probabilistic model proved to be effective at discerning FurA boxes from non-cognate sequences, while subsequent electrophoretic mobility shift assay experiments confirmed the in vitro specific binding of FurA to at least 20 selected predicted targets. Gene-expression analyses further supported the dual role of FurA as transcriptional modulator that can act both as repressor and as activator. In either role, the in vitro affinity of the protein to its target sequences is strongly dependent on metal co-regulator and reducing conditions, suggesting that FurA couples in vivo iron homeostasis and the response to oxidative stress to major physiological processes in cyanobacteria. PMID:24503250

González, Andrés; Angarica, Vladimir Espinosa; Sancho, Javier; Fillat, María F

2014-04-01

140

The Fur regulon in anaerobically grown Salmonella enterica sv. Typhimurium: identification of new Fur targets  

PubMed Central

Background The Ferric uptake regulator (Fur) is a transcriptional regulator that controls iron homeostasis in bacteria. Although the regulatory role of Fur in Escherichia coli is well characterized, most of the studies were conducted under routine culture conditions, i.e., in ambient oxygen concentration. To reveal potentially novel aspects of the Fur regulon in Salmonella enterica serovar Typhimurium under oxygen conditions similar to that encountered in the host, we compared the transcriptional profiles of the virulent wild-type strain (ATCC 14028s) and its isogenic ?fur strain under anaerobic conditions. Results Microarray analysis of anaerobically grown ?fur S. Typhimurium identified 298 differentially expressed genes. Expression of several genes controlled by Fnr and NsrR appeared to be also dependent on Fur. Furthermore, Fur was required for the activity of the cytoplasmic superoxide disumutases (MnSOD and FeSOD). The regulation of FeSOD gene, sodB, occurred via small RNAs (i.e., the ryhB homologs, rfrA and rfrB) with the aid of the RNA chaperone Hfq. The transcription of sodA was increased in ?fur; however, the enzyme was inactive due to the incorporation of iron instead of manganese in SodA. Additionally, in ?fur, the expression of the gene coding for the ferritin-like protein (ftnB) was down-regulated, while the transcription of the gene coding for the nitric oxide (NO·) detoxifying flavohemoglobin (hmpA) was up-regulated. The promoters of ftnB and hmpA do not contain recognized Fur binding motifs, which indicated their probable indirect regulation by Fur. However, Fur activation of ftnB was independent of Fnr. In addition, the expression of the gene coding for the histone-like protein, H-NS (hns) was increased in ?fur. This may explain the observed down-regulation of the tdc operon, responsible for the anaerobic degradation of threonine, and ftnB in ?fur. Conclusions This study determined that Fur is a positive factor in ftnB regulation, while serving to repress the expression of hmpA. Furthermore, Fur is required for the proper expression and activation of the antioxidant enzymes, FeSOD and MnSOD. Finally, this work identified twenty-six new targets of Fur regulation, and demonstrates that H-NS repressed genes are down-regulated in ?fur.

2011-01-01

141

Identification, Functional Studies, and Genomic Comparisons of New Members of the NnrR Regulon in Rhodobacter sphaeroides?  

PubMed Central

Analysis of the Rhodobacter sphaeroides 2.4.3 genome revealed four previously unidentified sequences similar to the binding site of the transcriptional regulator NnrR. Expression studies demonstrated that three of these sequences are within the promoters of genes, designated paz, norEF, and cdgA, in the NnrR regulon, while the status of the fourth sequence, within the tat operon promoter, remains uncertain. nnrV, under control of a previously identified NnrR site, was also identified. paz encodes a pseudoazurin that is a donor of electrons to nitrite reductase. paz inactivation did not decrease nitrite reductase activity, but loss of pseudoazurin and cytochrome c2 together reduced nitrite reduction. Inactivation of norEF reduced nitrite and nitric oxide reductase activity and increased the sensitivity to nitrite in a taxis assay. This suggests that loss of norEF increases NO production as a result of decreased nitric oxide reductase activity. 2.4.3 is the only strain of R. sphaeroides with norEF, even though all four of the strains whose genomes have been sequenced have the norCBQD operon and nnrR. norEF was shown to provide resistance to nitrite when it was mobilized into R. sphaeroides strain 2.4.1 containing nirK. Inactivation of the other identified genes did not reveal any detectable denitrification-related phenotype. The distribution of members of the NnrR regulon in R. sphaeroides revealed patterns of coselection of structural genes with the ancillary genes identified here. The strong coselection of these genes indicates their functional importance under real-world conditions, even though inactivation of the majority of them does not impact denitrification under laboratory conditions.

Hartsock, Angela; Shapleigh, James P.

2010-01-01

142

Identification, functional studies, and genomic comparisons of new members of the NnrR regulon in Rhodobacter sphaeroides.  

PubMed

Analysis of the Rhodobacter sphaeroides 2.4.3 genome revealed four previously unidentified sequences similar to the binding site of the transcriptional regulator NnrR. Expression studies demonstrated that three of these sequences are within the promoters of genes, designated paz, norEF, and cdgA, in the NnrR regulon, while the status of the fourth sequence, within the tat operon promoter, remains uncertain. nnrV, under control of a previously identified NnrR site, was also identified. paz encodes a pseudoazurin that is a donor of electrons to nitrite reductase. paz inactivation did not decrease nitrite reductase activity, but loss of pseudoazurin and cytochrome c(2) together reduced nitrite reduction. Inactivation of norEF reduced nitrite and nitric oxide reductase activity and increased the sensitivity to nitrite in a taxis assay. This suggests that loss of norEF increases NO production as a result of decreased nitric oxide reductase activity. 2.4.3 is the only strain of R. sphaeroides with norEF, even though all four of the strains whose genomes have been sequenced have the norCBQD operon and nnrR. norEF was shown to provide resistance to nitrite when it was mobilized into R. sphaeroides strain 2.4.1 containing nirK. Inactivation of the other identified genes did not reveal any detectable denitrification-related phenotype. The distribution of members of the NnrR regulon in R. sphaeroides revealed patterns of coselection of structural genes with the ancillary genes identified here. The strong coselection of these genes indicates their functional importance under real-world conditions, even though inactivation of the majority of them does not impact denitrification under laboratory conditions. PMID:19966004

Hartsock, Angela; Shapleigh, James P

2010-02-01

143

Plastid segregation and cell division in the apicomplexan parasite Sarcocystis neurona.  

PubMed

Apicomplexan parasites harbor a secondary plastid that is essential to their survival. Several metabolic pathways confined to this organelle have emerged as promising parasite-specific drug targets. The maintenance of the organelle and its genome is an equally valuable target. We have studied the replication and segregation of this important organelle using the parasite Sarcocystis neurona as a cell biological model. This model system makes it possible to differentiate and dissect organellar growth, fission and segregation over time, because of the parasite's peculiar mode of cell division. S. neurona undergoes five cycles of chromosomal replication without nuclear division, thus yielding a cell with a 32N nucleus. This nucleus undergoes a sixth replication cycle concurrent with nuclear division and cell budding to give rise to 64 haploid daughter cells. Interestingly, intranuclear spindles persist throughout the cell cycle, thereby providing a potential mechanism to organize chromosomes and organelles in an organism that undergoes dramatic changes in ploidy. The development of the plastid mirrors that of the nucleus, a continuous organelle, which grows throughout the parasite's development and shows association with all centrosomes. Pharmacological ablation of the parasite's multiple spindles demonstrates their essential role in the organization and faithful segregation of the plastid. By using several molecular markers we have timed organelle fission to the last replication cycle and tied it to daughter cell budding. Finally, plastids were labeled by fluorescent protein expression using a newly developed S. neurona transfection system. With these transgenic parasites we have tested our model in living cells employing laser bleaching experiments. PMID:16079283

Vaishnava, Shipra; Morrison, David P; Gaji, Rajshekhar Y; Murray, John M; Entzeroth, Rolf; Howe, Daniel K; Striepen, Boris

2005-08-01

144

Attenuation of virulence in an apicomplexan hemoparasite results in reduced genome diversity at the population level  

PubMed Central

Background Virulence acquisition and loss is a dynamic adaptation of pathogens to thrive in changing milieus. We investigated the mechanisms of virulence loss at the whole genome level using Babesia bovis as a model apicomplexan in which genetically related attenuated parasites can be reliably derived from virulent parental strains in the natural host. We expected virulence loss to be accompanied by consistent changes at the gene level, and that such changes would be shared among attenuated parasites of diverse geographic and genetic background. Results Surprisingly, while single nucleotide polymorphisms in 14 genes distinguished all attenuated parasites from their virulent parental strains, all non-synonymous changes resulted in no deleterious amino acid modification that could consistently be associated with attenuation (or virulence) in this hemoparasite. Interestingly, however, attenuation significantly reduced the overall population's genome diversity with 81% of base pairs shared among attenuated strains, compared to only 60% of base pairs common among virulent parental parasites. There were significantly fewer genes that were unique to their geographical origins among the attenuated parasites, resulting in a simplified population structure among the attenuated strains. Conclusions This simplified structure includes reduced diversity of the variant erythrocyte surface 1 (ves) multigene family repertoire among attenuated parasites when compared to virulent parental strains, possibly suggesting that overall variance in large protein families such as Variant Erythrocyte Surface Antigens has a critical role in expression of the virulence phenotype. In addition, the results suggest that virulence (or attenuation) mechanisms may not be shared among all populations of parasites at the gene level, but instead may reflect expansion or contraction of the population structure in response to shifting milieus.

2011-01-01

145

Stage-specific expression of protease genes in the apicomplexan parasite, Eimeria tenella  

PubMed Central

Background Proteases regulate pathogenesis in apicomplexan parasites but investigations of proteases have been largely confined to the asexual stages of Plasmodium falciparum and Toxoplasma gondii. Thus, little is known about proteases in other Apicomplexa, particularly in the sexual stages. We screened the Eimeria tenella genome database for proteases, classified these into families and determined their stage specific expression. Results Over forty protease genes were identified in the E. tenella genome. These were distributed across aspartic (three genes), cysteine (sixteen), metallo (fourteen) and serine (twelve) proteases. Expression of at least fifteen protease genes was upregulated in merozoites including homologs of genes known to be important in host cell invasion, remodelling and egress in P. falciparum and/or T. gondii. Thirteen protease genes were specifically expressed or upregulated in gametocytes; five of these were in two families of serine proteases (S1 and S8) that are over-represented in the coccidian parasites, E. tenella and T. gondii, distinctive within the Apicomplexa because of their hard-walled oocysts. Serine protease inhibitors prevented processing of EtGAM56, a protein from E. tenella gametocytes that gives rise to tyrosine-rich peptides that are incorporated into the oocyst wall. Conclusion Eimeria tenella possesses a large number of protease genes. Expression of many of these genes is upregulated in asexual stages. However, expression of almost one-third of protease genes is upregulated in, or confined to gametocytes; some of these appear to be unique to the Coccidia and may play key roles in the formation of the oocyst wall, a defining feature of this group of parasites.

2012-01-01

146

Identification of the Treponema pallidum subsp. pallidum TP0092 (RpoE) Regulon and Its Implications for Pathogen Persistence in the Host and Syphilis Pathogenesis  

PubMed Central

Bacteria often respond to harmful environmental stimuli with the induction of extracytoplasmic function (ECF) sigma (?) factors that in turn direct RNA polymerase to transcribe specific groups of response genes (or regulons) to minimize cellular damage and favor adaptation to the changed extracellular milieu. In Treponema pallidum subsp. pallidum, the agent of syphilis, the TP0092 gene is predicted to code for the pathogen's only annotated ECF ? factor, homologous to RpoE, known in Escherichia coli to control a key transduction pathway for maintenance of envelope homeostasis in response to external stress and cell growth. Here we have shown that TP0092 is highly transcribed during experimental syphilis. Furthermore, TP0092 transcription levels significantly increase as infection progresses toward immune clearance of the pathogen, suggesting a role for TP0092 in helping T. pallidum respond to harmful stimuli in the host environment. To investigate this hypothesis, we determined the TP0092 regulon at two different time points during infection using chromatin immunoprecipitation followed by high-throughput sequencing. A total of 22 chromosomal regions, all containing putative TP0092-binding sites and corresponding to as many T. pallidum genes, were identified. Noteworthy among them are the genes encoding desulfoferrodoxin and thioredoxin, involved in detoxification of reactive oxygen species (ROS). Because T. pallidum does not possess other enzymes for ROS detoxification, such as superoxide dismutase, catalase, or glutathione peroxidase, our results suggest that the TP0092 regulon is important in protecting the syphilis spirochete from damage caused by ROS produced at the site of infection during the inflammatory response.

Denisenko, Oleg; Tompa, Martin; Centurion-Lara, Arturo

2013-01-01

147

Expression of the Streptomyces coelicolor SoxR Regulon Is Intimately Linked with Actinorhodin Production? †  

PubMed Central

The [2Fe-2S]-containing transcription factor SoxR is conserved in diverse bacteria. SoxR is traditionally known as the regulator of a global oxidative stress response in Escherichia coli, but recent studies suggest that this function may be restricted to enteric bacteria. In the vast majority of nonenterics, SoxR is predicted to mediate a response to endogenously produced redox-active metabolites. We have examined the regulation and function of the SoxR regulon in the model antibiotic-producing filamentous bacterium Streptomyces coelicolor. Unlike the E. coli soxR deletion mutant, the S. coelicolor equivalent is not hypersensitive to oxidants, indicating that SoxR does not potentiate antioxidant defense in the latter. SoxR regulates five genes in S. coelicolor, including those encoding a putative ABC transporter, two oxidoreductases, a monooxygenase, and a possible NAD-dependent epimerase/dehydratase. Expression of these genes depends on the production of the benzochromanequinone antibiotic actinorhodin and requires intact [2Fe-2S] clusters in SoxR. These data indicate that actinorhodin, or a redox-active precursor, modulates SoxR activity in S. coelicolor to stimulate the production of a membrane transporter and proteins with homology to actinorhodin-tailoring enzymes. While the role of SoxR in S. coelicolor remains under investigation, these studies support the notion that SoxR has been adapted to perform distinct physiological functions to serve the needs of organisms that occupy different ecological niches and face different environmental challenges.

Dela Cruz, Rica; Gao, Yang; Penumetcha, Sahitya; Sheplock, Rebecca; Weng, Katherine; Chander, Monica

2010-01-01

148

Identified members of the Streptomyces lividans AdpA regulon involved in differentiation and secondary metabolism  

PubMed Central

Background AdpA is a key transcriptional regulator involved in the complex growth cycle of Streptomyces. Streptomyces are Gram-positive bacteria well-known for their production of secondary metabolites and antibiotics. Most work on AdpA has been in S. griseus, and little is known about the pathways it controls in other Streptomyces spp. We recently discovered interplay between ClpP peptidases and AdpA in S. lividans. Here, we report the identification of genes directly regulated by AdpA in S. lividans. Results Microarray experiments revealed that the expression of hundreds of genes was affected in a S. lividans adpA mutant during early stationary phase cultures in YEME liquid medium. We studied the expression of the S. lividans AdpA-regulated genes by quantitative real-time PCR analysis after various times of growth. In silico analysis revealed the presence of potential AdpA-binding sites upstream from these genes; electrophoretic mobility shift assays indicated that AdpA binds directly to their promoter regions. This work identifies new pathways directly controlled by AdpA and that are involved in S. lividans development (ramR, SLI7885 also known as hyaS and SLI6586), and primary (SLI0755-SLI0754 encoding CYP105D5 and Fdx4) or secondary (cchA, cchB, and hyaS) metabolism. Conclusions We characterised six S. lividans AdpA-dependent genes whose expression is directly activated by this pleiotropic regulator. Several of these genes are orthologous to bldA-dependent genes in S. coelicolor. Furthermore, in silico analysis suggests that over hundred genes may be directly activated or repressed by S. lividans AdpA, although few have been described as being part of any Streptomyces AdpA regulons. This study increases the number of known AdpA-regulated pathways in Streptomyces spp.

2014-01-01

149

Characterization of the SOS Regulon of Caulobacter crescentus? ‡  

PubMed Central

The SOS regulon is a paradigm of bacterial responses to DNA damage. A wide variety of bacterial species possess homologs of lexA and recA, the central players in the regulation of the SOS circuit. Nevertheless, the genes actually regulated by the SOS have been determined only experimentally in a few bacterial species. In this work, we describe 37 genes regulated in a LexA-dependent manner in the alphaproteobacterium Caulobacter crescentus. In agreement with previous results, we have found that the direct repeat GTTCN7GTTC is the SOS operator of C. crescentus, which was confirmed by site-directed mutagenesis studies of the imuA promoter. Several potential promoter regions containing the SOS operator were identified in the genome, and the expression of the corresponding genes was analyzed for both the wild type and the lexA strain, demonstrating that the vast majority of these genes are indeed SOS regulated. Interestingly, many of these genes encode proteins with unknown functions, revealing the potential of this approach for the discovery of novel genes involved in cellular responses to DNA damage in prokaryotes, and illustrating the diversity of SOS-regulated genes among different bacterial species.

da Rocha, Raquel Paes; de Miranda Paquola, Apua Cesar; do Valle Marques, Marilis; Menck, Carlos Frederico Martins; Galhardo, Rodrigo S.

2008-01-01

150

Control of the arabinose regulon in Bacillus subtilis by AraR in vivo: crucial roles of operators, cooperativity, and DNA looping.  

PubMed

The proteins involved in the utilization of L-arabinose by Bacillus subtilis are encoded by the araABDLMNPQ-abfA metabolic operon and by the araE/araR divergent unit. Transcription from the ara operon, araE transport gene, and araR regulatory gene is induced by L-arabinose and negatively controlled by AraR. The purified AraR protein binds cooperatively to two in-phase operators within the araABDLMNPQ-abfA (OR(A1) and OR(A2)) and araE (OR(E1) and OR(E2)) promoters and noncooperatively to a single operator in the araR (OR(R3)) promoter region. Here, we have investigated how AraR controls transcription from the ara regulon in vivo. A deletion analysis of the ara promoters region showed that the five AraR binding sites are the key cis-acting regulatory elements of their corresponding genes. Furthermore, OR(E1)-OR(E2) and OR(R3) are auxiliary operators for the autoregulation of araR and the repression of araE, respectively. Analysis of mutations designed to prevent cooperative binding of AraR showed that in vivo repression of the ara operon requires communication between repressor molecules bound to two properly spaced operators. This communication implicates the formation of a small loop by the intervening DNA. In an in vitro transcription system, AraR alone sufficed to abolish transcription from the araABDLMNPQ-abfA operon and araE promoters, strongly suggesting that it is the major protein involved in the repression mechanism of L-arabinose-inducible expression in vivo. The ara regulon is an example of how the architecture of the promoters is adapted to respond to the particular characteristics of the system, resulting in a tight and flexible control. PMID:11418559

Mota, L J; Sarmento, L M; de Sá-Nogueira, I

2001-07-01

151

Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping  

PubMed Central

The proteins involved in the utilization of l-arabinose by Bacillus subtilis are encoded by the araABDLMNPQ-abfA metabolic operon and by the araE/araR divergent unit. Transcription from the ara operon, araE transport gene, and araR regulatory gene is induced by l-arabinose and negatively controlled by AraR. The purified AraR protein binds cooperatively to two in-phase operators within the araABDLMNPQ-abfA (ORA1 and ORA2) and araE (ORE1 and ORE2) promoters and noncooperatively to a single operator in the araR (ORR3) promoter region. Here, we have investigated how AraR controls transcription from the ara regulon in vivo. A deletion analysis of the ara promoters region showed that the five AraR binding sites are the key cis-acting regulatory elements of their corresponding genes. Furthermore, ORE1-ORE2 and ORR3 are auxiliary operators for the autoregulation of araR and the repression of araE, respectively. Analysis of mutations designed to prevent cooperative binding of AraR showed that in vivo repression of the ara operon requires communication between repressor molecules bound to two properly spaced operators. This communication implicates the formation of a small loop by the intervening DNA. In an in vitro transcription system, AraR alone sufficed to abolish transcription from the araABDLMNPQ-abfA operon and araE promoters, strongly suggesting that it is the major protein involved in the repression mechanism of l-arabinose-inducible expression in vivo. The ara regulon is an example of how the architecture of the promoters is adapted to respond to the particular characteristics of the system, resulting in a tight and flexible control.

Mota, Luis Jaime; Sarmento, Leonor Morais; de Sa-Nogueira, Isabel

2001-01-01

152

Modulation of hexa-acyl pyrophosphate lipid A population under Escherichia coli phosphate (Pho) regulon activation.  

PubMed

Environmental phosphate is an important signal for microorganism gene regulation, and it has recently been shown to trigger some key bacterial virulence mechanisms. In many bacteria, the Pho regulon is the major circuit involved in adaptation to phosphate limitation. The Pho regulon is controlled jointly by the two-component regulatory system PhoR/PhoB and by the phosphate-specific transport (Pst) system, which both belong to the Pho regulon. We showed that a pst mutation results in virulence attenuation in extraintestinal pathogenic Escherichia coli (ExPEC) strains. Our results indicate that the bacterial cell surface of the pst mutants is altered. In this study, we show that pst mutants of ExPEC strains display an increased sensitivity to different cationic antimicrobial peptides and vancomycin. Remarkably, the hexa-acylated 1-pyrophosphate form of lipid A is significantly less abundant in pst mutants. Among differentially expressed genes in the pst mutant, lpxT coding for an enzyme that transfers a phosphoryl group to lipid A, forming the 1-diphosphate species, was found to be downregulated. Our results strongly suggest that the Pho regulon is involved in lipid A modifications, which could contribute to bacterial surface perturbations. Since the Pho regulon and the Pst system are conserved in many bacteria, such a lipid A modification mechanism could be widely distributed among gram-negative bacterial species. PMID:18515419

Lamarche, Martin G; Kim, Sang-Hyun; Crépin, Sébastien; Mourez, Michael; Bertrand, Nicolas; Bishop, Russell E; Dubreuil, J Daniel; Harel, Josée

2008-08-01

153

The Mycobacterium DosR regulon structure and diversity revealed by comparative genomic analysis.  

PubMed

Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), which claims approximately two million people annually, remains a global health concern. The non-replicating or dormancy like state of this pathogen which is impervious to anti-tuberculosis drugs is widely recognized as the culprit for this scenario. The dormancy survival regulator (DosR) regulon, composed of 48 co-regulated genes, is held as essential for Mtb persistence. The DosR regulon is regulated by a two-component regulatory system consisting of two sensor kinases-DosS (Rv3132c) and DosT (Rv2027c), and a response regulator DosR (Rv3133c). The underlying regulatory mechanism of DosR regulon expression is very complex. Many factors are involved, particularly the oxygen tension. The DosR regulon enables the pathogen to persist during lengthy hypoxia. Comparative genomic analysis demonstrated that the DosR regulon is widely distributed among the mycobacterial genomes, ranging from the pathogenic strains to the environmental strains. In-depth studies on the DosR response should provide insights into its role in TB latency in vivo and shape new measures to combat this exceeding recalcitrant pathogen. PMID:22833514

Chen, Tian; He, Liming; Deng, Wanyan; Xie, Jianping

2013-01-01

154

The Zinc-Responsive Regulon of Neisseria meningitidis Comprises 17 Genes under Control of a Zur Element  

PubMed Central

Zinc is a bivalent cation essential for bacterial growth and metabolism. The human pathogen Neisseria meningitidis expresses a homologue of the Zinc uptake regulator Zur, which has been postulated to repress the putative zinc uptake protein ZnuD. In this study, we elucidated the transcriptome of meningococci in response to zinc by microarrays and quantitative real-time PCR (qRT-PCR). We identified 15 genes that were repressed and two genes that were activated upon zinc addition. All transcription units (genes and operons) harbored a putative Zur binding motif in their promoter regions. A meningococcal Zur binding consensus motif (Zur box) was deduced in silico, which harbors a conserved central palindrome consisting of hexameric inverted repeats separated by three nucleotides (TGTTATDNHATAACA). In vitro binding of recombinant meningococcal Zur to this Zur box was shown for the first time using electrophoretic mobility shift assays. Zur binding to DNA depended specifically on the presence of zinc and was sensitive to mutations in the palindromic sequence. The Zur regulon among genes of unknown function comprised genes involved in zinc uptake, tRNA modification, and ribosomal assembly. In summary, this is the first study of the transcriptional response to zinc in meningococci.

Pawlik, Marie-Christin; Hubert, Kerstin; Joseph, Biju; Claus, Heike; Schoen, Christoph

2012-01-01

155

Listeria monocytogenes differential transcriptome analysis reveals temperature-dependent Agr regulation and suggests overlaps with other regulons.  

PubMed

Listeria monocytogenes is a ubiquitous, opportunistic pathogenic organism. Environmental adaptation requires constant regulation of gene expression. Among transcriptional regulators, AgrA is part of an auto-induction system. Temperature is an environmental cue critical for in vivo adaptation. In order to investigate how temperature may affect AgrA-dependent transcription, we compared the transcriptomes of the parental strain L. monocytogenes EGD-e and its ?agrA mutant at the saprophytic temperature of 25°C and in vivo temperature of 37°C. Variations of transcriptome were higher at 37°C than at 25°C. Results suggested that AgrA may be involved in the regulation of nitrogen transport, amino acids, purine and pyrimidine biosynthetic pathways and phage-related functions. Deregulations resulted in a growth advantage at 37°C, but affected salt tolerance. Finally, our results suggest overlaps with PrfA, ?B, ?H and CodY regulons. These overlaps may suggest that through AgrA, Listeria monocytogenes integrates information on its biotic environment. PMID:23024744

Garmyn, Dominique; Augagneur, Yoann; Gal, Laurent; Vivant, Anne-Laure; Piveteau, Pascal

2012-01-01

156

Listeria monocytogenes Differential Transcriptome Analysis Reveals Temperature-Dependent Agr Regulation and Suggests Overlaps with Other Regulons  

PubMed Central

Listeria monocytogenes is a ubiquitous, opportunistic pathogenic organism. Environmental adaptation requires constant regulation of gene expression. Among transcriptional regulators, AgrA is part of an auto-induction system. Temperature is an environmental cue critical for in vivo adaptation. In order to investigate how temperature may affect AgrA-dependent transcription, we compared the transcriptomes of the parental strain L. monocytogenes EGD-e and its ?agrA mutant at the saprophytic temperature of 25°C and in vivo temperature of 37°C. Variations of transcriptome were higher at 37°C than at 25°C. Results suggested that AgrA may be involved in the regulation of nitrogen transport, amino acids, purine and pyrimidine biosynthetic pathways and phage-related functions. Deregulations resulted in a growth advantage at 37°C, but affected salt tolerance. Finally, our results suggest overlaps with PrfA, ?B, ?H and CodY regulons. These overlaps may suggest that through AgrA, Listeria monocytogenes integrates information on its biotic environment.

Garmyn, Dominique; Augagneur, Yoann; Gal, Laurent; Vivant, Anne-Laure; Piveteau, Pascal

2012-01-01

157

Regulation of the phosphate regulon of Escherichia coli : Characterization of the promoter of the pstS gene  

Microsoft Academic Search

The pstS gene belongs to the phosphate regulon whose expression is induced by phosphate starvation and regulated positively by the PhoB protein. The phosphate (pho) box is a consensus sequence shared by the regulatory regions of the genes in the pho regulon. We constructed two series of deletion mutations in a plasmid in vitro, with upstream and downstream deletions in

Sigenobu Kimura; Kozo Makino; Hideo Shinagawa; Mitsuko Amemura; Atsuo Nakata

1989-01-01

158

Evolution and diversity of secretome genes in the apicomplexan parasite Theileria annulata  

PubMed Central

Background Little is known about how apicomplexan parasites have evolved to infect different host species and cell types. Theileria annulata and Theileria parva invade and transform bovine leukocytes but each species favours a different host cell lineage. Parasite-encoded proteins secreted from the intracellular macroschizont stage within the leukocyte represent a critical interface between host and pathogen systems. Genome sequencing has revealed that several Theileria-specific gene families encoding secreted proteins are positively selected at the inter-species level, indicating diversification between the species. We extend this analysis to the intra-species level, focusing on allelic diversity of two major secretome families. These families represent a well-characterised group of genes implicated in control of the host cell phenotype and a gene family of unknown function. To gain further insight into their evolution and function, this study investigates whether representative genes of these two families are diversifying or constrained within the T. annulata population. Results Strong evidence is provided that the sub-telomerically encoded SVSP family and the host-nucleus targeted TashAT family have evolved under contrasting pressures within natural T. annulata populations. SVSP genes were found to possess atypical codon usage and be evolving neutrally, with high levels of nucleotide substitutions and multiple indels. No evidence of geographical sub-structuring of allelic sequences was found. In contrast, TashAT family genes, implicated in control of host cell gene expression, are strongly conserved at the protein level and geographically sub-structured allelic sequences were identified among Tunisian and Turkish isolates. Although different copy numbers of DNA binding motifs were identified in alleles of TashAT proteins, motif periodicity was strongly maintained, implying conserved functional activity of these sites. Conclusions This analysis provides evidence that two distinct secretome genes families have evolved under contrasting selective pressures. The data supports current hypotheses regarding the biological role of TashAT family proteins in the management of host cell phenotype that may have evolved to allow adaptation of T. annulata to a specific host cell lineage. We provide new evidence of extensive allelic diversity in representative members of the enigmatic SVSP gene family, which supports a putative role for the encoded products in subversion of the host immune response.

2010-01-01

159

Variable suites of non-effector genes are co-regulated in the type III secretion virulence regulon across the Pseudomonas syringae phylogeny.  

PubMed

Pseudomonas syringae is a phylogenetically diverse species of Gram-negative bacterial plant pathogens responsible for crop diseases around the world. The HrpL sigma factor drives expression of the major P. syringae virulence regulon. HrpL controls expression of the genes encoding the structural and functional components of the type III secretion system (T3SS) and the type three secreted effector proteins (T3E) that are collectively essential for virulence. HrpL also regulates expression of an under-explored suite of non-type III effector genes (non-T3E), including toxin production systems and operons not previously associated with virulence. We implemented and refined genome-wide transcriptional analysis methods using cDNA-derived high-throughput sequencing (RNA-seq) data to characterize the HrpL regulon from six isolates of P. syringae spanning the diversity of the species. Our transcriptomes, mapped onto both complete and draft genomes, significantly extend earlier studies. We confirmed HrpL-regulation for a majority of previously defined T3E genes in these six strains. We identified two new T3E families from P. syringae pv. oryzae 1_6, a strain within the relatively underexplored phylogenetic Multi-Locus Sequence Typing (MLST) group IV. The HrpL regulons varied among strains in gene number and content across both their T3E and non-T3E gene suites. Strains within MLST group II consistently express the lowest number of HrpL-regulated genes. We identified events leading to recruitment into, and loss from, the HrpL regulon. These included gene gain and loss, and loss of HrpL regulation caused by group-specific cis element mutations in otherwise conserved genes. Novel non-T3E HrpL-regulated genes include an operon that we show is required for full virulence of P. syringae pv. phaseolicola 1448A on French bean. We highlight the power of integrating genomic, transcriptomic, and phylogenetic information to drive concise functional experimentation and to derive better insight into the evolution of virulence across an evolutionarily diverse pathogen species. PMID:24391493

Mucyn, Tatiana S; Yourstone, Scott; Lind, Abigail L; Biswas, Surojit; Nishimura, Marc T; Baltrus, David A; Cumbie, Jason S; Chang, Jeff H; Jones, Corbin D; Dangl, Jeffery L; Grant, Sarah R

2014-01-01

160

Variable Suites of Non-effector Genes Are Co-regulated in the Type III Secretion Virulence Regulon across the Pseudomonas syringae Phylogeny  

PubMed Central

Pseudomonas syringae is a phylogenetically diverse species of Gram-negative bacterial plant pathogens responsible for crop diseases around the world. The HrpL sigma factor drives expression of the major P. syringae virulence regulon. HrpL controls expression of the genes encoding the structural and functional components of the type III secretion system (T3SS) and the type three secreted effector proteins (T3E) that are collectively essential for virulence. HrpL also regulates expression of an under-explored suite of non-type III effector genes (non-T3E), including toxin production systems and operons not previously associated with virulence. We implemented and refined genome-wide transcriptional analysis methods using cDNA-derived high-throughput sequencing (RNA-seq) data to characterize the HrpL regulon from six isolates of P. syringae spanning the diversity of the species. Our transcriptomes, mapped onto both complete and draft genomes, significantly extend earlier studies. We confirmed HrpL-regulation for a majority of previously defined T3E genes in these six strains. We identified two new T3E families from P. syringae pv. oryzae 1_6, a strain within the relatively underexplored phylogenetic Multi-Locus Sequence Typing (MLST) group IV. The HrpL regulons varied among strains in gene number and content across both their T3E and non-T3E gene suites. Strains within MLST group II consistently express the lowest number of HrpL-regulated genes. We identified events leading to recruitment into, and loss from, the HrpL regulon. These included gene gain and loss, and loss of HrpL regulation caused by group-specific cis element mutations in otherwise conserved genes. Novel non-T3E HrpL-regulated genes include an operon that we show is required for full virulence of P. syringae pv. phaseolicola 1448A on French bean. We highlight the power of integrating genomic, transcriptomic, and phylogenetic information to drive concise functional experimentation and to derive better insight into the evolution of virulence across an evolutionarily diverse pathogen species.

Mucyn, Tatiana S.; Yourstone, Scott; Lind, Abigail L.; Biswas, Surojit; Nishimura, Marc T.; Baltrus, David A.; Cumbie, Jason S.; Chang, Jeff H.; Jones, Corbin D.; Dangl, Jeffery L.; Grant, Sarah R.

2014-01-01

161

Regulation of rugosity and biofilm formation in Vibrio cholerae: comparison of VpsT and VpsR regulons and epistasis analysis of vpsT, vpsR, and hapR.  

PubMed

Vibrio cholerae undergoes phenotypic variation that generates two morphologically different variants, termed smooth and rugose. The transcriptional profiles of the two variants differ greatly, and many of the differentially regulated genes are controlled by a complex regulatory circuitry that includes the transcriptional regulators VpsR, VpsT, and HapR. In this study, we identified the VpsT regulon and compared the VpsT and VpsR regulons to elucidate the contribution of each positive regulator to the rugose variant transcriptional profile and associated phenotypes. We have found that although the VpsT and VpsR regulons are very similar, the magnitude of the gene regulation accomplished by each regulator is different. We also determined that cdgA, which encodes a GGDEF domain protein, is partially responsible for the altered vps gene expression between the vpsT and vpsR mutants. Analysis of epistatic relationships among hapR, vpsT, and vpsR with respect to a whole-genome expression profile, colony morphology, and biofilm formation revealed that vpsR is epistatic to hapR and vpsT. Expression of virulence genes was increased in a vpsR hapR double mutant relative to a hapR mutant, suggesting that VpsR negatively regulates virulence gene expression in the hapR mutant. These results show that a complex regulatory interplay among VpsT, VpsR, HapR, and GGDEF/EAL family proteins controls transcription of the genes required for Vibrio polysaccharide and virulence factor production in V. cholerae. PMID:17071756

Beyhan, Sinem; Bilecen, Kivanc; Salama, Sofie R; Casper-Lindley, Catharina; Yildiz, Fitnat H

2007-01-01

162

Regulation of Rugosity and Biofilm Formation in Vibrio cholerae: Comparison of VpsT and VpsR Regulons and Epistasis Analysis of vpsT, vpsR, and hapR? †  

PubMed Central

Vibrio cholerae undergoes phenotypic variation that generates two morphologically different variants, termed smooth and rugose. The transcriptional profiles of the two variants differ greatly, and many of the differentially regulated genes are controlled by a complex regulatory circuitry that includes the transcriptional regulators VpsR, VpsT, and HapR. In this study, we identified the VpsT regulon and compared the VpsT and VpsR regulons to elucidate the contribution of each positive regulator to the rugose variant transcriptional profile and associated phenotypes. We have found that although the VpsT and VpsR regulons are very similar, the magnitude of the gene regulation accomplished by each regulator is different. We also determined that cdgA, which encodes a GGDEF domain protein, is partially responsible for the altered vps gene expression between the vpsT and vpsR mutants. Analysis of epistatic relationships among hapR, vpsT, and vpsR with respect to a whole-genome expression profile, colony morphology, and biofilm formation revealed that vpsR is epistatic to hapR and vpsT. Expression of virulence genes was increased in a vpsR hapR double mutant relative to a hapR mutant, suggesting that VpsR negatively regulates virulence gene expression in the hapR mutant. These results show that a complex regulatory interplay among VpsT, VpsR, HapR, and GGDEF/EAL family proteins controls transcription of the genes required for Vibrio polysaccharide and virulence factor production in V. cholerae.

Beyhan, Sinem; Bilecen, Kivanc; Salama, Sofie R.; Casper-Lindley, Catharina; Yildiz, Fitnat H.

2007-01-01

163

Direct stimulus perception and transcription activation by a membrane-bound DNA binding protein  

Microsoft Academic Search

Summary Few membrane proteins with a role in transcriptional regulation have been studied, and none are able to perceive their respective stimuli and activate tran- scription of their regulons without the aid of auxiliary proteins. The bacitracin resistance regulator, BcrR, of Enterococcus faecalis is a membrane-bound DNA binding protein and is required for bacitracin- dependent expression of the bacitracin resistance

Susanne Gebhard; Ahmed Gaballa; John D. Helmann; Gregory M. Cook

2009-01-01

164

Investigation of the malE promoter and MalR, a positive regulator of the maltose regulon, for an improved expression system in Sulfolobus acidocaldarius.  

PubMed

In this study, the regulator MalR (Saci_1161) of the TrmB family from Sulfolobus acidocaldarius was identified and was shown to be involved in transcriptional control of the maltose regulon (Saci_1660 to Saci_1666), including the ABC transporter (malEFGK), ?-amylase (amyA), and ?-glycosidase (malA). The ?malR deletion mutant exhibited a significantly decreased growth rate on maltose and dextrin but not on sucrose. The expression of the genes organized in the maltose regulon was induced only in the presence of MalR and maltose in the growth medium, indicating that MalR, in contrast to its TrmB and TrmB-like homologues, is an activator of the maltose gene cluster. Electrophoretic mobility shift assays revealed that the binding of MalR to malE was independent of sugars. Here we report the identification of the archaeal maltose regulator protein MalR, which acts as an activator and controls the expression of genes involved in maltose transport and metabolic conversion in S. acidocaldarius, and its use for improvement of the S. acidocaldarius expression system under the control of an optimized maltose binding protein (malE) promoter by promoter mutagenesis. PMID:24271181

Wagner, Michaela; Wagner, Alexander; Ma, Xiaoqing; Kort, Julia Christin; Ghosh, Abhrajyoti; Rauch, Bernadette; Siebers, Bettina; Albers, Sonja-Verena

2014-02-01

165

Proteomic analysis of the quorum-sensing regulon in Pantoea stewartii and identification of direct targets of EsaR.  

PubMed

The proteobacterium Pantoea stewartii subsp. stewartii causes Stewart's wilt disease in maize when it colonizes the xylem and secretes large amounts of stewartan, an exopolysaccharide. The success of disease pathogenesis lies in the timing of bacterial virulence factor expression through the different stages of infection. Regulation is achieved through a quorum-sensing (QS) system consisting of the acyl-homoserine lactone (AHL) synthase, EsaI, and the transcription regulator EsaR. At low cell densities, EsaR represses transcription of itself and of rcsA, an activator of the stewartan biosynthesis operon; it also activates esaS, which encodes a small RNA (sRNA). Repression or activation ceases at high cell densities when EsaI synthesizes sufficient levels of the AHL ligand N-3-oxo-hexanoyl-L-homoserine lactone to bind and inactivate EsaR. This study aims to identify other genes activated or repressed by EsaR during the QS response. Proteomic analysis identified a QS regulon of more than 30 proteins. Electrophoretic mobility shift assays of promoters of genes encoding differentially expressed proteins distinguished direct targets of EsaR from indirect targets. Additional quantitative reverse transcription-PCR (qRT-PCR) and DNA footprinting analysis established that EsaR directly regulates the promoters of dkgA, glpF, and lrhA. The proteins encoded by dkgA, glpF, and lrhA are a 2,5-diketogluconate reductase, glycerol facilitator, and transcriptional regulator of chemotaxis and motility, respectively, indicating a more global QS response in P. stewartii than previously recognized. PMID:23913428

Ramachandran, Revathy; Stevens, Ann M

2013-10-01

166

Peroxidase catalysed cross-linking of an intrinsically unstructured protein via dityrosine bonds in the oocyst wall of the apicomplexan parasite, Eimeria maxima  

Microsoft Academic Search

Apicomplexan parasites such as Eimeria maxima possess a resilient oocyst wall that protects them upon excretion in host faeces and in the outside world, allowing them to survive between hosts. The wall is formed from the contents of specialised organelles – wall-forming bodies – found in macrogametes of the parasites. The presence of dityrosine in the oocyst wall suggests that

Kelly Mai; Nicholas C. Smith; Zhi-Ping Feng; Marilyn Katrib; Jan Šlapeta; Iveta Šlapetova; Michael G. Wallach; Catherine Luxford; Michael J. Davies; Xuecheng Zhang; Raymond S. Norton; Sabina I. Belli

2011-01-01

167

Transcriptomic Analysis Reveals Evidence for a Cryptic Plastid in the Colpodellid Voromonas pontica, a Close Relative of Chromerids and Apicomplexan Parasites  

PubMed Central

Colpodellids are free-living, predatory flagellates, but their close relationship to photosynthetic chromerids and plastid-bearing apicomplexan parasites suggests they were ancestrally photosynthetic. Colpodellids may therefore retain a cryptic plastid, or they may have lost their plastids entirely, like the apicomplexan Cryptosporidium. To find out, we generated transcriptomic data from Voromonas pontica ATCC 50640 and searched for homologs of genes encoding proteins known to function in the apicoplast, the non-photosynthetic plastid of apicomplexans. We found candidate genes from multiple plastid-associated pathways including iron-sulfur cluster assembly, isoprenoid biosynthesis, and tetrapyrrole biosynthesis, along with a plastid-type phosphate transporter gene. Four of these sequences include the 5? end of the coding region and are predicted to encode a signal peptide and a transit peptide-like region. This is highly suggestive of targeting to a cryptic plastid. We also performed a taxon-rich phylogenetic analysis of small subunit ribosomal RNA sequences from colpodellids and their relatives, which suggests that photosynthesis was lost more than once in colpodellids, and independently in V. pontica and apicomplexans. Colpodellids therefore represent a valuable source of comparative data for understanding the process of plastid reduction in humanity's most deadly parasite.

Gile, Gillian H.; Slamovits, Claudio H.

2014-01-01

168

Genomic reconstruction of transcriptional regulatory networks in lactic acid bacteria  

PubMed Central

Background Genome scale annotation of regulatory interactions and reconstruction of regulatory networks are the crucial problems in bacterial genomics. The Lactobacillales order of bacteria collates various microorganisms having a large economic impact, including both human and animal pathogens and strains used in the food industry. Nonetheless, no systematic genome-wide analysis of transcriptional regulation has been previously made for this taxonomic group. Results A comparative genomics approach was used for reconstruction of transcriptional regulatory networks in 30 selected genomes of lactic acid bacteria. The inferred networks comprise regulons for 102 orthologous transcription factors (TFs), including 47 novel regulons for previously uncharacterized TFs. Numerous differences between regulatory networks of the Streptococcaceae and Lactobacillaceae groups were described on several levels. The two groups are characterized by substantially different sets of TFs encoded in their genomes. Content of the inferred regulons and structure of their cognate TF binding motifs differ for many orthologous TFs between the two groups. Multiple cases of non-orthologous displacements of TFs that control specific metabolic pathways were reported. Conclusions The reconstructed regulatory networks substantially expand the existing knowledge of transcriptional regulation in lactic acid bacteria. In each of 30 studied genomes the obtained regulatory network contains on average 36 TFs and 250 target genes that are mostly involved in carbohydrate metabolism, stress response, metal homeostasis and amino acids biosynthesis. The inferred networks can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. All reconstructed regulons are captured within the Streptococcaceae and Lactobacillaceae collections in the RegPrecise database (http://regprecise.lbl.gov).

2013-01-01

169

Hierarchical gene regulatory systems arising from fortuitous gene associations: controlling quorum sensing by the opine regulon in Agrobacterium.  

PubMed

Conjugation of the Agrobacterium Ti plasmid pTiC58 is regulated by a hierarchy involving induction by the opines agrocinopines A and B and a quorum-sensing system. Regulation by the opines is mediated by the repressor AccR, while quorum sensing is effected by the transcriptional activator TraR and its ligand, the acyl-homoserine lactone signal molecule Agrobacterium autoinducer (AAI). These last two elements combine to activate expression of the tra system at high population densities. Sequence analysis indicated that traR is the fourth gene of an operon, which we named arc, that is transcribed divergently from accR. Complementation analysis of mutations in the genes 5' to traR showed that the other members of the arc operon are not required for conjugation. Analysis of lacZ reporter fusions demonstrated that traR expression is regulated directly by AccR. Deletion analysis showed that AccR-regulated expression of traR initiates from a promoter located in the intergenic region between accR and orfA, the first gene of the arc operon. Reverse transcriptase-polymerase chain reaction (RT-PCR) and primer extension analyses indicated that the arc transcript initiates upstream of orfA and proceeds uninterrupted through traR. These results are consistent with a model in which quorum sensing is subordinate to the opine regulon because traR has become associated with an operon controlled by the opine-responsive transcriptional regulator. PMID:10361309

Piper, K R; Beck Von Bodman, S; Hwang, I; Farrand, S K

1999-06-01

170

The Mycobacterium tuberculosis DosR Regulon Assists in Metabolic Homeostasis and Enables Rapid Recovery from Nonrespiring Dormancy ? †  

PubMed Central

Mycobacterium tuberculosis survives in latently infected individuals, likely in a nonreplicating or dormancy-like state. The M. tuberculosis DosR regulon is a genetic program induced by conditions that inhibit aerobic respiration and prevent bacillus replication. In this study, we used a mutant incapable of DosR regulon induction to investigate the contribution of this regulon to bacterial metabolism during anaerobic dormancy. Our results confirm that the DosR regulon is essential for M. tuberculosis survival during anaerobic dormancy and demonstrate that it is required for metabolic processes that occur upon entry into and throughout the dormant state. Specifically, we showed that regulon mechanisms shift metabolism away from aerobic respiration in the face of dwindling oxygen availability and are required for maintaining energy levels and redox balance as the culture becomes anaerobic. We also demonstrated that the DosR regulon is crucial for rapid resumption of growth once M. tuberculosis exits an anaerobic or nitric oxide-induced nonrespiring state. In summary, the DosR regulon encodes novel metabolic mechanisms essential for M. tuberculosis to survive in the absence of respiration and to successfully transition rapidly between respiring and nonrespiring conditions without loss of viability.

Leistikow, Rachel L.; Morton, Russell A.; Bartek, Iona L.; Frimpong, Isaac; Wagner, Karleen; Voskuil, Martin I.

2010-01-01

171

The Mycobacterium tuberculosis DosR regulon assists in metabolic homeostasis and enables rapid recovery from nonrespiring dormancy.  

PubMed

Mycobacterium tuberculosis survives in latently infected individuals, likely in a nonreplicating or dormancy-like state. The M. tuberculosis DosR regulon is a genetic program induced by conditions that inhibit aerobic respiration and prevent bacillus replication. In this study, we used a mutant incapable of DosR regulon induction to investigate the contribution of this regulon to bacterial metabolism during anaerobic dormancy. Our results confirm that the DosR regulon is essential for M. tuberculosis survival during anaerobic dormancy and demonstrate that it is required for metabolic processes that occur upon entry into and throughout the dormant state. Specifically, we showed that regulon mechanisms shift metabolism away from aerobic respiration in the face of dwindling oxygen availability and are required for maintaining energy levels and redox balance as the culture becomes anaerobic. We also demonstrated that the DosR regulon is crucial for rapid resumption of growth once M. tuberculosis exits an anaerobic or nitric oxide-induced nonrespiring state. In summary, the DosR regulon encodes novel metabolic mechanisms essential for M. tuberculosis to survive in the absence of respiration and to successfully transition rapidly between respiring and nonrespiring conditions without loss of viability. PMID:20023019

Leistikow, Rachel L; Morton, Russell A; Bartek, Iona L; Frimpong, Isaac; Wagner, Karleen; Voskuil, Martin I

2010-03-01

172

The MetJ regulon in gammaproteobacteria determined by comparative genomics methods  

PubMed Central

Background Whole-genome sequencing of bacteria has proceeded at an exponential pace but annotation validation has lagged behind. For instance, the MetJ regulon, which controls methionine biosynthesis and transport, has been studied almost exclusively in E. coli and Salmonella, but homologs of MetJ exist in a variety of other species. These include some that are pathogenic (e.g. Yersinia) and some that are important for environmental remediation (e.g. Shewanella) but many of which have not been extensively characterized in the literature. Results We have determined the likely composition of the MetJ regulon in all species which have MetJ homologs using bioinformatics techniques. We show that the core genes known from E. coli are consistently regulated in other species, and we identify previously unknown members of the regulon. These include the cobalamin transporter, btuB; all the genes involved in the methionine salvage pathway; as well as several enzymes and transporters of unknown specificity. Conclusions The MetJ regulon is present and functional in five orders of gammaproteobacteria: Enterobacteriales, Pasteurellales, Vibrionales, Aeromonadales and Alteromonadales. New regulatory activity for MetJ was identified in the genomic data and verified experimentally. This strategy should be applicable for the elucidation of regulatory pathways in other systems by using the extensive sequencing data currently being generated.

2011-01-01

173

BCKDH: The Missing Link in Apicomplexan Mitochondrial Metabolism Is Required for Full Virulence of Toxoplasma gondii and Plasmodium berghei  

PubMed Central

While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens.

Oppenheim, Rebecca D.; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P.; Billker, Oliver; McConville, Malcolm J.; Soldati-Favre, Dominique

2014-01-01

174

BCKDH: The Missing Link in Apicomplexan Mitochondrial Metabolism Is Required for Full Virulence of Toxoplasma gondii and Plasmodium berghei.  

PubMed

While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens. PMID:25032958

Oppenheim, Rebecca D; Creek, Darren J; Macrae, James I; Modrzynska, Katarzyna K; Pino, Paco; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P; Billker, Oliver; McConville, Malcolm J; Soldati-Favre, Dominique

2014-07-01

175

Characterization of the regulon controlled by the leucine-responsive regulatory protein in Escherichia coli.  

PubMed Central

The leucine-responsive regulatory protein (Lrp) has been shown to regulate, either positively or negatively, the transcription of several Escherichia coli genes in response to leucine. We have used two-dimensional gel electrophoresis to analyze the patterns of polypeptide expression in isogenic lrp+ and lrp mutant strains in the presence or absence of leucine. The absence of a functional Lrp protein alters the expression of at least 30 polypeptides. The expression of the majority of these polypeptides is not affected by the presence or absence of 10 mM exogenous leucine. Outer membrane porins OmpC and OmpF, glutamine synthetase (GlnA), the small subunit of glutamate synthase (GltD), lysyl-tRNA synthetase form II (LysU), a high-affinity periplasmic binding protein specific for branched-chain amino acids (LivJ), W protein, and the enzymes of the pathway converting threonine to glycine, namely, threonine dehydrogenase (Tdh) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), were identified as members of the Lrp regulon by electrophoretic analysis. We have shown that Lrp is a positive regulator of glutamate synthase and glutamine synthetase and that exogenous leucine has little or no effect on the expression of these proteins. In strains carrying a glnL deletion and in strains carrying the glnL2302 allele, which directs the synthesis of a GlnL protein that is constitutively active, expression of glutamine synthetase is no longer regulated by Lrp, demonstrating that the effect of Lrp on glutamine synthetase levels is indirect and requires an intact glnL gene. lrp::Tn10 strains grow poorly when arginine or ornithine is present as the sole nitrogen source in the medium. On the bases of present studies and previous research, we propose that Lrp is involved in the adaptation of E. coli cells to major shifts in environment, such as those which occur when E. coli leaves the intestinal tract of its animal host. Several genes required for amino acid and peptide transport and catabolism are negatively regulated by Lrp, and other genes required for amino acid biosynthesis and ammonia assimilation in a nitrogen-poor environment are positively regulated by Lrp. Images

Ernsting, B R; Atkinson, M R; Ninfa, A J; Matthews, R G

1992-01-01

176

RivR and the small RNA RivX: the missing links between the CovR regulatory cascade and the Mga regulon.  

PubMed

The CovR/S two-component system regulates the transcription of many genes that are crucial for the virulence of Streptococcus pyogenes (group A Streptococcus, GAS). Previously, we demonstrated that one gene repressed directly by CovR is rivR, which encodes a member of the RofA-like family of transcriptional regulators. In this study, we deleted rivR and its downstream gene rivX in a DeltacovR background. Microarray analysis revealed that the products of the rivRX locus exert positive control over the transcription of members of the Mga regulon. Using mutational analysis, we established that rivX encodes a small regulatory RNA. We found that RivR enhances transcriptional activation by Mga in vivo and in vitro. An M1 DeltacovRDeltarivRX strain is attenuated for virulence in a murine model of invasive soft tissue infection and this attenuation is complemented by rivRX expressed from a plasmid, demonstrating the importance of the rivRX locus in pathogenesis. This study provides the first link between the CovR and Mga regulatory networks. By integrating the signals received through these two global regulators, GAS is able to select from its repertoire different combinations of specific virulence factors to express in response to a broad spectrum of environmental conditions. PMID:18005100

Roberts, Samantha A; Scott, June R

2007-12-01

177

The FlgS/FlgR two-component signal transduction system regulates the fla regulon in Campylobacter jejuni.  

PubMed

The human pathogen Campylobacter jejuni is a highly motile organism that carries a flagellum on each pole. The flagellar motility is regarded as an important trait in C. jejuni colonization of the intestinal tract, however, the knowledge of the regulation of this important colonization factor is rudimentary. We demonstrate by phosphorylation assays that the sensor FlgS and the response regulator FlgR form a two-component system that is on the top of the Campylobacter flagellum hierarchy. Phosphorylated FlgR is needed to activate RpoN-dependent genes of which the products form the hook-basal body filament complex. By real-time reverse transcriptase-PCR we identified that FlgS, FlgR, RpoN, and FliA belong to the early flagellar genes and are regulated by sigma70. FliD and the putative anti-sigma-factor FlgM are regulated by a sigma54- and sigma28-dependent promoters. Activation of the fla regulon is growth phase-dependent, a 100-fold rpoN mRNA reduction is seen in the early stationary phase compared with the early logarithmic phase. Whereas flaB transcription decreases, flaA transcription increases in early stationary phase. Our data show that the C. jejuni flagellar hierarchy largely differs from that of other bacteria. Phenotypical analysis revealed that unflagellated C. jejuni mutants grow three times faster in broth medium compared with wild-type bacteria. In vivo the C. jejuni flagella are needed to pass the gastrointestinal tract of chickens, but not to colonize the ceaca of the chicken. PMID:14960570

Wösten, Marc M S M; Wagenaar, Jaap A; van Putten, Jos P M

2004-04-16

178

Involvement and necessity of the Cpx regulon in the event of aberrant ?-barrel outer membrane protein assembly  

PubMed Central

Summary The Cpx and ?E regulons help maintain outer membrane integrity; the Cpx pathway monitors the biogenesis of cell surface structures, such as pili, while the ?E pathway monitors the biogenesis of ?-barrel outer membrane proteins (OMPs). In this study we revealed the importance of the Cpx regulon in the event of ?-barrel OMP mis-assembly, by utilizing mutants expressing either a defective ?-barrel OMP assembly machinery (Bam) or assembly defective ?-barrel OMPs. Analysis of specific mRNAs showed that ?cpxR bam double mutants failed to induce degP expression beyond the wild type level, despite activation of the ?E pathway. The synthetic conditional lethal phenotype of ?cpxR in mutant Bam or ?-barrel OMP backgrounds was reversed by wild type DegP expressed from a heterologous plasmid promoter. Consistent with the involvement of the Cpx regulon in the event of aberrant ?-barrel OMP assembly, the expression of cpxP, the archetypal member of the cpx regulon, was upregulated in defective Bam backgrounds or in cells expressing a single assembly-defective ?-barrel OMP species. Together, these results showed that both the Cpx and ?E regulons are required to reduce envelope stress caused by aberrant ?-barrel OMP assembly, with the Cpx regulon principally contributing by controlling degP expression.

Gerken, Henri; Leiser, Owen P.; Bennion, Drew; Misra, Rajeev

2010-01-01

179

Involvement and necessity of the Cpx regulon in the event of aberrant beta-barrel outer membrane protein assembly.  

PubMed

The Cpx and sigma(E) regulons help maintain outer membrane integrity; the Cpx pathway monitors the biogenesis of cell surface structures, such as pili, while the sigma(E) pathway monitors the biogenesis of beta-barrel outer membrane proteins (OMPs). In this study we revealed the importance of the Cpx regulon in the event of beta-barrel OMP mis-assembly, by utilizing mutants expressing either a defective beta-barrel OMP assembly machinery (Bam) or assembly defective beta-barrel OMPs. Analysis of specific mRNAs showed that Delta cpxR bam double mutants failed to induce degP expression beyond the wild type level, despite activation of the sigma(E) pathway. The synthetic conditional lethal phenotype of Delta cpxR in mutant Bam or beta-barrel OMP backgrounds was reversed by wild type DegP expressed from a heterologous plasmid promoter. Consistent with the involvement of the Cpx regulon in the event of aberrant beta-barrel OMP assembly, the expression of cpxP, the archetypal member of the cpx regulon, was upregulated in defective Bam backgrounds or in cells expressing a single assembly-defective beta-barrel OMP species. Together, these results showed that both the Cpx and sigma(E) regulons are required to reduce envelope stress caused by aberrant beta-barrel OMP assembly, with the Cpx regulon principally contributing by controlling degP expression. PMID:20487295

Gerken, Henri; Leiser, Owen P; Bennion, Drew; Misra, Rajeev

2010-02-01

180

Posttranscriptional operons and regulons co-ordinating gene expression  

Microsoft Academic Search

Experiments reported over the past several years, including genome-wide microarray approaches, have demonstrated that many eukaryotic RNA-binding proteins (RBPs) associate with multiple messenger RNAs (mRNAs) both in vitro and in vivo. This multitargeted binding property of RBPs has led to a model of regulated gene expression in eukaryotes that we termed the post-transcriptional operon. This concept was established by an

Jack D. Keene; Patrick J. Lager

2005-01-01

181

Identification of a CO2 Responsive Regulon in Bordetella  

PubMed Central

Sensing the environment allows pathogenic bacteria to coordinately regulate gene expression to maximize survival within or outside of a host. Here we show that Bordetella species regulate virulence factor expression in response to carbon dioxide levels that mimic in vivo conditions within the respiratory tract. We found strains of Bordetella bronchiseptica that did not produce adenylate cyclase toxin (ACT) when grown in liquid or solid media with ambient air aeration, but produced ACT and additional antigens when grown in air supplemented to 5% CO2. Transcriptome analysis and quantitative real time-PCR analysis revealed that strain 761, as well as strain RB50, increased transcription of genes encoding ACT, filamentous hemagglutinin (FHA), pertactin, fimbriae and the type III secretion system in 5% CO2 conditions, relative to ambient air. Furthermore, transcription of cyaA and fhaB in response to 5% CO2 was increased even in the absence of BvgS. In vitro analysis also revealed increases in cytotoxicity and adherence when strains were grown in 5% CO2. The human pathogens B. pertussis and B. parapertussis also increased transcription of several virulence factors when grown in 5% CO2, indicating that this response is conserved among the classical bordetellae. Together, our data indicate that Bordetella species can sense and respond to physiologically relevant changes in CO2 concentrations by regulating virulence factors important for colonization, persistence and evasion of the host immune response.

Hester, Sara E.; Lui, Minghsun; Nicholson, Tracy; Nowacki, Daryl; Harvill, Eric T.

2012-01-01

182

The Gal3p transducer of the GAL regulon interacts with the Gal80p repressor in its ligand-induced closed conformation  

PubMed Central

A wealth of genetic information and some biochemical analysis have made the GAL regulon of the yeast Saccharomyces cerevisiae a classic model system for studying transcriptional activation in eukaryotes. Galactose induces this transcriptional switch, which is regulated by three proteins: the transcriptional activator Gal4p, bound to DNA; the repressor Gal80p; and the transducer Gal3p. We showed previously that NADP appears to act as a trigger to kick the repressor off the activator. Sustained activation involves a complex of the transducer Gal3p and Gal80p mediated by galactose and ATP. We solved the crystal structure of the complex of Gal3p–Gal80p with ?-D-galactose and ATP to 2.1 Ĺ resolution. The interaction between the proteins occurs only when Gal3p is in a “closed” state induced by ligand binding. The structure of the complex provides a rationale for the phenotypes of several well-known Gal80p and Gal3p mutants as well as the lack of galactokinase activity of Gal3p.

Lavy, Tali; Kumar, P. Rajesh; He, Hongzhen; Joshua-Tor, Leemor

2012-01-01

183

The Gal3p transducer of the GAL regulon interacts with the Gal80p repressor in its ligand-induced closed conformation.  

PubMed

A wealth of genetic information and some biochemical analysis have made the GAL regulon of the yeast Saccharomyces cerevisiae a classic model system for studying transcriptional activation in eukaryotes. Galactose induces this transcriptional switch, which is regulated by three proteins: the transcriptional activator Gal4p, bound to DNA; the repressor Gal80p; and the transducer Gal3p. We showed previously that NADP appears to act as a trigger to kick the repressor off the activator. Sustained activation involves a complex of the transducer Gal3p and Gal80p mediated by galactose and ATP. We solved the crystal structure of the complex of Gal3p-Gal80p with ?-D-galactose and ATP to 2.1 Ĺ resolution. The interaction between the proteins occurs only when Gal3p is in a "closed" state induced by ligand binding. The structure of the complex provides a rationale for the phenotypes of several well-known Gal80p and Gal3p mutants as well as the lack of galactokinase activity of Gal3p. PMID:22302941

Lavy, Tali; Kumar, P Rajesh; He, Hongzhen; Joshua-Tor, Leemor

2012-02-01

184

Genome-Wide Analysis of Cell Type-Specific Gene Transcription during Spore Formation in Clostridium difficile  

PubMed Central

Clostridium difficile, a Gram positive, anaerobic, spore-forming bacterium is an emergent pathogen and the most common cause of nosocomial diarrhea. Although transmission of C. difficile is mediated by contamination of the gut by spores, the regulatory cascade controlling spore formation remains poorly characterized. During Bacillus subtilis sporulation, a cascade of four sigma factors, ?F and ?G in the forespore and ?E and ?K in the mother cell governs compartment-specific gene expression. In this work, we combined genome wide transcriptional analyses and promoter mapping to define the C. difficile ?F, ?E, ?G and ?K regulons. We identified about 225 genes under the control of these sigma factors: 25 in the ?F regulon, 97 ?E-dependent genes, 50 ?G-governed genes and 56 genes under ?K control. A significant fraction of genes in each regulon is of unknown function but new candidates for spore coat proteins could be proposed as being synthesized under ?E or ?K control and detected in a previously published spore proteome. SpoIIID of C. difficile also plays a pivotal role in the mother cell line of expression repressing the transcription of many members of the ?E regulon and activating sigK expression. Global analysis of developmental gene expression under the control of these sigma factors revealed deviations from the B. subtilis model regarding the communication between mother cell and forespore in C. difficile. We showed that the expression of the ?E regulon in the mother cell was not strictly under the control of ?F despite the fact that the forespore product SpoIIR was required for the processing of pro-?E. In addition, the ?K regulon was not controlled by ?G in C. difficile in agreement with the lack of pro-?K processing. This work is one key step to obtain new insights about the diversity and evolution of the sporulation process among Firmicutes.

Saujet, Laure; Soutourina, Olga; Monot, Marc; Shelyakin, Pavel V.; Gelfand, Mikhail S.; Dupuy, Bruno; Henriques, Adriano O.; Martin-Verstraete, Isabelle

2013-01-01

185

Nitrogen fixation in acidophile iron-oxidizing bacteria: The nif regulon of Leptospirillum ferrooxidans  

Microsoft Academic Search

The Gram-negative iron-oxidizing bacterium Leptospirillum ferrooxidans contains all genes necessary for nitrogen fixation, from genes encoding the Mo–Fe nitrogenase, the specific regulator (nifA), global regulators like glnB and ntrC like genes, to other sensors and transport systems somehow related to nitrogen assimilation. We review current knowledge about the nif regulon and its connection with other metabolic functions in L. ferrooxidans.

V??ctor Parro; Mercedes Moreno-Paz

2004-01-01

186

Comparative Proteomic Analysis of the PhoP Regulon in Salmonella enterica Serovar Typhi Versus Typhimurium  

Microsoft Academic Search

BackgroundS. Typhi, a human-restricted Salmonella enterica serovar, causes a systemic intracellular infection in humans (typhoid fever). In comparison, S. Typhimurium causes gastroenteritis in humans, but causes a systemic typhoidal illness in mice. The PhoP regulon is a well studied two component (PhoP\\/Q) coordinately regulated network of genes whose expression is required for intracellular survival of S. enterica.Methodology\\/Principal FindingsUsing high performance

Richelle C. Charles; Jason B. Harris; Michael R. Chase; Lauren M. Lebrun; Alaullah Sheikh; Regina C. Larocque; Tanya Logvinenko; Sean M. Rollins; Abdullah Tarique; Elizabeth L. Hohmann; Ian Rosenberg; Bryan Krastins; David A. Sarracino; Firdausi Qadri; Stephen B. Calderwood; Edward T. Ryan; Niyaz Ahmed

2009-01-01

187

Cohabitation of Two Different lexA Regulons in Pseudomonas putida  

Microsoft Academic Search

In contrast to the vast majority of the members of the domain Bacteria, several Pseudomonas and Xanthomo- nas species have two lexA genes, whose products have been shown to recognize different LexA binding motifs, making them an interesting target for studying the interplay between cohabiting LexA regulons in a single species. Here we report an analysis of the genetic composition

Marc Abella; Susana Campoy; Ivan Erill; Fernando Rojo; Jordi Barbe ´

2007-01-01

188

Modulation of activation-associated host cell gene expression by the apicomplexan parasite Theileria annulata  

PubMed Central

Summary Infection of bovine leucocytes by Theileria annulata results in establishment of transformed, infected cells. Infection of the host cell is known to promote constitutive activation of pro-inflammatory transcription factors that have the potential to be beneficial or detrimental. In this study we have compared the effect of LPS activation on uninfected bovine leucocytes (BL20 cells) and their Theileria-infected counterpart (TBL20). Gene expression profiles representing activated uninfected BL20 relative to TBL20 cells were also compared. The results show that while prolonged stimulation with LPS induces cell death and activation of NF-?B in BL20 cells, the viability of Theileria-infected cells was unaffected. Analysis of gene expression networks provided evidence that the parasite establishes tight control over pathways associated with cellular activation by modulating reception of extrinsic stimuli and by significantly altering the expression outcome of genes targeted by infection-activated transcription factors. Pathway analysis of the data set identified novel candidate genes involved in manipulation of cellular functions associated with the infected transformed cell. The data indicate that the T. annulata parasite can irreversibly reconfigure host cell gene expression networks associated with development of inflammatory disease and cancer to generate an outcome thatis beneficial to survival and propagation of the infected leucocyte.

Durrani, Zeeshan; Weir, William; Pillai, Sreerekha; Kinnaird, Jane; Shiels, Brian

2012-01-01

189

Functional analysis of Ralstonia solanacearum PrhG regulating the hrp regulon in host plants.  

PubMed

Genes in the hrp regulon encode component proteins of the type III secretion system and are essential for the pathogenicity of Ralstonia solanacearum. The hrp regulon is controlled by HrpB. We isolated several genes regulating hrpB expression from the Japanese strain OE1-1 using minitransposon mutagenesis. Among them, we mainly focused on two genes, hrpG and prhG, which are the positive regulators of hrpB. Although the global virulence regulator PhcA negatively regulated hrpG expression via prhIR, it positively regulated prhG expression. We further investigated the contrasting regulation of hrpG and prhG by PhcA and speculated that R. solanacearum may switch from HrpG to PrhG for hrpB activation in a cell density-dependent manner. Although the prhG mutant proliferated similarly to the wild-type in leaf intercellular spaces and in xylem vessels of the host plants, it was less virulent than the wild-type. The expression of the popA operon, which belongs to the hrp regulon, was significantly reduced in the prhG mutant by more than half in the leaf intercellular spaces and more than two-thirds in the xylem vessels when compared with the wild-type. PMID:23704782

Zhang, Yong; Chen, Li; Yoshimochi, Takeshi; Kiba, Akinori; Hikichi, Yasufumi; Ohnishi, Kouhei

2013-08-01

190

In silico analysis of DosR regulon proteins of Mycobacterium tuberculosis.  

PubMed

One of the challenges faced by Mycobacterium tuberculosis (M. tuberculosis) in dormancy is hypoxia. DosR/DevR of M. tuberculosis is a two component dormancy survival response regulator which induces the expression of 48 genes. In this study, we have used DosR regulon proteins of M. tuberculosis H37Rv as the query set and performed a comprehensive homology search against the non-redundant database. Homologs were found in environmental mycobacteria, environmental bacteria and archaebacteria. Analysis of genomic context of DosR regulon revealed that they are distributed as nine blocks in the genome of M. tuberculosis with many transposases and integrases in their vicinity. Further, we classified DosR regulon proteins into eight functional categories. One of the hypothetical proteins Rv1998c could probably be a methylisocitrate lyase or a phosphonomutase. Another hypothetical protein, Rv0572 was found only in mycobacteria. Insights gained in this study can potentially aid in the development of novel therapeutic interventions. PMID:22759512

Selvaraj, Suganya; Sambandam, Vaishnavi; Sardar, Dipasri; Anishetty, Sharmila

2012-09-10

191

Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL).  

PubMed

In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt-pbuX operons) are controlled by the PurR repressor, which inhibits transcription initiation. Other genes are regulated by a less-well-described transcription termination mechanism that responds to the presence of hypoxanthine and guanine. The pur operon and the xpt-pbuX operon, which were studied here, are regulated by both mechanisms. We isolated two mutants resistant to 2-fluoroadenine in which the pur operon and the xpt-pbuX operon are expressed at increased levels in a PurR-independent manner. The mutations were caused by deletions that disrupted a potential transcription terminator structure located immediately upstream of the ydhL gene. The 5' part of the ydhL leader region contained a 63-nucleotide (nt) sequence very similar to the 5' ends of the leaders of the pur and xpt-pbuX operons. Transcripts of these regions may form a common tandem stem-loop secondary structure. Two additional genes with potential leader regions containing the 63-nt sequence are pbuG, encoding a hypoxanthine-guanine transporter, and yxjA, which was shown to encode a purine nucleoside transporter and is renamed nupG. Transcriptional lacZ fusions and mutations in the 63-nt sequence encoding the possible secondary structures provided evidence that expression of the pur and xpt-pbuX operons and expression of the ydhL, nupG, and pbuG genes are regulated by a common mechanism. The new pur regulon is designated the XptR regulon. Except for ydhL, the operons and genes were negatively regulated by hypoxanthine and guanine. ydhL was positively regulated. The derived amino acid sequence encoded by ydhL (now called pbuE) is similar to the amino acid sequences of metabolite efflux pumps. When overexpressed, PbuE lowers the sensitivity to purine analogs. Indirect evidence indicated that PbuE decreases the size of the internal pool of hypoxanthine. This explains why the hypoxanthine- and guanine-regulated genes are expressed at elevated levels in a mutant that overexpresses pbuE. PMID:12923093

Johansen, Lars Engholm; Nygaard, Per; Lassen, Catharina; Agersř, Yvonne; Saxild, Hans H

2003-09-01

192

miRNA Regulons Associated with Synaptic Function  

PubMed Central

Differential RNA localization and local protein synthesis regulate synapse function and plasticity in neurons. MicroRNAs are a conserved class of regulatory RNAs that control mRNA stability and translation in tissues. They are abundant in the brain but the extent into which they are involved in synaptic mRNA regulation is poorly known. Herein, a computational analysis of the coding and 3?UTR regions of 242 presynaptic and 304 postsynaptic proteins revealed that 91% of them are predicted to be microRNA targets. Analysis of the longest 3?UTR isoform of synaptic transcripts showed that presynaptic mRNAs have significantly longer 3?UTR than control and postsynaptic mRNAs. In contrast, the shortest 3?UTR isoform of postsynaptic mRNAs is significantly shorter than control and presynaptic mRNAs, indicating they avert microRNA regulation under specific conditions. Examination of microRNA binding site density of synaptic 3?UTRs revealed that they are twice as dense as the rest of protein-coding transcripts and that approximately 50% of synaptic transcripts are predicted to have more than five different microRNA sites. An interaction map exploring the association of microRNAs and their targets revealed that a small set of ten microRNAs is predicted to regulate 77% and 80% of presynaptic and postsynaptic transcripts, respectively. Intriguingly, many of these microRNAs have yet to be identified outside primate mammals, implicating them in cognition differences observed between high-level primates and non-primate mammals. Importantly, the identified miRNAs have been previously associated with psychotic disorders that are characterized by neural circuitry dysfunction, such as schizophrenia. Finally, molecular dissection of their KEGG pathways showed enrichment for neuronal and synaptic processes. Adding on current knowledge, this investigation revealed the extent of miRNA regulation at the synapse and predicted critical microRNAs that would aid future research on the control of neuronal plasticity and etiology of psychiatric diseases.

Paschou, Maria; Paraskevopoulou, Maria D.; Vlachos, Ioannis S.; Koukouraki, Pelagia; Hatzigeorgiou, Artemis G.; Doxakis, Epaminondas

2012-01-01

193

Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus  

SciTech Connect

Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. Despite the growing number of genome-scale gene expression studies, our abilities to convert the results of these studies into accurate regulatory annotations and to project them from model to other organisms are extremely limited. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. However, even orthologous regulators with conserved DNA-binding motifs may control substantially different gene sets, revealing striking differences in regulatory strategies between the Shewanella spp. and E. coli. Multiple examples of regulatory network rewiring include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), and numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. NagR for N-acetylglucosamine catabolism and PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp).

Rodionov, Dmitry A.; Novichkov, Pavel; Stavrovskaya, Elena D.; Rodionova, Irina A.; Li, Xiaoqing; Kazanov, Marat D.; Ravcheev, Dmitry A.; Gerasimova, Anna V.; Kazakov, Alexey E.; Kovaleva, Galina Y.; Permina, Elizabeth A.; Laikova, Olga N.; Overbeek, Ross; Romine, Margaret F.; Fredrickson, Jim K.; Arkin, Adam P.; Dubchak, Inna; Osterman, Andrei L.; Gelfand, Mikhail S.

2011-06-15

194

Increased Pho regulon activation correlates with decreased virulence of an avian pathogenic Escherichia coli O78 strain.  

PubMed

Avian pathogenic Escherichia coli (APEC) strains are associated with respiratory infections, septicemia, cellulitis, peritonitis, and other conditions, since colibacillosis manifests in many ways. The Pho regulon is jointly controlled by the two-component regulatory system PhoBR and by the phosphate-specific transport (Pst) system. To determine the specific roles of the PhoBR regulon and the Pst system in the pathogenesis of the APEC O78 strain ?7122, different phoBR and pst mutant strains were tested in vivo in chickens and in vitro for virulence traits. Mutations resulting in constitutive activation of the Pho regulon rendered strains more sensitive than the wild type to hydrogen peroxide and to the bactericidal effects of rabbit serum. In addition, production of type 1 fimbriae was also impaired in these strains. Using a chicken competitive infection model, all PhoB constitutive mutants were outcompeted by the wild-type parent, including strains containing a functional Pst system. Cumulative inactivation of the Pst system and the PhoB regulator resulted in a restoration of virulence. In addition, loss of the PhoB regulator alone did not affect virulence in the chicken infection model. Interestingly, the level of attenuation of the mutant strains correlated directly with the level of activation of the Pho regulon. Overall, results indicate that activation of the Pho regulon rather than phosphate transport by the Pst system plays a major role in the attenuation of the APEC O78 strain ?7122. PMID:20921144

Bertrand, Nicolas; Houle, Sébastien; LeBihan, Guillaume; Poirier, Édith; Dozois, Charles M; Harel, Josée

2010-12-01

195

Divergence of the mitochondrial genome structure in the apicomplexan parasites, Babesia and Theileria.  

PubMed

Mitochondrial (mt) genomes from diverse phylogenetic groups vary considerably in size, structure, and organization. The genus Plasmodium, causative agent of malaria, of the phylum Apicomplexa, has the smallest mt genome in the form of a circular and/or tandemly repeated linear element of 6 kb, encoding only three protein genes (cox1, cox3, and cob). The closely related genera Babesia and Theileria also have small mt genomes (6.6 kb) that are monomeric linear with an organization distinct from Plasmodium. To elucidate the structural divergence and evolution of mt genomes between Babesia/Theileria and Plasmodium, we determined five new sequences from Babesia bigemina, B. caballi, B. gibsoni, Theileria orientalis, and T. equi. Together with previously reported sequences of B. bovis, T. annulata, and T. parva, all eight Babesia and Theileria mt genomes are linear molecules with terminal inverted repeats (TIRs) on both ends containing three protein-coding genes (cox1, cox3, and cob) and six large subunit (LSU) ribosomal RNA (rRNA) gene fragments. The organization and transcriptional direction of protein-coding genes and the rRNA gene fragments were completely conserved in the four Babesia species. In contrast, notable variation occurred in the four Theileria species. Although the genome structures of T. annulata and T. parva were nearly identical to those of Babesia, an inversion in the 3-kb central region was found in T. orientalis. Moreover, the T. equi mt genome is the largest (8.2 kb) and most divergent with unusually long TIR sequences, in which cox3 and two LSU rRNA gene fragments are located. The T. equi mt genome showed little synteny to the other species. These results suggest that the Theileria mt genome is highly diverse with lineage-specific evolution in two Theileria species: genome inversion in T. orientalis and gene-embedded long TIR in T. equi. PMID:20034997

Hikosaka, Kenji; Watanabe, Yoh-Ichi; Tsuji, Naotoshi; Kita, Kiyoshi; Kishine, Hiroe; Arisue, Nobuko; Palacpac, Nirianne Marie Q; Kawazu, Shin-Ichiro; Sawai, Hiromi; Horii, Toshihiro; Igarashi, Ikuo; Tanabe, Kazuyuki

2010-05-01

196

Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks  

SciTech Connect

Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the result, we demonstrate considerable interconnection between various nitrogen-oxides-responsive regulatory systems for the denitrification and NO detoxification genes and evolutionary plasticity of this transcriptional network.

Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.; Alm, EricJ.; Gelfand, Mikhail S.

2005-09-01

197

Dissimilatory Metabolism of Nitrogen Oxides in Bacteria: Comparative Reconstruction of Transcriptional Networks  

PubMed Central

Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR, and NnrR; two-component systems NarXL and NarQP; NO-responsive activator NorR; and nitrite-sensitive repressor NsrR. Using comparative genomics approaches, we predict DNA-binding motifs for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA recognition motif. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria, including Clostridia, Thermotogales, and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides' metabolism, not only in most gamma- and beta-proteobacteria (including well-studied species such as Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding motif. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon also includes two nitrite-responsive loci, nipAB (hcp-hcr) and nipC (dnrN), thus confirming the identity of the effector, i.e. nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the result, we demonstrate considerable interconnection between various nitrogen-oxides-responsive regulatory systems for the denitrification and NO detoxification genes and evolutionary plasticity of this transcriptional network.

Rodionov, Dmitry A; Dubchak, Inna L; Arkin, Adam P; Alm, Eric J; Gelfand, Mikhail S

2005-01-01

198

Ribulokinase and Transcriptional Regulation of Arabinose Metabolism in Clostridium acetobutylicum  

PubMed Central

The transcription factor AraR controls utilization of l-arabinose in Bacillus subtilis. In this study, we combined a comparative genomic reconstruction of AraR regulons in nine Clostridium species with detailed experimental characterization of AraR-mediated regulation in Clostridium acetobutylicum. Based on the reconstructed AraR regulons, a novel ribulokinase, AraK, present in all analyzed Clostridium species was identified, which was a nonorthologous replacement of previously characterized ribulokinases. The predicted function of the araK gene was confirmed by inactivation of the araK gene in C. acetobutylicum and biochemical assays using purified recombinant AraK. In addition to the genes involved in arabinose utilization and arabinoside degradation, extension of the AraR regulon to the pentose phosphate pathway genes in several Clostridium species was revealed. The predicted AraR-binding sites in the C. acetobutylicum genome and the negative effect of l-arabinose on DNA-regulator complex formation were verified by in vitro binding assays. The predicted AraR-controlled genes in C. acetobutylicum were experimentally validated by testing gene expression patterns in both wild-type and araR-inactivated mutant strains during growth in the absence or presence of l-arabinose.

Zhang, Lei; Leyn, Semen A.; Gu, Yang; Jiang, Weihong

2012-01-01

199

Arabidopsis Transcriptional Activators CBF1, CBF2, and CBF3 have Matching Functional Activities  

Microsoft Academic Search

When Arabidopsis is exposed to low temperature a small gene family encoding transcription factors known as CBF1, CBF2, and CBF3 (also referred to as DREB1b, DREB1c, and DREB1a, respectively) is rapidly induced followed by expression of CBF-targeted genes, the CBF regulon, which act to bring about an increase in freezing tolerance. The CBF1, 2 and 3 proteins, though highly similar

Sarah J. Gilmour; Sarah G. Fowler; Michael F. Thomashow

2004-01-01

200

Nitrofurantoin, phenazopyridine, and the superoxide-response regulon soxRS of Escherichia coli.  

PubMed

Nitrofurantoin and phenazopyridine are two drugs commonly used against urinary tract infections. Both compounds exert oxidative damage in patients deficient in glucose-6-phosphate dehydrogenase. This study was done to assess the interactions of these drugs with the soxRS regulon of Escherichia coli, a superoxide-defense system (that includes a nitroreductase that yields the active metabolite of nitrofurantoin) involved in antibiotic multi-resistance. The effects of either nitrofurantoin or phenazopyridine, upon strains with different soxRS genotypes, were measured as minimum inhibitory concentrations (MICs) and growth curves. Also, the ability of these drugs to induce the expression of a soxS'::lacZ gene fusion was assessed. The effect of antibiotics in the presence of phenazopyridine, paraquat (a known soxRS inducer), or an efflux inhibitor, was measured using the disk diffusion method. A strain constitutively expressing the soxRS regulon was slightly more susceptible to nitrofurantoin, and more resistant to phenazopyridine, compared to wild-type and soxRS-deleted strains, during early treatment, but 24-h MICs were the same (8 mg/l nitrofurantoin, 1,000 mg/l phenazopyridine) for all strains. Both compounds were capable of inducing the expression of a soxS'::lacZ fusion, but less than paraquat. Subinhibitory concentrations of phenazopyridine increased the antimicrobial effect of ampicillin, chloramphenicol, tetracycline, and nitrofurantoin. The induction or constitutive expression of the soxRS regulon seems to be a disadvantage for E. coli during nitrofurantoin exposure; but might be an advantage during phenazopyridine exposure, indicating that the latter compound could act as a selective pressure for mutations related to virulence and antibiotic multi-resistance. PMID:23793794

Amábile-Cuevas, Carlos F; Arredondo-García, José Luis

2013-12-01

201

DosS responds to a reduced electron transport system to induce the Mycobacterium tuberculosis DosR regulon.  

PubMed

The DosR regulon in Mycobacterium tuberculosis is involved in respiration-limiting conditions, its induction is controlled by two histidine kinases, DosS and DosT, and recent experimental evidence indicates DosS senses either molecular oxygen or a redox change. Under aerobic conditions, induction of the DosR regulon by DosS, but not DosT, was observed after the addition of ascorbate, a powerful cytochrome c reductant, demonstrating that DosS responds to a redox signal even in the presence of high oxygen tension. During hypoxic conditions, regulon induction was attenuated by treatment with compounds that occluded electron flow into the menaquinone pool or decreased the size of the menaquinone pool itself. Increased regulon expression during hypoxia was observed when exogenous menaquinone was added, demonstrating that the menaquinone pool is a limiting factor in regulon induction. Taken together, these data demonstrate that a reduced menaquinone pool directly or indirectly triggers induction of the DosR regulon via DosS. Biochemical analysis of menaquinones upon entry into hypoxic/anaerobic conditions demonstrated the disappearance of the unsaturated species and low-level maintenance of the mono-saturated menaquinone. Relative to the unsaturated form, an analog of the saturated form is better able to induce signaling via DosS and rescue inhibition of menaquinone synthesis and is less toxic. The menaquinone pool is central to the electron transport system (ETS) and therefore provides a mechanistic link between the respiratory state of the bacilli and DosS signaling. Although this report demonstrates that DosS responds to a reduced ETS, it does not rule out a role for oxygen in silencing signaling. PMID:20952575

Honaker, Ryan W; Dhiman, Rakesh K; Narayanasamy, Prabagaran; Crick, Dean C; Voskuil, Martin I

2010-12-01

202

DosS Responds to a Reduced Electron Transport System To Induce the Mycobacterium tuberculosis DosR Regulon?  

PubMed Central

The DosR regulon in Mycobacterium tuberculosis is involved in respiration-limiting conditions, its induction is controlled by two histidine kinases, DosS and DosT, and recent experimental evidence indicates DosS senses either molecular oxygen or a redox change. Under aerobic conditions, induction of the DosR regulon by DosS, but not DosT, was observed after the addition of ascorbate, a powerful cytochrome c reductant, demonstrating that DosS responds to a redox signal even in the presence of high oxygen tension. During hypoxic conditions, regulon induction was attenuated by treatment with compounds that occluded electron flow into the menaquinone pool or decreased the size of the menaquinone pool itself. Increased regulon expression during hypoxia was observed when exogenous menaquinone was added, demonstrating that the menaquinone pool is a limiting factor in regulon induction. Taken together, these data demonstrate that a reduced menaquinone pool directly or indirectly triggers induction of the DosR regulon via DosS. Biochemical analysis of menaquinones upon entry into hypoxic/anaerobic conditions demonstrated the disappearance of the unsaturated species and low-level maintenance of the mono-saturated menaquinone. Relative to the unsaturated form, an analog of the saturated form is better able to induce signaling via DosS and rescue inhibition of menaquinone synthesis and is less toxic. The menaquinone pool is central to the electron transport system (ETS) and therefore provides a mechanistic link between the respiratory state of the bacilli and DosS signaling. Although this report demonstrates that DosS responds to a reduced ETS, it does not rule out a role for oxygen in silencing signaling.

Honaker, Ryan W.; Dhiman, Rakesh K.; Narayanasamy, Prabagaran; Crick, Dean C.; Voskuil, Martin I.

2010-01-01

203

Mechanisms other than activation of the iron regulon account for the hyper-resistance to cobalt of a Saccharomyces cerevisiae strain obtained by evolutionary engineering.  

PubMed

Cobalt is an important metal ion with magnetic properties that is widely used for several industrial applications. Overexposure to cobalt ions can be highly toxic for the organisms because they usually overwhelm the endogenous physiological system that maintains their homeostasis causing (geno)toxic effects. To gain insight into the mechanism of cobalt toxicity, we characterized at the molecular and genetic levels a cobalt resistant CI25E Saccharomyces cerevisiae strain previously isolated by an in vivo evolutionary engineering strategy, and which was able to grow on 5 to 10 mM CoCl2. This evolved strain showed cross-resistance to other metal ions including iron, manganese, nickel and zinc, but not to copper. Moreover, the cobalt resistant trait was semi-dominant, and linked to more than one gene, as indicated by the absence of 2(+):2(-) segregation of the cobalt resistance. Genome wide transcriptional profiling revealed a constitutive activation of the iron regulon that could be accounted for by a constitutive nuclear localization of the transcriptional activator Aft1. However, the presence of Aft1 in the nucleus was not a prerequisite for hyper-resistance to cobalt, since a mutant defective in nuclear monothiol glutaredoxin encoding GRX3 and GRX4 that also leads to nuclear localization of Aft1 was cobalt hypersensitive. In addition, the loss of AFT1 only partially abolished the cobalt resistance in the evolved strain, and the deletion of COT1 encoding the major vacuolar transporter of cobalt had only a minor effect on this trait. Paradoxically to the activation of iron regulon, the evolved strain was hypersensitive to the iron chelator BPS, and this hypersensitivity was abrogated by cobalt ions. Taken together, this work suggested that cobalt resistance is not merely dependent upon activation of AFT1, but it likely implicates other mechanisms including intracellular reallocation of iron into important compartments whose function is dependent on this metal and adaptation of some cellular proteins to use Co(2+) in place of Fe(2+) for their catalytic activities. PMID:23864114

Alkim, Ceren; Benbadis, Laurent; Yilmaz, Ulku; Cakar, Z Petek; François, Jean Marie

2013-08-01

204

Quorum sensing but not autoinduction of Ti plasmid conjugal transfer requires control by the opine regulon and the antiactivator TraM.  

PubMed

Conjugal transfer of the Ti plasmids from Agrobacterium tumefaciens is controlled by autoinduction via the transcriptional activator TraR and the acyl-homoserine lactone ligand, Agrobacterium autoinducer (AAI). This control process is itself regulated by opines, which are small carbon compounds produced by the crown gall tumors that are induced by the bacteria. Opines control autoinduction by regulating the expression of traR. Transfer of pTiC58 from donors grown with agrocinopines A and B, the conjugal opines for this Ti plasmid, was detected only after the donors had reached a population level of 10(7) cells per cm(2). Donors incubated with the opines and AAI transferred their Ti plasmids at population levels about 10-fold lower than those incubated with opines only. Transcription of the tra regulon, as assessed by monitoring a traA::lacZ reporter, showed a similar dependence on the density of the donor population. However, even in cultures at low population densities that were induced with opines and AAI, there was a temporal lag of between 15 and 20 h in the development of conjugal competence. Moreover, even after this latent period, maximal transfer frequencies required several hours to develop. This lag period was independent of the population density of the donors but could be reduced somewhat by addition of exogenous AAI. Quorum-dependent development of conjugal competence required control by the opine regulon; donors harboring a mutant of pTiC58 deleted for the master opine responsive repressor accR transferred the Ti plasmid at maximum frequencies at very low population densities. Similarly, an otherwise wild-type derivative of pTiC58 lacking traM, which codes for an antiactivator that inhibits TraR activity, transferred at high frequency in a population-independent manner in the absence of the conjugal opines. Thus, while quorum sensing is dependent upon autoinduction, the two phenomena are not synonymous. We conclude that conjugal transfer of pTiC58 is regulated in a quorum-dependent fashion but that supercontrol of the TraR-AAI system by opines and by TraM results in a complex control process that requires not only the accumulation of AAI but also the expression of TraR and the synthesis of this protein at levels that overcome the inhibitory activity of TraM. PMID:10648535

Piper, K R; Farrand, S K

2000-02-01

205

Quorum Sensing but Not Autoinduction of Ti Plasmid Conjugal Transfer Requires Control by the Opine Regulon and the Antiactivator TraM  

PubMed Central

Conjugal transfer of the Ti plasmids from Agrobacterium tumefaciens is controlled by autoinduction via the transcriptional activator TraR and the acyl-homoserine lactone ligand, Agrobacterium autoinducer (AAI). This control process is itself regulated by opines, which are small carbon compounds produced by the crown gall tumors that are induced by the bacteria. Opines control autoinduction by regulating the expression of traR. Transfer of pTiC58 from donors grown with agrocinopines A and B, the conjugal opines for this Ti plasmid, was detected only after the donors had reached a population level of 107 cells per cm2. Donors incubated with the opines and AAI transferred their Ti plasmids at population levels about 10-fold lower than those incubated with opines only. Transcription of the tra regulon, as assessed by monitoring a traA::lacZ reporter, showed a similar dependence on the density of the donor population. However, even in cultures at low population densities that were induced with opines and AAI, there was a temporal lag of between 15 and 20 h in the development of conjugal competence. Moreover, even after this latent period, maximal transfer frequencies required several hours to develop. This lag period was independent of the population density of the donors but could be reduced somewhat by addition of exogenous AAI. Quorum-dependent development of conjugal competence required control by the opine regulon; donors harboring a mutant of pTiC58 deleted for the master opine responsive repressor accR transferred the Ti plasmid at maximum frequencies at very low population densities. Similarly, an otherwise wild-type derivative of pTiC58 lacking traM, which codes for an antiactivator that inhibits TraR activity, transferred at high frequency in a population-independent manner in the absence of the conjugal opines. Thus, while quorum sensing is dependent upon autoinduction, the two phenomena are not synonymous. We conclude that conjugal transfer of pTiC58 is regulated in a quorum-dependent fashion but that supercontrol of the TraR-AAI system by opines and by TraM results in a complex control process that requires not only the accumulation of AAI but also the expression of TraR and the synthesis of this protein at levels that overcome the inhibitory activity of TraM.

Piper, Kevin R.; Farrand, Stephen K.

2000-01-01

206

Expression of OsDREB2A transcription factor confers enhanced dehydration and salt stress tolerance in rice ( Oryza sativa L.)  

Microsoft Academic Search

Stress responsive transcriptional regulation is an adaptive strategy of plants that alleviates the adverse effects of environmental\\u000a stresses. The ectopic overexpression of Dehydration-Responsive Element Binding transcription factors (DREBs) either in homologous\\u000a or in heterologous plants improved stress tolerance indicating the DRE\\/DREB regulon is conserved across plants. We developed\\u000a 30 transgenic T0 rice plants overexpressing OsDREB2A which were devoid of any

Garladinne Mallikarjuna; Kokkanti Mallikarjuna; M. K. Reddy; Tanushri Kaul

2011-01-01

207

The rpoA341 allele of Escherichia coli specifically impairs the transcription of a group of positively-regulated operons  

Microsoft Academic Search

The specificity of the transcription defect caused by the rpoA341 (phs) allele has been investigated. Three apparently unlinked genetic systems have been found to be impaired in their transcription by this mutant allele of the alpha subunit of RNA polymerase. These three systems, the melAB operon the cysA locus and the ara regulon, are apparently unrelated other than by their

P. M. Giffard; I. R. Booth

1988-01-01

208

Induction of the nag regulon of Escherichia coli by N-acetylglucosamine and glucosamine: role of the cyclic AMP-catabolite activator protein complex in expression of the regulon.  

PubMed

The divergent nag regulon located at 15.5 min on the Escherichia coli map encodes genes necessary for growth on N-acetylglucosamine and glucosamine. Full induction of the regulon requires both the presence of N-acetylglucosamine and a functional cyclic AMP (cAMP)-catabolite activator protein (CAP) complex. Glucosamine produces a lower level of induction of the regulon. A nearly symmetric consensus CAP-binding site is located in the intergenic region between nagE (encoding EIINag) and nagB (encoding glucosamine-6-phosphate deaminase). Expression of both nagE and nagB genes is stimulated by cAMP-CAP, but the effect is more pronounced for nagE. In fact, very little expression of nagE is observed in the absence of cAMP-CAP, whereas 50% maximum expression of nagB is observed with N-acetylglucosamine in the absence of cAMP-CAP. Two mRNA 5' ends separated by about 100 nucleotides were located before nagB, and both seem to be similarly subject to N-acetylglucosamine induction and cAMP-CAP stimulation. To induce the regulon, N-acetylglucosamine or glucosamine must enter the cell, but the particular transport mechanism used is not important. PMID:2158978

Plumbridge, J A

1990-05-01

209

Rewiring of Posttranscriptional RNA Regulons: Puf4p in Fungi as an Example  

PubMed Central

It has been increasingly clear that changes in gene regulation play important roles in physiological and phenotypic evolution. Rewiring gene-regulatory networks, i.e., alteration of the gene-regulation system for different biological functions, has been demonstrated in various species. Posttranscriptional regulons have prominent roles in coordinating gene expression in a variety of eukaryotes. In this study, using Puf4p in fungi as an example, we demonstrate that posttranscriptional regulatory networks can also be rewired during evolution. Although Puf4p is highly conserved in fungi, targets of the posttranscriptional regulon are functionally diverse among known fungal species. In the Saccharomycotina subdivision, target genes of Puf4p mostly conduct function in the nucleolus; however, in the Pezizomycotina subdivision, they are enriched in the mitochondria. Furthermore, we demonstrate different regulation efficiencies of mitochondrial function by PUF proteins in different fungal clades. Our results indicate that rewiring of posttranscription regulatory networks may be an important way of generating genetic novelties in gene regulation during evolution.

Jiang, Huifeng; Guo, Xiaoxian; Xu, Lin; Gu, Zhenglong

2012-01-01

210

Isolation and characterization of the Salmonella typhimurium LT2 xylose regulon  

SciTech Connect

Salmonella DNA was partially digested with EcoRI, and the digest was fractionated to obtain fragments larger than 8 kilobases (kb). These were ligated into EcoRI-cut pBR322, and the mixture was used to transform Salmonella Xyl/sup -/ cells selecting for ampR xyl/sup +/ transformants. A 21- and a 27-kb plasmid were isolated, both of which contained the entire xylose regulon. The xylose regulon was localized to a 6.3-kb segment of a 13.5-kb EcoRI fragment. Subclones were constructed which contained either the genes for D-xylose isomerase and D-xylulokinase or the genes for the D-xylose transport and the D-xylose regulatory factors. The gene order determined by the subcloning experiments is consistent with that determined by genetic mapping. The spots corresponding to D-xylose isomerase and D-xylulokinase subunits were identified in two-dimensional gels of several xylose-induced strains. Each of them had a molecular weight of 45,000 and an isoelectric point of 6.2 +/- 0.1.

Ghangas, G.S.; Wilson, D.B.

1984-01-01

211

Characterization of the Fur Regulon in Pseudomonas syringae pv. tomato DC3000?†  

PubMed Central

The plant pathogen Pseudomonas syringae pv. tomato DC3000 (DC3000) is found in a wide variety of environments and must monitor and respond to various environmental signals such as the availability of iron, an essential element for bacterial growth. An important regulator of iron homeostasis is Fur (ferric uptake regulator), and here we present the first study of the Fur regulon in DC3000. Using chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-seq), 312 chromosomal regions were highly enriched by coimmunoprecipitation with a C-terminally tagged Fur protein. Integration of these data with previous microarray and global transcriptome analyses allowed us to expand the putative DC3000 Fur regulon to include genes both repressed and activated in the presence of bioavailable iron. Using nonradioactive DNase I footprinting, we confirmed Fur binding in 41 regions, including upstream of 11 iron-repressed genes and the iron-activated genes encoding two bacterioferritins (PSPTO_0653 and PSPTO_4160), a ParA protein (PSPTO_0855), and a two-component system (TCS) (PSPTO_3382 to PSPTO_3380).

Butcher, Bronwyn G.; Bronstein, Philip A.; Myers, Christopher R.; Stodghill, Paul V.; Bolton, James J.; Markel, Eric J.; Filiatrault, Melanie J.; Swingle, Bryan; Gaballa, Ahmed; Helmann, John D.; Schneider, David J.; Cartinhour, Samuel W.

2011-01-01

212

The plant signal salicylic acid shuts down expression of the vir regulon and activates quormone-quenching genes in Agrobacterium  

PubMed Central

Agrobacterium tumefaciens is capable of transferring and integrating an oncogenic T-DNA (transferred DNA) from its tumor-inducing (Ti) plasmid into dicotyledonous plants. This transfer requires that the virulence genes (vir regulon) be induced by plant signals such as acetosyringone in an acidic environment. Salicylic acid (SA) is a key signal molecule in regulating plant defense against pathogens. However, how SA influences Agrobacterium and its interactions with plants is poorly understood. Here we show that SA can directly shut down the expression of the vir regulon. SA specifically inhibited the expression of the Agrobacterium virA/G two-component regulatory system that tightly controls the expression of the vir regulon including the repABC operon on the Ti plasmid. We provide evidence suggesting that SA attenuates the function of the VirA kinase domain. Independent of its effect on the vir regulon, SA up-regulated the attKLM operon, which functions in degrading the bacterial quormone N-acylhomoserine lactone. Plants defective in SA accumulation were more susceptible to Agrobacterium infection, whereas plants overproducing SA were relatively recalcitrant to tumor formation. Our results illustrate that SA, besides its well known function in regulating plant defense, can also interfere directly with several aspects of the Agrobacterium infection process.

Yuan, Ze-Chun; Edlind, Merritt P.; Liu, Pu; Saenkham, Panatda; Banta, Lois M.; Wise, Arlene A.; Ronzone, Erik; Binns, Andrew N.; Kerr, Kathleen; Nester, Eugene W.

2007-01-01

213

Human T-cell responses to 25 novel antigens encoded by genes of the dormancy regulon of Mycobacterium tuberculosis.  

PubMed

The dormancy (DosR) regulon of Mycobacterium tuberculosis is expressed in vitro during hypoxia and low-dose nitric oxide stimulation. Tubercle bacilli are thought to encounter these conditions in humans during latent infection. In this study, immune responses were evaluated to 25 most strongly induced DosR-regulon-encoded proteins, referred to as latency antigens. Proliferation assays were performed using M. tuberculosis-specific T-cell lines and peripheral blood mononuclear cells (PBMC) from tuberculosis (TB) patients, tuberculin skin test positive (TST+) individuals and uninfected controls. All 25 latency antigens were able to induce production of interferon-gamma (IFN-gamma) by T-cell lines. Eighteen latency antigens were also recognized by PBMC of M. tuberculosis-infected individuals, which indicates expression of the DosR-regulon during natural infection. Differential analysis showed that TST+ individuals recognized more latency antigens and with a stronger cumulative IFN-gamma response than TB patients, while the opposite profile was found for culture filtrate protein-10. In particular Rv1733c, Rv2029c, Rv2627c and Rv2628 induced strong IFN-gamma responses in TST+ individuals, with 61%, 61%, 52% and 35% responders, respectively. In conclusion, several new M. tuberculosis antigens were identified within the DosR-regulon. Particularly strong IFN-gamma responses to latency antigens were observed in latently infected individuals, suggesting that immune responses against these antigens may contribute to controlling latent M. tuberculosis infection. PMID:16931093

Leyten, Eliane M S; Lin, May Young; Franken, Kees L M C; Friggen, Annemieke H; Prins, Corine; van Meijgaarden, Krista E; Voskuil, Martin I; Weldingh, Karin; Andersen, Peter; Schoolnik, Gary K; Arend, Sandra M; Ottenhoff, Tom H M; Klein, Michčl R

2006-07-01

214

Acidocalcisomes in Apicomplexan parasites  

Microsoft Academic Search

Acidocalcisomes are acidic calcium stores found in diverse organisms, being conserved from bacteria to man. They posses an acidic matrix that contains several cations bound to phosphates, mainly present in the form of short and long polyphosphate chains. Their matrix is acidified through the action of proton pumps such as a vacuolar proton ATPase and a vacuolar proton pyrophosphatase. The

Kildare Miranda; Wanderley de Souza; Helmut Plattner; Joachim Hentschel; Urara Kawazoe; Jianmin Fang; Silvia N. J. Moreno

2008-01-01

215

The ResD Response Regulator, through Functional Interaction with NsrR and Fur, Plays Three Distinct Roles in Bacillus subtilis Transcriptional Control  

PubMed Central

The ResD response regulator activates transcription of diverse genes in Bacillus subtilis in response to oxygen limitation. ResD regulon genes that are the most highly induced during nitrate respiration include the nitrite reductase operon (nasDEF) and the flavohemoglobin gene (hmp), whose products function in nitric oxide (NO) metabolism. Transcription of these genes is also under the negative control of the NO-sensitive NsrR repressor. Recent studies showed that the NsrR regulon contains genes with no apparent relevance to NO metabolism and that the ResD response regulator and NsrR coordinately regulate transcription. To determine whether these genes are direct targets of NsrR and ResD, we used chromatin affinity precipitation coupled with tiling chip (ChAP-chip) and ChAP followed by quantitative PCR (ChAP-qPCR) analyses. The study showed that ResD and NsrR directly control transcription of the ykuNOP operon in the Fur regulon. ResD functions as an activator at the nasD and hmp promoters, whereas it functions at the ykuN promoter as an antirepressor of Fur and a corepressor for NsrR. This mechanism likely participates in fine-tuning of transcript levels in response to different sources of stress, such as oxygen limitation, iron limitation, and exposure to NO.

Henares, Bernadette; Kommineni, Sushma; Chumsakul, Onuma; Ogasawara, Naotake; Ishikawa, Shu

2014-01-01

216

Autonomous induction of recombinant proteins by minimally rewiring native quorum sensing regulon of E. coli.  

PubMed

Quorum sensing (QS) enables an individual bacterium's metabolic state to be communicated to and ultimately control the phenotype of an emerging population. Harnessing the hierarchical nature of this signal transduction process may enable the exploitation of individual cell characteristics to direct or "program" entire populations of cells. We re-engineered the native QS regulon so that individual cell signals (autoinducers) are used to guide high level expression of recombinant proteins in E. coli populations. Specifically, the autoinducer-2 (AI-2) QS signal initiates and guides the overexpression of green fluorescent protein (GFP), chloramphenicol acetyl transferase (CAT) and beta-galactosidase (LacZ). The new process requires no supervision or input (e.g., sampling for optical density measurement, inducer addition, or medium exchange) and represents a low-cost, high-yield platform for recombinant protein production. Moreover, rewiring a native signal transduction circuit exemplifies an emerging class of metabolic engineering approaches that target regulatory functions. PMID:20060924

Tsao, Chen-Yu; Hooshangi, Sara; Wu, Hsuan-Chen; Valdes, James J; Bentley, William E

2010-05-01

217

soxR, a locus governing a superoxide response regulon in Escherichia coli K-12  

SciTech Connect

The nfo (endonuclease IV) gene of Escherichia coli is induced by superoxide generators such as paraquat (methyl viologen). An nfo{prime}-lacZ operon fusion was used to isolate extragenic mutations affecting its expression. The mutations also affected the expression of glucose 6-phosphate dehydrogenase, Mn{sup 2+}-superoxide dismutase (sodA), and three lacZ fusions to soil (superoxide-inducible) genes of unknown function. The mutations were located 2 kilobases clockwise of ssb at 92 min on the current linkage map. One set of mutations, in a new gene designated soxR, caused constitutive overexpression of nfo and the other genes. It included insertions or deletions affecting the carboxyl end of a 17-kilodalton polypeptide. The results define a new regulon, controlled by soxR, mediating at least part of the global response to superoxide in E. coli.

Tsaneva, I.R.; Weiss, B. (Univ. of Michigan Medical School, Ann Arbor (USA))

1990-08-01

218

Overproduction of MalK protein prevents expression of the Escherichia coli mal regulon.  

PubMed Central

The mal regulon of Escherichia coli comprises a large family of genes whose function is the metabolism of linear maltooligosaccharides. Five gene products are required for the active accumulation of maltodextrins as large as maltoheptaose. Two cytoplasmic gene products are necessary and sufficient for the intracellular catabolism of these sugars. Two newly discovered enzymes have the capacity to metabolize these sugars but are not essential for their catabolism in wild-type cells. A single regulatory protein, MalT, positively regulates the expression of all of these genes in response to intracellular inducers, one of which has been identified as maltotriose. In the course of studying the mechanism of the transport system, we have placed the structural gene for one of the transport proteins, MalK, under the control of the Ptrc promoter to produce large amounts of this protein. We found that although high-level expression of MalK was not detrimental to E. coli, the increased amount of MalK decreased the basal-level expression of the mal regulon and prevented induction of the mal system even in the presence of external maltooligosaccharides. Constitutive mutants in which MalT does not depend on the presence of the internal inducer(s) were unaffected by the increased levels of the MalK protein. These results are consistent with the idea that MalK protein somehow interferes with the activity of the MalT protein. Different models for the regulatory function of MalK are discussed. Images

Reyes, M; Shuman, H A

1988-01-01

219

Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses  

SciTech Connect

The Arc two-component system is a global regulator controlling many genes involved in aerobic/anaerobic respiration and fermentative metabolism in Escherichia coli. Shewanella oneidensis MR-1 contains a gene encoding a putative ArcA homolog with {approx} 81% amino acid sequence identity to the E. coli ArcA protein but not a full-length arcB gene. To understand the role of ArcA in S. oneidensis, an arcA deletion strain was constructed and subjected to both physiological characterization and microarray analysis. Compared to the wild-type MR-1, the mutant exhibited impaired aerobic growth and a defect in utilizing DMSO in the absence of O{sub 2}. Microarray analyses on cells grown aerobically and anaerobically on fumarate revealed that expression of 1009 genes was significantly affected (p < 0.05) by the mutation. In contrast to E. coli ArcA, the protein appears to be dispensable in regulation of the TCA cycle in S. oneidensis. To further determine genes regulated by the Arc system, an ArcA recognition weight matrix from DNA-binding data and bioinformatics analysis was generated and used to produce an ArcA sequence affinity map. By combining both techniques, we identified an ArcA regulon of at least 50 operons, of which only 6 were found to be directly controlled by ArcA in E. coli. These results indicate that the Arc system in S. oneidensis differs from that in E. coli substantially in terms of its physiological function and regulon while their binding motif are strikingly similar.

Gao, Haichun [University of Oklahoma; Wang, Xiaohu [Baylor College of Medicine, Huston; Yang, Zamin Koo [ORNL; Palzkill, Timothy [Baylor College of Medicine, Huston; Zhou, Jizhong [University of Oklahoma

2008-01-01

220

Mutations affecting catabolite repression of the L-arabinose regulon in Escherichia coli B/r.  

PubMed Central

Expression of the L-arabinose regulon in Escherichia coli B/r requires, among other things, cyclic adenosine-3', 5'-monophosphate (cAMP) and the cAMP receptor protein (CRP). Mutants deficient in adenyl cyclase (cya-), the enzyme which synthesizes cAMP, or CRP (crp-) are unable to utilize a variety of carbohydrates, including L-arabinose. Ara+ revertants of a cya-crp- strain were isolated on 0.2% minimal L-arabinose plates, conditions which require the entire ara regulon to be activated in the absence of cAMP and CRP. Evidence from genetic and physiological studies is consistent with placing these mutations in the araC regulatory gene. Deletion mapping with one mutant localized the site within either araO or araC, and complementation tests indicated the mutants acted trans to confer the ability to utilize L-arabinose in a cya-crp- genetic background. Since genetic analysis supports the conclusion, that the mutant sites are in the araC regulatory gene, the mutants were designated araCi, indicating a mutation in the regulatory gene affecting the cAMP-CRP requirement. Physiological analysis of one mutant, araCi1, illustrates the trans-acting nature of the mutation. In a cya-crp- genetic background, araCi1 promoted synthesis of both isomerase, a product of the araBAD operon, and permease, a product of the araE operon. Isomerase and permease levels in araCi1 cya+ crp+ were hyperinducible, and the sensitivity of each to cAMP was altered. Two models are presented that show the possible mutational lesion in the araCi strains.

Heffernan, L; Bass, R; Englesberg, E

1976-01-01

221

Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses  

PubMed Central

Background The Arc two-component system is a global regulator controlling many genes involved in aerobic/anaerobic respiration and fermentative metabolism in Escherichia coli. Shewanella oneidensis MR-1 contains a gene encoding a putative ArcA homolog with ~81% amino acid sequence identity to the E. coli ArcA protein but not a full-length arcB gene. Results To understand the role of ArcA in S. oneidensis, an arcA deletion strain was constructed and subjected to both physiological characterization and microarray analysis. Compared to the wild-type MR-1, the mutant exhibited impaired aerobic growth and a defect in utilizing DMSO in the absence of O2. Microarray analyses on cells grown aerobically and anaerobically on fumarate revealed that expression of 1009 genes was significantly affected (p < 0.05) by the mutation. In contrast to E. coli ArcA, the protein appears to be dispensable in regulation of the TCA cycle in S. oneidensis. To further determine genes regulated by the Arc system, an ArcA recognition weight matrix from DNA-binding data and bioinformatics analysis was generated and used to produce an ArcA sequence affinity map. By combining both techniques, we identified an ArcA regulon of at least 50 operons, of which only 6 were found to be directly controlled by ArcA in E. coli. Conclusion These results indicate that the Arc system in S. oneidensis differs from that in E. coli substantially in terms of its physiological function and regulon while their binding motif are strikingly similar.

Gao, Haichun; Wang, Xiaohu; Yang, Zamin K; Palzkill, Timothy; Zhou, Jizhong

2008-01-01

222

Molecular cloning, structure, promoters and regulatory elements for transcription of the Bacillus megaterium encoded regulon for xylose utilization  

Microsoft Academic Search

The xylA and xylB genes of Bacillus subtilis BR151 encoding xylose isomerase and xylulokinase, respectively, were disrupted by gene replacement rendering the constructed mutant strain unable to grow on xylose as the sole carbon source. The Bacillus megaterium encoded xyl genes were cloned by complementation of this strain to xylose utilization. The nucleotide sequence of about 4 kbp of the

T. Rygus; A. Scheler; R. Allmansberger; W. Hillen

1991-01-01

223

Analysis of the Actinobacillus pleuropneumoniae ArcA Regulon Identifies Fumarate Reductase as a Determinant of Virulence  

Microsoft Academic Search

response to anaerobic conditions, and we recently showed that an A. pleuropneumoniae arcA mutant had reduced virulence compared to the wild type (F. F. Buettner, A. Maas, and G.-F. Gerlach, Vet. Microbiol. 127:106-115, 2008). In order to understand the attenuated phenotype, we investigated the ArcA regulon of A. pleuropneumoniae by using a combination of transcriptome (microarray) and proteome (two-dimensional difference

Falk F. R. Buettner; Ibrahim M. Bendallah; Janine T. Bosse; Karla Dreckmann; John H. E. Nash; Paul R. Langford; G.-F. Gerlach

2008-01-01

224

Phosphate Acquisition Components of the Myxococcus xanthus Pho Regulon Are Regulated by both Phosphate Availability and Development?  

PubMed Central

In many organisms, phosphatase expression and phosphate (P) uptake are coordinately regulated by the Pho regulon. In Myxococcus xanthus P limitation initiates multicellular development, a process associated with changes in phosphatase expression. We sought here to characterize the link between P acquisition and development in this bacterium, an organism capable of preying upon other microorganisms as a sole nutrient source. M. xanthus seems to possess no significant internal P stores, as reducing the P concentration to less than 10 ?M retarded growth within one doubling time. Pyrophosphate, polyphosphate, and glyceraldehyde-3-phosphate could support growth as sole P sources, although many other P-containing biomolecules could not (including nucleic acids and phospholipids). Several Pho regulon promoters were found to be highly active during vegetative growth, and P limitation specifically induced pstSCAB, AcPA1, and pho3 promoter activity and repressed pit expression. Enhanced pstSCAB and pho3 promoter activities in a phoP4 mutant (in the presence of high and low concentrations of P) suggested that PhoP4 acts as a repressor of these genes. However, in a phoP4 background, the activities of pstSCAB remained P regulated, suggesting that there is additional regulation by a P-sensitive factor. Initiation of multicellular development caused immediate down-regulation of Pho regulon genes and caused pstSCAB and pho3 promoter activities to become P insensitive. Hence, P acquisition components of the M. xanthus Pho regulon are regulated by both P availability and development, with developmental down-regulation overriding up-regulation by P limitation. These observations suggest that when development is initiated, subsequent changes in P availability become irrelevant to the population, which presumably has sufficient intrinsic P to ensure completion of the developmental program.

Whitworth, David E.; Holmes, Antony B.; Irvine, Alistair G.; Hodgson, David A.; Scanlan, David J.

2008-01-01

225

Comparative proteomic analysis reveals new components of the PhoP regulon and highlights a role for PhoP in the regulation of genes encoding the F1F0 ATP synthase in Edwardsiella tarda.  

PubMed

Edwardsiella tarda is an important cause of haemorrhagic septicaemia in fish and also of gastro- and extra-intestinal infections in humans. We have recently demonstrated that the PhoP-PhoQ two-component regulatory system plays important roles in both virulence and stress tolerance in E. tarda. In this study, the proteomes of the WT and phoP mutant strains were compared to define components of the PhoP regulon in E. tarda EIB202. Overall, 18 proteins whose expression levels exhibited a twofold or greater change were identified; 13 of these proteins were found to require the presence of PhoP for full expression, while five were expressed at a higher level in the phoP mutant background. Identified proteins represented diverse functional categories, including energy production, amino acid metabolism and oxidative stress defence. Quantitative real-time PCR analysis of the mRNA levels for the identified proteins confirmed the proteomics data. Interestingly, the ? subunit of the F1F0 ATP synthase, playing an important role in growth and virulence of E. tarda, was listed as one of the proteins whose expression was greatly dependent on PhoP. The F1F0 ATP synthase was encoded in a gene cluster (atpIBEFHAGDC) and the nine genes were transcribed as an operon. PhoP positively regulated the transcription of the nine ATP synthase genes and exerted this effect through direct binding to the promoter of atpI. Overall, the results provide new insights into the PhoP regulon and unravel a novel role for PhoP in the regulation of the F1F0 ATP synthase. PMID:23657683

Lv, Yuanzhi; Yin, Kaiyu; Shao, Shuai; Wang, Qiyao; Zhang, Yuanxing

2013-07-01

226

Towards in vivo regulon kinetics: PurR activation by 5-phosphoribosyl-?-1-pyrophosphate during purine depletion in Lactococcus lactis.  

PubMed

Short-term adaptation to changing environments relies on regulatory elements translating shifting metabolite concentrations into a specifically optimized transcriptome. So far the focus of analyses has been divided between regulatory elements identified in vivo and kinetic studies of small molecules interacting with the regulatory elements in vitro. Here we describe how in vivo regulon kinetics can describe a regulon through the effects of the metabolite controlling it, exemplified by temporal purine exhaustion in Lactococcus lactis. We deduced a causal relation between the pathway precursor 5-phosphoribosyl-?-1-pyrophosphate (PRPP) and individual mRNA levels, whereby unambiguous and homogeneous relations could be obtained for PurR regulated genes, thus linking a specific regulon to a specific metabolite. As PurR activates gene expression upon binding of PRPP, the pur mRNA curves reflect the in vivo kinetics of PurR PRPP binding and activation. The method singled out the xpt-pbuX operon as kinetically distinct, which was found to be caused by a guanine riboswitch whose regulation was overlaying the PurR regulation. Importantly, genes could be clustered according to regulatory mechanism and long-term consequences could be distinguished from transient changes - many of which would not be seen in a long-term adaptation to a new environment. The strategy outlined here can be adapted to analyse the individual effects of members from larger metabolomes in virtually any organism, for elucidating regulatory networks in vivo. PMID:24722907

Jendresen, Christian Bille; Dimitrov, Peter; Gautier, Laurent; Liu, Meng; Martinussen, Jan; Kilstrup, Mogens

2014-07-01

227

Mycobacterium tuberculosis DosR Regulon Gene Rv0079 Encodes a Putative, 'Dormancy Associated Translation Inhibitor (DATIN)'  

PubMed Central

Mycobacterium tuberculosis is a major human pathogen that has evolved survival mechanisms to persist in an immune-competent host under a dormant condition. The regulation of M. tuberculosis metabolism during latent infection is not clearly known. The dormancy survival regulon (DosR regulon) is chiefly responsible for encoding dormancy related functions of M. tuberculosis. We describe functional characterization of an important gene of DosR regulon, Rv0079, which appears to be involved in the regulation of translation through the interaction of its product with bacterial ribosomal subunits. The protein encoded by Rv0079, possibly, has an inhibitory role with respect to protein synthesis, as revealed by our experiments. We performed computational modelling and docking simulation studies involving the protein encoded by Rv0079 followed by in vitro translation and growth curve analysis experiments, involving recombinant E. coli and Bacille Calmette Guérin (BCG) strains that overexpressed Rv0079. Our observations concerning the interaction of the protein with the ribosomes are supportive of its role in regulation/inhibition of translation. We propose that the protein encoded by locus Rv0079 is a ‘dormancy associated translation inhibitor’ or DATIN.

Kumar, Ashutosh; Majid, Mohammad; Kunisch, Ralph; Rani, Pittu Sandhya; Qureshi, Insaf A.; Lewin, Astrid; Hasnain, Seyed E.; Ahmed, Niyaz

2012-01-01

228

Model of transcriptional activation by MarA in escherichia coli  

SciTech Connect

The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

Wall, Michael E [Los Alamos National Laboratory; Rosner, Judah L [NATIONAL INSTITUTE OF HEALTH; Martin, Robert G [NATIONAL INSTITUTE OF HEALTH

2009-01-01

229

Large-Scale Mapping and Validation of Escherichia coli Transcriptional Regulation from a Compendium of Expression Profiles  

PubMed Central

Machine learning approaches offer the potential to systematically identify transcriptional regulatory interactions from a compendium of microarray expression profiles. However, experimental validation of the performance of these methods at the genome scale has remained elusive. Here we assess the global performance of four existing classes of inference algorithms using 445 Escherichia coli Affymetrix arrays and 3,216 known E. coli regulatory interactions from RegulonDB. We also developed and applied the context likelihood of relatedness (CLR) algorithm, a novel extension of the relevance networks class of algorithms. CLR demonstrates an average precision gain of 36% relative to the next-best performing algorithm. At a 60% true positive rate, CLR identifies 1,079 regulatory interactions, of which 338 were in the previously known network and 741 were novel predictions. We tested the predicted interactions for three transcription factors with chromatin immunoprecipitation, confirming 21 novel interactions and verifying our RegulonDB-based performance estimates. CLR also identified a regulatory link providing central metabolic control of iron transport, which we confirmed with real-time quantitative PCR. The compendium of expression data compiled in this study, coupled with RegulonDB, provides a valuable model system for further improvement of network inference algorithms using experimental data.

Thaden, Joshua T; Mogno, Ilaria; Wierzbowski, Jamey; Cottarel, Guillaume; Kasif, Simon; Collins, James J; Gardner, Timothy S

2007-01-01

230

Comparative Genomics of CytR, an Unusual Member of the LacI Family of Transcription Factors  

PubMed Central

CytR is a transcription regulator from the LacI family, present in some gamma-proteobacteria including Escherichia coli and known not only for its cellular role, control of transport and utilization of nucleosides, but for a number of unusual structural properties. The present study addressed three related problems: structure of CytR-binding sites and motifs, their evolutionary conservation, and identification of new members of the CytR regulon. While the majority of CytR-binding sites are imperfect inverted repeats situated between binding sites for another transcription factor, CRP, other architectures were observed, in particular, direct repeats. While the similarity between sites for different genes in one genome is rather low, and hence the consensus motif is weak, there is high conservation of orthologous sites in different genomes (mainly in the Enterobacteriales) arguing for the presence of specific CytR-DNA contacts. On larger evolutionary distances candidate CytR sites may migrate but the approximate distance between flanking CRP sites tends to be conserved, which demonstrates that the overall structure of the CRP-CytR-DNA complex is gene-specific. The analysis yielded candidate CytR-binding sites for orthologs of known regulon members in less studied genomes of the Enterobacteriales and Vibrionales and identified a new candidate member of the CytR regulon, encoding a transporter named NupT (YcdZ).

Sernova, Natalia V.; Gelfand, Mikhail S.

2012-01-01

231

RegTransBase - a database of regulatory sequences and interactions based on literature: a resource for investigating transcriptional regulation in prokaryotes  

PubMed Central

Background Due to the constantly growing number of sequenced microbial genomes, comparative genomics has been playing a major role in the investigation of regulatory interactions in bacteria. Regulon inference mostly remains a field of semi-manual examination since absence of a knowledgebase and informatics platform for automated and systematic investigation restricts opportunities for computational prediction. Additionally, confirming computationally inferred regulons by experimental data is critically important. Description RegTransBase is an open-access platform with a user-friendly web interface publicly available at http://regtransbase.lbl.gov. It consists of two databases – a manually collected hierarchical regulatory interactions database based on more than 7000 scientific papers which can serve as a knowledgebase for verification of predictions, and a large set of curated by experts transcription factor binding sites used in regulon inference by a variety of tools. RegTransBase captures the knowledge from published scientific literature using controlled vocabularies and contains various types of experimental data, such as: the activation or repression of transcription by an identified direct regulator; determination of the transcriptional regulatory function of a protein (or RNA) directly binding to DNA or RNA; mapping of binding sites for a regulatory protein; characterization of regulatory mutations. Analysis of the data collected from literature resulted in the creation of Putative Regulons from Experimental Data that are also available in RegTransBase. Conclusions RegTransBase is a powerful user-friendly platform for the investigation of regulation in prokaryotes. It uses a collection of validated regulatory sequences that can be easily extracted and used to infer regulatory interactions by comparative genomics techniques thus assisting researchers in the interpretation of transcriptional regulation data.

2013-01-01

232

Mobilization of Processed, Membrane-Tethered SPT23 Transcription Factor by CDC48 UFD1\\/NPL4, a Ubiquitin-Selective Chaperone  

Microsoft Academic Search

The OLE pathway of yeast regulates the level of the ER-bound enzyme ?9-fatty acid desaturase OLE1, thereby controlling membrane fluidity. A central component of this regulon is the transcription factor SPT23, a homolog of mammalian NF-?B. SPT23 is synthesized as an inactive, ER membrane-anchored precursor that is activated by regulated ubiquitin\\/proteasome-dependent processing (RUP). We now show that SPT23 dimerizes prior

Michael Rape; Thorsten Hoppe; Ingo Gorr; Marian Kalocay; Holger Richly; Stefan Jentsch

2001-01-01

233

Investigation of the Staphylococcus aureus GraSR Regulon Reveals Novel Links to Virulence, Stress Response and Cell Wall Signal Transduction Pathways  

PubMed Central

The GraS/GraR two-component system has been shown to control cationic antimicrobial peptide (CAMP) resistance in the major human pathogen Staphylococcus aureus. We demonstrated that graX, also involved in CAMP resistance and cotranscribed with graRS, encodes a regulatory cofactor of the GraSR signaling pathway, effectively constituting a three-component system. We identified a highly conserved ten base pair palindromic sequence (5? ACAAA TTTGT 3?) located upstream from GraR-regulated genes (mprF and the dlt and vraFG operons), which we show to be essential for transcriptional regulation by GraR and induction in response to CAMPs, suggesting it is the likely GraR binding site. Genome-based predictions and transcriptome analysis revealed several novel GraR target genes. We also found that the GraSR TCS is required for growth of S. aureus at high temperatures and resistance to oxidative stress. The GraSR system has previously been shown to play a role in S. aureus pathogenesis and we have uncovered previously unsuspected links with the AgrCA peptide quorum-sensing system controlling virulence gene expression. We also show that the GraSR TCS controls stress reponse and cell wall metabolism signal transduction pathways, sharing an extensive overlap with the WalKR regulon. This is the first report showing a role for the GraSR TCS in high temperature and oxidative stress survival and linking this system to stress response, cell wall and pathogenesis control pathways.

Falord, Melanie; Mader, Ulrike; Hiron, Aurelia; Debarbouille, Michel; Msadek, Tarek

2011-01-01

234

clpB, a novel member of the Listeria monocytogenes CtsR regulon, is involved in virulence but not in general stress tolerance.  

PubMed

Clp-HSP100 ATPases are a widespread family of ubiquitous proteins that occur in both prokaryotes and eukaryotes and play important roles in the folding of newly synthesized proteins and refolding of aggregated proteins. They have also been shown to participate in the virulence of several pathogens, including Listeria monocytogenes. Here, we describe a member of the Clp-HSP100 family of L. monocytogenes that harbors all the characteristics of the ClpB subclass, which is absent in the closely related gram-positive model organism, Bacillus subtilis. Transcriptional analysis of clpB revealed a heat shock-inducible sigma(A)-type promoter. Potential binding sites for the CtsR regulator of stress response were identified in the promoter region. In vivo and in vitro approaches were used to show that expression of clpB is repressed by CtsR, a finding indicating that clpB is a novel member of the L. monocytogenes CtsR regulon. We showed that ClpB is involved in the pathogenicity of L. monocytogenes since the DeltaclpB mutant is significantly affected by virulence in a murine model of infection; we also demonstrate that this effect is apparently not due to a defect in general stress resistance. Indeed, ClpB is not involved in tolerance to heat, salt, detergent, puromycin, or cold stress, even though its synthesis is inducible by heat shock. However, ClpB was shown to play a role in induced thermotolerance, allowing increased resistance of L. monocytogenes to lethal temperatures. This work gives the first example of a clpB gene directly controlled by CtsR and describes the first role for a ClpB protein in induced thermotolerance and virulence in a gram-positive organism. PMID:14762012

Chastanet, Arnaud; Derre, Isabelle; Nair, Shamila; Msadek, Tarek

2004-02-01

235

Characterization of the SigD regulon of C. difficile and its positive control of toxin production through the regulation of tcdR.  

PubMed

Clostridium difficile intestinal disease is mediated largely by the actions of toxins A (TcdA) and B (TcdB), whose production occurs after the initial steps of colonization involving different surface or flagellar proteins. In B. subtilis, the sigma factor SigD controls flagellar synthesis, motility, and vegetative autolysins. A homolog of SigD encoding gene is present in the C.difficile 630 genome. We constructed a sigD mutant in C. difficile 630 ?erm to analyze the regulon of SigD using a global transcriptomic approach. A total of 103 genes were differentially expressed between the wild-type and the sigD mutant, including genes involved in motility, metabolism and regulation. In addition, the sigD mutant displayed decreased expression of genes involved in flagellar biosynthesis, and also of genes encoding TcdA and TcdB as well as TcdR, the positive regulator of the toxins. Genomic analysis and RACE-PCR experiments allowed us to characterize promoter sequences of direct target genes of SigD including tcdR and to identify the SigD consensus. We then established that SigD positively regulates toxin expression via direct control of tcdR transcription. Interestingly, the overexpression of FlgM, a putative anti-SigD factor, inhibited the positive regulation of motility and toxin synthesis by SigD. Thus, SigD appears to be the first positive regulator of the toxin synthesis in C. difficile. PMID:24358307

El Meouche, Imane; Peltier, Johann; Monot, Marc; Soutourina, Olga; Pestel-Caron, Martine; Dupuy, Bruno; Pons, Jean-Louis

2013-01-01

236

Characterization of the small untranslated RNA RyhB and its regulon in Vibrio cholerae.  

PubMed

Numerous small untranslated RNAs (sRNAs) have been identified in Escherichia coli in recent years, and their roles are gradually being defined. However, few of these sRNAs appear to be conserved in Vibrio cholerae, and both identification and characterization of sRNAs in V. cholerae remain at a preliminary stage. We have characterized one of the few sRNAs conserved between E. coli and V. cholerae: RyhB. Sequence conservation is limited to the central region of the gene, and RyhB in V. cholerae is significantly larger than in E. coli. As in E. coli, V. cholerae RyhB is regulated by the iron-dependent repressor Fur, and it interacts with the RNA-binding protein Hfq. The regulons controlled by RyhB in V. cholerae and E. coli appear to differ, although some overlap is evident. Analysis of gene expression in V. cholerae in the absence of RyhB suggests that the role of this sRNA is not limited to control of iron utilization. Quantitation of RyhB expression in the suckling mouse intestine suggests that iron availability is not limiting in this environment, and RyhB is not required for colonization of this mammalian host by V. cholerae. PMID:15937163

Davis, Brigid M; Quinones, Mariam; Pratt, Jason; Ding, Yanpeng; Waldor, Matthew K

2005-06-01

237

Salmonella typhimurium flhE, a conserved flagellar regulon gene required for swarming  

PubMed Central

The Salmonella typhimurium gene flhE is located at the end of a large flagellar locus in at least 10 peritrichously flagellated Gram-negative bacterial genera, but it shares no significant similarity with other genes. This study shows that flhE is transcribed as part of an flhBAE flagellar operon, under the control of the flagellar master regulator FlhD2C2. Deletion of the chromosomal flhE gene did not affect swimming motility, but it abolished swarming motility across solid agar. Swarming was restored to the ?flhE mutant by the 130 aa putative envelope protein FlhE, but not by a truncated version lacking the N-terminal signal peptidase I recognition sequence. The ?flhE mutant was indistinguishable from the wild-type parent in number and distribution of flagella, secretion of flagellin subunits, and flagellar gene expression, and there were no obvious differences in cell-surface LPS and extracellular polysaccharide. The ?flhE mutant was able to swarm when non-ionic surfactant was included in agar medium, and it showed differences to the wild-type in binding calcofluor and Congo red dyes, and in biofilm production. The data show that the flhE gene is part of the flagella regulon but that it has no role in flagella biogenesis. It appears, nevertheless, to act at the cell envelope to influence flagella-dependent swarming.

Stafford, Graham P.; Hughes, Colin

2008-01-01

238

Genome-Wide Identification of Transcription Start Sites, Promoters and Transcription Factor Binding Sites in E. coli  

PubMed Central

Despite almost 40 years of molecular genetics research in Escherichia coli a major fraction of its Transcription Start Sites (TSSs) are still unknown, limiting therefore our understanding of the regulatory circuits that control gene expression in this model organism. RegulonDB (http://regulondb.ccg.unam.mx/) is aimed at integrating the genetic regulatory network of E. coli K12 as an entirely bioinformatic project up till now. In this work, we extended its aims by generating experimental data at a genome scale on TSSs, promoters and regulatory regions. We implemented a modified 5? RACE protocol and an unbiased High Throughput Pyrosequencing Strategy (HTPS) that allowed us to map more than 1700 TSSs with high precision. From this collection, about 230 corresponded to previously reported TSSs, which helped us to benchmark both our methodologies and the accuracy of the previous mapping experiments. The other ca 1500 TSSs mapped belong to about 1000 different genes, many of them with no assigned function. We identified promoter sequences and type of ? factors that control the expression of about 80% of these genes. As expected, the housekeeping ?70 was the most common type of promoter, followed by ?38. The majority of the putative TSSs were located between 20 to 40 nucleotides from the translational start site. Putative regulatory binding sites for transcription factors were detected upstream of many TSSs. For a few transcripts, riboswitches and small RNAs were found. Several genes also had additional TSSs within the coding region. Unexpectedly, the HTPS experiments revealed extensive antisense transcription, probably for regulatory functions. The new information in RegulonDB, now with more than 2400 experimentally determined TSSs, strengthens the accuracy of promoter prediction, operon structure, and regulatory networks and provides valuable new information that will facilitate the understanding from a global perspective the complex and intricate regulatory network that operates in E. coli.

Mendoza-Vargas, Alfredo; Olvera, Leticia; Olvera, Maricela; Grande, Ricardo; Vega-Alvarado, Leticia; Taboada, Blanca; Jimenez-Jacinto, Veronica; Salgado, Heladia; Juarez, Katy; Contreras-Moreira, Bruno; Huerta, Araceli M.; Collado-Vides, Julio; Morett, Enrique

2009-01-01

239

Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility.  

PubMed

In Salmonella enterica, an activated Rcs signalling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes -fliPQR- located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signalling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

Wang, Qingfeng; Harshey, Rasika M

2009-10-01

240

Rcs signaling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility  

PubMed Central

Summary In Salmonella enterica, an activated Rcs signaling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes - fliPQR - located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signaling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence.

Wang, Qingfeng; Harshey, Rasika M.

2009-01-01

241

Extending the classification of bacterial transcription factors beyond the helix-turn-helix motif as an alternative approach to discover new cis/trans relationships  

PubMed Central

Transcription factors (TFs) of bacterial helix–turn–helix superfamilies exhibit different effector-binding domains (EBDs) fused to a DNA-binding domain with a common feature. In a previous study of the GntR superfamily, we demonstrated that classifying members into subfamilies according to the EBD heterogeneity highlighted unsuspected and accurate TF-binding site signatures. In this work, we present how such in silico analysis can provide prediction tools to discover new cis/trans relationships. The TF-binding site consensus of the HutC/GntR subfamily was used to (i) predict target sites within the Streptomyces coelicolor genome, (ii) discover a new HutC/GntR regulon and (iii) discover its specific TF. By scanning the S.coelicolor genome we identified a presumed new HutC regulon that comprises genes of the phosphotransferase system (PTS) specific for the uptake of N-acetylglucosamine (PTSNag). A weight matrix was derived from the compilation of the predicted cis-acting elements upstream of each gene of the presumed regulon. Under the assumption that TFs are often subject to autoregulation, we used this matrix to scan the upstream region of the 24 HutC-like members of S.coelicolor. orf SCO5231 (dasR) was selected as the best candidate according to the high score of a 16 bp sequence identified in its upstream region. Our prediction that DasR regulates the PTSNag regulon was confirmed by in vivo and in vitro experiments. In conclusion, our in silico approach permitted to highlight the specific TF of a regulon out of the 673 orfs annotated as ‘regulatory proteins’ within the genome of S.coelicolor.

Rigali, Sebastien; Schlicht, Maximilian; Hoskisson, Paul; Nothaft, Harald; Merzbacher, Matthias; Joris, Bernard; Titgemeyer, Fritz

2004-01-01

242

Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator  

SciTech Connect

Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened or eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.

Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.; Llinás, Manuel (Princeton); (UW-MED)

2010-11-05

243

Aminopeptidase N1 (EtAPN1), an M1 Metalloprotease of the Apicomplexan Parasite Eimeria tenella, Participates in Parasite Development.  

PubMed

Aminopeptidases N are metalloproteases of the M1 family that have been reported in numerous apicomplexan parasites, including Plasmodium, Toxoplasma, Cryptosporidium, and Eimeria. While investigating the potency of aminopeptidases as therapeutic targets against coccidiosis, one of the most important avian diseases caused by the genus Eimeria, we identified and characterized Eimeria tenella aminopeptidase N1 (EtAPN1). Its inhibition by bestatin and amastatin, as well as its reactivation by divalent ions, is typical of zinc-dependent metalloproteases. EtAPN1 shared a similar sequence, three-dimensional structure, and substrate specificity and similar kinetic parameters with A-M1 from Plasmodium falciparum (PfA-M1), a validated target in the treatment of malaria. EtAPN1 is synthesized as a 120-kDa precursor and cleaved into 96-, 68-, and 38-kDa forms during sporulation. Further, immunolocalization assays revealed that, similar to PfA-M1, EtAPN1 is present during the intracellular life cycle stages in both the parasite cytoplasm and the parasite nucleus. The present results support the hypothesis of a conserved role between the two aminopeptidases, and we suggest that EtAPN1 might be a valuable target for anticoccidiosis drugs. PMID:24839124

Gras, Simon; Byzia, Anna; Gilbert, Florence B; McGowan, Sheena; Drag, Marcin; Silvestre, Anne; Niepceron, Alisson; Lecaille, Fabien; Lalmanach, Gilles; Brossier, Fabien

2014-07-01

244

Comparative genomics of bacterial zinc regulons: Enhanced ion transport, pathogenesis, and rearrangement of ribosomal proteins  

PubMed Central

Zinc is an important component of many proteins, but in large concentrations it is poisonous to the cell. Thus its transport is regulated by zinc repressors ZUR of proteobacteria and Gram-positive bacteria from the Bacillus group and AdcR of bacteria from the Streptococcus group. Comparative computational analysis allowed us to identify binding signals of ZUR repressors GAAATGTTATANTATAACATTTC for ?-proteobacteria, GTAATGTAATAACATTAC for the Agrobacterium group, GATATGTTATAACATATC for the Rhododoccus group, TAAATCGTAATNATTACGATTTA for Gram-positive bacteria, and TTAACYRGTTAA of the streptococcal AdcR repressor. In addition to known transporters and their paralogs, zinc regulons were predicted to contain a candidate component of the ATP binding cassette, zinT (b1995 in Escherichia coli and yrpE in Bacillus subtilis). Candidate AdcR-binding sites were identified upstream of genes encoding pneumococcal histidine triad (PHT) proteins from a number of pathogenic streptococci. Protein functional analysis of this family suggests that PHT proteins are involved in the invasion process. Finally, repression by zinc was predicted for genes encoding a variety of paralogs of ribosomal proteins. The original copies of all these proteins contain zinc-ribbon motifs and thus likely bind zinc, whereas these motifs are destroyed in zinc-regulated paralogs. We suggest that the induction of these paralogs in conditions of zinc starvation leads to their incorporation in a fraction of ribosomes instead of the original ribosomal proteins; the latter are then degraded with subsequent release of some zinc for the utilization by other proteins. Thus we predict a mechanism for maintaining zinc availability for essential enzymes.

Panina, Ekaterina M.; Mironov, Andrey A.; Gelfand, Mikhail S.

2003-01-01

245

Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium  

PubMed Central

Background The Salmonella PreA/PreB two-component system (TCS) is an ortholog of the QseBC TCS of Escherichia coli. In both Salmonella and E. coli, this system has been shown to affect motility and virulence in response to quorum-sensing and hormonal signals, and to affect the transcription of the Salmonella enterica serovar Typhimurium (S. Typhimurium) pmrAB operon, which encodes an important virulence-associated TCS. Results To determine the PreA/PreB regulon in S. Typhimurium, we performed DNA microarrays comparing the wild type strain and various preA and/or preB mutants in the presence of ectopically expressed preA (qseB). These data confirmed our previous findings of the negative effect of PreB on PreA gene regulation and identified candidate PreA-regulated genes. A proportion of the activated loci were previously identified as PmrA-activated genes (yibD, pmrAB, cptA, etc.) or were genes located in the local region around preA, including the preAB operon. The transcriptional units were defined in this local region by RT-PCR, suggesting three PreA activated operons composed of preA-preB, mdaB-ygiN, and ygiW-STM3175. Several putative virulence-related phenotypes were examined for preAB mutants, resulting in the observation of a host cell invasion and slight virulence defect of a preAB mutant. Contrary to previous reports on this TCS, we were unable to show a PreA/PreB-dependent effect of the quorum-sensing signal AI-2 or of epinephrine on S. Typhimurium with regard to bacterial motility. Conclusion This work further characterizes this unorthadox OmpR/EnvZ class TCS and provides novel candidate regulated genes for further study. This first in-depth study of the PreA/PreB regulatory system phenotypes and regulation suggests significant comparative differences to the reported function of the orthologous QseB/QseC in E. coli.

2009-01-01

246

Identification and characterization of transcription networks in environmentally significant species  

SciTech Connect

Understanding the regulation of gene expression, transcription regulation in particular, is one of the grand challenges of molecular biology. Transcription regulation is arguably the most important foundation of cellular function, since it exerts the most fundamental control of the abundance of virtually all of a cell's functional macromolecules. Nevertheless, this process, perhaps because of its difficulty, has been the subject of only a limited number of genomic level analyses. We have undertaken bioinformatics projects to address this issue by developing (1) a cross-species comparison method (i.e. phylogenetic footprinting) for the identification of transcription factor binding sites, (2) a Bayesian clustering method to identify regulons, (3) an improved scanning algorithm that uses a position weight matrix and several related species sequence data to locate transcription factor binding sites, and (4) a method to predict cognate binding sites for transcription factors of unknown specificity. These bioinformatics methods were developed using the model proteobacterium Escherichia coli, with further applications to the genomes of environmentally significant microbes (Rhodopseudomonas palustris, Shewanella oneidensis) in later years of the grant.

Lawrence, Charles E.; McCue, Lee Ann

2005-11-30

247

Components of the Legionella pneumophila Flagellar Regulon Contribute to Multiple Virulence Traits, Including Lysosome Avoidance and Macrophage Death  

PubMed Central

Legionella pneumophila is a motile intracellular pathogen of macrophages and amoebae. When nutrients become scarce, the bacterium induces expression of transmission traits, some of which are dependent on the flagellar sigma factor FliA (?28). To test how particular components of the L. pneumophila flagellar regulon contribute to virulence, we compared a fliA mutant with strains whose flagellar construction is disrupted at various stages. We find that L. pneumophila requires FliA to avoid lysosomal degradation in murine bone marrow-derived macrophages (BMM), to regulate production of a melanin-like pigment, and to regulate binding to the dye crystal violet, whereas motility, flagellar secretion, and external flagella or flagellin are dispensable for these activities. Thus, in addition to flagellar genes, the FliA sigma factor regulates an effector(s) or regulator(s) that contributes to other transmissive traits, notably inhibition of phagosome maturation. Whether or not the microbes produced flagellin, all nonmotile L. pneumophila mutants bound BMM less efficiently than the wild type, resulting in poor infectivity and a loss of contact-dependent death of BMM. Therefore, bacterial motility increases contact with host cells during infection, but flagellin is not an adhesin. When BMM contact by each nonmotile strain was promoted by centrifugation, all the mutants bound BMM similarly, but only those microbes that synthesized flagellin induced BMM death. Thus, the flagellar regulon equips the aquatic pathogen L. pneumophila to coordinate motility with multiple traits vital to virulence.

Molofsky, A. B.; Shetron-Rama, L. M.; Swanson, Michele S.

2005-01-01

248

Mutational analysis of the role of the first helix of region 4.2 of the ? 70 subunit of Escherichia coli RNA polymerase in transcriptional activation by activator protein PhoB  

Microsoft Academic Search

Transcription of the genes belonging to the phosphate (pho) regulon inEscherichia coli requires the specific activator protein PhoB, in addition to RNA polymerase containing the major sigma factor, ?70, which is encoded byrpoD. We previously isolated two mutant ?70s(D570G and E575K) that were specifically defective in transcribing thepho genes. The mutated sites were located near and within the first helix

S.-K. Kim; K. Makino; M. Amemura; A. Nakata; H. Shinagawa

1995-01-01

249

Transcriptional Regulator PerA Influences Biofilm-Associated, Platelet Binding, and Metabolic Gene Expression in Enterococcus faecalis  

PubMed Central

Enterococcus faecalis is an opportunistic pathogen and a leading cause of nosocomial infections, traits facilitated by the ability to quickly acquire and transfer virulence determinants. A 150 kb pathogenicity island (PAI) comprised of genes contributing to virulence is found in many enterococcal isolates and is known to undergo horizontal transfer. We have shown that the PAI-encoded transcriptional regulator PerA contributes to pathogenicity in the mouse peritonitis infection model. In this study, we used whole-genome microarrays to determine the PerA regulon. The PerA regulon is extensive, as transcriptional analysis showed 151 differentially regulated genes. Our findings reveal that PerA coordinately regulates genes important for metabolism, amino acid degradation, and pathogenicity. Further transcriptional analysis revealed that PerA is influenced by bicarbonate. Additionally, PerA influences the ability of E. faecalis to bind to human platelets. Our results suggest that PerA is a global transcriptional regulator that coordinately regulates genes responsible for enterococcal pathogenicity.

Maddox, Scott M.; Coburn, Phillip S.; Shankar, Nathan; Conway, Tyrrell

2012-01-01

250

Elucidating the regulon of multidrug resistance regulator RarA in Klebsiella pneumoniae.  

PubMed

RarA is an AraC-type regulator in Klebsiella pneumoniae, which, when overexpressed, confers a low-level multidrug-resistant (MDR) phenotype linked to the upregulation of both the acrAB and oqxAB efflux genes. Increased rarA expression has also been shown to be integral in the development of tigecycline resistance in the absence of ramA in K. pneumoniae. Given its phenotypic role in MDR, microarray analyses were performed to determine the RarA regulon. Transcriptome analysis was undertaken using strains Ecl8?rarA/pACrarA-2 (rarA-expressing construct) and Ecl8?rarA/pACYC184 (vector-only control) using bespoke microarray slides consisting of probes derived from the genomic sequences of K. pneumoniae MGH 78578 (NC_009648.1) and Kp342 (NC_011283.1). Our results show that rarA overexpression resulted in the differential expression of 66 genes (42 upregulated and 24 downregulated). Under the COG (clusters of orthologous groups) functional classification, the majority of affected genes belonged to the category of cell envelope biogenesis and posttranslational modification, along with genes encoding the previously uncharacterized transport proteins (e.g., KPN_03141, sdaCB, and leuE) and the porin OmpF. However, genes associated with energy production and conversion and amino acid transport/metabolism (e.g., nuoA, narJ, and proWX) were found to be downregulated. Biolog phenotype analyses demonstrated that rarA overexpression confers enhanced growth of the overexpresser in the presence of several antibiotic classes (i.e., beta-lactams and fluoroquinolones), the antifungal/antiprotozoal compound clioquinol, disinfectants (8-hydroxyquinoline), protein synthesis inhibitors (i.e., minocycline and puromycin), membrane biogenesis agents (polymyxin B and amitriptyline), DNA synthesis (furaltadone), and the cytokinesis inhibitor (sanguinarine). Both our transcriptome and phenotypic microarray data support and extend the role of RarA in the MDR phenotype of K. pneumoniae. PMID:23318802

De Majumdar, Shyamasree; Veleba, Mark; Finn, Sarah; Fanning, Séamus; Schneiders, Thamarai

2013-04-01

251

Host Cells Participate in the In Vitro Effects of Novel Diamidine Analogues against Tachyzoites of the Intracellular Apicomplexan Parasites Neospora caninum and Toxoplasma gondii?  

PubMed Central

The in vitro effects of 19 dicationic diamidine derivatives against the proliferative tachyzoite stages of the apicomplexan parasites Neospora caninum and Toxoplasma gondii were investigated. Four compounds (DB811, DB786, DB750, and DB766) with similar structural properties exhibited profound inhibition of tachyzoite proliferation. The lowest 50% inhibitory concentrations were found for DB786 (0.21 ?M against Neospora and 0.22 ?M against Toxoplasma) and DB750 (0.23 ?M against Neospora and 0.16 ?M against Toxoplasma), with complete proliferation inhibition at 1.7 ?M for both drugs against both species. DB750 and DB786 were chosen for further studies. Electron microscopy of N. caninum-infected human foreskin fibroblast (HFF) cultures revealed distinct alterations and damage of parasite ultrastructure upon drug treatment, while host cells remained unaffected. For true parasiticidal efficacy against N. caninum, a treatment duration of 3 h at 1.7 ?M was sufficient for DB750, while a longer treatment period (24 h) was necessary for DB786. Pretreatment of tachyzoites for 1 h prior to host cell exposure had no effect on infectivity. However, pretreatment of uninfected host cells had a significant adverse effect on N. caninum proliferation: exposure of HFFs to 1.7 ?M DB750 for 6, 12, or 24 h, followed by infection with N. caninum tachyzoites and subsequent culture in the absence of DB750, resulted in significantly delayed parasite proliferation. This suggests that either (i) these compounds or their respective active metabolites were still present after the removal of the drugs or (ii) the drug treatments reversibly impaired some functional activities in HFFs that were essential for parasite proliferation and/or survival.

Leepin, Angela; Studli, Angela; Brun, Reto; Stephens, Chad E.; Boykin, David W.; Hemphill, Andrew

2008-01-01

252

Identification of the REST regulon reveals extensive transposable element-mediated binding site duplication  

Microsoft Academic Search

The genome-wide mapping of gene-regulatory motifs remains a major goal that will facilitate the modelling of gene-regulatory networks and their evo- lution. The repressor element 1 is a long, conserved transcription factor-binding site which recruits the transcriptional repressor REST to numerous neuron- specific target genes. REST plays important roles in multiple biological processes and disease states. To map RE1 sites

Rory Johnson; Richard J. Gamblin; Lezanne Ooi; Alexander W. Bruce; Ian J. Donaldson; David R. Westhead; Ian C. Wood; Richard M. Jackson; Noel J. Buckley

2006-01-01

253

DNA microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: an approach to comprehensive analysis of B.subtilis two-component regulatory systems  

PubMed Central

We have analyzed the regulons of the Bacillus subtilis two-component regulators DegU, ComA and PhoP by using whole genome DNA microarrays. For these experiments we took the strategy that the response regulator genes were cloned downstream of an isopropyl-?-d-thiogalactopyranoside-inducible promoter on a multicopy plasmid and expressed in disruptants of the cognate sensor kinase genes, degS, comP and phoR, respectively. The feasibility of this experimental design to detect target genes was demonstrated by the following two results. First, expression of lacZ fusions of aprE, srfA and ydhF, the target genes of DegU, ComA and PhoP, respectively, was stimulated in their cognate sensor kinase-deficient mutants upon overproduction of the regulators. Secondly, by microarray analysis most of the known target genes for the regulators were detected and, where unknown genes were found, the regulator dependency of several of them was demonstrated. As the mutants used were deficient in the kinase genes, these results show that target candidates can be detected without signal transduction. Using this experimental design, we identified many genes whose dependency on the regulators for expression had not been known. These results suggest the applicability of the strategy to the comprehensive transcription analysis of the B.subtilis two-component systems.

Ogura, Mitsuo; Yamaguchi, Hirotake; Yoshida, Ken-ichi; Fujita, Yasutaro; Tanaka, Teruo

2001-01-01

254

Immunogenicity of Novel DosR Regulon-Encoded Candidate Antigens of Mycobacterium tuberculosis in Three High-Burden Populations in Africa? †  

PubMed Central

Increasing knowledge about DosR regulon-encoded proteins has led us to produce novel Mycobacterium tuberculosis antigens for immunogenicity testing in human populations in three countries in Africa to which tuberculosis (TB) is endemic. A total of 131 tuberculin skin test-positive and/or ESAT-6/CFP10-positive, human immunodeficiency virus-negative adult household contacts of active pulmonary TB cases from South Africa (n = 56), The Gambia (n = 26), and Uganda (n = 49) were tested for gamma interferon responses to 7 classical and 51 DosR regulon-encoded M. tuberculosis recombinant protein antigens. ESAT-6/CFP10 fusion protein evoked responses in >75% of study participants in all three countries. Of the DosR regulon-encoded antigens tested, Rv1733c was the most commonly recognized by participants from both South Africa and Uganda and the third most commonly recognized antigen in The Gambia. The four most frequently recognized DosR regulon-encoded antigens in Uganda (Rv1733c, Rv0081, Rv1735c, and Rv1737c) included the three most immunogenic antigens in South Africa. In contrast, Rv3131 induced the highest percentage of responders in Gambian contacts (38%), compared to only 3.4% of Ugandan contacts and no South African contacts. Appreciable percentages of TB contacts with a high likelihood of latent M. tuberculosis infection responded to several novel DosR regulon-encoded M. tuberculosis proteins. In addition to significant similarities in antigen recognition profiles between the three African population groups, there were also disparities, which may stem from genetic differences between both pathogen and host populations. Our findings have implications for the selection of potential TB vaccine candidates and for determining biosignatures of latent M. tuberculosis infection, active TB disease, and protective immunity.

Black, Gillian F.; Thiel, Bonnie A.; Ota, Martin O.; Parida, Shreemanta K.; Adegbola, Richard; Boom, W. Henry; Dockrell, Hazel M.; Franken, Kees L. M. C.; Friggen, Annemiek H.; Hill, Philip C.; Klein, Michel R.; Lalor, Maeve K.; Mayanja, Harriet; Schoolnik, Gary; Stanley, Kim; Weldingh, Karin; Kaufmann, Stefan H. E.; Walzl, Gerhard; Ottenhoff, Tom H. M.

2009-01-01

255

Repressor for the sn-glycerol 3-phosphate regulon of Escherichia coli K-12: primary structure and identification of the DNA-binding domain.  

PubMed Central

The nucleotide sequence of the glpEGR operon of Escherichia coli was determined. The translational reading frame at the beginning, middle, and end of each gene was verified. The glpE gene encodes an acidic, cytoplasmic protein of 108 amino acids with a molecular weight of 12,082. The glpG gene encodes a basic, cytoplasmic membrane-associated protein of 276 amino acids with a molecular weight of 31,278. The functions of GlpE and GlpG are unknown. The glpR gene encodes the repressor for the glycerol 3-phosphate regulon, a protein predicted to contain 252 amino acids with a calculated molecular weight of 28,048. The amino acid sequence of the glp repressor was similar to several repressors of carbohydrate catabolic systems, including those of the glucitol (GutR), fucose (FucR), and deoxyribonucleoside (DeoR) systems of E. coli, as well as those of the lactose (LacR) and inositol (IolR) systems of gram-positive bacteria and agrocinopine (AccR) system of Agrobacterium tumefaciens. These repressors constitute a family of related proteins, all of which contain approximately 250 amino acids, possess a helix-turn-helix DNA-binding motif near the amino terminus, and bind a sugar phosphate molecule as the inducing signal. The DNA recognition helix of the glp repressor and the nucleotide sequence of the glp operator were very similar to those of the deo system. The presumptive recognition helix of the glp repressor was changed by site-directed mutagenesis to match that of the deo repressor or, in a separate construct, to abolish DNA binding. Neither altered form of the glp repressor recognized the glp or deo operator, either in vivo or in vitro. However, both altered forms of the glp repressor were negatively dominant to the wild-type glp repressor, indicating that the inability to bind DNA with high affinity was due to alteration of the DNA-binding domain, not to an inability to oligomerize or instability of the altered repressors. For the first time, analysis of repressors with altered DNA-binding domains has verified the assignment of the helix-turn-helix motif of the transcriptional regulators in the deoR family.

Zeng, G; Ye, S; Larson, T J

1996-01-01

256

Repressor for the sn-glycerol 3-phosphate regulon of Escherichia coli K-12: primary structure and identification of the DNA-binding domain.  

PubMed

The nucleotide sequence of the glpEGR operon of Escherichia coli was determined. The translational reading frame at the beginning, middle, and end of each gene was verified. The glpE gene encodes an acidic, cytoplasmic protein of 108 amino acids with a molecular weight of 12,082. The glpG gene encodes a basic, cytoplasmic membrane-associated protein of 276 amino acids with a molecular weight of 31,278. The functions of GlpE and GlpG are unknown. The glpR gene encodes the repressor for the glycerol 3-phosphate regulon, a protein predicted to contain 252 amino acids with a calculated molecular weight of 28,048. The amino acid sequence of the glp repressor was similar to several repressors of carbohydrate catabolic systems, including those of the glucitol (GutR), fucose (FucR), and deoxyribonucleoside (DeoR) systems of E. coli, as well as those of the lactose (LacR) and inositol (IolR) systems of gram-positive bacteria and agrocinopine (AccR) system of Agrobacterium tumefaciens. These repressors constitute a family of related proteins, all of which contain approximately 250 amino acids, possess a helix-turn-helix DNA-binding motif near the amino terminus, and bind a sugar phosphate molecule as the inducing signal. The DNA recognition helix of the glp repressor and the nucleotide sequence of the glp operator were very similar to those of the deo system. The presumptive recognition helix of the glp repressor was changed by site-directed mutagenesis to match that of the deo repressor or, in a separate construct, to abolish DNA binding. Neither altered form of the glp repressor recognized the glp or deo operator, either in vivo or in vitro. However, both altered forms of the glp repressor were negatively dominant to the wild-type glp repressor, indicating that the inability to bind DNA with high affinity was due to alteration of the DNA-binding domain, not to an inability to oligomerize or instability of the altered repressors. For the first time, analysis of repressors with altered DNA-binding domains has verified the assignment of the helix-turn-helix motif of the transcriptional regulators in the deoR family. PMID:8955387

Zeng, G; Ye, S; Larson, T J

1996-12-01

257

Transcriptional plasticity through differential assembly of a multiprotein activation complex.  

PubMed

Cell adaptation to the environment often involves induction of complex gene expression programs under the control of specific transcriptional activators. For instance, in response to cadmium, budding yeast induces transcription of the sulfur amino acid biosynthetic genes through the basic-leucine zipper activator Met4, and also launches a program of substitution of abundant glycolytic enzymes by isozymes with a lower content in sulfur. We demonstrate here that transcriptional induction of PDC6, which encodes a pyruvate decarboxylase isoform with low sulfur content, is directly controlled by Met4 and its DNA-binding cofactors the basic-helix-loop-helix protein Cbf1 and the two homologous zinc finger proteins Met31 and Met32. Study of Cbf1 and Met31/32 association with PDC6 allowed us to find a new mechanism of recruitment of Met4, which allows PDC6 being differentially regulated compared to sulfur amino acid biosynthetic genes. Our findings provide a new example of mechanism allowing transcriptional plasticity within a regulatory network thanks to a definite toolbox comprising a unique master activator and several dedicated DNA-binding cofactors. We also show evidence suggesting that integration of PDC6 to the Met4 regulon may have occurred recently in the evolution of the Saccharomyces cerevisiae lineage. PMID:20392822

Cormier, Laëtitia; Barbey, Régine; Kuras, Laurent

2010-08-01

258

Bacillus subtilis ilvB operon: an intersection of global regulons.  

PubMed

The genes of the major Bacillus subtilis operon (ilvB) for biosynthesis of branched-chain amino acids are subject to multiple mechanisms of regulation. The global regulatory proteins CodY and TnrA bind upstream of the transcription start site and are likely to control transcription initiation, leucine-specific tRNA regulates transcriptional elongation, and unknown factors differentially cleave the full-length mRNA. Another global regulator, CcpA, known to be required for ilvB transcription, was shown here to act directly at the ilvB promoter by a novel mechanism. Although CcpA was able to bind to the ilvB promoter region, it stimulated transcription significantly only when CodY was present, suggesting that CcpA acts primarily by interfering with repression by CodY. Additionally, CcpA was shown to control indirectly the expression of other CodY-regulated target genes, apparently by altering the intracellular level of branched-chain amino acids. PMID:15916605

Shivers, Robert P; Sonenshein, Abraham L

2005-06-01

259

Transcriptional regulation of NAD metabolism in bacteria: NrtR family of Nudix-related regulators  

PubMed Central

A novel family of transcription factors responsible for regulation of various aspects of NAD synthesis in a broad range of bacteria was identified by comparative genomics approach. Regulators of this family (here termed NrtR for Nudix-related transcriptional regulators), currently annotated as ADP-ribose pyrophosphatases from the Nudix family, are composed of an N-terminal Nudix-like effector domain and a C-terminal DNA-binding HTH-like domain. NrtR regulons were reconstructed in diverse bacterial genomes by identification and comparative analysis of NrtR-binding sites upstream of genes involved in NAD biosynthetic pathways. The candidate NrtR-binding DNA motifs showed significant variability between microbial lineages, although the common consensus sequence could be traced for most of them. Bioinformatics predictions were experimentally validated by gel mobility shift assays for two NrtR family representatives. ADP-ribose, the product of glycohydrolytic cleavage of NAD, was found to suppress the in vitro binding of NrtR proteins to their DNA target sites. In addition to a major role in the direct regulation of NAD homeostasis, some members of NrtR family appear to have been recruited for the regulation of other metabolic pathways, including sugar pentoses utilization and biogenesis of phosphoribosyl pyrophosphate. This work and the accompanying study of NiaR regulon demonstrate significant variability of regulatory strategies for control of NAD metabolic pathway in bacteria.

De Ingeniis, Jessica; Mancini, Chiara; Cimadamore, Flavio; Zhang, Hong; Osterman, Andrei L.; Raffaelli, Nadia

2008-01-01

260

What Determines the Assembly of Transcriptional Network Motifs in Escherichia coli?  

PubMed Central

Transcriptional networks are constituted by a collection of building blocks known as network motifs. Why do motifs appear? An adaptive model of motif emergence was recently questioned in favor of neutralist scenarios. Here, we provide a new picture of motif assembly in Escherichia coli which partially clarifies these contrasting explanations. This is based on characterizing the linkage between motifs and sensing or response specificity of their constituent transcriptional factors (TFs). We find that sensing specificity influences the distribution of autoregulation, while the tendency of a TF to establish feed-forward loops (FFLs) depends on response specificity, i.e., regulon size. Analysis of the latter pattern reveals that coregulation between large regulon-size TFs is common under a network neutral model, leading to the assembly of a great number of FFLs and bifans. In addition, neutral exclusive regulation also leads to a collection of single input modules -the fourth basic motif. On the whole, and even under the conservative neutralist scenario considered, a substantial group of regulatory structures revealed adaptive. These structures visibly function as fully-fledged working units.

Camas, Francisco M.; Poyatos, Juan F.

2008-01-01

261

Whole genome shotgun sequencing of one Colombian clinical isolate of Mycobacterium tuberculosis reveals DosR regulon gene deletions.  

PubMed

Several genomes of different Mycobacterium tuberculosis isolates have been completely sequenced around the world. The genomic information obtained have shown higher diversity than originally thought and specific adaptations to different human populations. Within this work, we sequenced the genome of one Colombian M. tuberculosis virulent isolate. Genomic comparison against the reference genome of H37Rv and other strains showed multiple deletion and insertions that ranged between a few bases to thousands. Excluding PPE and PG-PGRS genes, 430 proteins present changes in at least 1 amino acid. Also, novel positions of the IS6110 mobile element were identified. This isolate is also characterized by a large genomic deletion of 3.6 kb, leading to the loss and modification of the dosR regulon genes, Rv1996 and Rv1997. To our knowledge, this is the first report of the genome sequence of a Latin American M. tuberculosis clinical isolate. PMID:22404577

Isaza, Juan Pablo; Duque, Camilo; Gomez, Verónica; Robledo, Jaime; Barrera, Luis F; Alzate, Juan F

2012-05-01

262

The Sulfur-Regulated Arylsulfatase Gene Cluster of Pseudomonas aeruginosa, a New Member of the cys Regulon  

PubMed Central

A gene cluster upstream of the arylsulfatase gene (atsA) in Pseudomonas aeruginosa was characterized and found to encode a putative ABC-type transporter, AtsRBC. Mutants with insertions in the atsR or atsB gene were unable to grow with hexyl-, octyl-, or nitrocatecholsulfate, although they grew normally with other sulfur sources, such as sulfate, methionine, and aliphatic sulfonates. AtsRBC therefore constitutes a general sulfate ester transport system, and desulfurization of aromatic and medium-chain-length aliphatic sulfate esters occurs in the cytoplasm. Expression of the atsR and atsBCA genes was repressed during growth with sulfate, cysteine, or thiocyanate. No expression of these genes was observed in the cysB mutant PAO-CB, and the ats genes therefore constitute an extension of the cys regulon in this species.

Hummerjohann, Jorg; Laudenbach, Sascha; Retey, Julia; Leisinger, Thomas; Kertesz, Michael A.

2000-01-01

263

Mitochondrial transcription  

PubMed Central

The structure of the mitochondrial transcription termination factor (MTERF1) provides novel insight into the mechanism of binding, recognition of the termination sequence and conformational changes involved in mediating termination. Besides its functional implications, this structure provides a framework to understand the consequences of numerous diseases associated with mitochondrial DNA mutations.

Byrnes, James

2011-01-01

264

Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages  

PubMed Central

Little is known about the biochemical environment in phagosomes harboring an infectious agent. To assess the state of this organelle we captured the transcriptional responses of Mycobacterium tuberculosis (MTB) in macrophages from wild-type and nitric oxide (NO) synthase 2–deficient mice before and after immunologic activation. The intraphagosomal transcriptome was compared with the transcriptome of MTB in standard broth culture and during growth in diverse conditions designed to simulate features of the phagosomal environment. Genes expressed differentially as a consequence of intraphagosomal residence included an interferon ?– and NO-induced response that intensifies an iron-scavenging program, converts the microbe from aerobic to anaerobic respiration, and induces a dormancy regulon. Induction of genes involved in the activation and ?-oxidation of fatty acids indicated that fatty acids furnish carbon and energy. Induction of ?E-dependent, sodium dodecyl sulfate–regulated genes and genes involved in mycolic acid modification pointed to damage and repair of the cell envelope. Sentinel genes within the intraphagosomal transcriptome were induced similarly by MTB in the lungs of mice. The microbial transcriptome thus served as a bioprobe of the MTB phagosomal environment, showing it to be nitrosative, oxidative, functionally hypoxic, carbohydrate poor, and capable of perturbing the pathogen's cell envelope.

Schnappinger, Dirk; Ehrt, Sabine; Voskuil, Martin I.; Liu, Yang; Mangan, Joseph A.; Monahan, Irene M.; Dolganov, Gregory; Efron, Brad; Butcher, Philip D.; Nathan, Carl; Schoolnik, Gary K.

2003-01-01

265

Effects of triclocarban on the transcription of estrogen, androgen and aryl hydrocarbon receptor responsive genes in human breast cancer cells.  

PubMed

Triclocarban (TCC) is an antimicrobial agent that is used in detergents, soaps and other personal hygiene products. Similarly to triclosan the widespread use of TCC has raised concerns about its endocrine potential. In luciferase-based reporter assays TCC has been shown to enhance estrogenic and androgenic activities following cellular coexposure with estrogen or dihydrotestosterone, respectively. The present study demonstrates that although coexposure with TCC enhances the estrogenic and androgenic readout of luciferase-based reporter cell lines such as HeLa9908 and MDA-kb2, it fails to act as a xenoandrogen on transcriptional level, nor does it induce cell proliferation in the estrogen sensitive E-screen. In addition TCC did not alter the expression of estrogen responsive genes in human mammary carcinoma MCF-7 cells exposed to 17?-estradiol, bisphenol A, butylparaben or genistein. However, TCC was shown to interfere with the regulon of the aryl hydrocarbon receptor (AhR) as TCC showed a costimulatory effect on transcription of CYP1A1 and CYP1B1, effectively lowering the transcriptional threshold for both genes in the presence of estrogens. It thus seems, that while the induction of the respective luciferase reporter assays by TCC is an unspecific false positive signal caused by luciferase stabilisation, TCC has the potential to interfere with the regulatory crosstalk of the estrogen receptor (ER) and the AhR regulon. PMID:23524099

Tarnow, Patrick; Tralau, Tewes; Hunecke, Danele; Luch, Andreas

2013-08-01

266

The Evolutionary Rewiring of the Ribosomal Protein Transcription Pathway Modifies the Interaction of Transcription Factor Heteromer Ifh1-Fhl1 (Interacts with Forkhead 1-Forkhead-like 1) with the DNA-binding Specificity Element*  

PubMed Central

The genes encoding the ribosomal proteins of fungi form a regulon whose expression is enhanced under good growth conditions and down-regulated under starvation conditions. The fungal pathogen Candida albicans contains an evolutionarily ancient control circuit for this regulon where a heteromer made up of the transcription regulators Ifh1 (interacts with Forkhead 1) and Fhl1 (Forkhead-like 1) is targeted to the ribosomal protein genes by the DNA binding factor Tbf1. In the more recently evolved circuit in the model yeast Saccharomyces cerevisiae (Sc), the generalist repressor-activator protein Rap1 now directs the Ifh1-Fhl1 module to the ribosomal protein genes. Even though overall sequence similarity is low for the respective Fhl1 and Ifh1 subunits, in both species, the Ifh1 protein links to the Forkhead-associated domain of Fhl1 through its FHB domain. Intriguingly, correlated with the transition to the Rap1-regulated circuit, the Sc-Ifh1 contains a Rap1 binding domain that is not present in the C. albicans protein. Because no extensive common sequences are found in Tbf1 and Rap1, it appears that these targeting proteins must connect to the Ifh1-Fhl1 module in distinct ways. Two-hybrid and co-immunoprecipitation analysis has been used to show that in C. albicans Tbf1 is linked to the heterodimer through direct association with Fhl1. By contrast, in S. cerevisiae, the linkage of the heteromer to Rap1 occurs through Ifh1. Thus, in the ascomycetes, the Ifh1-Fhl1 heterodimer has reconfigured its protein associations to remain connected to the ribosomal protein regulon despite rewiring of the targeting transcription factor from Tbf1 to Rap1.

Mallick, Jaideep; Whiteway, Malcolm

2013-01-01

267

Characterization of the Escherichia coli O157:H7 Sakai GadE Regulon  

Microsoft Academic Search

Integrating laterally acquired virulence genes into the backbone regulatory network is important for the pathogenesis of Escherichia coli O157:H7, which has captured many virulence genes through horizontal transfer during evolution. GadE is an essential transcriptional activator of the glutamate decarboxylase (GAD) system, the most efficient acid resistance (AR) mechanism in E. coli. The full contribution of GadE to the AR

Sivapriya Kailasan Vanaja; Teresa M. Bergholz; Thomas S. Whittam

2009-01-01

268

Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus  

Microsoft Academic Search

BACKGROUND: The catabolite control protein A (CcpA) is a member of the LacI\\/GalR family of transcriptional regulators controlling carbon-metabolism pathways in low-GC Gram-positive bacteria. It functions as a catabolite repressor or activator, allowing the bacteria to utilize the preferred carbon source over secondary carbon sources. This study is the first CcpA-dependent transcriptome and proteome analysis in Staphylococcus aureus, focussing on

Kati Seidl; Susanne Müller; Patrice François; Carsten Kriebitzsch; Jacques Schrenzel; Susanne Engelmann; Markus Bischoff; Brigitte Berger-Bächi

2009-01-01

269

Genome-wide analysis of the RpoN regulon in Geobacter sulfurreducens  

Microsoft Academic Search

BACKGROUND: The role of the RNA polymerase sigma factor RpoN in regulation of gene expression in Geobacter sulfurreducens was investigated to better understand transcriptional regulatory networks as part of an effort to develop regulatory modules for genome-scale in silico models, which can predict the physiological responses of Geobacter species during groundwater bioremediation or electricity production. RESULTS: An rpoN deletion mutant

Ching Leang; Julia Krushkal; Toshiyuki Ueki; Marko Puljic; Jun Sun; Katy Juárez; Cinthia Núńez; Gemma Reguera; Raymond DiDonato; Bradley Postier; Ronald M Adkins; Derek R Lovley

2009-01-01

270

Deep Sequencing Analysis of Small Noncoding RNA and mRNA Targets of the Global Post-Transcriptional Regulator, Hfq  

PubMed Central

Recent advances in high-throughput pyrosequencing (HTPS) technology now allow a thorough analysis of RNA bound to cellular proteins, and, therefore, of post-transcriptional regulons. We used HTPS to discover the Salmonella RNAs that are targeted by the common bacterial Sm-like protein, Hfq. Initial transcriptomic analysis revealed that Hfq controls the expression of almost a fifth of all Salmonella genes, including several horizontally acquired pathogenicity islands (SPI-1, -2, -4, -5), two sigma factor regulons, and the flagellar gene cascade. Subsequent HTPS analysis of 350,000 cDNAs, derived from RNA co-immunoprecipitation (coIP) with epitope-tagged Hfq or control coIP, identified 727 mRNAs that are Hfq-bound in vivo. The cDNA analysis discovered new, small noncoding RNAs (sRNAs) and more than doubled the number of sRNAs known to be expressed in Salmonella to 64; about half of these are associated with Hfq. Our analysis explained aspects of the pleiotropic effects of Hfq loss-of-function. Specifically, we found that the mRNAs of hilD (master regulator of the SPI-1 invasion genes) and flhDC (flagellar master regulator) were bound by Hfq. We predicted that defective SPI-1 secretion and flagellar phenotypes of the hfq mutant would be rescued by overexpression of HilD and FlhDC, and we proved this to be correct. The combination of epitope-tagging and HTPS of immunoprecipitated RNA detected the expression of many intergenic chromosomal regions of Salmonella. Our approach overcomes the limited availability of high-density microarrays that have impeded expression-based sRNA discovery in microorganisms. We present a generic strategy that is ideal for the systems-level analysis of the post-transcriptional regulons of RNA-binding proteins and for sRNA discovery in a wide range of bacteria.

Sittka, Alexandra; Lucchini, Sacha; Papenfort, Kai; Sharma, Cynthia M.; Rolle, Katarzyna; Binnewies, Tim T.; Hinton, Jay C. D.; Vogel, Jorg

2008-01-01

271

Convergence of the Transcriptional Responses to Heat Shock and Singlet Oxygen Stresses  

PubMed Central

Cells often mount transcriptional responses and activate specific sets of genes in response to stress-inducing signals such as heat or reactive oxygen species. Transcription factors in the RpoH family of bacterial alternative ? factors usually control gene expression during a heat shock response. Interestingly, several ?-proteobacteria possess two or more paralogs of RpoH, suggesting some functional distinction. We investigated the target promoters of Rhodobacter sphaeroides RpoHI and RpoHII using genome-scale data derived from gene expression profiling and the direct interactions of each protein with DNA in vivo. We found that the RpoHI and RpoHII regulons have both distinct and overlapping gene sets. We predicted DNA sequence elements that dictate promoter recognition specificity by each RpoH paralog. We found that several bases in the highly conserved TTG in the ?35 element are important for activity with both RpoH homologs; that the T-9 position, which is over-represented in the RpoHI promoter sequence logo, is critical for RpoHI–dependent transcription; and that several bases in the predicted ?10 element were important for activity with either RpoHII or both RpoH homologs. Genes that are transcribed by both RpoHI and RpoHII are predicted to encode for functions involved in general cell maintenance. The functions specific to the RpoHI regulon are associated with a classic heat shock response, while those specific to RpoHII are associated with the response to the reactive oxygen species, singlet oxygen. We propose that a gene duplication event followed by changes in promoter recognition by RpoHI and RpoHII allowed convergence of the transcriptional responses to heat and singlet oxygen stress in R. sphaeroides and possibly other bacteria.

Dufour, Yann S.; Imam, Saheed; Koo, Byoung-Mo; Green, Heather A.; Donohue, Timothy J.

2012-01-01

272

Mutational Analysis of the phoD Promoter in Bacillus subtilis: Implications for PhoP Binding and Promoter Activation of Pho Regulon Promoters  

Microsoft Academic Search

The PhoP-PhoR two-component regulatory system controls the phosphate deficiency response in B. subtilis. A number of Pho regulon genes which require PhoP;P for activation or repression have been identified. The studies reported here were initiated to understand the PhoP-DNA interaction necessary for Pho promoter regulation. The regulatory region of phoD was characterized in detail using oligo-directed mutagenesis, DNase I footprinting,

STEVE EDER; WEI LIU; F. MARION HULETT

1999-01-01

273

Constitutive expression in gal7 mutants of Kluyveromyces lactis is due to internal production of galactose as an inducer of the Gal/Lac regulon.  

PubMed

The induction process of the galactose regulon has been intensively studied, but until now the nature of the inducer has remained unknown. We have analyzed a delta gal7 mutant of the yeast Kluyveromyces lactis, which lacks the galactotransferase activity and is able to express the genes of the Gal/Lac regulon also in the absence of galactose. We found that this expression is semiconstitutive and undergoes a strong induction during the stationary phase. The gal1-209 mutant, which has a reduced kinase activity but retains its positive regulatory function, also shows a constitutive expression of beta-galactosidase, suggesting that galactose is the inducer. A gal10 deletion in delta gal7 or gal1-209 mutants reduces the expression to under wild-type levels. The presence of the inducer could be demonstrated in both delta gal7 crude extracts and culture medium by means of a bioassay using the induction in gal1-209 cells. A mutation in the transporter gene LAC12 decreases the level of induction in gal7 cells, indicating that galactose is partly released into the medium and then retransported into the cells. Nuclear magnetic resonance analysis of crude extracts from delta gal7 cells revealed the presence of 50 microM galactose. We conclude that galactose is the inducer of the Gal/Lac regulon and is produced via UDP-galactose through a yet-unknown pathway. PMID:9032299

Cardinali, G; Vollenbroich, V; Jeon, M S; de Graaf, A A; Hollenberg, C P

1997-03-01

274

Activation of silent gal genes in the lac-gal regulon of Streptococcus thermophilus.  

PubMed

Streptococcus thermophilus strain CNRZ 302 is unable to ferment galactose, neither that generated intracellularly by lactose hydrolysis nor the free sugar. Nevertheless, sequence analysis and complementation studies with Escherichia coli demonstrated that strain CNRZ 302 contained structurally intact genes for the Leloir pathway enzymes. These were organized into an operon in the order galKTE, which was preceded by a divergently transcribed regulator gene, galR, and followed by a galM gene and the lactose operon lacSZ. Results of Northern blot analysis showed that the structural gal genes were transcribed weakly, and only in medium containing lactose, by strain CNRZ 302. However, in a spontaneous galactose-fermenting mutant, designated NZ302G, the galKTE genes were well expressed in cells grown on lactose or galactose. In both CNRZ 302 and the Gal(+) mutant NZ302G, the transcription of the galR gene was induced by growth on lactose. Disruption of galR indicated that it functioned as a transcriptional activator of both the gal and lac operons while negatively regulating its own expression. Sequence analysis of the gal promoter regions of NZ302G and nine other independently isolated Gal(+) mutants of CNRZ 302 revealed mutations at three positions in the galK promoter region, which included substitutions at positions -9 and -15 as well as a single-base-pair insertion at position -37 with respect to the main transcription initiation point. Galactokinase activity measurements and analysis of gusA reporter gene fusions in strains containing the mutated promoters suggested that they were gal promoter-up mutations. We propose that poor expression of the gal genes in the galactose-negative S. thermophilus CNRZ 302 is caused by naturally occurring mutations in the galK promoter. PMID:11157930

Vaughan, E E; van den Bogaard, P T; Catzeddu, P; Kuipers, O P; de Vos, W M

2001-02-01

275

Defining a rob Regulon in Escherichia coli by Using Transposon Mutagenesis  

PubMed Central

The Rob protein of Escherichia coli is a member of the AraC-XylS family of prokaryotic transcriptional regulators and is expressed constitutively. Deletion of the rob gene increases susceptibility to organic solvents, while overexpression of Rob increases tolerance to organic solvents and resistance to a variety of antibiotics and to the superoxide-generating compound phenazine methosulfate. To determine whether constitutive levels of Rob regulate basal gene expression, we performed a MudJ transposon screen in a rob deletion mutant containing a plasmid that allows for controlled rob gene expression. We identified eight genes and confirmed that seven are transcriptionally activated by normal expression of Rob from the chromosomal rob gene (inaA, marR, aslB, ybaO, mdlA, yfhD, and ybiS). One gene, galT, was repressed by Rob. We also demonstrated by Northern analysis that basal expression of micF is significantly higher in wild-type E. coli than in a rob deletion mutant. Rob binding to the promoter regions of most of these genes was substantiated in electrophoretic mobility shift assays. However, Mu insertions in individual Rob-regulated genes did not affect solvent sensitivity. This phenotype may depend on changes in the expression of several of these Rob-regulated genes or on other genes that were not identified. Rob clearly affects the basal expression of genes with a broad range of functions, including antibiotic resistance, acid adaptation, carbon metabolism, cell wall synthesis, central intermediary metabolism, and transport. The magnitudes of Rob's effects are modest, however, and the protein may thus play a role as a general transcription cofactor.

Bennik, Marjon H. J.; Pomposiello, Pablo J.; Thorne, Derek F.; Demple, Bruce

2000-01-01

276

Heat Shock Response in Yeast Involves Changes in Both Transcription Rates and mRNA Stabilities  

PubMed Central

We have analyzed the heat stress response in the yeast Saccharomyces cerevisiae by determining mRNA levels and transcription rates for the whole transcriptome after a shift from 25°C to 37°C. Using an established mathematical algorithm, theoretical mRNA decay rates have also been calculated from the experimental data. We have verified the mathematical predictions for selected genes by determining their mRNA decay rates at different times during heat stress response using the regulatable tetO promoter. This study indicates that the yeast response to heat shock is not only due to changes in transcription rates, but also to changes in the mRNA stabilities. mRNA stability is affected in 62% of the yeast genes and it is particularly important in shaping the mRNA profile of the genes belonging to the environmental stress response. In most cases, changes in transcription rates and mRNA stabilities are homodirectional for both parameters, although some interesting cases of antagonist behavior are found. The statistical analysis of gene targets and sequence motifs within the clusters of genes with similar behaviors shows that both transcriptional and post-transcriptional regulons apparently contribute to the general heat stress response by means of transcriptional factors and RNA binding proteins.

Castells-Roca, Laia; Garcia-Martinez, Jose; Moreno, Joaquin; Herrero, Enrique; Belli, Gemma; Perez-Ortin, Jose E.

2011-01-01

277

Transcriptional analysis of the bglP gene from Streptococcus mutans  

PubMed Central

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Cote, Christopher K; Honeyman, Allen L

2006-01-01

278

Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress  

PubMed Central

Background Organisms of the genus Clostridium are Gram-positive endospore formers of great importance to the carbon cycle, human normo- and pathophysiology, but also in biofuel and biorefinery applications. Exposure of Clostridium organisms to chemical and in particular toxic metabolite stress is ubiquitous in both natural (such as in the human microbiome) and engineered environments, engaging both the general stress response as well as specialized programs. Yet, despite its fundamental and applied significance, it remains largely unexplored at the systems level. Results We generated a total of 96 individual sets of microarray data examining the transcriptional changes in C. acetobutylicum, a model Clostridium organism, in response to three levels of chemical stress from the native metabolites, butanol and butyrate. We identified 164 significantly differentially expressed transcriptional regulators and detailed the cellular programs associated with general and stressor-specific responses, many previously unexplored. Pattern-based, comparative genomic analyses enabled us, for the first time, to construct a detailed picture of the genetic circuitry underlying the stress response. Notably, a list of the regulons and DNA binding motifs of the stress-related transcription factors were identified: two heat-shock response regulators, HrcA and CtsR; the SOS response regulator LexA; the redox sensor Rex; and the peroxide sensor PerR. Moreover, several transcriptional regulators controlling stress-responsive amino acid and purine metabolism and their regulons were also identified, including ArgR (arginine biosynthesis and catabolism regulator), HisR (histidine biosynthesis regulator), CymR (cysteine metabolism repressor) and PurR (purine metabolism repressor). Conclusions Using an exceptionally large set of temporal transcriptional data and regulon analyses, we successfully built a STRING-based stress response network model integrating important players for the general and specialized metabolite stress response in C. acetobutylicum. Since the majority of the transcription factors and their target genes are highly conserved in other organisms of the Clostridium genus, this network would be largely applicable to other Clostridium organisms. The network informs the molecular basis of Clostridium responses to toxic metabolites in natural ecosystems and the microbiome, and will facilitate the construction of genome-scale models with added regulatory-network dimensions to guide the development of tolerant strains.

2013-01-01

279

Microarray analysis identifies Salmonella genes belonging to the low-shear modeled microgravity regulon  

NASA Technical Reports Server (NTRS)

The low-shear environment of optimized rotation suspension culture allows both eukaryotic and prokaryotic cells to assume physiologically relevant phenotypes that have led to significant advances in fundamental investigations of medical and biological importance. This culture environment has also been used to model microgravity for ground-based studies regarding the impact of space flight on eukaryotic and prokaryotic physiology. We have previously demonstrated that low-shear modeled microgravity (LSMMG) under optimized rotation suspension culture is a novel environmental signal that regulates the virulence, stress resistance, and protein expression levels of Salmonella enterica serovar Typhimurium. However, the mechanisms used by the cells of any species, including Salmonella, to sense and respond to LSMMG and identities of the genes involved are unknown. In this study, we used DNA microarrays to elucidate the global transcriptional response of Salmonella to LSMMG. When compared with identical growth conditions under normal gravity (1 x g), LSMMG differentially regulated the expression of 163 genes distributed throughout the chromosome, representing functionally diverse groups including transcriptional regulators, virulence factors, lipopolysaccharide biosynthetic enzymes, iron-utilization enzymes, and proteins of unknown function. Many of the LSMMG-regulated genes were organized in clusters or operons. The microarray results were further validated by RT-PCR and phenotypic analyses, and they indicate that the ferric uptake regulator is involved in the LSMMG response. The results provide important insight about the Salmonella LSMMG response and could provide clues for the functioning of known Salmonella virulence systems or the identification of uncharacterized bacterial virulence strategies.

Wilson, James W.; Ramamurthy, Rajee; Porwollik, Steffen; McClelland, Michael; Hammond, Timothy; Allen, Pat; Ott, C. Mark; Pierson, Duane L.; Nickerson, Cheryl A.

2002-01-01

280

Characterization of the AggR Regulon in Enteroaggregative Escherichia coli  

PubMed Central

AggR is a transcriptional regulator of enteroaggregative Escherichia coli (EAEC) and has been proposed as the defining factor for typical EAEC strains. Expression of multiple putative virulence factors, including the aggregative adherence fimbriae (AAF), dispersin, the dispersin translocator Aat, and the Aai type VI secretion system, have been found to be regulated by AggR. Here, we confirm the existence of at least 44 AggR-regulated genes using DNA microarray and real-time quantitative reverse transcription-PCR (qRT-PCR); these genes include chromosomal and plasmid-borne loci and 19 previously unsuspected genes. Two previously uncharacterized virulence plasmid-encoded open reading frames (ORFs) (designated ORF3 and ORF4) exhibit significant identity with isoprenoid biosynthesis genes of Bacteria and Archaea. The predicted ORF4 product is closely related to isopentenyl isomerase (IDI) enzymes, whereas the predicted product of the adjacent ORF3 exhibits an aspartate-rich region that is common among trans-isoprenyl phosphate synthases. We show that mutations in these ORFs confer changes in bacterial surface properties. AggR coordinately controls expression of a large number of EAEC genes.

Morin, Nicholas; Santiago, Araceli E.; Ernst, Robert K.; Guillot, Stacey J.

2013-01-01

281

Cyclic di-GMP inhibits Vibrio cholerae motility by repressing induction of transcription and inducing extracellular polysaccharide production.  

PubMed

Cyclic di-GMP (c-di-GMP) controls the transition between sessility and motility in many bacterial species. This regulation is achieved by a variety of mechanisms including alteration of transcription initiation and inhibition of flagellar function. How c-di-GMP inhibits the motility of Vibrio cholerae has not been determined.?FlrA, a homologue of the c-di-GMP binding Pseudomonas aeruginosa motility regulator FleQ, is the master regulator of the V.?cholerae flagellar biosynthesis regulon. Here we show that binding of c-di-GMP to FlrA abrogates binding of FlrA to the promoter of the flrBC operon, deactivating expression of the flagellar biosynthesis regulon. FlrA does not regulate expression of extracellular Vibrio polysaccharide (VPS) synthesis genes. Mutation of the FlrA amino acids R135 and R176 to histidine abrogates binding of c-di-GMP to FlrA, rendering FlrA active in the presence of high levels of c-di-GMP. Surprisingly, c-di-GMP still inhibited the motility of V.?cholerae only expressing the c-di-GMP blind FlrA(R176H) mutant. We determined that this flagellar transcription-independent inhibition is due to activation of VPS production by c-di-GMP. Therefore, c-di-GMP prevents motility of V.?cholerae by two distinct but functionally redundant mechanisms. PMID:24134710

Srivastava, Disha; Hsieh, Meng-Lun; Khataokar, Atul; Neiditch, Matthew B; Waters, Christopher M

2013-12-01

282

The transcriptional program underlying the physiology of clostridial sporulation  

PubMed Central

Background Clostridia are ancient soil organisms of major importance to human and animal health and physiology, cellulose degradation, and the production of biofuels from renewable resources. Elucidation of their sporulation program is critical for understanding important clostridial programs pertaining to their physiology and their industrial or environmental applications. Results Using a sensitive DNA-microarray platform and 25 sampling timepoints, we reveal the genome-scale transcriptional basis of the Clostridium acetobutylicum sporulation program carried deep into stationary phase. A significant fraction of the genes displayed temporal expression in six distinct clusters of expression, which were analyzed with assistance from ontological classifications in order to illuminate all known physiological observations and differentiation stages of this industrial organism. The dynamic orchestration of all known sporulation sigma factors was investigated, whereby in addition to their transcriptional profiles, both in terms of intensity and differential expression, their activity was assessed by the average transcriptional patterns of putative canonical genes of their regulon. All sigma factors of unknown function were investigated by combining transcriptional data with predicted promoter binding motifs and antisense-RNA downregulation to provide a preliminary assessment of their roles in sporulation. Downregulation of two of these sigma factors, CAC1766 and CAP0167, affected the developmental process of sporulation and are apparently novel sporulation-related sigma factors. Conclusion This is the first detailed roadmap of clostridial sporulation, the most detailed transcriptional study ever reported for a strict anaerobe and endospore former, and the first reported holistic effort to illuminate cellular physiology and differentiation of a lesser known organism.

Jones, Shawn W; Paredes, Carlos J; Tracy, Bryan; Cheng, Nathan; Sillers, Ryan; Senger, Ryan S; Papoutsakis, Eleftherios T

2008-01-01

283

Analysis of the Corynebacterium diphtheriae DtxR Regulon: Identification of a Putative Siderophore Synthesis and Transport System That Is Similar to the Yersinia High-Pathogenicity Island-Encoded Yersiniabactin Synthesis and Uptake System  

PubMed Central

The diphtheria toxin repressor, DtxR, is a global iron-dependent regulatory protein in Corynebacterium diphtheriae that controls gene expression by binding to 19-bp operator sequences. To further define the DtxR regulon in C. diphtheriae, a DtxR repressor titration assay (DRTA) was developed and used to identify 10 previously unknown DtxR binding sites. Open reading frames downstream from seven of the newly identified DtxR binding sites are predicted to encode proteins associated with iron or heme transport. Electrophoretic mobility shift assays indicated that DtxR was able to bind to DNA fragments carrying the 19-bp operator regions, and transcriptional analysis of putative promoter elements adjacent to the binding site sequences revealed that most of these regions displayed iron- and DtxR-regulated activity. A putative siderophore biosynthesis and transport operon located downstream from one of the DtxR binding sites, designated sid, is similar to the yersiniabactin synthesis and uptake genes encoded on the Yersinia pestis high pathogenicity island. The siderophore biosynthetic genes in the sid operon contained a large deletion in the C. diphtheriae C7 strain, but the sid genes were unaffected in four clinical isolates that are representative of the dominant strains from the recent diphtheria epidemic in the former Soviet Union. Mutations in the siderophore biosynthetic genes in a clinical strain had no effect on siderophore synthesis or growth in low-iron conditions; however, a mutation in one of the putative transport proteins, cdtP, resulted in reduced growth in iron-depleted media, which suggests that this system may have a role in iron uptake. The findings from this study indicate that C. diphtheriae contains at least 18 DtxR binding sites and that DtxR may affect the expression of as many as 40 genes.

Kunkle, Carey A.; Schmitt, Michael P.

2003-01-01

284

Transcriptome Analysis of the ArgR Regulon in Pseudomonas aeruginosa  

PubMed Central

Arginine metabolism in pseudomonads with multiple catabolic pathways for its utilization as carbon and nitrogen sources is of particular interest as the model system to study control of metabolic integration. We performed transcriptome analyses to identify genes controlled by the arginine regulatory protein ArgR and to better understand arginine metabolic pathways of P. aeruginosa. We compared gene expression in wild-type strain PAO1 with that in argR mutant strain PAO501 grown in glutamate minimal medium in the presence and absence of arginine. Ten putative transcriptional units of 28 genes were inducible by ArgR and arginine, including all known ArgR-regulated operons under aerobic conditions. The newly identified genes include the putative adcAB operon, which encodes a catabolic arginine decarboxylase and an antiporter protein, and PA0328, which encodes a hypothetical fusion protein of a peptidase and a type IV autotransporter. Also identified as members of the arginine network are the following solute transport systems: PA1971 (braZ) for branched-chain amino acids permease; PA2042 for a putative sodium:serine symporter; PA3934, which belongs to the family of small oligopeptide transporters; and PA5152-5155, which encodes components of an ABC transporter for a putative opine uptake system. The effect of arginine on the expression of these genes was confirmed by lacZ fusion studies and by DNA binding studies with purified ArgR. Only five transcriptional units of nine genes were qualified as repressible by ArgR and arginine, with three operons (argF, carAB, and argG) in arginine biosynthesis and two operons (gltBD and gdhA) in glutamate biosynthesis. These results indicate that ArgR is important in control of arginine and glutamate metabolism and that arginine and ArgR may have a redundant effect in inducing the uptake systems of certain compounds.

Lu, Chung-Dar; Yang, Zhe; Li, Wei

2004-01-01

285

Discovery of novel transcription factor binding sites by statistical overrepresentation  

PubMed Central

Understanding the complex and varied mechanisms that regulate gene expression is an important and challenging problem. A fundamental sub-problem is to identify DNA binding sites for unknown regulatory factors, given a collection of genes believed to be co-regulated. We discuss a computational method that identifies good candidates for such binding sites. Unlike local search techniques such as expectation maximization and Gibbs samplers that may not reach a global optimum, the method discussed enumerates all motifs in the search space, and is guaranteed to produce the motifs with greatest z-scores. We discuss the results of validation experiments in which this algorithm was used to identify candidate binding sites in several well studied regulons of Saccharomyces cerevisiae, where the most prominent transcription factor binding sites are largely known. We then discuss the results on gene families in the functional and mutant phenotype catalogs of S.cerevisiae, where the algorithm suggests many promising novel transcription factor binding sites. The program is available at http://bio.cs.washington.edu/software.html.

Sinha, Saurabh; Tompa, Martin

2002-01-01

286

Inference of Self-Regulated Transcriptional Networks by Comparative Genomics  

PubMed Central

The assumption of basic properties, like self-regulation, in simple transcriptional regulatory networks can be exploited to infer regulatory motifs from the growing amounts of genomic and meta-genomic data. These motifs can in principle be used to elucidate the nature and scope of transcriptional networks through comparative genomics. Here we assess the feasibility of this approach using the SOS regulatory network of Gram-positive bacteria as a test case. Using experimentally validated data, we show that the known regulatory motif can be inferred through the assumption of self-regulation. Furthermore, the inferred motif provides a more robust search pattern for comparative genomics than the experimental motifs defined in reference organisms. We take advantage of this robustness to generate a functional map of the SOS response in Gram-positive bacteria. Our results reveal definite differences in the composition of the LexA regulon between Firmicutes and Actinobacteria, and confirm that regulation of cell-division inhibition is a widespread characteristic of this network among Gram-positive bacteria.

Cornish, Joseph P.; Matthews, Fialelei; Thomas, Julien R.; Erill, Ivan

2012-01-01

287

Characterization of fhlA mutations resulting in ligand-independent transcriptional activation and ATP hydrolysis.  

PubMed Central

The FhlA protein belongs to the NtrC family of transcriptional regulators. It induces transcription from the -12/-24 promoters of the genes of the formate regulon by sigma54 RNA polymerase. FhlA is activated by binding of the ligand formate and does not require phosphorylation. A mutational analysis of the fhLA gene portion coding for the A and C domains was conducted with the aim of gaining information on the interaction between formate binding and ATP hydrolysis plus transcription activation. Four mutations were identified, all located in the A domain; one of them rendered transcription completely independent from the presence of formate, and the others conferred a semiconstitutive phenotype. The FhlA protein of one of the semiconstitutive variants was purified. Catalytic efficiency of ATP hydrolysis of the mutant FhlA was increased in the absence of formate in the same manner as formate influences the activity of wild-type FhlA. Moreover, in vitro transcription occurred at much lower threshold concentrations of the mutant protein and of nucleoside triphosphates than with the wild-type FhlA.

Korsa, I; Bock, A

1997-01-01

288

The Unfolded Protein Response in the Protozoan Parasite Toxoplasma gondii Features Translational and Transcriptional Control  

PubMed Central

The unfolded protein response (UPR) is an important regulatory network that responds to perturbations in protein homeostasis in the endoplasmic reticulum (ER). In mammalian cells, the UPR features translational and transcriptional mechanisms of gene expression aimed at restoring proteostatic control. A central feature of the UPR is phosphorylation of the ? subunit of eukaryotic initiation factor-2 (eIF2) by PERK (EIF2AK3/PEK), which reduces the influx of nascent proteins into the ER by lowering global protein synthesis, coincident with preferential translation of key transcription activators of genes that function to expand the processing capacity of this secretory organelle. Upon ER stress, the apicomplexan parasite Toxoplasma gondii is known to induce phosphorylation of Toxoplasma eIF2? and lower translation initiation. To characterize the nature of the ensuing UPR in this parasite, we carried out microarray analyses to measure the changes in the transcriptome and in translational control during ER stress. We determined that a collection of transcripts linked with the secretory process are induced in response to ER stress, supporting the idea that a transcriptional induction phase of the UPR occurs in Toxoplasma. Furthermore, we determined that about 500 gene transcripts showed enhanced association with translating ribosomes during ER stress. Many of these target genes are suggested to be involved in gene expression, including JmjC5, which continues to be actively translated during ER stress. This study indicates that Toxoplasma triggers a UPR during ER stress that features both translational and transcriptional regulatory mechanisms, which is likely to be important for parasite invasion and development.

Joyce, Bradley R.; Tampaki, Zoi; Kim, Kami

2013-01-01

289

Effect of FliK mutation on the transcriptional activity of the ?54 sigma factor RpoN in Helicobacter pylori  

PubMed Central

Helicobacter pylori is a motile Gram-negative bacterium that colonizes and persists in the human gastric mucosa. The flagellum gene regulatory circuitry of H. pylori is unique in many aspects compared with the Salmonella/Escherichia coli paradigms, and some regulatory checkpoints remain unclear. FliK controls the hook length during flagellar assembly. Microarray analysis of a fliK-null mutant revealed increased transcription of genes under the control of the ?54 sigma factor RpoN. This sigma factor has been shown to be responsible for transcription of the class II flagellar genes, including flgE and flaB. No genes higher in the flagellar hierarchy had altered expression, suggesting specific and localized FliK-dependent feedback on the RpoN regulon. FliK thus appears to be involved in three processes: hook-length control, export substrate specificity and control of RpoN transcriptional activity.

Douillard, Francois P.; Ryan, Kieran A.; Hinds, Jason; O'Toole, Paul W.

2011-01-01

290

Quantitative proteomic analysis of the Hfq-regulon in Sinorhizobium meliloti 2011.  

PubMed

Riboregulation stands for RNA-based control of gene expression. In bacteria, small non-coding RNAs (sRNAs) are a major class of riboregulatory elements, most of which act at the post-transcriptional level by base-pairing target mRNA genes. The RNA chaperone Hfq facilitates antisense interactions between target mRNAs and regulatory sRNAs, thus influencing mRNA stability and/or translation rate. In the ?-proteobacterium Sinorhizobium meliloti strain 2011, the identification and detection of multiple sRNAs genes and the broadly pleitropic phenotype associated to the absence of a functional Hfq protein both support the existence of riboregulatory circuits controlling gene expression to ensure the fitness of this bacterium in both free living and symbiotic conditions. In order to identify target mRNAs subject to Hfq-dependent riboregulation, we have compared the proteome of an hfq mutant and the wild type S. meliloti by quantitative proteomics following protein labelling with (15)N. Among 2139 univocally identified proteins, a total of 195 proteins showed a differential abundance between the Hfq mutant and the wild type strain; 65 proteins accumulated ?2-fold whereas 130 were downregulated (?0.5-fold) in the absence of Hfq. This profound proteomic impact implies a major role for Hfq on regulation of diverse physiological processes in S. meliloti, from transport of small molecules to homeostasis of iron and nitrogen. Changes in the cellular levels of proteins involved in transport of nucleotides, peptides and amino acids, and in iron homeostasis, were confirmed with phenotypic assays. These results represent the first quantitative proteomic analysis in S. meliloti. The comparative analysis of the hfq mutant proteome allowed identification of novel strongly Hfq-regulated genes in S. meliloti. PMID:23119037

Sobrero, Patricio; Schlüter, Jan-Philip; Lanner, Ulrike; Schlosser, Andreas; Becker, Anke; Valverde, Claudio

2012-01-01

291

Quantitative Proteomic Analysis of the Hfq-Regulon in Sinorhizobium meliloti 2011  

PubMed Central

Riboregulation stands for RNA-based control of gene expression. In bacteria, small non-coding RNAs (sRNAs) are a major class of riboregulatory elements, most of which act at the post-transcriptional level by base-pairing target mRNA genes. The RNA chaperone Hfq facilitates antisense interactions between target mRNAs and regulatory sRNAs, thus influencing mRNA stability and/or translation rate. In the ?-proteobacterium Sinorhizobium meliloti strain 2011, the identification and detection of multiple sRNAs genes and the broadly pleitropic phenotype associated to the absence of a functional Hfq protein both support the existence of riboregulatory circuits controlling gene expression to ensure the fitness of this bacterium in both free living and symbiotic conditions. In order to identify target mRNAs subject to Hfq-dependent riboregulation, we have compared the proteome of an hfq mutant and the wild type S. meliloti by quantitative proteomics following protein labelling with 15N. Among 2139 univocally identified proteins, a total of 195 proteins showed a differential abundance between the Hfq mutant and the wild type strain; 65 proteins accumulated ?2-fold whereas 130 were downregulated (?0.5-fold) in the absence of Hfq. This profound proteomic impact implies a major role for Hfq on regulation of diverse physiological processes in S. meliloti, from transport of small molecules to homeostasis of iron and nitrogen. Changes in the cellular levels of proteins involved in transport of nucleotides, peptides and amino acids, and in iron homeostasis, were confirmed with phenotypic assays. These results represent the first quantitative proteomic analysis in S. meliloti. The comparative analysis of the hfq mutant proteome allowed identification of novel strongly Hfq-regulated genes in S. meliloti.

Sobrero, Patricio; Schluter, Jan-Philip; Lanner, Ulrike; Schlosser, Andreas; Becker, Anke; Valverde, Claudio

2012-01-01

292

A regulator of the flagellar regulon of Escherichia coli, flhD, also affects cell division.  

PubMed Central

The role of an activator of flagellar transcription in Escherichia coli, flhD, was investigated in the regulation of cell division. When grown in tryptone broth, flhD mutant cells divided exponentially until they reached a cell density of 2.5 x 10(9) cells per ml. Wild-type cells and flhC mutant cells divided exponentially until they reached a cell density of 4 x 10(7) cells per ml. flhD mutant cells divided 5 times more than wild-type cells before they reduced their cell division rate and reached a cell density 37 times higher than that of wild-type or flhC mutant cultures. In stationary phase, the biomasses of all cultures were similar; however, flhD mutant cells were significantly smaller. Additional tryptone, Casamino Acids, and individual amino acids, added at the beginning of growth, allowed wild-type cells to grow to higher cell densities. Serine was determined to have the greatest effect. In contrast, the addition of Casamino Acids did not exhibit an effect upon flhD mutant cells. flhD mutant cells exhibited normal rates of uptake of serine and other amino acids. In both wild-type and flhD mutant cultures, the concentrations of serine in the media dropped from 140 to 20 microM within the first 2 h of growth. Serine concentrations and cell division rates were highly correlated. Wild-type cells reduced their cell division rate at a medium concentration of 50 microM serine, and the addition of serine at this time caused cells to resume a higher rate of division. We conclude that the reduction of the cell division rate in wild-type cells is caused by the depletion of serine from the medium and that flhD mutant cells seem to be unable to sense this depletion.

Pruss, B M; Matsumura, P

1996-01-01

293

Analysis of the Pseudomonas aeruginosa Regulon Controlled by the Sensor Kinase KinB and Sigma Factor RpoN  

PubMed Central

Alginate overproduction by Pseudomonas aeruginosa, also known as mucoidy, is associated with chronic endobronchial infections in cystic fibrosis. Alginate biosynthesis is initiated by the extracytoplasmic function sigma factor (?22; AlgU/AlgT). In the wild-type (wt) nonmucoid strains, such as PAO1, AlgU is sequestered to the cytoplasmic membrane by the anti-sigma factor MucA that inhibits alginate production. One mechanism underlying the conversion to mucoidy is mutation of mucA. However, the mucoid conversion can occur in wt mucA strains via the degradation of MucA by activated intramembrane proteases AlgW and/or MucP. Previously, we reported that the deletion of the sensor kinase KinB in PAO1 induces an AlgW-dependent proteolysis of MucA, resulting in alginate overproduction. This type of mucoid induction requires the alternate sigma factor RpoN (?54). To determine the RpoN-dependent KinB regulon, microarray and proteomic analyses were performed on a mucoid kinB mutant and an isogenic nonmucoid kinB rpoN double mutant. In the kinB mutant of PAO1, RpoN controlled the expression of approximately 20% of the genome. In addition to alginate biosynthetic and regulatory genes, KinB and RpoN also control a large number of genes including those involved in carbohydrate metabolism, quorum sensing, iron regulation, rhamnolipid production, and motility. In an acute pneumonia murine infection model, BALB/c mice exhibited increased survival when challenged with the kinB mutant relative to survival with PAO1 challenge. Together, these data strongly suggest that KinB regulates virulence factors important for the development of acute pneumonia and conversion to mucoidy.

Damron, F. Heath; Owings, Joshua P.; Okkotsu, Yuta; Varga, John J.; Schurr, Jill R.; Goldberg, Joanna B.; Schurr, Michael J.

2012-01-01

294

Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363?  

PubMed Central

Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363?ccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric ?35 sequence at an average position of ?56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative ?35 and ?10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical ?10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism.

Zomer, Aldert L.; Buist, Girbe; Larsen, Rasmus; Kok, Jan; Kuipers, Oscar P.

2007-01-01

295

Transcriptome Analysis of the Rhodobacter sphaeroides PpsR Regulon: PpsR as a Master Regulator of Photosystem Development†  

PubMed Central

PpsR from the anoxygenic phototrophic bacterium Rhodobacter sphaeroides has been known as an oxygen- and light-dependent repressor of bacteriochlorophyll and carotenoid biosynthesis genes and puc operons involved in photosystem development. However, the putative PpsR-binding sites, TGTN12ACA, are also located upstream of numerous nonphotosystem genes, thus raising the possibility that the role of PpsR is broader. To characterize the PpsR regulon, transcriptome profiling was performed on the wild-type strain grown at high and low oxygen tensions, on the strain overproducing PpsR, and on the ppsR mutant. Transcriptome analysis showed that PpsR primarily regulates photosystem genes; the consensus PpsR binding sequence is TGTcN10gACA (lowercase letters indicate lesser conservation); the presence of two binding sites is required for repression in vivo. These findings explain why numerous single TGTN12ACA sequences are nonfunctional. In addition to photosystem genes, the hemC and hemE genes involved in the early steps of tetrapyrrole biosynthesis were identified as new direct targets of PpsR repression. Unexpectedly, PpsR was found to indirectly repress the puf and puhA operons encoding photosystem core proteins. The upstream regions of these operons contain no PpsR binding sites. Involvement in regulation of these operons suggests that PpsR functions as a master regulator of photosystem development. Upregulation of the puf and puhA operons that resulted from ppsR inactivation was sufficient to restore the ability to grow phototrophically to the prrA mutant. PrrA, the global redox-dependent activator, was previously considered indispensable for phototrophic growth. It is revealed that the PrrBA and AppA-PpsR systems, believed to work independently, in fact interact and coordinately regulate photosystem development.

Moskvin, Oleg V.; Gomelsky, Larissa; Gomelsky, Mark

2005-01-01

296

The new pLAI (lux regulon based auto-inducible) expression system for recombinant protein production in Escherichia coli  

PubMed Central

Background After many years of intensive research, it is generally assumed that no universal expression system can exist for high-level production of a given recombinant protein. Among the different expression systems, the inducible systems are the most popular for their tight regulation. However, induction is in many cases less favorable due to the high cost and/or toxicity of inducers, incompatibilities with industrial scale-up or detrimental growth conditions. Expression systems using autoinduction (or self-induction) prove to be extremely versatile allowing growth and induction of recombinant proteins without the need to monitor cell density or add inducer. Unfortunately, almost all the actual auto inducible expression systems need endogenous or induced metabolic changes during the growth to trigger induction, both frequently linked to detrimental condition to cell growth. In this context, we use a simple modular approach for a cell density-based genetic regulation in order to assemble an autoinducible recombinant protein expression system in E. coli. Result The newly designed pLAI expression system places the expression of recombinant proteins in Escherichia coli under control of the regulatory genes of the lux regulon of Vibrio fischeri's Quorum Sensing (QS) system. The pLAI system allows a tight regulation of the recombinant gene allowing a negligible basal expression and expression only at high cell density. Sequence optimization of regulative genes of QS of V. fischeri for expression in E. coli upgraded the system to high level expression. Moreover, partition of regulative genes between the plasmid and the host genome and introduction of a molecular safety lock permitted tighter control of gene expression. Conclusion Coupling gene expression to cell density using cell-to-cell communication provides a promising approach for recombinant protein production. The system allows the control of expression of the target recombinant gene independently from external inducers or drastic changes in metabolic conditions and enabling tight regulation of expression.

2012-01-01

297

Analysis of growth-phase regulated genes in Streptococcus agalactiae by global transcript profiling  

PubMed Central

Background Bacteria employ multiple mechanisms to control gene expression and react to their constantly changing environment. Bacterial growth in rich laboratory medium is a dynamic process in which bacteria utilize nutrients from simple to complex and change physical properties of the medium, as pH, during the process. To determine which genes are differentially expressed throughout growth from mid log to stationary phase, we performed global transcript analysis. Results The S. agalactiae transcriptome is dynamic in response to growth conditions. Several genes and regulons involved in virulence factor production and utilization of alternate carbon sources were differentially expressed throughout growth. Conclusion These data provide new information about the magnitude of plasticity of the S. agalactiae transcriptome and its adaptive response to changing environmental conditions. The resulting information will greatly assist investigators studying S. agalactiae physiology and pathogenesis.

2009-01-01

298

Early activation of quorum sensing in Pseudomonas aeruginosa reveals the architecture of a complex regulon  

PubMed Central

Background Quorum-sensing regulation of gene expression in Pseudomonas aeruginosa is complex. Two interconnected acyl-homoserine lactone (acyl-HSL) signal-receptor pairs, 3-oxo-dodecanoyl-HSL-LasR and butanoyl-HSL-RhlR, regulate more than 300 genes. The induction of most of the genes is delayed during growth of P. aeruginosa in complex medium, cannot be advanced by addition of exogenous signal, and requires additional regulatory components. Many of these late genes can be induced by addition of signals early by using specific media conditions. While several factors super-regulate the quorum receptors, others may co-regulate target promoters or may affect expression posttranscriptionally. Results To better understand the contributions of super-regulation and co-regulation to quorum-sensing gene expression, and to better understand the general structure of the quorum sensing network, we ectopically expressed the two receptors (in the presence of their cognate signals) and another component that affects quorum sensing, the stationary phase sigma factor RpoS, early in growth. We determined the effect on target gene expression by microarray and real-time PCR analysis. Our results show that many target genes (e.g. lasB and hcnABC) are directly responsive to receptor protein levels. Most genes (e.g. lasA, lecA, and phnAB), however, are not significantly affected, although at least some of these genes are directly regulated by quorum sensing. The majority of promoters advanced by RhlR appeared to be regulated directly, which allowed us to build a RhlR consensus sequence. Conclusion The direct responsiveness of many quorum sensing target genes to receptor protein levels early in growth confirms the role of super-regulation in quorum sensing gene expression. The observation that the induction of most target genes is not affected by signal or receptor protein levels indicates that either target promoters are co-regulated by other transcription factors, or that expression is controlled posttranscriptionally. This architecture permits the integration of multiple signaling pathways resulting in quorum responses that require a "quorum" but are otherwise highly adaptable and receptive to environmental conditions.

Schuster, Martin; Greenberg, E Peter

2007-01-01

299

Autogenous transcriptional activation of a thiostrepton-induced gene in Streptomyces lividans.  

PubMed

Although the antibiotic thiostrepton is best known as an inhibitor of protein synthesis, it also, at extremely low concentrations (< 10(-9) M), induces the expression of a regulon of unknown function in certain Streptomyces species. Here, we report the purification of a Streptomyces lividans thiostrepton-induced transcriptional activator protein, TipAL, whose N-terminus is similar to a family of eubacterial regulatory proteins represented by MerR. TipAL was first purified from induced cultures of S.lividans as a factor which bound to and activated transcription from its own promoter. The tipAL gene was overexpressed in Escherichia coli and TipAL protein purified in a single step using a thiostrepton affinity column. Thiostrepton enhanced binding of TipAL to the promoter and catalysed specific transcription in vitro. TipAS, a second gene product of the same open reading frame consisting of the C-terminal domain of TipAL, is apparently translated using its own in-frame initiation site. Since it is produced in large molar excess relative to TipAL after induction and also binds thiostrepton, it may competitively modulate transcriptional activation. PMID:7688297

Holmes, D J; Caso, J L; Thompson, C J

1993-08-01

300

Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.  

PubMed

The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. PMID:20807373

Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G

2010-12-01

301

Prediction of the general transcription factors associated with RNA polymerase II in Plasmodium falciparum: conserved features and differences relative to other eukaryotes  

PubMed Central

Background To date, only a few transcription factors have been identified in the genome of the parasite Plasmodium falciparum, the causative agent of malaria. Moreover, no detailed molecular analysis of its basal transcription machinery, which is otherwise well-conserved in the crown group of eukaryotes, has yet been reported. In this study, we have used a combination of sensitive sequence analysis methods to predict the existence of several parasite encoded general transcription factors associated with RNA polymerase II. Results Several orthologs of general transcription factors associated with RNA polymerase II can be predicted among the hypothetical proteins of the P. falciparum genome using the two-dimensional Hydrophobic Cluster Analysis (HCA) together with profile-based search methods (PSI-BLAST). These predicted orthologous genes encoding putative transcription factors include the large subunit of TFIIA and two candidates for its small subunit, the TFIIE ?-subunit, which would associate with the previously known TFIIE ?-subunit, the TFIIF ?-subunit, as well as the p62/TFB1 subunit of the TFIIH core. Within TFIID, the putative orthologs of TAF1, TAF2, TAF7 and TAF10 were also predicted. However, no candidates for TAFs with classical histone fold domain (HFD) were found, suggesting an unusual architecture of TFIID complex of RNA polymerase II in the parasite. Conclusion Taken together, these results suggest that more general transcription factors may be present in the P. falciparum proteome than initially thought. The prediction of these orthologous general transcription factors opens the way for further studies dealing with transcriptional regulation in P. falciparum. These alternative and sensitive sequence analysis methods can help to identify candidates for other transcriptional regulatory factors in P. falciparum. They will also facilitate the prediction of biological functions for several orphan proteins from other apicomplexan parasites such as Toxoplasma gondii, Cryptosporidium parvum and Eimeria.

Callebaut, Isabelle; Prat, Karine; Meurice, Edwige; Mornon, Jean-Paul; Tomavo, Stanislas

2005-01-01

302

Transcription in archaea  

NASA Technical Reports Server (NTRS)

Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)

1999-01-01

303

Stochastic transcription initiation: Time dependent transcription rates.  

PubMed

The noise in the central process such as transcription, replication and translation of the genomic DNA is very important since it can directly affect the phenotypic and behavioral aspects of an organism as well as the entire cellular function. Here we develop a model on the transcription process based on the assumption that the initiation of the transcription is a stochastic event and the transcription rates may be time dependent random quantities. We derive the central measure properties i.e. mean and the variance, of the distribution of the transcription rates. Our results show that the Fano factor which is a measure of deviation from the Poisson distribution associated with the fluctuations in the number of mRNA molecules deviates from unity due to the randomness in the transcription rates. However when the RNA polymerase molecule searches for the promoter sequences on the DNA lattice by random jumps, the Fano factor approaches the Poisson limit as the jump size associated with the RNA polymerase increases. Since the jump size associated with dynamics of RNAP molecule is positively correlated with the degree of super coiling of DNA, we argue that the super coiled or close-packed structure of DNA might have evolved to keep the noises at the transcriptional level in a minimum. PMID:16442697

Murugan, R

2006-04-20

304

CsrA modulates luxR transcript levels in Vibrio fischeri.  

PubMed

The quorum-sensing and CsrA regulons of Vibrios control overlapping cellular functions during growth. Hence, the potential exists for regulatory network interactions between the pathways that enable them to be coordinately controlled. In Vibrio cholerae, CsrA indirectly modulates the activity of LuxO in the quorum-sensing signaling pathway. In this study, it was demonstrated that in Vibrio fischeri, CsrA causes an increase in the transcript levels of a downstream quorum-sensing regulatory gene, luxR, which does not exist in the V. cholerae system. In V. fischeri, the increase in luxR transcripts caused by CsrA does not depend on the LitR transcriptional activator nor does the CsrA effect seem to occur through the global regulator cAMP-CRP. Thus, there appears to be more than one mechanism whereby the CsrA and quorum-sensing pathways integrate regulatory outputs in Vibrios. PMID:22250984

Williams, Joshua W; Ritter, A L; Stevens, Ann M

2012-04-01

305

Global position analysis of the Pseudomonas aeruginosa quorum-sensing transcription factor LasR  

PubMed Central

Summary In Pseudomonas aeruginosa quorum sensing (QS), the transcriptional regulator LasR controls the expression of more than 300 genes. Several of these genes are activated indirectly via a second, subordinate QS regulator, RhlR. Conserved sequence elements upstream of individual other genes have been shown to bind LasR in vitro. To comprehensively identify all regions that are bound by LasR in vivo, we employed chromatin immunoprecipitation in conjunction with microarray analysis. We identified 35 putative promoter regions that direct the expression of up to 74 genes. In vitro DNA binding studies allowed us to distinguish between cooperative and non-cooperative LasR binding sites, and allowed us to build consensus sequences according to the mode of binding. Five promoter regions were not previously recognized as QS-controlled. Two of the associated transcript units encode proteins involved in the cold-shock response and in Psl exopolysaccharide synthesis, respectively. The LasR regulon includes seven genes encoding transcriptional regulators, while secreted factors and secretion machinery are the most overrepresented functional categories overall. This supports the notion that the core function of LasR is to coordinate the production of extracellular factors, although many of its effects on global gene expression are likely mediated indirectly by regulatory genes under its control.

Gilbert, Kerrigan B.; Kim, Tae Hoon; Gupta, Rashmi; Greenberg, E. P.; Schuster, Martin

2009-01-01

306

A workflow for genome-wide mapping of archaeal transcription factors with ChIP-seq  

PubMed Central

Deciphering the structure of gene regulatory networks across the tree of life remains one of the major challenges in postgenomic biology. We present a novel ChIP-seq workflow for the archaea using the model organism Halobacterium salinarum sp. NRC-1 and demonstrate its application for mapping the genome-wide binding sites of natively expressed transcription factors. This end-to-end pipeline is the first protocol for ChIP-seq in archaea, with methods and tools for each stage from gene tagging to data analysis and biological discovery. Genome-wide binding sites for transcription factors with many binding sites (TfbD) are identified with sensitivity, while retaining specificity in the identification the smaller regulons (bacteriorhodopsin-activator protein). Chromosomal tagging of target proteins with a compact epitope facilitates a standardized and cost-effective workflow that is compatible with high-throughput immunoprecipitation of natively expressed transcription factors. The Pique package, an open-source bioinformatics method, is presented for identification of binding events. Relative to ChIP-Chip and qPCR, this workflow offers a robust catalog of protein–DNA binding events with improved spatial resolution and significantly decreased cost. While this study focuses on the application of ChIP-seq in H. salinarum sp. NRC-1, our workflow can also be adapted for use in other archaea and bacteria with basic genetic tools.

Wilbanks, Elizabeth G.; Larsen, David J.; Neches, Russell Y.; Yao, Andrew I.; Wu, Chia-Ying; Kjolby, Rachel A. S.; Facciotti, Marc T.

2012-01-01

307

SlyA is a transcriptional regulator involved in the virulence of Enterococcus faecalis.  

PubMed

Phylogenetic analysis of the crystal structure of the Enterococcus faecalis SlyA (EF_3002) transcriptional factor places it between the SlyA and MarR regulator subfamilies. Proteins of these families are often involved in the regulation of genes important for bacterial virulence and stress response. To gather evidence for the role of this putative regulator in E. faecalis biology, we dissected the genetic organization of the slyA-EF_3001 locus and constructed a slyA deletion mutant as well as complemented strains. Interestingly, compared to the wild-type parent, the ?slyA mutant is more virulent in an insect infection model (Galleria mellonella), exhibits increased persistence in mouse kidneys and liver, and survives better inside peritoneal macrophages. In order to identify a possible SlyA regulon, global microarray transcriptional analysis was performed. This study revealed that the slyA-EF_3001 locus appears to be autoregulated and that 117 genes were differentially regulated in the ?slyA mutant. In the mutant strain, 111 were underexpressed and 6 overexpressed, indicating that SlyA functions mainly as an activator of transcription. PMID:21536798

Michaux, Charlotte; Sanguinetti, Maurizio; Reffuveille, Fany; Auffray, Yanick; Posteraro, Brunella; Gilmore, Michael S; Hartke, Axel; Giard, Jean-Christophe

2011-07-01

308

Relationship of the superoxide dismutase genes, sodA and sodB, to the iron uptake (/ital fur/) regulon in /ital Escherichia coli/ K-12  

SciTech Connect

Expression of sodA, as indicated by MnSod activity is normal in /ital fur/ mutants. This suggests that sodA is not a member of the /ital fur/ regulon and that the putative Fe-binding, regulatory protein of sodA, suggested by Moody and Hassan is not the Fur protein. by contrast, expression of sodB, as indicated by FeSod activity, is completely blocked in /ital fur/ mutants and the effect is restored by transformation with a plasmid having a normal /ital fur/ locus. The observations suggest that Fur, either directly or indirectly, controls SodB biosynthesis. Additional observations are described which indicate that SodB and Fur act together in a complicated fashion to control the biosynthesis of enterobactin. 26 refs., 3 tabs.

Niederhoffer, E.C.; Naranjo, C.M.; Fee, J.A.

1988-01-01

309

Computational Reconstruction of Iron- and Manganese-Responsive Transcriptional Networks in ?-Proteobacteria  

PubMed Central

We used comparative genomics to investigate the distribution of conserved DNA-binding motifs in the regulatory regions of genes involved in iron and manganese homeostasis in alpha-proteobacteria. Combined with other computational approaches, this allowed us to reconstruct the metal regulatory network in more than three dozen species with available genome sequences. We identified several classes of cis-acting regulatory DNA motifs (Irr-boxes or ICEs, RirA-boxes, Iron-Rhodo-boxes, Fur-alpha-boxes, Mur-box or MRS, MntR-box, and IscR-boxes) in regulatory regions of various genes involved in iron and manganese uptake, Fe-S and heme biosynthesis, iron storage, and usage. Despite the different nature of the iron regulons in selected lineages of alpha-proteobacteria, the overall regulatory network is consistent with, and confirmed by, many experimental observations. This study expands the range of genes involved in iron homeostasis and demonstrates considerable interconnection between iron-responsive regulatory systems. The detailed comparative and phylogenetic analyses of the regulatory systems allowed us to propose a theory about the possible evolution of Fe and Mn regulons in alpha-proteobacteria. The main evolutionary event likely occurred in the common ancestor of the Rhizobiales and Rhodobacterales, where the Fur protein switched to regulating manganese transporters (and hence Fur had become Mur). In these lineages, the role of global iron homeostasis was taken by RirA and Irr, two transcriptional regulators that act by sensing the physiological consequence of the metal availability rather than its concentration per se, and thus provide for more flexible regulation.

Rodionov, Dmitry A; Gelfand, Mikhail S; Todd, Jonathan D; Curson, Andrew R. J; Johnston, Andrew W. B

2006-01-01

310

Appropriate DevR (DosR)-Mediated Signaling Determines Transcriptional Response, Hypoxic Viability and Virulence of Mycobacterium tuberculosis  

PubMed Central

Background The DevR(DosR) regulon is implicated in hypoxic adaptation and virulence of Mycobacterium tuberculosis. The present study was designed to decipher the impact of perturbation in DevR-mediated signaling on these properties. Methodology/Principal Findings M. tb complemented (Comp) strains expressing different levels of DevR were constructed in Mut1* background (expressing DevR N-terminal domain in fusion with AphI (DevRN-Kan) and in Mut2?devR background (deletion mutant). They were compared for their hypoxia adaptation and virulence properties. Diverse phenotypes were noted; basal level expression (?5.3±2.3 µM) when induced to levels equivalent to WT levels (?25.8±9.3 µM) was associated with robust DevR regulon induction and hypoxic adaptation (Comp 9* and 10*), whereas low-level expression (detectable at transcript level) as in Comp 11* and Comp15 was associated with an adaptation defect. Intermediate-level expression (?3.3±1.2 µM) partially restored hypoxic adaptation functions in Comp2, but not in Comp1* bacteria that co-expressed DevRN-Kan. Comp* strains in Mut1* background also exhibited diverse virulence phenotypes; high/very low-level DevR expression was associated with virulence whereas intermediate-level expression was associated with low virulence. Transcription profiling and gene expression analysis revealed up-regulation of the phosphate starvation response (PSR) in Mut1* and Comp11* bacteria, but not in WT/Mut2?devR/other Comp strains, indicating a plasticity in expression pathways that is determined by the magnitude of signaling perturbation through DevRN-Kan. Conclusions/Significance A minimum DevR concentration of ?3.3±1.2 µM (as in Comp2 bacteria) is required to support HspX expression in the standing culture hypoxia model. The relative intracellular concentrations of DevR and DevRN-Kan appear to be critical for determining dormancy regulon induction, hypoxic adaptation and virulence. Dysregulated DevRN-Kan-mediated signaling selectively triggers the PSR in bacteria expressing no/very low level of DevR. Our findings illustrate the important role of appropriate two-component- mediated signaling in pathogen physiology and the resilience of bacteria when such signaling is perturbed.

De Majumdar, Shyamasree; Vashist, Atul; Dhingra, Sakshi; Gupta, Rajesh; Singh, Alka; Challu, Vijay K.; Ramanathan, V. D.; Kumar, Prahlad; Tyagi, Jaya Sivaswami

2012-01-01

311

Control of Proteobacterial Central Carbon Metabolism by the HexR Transcriptional Regulator. A Case Study in Shewanella oneidensis  

SciTech Connect

Bacteria exploit multiple mechanisms for controlling central carbon metabolism (CCM). Thus, a bioinformatic analysis together with some experimental data implicated HexR transcriptional factor as a global CCM regulator in some lineages of Gammaproteobacteria operating as a functional replacement of Cra regulator characteristic of Enterobacteriales. In this study we combined a large-scale comparative genomic reconstruction of HexRcontrolled regulons in 87 species of Proteobacteria with the detailed experimental analysis of HexR regulatory network in Shewanella oneidensis model system. Although nearly all of the HexR-controlled genes are associated with CCM, remarkable variations were revealed in the scale (from 1-2 target operons in Enterobacteriales up to 20 operons in Aeromonadales) and gene content of HexR regulons between 11 compared lineages. A predicted 17-bp pseudo-palindrome with a consensus tTGTAATwwwATTACa, was confirmed as HexR-binding motif for 15 target operons (comprising 30 genes) by in vitro binding assays. The negative effect of the key CCM intermediate, 2-keto-3-deoxy-6- phosphogluconate, on the DNA-regulator complex formation was verified. A dual mode of HexR action on various target promoters, repression of genes involved in catabolic pathways and activation of gluconeogenic genes, was for the first time predicted by the bioinformatc analysis and experimentally verified by changed gene expression pattern in S. oneidensis AhexR mutant. Phenotypic profiling revealed the inability of this mutant to grow on lactate or pyruvate as a single carbon source. A comparative metabolic flux analysis of wild-type and mutant strains of S. oneidensis using 13Clactate labeling and GC-MS analysis confirmed the hypothesized HexR role as a master regulator of gluconeogenic flux from pyruvate via the transcriptional activation of phosphoenolpyruvate synthase (PpsA).

Leyn, Semen; Li, Xiaoqing; Zheng, Qijing; Novichkov, Pavel; Reed, Samantha B.; Romine, Margaret F.; Fredrickson, Jim K.; Yang, Chen; Osterman, Andrei L.; Rodionov, Dmitry A.

2011-08-17

312

A Novel Role for the Transcription Factor Cwt1p as a Negative Regulator of Nitrosative Stress in Candida albicans  

PubMed Central

The ability of Candida albicans to survive in the presence of nitrosative stress during the initial contact with the host immune system is crucial for its ability to colonize mammalian hosts. Thus, this fungus must activate robust mechanisms to neutralize and repair nitrosative-induced damage. Until now, very little was known regarding the regulatory circuits associated with reactive nitrogen species detoxification in fungi. To gain insight into the transcriptional regulatory networks controlling nitrosative stress response (NRS) in C. albicans a compilation of transcriptional regulator-defective mutants were screened. This led to the identification of Cwt1p as a negative regulator of NSR. By combining genome-wide location and expression analyses, we have characterized the Cwt1p regulon and demonstrated that Cwt1p is directly required for proper repression of the flavohemoglobin Yhb1p, a key NO-detoxification enzyme. Furthermore, Cwt1p operates both by activating and repressing genes of specific functions solicited upon NSR. Additionally, we used Gene Set Enrichment Analysis to reinvestigate the C. albicans NSR-transcriptome and demonstrate a significant similarity with the transcriptional profiles of C. albicans interacting with phagocytic host-cells. In summary, we have characterized a novel negative regulator of NSR and bring new insights into the transcriptional regulatory network governing fungal NSR.

Whiteway, Malcolm; Nantel, Andre

2012-01-01

313

Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa  

PubMed Central

Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction. This systematic analysis illustrates the similarities and differences in regulation of hemicellulose degradation among filamentous fungi.

Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

2012-01-01

314

Dissecting the expression patterns of transcription factors across conditions using an integrated network-based approach  

PubMed Central

In prokaryotes, regulation of gene expression is predominantly controlled at the level of transcription. Transcription in turn is mediated by a set of DNA-binding factors called transcription factors (TFs). In this study, we map the complete repertoire of ?300 TFs of the bacterial model, Escherichia coli, onto gene expression data for a number of nonredundant experimental conditions and show that TFs are generally expressed at a lower level than other gene classes. We also demonstrate that different conditions harbor varying number of active TFs, with an average of about 15% of the total repertoire, with certain stress and drug-induced conditions exhibiting as high as one-third of the collection of TFs. Our results also show that activators are more frequently expressed than repressors, indicating that activation of promoters might be a more common phenomenon than repression in bacteria. Finally, to understand the association of TFs with different conditions and to elucidate their dynamic interplay with other TFs, we develop a network-based framework to identify TFs which act as markers, defined as those which are responsible for condition-specific transcriptional rewiring. This approach allowed us to pinpoint several marker TFs as being central in various specialized conditions such as drug induction or growth condition variations, which we discuss in light of previously reported experimental findings. Further analysis showed that a majority of identified markers effectively control the expression of their regulons and, in general, transcriptional programs of most conditions can be effectively rewired by a very small number of TFs. It was also found that closeness is a key centrality measure which can aid in the successful identification of marker TFs in regulatory networks. Our results suggest the utility of the network-based approaches developed in this study to be applicable for understanding other interactomic data sets.

Janga, Sarath Chandra; Contreras-Moreira, Bruno

2010-01-01

315

Deciphering transcriptional regulatory mechanisms associated with hemicellulose degradation in Neurospora crassa.  

PubMed

Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction. This systematic analysis illustrates the similarities and differences in regulation of hemicellulose degradation among filamentous fungi. PMID:22345350

Sun, Jianping; Tian, Chaoguang; Diamond, Spencer; Glass, N Louise

2012-04-01

316

Comparative genomics supports a deep evolutionary origin for the large, four-module transcriptional mediator complex  

PubMed Central

The multisubunit Mediator (MED) complex bridges DNA-bound transcriptional regulators to the RNA polymerase II (PolII) initiation machinery. In yeast, the 25 MED subunits are distributed within three core subcomplexes and a separable kinase module composed of Med12, Med13 and the Cdk8-CycC pair thought to control the reversible interaction between MED and PolII by phosphorylating repeated heptapeptides within the Rpb1 carboxyl-terminal domain (CTD). Here, MED conservation has been investigated across the eukaryotic kingdom. Saccharomyces cerevisiae Med2, Med3/Pgd1 and Med5/Nut1 subunits are apparent homologs of metazoan Med29/Intersex, Med27/Crsp34 and Med24/Trap100, respectively, and these and other 30 identified human MED subunits have detectable counterparts in the amoeba Dictyostelium discoideum, indicating that none is specific to metazoans. Indeed, animal/fungal subunits are also conserved in plants, green and red algae, entamoebids, oomycetes, diatoms, apicomplexans, ciliates and the ‘deep-branching’ protists Trichomonas vaginalis and Giardia lamblia. Surprisingly, although lacking CTD heptads, T. vaginalis displays 44 MED subunit homologs, including several CycC, Med12 and Med13 paralogs. Such observations have allowed the identification of a conserved 17-subunit framework around which peripheral subunits may be assembled, and support a very ancient eukaryotic origin for a large, four-module MED. The implications of this comprehensive work for MED structure–function relationships are discussed.

Bourbon, Henri-Marc

2008-01-01

317

Infection by Toxoplasma gondii Specifically Induces Host c-Myc and the Genes This Pivotal Transcription Factor Regulates.  

PubMed

Toxoplasma gondii infection has previously been described to cause dramatic changes in the host transcriptome by manipulating key regulators, including STATs, NF-?B, and microRNAs. Here, we report that Toxoplasma tachyzoites also mediate rapid and sustained induction of another pivotal regulator of host cell transcription, c-Myc. This induction is seen in cells infected with all three canonical types of Toxoplasma but not the closely related apicomplexan parasite Neospora caninum. Coinfection of cells with both Toxoplasma and Neospora still results in an increase in the level of host c-Myc, showing that c-Myc is actively upregulated by Toxoplasma infection (rather than repressed by Neospora). We further demonstrate that this upregulation may be mediated through c-Jun N-terminal protein kinase (JNK) and is unlikely to be a nonspecific host response, as heat-killed Toxoplasma parasites do not induce this increase and neither do nonviable parasites inside the host cell. Finally, we show that the induced c-Myc is active and that transcripts dependent on its function are upregulated, as predicted. Hence, c-Myc represents an additional way in which Toxoplasma tachyzoites have evolved to specifically alter host cell functions during intracellular growth. PMID:24532536

Franco, Magdalena; Shastri, Anjali J; Boothroyd, John C

2014-04-01

318

Involvement of Outer Membrane Protein TolC, a Possible Member of the mar-sox Regulon, in Maintenance and Improvement of Organic Solvent Tolerance of Escherichia coli K-12  

Microsoft Academic Search

Escherichia coli mutants with improved organic solvent tolerance levels showed high levels of outer mem- brane protein TolC and inner membrane protein AcrA. The TolC level was regulated positively by MarA, Rob, or SoxS. A possible mar-rob-sox box sequence was found upstream of the tolC gene. These findings suggest that tolC is a member of the mar-sox regulon responsive to

RIKIZO AONO; NORIHIKO TSUKAGOSHI; MAMI YAMAMOTO

1998-01-01

319

Transcription of the Staphylococcus aureus cid and lrg murein hydrolase regulators is affected by sigma factor B.  

PubMed

The Staphylococcus aureus lrg and cid loci are homologous operons that have been shown to regulate murein hydrolase activity and affect sensitivity to penicillin. Although the mode of action of these operons has not been demonstrated, a model based on the similarities of the lrgA and cidA gene products to the bacteriophage holin family of proteins has been proposed. In this study, the transcription organization and regulation of these operons were examined by Northern blot analyses. Unexpectedly, cidB and a gene located immediately downstream, designated cidC, were found to be cotranscribed on a 2.7-kb transcript. Maximal cidBC transcription occurred during early exponential growth, and high-level transcription of cidBC was dependent on the rsbU-mediated activation of the alternative sigma factor B (sigmaB). In contrast, lrgAB transcription in stationary phase was negatively regulated by sigmaB. Although cidABC transcription was not detected by Northern blot analysis, reverse transcriptase PCR revealed that these genes are also cotranscribed as a single RNA message in early exponential growth. Primer extension analysis revealed the presence of two cidBC transcription start sites, but no apparent sigmaB-dependent promoter consensus sequence was identified in these regions. The rsbU gene was also shown to have a positive impact on murein hydrolase activity but a negligible effect on sensitivity to penicillin-induced killing. These results suggest that the lrgAB and cidBC genes may be part of the S. aureus sigmaB-controlled stress regulon. PMID:15126464

Rice, Kelly C; Patton, Toni; Yang, Soo-Jin; Dumoulin, Alexis; Bischoff, Markus; Bayles, Kenneth W

2004-05-01

320

Heat shock-dependent transcriptional activation of the metA gene of Escherichia coli.  

PubMed

In Escherichia coli, the growth rate at elevated temperatures is controlled by the availability of endogenous methionine, which is limited because of the temperature sensitivity of the metA gene product, homoserine transsuccinylase (HTS). In order to determine the relationship between this control mechanism and the heat shock response, we estimated the cellular levels of HTS during heat shock by Western (immunoblot) analysis and found an increase following induction by temperature shift and by addition of ethanol or cadmium ions. The elevated level of HTS was a result of transcriptional activation of the metA gene. This activation was heat shock dependent, as it did not take place in rpoH mutants, and probably specific to the metA gene, as another gene of the methionine regulon (metE) was not activated. These results suggest a metabolic link between the two systems that control the response of E. coli to elevated temperatures: the metA gene, which codes for the enzyme responsible for regulating cell growth as a function of temperature elevation (HTS), is transcriptionally activated by the heat shock response. PMID:7868613

Biran, D; Brot, N; Weissbach, H; Ron, E Z

1995-03-01

321

Heat shock-dependent transcriptional activation of the metA gene of Escherichia coli.  

PubMed Central

In Escherichia coli, the growth rate at elevated temperatures is controlled by the availability of endogenous methionine, which is limited because of the temperature sensitivity of the metA gene product, homoserine transsuccinylase (HTS). In order to determine the relationship between this control mechanism and the heat shock response, we estimated the cellular levels of HTS during heat shock by Western (immunoblot) analysis and found an increase following induction by temperature shift and by addition of ethanol or cadmium ions. The elevated level of HTS was a result of transcriptional activation of the metA gene. This activation was heat shock dependent, as it did not take place in rpoH mutants, and probably specific to the metA gene, as another gene of the methionine regulon (metE) was not activated. These results suggest a metabolic link between the two systems that control the response of E. coli to elevated temperatures: the metA gene, which codes for the enzyme responsible for regulating cell growth as a function of temperature elevation (HTS), is transcriptionally activated by the heat shock response.

Biran, D; Brot, N; Weissbach, H; Ron, E Z

1995-01-01

322

Proteins Needed to Activate a Transcriptional Response to the Reactive Oxygen Species Singlet Oxygen  

PubMed Central

ABSTRACT Singlet oxygen (1O2) is a reactive oxygen species generated by energy transfer from one or more excited donors to molecular oxygen. Many biomolecules are prone to oxidation by 1O2, and cells have evolved systems to protect themselves from damage caused by this compound. One way that the photosynthetic bacterium Rhodobacter sphaeroides protects itself from 1O2 is by inducing a transcriptional response controlled by ChrR, an anti-? factor which releases an alternative sigma factor, ?E, in the presence of 1O2. Here we report that induction of ?E-dependent gene transcription is decreased in the presence of 1O2 when two conserved genes in the ?E regulon are deleted, including one encoding a cyclopropane fatty acid synthase homologue (RSP2144) or one encoding a protein of unknown function (RSP1091). Thus, we conclude that RSP2144 and RSP1091 are each necessary to increase ?E activity in the presence of 1O2. In addition, we found that unlike in wild-type cells, where ChrR is rapidly degraded when 1O2 is generated, turnover of this anti-? factor is slowed when cells lacking RSP2144, RSP1091, or both of these proteins are exposed to 1O2. Further, we demonstrate that the organic hydroperoxide tert-butyl hydroperoxide promotes ChrR turnover in both wild-type cells and mutants lacking RSP2144 or RSP1091, suggesting differences in the ways different types of oxidants increase ?E activity.

Nam, Tae-Wook; Ziegelhoffer, Eva C.; Lemke, Rachelle A. S.; Donohue, Timothy J.

2013-01-01

323

Transcriptional Responses of Uropathogenic Escherichia coli to Increased Environmental Osmolality Caused by Salt or Urea  

PubMed Central

Uropathogenic Escherichia coli (UPEC) is the most common causative agent of urinary tract infections in humans. The majority of urinary infections develop via ascending route through the urethra, where bacterial cells come in contact with human urine prior to reaching the bladder or kidneys. Since urine contains significant amounts of inorganic ions and urea, it imposes osmotic and denaturing stresses on bacterial cells. In this study, we determined the transcriptional adaptive responses of UPEC strain CFT073 to the presence of 0.3 M NaCl or 0.6 M urea in the growth medium. The cell responses to these two osmolytes were drastically different. Although most of the genes of the osmotically inducible regulon were overexpressed in medium with salt, urea failed to stimulate osmotic stress response. At the same time, UPEC colonization genes encoding type 1 and F1C fimbriae and capsule biosynthesis were transcriptionally induced in the presence of urea but did not respond to increased salt concentration. We speculate that urea can potentially be sensed by uropathogenic bacteria to initiate infection program. In addition, several molecular chaperone genes were overexpressed in the presence of urea, whereas adding NaCl to the medium led to an upregulation of a number of anaerobic metabolism pathways.

Withman, Benjamin; Gunasekera, Thusitha S.; Beesetty, Pavani; Agans, Richard

2013-01-01

324

Transcriptional responses of uropathogenic Escherichia coli to increased environmental osmolality caused by salt or urea.  

PubMed

Uropathogenic Escherichia coli (UPEC) is the most common causative agent of urinary tract infections in humans. The majority of urinary infections develop via ascending route through the urethra, where bacterial cells come in contact with human urine prior to reaching the bladder or kidneys. Since urine contains significant amounts of inorganic ions and urea, it imposes osmotic and denaturing stresses on bacterial cells. In this study, we determined the transcriptional adaptive responses of UPEC strain CFT073 to the presence of 0.3 M NaCl or 0.6 M urea in the growth medium. The cell responses to these two osmolytes were drastically different. Although most of the genes of the osmotically inducible regulon were overexpressed in medium with salt, urea failed to stimulate osmotic stress response. At the same time, UPEC colonization genes encoding type 1 and F1C fimbriae and capsule biosynthesis were transcriptionally induced in the presence of urea but did not respond to increased salt concentration. We speculate that urea can potentially be sensed by uropathogenic bacteria to initiate infection program. In addition, several molecular chaperone genes were overexpressed in the presence of urea, whereas adding NaCl to the medium led to an upregulation of a number of anaerobic metabolism pathways. PMID:23090957

Withman, Benjamin; Gunasekera, Thusitha S; Beesetty, Pavani; Agans, Richard; Paliy, Oleg

2013-01-01

325

The RclR protein is a reactive chlorine-specific transcription factor in Escherichia coli.  

PubMed

Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance. PMID:24078635

Parker, Benjamin W; Schwessinger, Emily A; Jakob, Ursula; Gray, Michael J

2013-11-01

326

Regulation of Expression of the 2-Deoxy-d-Ribose Utilization Regulon, deoQKPX, from Salmonella enterica Serovar Typhimurium  

PubMed Central

Salmonella enterica, in contrast to Escherichia coli K12, can use 2-deoxy-d-ribose as the sole carbon source. The genetic determinants for this capacity in S. enterica serovar Typhimurium include four genes, of which three, deoK, deoP, and deoX, constitute an operon. The fourth, deoQ, is transcribed in the opposite direction. The deoK gene encodes deoxyribokinase. In silico analyses indicated that deoP encodes a permease and deoQ encodes a regulatory protein of the deoR family. The deoX gene product showed no match to known proteins in the databases. Deletion analyses showed that both a functional deoP gene and a functional deoX gene were required for optimal utilization of deoxyribose. Using gene fusion technology, we observed that deoQ and the deoKPX operon were transcribed from divergent promoters located in the 324-bp intercistronic region between deoQ and deoK. The deoKPX promoter was 10-fold stronger than the deoQ promoter, and expression was negatively regulated by DeoQ as well as by DeoR, the repressor of the deoxynucleoside catabolism operon. Transcription of deoKPX but not of deoQ was regulated by catabolite repression. Primer extension analysis identified the transcriptional start points of both promoters and showed that induction by deoxyribose occurred at the level of transcription initiation. Gel retardation experiments with purified DeoQ illustrated that it binds independently to tandem operator sites within the deoQ and deoK promoter regions with Kd values of 54 and 2.4 nM, respectively.

Christensen, Mette; Borza, Tudor; Dandanell, Gert; Gilles, Anne-Marie; Barzu, Octavian; Kelln, Rod A.; Neuhard, Jan

2003-01-01

327

The checkpoint transcriptional response  

PubMed Central

The replication checkpoint signaling network monitors the presence of replication-induced lesions to DNA and coordinates an elaborate cellular response that includes ample transcriptional reprogramming. Recent work has established two major groups of replication stress-induced genes in Saccharomyces cerevisiae, the DNA damage response (DDR) genes and G1/S cell cycle (CC) genes. In both cases, transcriptional activation is mediated via checkpoint-dependent inhibition of a transcriptional repressor (Crt1 for DDR and Nrm1 for CC) that participates in negative feedback regulation. This repressor-mediated regulation enables transcription to be rapidly repressed once cells have dealt with the replication stress. The recent finding of a new class of CC genes, named “switch genes,” further uncovers a mode of transcription regulation that prevents overexpression of replication stress induced genes during G1. Collectively, these findings highlight the need for mechanisms that tightly control replication stress-induced transcription, allowing rapid transcriptional activation during replication stress but also avoiding long-term hyperaccumulation of the induced protein product that may be detrimental to cell proliferation.

Smolka, Marcus B.; Bastos de Oliveira, Francisco M.; Harris, Michael R.; de Bruin, Robertus A.M.

2012-01-01

328

ASTP Onboard Voice Transcription  

NASA Technical Reports Server (NTRS)

The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

1975-01-01

329

Rem, a New Transcriptional Activator of Motility and Chemotaxis in Sinorhizobium meliloti  

PubMed Central

The expression of 51 known genes clustered in the flagellar regulon of Sinorhizobium meliloti is organized as a three-class hierarchy: class IA comprises the master regulatory genes, visN and visR; class II, controlled by VisNR, comprises flagellar assembly and motility genes; and class III comprises flagellin and chemotaxis genes requiring class II for expression. The expression of visN-visR is constitutive throughout growth, whereas that of class II and class III genes is limited to exponential growth. A new OmpR-like, 25-kDa transcription factor, Rem, whose synthesis is confined to exponential growth, was shown to positively control swimming motility. No phosphorylation of the receiver domain of Rem was required for its activity. Gene expression in tester strains with known deficiencies placed the rem gene (class IB) below visN-visR (class IA) and above class II genes in the regulatory cascade. Footprinting analysis demonstrated that the Rem protein binds to class II gene promoters as well as to its own promoter, indicating that this protein is autoregulatory. An alignment of the Rem-protected DNA sequences revealed a conserved binding motif of imperfect tandem repeats overlapping a predicted ?35 promoter box by 3 bp. This new promoter was confirmed by mapping the transcription start site of a typical class II gene, flgB, 5 nucleotides downstream of the ?10 promoter box. The transcription of rem is under dual control of an upstream (Rem-activated) class II-type promoter and a downstream (VisNR-activated) ?70-like promoter. The central role of Rem as the growth-dependent transcriptional activator intermediate between the master regulator, VisNR, and the flagellar and motility genes is a new distinguishing feature of the S. meliloti regulatory cascade.

Rotter, Christine; Muhlbacher, Susanne; Salamon, Daniel; Schmitt, Rudiger; Scharf, Birgit

2006-01-01

330

Global transcriptional response of Caulobacter crescentus to iron availability  

PubMed Central

Background In the alpha subclass of proteobacteria iron homeostasis is controlled by diverse iron responsive regulators. Caulobacter crescentus, an important freshwater ?-proteobacterium, uses the ferric uptake repressor (Fur) for such purpose. However, the impact of the iron availability on the C. crescentus transcriptome and an overall perspective of the regulatory networks involved remain unknown. Results In this work we report the identification of iron-responsive and Fur-regulated genes in C. crescentus using microarray-based global transcriptional analyses. We identified 42 genes that were strongly upregulated both by mutation of fur and by iron limitation condition. Among them, there are genes involved in iron uptake (four TonB-dependent receptor gene clusters, and feoAB), riboflavin biosynthesis and genes encoding hypothetical proteins. Most of these genes are associated with predicted Fur binding sites, implicating them as direct targets of Fur-mediated repression. These data were validated by ?-galactosidase and EMSA assays for two operons encoding putative transporters. The role of Fur as a positive regulator is also evident, given that 27 genes were downregulated both by mutation of fur and under low-iron condition. As expected, this group includes many genes involved in energy metabolism, mostly iron-using enzymes. Surprisingly, included in this group are also TonB-dependent receptors genes and the genes fixK, fixT and ftrB encoding an oxygen signaling network required for growth during hypoxia. Bioinformatics analyses suggest that positive regulation by Fur is mainly indirect. In addition to the Fur modulon, iron limitation altered expression of 113 more genes, including induction of genes involved in Fe-S cluster assembly, oxidative stress and heat shock response, as well as repression of genes implicated in amino acid metabolism, chemotaxis and motility. Conclusions Using a global transcriptional approach, we determined the C. crescentus iron stimulon. Many but not all of iron responsive genes were directly or indirectly controlled by Fur. The iron limitation stimulon overlaps with other regulatory systems, such as the RpoH and FixK regulons. Altogether, our results showed that adaptation of C. crescentus to iron limitation not only involves increasing the transcription of iron-acquisition systems and decreasing the production of iron-using proteins, but also includes novel genes and regulatory mechanisms.

2013-01-01

331

Identification of a cold shock transcriptional enhancer of the Escherichia coli gene encoding nucleoid protein H-NS.  

PubMed Central

The hns (27 min) gene encoding the 15.4-kDa nucleoid protein H-NS was shown to belong to the cold shock regulon of Escherichia coli, its expression being enhanced 3- to 4-fold during the growth lag that follows a shift from 37 degrees C to 10 degrees C. A 110-base-pair (bp) DNA fragment containing the promoter of hns fused to a promoterless cat gene (hns-cat fusion) conferred a similar cold shock response to the expression of chloramphenicol acetyltransferase (CAT) activity in vivo and in coupled transcription-translation systems prepared with extracts of cold-shocked cells. Extracts of the same cells produce a specific gel shift of the 110-bp DNA fragment and this fragment, immobilized on a solid support, specifically retains a single 7-kDa protein present only in cold-shocked cells that was found to be identical to F10.6 (CS7.4), the product of cspA. This purified protein, which is homologous to human DNA-binding protein YB-1, recognizes some feature of the 110-bp promoter region of hns and acts as a cold shock transcriptional activator of this gene since it stimulates the expression of CAT activity and of cat transcription in in vitro systems programmed with plasmid DNA carrying the hns-cat fusion. Images

La Teana, A; Brandi, A; Falconi, M; Spurio, R; Pon, C L; Gualerzi, C O

1991-01-01

332

The Fidelity of Transcription  

PubMed Central

The fidelity of RNA synthesis depends on both accurate template-mediated nucleotide selection and proper maintenance of register between template and RNA. Loss of register, or transcriptional slippage, is particularly likely on homopolymeric runs in the template. Transcriptional slippage can alter the coding capacity of mRNAs and is used as a regulatory mechanism. Here we describe mutations in the largest subunit of Saccharomyces cerevisiae RNA polymerase II that substantially increase the level of transcriptional slippage. Alleles of RPB1 (RPO21) with elevated slippage rates were identified among 6-azauracil-sensitive mutants and were also isolated using a slippage-dependent reporter gene. Biochemical characterization of polymerase II isolated from these mutants confirms elevated levels of transcriptional slippage.

Strathern, Jeffrey; Malagon, Francisco; Irvin, Jordan; Gotte, Deanna; Shafer, Brenda; Kireeva, Maria; Lubkowska, Lucyna; Jin, Ding Jun; Kashlev, Mikhail

2013-01-01

333

Antigene Oligomers Inhibit Transcription.  

National Technical Information Service (NTIS)

Transcription of a gene in a mammalian cell is methylase-independently inhibited by contacting the cell with a nucleic acid oligomer of 12-28 bases complementary for a partially single-stranded target genomic sequence of the gene.

B. A. Janowski D. R. Corey

2006-01-01

334

Transcription Factor Effector Domains  

Microsoft Academic Search

\\u000a The last decade has seen an incredible breakthrough in technologies that allow histones, transcription factors (TFs), and\\u000a RNA polymerases to be precisely mapped throughout the genome. From this research, it is clear that there is a complex interaction\\u000a between the chromatin landscape and the general transcriptional machinery and that the dynamic control of this interface is\\u000a central to gene regulation.

Seth Frietze; Peggy J. Farnham

335

Intersection of the stringent response and the CodY regulon in low GC Gram-positive bacteria.  

PubMed

Bacteria adapt efficiently to a wide range of nutritional environments. Therefore, they possess overlapping regulatory systems that detect intracellular pools of key metabolites. In low GC Gram-positive bacteria, two global regulators, the stringent response and the CodY repressor, respond to an intracellular decrease in amino acid content. Amino acid limitation leads to rapid synthesis of the alarmones pppGpp and ppGpp through the stringent response and inactivates the CodY repressor. Two cofactors, branched chain amino acids (BCAA) and GTP, are ligands for CodY and facilitate binding to the target DNA. Because (p)ppGpp synthesis and accumulation evidentially reduce the intracellular GTP pool, CodY is released from the DNA, and transcription of target genes is altered. Here, we focus on this intimate link between the stringent response and CodY regulation in different Gram-positive species. PMID:24462007

Geiger, Tobias; Wolz, Christiane

2014-03-01

336

Promoter and regulon analysis of nitrogen assimilation factor, sigma54, reveal alternative strategy for E. coli MG1655 flagellar biosynthesis.  

PubMed

Bacteria core RNA polymerase (RNAP) must associate with a sigma factor to recognize promoter sequences. Promoters recognized by the sigma(54) (or sigma(N)) associated RNA polymerase are unique in having conserved positions around -24 and -12 nucleotides upstream from the transcriptional start site. Using DNA microarrays representing the entire Escherichia coli genome and promoter validation approaches, we identify 40 in vivo targets of sigma(54), the nitrogen assimilation sigma factor, and estimate that there are 70 sigma(54) promoters in total. Immunoprecipitation assays have been performed to further evaluate the efficiency of our approaches. In addition, promoter consensus binding search and primer extension assay helped us to identify a new sigma(54) promoter carried by insB-5 in the upstream of flhDC operon. The involvement of sigma(54) in flagellar biosynthesis in sequenced E. coli strain MG1655 indicates a fluid gene regulation phenomenon carried by some mobile elements in bacteria genome. PMID:19969540

Zhao, Kai; Liu, Mingzhu; Burgess, Richard R

2010-03-01

337

Promoter and regulon analysis of nitrogen assimilation factor, ?54, reveal alternative strategy for E. coli MG1655 flagellar biosynthesis  

PubMed Central

Bacteria core RNA polymerase (RNAP) must associate with a ? factor to recognize promoter sequences. Promoters recognized by the ?54 (or ?N) associated RNA polymerase are unique in having conserved positions around ?24 and ?12 nucleotides upstream from the transcriptional start site. Using DNA microarrays representing the entire Escherichia coli genome and promoter validation approaches, we identify 40 in vivo targets of ?54, the nitrogen assimilation ? factor, and estimate that there are 70 ?54 promoters in total. Immunoprecipitation assays have been performed to further evaluate the efficiency of our approaches. In addition, promoter consensus binding search and primer extension assay helped us to identify a new ?54 promoter carried by insB-5 in the upstream of flhDC operon. The involvement of ?54 in flagellar biosynthesis in sequenced E. coli strain MG1655 indicates a fluid gene regulation phenomenon carried by some mobile elements in bacteria genome.

Zhao, Kai; Liu, Mingzhu; Burgess, Richard R.

2010-01-01

338

Transcription control of DAPK.  

PubMed

Imbalanced cell death is a common phenomenon in many human diseases, including cancer. DAPK's essential function is in promoting apoptosis. DAPK interacts with stress-induced receptors through its death domain to initiate an apoptosis cascade. In addition, DAPK phosphorylates multiple cytosolic substrates and can mediate transfer of signaling pathways to the effector caspases. A series of studies demonstrated that, depending on stimuli, DAPK expression is regulated on both the transcriptional and posttranscriptional levels. Silencing of DAPK due to hypermethylation of its promoter was reported in many types of cancer. STAT3 and p52-NFkB transcription factors have been shown to down-regulate DAPK expression. In contrast, p53, C/EBP-? and Smad transcription factors bind to their specific response elements within the DAPK promoter and induce its transcription. Post-transcriptionally, DAPK undergoes alternative splicing, which results in the production of two functionally different isoforms. Moreover, miRNA 103 and miRNA 107 recently were shown to inhibit DAPK in colorectal cancer. Here we summarize our recent knowledge about transcriptional regulation of DAPK expression. PMID:24217921

Benderska, Natalya; Schneider-Stock, Regine

2014-02-01

339

LOX-1 transcription.  

PubMed

The importance of the lectin-like oxidized LDL receptor (LOX-1) gene in cardiovascular and other diseases is slowly being revealed. LOX-1 gene expression appears to be a "canary in a coal mine" for atherogenesis, being strongly up-regulated early on in a number of cell types when they are activated, and predicting the sites of future disease. From this early time point the LOX-1 protein often participates in the disease process itself. While gene/protein expression can be regulated on a multiplicity of levels, the most basic and important mode of regulation is usually transcriptional. There are very few studies on the transcriptional regulation of the human LOX-1 promoter; fewer still on definitive mapping of the transcription factors involved. It is known that a wide variety of stimuli up-regulate LOX-1, usually/probably on the transcriptional level. Angiotensin II (Ang II) is one important regulator of renin-angiotensin system and stimulator LOX-1. Ang II is known to up-regulate LOX-1 transcription through an NF-kB motif located at nt -2158. Oxidized low density lipoprotein (ox-LDL) is another important cardiovascular regulator, particularly of atherosclerotic disease, and a strong stimulator of LOX-1. Ox-LDL is known to up-regulate LOX-1 transcription through an Oct-1 motif located at nt -1556. The subsequent enhanced LOX-1 receptor numbers and their binding by ox-LDL ligand triggers a positive feedback loop, increasing further LOX-1 expression, with a presently unknown regulatory governor. The Oct-1 gene also has its own Oct-1-driven positive feedback loop, which likely also contributes to LOX-1 up-regulation. There is also data which suggests the involvement of the transcription factor AP-1 during stimulation with Phorbol 12-myristate acetate. While the importance of NF-?B as a transcriptional regulator of cardiovascular-relevant genes is well known, the importance of Oct-1 is not. Data suggests that Oct-1-mediated up-regulation of transcription is an early event in the stimulation of LOX-1 by ox-LDL. Yet Oct-1 also down-regulates cardiovascular-relevant genes by suppressing NF-?B transactivation. Thus, Oct-1 is presently somewhat of an enigma, up-regulating and down-regulating genes seemingly at random without an overall theme (with the exception of cell cycle). Yet the up-regulation of LOX-1 by ox-LDL is a very important event in atherogenesis (both early and late) and Oct-1 is, therefore, an important transcriptional gatekeeper of this important atherogenic trigger. PMID:21796333

Hermonat, Paul L; Zhu, Hongqing; Cao, Maohua; Mehta, Jawahar L

2011-10-01

340

The Transcription Factor Encyclopedia  

PubMed Central

Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe.

2012-01-01

341

Regulon studies and in planta role of the BraI/R quorum-sensing system in the plant-beneficial Burkholderia cluster.  

PubMed

The genus Burkholderia is composed of functionally diverse species, and it can be divided into several clusters. One of these, designated the plant-beneficial-environmental (PBE) Burkholderia cluster, is formed by nonpathogenic species, which in most cases have been found to be associated with plants. It was previously established that members of the PBE group share an N-acyl-homoserine lactone (AHL) quorum-sensing (QS) system, designated BraI/R, that produces and responds to 3-oxo-C14-HSL (OC14-HSL). Moreover, some of them also possess a second AHL QS system, designated XenI2/R2, producing and responding to 3-hydroxy-C8-HSL (OHC8-HSL). In the present study, we performed liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis to determine which AHL molecules are produced by each QS system of this group of bacteria. The results showed that XenI2/R2 is mainly responsible for the production of OHC8-HSL and that the BraI/R system is involved in the production of several different AHLs. This analysis also revealed that Burkholderia phymatum STM815 produces greater amounts of AHLs than the other species tested. Further studies showed that the BraR protein of B. phymatum is more promiscuous than other BraR proteins, responding equally well to several different AHL molecules, even at low concentrations. Transcriptome studies with Burkholderia xenovorans LB400 and B. phymatum STM815 revealed that the BraI/R regulon is species specific, with exopolysaccharide production being the only common phenotype regulated by this system in the PBE cluster. In addition, BraI/R was shown not to be important for plant nodulation by B. phymatum strains or for endophytic colonization and growth promotion of maize by B. phytofirmans PsJN. PMID:23686262

Coutinho, Bruna G; Mitter, Birgit; Talbi, Chouhra; Sessitsch, Angela; Bedmar, Eulogio J; Halliday, Nigel; James, Euan K; Cámara, Miguel; Venturi, Vittorio

2013-07-01

342

The Streptococcus pyogenes serotype M49 Nra-Ralp3 transcriptional regulatory network and its control of virulence factor expression from the novel eno ralp3 epf sagA pathogenicity region.  

PubMed

Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known GAS growth phase-dependent regulatory network. PMID:17893125

Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O; Podbielski, Andreas

2007-12-01

343

Tagging mammalian transcription complexity  

Microsoft Academic Search

The nature of the 'transcriptome' is more complex than first realized. Although CAGE, various tagging technol- ogies and tiling arrays show that most of the mammalian genome is transcribed, a large proportion of transcripts do not encode proteins and are either poorly polyade- nylated, involved in sense-antisense pairs or never leave the nucleus. In this article, I review the various

Piero Carninci

2006-01-01

344

Transcriptional control: imprinting insulation.  

PubMed

Recent studies on the transcriptional regulation of two linked, imprinted genes, Igf2 and H19, have provided evidence for a novel mechanism of epigenetic control. DNA methylation controls the activity of an insulator element located between the two linked genes by regulating the binding of the zinc-finger protein CTCF. PMID:10873799

Wolffe, A P

2000-06-15

345

Transcription of Vowels.  

ERIC Educational Resources Information Center

This article addresses the special problems of transcribing vowels in the evaluation of speech samples. It reviews the International Phonetic Alphabet (IPA) symbols and diacritics for transcribing vowels and discusses their importance in the transcription of disordered speech and dialect variation. (Contains references.) (Author/DB)

Pollock, Karen E.; Berni, Mary C.

2001-01-01

346

Transcription factors in autoimmunity  

Microsoft Academic Search

The identification of two transcription factors that, when mutated, are responsible for severe autoimmune disease in humans is leading to a better understanding of the fundamental processes involved in T-cell tolerance. Both AIRE and FOXP3, identified initially via their association with genetically manipulated mice, are critically involved in tolerance induction in humans. Although mutations in these genes may cause rare

Fred Ramsdell; Steven F Ziegler

2003-01-01

347

Mapping Yeast Transcriptional Networks  

PubMed Central

The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms.

Hughes, Timothy R.; de Boer, Carl G.

2013-01-01

348

Phosphate concentration regulates transcription of the Acinetobacter polyhydroxyalkanoic acid biosynthetic genes.  

PubMed Central

The polyhydroxyalkanoic acid (PHA) biosynthetic gene locus was cloned and characterized from an Acinetobacter sp. isolated from activated sludge. Nucleotide sequence analysis identified three clustered genes, phaAAc (encoding a beta-ketothiolase), phaBAc (encoding an acetoacetyl coenzyme A reductase), and phaCAc (encoding a PHA synthase). In addition, an open reading frame (ORF1) with potential to encode a 13-kDa protein was identified within this locus. The sequence of the putative translational product of ORF1 does not show significant similarity to any sequences in the database. A plasmid containing the Acinetobacter pha locus conferred the ability to accumulate poly-beta-hydroxybutyrate on its Escherichia coli host. These genes appear to lie in an operon transcribed by two promoters upstream of phaBAc, an apparent constitutive promoter, and a second promoter induced by phosphate starvation and under pho regulon control. These as well as a number of additional potential transcription start points were identified by a combination of primer extension and promoter-chloramphenicol acetyltransferase gene fusion studies carried out in Acinetobacter or E. coli transformants.

Schembri, M A; Bayly, R C; Davies, J K

1995-01-01

349

Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment.  

PubMed

Little is known about the biochemical environment in phagosomes harboring an infectious agent. To assess the state of this organelle we captured the transcriptional responses of Mycobacterium tuberculosis (MTB) in macrophages from wild-type and nitric oxide (NO) synthase 2-deficient mice before and after immunologic activation. The intraphagosomal transcriptome was compared with the transcriptome of MTB in standard broth culture and during growth in diverse conditions designed to simulate features of the phagosomal environment. Genes expressed differentially as a consequence of intraphagosomal residence included an interferon gamma- and NO-induced response that intensifies an iron-scavenging program, converts the microbe from aerobic to anaerobic respiration, and induces a dormancy regulon. Induction of genes involved in the activation and beta-oxidation of fatty acids indicated that fatty acids furnish carbon and energy. Induction of sigmaE-dependent, sodium dodecyl sulfate-regulated genes and genes involved in mycolic acid modification pointed to damage and repair of the cell envelope. Sentinel genes within the intraphagosomal transcriptome were induced similarly by MTB in the lungs of mice. The microbial transcriptome thus served as a bioprobe of the MTB phagosomal environment, showing it to be nitrosative, oxidative, functionally hypoxic, carbohydrate poor, and capable of perturbing the pathogen's cell envelope. PMID:12953091

Schnappinger, Dirk; Ehrt, Sabine; Voskuil, Martin I; Liu, Yang; Mangan, Joseph A; Monahan, Irene M; Dolganov, Gregory; Efron, Brad; Butcher, Philip D; Nathan, Carl; Schoolnik, Gary K

2003-09-01

350

Analysis of transcriptional control of the gerD spore germination gene of Bacillus subtilis 168.  

PubMed Central

The gerD locus of Bacillus subtilis comprises a single gene whose function is essential for the germination of B. subtilis spores in media containing asparagine, glucose, and fructose. The expression of gerD has been characterized by using a chromosomal lacZ fusion to the gerD promoter. The promoter is switched on at the same time as the synthesis of glucose dehydrogenase, 2.5 h after sporulation has been initiated in the developing forespore. The gerD gene is not expressed in spoIIB or spoIIIA, -IIIB, -EIII, -FIII, or -IIIG mutants, but it is expressed in spoIIIC and -IIID and spoIVA mutant backgrounds. The in vivo transcriptional start point of the gene has been mapped by primer extension analysis, and sequences upstream from the start point show considerable homology with the promoter consensus sequences recognized by RNA polymerase containing the forespore-specific sigma factor sigma G (E sigma G). gerD is transcribed in vitro by E sigma G with a similar if not identical start point to that found in vivo, and expression of the gene can be rapidly induced in vegetative cells following the induction of sigma G synthesis. These results indicate that gerD is another member of the sigma G regulon, which includes a number of genes expressed only in the forespore compartment of sporulating cells of B. subtilis. Images

Kemp, E H; Sammons, R L; Moir, A; Sun, D; Setlow, P

1991-01-01

351

A large family of antivirulence regulators modulates the effects of transcriptional activators in Gram-negative pathogenic bacteria.  

PubMed

We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44-100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family. PMID:24875828

Santiago, Araceli E; Ruiz-Perez, Fernando; Jo, Noah Y; Vijayakumar, Vidhya; Gong, Mei Q; Nataro, James P

2014-05-01

352

Genome-wide analysis and expression profiling of the DREB transcription factor gene family in Malus under abiotic stress.  

PubMed

The dehydration responsive element binding (DREB) transcription factor family is one of the most promising regulons for genetic engineering of plant responses to abiotic stresses. However, knowledge about apple DREB genes is limited. In the present study, we found, for the first time, 68 MdDREB genes that could be further classified into six subgroups against the entire genome of apple. All putative proteins from those genes contained a typical APETALA 2 domain and shared similar motifs. The predicted MdDREBs were distributed with different densities over 12 chromosomes, with five tandem duplication sites occurring simultaneously. Both Genevestigator and expressed sequence tags were used for preliminary investigations of expression patterns. Results from quantitative real-time PCR showed that transcript levels of some putative MdDREB genes were up-regulated significantly under various abiotic-stress treatments, which indicated their vital roles during stress adaptation. Identifying these genes and profiling their expression provides useful information and constitutes a foundation for their further, practical utilization in apple through gene-transfer techniques. PMID:22526429

Zhao, Tao; Liang, Dong; Wang, Ping; Liu, Jingying; Ma, Fengwang

2012-05-01

353

RegPrecise web services interface: programmatic access to the transcriptional regulatory interactions in bacteria reconstructed by comparative genomics.  

PubMed

Web services application programming interface (API) was developed to provide a programmatic access to the regulatory interactions accumulated in the RegPrecise database (http://regprecise.lbl.gov), a core resource on transcriptional regulation for the microbial domain of the Department of Energy (DOE) Systems Biology Knowledgebase. RegPrecise captures and visualize regulogs, sets of genes controlled by orthologous regulators in several closely related bacterial genomes, that were reconstructed by comparative genomics. The current release of RegPrecise 2.0 includes >1400 regulogs controlled either by protein transcription factors or by conserved ribonucleic acid regulatory motifs in >250 genomes from 24 taxonomic groups of bacteria. The reference regulons accumulated in RegPrecise can serve as a basis for automatic annotation of regulatory interactions in newly sequenced genomes. The developed API provides an efficient access to the RegPrecise data by a comprehensive set of 14 web service resources. The RegPrecise web services API is freely accessible at http://regprecise.lbl.gov/RegPrecise/services.jsp with no login requirements. PMID:22700702

Novichkov, Pavel S; Brettin, Thomas S; Novichkova, Elena S; Dehal, Paramvir S; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A

2012-07-01

354

The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis  

PubMed Central

Efg1 (a member of the APSES family) is an important regulator of hyphal growth and of the white-to-opaque transition in Candida albicans and very closely related species. We show that in Candida parapsilosis?Efg1 is a major regulator of a different morphological switch at the colony level, from a concentric to smooth morphology. The rate of switching is at least 20-fold increased in an efg1 knockout relative to wild type. Efg1 deletion strains also have reduced biofilm formation, attenuated virulence in an insect model, and increased sensitivity to SDS and caspofungin. Biofilm reduction is more dramatic in in vitro than in in vivo models. An Efg1 paralogue (Efh1) is restricted to Candida species, and does not regulate concentric-smooth phenotype switching, biofilm formation or stress response. We used ChIP-seq to identify the Efg1 regulon. A total of 931 promoter regions bound by Efg1 are highly enriched for transcription factors and regulatory proteins. Efg1 also binds to its own promoter, and negatively regulates its expression. Efg1 targets are enriched in binding sites for 93 additional transcription factors, including Ndt80. Our analysis suggests that Efg1 has an ancient role as regulator of development in fungi, and is central to several regulatory networks.

Connolly, Leona A; Riccombeni, Alessandro; Grozer, Zsuzsana; Holland, Linda M; Lynch, Denise B; Andes, David R; Gacser, Attila; Butler, Geraldine

2013-01-01

355

Quorum sensing modulates transcription of cpsQ-mfpABC and mfpABC in Vibrio parahaemolyticus.  

PubMed

Vibrio parahaemolyticus AphA and OpaR are the two master regulators of quorum sensing (QS) that are abundantly produced and operate at low cell density (LCD) and high cell density (HCD), respectively, with an outcome of reciprocally gradient production of these two proteins with transition between LCD and HCD. The cpsQ-mfpABC gene cluster is transcribed as two operons cpsQ-mfpABC and mfpABC in V. parahaemolyticus. MfpABC is a putative membrane fusion transporter that contributes to biofilm development. CpsQ is a c-di-GMP-binding regulator that activates the expression of capsular polysaccharide genes and mfpABC and, thus, induces biofilm development. As shown in this study, OpaR and AphA bind to the promoter region of mfpABC to enhance and repress its transcription, respectively. In contrast, the positive and negative regulation of cpsQ-mfpABC by AphA and OpaR, respectively, achieves probably through acting of AphA or OpaR on additional unknown regulator(s) of cpsQ-mfpABC. The transcriptional levels of cpsQ-mfpABC and mfpABC enhance gradually with transition from LCD to HCD due to the above reciprocal regulatory action of OpaR and AphA. Data presented here present a novel paradigm of combined action of the two master QS regulators in controlling expression of the QS regulon members. PMID:24036587

Zhou, Dongsheng; Yan, Xiaojuan; Qu, Fen; Wang, Li; Zhang, Yiquan; Hou, Jun; Hu, Yan; Li, Jin; Xin, Shaojie; Qiu, Jingfu; Yang, Ruifu; Mao, Panyong

2013-09-16

356

The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis.  

PubMed

Efg1 (a member of the APSES family) is an important regulator of hyphal growth and of the white-to-opaque transition in Candida albicans and very closely related species. We show that in Candida parapsilosis?Efg1 is a major regulator of a different morphological switch at the colony level, from a concentric to smooth morphology. The rate of switching is at least 20-fold increased in an efg1 knockout relative to wild type. Efg1 deletion strains also have reduced biofilm formation, attenuated virulence in an insect model, and increased sensitivity to SDS and caspofungin. Biofilm reduction is more dramatic in in vitro than in in vivo models. An Efg1 paralogue (Efh1) is restricted to Candida species, and does not regulate concentric-smooth phenotype switching, biofilm formation or stress response. We used ChIP-seq to identify the Efg1 regulon. A total of 931 promoter regions bound by Efg1 are highly enriched for transcription factors and regulatory proteins. Efg1 also binds to its own promoter, and negatively regulates its expression. Efg1 targets are enriched in binding sites for 93 additional transcription factors, including Ndt80. Our analysis suggests that Efg1 has an ancient role as regulator of development in fungi, and is central to several regulatory networks. PMID:23895281

Connolly, Leona A; Riccombeni, Alessandro; Grózer, Zsuzsana; Holland, Linda M; Lynch, Denise B; Andes, David R; Gácser, Attila; Butler, Geraldine

2013-10-01

357

A Large Family of Antivirulence Regulators Modulates the Effects of Transcriptional Activators in Gram-negative Pathogenic Bacteria  

PubMed Central

We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44–100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family.

Santiago, Araceli E.; Ruiz-Perez, Fernando; Jo, Noah Y.; Vijayakumar, Vidhya; Gong, Mei Q.; Nataro, James P.

2014-01-01

358

Screening of transcription factors with transcriptional initiation activity.  

PubMed

A majority of mammalian promoters are associated with CpG islands. CpG island promoters frequently lack common core promoter elements, such as the TATA box, and often have dispersed transcription start sites. The mechanism through which CpG island promoters are transcriptionally initiated remains unclear. We speculate that some transcription factors can direct transcription initiation by themselves. To test this hypothesis, we screened a variety of transcription factors to see whether they could initiate transcription. Most transcription factors, including specificity protein 1 (Sp1) and nuclear factor Y (NF-Y), showed little transcriptional initiation activity. However, nuclear respiratory factor 1 (NRF-1), the basic helix-loop-helix/leucine zipper (bHLH/ZIP) family of proteins and the E-twenty six (Ets) family of proteins had strong transcriptional activity. We further demonstrated that these transcription factors initiate dispersed transcription. Our studies provide perspectives to the mechanism of transcription initiation from CpG island promoters. PMID:23933270

Zhang, Lang; Yu, Haoyue; Wang, Pan; Ding, Qingyang; Wang, Zhao

2013-11-15

359

Non-transcriptional regulatory processes shape transcriptional network dynamics  

PubMed Central

Preface Information about the extra- or intracellular environment is often captured as biochemical signals propagating through regulatory networks. These signals eventually drive phenotypic changes, typically by altering gene expression programs in the cell. Reconstruction of transcriptional regulatory networks has given a compelling picture of bacterial physiology, but transcriptional network maps alone often fail to describe phenotypes. In many cases, the dynamical performance of transcriptional regulatory networks depends on post-transcriptional or post-translational regulation and pleiotropic effects. Cellular response dynamics are ultimately determined by interactions between transcriptional and non-transcriptional networks with dramatic implications for physiology and evolution. Here, we provide an overview of non-transcriptional interactions that can affect the performance of natural and synthetic bacterial regulatory networks.

Ray, J. Christian J.; Tabor, Jeffrey J.; Igoshin, Oleg A.

2013-01-01