Science.gov

Sample records for apoptotic enzymes escape

  1. Evidence for genes associated with the ability of Mycobacterium avium subsp. hominissuis to escape apoptotic macrophages

    PubMed Central

    Bermudez, Luiz E.; Danelishvili, Lia; Babrack, Lmar; Pham, Tuan

    2015-01-01

    Mycobacterium avium subsp. hominissuis (MAH) is an environmental bacteria that infects immunocompromised humans. MAH cases are increasing in incidence, making it crucial to gain knowledge of the pathogenic mechanisms associated with the bacterium. MAH infects macrophages and after several days the infection triggers the phagocyte apoptosis. Many of the intracellular MAH escape the cell undergoing apoptosis leading to infection of neighboring macrophages. We screened a transposon bank of MAH mutants in U937 mononuclear phagocytes for the inability to escape macrophages undergoing apoptosis. Mutations in genes; MAV_2235, MAV_2120, MAV_2410, and MAV_4563 resulted in the inability of the bacteria to exit macrophages upon apoptosis. Complementation of the mutations corrected the phenotype either completely or partially. Testing for the ability of the mutants to survive in macrophages compared to the wild-type bacterium revealed that the mutant clones were not attenuated up to 4 days of infection. Testing in vivo, however, demonstrated that all the MAH clones were attenuated compared with the wild-type MAC 104 in tissues of mice. Although the mechanism associated with the bacterial inability to leave apoptotic macrophages is unknown, the identification of macrophage cytoplasm targets for the MAH proteins suggest that they interfere either with protein degradation machinery or post-translation mechanisms. The identification of tatC as a MAH protein involved in the ability of MAH to leave macrophages, suggests that secreted effector(s) are involved in the process. The study reveals a pathway of escape from macrophages, not shared with Mycobacterium tuberculosis. PMID:26380226

  2. Echinacoside induces apoptotic cancer cell death by inhibiting the nucleotide pool sanitizing enzyme MTH1

    PubMed Central

    Dong, Liwei; Wang, Hongge; Niu, Jiajing; Zou, Mingwei; Wu, Nuoting; Yu, Debin; Wang, Ye; Zou, Zhihua

    2015-01-01

    Inhibition of the nucleotide pool sanitizing enzyme MTH1 causes extensive oxidative DNA damages and apoptosis in cancer cells and hence may be used as an anticancer strategy. As natural products have been a rich source of medicinal chemicals, in the present study, we used the MTH1-catalyzed enzymatic reaction as a high-throughput in vitro screening assay to search for natural compounds capable of inhibiting MTH1. Echinacoside, a compound derived from the medicinal plants Cistanche and Echinacea, effectively inhibited the catalytic activity of MTH1 in an in vitro assay. Treatment of various human cancer cell lines with Echinacoside resulted in a significant increase in the cellular level of oxidized guanine (8-oxoguanine), while cellular reactive oxygen species level remained unchanged, indicating that Echinacoside also inhibited the activity of cellular MTH1. Consequently, Echinacoside treatment induced an immediate and dramatic increase in DNA damage markers and upregulation of the G1/S-CDK inhibitor p21, which were followed by marked apoptotic cell death and cell cycle arrest in cancer but not in noncancer cells. Taken together, these studies identified a natural compound as an MTH1 inhibitor and suggest that natural products can be an important source of anticancer agents. PMID:26677335

  3. Induced resistance enzymes in wild plants-do `early birds' escape from pathogen attack?

    NASA Astrophysics Data System (ADS)

    Heil, Martin; Ploss, Kerstin

    2006-09-01

    Systemic acquired resistance (SAR) of plants to pathogens is a well-defined phenomenon. The underlying signalling pathways and its application in crop protection are intensively studied. However, most studies are conducted on crop plants or on Arabidopsis as a model plant. The taxonomic distribution of this phenomenon and its dependence on life history are thus largely unknown. We quantified activities of three classes of resistance-related enzymes in 18 plant species to investigate whether plants with varying life histories differ in their investment in disease resistance. Enzyme activities were quantified in untreated plants, and in plants induced with BION, a chemical resistance elicitor. All species showed constitutive activities of chitinase, peroxidase, or glucanase. However, constitutive chitinase activities varied by 30 times, and peroxidase by 50 times, among species. Several species did not respond to the induction treatment, while enzyme activities in other species increased more than threefold after BION application. Plant species differ dramatically in the presence and inducibility of resistance enzymes. This variation could be related to life history: While all resistance enzymes were significantly induced in larger perennial plants that flower during summer, spring geophytes hardly showed inducible resistance. These plants grow in an environment that is characterised by a low-pathogen pressure, and thus may simply ‘escape’ from infection. Our study presents the first comparative data set on resistance-related enzymes in noncultivated plants. The current view on SAR—narrowed by the concentration on cultivated crops—is not sufficient to understand the ecological and evolutionary relevance of this widespread plant trait.

  4. A new insight into phagocytosis of apoptotic cells: proteolytic enzymes divert the recognition and clearance of polymorphonuclear leukocytes by macrophages.

    PubMed

    Guzik, K; Bzowska, M; Smagur, J; Krupa, O; Sieprawska, M; Travis, J; Potempa, J

    2007-01-01

    The recognition of phosphatidylserine (PS) on the surface of any apoptotic cell is considered to be a key event for its clearance. We challenge this concept by showing that pretreatment of neutrophils with either host or bacterial protease affects their uptake by human monocyte-derived macrophages without having an effect on cell-surface PS presentation. Specifically, whereas preincubation of apoptotic neutrophils with cathepsin G or thrombin significantly inhibited their uptake, gingipains R or clostripain enhanced phagocytosis by macrophages. Moreover, bacterial proteinases sensitized healthy neutrophils for uptake by macrophages, whereas endogenous proteinases were unable to elicit this effect. This stimulation was apparently owing to the combined effect of proteolytic cleavage of an antiphagocytic signal (CD31) and the generation of a novel 'eat-me' signal on the neutrophil surface. These results argue that neutrophil recognition and phagocytosis by macrophages is mediated by a protein ligand whose proteolytic modification could affect the local inflammatory process. PMID:16628232

  5. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  6. Enzyme

    MedlinePlus

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  7. Inhibition of ROS-induced apoptosis in endothelial cells by nitrone spin traps via induction of phase II enzymes and suppression of mitochondria-dependent pro-apoptotic signaling

    PubMed Central

    Das, Amlan; Gopalakrishnan, Bhavani; Voss, Oliver H.; Doseff, Andrea I.; Villamena, Frederick A.

    2012-01-01

    Oxidative stress is the main etiological factor behind the pathogenesis of various diseases including inflammation, cancer, cardiovascular and neurodegenerative disorders. Due to the spin trapping abilities and various pharmacological properties of nitrones, their application as therapeutic agent has been gaining attention. Though the antioxidant properties of the nitrones are well known, the mechanisms by which they modulate the cellular defense machinery against oxidative stress is not well investigated and requires further elucidation. Here, we have investigated the mechanisms of cytoprotection of the nitrone spin traps against oxidative stress in bovine aortic endothelial cells (BAEC). Cytoprotective properties of both the cyclic nitrone 5,5-dimethyl-pyrroline N-oxide (DMPO) and linear nitrone alpha-phenyl N-tert-butyl nitrone (PBN) against H2O2-induced cytoxicity were investigated. Preincubation of BAEC with PBN or DMPO resulted in the inhibition of H2O2–mediated cytotoxicity and apoptosis. Nitrone-treatment resulted in the induction and restoration of phase II antioxidant enzymes via nuclear translocation of NF-E2-related factor 2 (Nrf-2) in oxidatively-challenged cells. Furthermore, the nitrones were found to inhibit the mitochondrial depolarization and subsequent activation of caspase-3 induced by H2O2. Significant down-regulation of the pro-apoptotic proteins p53 and Bax, and up-regulation of the anti-apoptotic proteins Bcl-2 and p-Bad were observed when the cells were preincubated with the nitrones prior to H2O2–treatment. It was also observed that Nrf-2 silencing completely abolished the protective effects of nitrones. Hence, these findings suggest that nitrones confer protection to the endothelial cells against oxidative stress by modulating phase II antioxidant enzymes and subsequently inhibiting mitochondria-dependent apoptotic cascade. PMID:22580046

  8. Single oral acute fluoride exposure causes changes in cardiac expression of oxidant and antioxidant enzymes, apoptotic and necrotic markers in male rats.

    PubMed

    Panneerselvam, Lakshmikanthan; Govindarajan, Vimal; Ameeramja, Jaishabanu; Nair, Harikumaran Raveendran; Perumal, Ekambaram

    2015-12-01

    Several studies have shown that acute fluoride (F(-)) exposure impairs cardiac function, but the molecular mechanism is not clear. In order to study this, male Wistar rats were treated with single oral doses of 45 and 90 mg/kg F(-) for 24 h. A significant accumulation of F(-) was found in the serum and myocardium of experimental rats. F(-) treatment causes myocardial necrosis as evident from increased levels of myocardial troponin I, creatine kinase, lactate dehydrogenase and aspartate transaminase. In addition, F(-) induces myocardial oxidative stress via increased reactive oxygen species, lipid peroxidation, protein carbonyl content and nitrate levels along with decreased in the levels of enzymatic (superoxide dismutase 2, catalase, glutathione peroxidase and glutathione s transferase pi class) and non-enzymatic (reduced glutathione) antioxidants. Notably, F(-) triggers myocardial apoptosis through altered Bax/Bcl2 ratio and increased cytochrome c, caspase 3p20 and terminal deoxynucleotidyl transferase dUTP nick end labeled positive cells. An increased cardiac expression of Nox4 and p38α MAPK in F(-) treated rats indicates the oxidative and apoptotic damage. Moreover, ultra-structural changes, histopathological and luxol fast blue staining demonstrates the degree of myocardial damage at subcellular level. Taken together, these findings reveal that acute F(-) exposure causes cardiac impairment by altering the expression of oxidative stress, apoptosis and necrotic markers. PMID:26455266

  9. Biochemical identification of a neutral sphingomyelinase 1 (NSM1)-like enzyme as the major NSM activity in the DT40 B-cell line: absence of a role in the apoptotic response to endoplasmic reticulum stress.

    PubMed Central

    Fensome, Amanda C; Josephs, Michelle; Katan, Matilda; Rodrigues-Lima, Fernando

    2002-01-01

    DT40 cells have approx. 10-fold higher Mg2+-dependent neutral sphingomyelinase (NSM) activity in comparison with other B-cell lines and contain very low acidic sphingomyelinase activity. Purification of this activity from DT40 cell membranes suggested the presence of one major NSM isoform. Although complete purification of this isoform could not be achieved, partially purified fractions were examined further with regard to the known characteristics of previously partially purified NSMs and the two cloned enzymes exhibiting in vitro NSM activity (NSM1 and NSM2). For a direct comparative study, highly purified brain preparations, purified NSM1 protein and Bacillus cereus enzyme were used. Analysis of the enzymic properties of the partially purified DT40 NSM, such as cation dependence, substrate specificity, redox regulation and stimulation by phosphatidylserine, together with the localization of this enzyme to the endoplasmic reticulum (ER), suggested that this NSM from DT40 cells corresponds to NSM1. Further studies aimed to correlate presence of the high levels of this NSM1-like activity in DT40 cells with the ability of these cells to accumulate ceramide and undergo apoptosis. When DT40 cells were stimulated to apoptose by a variety of agents, including the ER stress, an increase in endogenous ceramide levels was observed. However, these responses were not enhanced compared with another B-cell line (Nalm-6), characterized by low sphingomyelinase activity. In addition, DT40 cells were not more susceptible to ceramide accumulation and apoptosis when exposed to the ER stress compared with other apoptotic agents. Inhibition of de novo synthesis of ceramide partially inhibited its accumulation, indicating that the ceramide production in DT40 cells could be complex and, under some conditions, could involve both sphingomyelin hydrolysis and ceramide synthesis. PMID:12071841

  10. In the absence of cellular poly (A) binding protein, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53

    SciTech Connect

    Thangima Zannat, Mst.; Bhattacharjee, Rumpa B.; Bag, Jnanankur

    2011-06-03

    Highlights: {yields} PABP knock down and cell apoptosis. {yields} Nuclear translocation of GAPDH in PABP depleted cells. {yields} Role of p53 in apoptosis of PABP depleted cells. {yields} Bax translocation and cytochrome C release and caspase 3 activation following PABP depletion. {yields} Association of p53 with Bcl2 and Bax. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) interacts with 3' poly (A) tract of eukaryotic mRNA and is important for both translation and stability of mRNA. Previously, we have shown that depletion of PABP by siRNA prevents protein synthesis and consequently leads to cell death through apoptosis. In the present investigation, we studied the mechanism of cell apoptosis. We show that in the absence of PABP, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53. As a result, p53 translocated to the mitochondria to initiate Bax mediated apoptosis.

  11. Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis.

    PubMed

    Nath, R; Raser, K J; Stafford, D; Hajimohammadreza, I; Posner, A; Allen, H; Talanian, R V; Yuen, P; Gilbertsen, R B; Wang, K K

    1996-11-01

    The cytoskeletal protein non-erythroid alpha-spectrin is well documented as an endogenous calpain substrate, especially under pathophysiological conditions. In cell necrosis (e.g. maitotoxin-treated neuroblastoma SH-SY5Y cells), alpha-spectrin breakdown products (SBDPs) of 150 kDa and 145 kDa were produced by cellular calpains. In contrast, in neuronal cells undergoing apoptosis (cerebellar granule neurons subjected to low potassium and SH-SY5Y cells treated with staurosporine), an additional SBDP of 120 kDa was also observed. The formation of the 120 kDa SBDP was insensitive to calpain inhibitors but was completely blocked by an interleukin 1 beta-converting-enzyme (ICE)-like protease inhibitor, Z-Asp-CH2OC(O)-2,6-dichlorobenzene. Autolytic activation of both calpain and the ICE homologue CPP32 was also observed in apoptotic cells. alpha-Spectrin can also be cleaved in vitro by purified calpains to produce the SBDP doublet of 150/145 kDa and by ICE and ICE homologues [ICH-1, ICH-2 and CPP32(beta)] to produce a 150 kDa SBDP. In addition, CPP32 and ICE also produced a 120 kDa SBDP. Furthermore inhibition of either ICE-like protease(s) or calpain protects both granule neurons and SH-SY5Y cells against apoptosis. Our results suggest that both protease families participate in the expression of neuronal apoptosis. PMID:8920967

  12. The great escape

    PubMed Central

    Sin, Ho-Su; Namekawa, Satoshi H

    2013-01-01

    Epigenetic mechanisms precisely regulate sex chromosome inactivation as well as genes that escape the silencing process. In male germ cells, DNA damage response factor RNF8 establishes active epigenetic modifications on the silent sex chromosomes during meiosis, and activates escape genes during a state of sex chromosome-wide silencing in postmeiotic spermatids. During the course of evolution, the gene content of escape genes in postmeiotic spermatids recently diverged on the sex chromosomes. This evolutionary feature mirrors the epigenetic processes of sex chromosomes in germ cells. In this article, we describe how epigenetic processes have helped to shape the evolution of sex chromosome-linked genes. Furthermore, we compare features of escape genes on sex chromosomes in male germ cells to escape genes located on the single X chromosome silenced during X-inactivation in females, clarifying the distinct evolutionary implications between male and female escape genes. PMID:23880818

  13. Crew Escape Certification Test

    NASA Technical Reports Server (NTRS)

    1988-01-01

    This video tape shows the Shuttle hatch jettison test at Rockwell facilities. The video also shows a Shuttle escape pole deployment test from a NASA aircraft, and an emergency egress test performed by a volunteer Navy parachutist using the pole and a parachute escape system.

  14. Dust escape from Io

    NASA Astrophysics Data System (ADS)

    Flandes, Alberto

    2004-08-01

    The Dust ballerina skirt is a set of well defined streams composed of nanometric sized dust particles that escape from the Jovian system and may be accelerated up to >=200 km/s. The source of this dust is Jupiter's moon Io, the most volcanically active body in the Solar system. The escape of dust grains from Jupiter requires first the escape of these grains from Io. This work is basically devoted to explain this escape given that the driving of dust particles to great heights and later injection into the ionosphere of Io may give the particles an equilibrium potential that allow the magnetic field to accelerate them away from Io. The grain sizes obtained through this study match very well to the values required for the particles to escape from the Jovian system.

  15. THERMALLY DRIVEN ATMOSPHERIC ESCAPE

    SciTech Connect

    Johnson, Robert E.

    2010-06-20

    Accurately determining the escape rate from a planet's atmosphere is critical for determining its evolution. A large amount of Cassini data is now available for Titan's upper atmosphere and a wealth of data is expected within the next decade on escape from Pluto, Mars, and extra-solar planets. Escape can be driven by upward thermal conduction of energy deposited well below the exobase, as well as by nonthermal processes produced by energy deposited in the exobase region. Recent applications of a model for escape driven by upward thermal conduction, called the slow hydrodynamic escape model, have resulted in surprisingly large loss rates for the atmosphere of Titan, Saturn's largest moon. Based on a molecular kinetic simulation of the exobase region, these rates appear to be orders of magnitude too large. Therefore, the slow hydrodynamic model is evaluated here. It is shown that such a model cannot give a reliable description of the atmospheric temperature profile unless it is coupled to a molecular kinetic description of the exobase region. Therefore, the present escape rates for Titan and Pluto must be re-evaluated using the atmospheric model described here.

  16. Escape behaviors in insects.

    PubMed

    Card, Gwyneth M

    2012-04-01

    Escape behaviors are, by necessity, fast and robust, making them excellent systems with which to study the neural basis of behavior. This is especially true in insects, which have comparatively tractable nervous systems and members who are amenable to manipulation with genetic tools. Recent technical developments in high-speed video reveal that, despite their short duration, insect escape behaviors are more complex than previously appreciated. For example, before initiating an escape jump, a fly performs sophisticated posture and stimulus-dependent preparatory leg movements that enable it to jump away from a looming threat. This newfound flexibility raises the question of how the nervous system generates a behavior that is both rapid and flexible. Recordings from the cricket nervous system suggest that synchrony between the activity of specific interneuron pairs may provide a rapid cue for the cricket to detect the direction of an approaching predator and thus which direction it should run. Technical advances make possible wireless recording from neurons while locusts escape from a looming threat, enabling, for the first time, a direct correlation between the activity of multiple neurons and the time-course of an insect escape behavior. PMID:22226514

  17. Escape and rescue model

    NASA Astrophysics Data System (ADS)

    Alvord, D.; Nelson, H. E.

    The Escape and Rescue model is a discrete-event simulation program written in Simscript. It was developed to simulate the emergency movement involved in escape and/or rescue of people from a Board and Care Home housing a group of persons with varying degrees of physical or mental disabilities along with a small live-in staff. It may, however, be used in a much more general setting. It can reasonably handle a building with up to 100 residents and 100 rooms.

  18. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis

    PubMed Central

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia; Erler, Silvio; Kryger, Per; Lewkowski, Oleg; Müller, Thomas; Widder, Miriam; Moritz, Robin F. A.

    2015-01-01

    Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host’s apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap)-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion. PMID:26445372

  19. Spacecraft Escape Capsule

    NASA Technical Reports Server (NTRS)

    Robertson, Edward A.; Charles, Dingell W.; Bufkin, Ann L.; Rodriggs, Liana M.; Peterson, Wayne; Cuthbert, Peter; Lee, David E.; Westhelle, Carlos

    2006-01-01

    A report discusses the Gumdrop capsule a conceptual spacecraft that would enable the crew to escape safely in the event of a major equipment failure at any time from launch through atmospheric re-entry. The scaleable Gumdrop capsule would comprise a command module (CM), a service module (SM), and a crew escape system (CES). The CM would contain a pressurized crew environment that would include avionic, life-support, thermal control, propulsive attitude control, and recovery systems. The SM would provide the primary propulsion and would also supply electrical power, life-support resources, and active thermal control to the CM. The CES would include a solid rocket motor, embedded within the SM, for pushing the CM away from the SM in the event of a critical thermal-protection-system failure or loss of control. The CM and SM would normally remain integrated with each other from launch through recovery, but could be separated using the CES, if necessary, to enable the safe recovery of the crew in the CM. The crew escape motor could be used, alternatively, as a redundant means of de-orbit propulsion for the CM in the event of a major system failure in the SM.

  20. Advanced Crew Escape Suit.

    PubMed

    1995-09-01

    Design of the S1032 Launch Entry Suit (LES) began following the Challenger loss and NASA's decision to incorporate a Shuttle crew escape system. The LES (see Figure 1) has successfully supported Shuttle missions since NASA's Return to Flight with STS-26 in September 1988. In 1990, engineers began developing the S1035 Advanced Crew Escape Suit (ACES) to serve as a replacement for the LES. The ACES was designed to be a simplified, lightweight, low-bulk pressure suit which aided self donning/doffing, provided improved comfort, and enhanced overall performance to reduce crew member stress and fatigue. Favorable crew member evaluations of a prototype led to full-scale development and qualification of the S1035 ACES between 1990 and 1992. Production of the S1035 ACES began in February 1993, with the first unit delivered to NASA in May 1994. The S1035 ACES first flew aboard STS-68 in August 1994 and will become the primary crew escape suit when the S1032 LES ends its service life in late 1995. The primary goal of the S1035 development program was to provide improved performance over that of the S1032 to minimize the stress and fatigue typically experienced by crew members. To achieve this, five fundamental design objectives were established, resulting in various material/configuration changes. PMID:11540717

  1. Orbiter escape pole

    NASA Technical Reports Server (NTRS)

    Goodrich, Winston D. (Inventor); Wesselski, Clarence J. (Inventor); Pelischek, Timothy E. (Inventor); Becker, Bruce H. (Inventor); Kahn, Jon B. (Inventor); Grimaldi, Margaret E. (Inventor); McManamen, John P. (Inventor); Castro, Edgar O. (Inventor)

    1989-01-01

    A Shuttle type of aircraft (10) with an escape hatch (12) has an arcuately shaped pole housing (16) attachable to an interior wall and ceiling with its open end adjacent to the escape hatch. The pole housing 16 contains a telescopically arranged and arcuately shaped primary pole member (22) and extension pole member (23) which are guided by roller assemblies (30,35). The extension pole member (23) is slidable and extendable relative to the primary pole member (22). For actuation, a spring actuated system includes a spring (52) in the pole housing. A locking member (90) engages both pole members (22,23) through notch portions (85,86) in the pole members. The locking member selectively releases the extension pole member (23) and the primary pole member (22). An internal one-way clutch or anti-return mechanism prevents retraction of the extension pole member from an extended position. Shock absorbers (54)(150,152) are for absoring the energy of the springs. A manual backup deployment system is provided which includes a canted ring (104) biased by a spring member (108). A lever member (100) with a slot and pin connection (102) permits the mechanical manipulation of the canted ring to move the primary pole member. The ring (104) also prevents retraction of the main pole. The crew escape mechanism includes a magazine (60) and a number of lanyards (62), each lanyard being mounted by a roller loop (68) over the primary pole member (22). The strap on the roller loop has stitching for controlled release, a protection sheath (74) to prevent tangling and a hook member (69) for attachment to a crew harness.

  2. Inhibitors of apoptotic proteins: new targets for anticancer therapy.

    PubMed

    Saleem, Mohammad; Qadir, Muhammad Imran; Perveen, Nadia; Ahmad, Bashir; Saleem, Uzma; Irshad, Tehseen; Ahmad, Bashir

    2013-09-01

    Inhibitors of apoptotic proteins (IAPs) can play an important role in inhibiting apoptosis by exerting their negative action on caspases (apoptotic proteins). There are eight proteins in this family: NAIP/BIRC1/NLRB, cellular IAP1 (cIAP1)/human IAP2/BIRC2, cellular IAP2 (cIAP2)/human IAP1/BIRC3, X-linked IAP (XIAP)/BIRC4, survivin/BIRC5, baculoviral IAP repeat (BIR)-containing ubiquitin-conjugating enzyme/apollon/BIRC6, livin/melanoma-IAP (ML-IAP)/BIRC7/KIAP, and testis-specific IAP (Ts-IAP)/hILP-2/BIRC8. Deregulation of these inhibitors of apoptotic proteins (IAPs) may push cell toward cancer and neurodegenerative disorders. Inhibitors of apoptotic proteins (IAPs) may provide new target for anticancer therapy. Drugs may be developed that are inhibiting these IAPs to induce apoptosis in cancerous cells. PMID:23790005

  3. Endosomal escape: a bottleneck in intracellular delivery.

    PubMed

    Shete, Harshad K; Prabhu, Rashmi H; Patravale, Vandana B

    2014-01-01

    With advances in therapeutic science, apart from drugs, newer bioactive moieties like oligonucleotides, proteins, peptides, enzymes and antibodies are constantly being introduced for the betterment of therapeutic efficacy. These moieties have intracellular components of the cells like cytoplasm and nucleus as one of their pharmacological sites for exhibiting therapeutic activity. Despite their promising efficacy, their intracellular bioavailability has been critically hampered leading to failure in the treatment of numerous diseases and disorders. The endosomal uptake pathway is known to be a rate-limiting barrier for such systems. Bioactive molecules get trapped in the endosomal vesicles and degraded in the lysosomal compartment, necessitating the need for effective strategies that facilitate the endosomal escape and enhance the cytosolic bioavailability of bioactives. Microbes like viruses and bacteria have developed their innate mechanistic tactics to translocate their genome and toxins by efficiently penetrating the host cell membrane. Understanding this mechanism and exploring it further for intracellular delivery has opened new avenues to surmount the endosomal barrier. These strategies include membrane fusion, pore formation and proton sponge effects. On the other hand, progress in designing a novel smart polymeric carrier system that triggers endosomal escape by undergoing modulations in the intracellular milieu has further led to an improvement in intracellular delivery. These comprise pH, enzyme and temperature-induced modulators, synthetic cationic lipids and photo-induced physical disruption. Each of the aforementioned strategies has its own unique mechanism to escape the endosome. This review recapitulates the numerous strategies designed to surmount the bottleneck of endosomal escape and thereby achieve successful intracellular uptake of bioactives. PMID:24730275

  4. [Sphingolipid-mediated apoptotic signaling pathways].

    PubMed

    Cuvillier, Olivier; Andrieu-Abadie, Nathalie; Ségui, Bruno; Malagarie-Cazenave, Sophie; Tardy, Claudine; Bonhoure, Elisabeth; Levade, Thierry

    2003-01-01

    Various sphingolipids are being viewed as bioactive molecules and/or second messengers. Among them, ceramide (or N-acylsphingosine) and sphingosine generally behave as pro-apoptotic mediators. Indeed, ceramide mediates the death signal initiated by numerous stress agents which either stimulate its de novo synthesis or activate sphingomyelinases that release ceramide from sphingomyelin. For instance, the early generation of ceramide promoted by TNF is mediated by a neutral sphingomyelinase the activity of which is regulated by the FAN adaptor protein, thereby controlling caspase activation and the cell death programme. In addition, the activity of this neutral sphingomyelinase is negatively modulated by caveolin, a major constituent of some membrane microdomains. The enzyme sphingosine kinase also plays a crucial role in apoptosis signalling by regulating the intracellular levels of two sphingolipids having opposite effects, namely the pro-apoptotic sphingosine and the anti-apoptotic sphingosine 1-phosphate molecule. Ceramide and sphingosine metabolism therefore appears as a pivotal regulatory pathway in the determination of cell fate. PMID:14708343

  5. Reconstructing the Alcatraz escape

    NASA Astrophysics Data System (ADS)

    Baart, F.; Hoes, O.; Hut, R.; Donchyts, G.; van Leeuwen, E.

    2014-12-01

    In the night of June 12, 1962 three inmates used a raft made of raincoatsto escaped the ultimate maximum security prison island Alcatraz in SanFrancisco, United States. History is unclear about what happened tothe escapees. At what time did they step into the water, did theysurvive, if so, where did they reach land? The fate of the escapees has been the subject of much debate: did theymake landfall on Angel Island, or did the current sweep them out ofthe bay and into the cold pacific ocean? In this presentation, we try to shed light on this historic case using avisualization of a high-resolution hydrodynamic simulation of the San Francisco Bay, combined with historical tidal records. By reconstructing the hydrodynamic conditions and using a particle based simulation of the escapees we show possible scenarios. The interactive model is visualized using both a 3D photorealistic and web based visualization. The "Escape from Alcatraz" scenario demonstrates the capabilities of the 3Di platform. This platform is normally used for overland flooding (1D/2D). The model engine uses a quad tree structure, resulting in an order of magnitude speedup. The subgrid approach takes detailed bathymetry information into account. The inter-model variability is tested by comparing the results with the DFlow Flexible Mesh (DFlowFM) San Francisco Bay model. Interactivity is implemented by converting the models from static programs to interactive libraries, adhering to the Basic ModelInterface (BMI). Interactive models are more suitable for answeringexploratory research questions such as this reconstruction effort. Although these hydrodynamic simulations only provide circumstantialevidence for solving the mystery of what happened during the foggy darknight of June 12, 1962, it can be used as a guidance and provides aninteresting testcase to apply interactive modelling.

  6. THERMALLY DRIVEN ATMOSPHERIC ESCAPE: TRANSITION FROM HYDRODYNAMIC TO JEANS ESCAPE

    SciTech Connect

    Volkov, Alexey N.; Johnson, Robert E.; Tucker, Orenthal J.; Erwin, Justin T.

    2011-03-10

    Thermally driven escape from planetary atmospheres changes in nature from an organized outflow (hydrodynamic escape) to escape on a molecule-by-molecule basis (Jeans escape) with increasing Jeans parameter, {lambda}, the ratio of the gravitational to thermal energy of the atmospheric molecules. This change is described here for the first time using the direct simulation Monte Carlo method. When heating is predominantly below the lower boundary of the simulation region, R{sub 0}, and well below the exobase of a single-component atmosphere, the nature of the escape process changes over a surprisingly narrow range of Jeans parameters, {lambda}{sub 0}, evaluated at R{sub 0}. For an atomic gas, the transition occurs over {lambda}{sub 0} {approx} 2-3, where the lower bound, {lambda}{sub 0} {approx} 2.1, corresponds to the upper limit for isentropic, supersonic outflow. For {lambda}{sub 0} > 3 escape occurs on a molecule-by-molecule basis and we show that, contrary to earlier suggestions, for {lambda}{sub 0} > {approx}6 the escape rate does not deviate significantly from the familiar Jeans rate. In a gas composed of diatomic molecules, the transition shifts to {lambda}{sub 0} {approx} 2.4-3.6 and at {lambda}{sub 0} > {approx}4 the escape rate increases a few tens of percent over that for the monatomic gas. Scaling by the Jeans parameter and the Knudsen number, these results can be applied to thermally induced escape of the major species from solar and extrasolar planets.

  7. Escape from Vela X

    SciTech Connect

    Hinton, J.; Funk, S.; Parsons, R.D.; Ohm, S.; /Leicester U. /Leeds U.

    2012-02-15

    While the Vela pulsar and its associated nebula are often considered as the archetype of a system powered by a {approx} 10{sup 4} year old isolated neutron star, many features of the spectral energy distribution of this pulsar wind nebula are both puzzling and unusual. Here we develop a model that for the first time relates the main structures in the system, the extended radio nebula (ERN) and the X-ray cocoon through continuous injection of particles with a fixed spectral shape. We argue that diffusive escape of particles from the ERN can explain the steep Fermi-LAT spectrum. In this scenario Vela X should produce a distinct feature in the locally-measured cosmic ray electron spectrum at very high energies. This prediction can be tested in the future using the Cherenkov Telescope Array (CTA). If particles are indeed released early in the evolution of PWNe and can avoid severe adiabatic losses, PWN provide a natural explanation for the rising positron fraction in the local CR spectrum.

  8. An escape from crowding.

    PubMed

    Freeman, Jeremy; Pelli, Denis G

    2007-01-01

    Crowding occurs when nearby flankers jumble the appearance of a target object, making it hard to identify. Crowding is feature integration over an inappropriately large region. What determines the size of that region? According to bottom-up proposals, the size is that of an anatomically determined isolation field. According to top-down proposals, the size is that of the spotlight of attention. Intriligator and Cavanagh (2001) proposed the latter, but we show that their conclusion rests on an implausible assumption. Here we investigate the role of attention in crowding using the change blindness paradigm. We measure capacity for widely and narrowly spaced letters during a change detection task, both with and without an interstimulus cue. We find that standard crowding manipulations-reducing spacing and adding flankers-severely impair uncued change detection but have no effect on cued change detection. Because crowded letters look less familiar, we must use longer internal descriptions (less compact representations) to remember them. Thus, fewer fit into working memory. The memory limit does not apply to the cued condition because the observer need remember only the cued letter. Cued performance escapes the effects of crowding, as predicted by a top-down account. However, our most parsimonious account of the results is bottom-up: Cued change detection is so easy that the observer can tolerate feature degradation and letter distortion, making the observer immune to crowding. The change detection task enhances the classic partial report paradigm by making the test easier (same/different instead of identifying one of many possible targets), which increases its sensitivity, so it can reveal degraded memory traces. PMID:18217837

  9. Suicide as Escape from Self.

    ERIC Educational Resources Information Center

    Baumeister, Roy F.

    1990-01-01

    Suicide is analyzed as a motivation to escape from adversive self-awareness. The causal chain is traced from initial failures that are attributed internally because of a cognitively deconstructed state. (SLD)

  10. Immunosuppressive effects of apoptotic cells

    NASA Astrophysics Data System (ADS)

    Voll, Reinhard E.; Herrmann, Martin; Roth, Edith A.; Stach, Christian; Kalden, Joachim R.; Girkontaite, Irute

    1997-11-01

    Apoptotic cell death is important in the development and homeostasis of multicellular organisms and is a highly controlled means of eliminating dangerous, damaged or unnecessary cells without causing an inflammatory response or tissue damage,. We now show that the presence of apoptotic cells during monocyte activation increases their secretion of the anti-inflammatory and immunoregulatory cytokine interleukin 10 (IL-10) and decreases secretion of the proinflammatory cytokines tumour necrosis factor-α (TNF-α), IL-1 and IL-12. This may inhibit inflammation and contribute to impaired cell-mediated immunity in conditions associated with increased apoptosis, such as viral infections, pregnancy, cancer and exposure to radiation.

  11. Plasma Escape from Unmagnetized Bodies

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Grebowsky, J. M.; Intriligator, D. S.

    1998-01-01

    A considerable fraction of atmospheric loss at Venus and Titan is in the form of plasma escape. This is due in part to the fact that the ionospheres of these unmagnetized bodies interact directly with the high speed plasmas flowing around them. The similarities of the interactions help reinforce interpretations of measurements made at each body, especially when instruments and measurement sites differ. For example, it is well established through this method that ions born in the exospheres above the ionopauses are picked up and carried away by the solar wind at Venus and the rotating plasma in Saturn's magnetosphere. On the other hand, it is more difficult to relate the observations associated with escape of cooler ionospheric plasma down the ionotails of each body. A clear example of ionospheric plasma escaping Titan was observed as it flowed down its ionotail (1). Measurements at Venus have not as yet clearly distinguished between ionospheric and pickup ion escape in the ionotail; however, cold ions detected in the distant wake at 1 AU by the CELIAS/CTOF instrument on SOHO have been interpreted as ionospheric in origin (2). An algorithm to determine ionospheric flow from Pioneer Venus aeronomical measurements is used to show that escape of cold ionospheric plasma is likely to occur. These results along with plasma flow measurements made in the ionotail of Venus are combined and compared to the corresponding flow at Titan.

  12. Viral escape from antisense RNA.

    PubMed

    Bull, J J; Jacobson, A; Badgett, M R; Molineux, I J

    1998-05-01

    RNA coliphage SP was propagated for several generations on a host expressing an inhibitory antisense RNA complementary to bases 31-270 of the positive-stranded genome. Phages evolved that escaped inhibition. Typically, these escape mutants contained 3-4 base substitutions, but different sequences were observed among different isolates. The mutations were located within three different types of structural features within the predicted secondary structure of SP genomic RNA: (i) hairpin loops; (ii) hairpin stems; and (iii) the 5' region of the phage genome complementary to the antisense molecule. Computer modelling of the mutant genomic RNAs showed that all of the substitutions within hairpin stems improved the Watson-Crick pairing of the stem. No major structural rearrangements were predicted for any of the mutant genomes, and most substitutions in coding regions did not alter the amino acid sequence. Although the evolved phage populations were polymorphic for substitutions, many substitutions appeared independently in two selected lines. The creation of a new, perfect, antisense RNA against an escape mutant resulted in the inhibition of that mutant but not of other escape mutants nor of the ancestral, unevolved phage. Thus, at least in this system, a population of viruses that evolved to escape from a single antisense RNA would require a cocktail of several antisense RNAs for inhibition. PMID:9643550

  13. Collective Predation and Escape Strategies

    NASA Astrophysics Data System (ADS)

    Angelani, Luca

    2012-09-01

    The phenomenon of collective predation is analyzed by using a simple individual-based model reproducing spatial animal movements. Two groups of self-propelled organisms are simulated by using Vicseklike models including steric intragroup repulsion. Chase and escape are described by intergroups interactions, attraction (for predators) or repulsion (for preys) from nearest particles of the opposite group. The quantitative analysis of some relevant quantities (total catch time, lifetime distribution, predation rate) allows us to characterize many aspects of the predation phenomenon and gives insights into the study of efficient escape strategies. The reported findings could be of relevance for many basic and applied disciplines, from statistical physics, to ecology, and robotics.

  14. Automated Escape Guidance Algorithms for An Escape Vehicle

    NASA Technical Reports Server (NTRS)

    Flanary, Ronald; Hammen, David; Ito, Daigoro; Rabalais, Bruce; Rishikof, Brian; Siebold, Karl

    2002-01-01

    An escape vehicle was designed to provide an emergency evacuation for crew members living on a space station. For maximum escape capability, the escape vehicle needs to have the ability to safely evacuate a station in a contingency scenario such as an uncontrolled (e.g., tumbling) station. This emergency escape sequence will typically be divided into three events: The fust separation event (SEP1), the navigation reconstruction event, and the second separation event (SEP2). SEP1 is responsible for taking the spacecraft from its docking port to a distance greater than the maximum radius of the rotating station. The navigation reconstruction event takes place prior to the SEP2 event and establishes the orbital state to within the tolerance limits necessary for SEP2. The SEP2 event calculates and performs an avoidance burn to prevent station recontact during the next several orbits. This paper presents the tools and results for the whole separation sequence with an emphasis on the two separation events. The fust challenge includes collision avoidance during the escape sequence while the station is in an uncontrolled rotational state, with rotation rates of up to 2 degrees per second. The task of avoiding a collision may require the use of the Vehicle's de-orbit propulsion system for maximum thrust and minimum dwell time within the vicinity of the station vicinity. The thrust of the propulsion system is in a single direction, and can be controlled only by the attitude of the spacecraft. Escape algorithms based on a look-up table or analytical guidance can be implemented since the rotation rate and the angular momentum vector can be sensed onboard and a-priori knowledge of the position and relative orientation are available. In addition, crew intervention has been provided for in the event of unforeseen obstacles in the escape path. The purpose of the SEP2 burn is to avoid re-contact with the station over an extended period of time. Performing this maneuver properly

  15. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  16. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  17. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  18. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  19. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  20. Lise Meitner's escape from Germany

    NASA Astrophysics Data System (ADS)

    Sime, Ruth Lewin

    1990-03-01

    Lise Meitner (1878-1968) achieved prominence as a nuclear physicist in Germany; although of Jewish origin, her Austrian citizenship exempted her from Nazi racial laws until the annexation of Austria in 1938 precipitated her dismissal. Forbidden to emigrate, she narrowly escaped to the Netherlands with the help of concerned friends in the international physics community.

  1. Mechanisms of Ionospheric Mass Escape

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Khazanov, G. V.

    2010-01-01

    The dependence of ionospheric O+ escape flux on electromagnetic energy flux and electron precipitation into the ionosphere is derived for a hypothetical ambipolar pick-up process, powered the relative motion of plasmas and neutral upper atmosphere, and by electron precipitation, at heights where the ions are magnetized but influenced by photo-ionization, collisions with gas atoms, ambipolar and centrifugal acceleration. Ion pick-up by the convection electric field produces "ring-beam" or toroidal velocity distributions, as inferred from direct plasma measurements, from observations of the associated waves, and from the spectra of incoherent radar echoes. Ring-beams are unstable to plasma wave growth, resulting in rapid relaxation via transverse velocity diffusion, into transversely accelerated ion populations. Ion escape is substantially facilitated by the ambipolar potential, but is only weakly affected by centrifugal acceleration. If, as cited simulations suggest, ion ring beams relax into non-thermal velocity distributions with characteristic speed equal to the local ion-neutral flow speed, a generalized "Jeans escape" calculation shows that the escape flux of ionospheric O+ increases with Poynting flux and with precipitating electron density in rough agreement with observations.

  2. Lunar escape systems feasibility study

    NASA Technical Reports Server (NTRS)

    Matzenauer, J. O.

    1976-01-01

    Results are presented for a study conducted to determine the feasibility of simple lunar escape system concepts, to develop a spectrum of operational data, and to identify techniques and configurations suitable for the emergency escape mission. The study demonstrated the feasibility of the lunar emergency escape-to-orbit system (LESS) designed to provide a means for the two-man crew of a lunar module (LM) or extended-stay LM (ELM) to escape from the lunar surface in the event that the LM/ELM ascent stage becomes unsafe or is otherwise unable to take off. The LESS is to carry the two astronauts to a safe lunar orbit, where the Apollo command and service modules (CSM) are to be used for rendezvous and rescue, all within the lifetime of the backpack life support system (about 4 hr). It is concluded that simple manual control modes are sufficient, that simple boost profiles are acceptable, and that one man can deploy and set up the LESS. Initial guidance data can be calculated for the LESS by Mission Control and transmitted via the LM/ELM uplink.

  3. Apoptotic Cell Death in Neuroblastoma

    PubMed Central

    Li, Yuanyuan; Nakagawara, Akira

    2013-01-01

    Neuroblastoma (NB) is one of the most common malignant solid tumors in childhood, which derives from the sympathoadrenal lineage of the neural crest and exhibits extremely heterogeneous biological and clinical behaviors. The infant patients frequently undergo spontaneous regression even with metastatic disease, whereas the patients of more than one year of age who suffer from disseminated disease have a poor outcome despite intensive multimodal treatment. Spontaneous regression in favorable NBs has been proposed to be triggered by nerve growth factor (NGF) deficiency in the tumor with NGF dependency for survival, while aggressive NBs have defective apoptotic machinery which enables the tumor cells to evade apoptosis and confers the resistance to treatment. This paper reviews the molecules and pathways that have been recently identified to be involved in apoptotic cell death in NB and discusses their potential prospects for developing more effective therapeutic strategies against aggressive NB. PMID:24709709

  4. Apoptotic markers in protozoan parasites

    PubMed Central

    2010-01-01

    The execution of the apoptotic death program in metazoans is characterized by a sequence of morphological and biochemical changes that include cell shrinkage, presentation of phosphatidylserine at the cell surface, mitochondrial alterations, chromatin condensation, nuclear fragmentation, membrane blebbing and the formation of apoptotic bodies. Methodologies for measuring apoptosis are based on these markers. Except for membrane blebbing and formation of apoptotic bodies, all other events have been observed in most protozoan parasites undergoing cell death. However, while techniques exist to detect these markers, they are often optimised for metazoan cells and therefore may not pick up subtle differences between the events occurring in unicellular organisms and multi-cellular organisms. In this review we discuss the markers most frequently used to analyze cell death in protozoan parasites, paying special attention to changes in cell morphology, mitochondrial activity, chromatin structure and plasma membrane structure/permeability. Regarding classical regulators/executors of apoptosis, we have reviewed the present knowledge of caspase-like and nuclease activities. PMID:21062457

  5. Blue Origin Conducts Pad Escape Test

    NASA Video Gallery

    Blue Origin conducted a successful pad escape test Oct. 19 at the company's West Texas launch site, firing its pusher escape motor and launching a full-scale suborbital crew capsule from a simulate...

  6. Genetic Algorithms with Local Minimum Escaping Technique

    NASA Astrophysics Data System (ADS)

    Tamura, Hiroki; Sakata, Kenichiro; Tang, Zheng; Ishii, Masahiro

    In this paper, we propose a genetic algorithm(GA) with local minimum escaping technique. This proposed method uses the local minimum escaping techique. It can escape from the local minimum by correcting parameters when genetic algorithm falls into a local minimum. Simulations are performed to scheduling problem without buffer capacity using this proposed method, and its validity is shown.

  7. [Escape Behaviors and Its Underlying Neuronal Circuits].

    PubMed

    Oda, Yoichi

    2015-10-01

    Escape behaviors are crucial to survive predator encounters or aversive stimuli. The neural circuits mediating escape behaviors of different animal species have a common framework to trigger extremely fast and robust movement with minimum delay. Thus, the neuronal escape circuits possibly represent functional architectures that perform the most efficient sensory-motor processing in the brain. Here, I review the escape behaviors and underlying neuronal circuits of several invertebrates and fish by focusing on the Mauthner cells, a pair of giant reticulospinal neurons in the hindbrain, that trigger fast escape behavior in goldfish and zebrafish. PMID:26450070

  8. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, Riku

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics. Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects? One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  9. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, R.

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics.Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects?One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  10. Escape Dynamics in Quasihomogeneous Fields

    NASA Astrophysics Data System (ADS)

    Mioc, Vasile; Stavinschi, Magda

    The escape in the two-body problem associated to a quasihomogeneous potential (a sum of homogeneous potentials) is being tackled. The basic equations of the problem are put in a form for which the infinity is a singularity, then they are regularized via McGehee-type transformations. The singularity is replaced by a manifold pasted on the phase space, and the flow on this manifold is described; it is identical with the analogous flows corresponding to already studied concrete astronomical and physical situations.

  11. Mars atmosphere evolution: Escape to space

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.

    1992-01-01

    The loss mechanisms and the rates of escape, to space, of Martian atmosphere constituents have changed throughout the history of the solar system. For the first billion years, Mars' atmosphere escape was probably dominated by impact erosion related to the presence of debris left over from the accretionary phase. This loss was further augmented by hydrodynamic outflows related to the presence of an early denser atmosphere and a sun that was brighter in the EUV wavelengths. Following this initial 'catastrophic' phase, during which a large fraction of the original atmosphere was lost but then replaced by volcanism and cometary impact, the 'modern' loss mechanisms which still operate today would have taken over. Those mechanisms that now contribute to escape to space consist of classical thermal or Jeans escape, nonthermal escape due to chemical reaction in the atmosphere, and solar wind-related losses. Both the loss mechanisms and the rates of escape are discussed.

  12. Wind-Induced Atmospheric Escape: Titan

    NASA Technical Reports Server (NTRS)

    Hartle, Richard; Johnson, Robert; Sittler, Edward, Jr.; Sarantos, Menelaos; Simpson, David

    2012-01-01

    Rapid thermospheric flows can significantly enhance the estimates of the atmospheric loss rate and the structure of the atmospheric corona of a planetary body. In particular, rapid horizontal flow at the exobase can increase the corresponding constituent escape rate. Here we show that such corrections, for both thermal and non-thermal escape, cannot be ignored when calculating the escape of methane from Titan, for which drastically different rates have been proposed. Such enhancements are also relevant to Pluto and exoplanets.

  13. Escape nightmares and postescape stressful events.

    PubMed

    Cernovsky, Z Z

    1988-04-01

    Correlation matrix based on questionnaire item responses by 38 Czechoslovak refugees suggested that "escape nightmares" (recurrent nightmares about being back in the exhomeland, wanting to or trying to re-escape to the free world) are unrelated to postescape incidence of various stressful events (e.g., illness, job difficulties, financial problems). However, refugees who reported a greater number of the stressful events also reported a somewhat higher incidence of nightmares on themes other than escape from homeland (r = .34). PMID:3399334

  14. Model of a mechanical clock escapement

    NASA Astrophysics Data System (ADS)

    Moline, David; Wagner, John; Volk, Eugene

    2012-07-01

    The mechanical tower clock originated in Europe during the 14th century to sound hourly bells and later display hands on a dial. An important innovation was the escapement mechanism, which converts stored energy into oscillatory motion for fixed time intervals through the pendulum swing. Previous work has modeled the escapement mechanism in terms of inelastic and elastic collisions. We derive and experimentally verify a theoretical model in terms of impulsive differential equations for the Graham escapement mechanism in a Seth Thomas tower clock. The model offers insight into the clock's mechanical behavior and the functionality of the deadbeat escapement mechanism.

  15. Electronic Escape Trails for Firefighters

    NASA Technical Reports Server (NTRS)

    Jorgensen, Charles; Schipper, John; Betts, Bradley

    2008-01-01

    A proposed wireless-communication and data-processing system would exploit recent advances in radio-frequency identification devices (RFIDs) and software to establish information lifelines between firefighters in a burning building and a fire chief at a control station near but outside the building. The system would enable identification of trails that firefighters and others could follow to escape from the building, including identification of new trails should previously established trails become blocked. The system would include a transceiver unit and a computer at the control station, portable transceiver units carried by the firefighters in the building, and RFID tags that the firefighters would place at multiple locations as they move into and through the building (see figure). Each RFID tag, having a size of the order of a few centimeters, would include at least standard RFID circuitry and possibly sensors for measuring such other relevant environmental parameters as temperature, levels of light and sound, concentration of oxygen, concentrations of hazardous chemicals in smoke, and/or levels of nuclear radiation. The RFID tags would be activated and interrogated by the firefighters and control-station transceivers. Preferably, RFID tags would be configured to communicate with each other and with the firefighters units and the control station in an ordered sequence, with built-in redundancy. In a typical scenario, as firefighters moved through a building, they would scatter many RFID tags into smoke-obscured areas by use of a compressed-air gun. Alternatively or in addition, they would mark escape trails by dropping RFID tags at such points of interest as mantraps, hot spots, and trail waypoints. The RFID tags could be of different types, operating at different frequencies to identify their functions, and possibly responding by emitting audible beeps when activated by signals transmitted by transceiver units carried by nearby firefighters.

  16. Exploiting death: apoptotic immunity in microbial pathogenesis.

    PubMed

    Ucker, D S

    2016-06-01

    Innate immunity typically is responsible for initial host responses against infections. Independently, nucleated cells that die normally as part of the physiological process of homeostasis in mammals (including humans) suppress immunity. Specifically, the physiological process of cell death (apoptosis) generates cells that are recognized specifically by viable cells of all types and elicit a profound transient suppression of host immunity (termed 'innate apoptotic immunity' (IAI)). IAI appears to be important normally for the maintenance of self-tolerance and for the resolution of inflammation. In addition, pathogens are able to take advantage of IAI through a variety of distinct mechanisms, to enable their proliferation within the host and enhance pathogenicity. For example, the protist pathogen Leishmania amazonensis, at its infective stage, mimics apoptotic cells by expressing apoptotic-like protein determinants on the cell surface, triggering immunosuppression directly. In contrast, the pathogenic bacterium Listeria monocytogenes triggers cell death in host lymphocytes, relying on those apoptotic cells to suppress host immune control and facilitate bacterial expansion. Finally, although the inhibition of apoptotic cell death is a common attribute of many viruses which facilitates their extended replication, it is clear that adenoviruses also reprogram the non-apoptotic dead cells that arise subsequently to manifest apoptotic-like immunosuppressive properties. These three instances represent diverse strategies used by microbial pathogens to exploit IAI, focusing attention on the potency of this facet of host immune control. Further examination of these cases will be revealing both of varied mechanisms of pathogenesis and the processes involved in IAI control. PMID:26943319

  17. Escape as Reinforcement and Escape Extinction in the Treatment of Feeding Problems

    ERIC Educational Resources Information Center

    LaRue, Robert H.; Stewart, Victoria; Piazza, Cathleen C.; Volkert, Valerie M.; Patel, Meeta R.; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of…

  18. Cooperation between Apoptotic and Viable Metacyclics Enhances the Pathogenesis of Leishmaniasis

    PubMed Central

    Wanderley, João Luiz Mendes; Pinto da Silva, Lucia Helena; Deolindo, Poliana; Soong, Lynn; Borges, Valéria Matos; Prates, Deboraci Brito; de Souza, Ana Paula Almeida; Barral, Aldina; de Freitas Balanco, José Mario; do Nascimento, Michelle Tanny Cunha; Saraiva, Elvira Maria; Barcinski, Marcello André

    2009-01-01

    Mimicking mammalian apoptotic cells by exposing phosphatidylserine (PS) is a strategy used by virus and parasitic protozoa to escape host protective inflammatory responses. With Leishmania amazonensis (La), apoptotic mimicry is a prerogative of the intramacrophagic amastigote form of the parasite and is modulated by the host. Now we show that differently from what happens with amastigotes, promastigotes exposing PS are non-viable, non-infective cells, undergoing apoptotic death. As part of the normal metacyclogenic process occurring in axenic cultures and in the gut of sand fly vectors, a sub-population of metacyclic promastigotes exposes PS. Apoptotic death of the purified PS-positive (PSPOS) sub-population was confirmed by TUNEL staining and DNA laddering. Transmission electron microscopy revealed morphological alterations in PSPOS metacyclics such as DNA condensation, cytoplasm degradation and mitochondrion and kinetoplast destruction, both in in vitro cultures and in sand fly guts. TUNELPOS promastigotes were detected only in the anterior midgut to foregut boundary of infected sand flies. Interestingly, caspase inhibitors modulated parasite death and PS exposure, when added to parasite cultures in a specific time window. Efficient in vitro macrophage infections and in vivo lesions only occur when PSPOS and PS-negative (PSNEG) parasites were simultaneously added to the cell culture or inoculated in the mammalian host. The viable PSNEG promastigote was the infective form, as shown by following the fate of fluorescently labeled parasites, while the PSPOS apoptotic sub-population inhibited host macrophage inflammatory response. PS exposure and macrophage inhibition by a subpopulation of promastigotes is a different mechanism than the one previously described with amastigotes, where the entire population exposes PS. Both mechanisms co-exist and play a role in the transmission and development of the disease in case of infection by La. Since both processes confer

  19. MEMO: Mars Escape and Magnetic Orbiter

    NASA Astrophysics Data System (ADS)

    Leblanc, F.; Langlais, B.; Chassefiere, E.; Sotin, C.; Barabash, S.; Dehant, V.; Dougherty, M.; Lammer, H.; Mandea, M.; Vennerstrom, S.

    2007-03-01

    MEMO is a new orbiter devoted to the characterization of present atmospheric escape and of the fossile magnetic field. The low periapsis (~130 km) is required to detect and quantify atoms and molecules involved in the escape, and to measure the magnetic f

  20. Escaping Homelessness: Anticipated and Perceived Facilitators

    ERIC Educational Resources Information Center

    Patterson, Allisha; Tweed, Roger

    2009-01-01

    One study with two distinct sections was conducted to identify factors facilitating escape from homelessness. In Section 1, 58 homeless individuals rated possible facilitators of escape (factors they believed would help them become more independent and self-sufficient). In Section 2, 80 participants who had already exited homelessness rated the…

  1. Submarine 'safe to escape' studies in man.

    PubMed

    Jurd, K M; Seddon, F M; Thacker, J C; Blogg, S L; Stansfield, M R D; White, M G; Loveman, G A M

    2014-01-01

    The Royal Navy requires reliable advice on the safe limits of escape from a distressed submarine (DISSUB). Flooding in a DISSUB may cause a rise in ambient pressure, increasing the risk of decompression sickness (DCS) and decreasing the maximum depth from which it is safe to escape. The aim of this study was to investigate the pressure/depth limits to escape following saturation at raised ambient pressure. Exposure to saturation pressures up to 1.6 bar (a) (160 kPa) (n = 38); escapes from depths down to 120 meters of sea water (msw) (n = 254) and a combination of saturation followed by escape (n = 90) was carried out in the QinetiQ Submarine Escape Simulator, Alverstoke, United Kingdom. Doppler ultrasound monitoring was used to judge the severity of decompression stress. The trials confirmed the previously untested advice, in the Guardbook, that if a DISSUB was lying at a depth of 90 msw, then it was safe to escape when the pressure in the DISSUB was 1.5 bar (a), but also indicated that this advice may be overly conservative. This study demonstrated that the upper DISSUB saturation pressure limit to safe escape from 90 msw was 1.6 bar (a), resulting in two cases of DCS. PMID:25109084

  2. Atmospheric escape, redox evolution, and planetary habitability

    NASA Astrophysics Data System (ADS)

    Catling, D. C.; Zahnle, K. J.

    2011-12-01

    Through the greenhouse effect, the presence and composition of an atmosphere is critical for defining a (conventional) circumstellar habitable zone in terms of planetary surface temperatures suitable for liquid water. Lack of knowledge of planetary atmospheres is likely to frustrate attempts to say with any certainty whether detected terrestrial-sized exoplanets may or may not be habitable. Perhaps an underappreciated role in such considerations is the evolutionary effect of atmospheric escape for determining atmospheric composition or whether an atmosphere exists in the first place. Whether atmospheres exist at all on planets is demonstrably connected to the effect of integrated atmospheric escape. When we observe our own Solar System and transiting exoplanets, the existence of an atmosphere is clearly delineated by a relative vulnerability to thermal escape and impact erosion. The prevalence of thermal escape as a key evolutionary determinant for the presence of planetary atmosphere is shown by a relationship between the relative solar (or stellar) heating and the escape velocity. Those bodies with too much stellar heating and too smaller escape velocity end up devoid of atmospheres. Impact erosion is evident in the relationship between impact velocity and escape velocity. Escape due to impacts is particularly important for understanding the large differences in the atmospheres of giant planet moons, such as Ganymede versus Titan. It is also significant for Mars-sized planets. The oxidation state of atmospheres is important for some theories of the origin of life (where an early reducing atmosphere is helpful for organic synthesis) and the evolution of advanced life (where free molecular oxygen is the best source of high energy metabolism). Surfaces on some relatively small planets and moons are observed to have evolved to an oxidized state, which theory and observation can explain through atmospheric escape. There are several examples in the Solar System where a

  3. Intercellular transfer of apoptotic signals via electrofusion

    SciTech Connect

    Park, Jin Suk; Lee, Wilson; McCulloch, Christopher A.

    2012-05-01

    We determined whether cells that are induced to undergo anoikis by matrix detachment can initiate apoptosis in healthy cells following electroporation-induced fusion. Separate populations of MDCK cells undergoing anoikis and stained with FITC-annexin or viable MDCK cells that were labeled with spectrally discrete fluorescent beads were electroporated. Cells were analyzed by flow cytometry for enumeration of viable cells with beads, apoptotic cells or fused cells. Electroporation promoted a 49-fold increase of the percentage of viable cells that had fused with apoptotic cells. Apoptotic cell-viable cell fusions were 8-fold more likely to not attach to cell culture plastic and 2.3-fold less likely to proliferate after 24 hr incubation than viable cell fusion controls. These data demonstrate that apoptotic signals can be transferred between cells by electrofusion, possibly suggesting a novel investigative approach for optimizing targeted cell deletion in cancer treatment.

  4. Clusterin facilitates apoptotic cell clearance and prevents apoptotic cell-induced autoimmune responses.

    PubMed

    Cunin, P; Beauvillain, C; Miot, C; Augusto, J-F; Preisser, L; Blanchard, S; Pignon, P; Scotet, M; Garo, E; Fremaux, I; Chevailler, A; Subra, J-F; Blanco, P; Wilson, M R; Jeannin, P; Delneste, Y

    2016-01-01

    Clusterin (Clu), an extracellular chaperone, exhibits characteristics of soluble innate immunity receptors, as assessed by its ability to bind some bacteria strains. In this study, we report that Clu also binds specifically to late apoptotic cells but not to live, early apoptotic, or necrotic cells. Histones, which accumulate on blebs during the apoptotic process, represent privileged Clu-binding motifs at the surface of late apoptotic cells. As a consequence, Clu potentiates, both in vitro and in vivo, the phagocytosis of late apoptotic cells by macrophages. Moreover, the increased phagocytosis of late apoptotic cells induced by Clu favors the presentation and cross-presentation of apoptotic cell-associated antigens. Finally, we observed that, in a model of apoptotic cell-induced autoimmunity, and relative to control mice, Clu(-/-) mice develop symptoms of autoimmunity, including the generation of anti-dsDNA antibodies, deposition of immunoglobulins and complement components within kidneys, and splenomegaly. These results identify Clu as a new molecule partner involved in apoptotic cell efferocytosis and suggest a protective role for Clu in inflammation and autoimmune diseases. PMID:27148688

  5. Clusterin facilitates apoptotic cell clearance and prevents apoptotic cell-induced autoimmune responses

    PubMed Central

    Cunin, P; Beauvillain, C; Miot, C; Augusto, J-F; Preisser, L; Blanchard, S; Pignon, P; Scotet, M; Garo, E; Fremaux, I; Chevailler, A; Subra, J-F; Blanco, P; Wilson, M R; Jeannin, P; Delneste, Y

    2016-01-01

    Clusterin (Clu), an extracellular chaperone, exhibits characteristics of soluble innate immunity receptors, as assessed by its ability to bind some bacteria strains. In this study, we report that Clu also binds specifically to late apoptotic cells but not to live, early apoptotic, or necrotic cells. Histones, which accumulate on blebs during the apoptotic process, represent privileged Clu-binding motifs at the surface of late apoptotic cells. As a consequence, Clu potentiates, both in vitro and in vivo, the phagocytosis of late apoptotic cells by macrophages. Moreover, the increased phagocytosis of late apoptotic cells induced by Clu favors the presentation and cross-presentation of apoptotic cell-associated antigens. Finally, we observed that, in a model of apoptotic cell-induced autoimmunity, and relative to control mice, Clu−/− mice develop symptoms of autoimmunity, including the generation of anti-dsDNA antibodies, deposition of immunoglobulins and complement components within kidneys, and splenomegaly. These results identify Clu as a new molecule partner involved in apoptotic cell efferocytosis and suggest a protective role for Clu in inflammation and autoimmune diseases. PMID:27148688

  6. Light weight escape capsule for fighter aircraft

    NASA Technical Reports Server (NTRS)

    Robert, James A.

    1988-01-01

    Emergency crew escape capabilities have been less than adequate for fighter aircraft since before WW II. From the over-the-side bailout of those days through the current ejection seat with a rocket catapult, escaping from a disabled aircraft has been risky at best. Current efforts are underway toward developing a high-tech, smart ejection seat that will give fighter pilots more room to live in the sky, but an escape capsule is needed to meet current and future fighter envelopes. Escape capsules have a bad reputation due to past examples of high weight, poor performance and great complexity. However, the advantages available demand that a capsule be developed. This capsule concept will minimize the inherent disavantages and incorporate the benefits while integrating all aspects of crew station design. The resulting design is appropriate for a crew station of the year 2010 and includes improved combat acceleration protection, chemical or biological combat capability, improved aircraft to escape system interaction, and the highest level of escape performance achievable. The capsule is compact, which can allow a reduced aircraft size and weighs only 1200 lb. The escape system weight penalty is only 120 lb higher than that for the next ejection seat and the capsule has a corresponding increase in performance.

  7. In situ apoptosis of adaptive immune cells and the cellular escape of rabies virus in CNS from patients with human rabies transmitted by Desmodus rotundus.

    PubMed

    Fernandes, Elaine Raniero; de Andrade, Heitor Franco; Lancellotti, Carmen Lúcia Penteado; Quaresma, Juarez Antônio Simões; Demachki, Samia; da Costa Vasconcelos, Pedro Fernando; Duarte, Maria Irma Seixas

    2011-03-01

    The aim of the current study was to investigate the apoptosis of neurons, astrocytes and immune cells from human patients that were infected with rabies virus by vampire bats bite. Apoptotic neurons were identified by their morphology and immune cells were identified using double immunostaining. There were very few apoptotic neurons present in infected tissue samples, but there was an increase of apoptotic infiltrating CD4+ and TCD8+ adaptive immune cells in the rabies infected tissue. No apoptosis was present in NK, macrophage and astrocytes. The dissemination of the human rabies virus within an infected host may be mediated by viral escape of the virus from an infected cell and may involve an anti-apoptotic mechanism, which does not kill the neuron or pro-apoptosis of TCD4+ and TCD8+ lymphocytes and which allows for increased proliferation of the virus within the CNS by attenuation of the adaptive immune response. PMID:21255623

  8. Apollo experience report: Launch escape propulsion subsystem

    NASA Technical Reports Server (NTRS)

    Townsend, N. A.

    1973-01-01

    The Apollo launch escape propulsion subsystem contained three solid rocket motors. The general design, development, and qualification of the solid-propellant pitch-control, tower-jettison, and launch-escape motors of the Apollo launch escape propulsion subsystem were completed during years 1961 to 1966. The launch escape system components are described in general terms, and the sequence of events through the ground-based test programs and flight-test programs is discussed. The initial ground rules established for this system were that it should use existing technology and designs as much as possible. The practicality of this decision is proved by the minimum number of problems that were encountered during the development and qualification program.

  9. Wind enhanced planetary escape: Collisional modifications

    NASA Technical Reports Server (NTRS)

    Curtis, S. A.; Hartle, R. E.

    1976-01-01

    The problem of thermal escape is considered in which both the effects of thermospheric winds at the exobase and collisions below the exobase are included in a Monte Carlo calculation. The collisions are included by means of a collisional relaxation layer of a background gas which models the transition region between the exosphere and the thermosphere. The wind effects are considered in the limiting cases of vertical and horizontal flows. Two species are considered: terrestrial hydrogen and terrestrial helium. In the cases of terrestrial hydrogen the escape fluxes were found to be strongly filtered or throttled by collisions at high exospheric temperatures. The model is applied to molecular hydrogen diffusing through a methane relaxation layer under conditions possible on Titan. The results are similar to the case of terrestrial hydrogen with wind enhanced escape being strongly suppressed by collisions. It is concluded that wind enhanced escape is not an important process on Titan.

  10. Biogeochemistry: Nocturnal escape route for marsh gas

    NASA Astrophysics Data System (ADS)

    Anthony, Katey Walter; MacIntyre, Sally

    2016-07-01

    A field study of methane emissions from wetlands reveals that more of the gas escapes through diffusive processes than was thought, mostly at night. Because methane is a greenhouse gas, the findings have implications for global warming.

  11. Polymer escape from a confining potential

    SciTech Connect

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-02-07

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  12. Polymer escape from a confining potential

    NASA Astrophysics Data System (ADS)

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-02-01

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  13. Submarine tower escape decompression sickness risk estimation.

    PubMed

    Loveman, G A M; Seddon, E M; Thacker, J C; Stansfield, M R; Jurd, K M

    2014-01-01

    Actions to enhance survival in a distressed submarine (DISSUB) scenario may be guided in part by knowledge of the likely risk of decompression sickness (DCS) should the crew attempt tower escape. A mathematical model for DCS risk estimation has been calibrated against DCS outcome data from 3,738 exposures of either men or goats to raised pressure. Body mass was used to scale DCS risk. The calibration data included more than 1,000 actual or simulated submarine escape exposures and no exposures with substantial staged decompression. Cases of pulmonary barotrauma were removed from the calibration data. The calibrated model was used to estimate the likelihood of DCS occurrence following submarine escape from the United Kingdom Royal Navy tower escape system. Where internal DISSUB pressure remains at - 0.1 MPa, escape from DISSUB depths < 200 meters is estimated to have DCS risk < 6%. Saturation at raised DISSUB pressure markedly increases risk, with > 60% DCS risk predicted for a 200-meter escape from saturation at 0.21 MPa. Using the calibrated model to predict DCS for direct ascent from saturation gives similar risk estimates to other published models. PMID:25109085

  14. Apoptotic processes during mammalian preimplantation development.

    PubMed

    Fabian, Dusan; Koppel, Juraj; Maddox-Hyttel, Poul

    2005-07-15

    The paper provides a review of the current state of knowledge on apoptosis during normal preimplantation development based on the literature and on the authors' own findings. Information is focused on the occurrence and the characteristics of spontaneous apoptotic processes. Reports concerning the chronology and the incidence of programmed cell death in mouse, cow, pig and human embryos in early preimplantation stages up to the blastocyst stage are summarized. In addition, specific attributes of the apoptotic process in mammalian preimplantation development are provided, including the description of both morphological and biochemical features of cell death. PMID:15955348

  15. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... Operate With More Than 16 Individuals on Board § 28.390 Means of escape. (a) Each space which is used by... two widely separated means of escape. At least one of the means of escape must be independent...

  16. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 1 2013-10-01 2013-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... Operate With More Than 16 Individuals on Board § 28.390 Means of escape. (a) Each space which is used by... two widely separated means of escape. At least one of the means of escape must be independent...

  17. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  18. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  19. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  20. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  1. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  2. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 1 2012-10-01 2012-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... Operate With More Than 16 Individuals on Board § 28.390 Means of escape. (a) Each space which is used by... two widely separated means of escape. At least one of the means of escape must be independent...

  3. Hydrogen Escape from early Earth and Mars

    NASA Astrophysics Data System (ADS)

    Zugger, M. E.; Ramirez, R. M.; Kasting, J. F.

    2012-12-01

    A controversy regarding hydrodynamic escape rates arose when Tian et al. (2005) published transonic escape rates for an atmosphere composed of pure H2. Tian et al. concluded that the hydrogen escape rate from early Earth would have been a factor of 20 or more slower than the diffusion limit, even if the solar EUV (extreme ultraviolet) flux was enhanced by a factor of 5 relative to today. This conclusion was challenged by Catling (2006), who pointed out that solar EUV fluxes could have been much higher than this so that plenty of energy should have been available to power escape. This controversy has remained unresolved to date. Hydrogen escape from early Mars is also of interest. As discussed in this session in a complementary paper by Ramirez et al., collision-induced absorption by molecular hydrogen could have helped to warm early Mars, perhaps explaining the formation of valleys and valley networks. Ramirez et al. have shown that a mixture of 90% CO2 and 10% H2 is capable raising early Mars' surface temperature above the freezing point of water, for surface pressures exceeding ~3 bar. However, we need to understand whether H2 mixing ratios of 10% are physically plausible. The H2 partial pressure in Mars' early atmosphere would have been determined by the balance between volcanic outgassing and escape to space. The 10% mixing ratio is high compared to the value of ~10-3 typically assumed for early Earth. But Mars' early atmosphere may have been more reduced than Earth's (Wadwha, 2001); if the hydrogen escape rate on Mars was also slower than on Earth, then additional increases in atmospheric hydrogen concentration are possible. To answer these questions about the early atmospheres of Earth and Mars, we have modified an existing model of hydrodynamic escape, developed by F. Tian, J. Kasting, and others, to converge for atmospheres with a wide range of hydrogen mixing ratios. The model finds subsonic solutions to the hydrodynamic equations; these can be shown to

  4. MEMO: Mars Escape and Magnetic Orbiter

    NASA Astrophysics Data System (ADS)

    Chassefiere, E.; Langlais, B.; Leblanc, F.; Sotin, C.; Barabash, S.; Dehant, V.; Dougherty, M.; Lammer, H.; Mandea, M.; Vennerstrom, S.

    There are several reasons to believe that Mars could have become an Earth like planet rather than the present dry and cold planet. In particular, many elements suggest the presence of liquid water at the Martian surface during a relatively short period at an early stage of its history. Since liquid water may have been the birthplace for life on Earth, the fate of Martian water is one of the major key and yet unanswered question to be solved. Mars Escape and Magnetic Orbiter (MEMO) is a low periapsis orbiter of Mars devoted to the measurement of present escape and the characterization of the fossil magnetic field of Mars. The use of a low periapsis altitude orbit (120-150 km) is required to detect and quantify all populations of atoms and molecules involved in escape. It is also required to measure the magnetic field of Mars with an unprecedented spatial resolution that would allow getting a more precise timing of the dynamo and its disappearance. Achieving a full characterization of atmospheric escape, and extrapolating it back to the past requires: (i) to measure escape fluxes of neutral and ion species, and characterize the dynamics and chemistry of the regions of the atmosphere where escape occurs (thermosphere, ionosphere, exosphere), as well as their responses to solar activity, and (ii) to characterize the lateral variations of the magnetic field of lithospheric origin, and by extension, the timing of the Martian dynamo. Of particular interest is the extinction of the dynamo that is thought to have enhanced the atmospheric escape processes still operating today. The proposed low-periapsis orbiter will consist of the following elements: • An "Escape Package" to characterize by both in-situ and remote measurements the thermosphere, ionosphere, exosphere and solar wind interaction regions (from one hundred to several thousand km), including thermal, suprathermal 1 and energetic particles. • A "Magnetic Field Package", to characterize the magnetization of the

  5. Enzyme markers

    MedlinePlus

    ... or defects passed down through families (inherited) can affect how enzymes work. Some enzymes are affected by several genes. Test results are usually reported as a percentage of normal enzyme activity.

  6. Compensatory escape mechanism at low Reynolds number

    PubMed Central

    Gemmell, Brad J.; Sheng, Jian; Buskey, Edward J.

    2013-01-01

    Despite high predation pressure, planktonic copepods remain one of the most abundant groups on the planet. Their escape response provides one of most effective mechanisms to maximize evolutionary fitness. Owing to their small size (100 µm) compared with their predators (>1 mm), increasing viscosity is believed to have detrimental effects on copepods’ fitness at lower temperature. Using high-speed digital holography we acquire 3D kinematics of the nauplius escape including both location and detailed appendage motion. By independently varying temperature and viscosity we demonstrate that at natural thermal extremes, contrary to conventional views, nauplii achieve equivalent escape distance while maintaining optimal velocity. Using experimental results and kinematic simulations from a resistive force theory propulsion model, we demonstrate that a shift in appendage timing creates an increase in power stroke duration relative to recovery stroke duration. This change allows the nauplius to limit losses in velocity and maintain distance during escapes at the lower bound of its natural thermal range. The shift in power stroke duration relative to recovery stroke duration is found to be regulated by the temperature dependence of swimming appendage muscle groups, not a dynamic response to viscosity change. These results show that copepod nauplii have natural adaptive mechanisms to compensate for viscosity variations with temperature but not in situations in which viscosity varies independent of temperature, such as in some phytoplankton blooms. Understanding the robustness of escapes in the wake of environmental changes such as temperature and viscosity has implications in assessing the future health of performance compensation. PMID:23487740

  7. Cerebrospinal Fluid HIV Escape from Antiretroviral Therapy.

    PubMed

    Ferretti, Francesca; Gisslen, Magnus; Cinque, Paola; Price, Richard W

    2015-06-01

    CNS infection is a nearly constant facet of systemic CNS infection and is generally well controlled by suppressive systemic antiretroviral therapy (ART). However, there are instances when HIV can be detected in the cerebrospinal fluid (CSF) despite suppression of plasma viruses below the clinical limits of measurement. We review three types of CSF viral escape: asymptomatic, neuro-symptomatic, and secondary. The first, asymptomatic CSF escape, is seemingly benign and characterized by lack of discernable neurological deterioration or subsequent CNS disease progression. Neuro-symptomatic CSF escape is an uncommon, but important, entity characterized by new or progressive CNS disease that is critical to recognize clinically because of its management implications. Finally, secondary CSF escape, which may be even more uncommon, is defined by an increase of CSF HIV replication in association with a concomitant non-HIV infection, as a consequence of the local inflammatory response. Understanding these CSF escape settings not only is important for clinical diagnosis and management but also may provide insight into the CNS HIV reservoir. PMID:25860317

  8. Radiative equilibrium and escape of Pluto's atmosphere

    NASA Astrophysics Data System (ADS)

    Erwin, Justin; Koskinen, Tommi T.; Yelle, Roger V.

    2015-11-01

    Observations of Pluto’s extend atmosphere by the New Horizons spacecraft motivate an update to our modeling effort on Pluto’s atmosphere. New Horizons observations have already improved our constraints on planet radius and surface pressure, which are key to modeling the atmospheric structure. We model the radiative conductive equilibrium in the lower atmosphere combined with the UV driven escape model of the upper atmosphere. The non-LTE radiative transfer model in the lower atmosphere include heating and cooling by CH4, CO, and HCN. The escape model of the upper atmosphere is updated to include diffusion and escape of each molecular component. These results will be used to aid in the analysis and better understanding of the full atmospheric structure.

  9. Thermal escape from extrasolar giant planets.

    PubMed

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres. PMID:24664923

  10. Thermal escape from extrasolar giant planets

    PubMed Central

    Koskinen, Tommi T.; Lavvas, Panayotis; Harris, Matthew J.; Yelle, Roger V.

    2014-01-01

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres. PMID:24664923

  11. Apoptotic and proliferation indexes in canine lymphoma.

    PubMed

    Phillips, B S; Kass, P H; Naydan, D K; Winthrop, M D; Griffey, S M; Madewell, B R

    2000-03-01

    Proliferative and apoptotic fractions of tumors were evaluated in 41 dogs with lymphoma for prediction of response to chemotherapy. All dogs had advanced clinical stage tumors, were untreated prior to study, and received identical induction-remission chemotherapy. Tumor cell proliferation was determined in all pretreatment biopsy specimens and in 18 specimens collected at the time of clinical relapse from remission. Quantitative measures included mitotic index and immunoreactivities for proliferating cell nuclear antigen (PCNA) and Ki-67. Apoptotic index was evaluated from 40 dogs pretreatment and from 16 dogs at the time of first relapse. Pretreatment tumor values for Ki-67, PCNA, and apoptosis were compared with posttreatment values. The median first relapse-free interval (RFI) and overall survival (OS) time were 174 days and 445 days, respectively. Of the proliferation markers, only the results of the Ki-67 analysis were predictive for duration of the first RFI but not OS. Pretreatment apoptotic index was also predictive of the duration of first RFI but not OS. No significant predictive value for comparison of the pretreatment and postrelapse values was demonstrated. Ki-67 labeling index and apoptotic indexes were combined to form both a proliferation/apoptotic ratio (PAR) and a sum, or turnover index. Only the PAR was predictive for duration of first RFI on multivariate analysis. Other variables that were evaluated for their influence on treatment outcome included patient age, weight, gender, clinical stage, clinical substage, and tumor immunophenotype. Of these variables, only immunophenotype was found to be of value for predicting duration of first RFI and OS. PMID:10730938

  12. Statistical theory of asteroid escape rates.

    PubMed

    Jaffé, Charles; Ross, Shane D; Lo, Martin W; Marsden, Jerrold; Farrelly, David; Uzer, T

    2002-07-01

    Transition states in phase space are identified and shown to regulate the rate of escape of asteroids temporarily captured in circumplanetary orbits. The transition states, similar to those occurring in chemical reaction dynamics, are then used to develop a statistical semianalytical theory for the rate of escape of asteroids temporarily captured by Mars. Theory and numerical simulations are found to agree to better than 1%. These calculations suggest that further development of transition state theory in celestial mechanics, as an alternative to large-scale numerical simulations, will be a fruitful approach to mass transport calculations. PMID:12097024

  13. Martian Atmospheric and Ionospheric plasma Escape

    NASA Astrophysics Data System (ADS)

    Lundin, Rickard

    2016-04-01

    Solar forcing is responsible for the heating, ionization, photochemistry, and erosion processes in the upper atmosphere throughout the lifetime of the terrestrial planets. Of the four terrestrial planets, the Earth is the only one with a fully developed biosphere, while our kin Venus and Mars have evolved into arid inhabitable planets. As for Mars, there are ample evidences for an early Noachian, water rich period on Mars. The question is, what made Mars evolve so differently compared to the Earth? Various hydrosphere and atmospheric evolution scenarios for Mars have been forwarded based on surface morphology, chemical composition, simulations, semi-empiric (in-situ data) models, and the long-term evolution of the Sun. Progress has been made, but the case is still open regarding the changes that led to the present arid surface and tenuous atmosphere at Mars. This presentation addresses the long-term variability of the Sun, the solar forcing impact on the Martian atmosphere, and its interaction with the space environment - an electromagnetic wave and particle interaction with the upper atmosphere that has implications for its photochemistry, composition, and energization that governs thermal and non-thermal escape. Non-thermal escape implies an electromagnetic upward energization of planetary ions and molecules to velocities above escape velocity, a process governed by a combination of solar EUV radiation (ionization), and energy and momentum transfer by the solar wind. The ion escape issue dates back to the early Soviet and US-missions to Mars, but the first more accurate estimates of escape rates came with the Phobos-2 mission in 1989. Better-quality ion composition measurement results of atmospheric/ionospheric ion escape from Mars, obtained from ESA Mars Express (MEX) instruments, have improved our understanding of the ion escape mechanism. With the NASA MAVEN spacecraft orbiting Mars since Sept. 2014, dual in-situ measurement with plasma instruments are now

  14. Stabilization of apoptotic cells: generation of zombie cells.

    PubMed

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-01-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn(2+) (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy. PMID:25118929

  15. Stabilization of apoptotic cells: generation of zombie cells

    PubMed Central

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-01-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn2+ (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy. PMID:25118929

  16. Centrifugally Stimulated Exospheric Ion Escape at Mercury

    NASA Technical Reports Server (NTRS)

    Delcourt, Dominique; Seki, K.; Terada, N.; Moore, Thomas E.

    2012-01-01

    We investigate the transport of ions in the low-altitude magnetosphere magnetosphere of Mercury. We show that, because of small spatial scales, the centrifugal effect due to curvature of the E B drift paths can lead to significant particle energization in the parallel direction. We demonstrate that because of this effect, ions with initial speed smaller than the escape speed such as those produced via thermal desorption can overcome gravity and escape into the magnetosphere. The escape route of this low-energy exosphere originating material is largely controlled by the magnetospheric convection rate. This escape route spreads over a narrower range of altitudes when the convection rate increases. Bulk transport of low-energy planetary material thus occurs within a limited region of space once moderate magnetospheric convection is established. These results suggest that, via release of material otherwise gravitationally trapped, the E B related centrifugal acceleration is an important mechanism for the net supply of plasma to the magnetosphere of Mercury.

  17. Developing the E-Scape Software System

    ERIC Educational Resources Information Center

    Derrick, Karim

    2012-01-01

    Most innovations have contextual pre-cursors that prompt new ways of thinking and in their turn help to give form to the new reality. This was the case with the e-scape software development process. The origins of the system existed in software components and ideas that we had developed through previous projects, but the ultimate direction we took…

  18. Nociception and escape behavior in planarians

    NASA Astrophysics Data System (ADS)

    Schoetz Collins, Eva-Maria

    2015-03-01

    Planarians are famous and widely studied for their regenerative capabilities. When a moving planarian is cut through the middle, the resulting head and tail pieces instantaneously retract and exhibit a characteristic escape response that differs from normal locomotion. In asexual animals, a similar reaction is observed when the planarian undergoes fission, suggesting that reproduction through self-tearing is a rather traumatic event for the animal. Using a multiscale approach, we unravel the dynamics, mechanics, and functional aspects of the planarian escape response. This musculature-driven gait was found to be a dominating response that supersedes the urge to feed or reproduce and quantitatively differs from other modes of planarian locomotion (gliding, peristalsis). We show that this escape gait constitutes the animal's pain response mediated by TRP like receptors and the neurotransmitter histamine, and that it can be induced through adverse thermal, mechanical, electrical or chemical stimuli. Ultimately, we will examine the neuronal subpopulations involved in mediating escape reflexes in planarians and how they are functionally restored during regeneration, thereby gaining mechanistic insight into the neuronal circuits required for specific behaviors. Supported by BWF CASI and Sloan Foundation.

  19. Animal escapology II: escape trajectory case studies

    PubMed Central

    Domenici, Paolo; Blagburn, Jonathan M.; Bacon, Jonathan P.

    2011-01-01

    Summary Escape trajectories (ETs; measured as the angle relative to the direction of the threat) have been studied in many taxa using a variety of methodologies and definitions. Here, we provide a review of methodological issues followed by a survey of ET studies across animal taxa, including insects, crustaceans, molluscs, lizards, fish, amphibians, birds and mammals. Variability in ETs is examined in terms of ecological significance and morpho-physiological constraints. The survey shows that certain escape strategies (single ETs and highly variable ETs within a limited angular sector) are found in most taxa reviewed here, suggesting that at least some of these ET distributions are the result of convergent evolution. High variability in ETs is found to be associated with multiple preferred trajectories in species from all taxa, and is suggested to provide unpredictability in the escape response. Random ETs are relatively rare and may be related to constraints in the manoeuvrability of the prey. Similarly, reports of the effect of refuges in the immediate environment are relatively uncommon, and mainly confined to lizards and mammals. This may be related to the fact that work on ETs carried out in laboratory settings has rarely provided shelters. Although there are a relatively large number of examples in the literature that suggest trends in the distribution of ETs, our understanding of animal escape strategies would benefit from a standardization of the analytical approach in the study of ETs, using circular statistics and related tests, in addition to the generation of large data sets. PMID:21753040

  20. Evolution: Escaping the Inevitability of Ageing.

    PubMed

    Archer, C Ruth; Hosken, David J

    2016-03-01

    William Hamilton argued that even species inhabiting the farthest flung corners of the universe should age. However, a recent study shows that to find a species that escapes ageing, you only need to look as far as your local pond. PMID:26954440

  1. Elevated Levels of Uterine Anti-Apoptotic Signaling May Activate NFKB and Potentially Confer Resistance to Caspase 3-Mediated Apoptotic Cell Death During Pregnancy in Mice1

    PubMed Central

    Jeyasuria, Pancharatnam; Subedi, Kalpana; Suresh, Arvind; Condon, Jennifer C.

    2011-01-01

    Preserving the uterus in a state of relative quiescence is vital to the maintenance of a successful pregnancy. Elevated cytoplasmic levels of uterine caspase 3 during pregnancy have been proposed as a potential regulator of uterine quiescence through direct targeting and disabling of the uterine contractile architecture. However, despite highly elevated levels of uterine caspase 3 during pregnancy, there is minimal evidence of apoptosis. This current study defines the mechanism whereby the pregnant uterine myocyte may harness the tocolytic activity of active caspases while avoiding apoptotic cell death. Using the pregnant mouse model, we have analyzed the uterus for changes in pro- and antiapoptotic signaling patterns associated with the advancing stages of pregnancy. Briefly, we have found that members of the IAP family, such as SURVIVIN and XIAP, and the Bcl2 family members, such as MCL1, are elevated in the uterine myocyte during late gestation. The IAP family members are the only endogenous inhibitors of active caspase 3, and MCL1 limits activation of caspase 3 by suppressing proapoptotic signaling. Elevated XIAP levels partner with SURVIVIN, resulting in increased levels of the antiapoptotic MCL1 via NFKB activation; these together have the potential to limit both the activity and level of active caspase 3 in the pregnant uterus as term approaches. We propose that modification of these antiapoptotic signaling partners allows the pregnant uterus to escape the apoptotic action of elevated active caspase 3 levels but also functions to limit the levels of active uterine caspase 3 near term. PMID:21566000

  2. Conjugated Polyelectrolyte Nanoparticles for Apoptotic Cell Imaging.

    PubMed

    Liu, Yu; Wu, Pan; Jiang, Jianhua; Wu, Jiatao; Chen, Yan; Tan, Ying; Tan, Chunyan; Jiang, Yuyang

    2016-08-31

    Three anionic conjugated polyelectrolytes (CPEs) with poly(p-phenylene ethynylene thiophene) backbones were designed and synthesized, among which PPET3-CO2Na showed greater molar extinction coefficient with red-shifted bands in both absorption and emission spectra compared to the well-studied PPE-CO2Na polymer. PPET3-CO2Na was thus chosen to construct CPE-based nanoparticles (CPNs) with cationic octaarginine (R8) peptide through electrostatic-interaction-induced self-assembly. Due to plasma membrane permeabilization and mitochondrial outer membrane permeabilization (MOMP) in early apoptotic cells, PPET3/R8 CPNs demonstrated excellent colocalization with MitoTracker Red in apoptotic cells instead of normal cells, which had potential application in cell imaging for early apoptosis recognition. PMID:27525500

  3. Apoptotic pathways in pancreatic ductal adenocarcinoma

    PubMed Central

    Hamacher, Rainer; Schmid, Roland M; Saur, Dieter; Schneider, Günter

    2008-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is one of the most common causes of cancer related death. Despite the advances in understanding of the molecular pathogenesis, pancreatic cancer remains a major unsolved health problem. Overall, the 5-year survival rate is less than 5% demonstrating the insufficiency of current therapies. Most cytotoxic therapies induce apoptosis and PDAC cells have evolved a plethora of molecular mechanisms to assure survival. We will present anti-apoptotic strategies working at the level of the death receptors, the mitochondria or involving the caspase inhibitors of the IAP family. Furthermore, the survival function of the phosphotidylinositol-3' kinase (PI3K)/AKT- and NF-kappaB-pathways are illustrated. A detailed molecular knowledge of the anti-apoptotic mechanisms of PDAC cells will help to improve therapies for this dismal disease and therapeutic strategies targeting the programmed cell death machinery are in early preclinical and clinical development. PMID:18652674

  4. The Dynamics of Apoptotic Cell Clearance.

    PubMed

    Elliott, Michael R; Ravichandran, Kodi S

    2016-07-25

    The phagocytic clearance of dying cells in a tissue is a highly orchestrated series of intercellular events coordinated by a complex signaling network. Recent data from genetic, biochemical, and live-imaging approaches have greatly enhanced our understanding of the dynamics of cell clearance and how the process is orchestrated at the cellular and tissue levels. We discuss how networks regulating apoptotic cell clearance are integrated to enable a rapid, efficient, and high-capacity clearance system within tissues. PMID:27459067

  5. Assembly of the Bak Apoptotic Pore

    PubMed Central

    Ma, Stephen; Hockings, Colin; Anwari, Khatira; Kratina, Tobias; Fennell, Stephanie; Lazarou, Michael; Ryan, Michael T.; Kluck, Ruth M.; Dewson, Grant

    2013-01-01

    Bak and Bax are the essential effectors of the intrinsic pathway of apoptosis. Following an apoptotic stimulus, both undergo significant changes in conformation that facilitates their self-association to form pores in the mitochondrial outer membrane. However, the molecular structures of Bak and Bax oligomeric pores remain elusive. To characterize how Bak forms pores during apoptosis, we investigated its oligomerization under native conditions using blue native PAGE. We report that, in a healthy cell, inactive Bak is either monomeric or in a large complex involving VDAC2. Following an apoptotic stimulus, activated Bak forms BH3:groove homodimers that represent the basic stable oligomeric unit. These dimers multimerize to higher-order oligomers via a labile interface independent of both the BH3 domain and groove. Linkage of the α6:α6 interface is sufficient to stabilize higher-order Bak oligomers on native PAGE, suggesting an important role in the Bak oligomeric pore. Mutagenesis of the α6 helix disrupted apoptotic function because a chimera of Bak with the α6 derived from Bcl-2 could be activated by truncated Bid (tBid) and could form BH3:groove homodimers but could not form high molecular weight oligomers or mediate cell death. An α6 peptide could block Bak function but did so upstream of dimerization, potentially implicating α6 as a site for activation by BH3-only proteins. Our examination of native Bak oligomers indicates that the Bak apoptotic pore forms by the multimerization of BH3:groove homodimers and reveals that Bak α6 is not only important for Bak oligomerization and function but may also be involved in how Bak is activated by BH3-only proteins. PMID:23893415

  6. The amino acid sensor GCN2 inhibits inflammatory responses to apoptotic cells promoting tolerance and suppressing systemic autoimmunity.

    PubMed

    Ravishankar, Buvana; Liu, Haiyun; Shinde, Rahul; Chaudhary, Kapil; Xiao, Wei; Bradley, Jillian; Koritzinsky, Marianne; Madaio, Michael P; McGaha, Tracy L

    2015-08-25

    Efficient apoptotic cell clearance and induction of immunologic tolerance is a critical mechanism preventing autoimmunity and associated pathology. Our laboratory has reported that apoptotic cells induce tolerance by a mechanism dependent on the tryptophan catabolizing enzyme indoleamine 2,3 dioxygenase 1 (IDO1) in splenic macrophages (MΦ). The metabolic-stress sensing protein kinase GCN2 is a primary downstream effector of IDO1; thus, we tested its role in apoptotic cell-driven immune suppression. In vitro, expression of IDO1 in MΦs significantly enhanced apoptotic cell-driven IL-10 and suppressed IL-12 production in a GCN2-dependent mechanism. Suppression of IL-12 protein production was due to attenuation of IL-12 mRNA association with polyribosomes inhibiting translation while IL-10 mRNA association with polyribosomes was not affected. In vivo, apoptotic cell challenge drove a rapid, GCN2-dependent stress response in splenic MΦs with increased IL-10 and TGF-β production, whereas myeloid-specific deletion of GCN2 abrogated regulatory cytokine production with provocation of inflammatory T-cell responses to apoptotic cell antigens and failure of long-tolerance induction. Consistent with a role in prevention of apoptotic cell driven autoreactivity, myeloid deletion of GCN2 in lupus-prone mice resulted in increased immune cell activation, humoral autoimmunity, renal pathology, and mortality. In contrast, activation of GCN2 with an agonist significantly reduced anti-DNA autoantibodies and protected mice from disease. Thus, this study implicates a key role for GCN2 signals in regulating the tolerogenic response to apoptotic cells and limiting autoimmunity. PMID:26261340

  7. The amino acid sensor GCN2 inhibits inflammatory responses to apoptotic cells promoting tolerance and suppressing systemic autoimmunity

    PubMed Central

    Ravishankar, Buvana; Liu, Haiyun; Shinde, Rahul; Chaudhary, Kapil; Xiao, Wei; Bradley, Jillian; Koritzinsky, Marianne; Madaio, Michael P.; McGaha, Tracy L.

    2015-01-01

    Efficient apoptotic cell clearance and induction of immunologic tolerance is a critical mechanism preventing autoimmunity and associated pathology. Our laboratory has reported that apoptotic cells induce tolerance by a mechanism dependent on the tryptophan catabolizing enzyme indoleamine 2,3 dioxygenase 1 (IDO1) in splenic macrophages (MΦ). The metabolic-stress sensing protein kinase GCN2 is a primary downstream effector of IDO1; thus, we tested its role in apoptotic cell-driven immune suppression. In vitro, expression of IDO1 in MΦs significantly enhanced apoptotic cell-driven IL-10 and suppressed IL-12 production in a GCN2-dependent mechanism. Suppression of IL-12 protein production was due to attenuation of IL-12 mRNA association with polyribosomes inhibiting translation while IL-10 mRNA association with polyribosomes was not affected. In vivo, apoptotic cell challenge drove a rapid, GCN2-dependent stress response in splenic MΦs with increased IL-10 and TGF-β production, whereas myeloid-specific deletion of GCN2 abrogated regulatory cytokine production with provocation of inflammatory T-cell responses to apoptotic cell antigens and failure of long-tolerance induction. Consistent with a role in prevention of apoptotic cell driven autoreactivity, myeloid deletion of GCN2 in lupus-prone mice resulted in increased immune cell activation, humoral autoimmunity, renal pathology, and mortality. In contrast, activation of GCN2 with an agonist significantly reduced anti-DNA autoantibodies and protected mice from disease. Thus, this study implicates a key role for GCN2 signals in regulating the tolerogenic response to apoptotic cells and limiting autoimmunity. PMID:26261340

  8. Launch Pad Escape System Design (Human Spaceflight)

    NASA Technical Reports Server (NTRS)

    Maloney, Kelli

    2011-01-01

    A launch pad escape system for human spaceflight is one of those things that everyone hopes they will never need but is critical for every manned space program. Since men were first put into space in the early 1960s, the need for such an Emergency Escape System (EES) has become apparent. The National Aeronautics and Space Administration (NASA) has made use of various types of these EESs over the past 50 years. Early programs, like Mercury and Gemini, did not have an official launch pad escape system. Rather, they relied on a Launch Escape System (LES) of a separate solid rocket motor attached to the manned capsule that could pull the astronauts to safety in the event of an emergency. This could only occur after hatch closure at the launch pad or during the first stage of flight. A version of a LES, now called a Launch Abort System (LAS) is still used today for all manned capsule type launch vehicles. However, this system is very limited in that it can only be used after hatch closure and it is for flight crew only. In addition, the forces necessary for the LES/LAS to get the capsule away from a rocket during the first stage of flight are quite high and can cause injury to the crew. These shortcomings led to the development of a ground based EES for the flight crew and ground support personnel as well. This way, a much less dangerous mode of egress is available for any flight or ground personnel up to a few seconds before launch. The early EESs were fairly simple, gravity-powered systems to use when thing's go bad. And things can go bad very quickly and catastrophically when dealing with a flight vehicle fueled with millions of pounds of hazardous propellant. With this in mind, early EES designers saw such a passive/unpowered system as a must for last minute escapes. This and other design requirements had to be derived for an EES, and this section will take a look at the safety design requirements had to be derived for an EES, and this section will take a look at

  9. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  10. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  11. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  12. 17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ELEVATOR TO 18-FOOT LOCK, LOOKING EAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  13. 14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLDDOWN RODS, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLD-DOWN RODS, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  14. 15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, SHOWING ENTRANCE TO SUBMARINE SECTION AT 110-FOOT LEVEL - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  15. 34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION OF BLISTERS IN 1959, LOOKING SOUTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  16. 21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA AND TOP OF THE TANK, LOOKING NORTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  17. 18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM 50-FOOT LOCK TO ELEVATOR, LOOKING WEST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  18. 23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWOLOCK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWO-LOCK RECOMPRESSION CHAMBER IN PASSAGEWAY FROM ELEVATOR TO CUPOLA - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  19. Enzyme Kinetics.

    ERIC Educational Resources Information Center

    Moe, Owen; Cornelius, Richard

    1988-01-01

    Conveys an appreciation of enzyme kinetic analysis by using a practical and intuitive approach. Discusses enzyme assays, kinetic models and rate laws, the kinetic constants (V, velocity, and Km, Michaels constant), evaluation of V and Km from experimental data, and enzyme inhibition. (CW)

  20. BCDO2 acts as a carotenoid scavenger and gatekeeper for the mitochondrial apoptotic pathway

    PubMed Central

    Lobo, Glenn P.; Isken, Andrea; Hoff, Sylvia; Babino, Darwin; von Lintig, Johannes

    2012-01-01

    Carotenoids and their metabolites are widespread and exert key biological functions in living organisms. In vertebrates, the carotenoid oxygenase BCMO1 converts carotenoids such as β,β-carotene to retinoids, which are required for embryonic pattern formation and cell differentiation. Vertebrate genomes encode a structurally related protein named BCDO2 but its physiological function remains undefined. Here, we show that BCDO2 is expressed as an oxidative stress-regulated protein during zebrafish development. Targeted knockdown of this mitochondrial enzyme resulted in anemia at larval stages. Marker gene analysis and staining for hemoglobin revealed that erythropoiesis was not impaired but that erythrocytes underwent apoptosis in BCDO2-deficient larvae. To define the mechanism of this defect, we have analyzed the role of BCDO2 in human cell lines. We found that carotenoids caused oxidative stress in mitochondria that eventually led to cytochrome c release, proteolytic activation of caspase 3 and PARP1, and execution of the apoptotic pathway. Moreover, BCDO2 prevented this induction of the apoptotic pathway by carotenoids. Thus, our study identifying BCDO2 as a crucial protective component against oxidative stress establishes this enzyme as mitochondrial carotenoid scavenger and a gatekeeper of the intrinsic apoptotic pathway. PMID:22764054

  1. [Escape mutants of hepatitis B virus].

    PubMed

    Jaramillo, Carlos Mario; Navas, María-Cristina

    2015-04-01

    The hepatitis B virus (HBV) infection is a public health problem worldwide. Considering HBV morbidity and mortality and the economic consequences .of this infection, policies and strategies to control it have been implemented, especially in regions where HBV infection is endemic, with high rates of vertical and horizontal infection. One of these strategies is the development of the recombinant vaccine. A 92% of the countries in the world have implemented the vaccine with a global coverage of 69%. The escape variants of HBV correspond to isolates with mutations in the sequence coding for the "a" determinant; these mutations result in changes in the amino acid sequence of the surface antigen (HBsAg) that prevent neutralization of viral particles by antibodies generated in response to vaccination or infection. The escape variants can infect vaccinated individuals and have been identified in the population of countries with different epidemiological patterns. PMID:26065452

  2. Escape of atmospheres and loss of water

    NASA Technical Reports Server (NTRS)

    Hunten, D. M.; Donahue, T. M.; Walker, J. C. G.; Kasting, J. F.

    1989-01-01

    The properties and limitations of several loss processes for atmospheric gases are presented and discussed. They include thermal loss (Jeans and hydrodynamic); nonthermal loss (all processes involve charged particles); and impact erosion, including thermal escape from a molten body heated by rapid accretion. Hydrodynamic escape, or 'blowoff', is of particular interest because it offers the prospect of processing large quantities of gas and enriching the remainder in heavy elements and isotopes. In a second part, the water budgets and likely evolutionary histories of Venus, Earth and Mars are assessed. Although it is tempting to associate the great D/H enrichment on Venus with loss of a large initial endowment, a steady state with juvenile water (perhaps from comets) is equally probable.

  3. Cold ion escape from the Martian ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, M.; Dubinin, E.; Andrews, D.; Barabash, S.; Nilsson, H.; Fedorov, A.

    2015-12-01

    We here report on new measurements of the escape flux of oxygen ions from Mars by combining the observations of the ASPERA-3 and MARSIS experiments on board the European Mars Express spacecraft. We show that in previous estimates of the total heavy ion escape flow the contribution of the cold ionospheric outflow with energies below 10 eV has been underestimated. Both case studies and the derived flow pattern indicate that the cold plasma observed by MARSIS and the superthermal plasma observed by ASPERA-3 move with the same bulk speed in most regions of the Martian tail. We determine maps of the tailside heavy ion flux distribution derived from mean ion velocity distributions sampled over 7 years. If we assume that the superthermal bulk speed derived from these long time averages of the ion distribution function represent the total plasma bulk speed we derive the total tailside plasma flux. Assuming cylindrical symmetry we determine the mean total escape rate for the years 2007-2014 at 2.8 ± 0.4 ×1025 atoms / s which is in good agreement with model estimates. A possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside.

  4. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, M.; Dubinin, E.; Andrews, D.; Nilsson, H.; Barabash, S.; Fedorov, A.

    2015-10-01

    We here report on new measurements of the escape flux of oxygen ions from Mars by combining the observations of the ASPERA-3 and MARSIS experiments on board the European Mars Express spacecraft. We show that in previous estimates of the total heavy ion escape flow the contribution of the coldionospheric outflow with energies below 10 eV has been underestimated. Both case studies and the derived flow pattern indicate that the cold plasma observed by MARSIS and the superthermal plasma observed by ASPERA-3 move with the same bulk speed in most regions of the Martian tail. We determine maps of the tailside heavy ion flux distribution derived from mean ion velocity distributions sampled over 7 years. If we assume that the superthermal bulk speed derived from these long time averages of the ion distribution function represent the total plasma bulk speed we derive the total tailside plasma flux. Assuming cylindrical symmetry we determine the mean total escape rate for the years 2007 to 2014 at 2.9±0.2×10 25 atoms/s which is in good agreement with model estimates. In this talk we will also try to compare these results with more recent observations by the MAVEN spacecraft. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  5. Scrunching: a novel escape gait in planarians

    NASA Astrophysics Data System (ADS)

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J.; Collins, Eva-Maria S.

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, ‘scrunching’, which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration.

  6. Scrunching: a novel escape gait in planarians.

    PubMed

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J; Collins, Eva-Maria S

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, 'scrunching', which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration. PMID:26356147

  7. Xenon Fractionation and Archean Hydrogen Escape

    NASA Technical Reports Server (NTRS)

    Zahnle, K. J.

    2015-01-01

    Xenon is the heaviest gas found in significant quantities in natural planetary atmospheres. It would seem the least likely to escape. Yet there is more evidence for xenon escape from Earth than for any element other than helium and perhaps neon. The most straightforward evidence is that most of the radiogenic Xe from the decay of (129)I (half-life 15.7 Myr) and (244)Pu (half-life 81 Myr) that is Earth's birthright is missing. The missing xenon is often attributed to the impact erosion of early atmospheres of Earth and its ancestors. It is obvious that if most of the radiogenic xenon were driven off by impacts, most of the rest of the atmophiles fared the same fate. The other line of evidence is in the nonradiogenic isotopes of xenon and its silent partner, krypton. Atmospheric xenon is strongly mass fractionated (at about 4% per amu) compared to any known solar system source (Figure 1). This is in stark contrast to krypton, which may not be fractionated at all: atmospheric Kr is slightly heavier than solar Kr (at about 0.5% per amu), but it is the same as in carbonaceous chondrites. Nonradiogenic xenon is also under abundant relative to krypton (the so-called "missing xenon" problem). Together these observations imply that xenon has been subject to fractionating escape and krypton not.

  8. CRV Escape Trajectories from the ISS

    NASA Technical Reports Server (NTRS)

    Foti, Tony M.

    1999-01-01

    The Crew Return Vehicle (CRV) slated for use on the International Space Station (ISS) provides a safe return for up to seven crew members under various emergency conditions. One of the most demanding situations for executing the escape involves separating from a tumbling ISS Current requirements specify a maximum Root Sum Square (RSS) tumble rate of 2 degrees/second, with the additional requirement for an expedited departure from any ISS attitude. The design of a trajectory that ensures no re-contact with the ISS poses many challenges on the Guidance, Navigation, and Control (GN&C) system of the vehicle. To ensure no re-contact the trajectory design employs a two burn sequence, with the first burn preventing near-term collision and the second burn preventing far-field re-contact This presentation describes the approach used to design and to evaluate trajectories for CRV departure from the baselined location on the ISS Node 3 starboard. This approach involved performing a parametric search of selected control variables vital in escaping the tumbling ISS The presentation provides a candidate targeting methodology for escape using minimal information from available navigation devices, and presents the quantitative results from the analysis.

  9. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape...

  10. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape...

  11. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  12. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  13. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  14. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  15. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  16. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  17. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST... Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l) and (m) of this section, there must be at least two means of escape, exclusive of windows...

  18. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST... Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l) and (m) of this section, there must be at least two means of escape, exclusive of windows...

  19. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST... Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l) and (m) of this section, there must be at least two means of escape, exclusive of windows...

  20. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  1. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Means of escape. 116.500 Section 116.500 Shipping COAST... and Embarkation Station Requirements § 116.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  2. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  3. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Means of escape. 116.500 Section 116.500 Shipping COAST... and Embarkation Station Requirements § 116.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  4. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  5. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Means of escape. 116.500 Section 116.500 Shipping COAST... and Embarkation Station Requirements § 116.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  6. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  7. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fraenz, M.; Dubinin, E.; Wei, Y.; Woch, J. G.; Morgan, D. D.; Barabash, S. V.; Lundin, R. N.; Fedorov, A.

    2012-12-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. We first use support from the MARSIS radar experiment for some orbits with fortunate observation geometry. Here we have observed a transterminator flow of O+ and O2+ ions with a super-sonic velocity of around 5km/s and fluxes of 0.8x10^9/cm^2s. If we assume a symmetric flux around the terminator this corresponds to an ion flow of 3.1x10^25/s half of which is expected to escape from Mars (Fraenz et al, 2010). This escape flux is significantly higher than previously observed on the tailside of Mars, we discuss possible reasons for the difference. Since 2008 the MARSIS radar does nightside local plasma density measurement which often coincide with ASPERA-3 measurements. In a new analysis of the combined nightside datasets (Fig. 1) we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 R_M the flux settles at a constant value (Fig. 2) which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvenic regime.; Median oxygen ion flux reconstructed by combining ion velocity observations of the Mars Express ASPERA-3 IMA sensor and local plasma density observations by the MARSIS radar. Each bin value is the median from observations on about 3000 orbits between May 2007 and July 2011. Horizontal axis is MSO X-axis (Sun towards the left), vertical axis is vertical distance from MSO X-axis. ; Ring median flux of cylindrical ring regions of all bins shown in previous figure. The different colors show median fluxes

  8. Hydrodynamical Modeling of Hydrogen Escape from Rocky Planets

    NASA Astrophysics Data System (ADS)

    Barringer, Daniel; Zugger, M.; Kasting, J.

    2013-01-01

    Hydrogen escape affects both the composition of primitive atmospheres of terrestrial planets and the planet’s state of oxidation. On Mars, hydrogen escape played a critical role in how long the planet remained in a warm wet state amenable to life. For both solar and extrasolar planets, hydrogen-rich atmospheres are better candidates for originating life by way of Miller-Urey-type prebiotic synthesis. However, calculating the rate of atmospheric hydrogen escape is difficult, for a number of reasons. First, the escape can be controlled either by diffusion through the homopause or by conditions in the upper atmosphere, whichever is slower. Second, both thermal and non-thermal escape mechanisms are typically important. Third, thermal escape itself can be subdivided into Jeans escape (thin upper atmosphere), and hydrodynamic escape, and hydrodynamic escape can be further subdivided into transonic escape and slower subsonic escape, depending on whether the exobase occurs above or below the sonic point. Additionally, the rate of escape for real terrestrial planet atmospheres, which are not 100% hydrogen, depends upon the concentration of infrared coolants, and upon heating and photochemistry driven largely by extreme ultraviolet (EUV) radiation. We have modified an existing 1-D model of hydrodynamic escape (F. Tian et al., JGR, 2008) to work in the high- hydrogen regime. Calculations are underway to determine hydrogen escape rates as a function of atmospheric H2 mixing ratio and the solar EUV flux. We will compare these rates with the estimated upper limit on the escape rate based on diffusion. Initial results for early Earth and Mars will later be extended to rocky exoplanets.

  9. Risks incurred by hydrogen escaping from containers and conduits

    SciTech Connect

    Swain, M.R.; Grilliot, E.S.; Swain, M.N.

    1998-08-01

    This paper is a discussion of a method for hydrogen leak classification. Leaks are classified as; gas escapes into enclosed spaces, gas escapes into partially enclosed spaces (vented), and gas escapes into unenclosed spaces. Each of the three enclosure classifications is further divided into two subclasses; total volume of hydrogen escaped and flow rate of escaping hydrogen. A method to aid in risk assessment determination in partially enclosed spaces is proposed and verified for several enclosure geometries. Examples are discussed for additional enclosure geometries.

  10. Enzyme Informatics

    PubMed Central

    Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika

    2012-01-01

    Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471

  11. Organization of the Mitochondrial Apoptotic BAK Pore

    PubMed Central

    Aluvila, Sreevidya; Mandal, Tirtha; Hustedt, Eric; Fajer, Peter; Choe, Jun Yong; Oh, Kyoung Joon

    2014-01-01

    The multidomain pro-apoptotic Bcl-2 family proteins BAK and BAX are believed to form large oligomeric pores in the mitochondrial outer membrane during apoptosis. Formation of these pores results in the release of apoptotic factors including cytochrome c from the intermembrane space into the cytoplasm, where they initiate the cascade of events that lead to cell death. Using the site-directed spin labeling method of electron paramagnetic resonance (EPR) spectroscopy, we have determined the conformational changes that occur in BAK when the protein targets to the membrane and forms pores. The data showed that helices α1 and α6 disengage from the rest of the domain, leaving helices α2-α5 as a folded unit. Helices α2-α5 were shown to form a dimeric structure, which is structurally homologous to the recently reported BAX “BH3-in-groove homodimer.” Furthermore, the EPR data and a chemical cross-linking study demonstrated the existence of a hitherto unknown interface between BAK BH3-in-groove homodimers in the oligomeric BAK. This novel interface involves the C termini of α3 and α5 helices. The results provide further insights into the organization of the BAK oligomeric pores by the BAK homodimers during mitochondrial apoptosis, enabling the proposal of a BAK-induced lipidic pore with the topography of a “worm hole.” PMID:24337568

  12. The Modulation of Apoptotic Pathways by Gammaherpesviruses

    PubMed Central

    Banerjee, Shuvomoy; Uppal, Timsy; Strahan, Roxanne; Dabral, Prerna; Verma, Subhash C.

    2016-01-01

    Apoptosis or programmed cell death is a tightly regulated process fundamental for cellular development and elimination of damaged or infected cells during the maintenance of cellular homeostasis. It is also an important cellular defense mechanism against viral invasion. In many instances, abnormal regulation of apoptosis has been associated with a number of diseases, including cancer development. Following infection of host cells, persistent and oncogenic viruses such as the members of the Gammaherpesvirus family employ a number of different mechanisms to avoid the host cell’s “burglar” alarm and to alter the extrinsic and intrinsic apoptotic pathways by either deregulating the expressions of cellular signaling genes or by encoding the viral homologs of cellular genes. In this review, we summarize the recent findings on how gammaherpesviruses inhibit cellular apoptosis via virus-encoded proteins by mediating modification of numerous signal transduction pathways. We also list the key viral anti-apoptotic proteins that could be exploited as effective targets for novel antiviral therapies in order to stimulate apoptosis in different types of cancer cells. PMID:27199919

  13. Apoptotic cell death induced by intracellular proteolysis.

    PubMed

    Williams, M S; Henkart, P A

    1994-11-01

    To mimic the injection of granzymes into target cells by cytotoxic lymphocytes or the activation of endogenous proteases in programmed cell death, the proteases chymotrypsin, proteinase K, or trypsin were loaded into the cytoplasm of several different cell types using the osmotic lysis of pinosomes technique. Internalization of these proteases caused cell lysis within several hours, accompanied by extensive nuclear damage in most but not all combinations of target cells and proteases. This nuclear damage, quantitated by DNA release from nuclei, was associated with apoptotic features including DNA fragmentation into nucleosomal ladders, chromatin condensation, nuclear fragmentation, and membrane blebbing. Agents reported to block programmed cell death, including aurintricarboxylic acid, inhibitors of energy metabolism, and protein or RNA synthesis, failed to block this protease-induced death, although some inhibited nuclear damage. In separate experiments, introduction of staphylococcal nuclease into cells led to near complete (at least 75% of total) nucleosomal DNA fragmentation within 6 to 8 h. Condensation of chromatin did not accompany this fragmentation to the same extent, and there was approximately a 10-h lag between half-maximal DNA fragmentation and 50% loss of membrane integrity. The results suggest that activation of intracellular proteases during cell death by any molecular pathway could give rise to apoptotic morphology and DNA fragmentation. PMID:7930626

  14. Genistein suppresses the mitochondrial apoptotic pathway in hippocampal neurons in rats with Alzheimer's disease

    PubMed Central

    Wang, Yan; Cai, Biao; Shao, Jing; Wang, Ting-ting; Cai, Run-ze; Ma, Chang-ju; Han, Tao; Du, Jun

    2016-01-01

    Genistein is effective against amyloid-β toxicity, but the underlying mechanisms are unclear. We hypothesized that genistein may protect neurons by inhibiting the mitochondrial apoptotic pathway, and thereby play a role in the prevention of Alzheimer’s disease. A rat model of Alzheimer’s disease was established by intraperitoneal injection of D-galactose and intracerebral injection of amyloid-β peptide (25–35). In the genistein treatment groups, a 7-day pretreatment with genistein (10, 30, 90 mg/kg) was given prior to establishing Alzheimer’s disease model, for 49 consecutive days. Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling assay demonstrated a reduction in apoptosis in the hippocampus of rats treated with genistein. Western blot analysis showed that expression levels of capase-3, Bax and cytochrome c were decreased compared with the model group. Furthermore, immunohistochemical staining revealed reductions in cytochrome c and Bax immunoreactivity in these rats. Morris water maze revealed a substantial shortening of escape latency by genistein in Alzheimer’s disease rats. These findings suggest that genistein decreases neuronal loss in the hippocampus, and improves learning and memory ability. The neuroprotective effects of genistein are associated with the inhibition of the mitochondrial apoptotic pathway, as shown by its ability to reduce levels of caspase-3, Bax and cytochrome c.

  15. Galectin-1 and Galectin-3 induce mitochondrial apoptotic pathway in Jurkat cells

    NASA Astrophysics Data System (ADS)

    Vasil'eva, O. A.; Isaeva, A. V.; Prokhorenko, T. S.; Zima, A. P.; Novitsky, V. V.

    2016-08-01

    Cellular malignant transformation is often accompanied by increased gene expression of low-molecular proteins of lectins family-galectins. But it is unknown how galectins promote tumor growth and malignization. Galectins-1 and galectin-3 are thought to be possible immunoregulators exerting their effects by regulating the balance of CD4+ lymphocytes. In addition it is known that tumor cells overexpressing galectins are capable of escaping immunological control, causing apoptosis of lymphocytes. The aim of the study is to investigate the role of galectin-1 and galectin-3 in the implementation of mitochondrial apoptotic pathway in Jurkat cells. Methods: Jurkat cells were used as a model for the study of T-lymphocytes. Jurkat cells were activated with antibodies to CD3 and CD28 and cultured with recombinant galectin-1 and -3. Apoptosis of Jurkat cells and depolarization of the mitochondrial membrane were assessed by flow cytometry. It was found that galectin-1 and galectin-3 have a dose-dependent pro-apoptotic effect on Jurkat cells in vitro and enlarge the number of cells with decreased mitochondrial membrane potential compared with intact cells.

  16. Apoptotic cell clearance: basic biology and therapeutic potential

    PubMed Central

    Poon, Ivan K. H.; Lucas, Christopher D.

    2014-01-01

    Prompt removal of apoptotic cells by phagocytes is important for maintaining tissue homeostasis. The molecular and cellular events that underpin apoptotic cell recognition and uptake, and the subsequent biological responses are increasingly better defined. The detection and disposal of apoptotic cells generally promote an anti-inflammatory response at the tissue level, as well as immunological tolerance. Consequently, defects in apoptotic cell clearance have been linked with a variety of inflammatory diseases and autoimmunity. Conversely, under certain conditions such as killing tumour cells by specific cell death inducers, the recognition of apoptotic tumour cells can promote an immunogenic response and anti-tumour immunity. Here, we review the current understanding of the complex process of apoptotic cell clearance in physiology and pathology, and discuss how this knowledge could be harnessed for new therapeutic strategies. PMID:24481336

  17. Dual-functional bio-derived nanoparticulates for apoptotic antitumor therapy.

    PubMed

    Ding, Yang; Wang, Yazhe; Opoku-Damoah, Yaw; Wang, Cheng; Shen, Lingjia; Yin, Lifang; Zhou, Jianping

    2015-12-01

    The application of bio-derived nanoparticulates has gained a remarkable degree of interest as a promising sustained-release, site-targeted and completely biodegradable delivery system for chemotherapeutics. We hereby introduce a dual-functionalized biomimetic nanovector, cell-penetrating peptide (CPP)-anchored recombinant high density lipoproteins (cp-rHDL), which affords high payload and improved targeting of gambogic acid (GA), a therapeutic agent for apoptotic antitumor therapy. GA-loaded cp-rHDL nanoparticles (cp-rHDL/GA) consisted of hydrophobic core modulating GA, apolipoprotein A-I (apo A-I) for attractive integrating and tumor-homing, and lipophilic anchored R6H4 (RRRRRRHHHH, a pH-responsive CPP) offering a pH-controlled penetrating potential. Upon stepwise incubation with apo A-I and R6H4, cp-rHDL/GA presented several merits, including desirable physicochemical properties, superior biostability, and favorable buffering capacity resulting in proton sponge effect. Synergistic intracellular mechanism for scavenger receptor class B type I (SR-BI)-mediated direct transmembrane delivery, and pH-responsive R6H4 associated endocytotic pathway with rapid endo-lysosomal escape was also observed. This tailored cp-rHDL/GA displayed remarkable cytotoxicity and apoptotic effect via triggering p53 pathway, and provided approximately 5-fold increase in IC50 compared to free GA. Moreover, this rational biomimetic therapeutic strategy attained superior tumor accumulation and significant inhibition of tumor growth in HepG2 xenograft tumor animal models without measurable adverse effect. Results of this study demonstrated that bio-derived cp-rHDL/GA presents pH-responsive penetrating potential and efficient cellular internalization. This dual-functionalization model will open an avenue for exploration of multi-functional bio-derived drug delivery, thereby rendering potential broad applications in apoptotic anticancer therapy. PMID:26344366

  18. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, Markus; Dubinin, Eduard; Andrews, David; Nilsson, Hans; Fedorov, Andrei

    2014-05-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. The ion sensor IMA of this experiment has in principle a low-energy cut-off at 10eV but in negative spacecraft charging cold ions are lifted into the range of measurement but the field of view is restricted to about 4x360 deg. In a recent paper Nilsson et al. (Earth Planets Space, 64, 135, 2012) tried to use the method of long-time averaged distribution functions to overcome these constraints. In this paper we first use the same method to show that we get results consistent with this when using ASPERA-3 observations only. But then we can show that these results are inconsistent with observations of the local plasma density by the MARSIS radar instrument on board Mars Express. We demonstrate that the method of averaged distribution function can deliver the mean flow speed of the plasma but the low-energy cut-off does usually not allow to reconstruct the density. We then combine measurements of the cold ion flow speed with the plasma density observations of MARSIS to derive the cold ion flux. In an analysis of the combined nightside datasets we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 Martian radii the flux settles at a constant value which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  19. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    PubMed Central

    2011-01-01

    Background Runt-related transcription factor 3 (RUNX3) is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC). Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91%) and tissues (90%). RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis. PMID:21205319

  20. X-chromosome inactivation and escape

    PubMed Central

    DISTECHE, CHRISTINE M.; BERLETCH, JOEL B.

    2016-01-01

    X-chromosome inactivation, which was discovered by Mary Lyon in 1961 results in random silencing of one X chromosome in female mammals. This review is dedicated to Mary Lyon, who passed away last year. She predicted many of the features of X inactivation, for e.g., the existence of an X inactivation center, the role of L1 elements in spreading of silencing and the existence of genes that escape X inactivation. Starting from her published work here we summarize advances in the field. PMID:26690513

  1. Suicide as escape from psychotic panic.

    PubMed

    Goldblatt, Mark J; Ronningstam, Elsa; Schechter, Mark; Herbstman, Benjamin; Maltsberger, John T

    2016-01-01

    Suicides of patients in states of acute persecutory panic may be provoked by a subjective experience of helpless terror threatening imminent annihilation or dismemberment. These patients are literally scared to death and try to run away. They imagine suicide is survivable and desperately attempt to escape from imaginary enemies. These states of terror occur in a wide range of psychotic illnesses and are often associated with command hallucinations and delusions. In this article, the authors consider the subjective experience of persecutory panic and the suicide response as an attempt to flee from danger. PMID:27294586

  2. Serial Escape System For Aircraft Crews

    NASA Technical Reports Server (NTRS)

    Wood, Kenneth E.

    1990-01-01

    Emergency escape system for aircraft and aerospace vehicles ejects up to seven crewmembers, one by one, within 120 s. Intended for emergencies in which disabled craft still in stable flight at no more than 220 kn (113 m/s) equivalent airspeed and sinking no faster than 110 ft/s (33.5 m/s) at altitudes up to 50,000 ft (15.2 km). Ejection rockets load themselves from magazine after each crewmember ejected. Jumpmaster queues other crewmembers and helps them position themselves on egress ramp. Rockets pull crewmembers clear of aircraft structure. Provides orderly, controlled exit and avoids ditching at sea or landing in rough terrain.

  3. Escape Artists of the X Chromosome.

    PubMed

    Balaton, Bradley P; Brown, Carolyn J

    2016-06-01

    Inactivation of one X chromosome in mammalian females achieves dosage compensation between XX females and XY males; however, over 15% of human X-linked genes continue to be expressed from the inactive X chromosome. New genomic methodologies have improved our identification and characterization of these escape genes, revealing the importance of DNA sequence, chromatin structure, and chromosome ultrastructure in regulating expression from an otherwise inactive chromosome. Study of these exceptions to the rule of silencing highlights the interconnectedness of chromatin and chromosome structure in X-chromosome inactivation (XCI). Recent advances also demonstrate the importance of these genes in sexually dimorphic disease risk, particularly cancer. PMID:27103486

  4. Intracellular Staphylococcus aureus Escapes the Endosome and Induces Apoptosis in Epithelial Cells

    PubMed Central

    Bayles, Kenneth W.; Wesson, Carla A.; Liou, Linda E.; Fox, Lawrence K.; Bohach, Gregory A.; Trumble, W. R.

    1998-01-01

    We examined the invasion of an established bovine mammary epithelial cell line (MAC-T) by a Staphylococcus aureus mastitis isolate to study the potential role of intracellular survival in the persistence of staphylococcal infections. S. aureus cells displayed dose-dependent invasion of MAC-T cells and intracellular survival. An electron microscopic examination of infected cells indicated that the bacteria induced internalization via a mechanism involving membrane pseudopod formation and then escaped into the cytoplasm following lysis of the endosomal membrane. Two hours after the internalization of S. aureus, MAC-T cells exhibited detachment from the matrix, rounding, a mottled cell membrane, and vacuolization of the cytoplasm, all of which are indicative of cells undergoing programmed cell death (apoptosis). By 18 h, the majority of the MAC-T cell population exhibited an apoptotic morphology. Other evidence for apoptosis was the generation of MAC-T cell DNA fragments differing in size by increments of approximately 180 bp and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling of the fragmented nuclear DNA of the infected host cells. These results demonstrate that after internalization S. aureus escapes the endosome and induces apoptosis in nonprofessional phagocytes. PMID:9423876

  5. Enzymes, Industrial

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes serve key roles in numerous biotechnology processes and products that are commonly encountered in the forms of food and beverages, cleaning supplies, clothing, paper products, transportation fuels, pharmaceuticals, and monitoring devices. Enzymes can display regio- and stereo-specificity, p...

  6. Understanding Enzymes.

    ERIC Educational Resources Information Center

    Sinnott, M. L.

    1979-01-01

    Describes the way enzymes operate through reaction energetics, and explains that most of the catalytic power of enzymes lies in the strong noncovalent forces responsible for initial binding of substrate, which are only manifested at the transition state of the reaction. (Author/GA)

  7. Soil Enzymes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The functionality and resilience of natural and managed ecosystems mainly rely on the metabolic abilities of microbial communities, the main source of enzymes in soils. Enzyme mediated reactions are critical in the decomposition of organic matter, cycling of nutrients, and in the breakdown of herbic...

  8. The effects of steady swimming on fish escape performance.

    PubMed

    Anwar, Sanam B; Cathcart, Kelsey; Darakananda, Karin; Gaing, Ashley N; Shin, Seo Yim; Vronay, Xena; Wright, Dania N; Ellerby, David J

    2016-06-01

    Escape maneuvers are essential to the survival and fitness of many animals. Escapes are frequently initiated when an animal is already in motion. This may introduce constraints that alter the escape performance. In fish, escape maneuvers and steady, body caudal fin (BCF) swimming are driven by distinct patterns of curvature of the body axis. Pre-existing muscle activity may therefore delay or diminish a response. To quantify the performance consequences of escaping in flow, escape behavior was examined in bluegill sunfish (Lepomis macrochirus) in both still-water and during steady swimming. Escapes executed during swimming were kinematically less variable than those made in still-water. Swimming escapes also had increased response latencies and lower peak velocities and accelerations than those made in still-water. Performance was also lower for escapes made up rather than down-stream, and a preference for down-stream escapes may be associated with maximizing performance. The constraints imposed by pre-existing motion and flow, therefore, have the potential to shape predator-prey interactions under field conditions by shifting the optimal strategies for both predators and prey. PMID:27161016

  9. Escape from X Inactivation Varies in Mouse Tissues

    PubMed Central

    Yang, Fan; Shendure, Jay; Noble, William S.; Disteche, Christine M.; Deng, Xinxian

    2015-01-01

    X chromosome inactivation (XCI) silences most genes on one X chromosome in female mammals, but some genes escape XCI. To identify escape genes in vivo and to explore molecular mechanisms that regulate this process we analyzed the allele-specific expression and chromatin structure of X-linked genes in mouse tissues and cells with skewed XCI and distinguishable alleles based on single nucleotide polymorphisms. Using a binomial model to assess allelic expression, we demonstrate a continuum between complete silencing and expression from the inactive X (Xi). The validity of the RNA-seq approach was verified using RT-PCR with species-specific primers or Sanger sequencing. Both common escape genes and genes with significant differences in XCI status between tissues were identified. Such genes may be candidates for tissue-specific sex differences. Overall, few genes (3–7%) escape XCI in any of the mouse tissues examined, suggesting stringent silencing and escape controls. In contrast, an in vitro system represented by the embryonic-kidney-derived Patski cell line showed a higher density of escape genes (21%), representing both kidney-specific escape genes and cell-line specific escape genes. Allele-specific RNA polymerase II occupancy and DNase I hypersensitivity at the promoter of genes on the Xi correlated well with levels of escape, consistent with an open chromatin structure at escape genes. Allele-specific CTCF binding on the Xi clustered at escape genes and was denser in brain compared to the Patski cell line, possibly contributing to a more compartmentalized structure of the Xi and fewer escape genes in brain compared to the cell line where larger domains of escape were observed. PMID:25785854

  10. Structured Observations Reveal Slow HIV-1 CTL Escape

    PubMed Central

    Roberts, Hannah E.; Hurst, Jacob; Robinson, Nicola; Brown, Helen; Flanagan, Peter; Vass, Laura; Fidler, Sarah; Weber, Jonathan; Babiker, Abdel; Phillips, Rodney E.; McLean, Angela R.; Frater, John

    2015-01-01

    The existence of viral variants that escape from the selection pressures imposed by cytotoxic T-lymphocytes (CTLs) in HIV-1 infection is well documented, but it is unclear when they arise, with reported measures of the time to escape in individuals ranging from days to years. A study of participants enrolled in the SPARTAC (Short Pulse Anti-Retroviral Therapy at HIV Seroconversion) clinical trial allowed direct observation of the evolution of CTL escape variants in 125 adults with primary HIV-1 infection observed for up to three years. Patient HLA-type, longitudinal CD8+ T-cell responses measured by IFN-γ ELISpot and longitudinal HIV-1 gag, pol, and nef sequence data were used to study the timing and prevalence of CTL escape in the participants whilst untreated. Results showed that sequence variation within CTL epitopes at the first time point (within six months of the estimated date of seroconversion) was consistent with most mutations being transmitted in the infecting viral strain rather than with escape arising within the first few weeks of infection. Escape arose throughout the first three years of infection, but slowly and steadily. Approximately one third of patients did not drive any new escape in an HLA-restricted epitope in just under two years. Patients driving several escape mutations during these two years were rare and the median and modal numbers of new escape events in each patient were one and zero respectively. Survival analysis of time to escape found that possession of a protective HLA type significantly reduced time to first escape in a patient (p = 0.01), and epitopes escaped faster in the face of a measurable CD8+ ELISpot response (p = 0.001). However, even in an HLA matched host who mounted a measurable, specific, CD8+ response the average time before the targeted epitope evolved an escape mutation was longer than two years. PMID:25642847

  11. The escape model for Galactic cosmic rays

    NASA Astrophysics Data System (ADS)

    Giacinti, G.; Kachelrieß, M.; Semikoz, D. V.

    2015-08-01

    The escape model explains the cosmic ray (CR) knee by energy-dependent CR leakage from the Milky Way, with an excellent fit to all existing data. We test this model calculating the trajectories of individual CRs in the Galactic magnetic field. We find that the CR escape time τesc(E) exhibits a knee-like structure around E/Z = few × 1015 eV for small coherence lengths and strengths of the turbulent magnetic field. The resulting intensities for different groups of nuclei are consistent with the ones determined by KASCADE and KASCADE-Grande, using simple power-laws as injection spectra. The transition from Galactic to extragalactic CRs happens in this model at low energies and is terminated below ≈ 3 × 1018 eV. The intermediate energy region up to the ankle is populated by CRs accelerated in starburst galaxies. This model provides a good fit to ln(A) data, while the estimated CR dipole anisotropy is close to, or below, upper limits in the energy range 1017 - 1018 eV. The phase of the dipole is expected to change between 1 × 1017 and 3 × 1018 eV.

  12. A New Maneuver for Escape Trajectories

    NASA Technical Reports Server (NTRS)

    Adams, Robert B.

    2008-01-01

    This presentation put forth a new maneuver for escape trajectories and specifically sought to find an analytical approximation for medium thrust trajectories. In most low thrust derivations the idea is that escape velocity is best achieved by accelerating along the velocity vector. The reason for this is that change in specific orbital energy is a function of velocity and acceleration. However, Levin (1952) suggested that while this is a locally optimal solution it might not be a globally optimal one. Turning acceleration inward would drop periapse giving a higher velocity later in the trajectory. Acceleration at that point would be dotted against a higher magnitude V giving a greater rate of change of mechanical energy. The author then hypothesized that decelerating from the initial orbit and then accelerating at periapse would not lead to a gain in greater specific orbital energy--however, the hypothesis was incorrect. After considerable derivation it was determined that this new maneuver outperforms a direct burn when the overall DeltaV budget exceeds the initial orbital velocity (the author has termed this the Heinlein maneuver). The author provides a physical explanation for this maneuver and presents optimization analyses.

  13. Escape mechanisms of dust in Io

    NASA Astrophysics Data System (ADS)

    Flandes, A.

    The injection of material into the jovian magnetosphere through Io's volcanic activity makes possible the formation of structures such as the plasma torus and the dust ballerina skirt. Io's high temperature volcanism produces spectacular plumes, but even the tallest plumes, as those of Pelen Patera, will not produce enough energy to defeat the gravitational attraction of Io. The fact is that dust escapes from Io, which implies that a second mechanism is acting on the grains. Grains brought to the top of the highest plumes by the volcanic forces are still under Io's gravitational pull, but need only a minimum charge (~10-1 4 C) so that the Lorentz force due to the Jovian magnetic field equilibrates this attraction. In the volcanic vents, the escape velocity of the ejected material and its own density produces enough collisions to create charges. On top of the highest plumes (~500km) charged grains are exposed to the plasma torus that co-rotates rigidly with Jupiter and, due to the relative velocity among Io and the torus, the grains will be dragged away from Io. As it is well known, these dust grains will also be dragged away from Jupiter.

  14. Escape dynamics of many hard disks.

    PubMed

    Taniguchi, Tooru; Murata, Hiroki; Sawada, Shin-Ichi

    2014-11-01

    Many-particle effects in escapes of hard disks from a square box via a hole are discussed in a viewpoint of dynamical systems. Starting from N disks in the box at the initial time, we calculate the probability P_{n}(t) for at least n disks to remain inside the box at time t for n=1,2,...,N. At early times, the probabilities P_{n}(t),n=2,3,...,N-1, are described by superpositions of exponential decay functions. On the other hand, after a long time the probability P_{n}(t) shows a power-law decay ∼t^{-2n} for n≠1, in contrast to the fact that it decays with a different power law ∼t^{-n} for cases without any disk-disk collision. Chaotic or nonchaotic properties of the escape systems are discussed by the dynamics of a finite-time largest Lyapunov exponent, whose decay properties are related with those of the probability P_{n}(t). PMID:25493874

  15. Orbital Effects on Mercury's Escaping Sodium Exosphere

    NASA Technical Reports Server (NTRS)

    Schmidt, Carl A.; Wilson, Jody K.; Baumgardner, Jeffrey; Mendillo, Michael

    2009-01-01

    We present results from coronagraphic imaging of Mercury's sodium tail over a 7 deg field of view. Several sets of observations made at the McDonald Observatory since May 2007 show a tail of neutral sodium atoms stretching more than 1000 Mercury radii (R(sub m)) in length, or a full degree of sky. However, no tail was observed extending beyond 120 R(sub m) during the January 2008 MESSENGER Fly-by period, or during a similar orbital phase of Mercury in July 2008. Large changes in Mercury's heliocentric radial velocity cause Doppler shifts about the Fraunhofer absorption features; the resultant change in solar flux and radiation pressure is the primary cause of the observed variation in tail brightness. Smaller fluctuations in brightness may exist due to changing source rates at the surface, but we have no explicit evidence for such changes in this data set. The effects of radiation pressure on Mercury's escaping atmosphere are investigated using seven observations spanning different orbital phases. Total escape rates of atmospheric sodium are estimated to be between 5 and 13 x 10(exp 23) atoms/s and show a correlation to radiation pressure. Candidate sources of Mercury's sodium exosphere include desorption by UV sunlight, thermal desorption, solar wind channeled along Mercury's magnetic field lines, and micro-meteor impacts. Wide-angle observations of the full extent of Mercury's sodium tail offer opportunities to enhance our understanding of the time histories of these source rates.

  16. How some T cells escape tolerance induction.

    PubMed

    Gammon, G; Sercarz, E

    1989-11-01

    A feature common to many animal models of autoimmune disease, for example, experimental allergic encephalomyelitis, experimental autoimmune myasthenia gravis and collagen-induced arthritis, is the presence of self-reactive T cells in healthy animals, which are activated to produce disease by immunization with exogenous antigen. It is unclear why these T cells are not deleted during ontogeny in the thymus and, having escaped tolerance induction, why they are not spontaneously activated by self-antigen. To investigate these questions, we have examined an experimental model in which mice are tolerant to an antigen despite the presence of antigen-reactive T cells. We find that the T cells that escape tolerance induction are specific for minor determinants on the antigen. We propose that these T cells evade tolerance induction because some minor determinants are only available in relatively low amounts after in vivo processing of the whole antigen. For the same reason, these T cells are not normally activated but can be stimulated under special circumstances to circumvent tolerance. PMID:2478888

  17. F111 Crew Escape Module pilot parachute

    SciTech Connect

    Tadios, E.L.

    1991-01-01

    A successfully deployment of a parachute system highly depends on the efficiency of the deployment device and/or method. There are several existing methods and devices that may be considered for a deployment system. For the F111 Crew Escape Module (CEM), the recovery parachute system deployment is initiated by the firing of a catapult that ejects the complete system from the CEM. At first motion of the pack, a drogue gun is fired, which deploys the pilot parachute system. The pilot parachute system then deploys the main parachute system, which consists of a cluster of three 49-ft diameter parachutes. The pilot parachute system which extracts the F111 Crew Escape Module recovery parachute system must provide reasonable bag strip velocities throughout the flight envelope (10 psf to 300 psf). The pilot parachute system must, therefore, have sufficient drag area at the lower dynamic pressures and a reduced drag area at the high end of the flight envelope. The final design that was developed was a dual parachute system which consists of a 5-ft diameter guide surface parachute tethered inside a 10-ft diameter flat circular parachute. The high drag area is sustained at the low dynamic pressures by keeping both parachutes intact. The drag area is reduced at the higher extreme by allowing the 10-ft parachute attachment to fail. The discussions to follow describe in detail how the system was developed. 4 refs., 10 figs., 2 tabs.

  18. Circulating IgM Requires Plasma Membrane Disruption to Bind Apoptotic and Non-Apoptotic Nucleated Cells and Erythrocytes

    PubMed Central

    Hesketh, Emily E.; Dransfield, Ian; Kluth, David C.; Hughes, Jeremy

    2015-01-01

    Autoimmunity is associated with defective phagocytic clearance of apoptotic cells. IgM deficient mice exhibit an autoimmune phenotype consistent with a role for circulating IgM antibodies in apoptotic cell clearance. We have extensively characterised IgM binding to non-apoptotic and apoptotic mouse thymocytes and human Jurkat cells using flow cytometry, confocal imaging and electron microscopy. We demonstrate strong specific IgM binding to a subset of Annexin-V (AnnV)+PI (Propidium Iodide)+ apoptotic cells with disrupted cell membranes. Electron microscopy studies indicated that IgM+AnnV+PI+ apoptotic cells exhibited morphologically advanced apoptosis with marked plasma membrane disruption compared to IgM-AnnV+PI+ apoptotic cells, suggesting that access to intracellular epitopes is required for IgM to bind. Strong and comparable binding of IgM to permeabilised non-apoptotic and apoptotic cells suggests that IgM bound epitopes are 'apoptosis independent' such that IgM may bind any cell with profound disruption of cell plasma membrane integrity. In addition, permeabilised erythrocytes exhibited significant IgM binding thus supporting the importance of cell membrane epitopes. These data suggest that IgM may recognize and tag damaged nucleated cells or erythrocytes that exhibit significant cell membrane disruption. The role of IgM in vivo in conditions characterized by severe cell damage such as ischemic injury, sepsis and thrombotic microangiopathies merits further exploration. PMID:26121639

  19. Crystal Structure of CRN-4: Implications for Domain Function in Apoptotic DNA Degradation▿

    PubMed Central

    Hsiao, Yu-Yuan; Nakagawa, Akihisa; Shi, Zhonghao; Mitani, Shohei; Xue, Ding; Yuan, Hanna S.

    2009-01-01

    Cell death related nuclease 4 (CRN-4) is one of the apoptotic nucleases involved in DNA degradation in Caenorhabditis elegans. To understand how CRN-4 is involved in apoptotic DNA fragmentation, we analyzed CRN-4's biochemical properties, in vivo cell functions, and the crystal structures of CRN-4 in apo-form, Mn2+-bound active form, and Er3+-bound inactive form. CRN-4 is a dimeric nuclease with the optimal enzyme activity in cleaving double-stranded DNA in apoptotic salt conditions. Both mutational studies and the structures of the Mn2+-bound CRN-4 revealed the geometry of the functional nuclease active site in the N-terminal DEDDh domain. The C-terminal domain, termed the Zn-domain, contains basic surface residues ideal for nucleic acid recognition and is involved in DNA binding, as confirmed by deletion assays. Cell death analysis in C. elegans further demonstrated that both the nuclease active site and the Zn-domain are required for crn-4's function in apoptosis. Combining all of the data, we suggest a structural model where chromosomal DNA is bound at the Zn-domain and cleaved at the DEDDh nuclease domain in CRN-4 when the cell is undergoing apoptosis. PMID:18981218

  20. Nitric oxide as a pro-apoptotic as well as anti-apoptotic modulator.

    PubMed

    Choi, Byung-Min; Pae, Hyun-Ock; Jang, Seon Il; Kim, Young-Myeong; Chung, Hun-Taeg

    2002-01-31

    Nitric oxide (NO), synthesized from L-arginine by NO synthases, is a small, lipophilic, diffusible, highly reactive molecule with dichotomous regulatory roles in many biological events under physiological and pathological conditions. NO can promote apoptosis (pro-apoptosis) in some cells, whereas it inhibits apoptosis (anti-apoptosis) in other cells. This complexity is a consequence of the rate of NO production and the interaction with biological molecules such as metal ion, thiol, protein tyrosine, and reactive oxygen species. Long-lasting overproduction of NO acts as a pro-apoptotic modulator, activating caspase family proteases through the release of mitochondrial cytochrome c into cytosol, up-regulation of the p53 expression, and alterations in the expression of apoptosis-associated proteins, including the Bcl-2 family. However, low or physiological concentrations of NO prevent cells from apoptosis that is induced by the trophic factor withdrawal, Fas, TNFalpha/ActD, and LPS. The anti-apoptotic mechanism is understood on the basis of gene transcription of protective proteins. These include: heat shock protein, hemeoxygenase, or cyclooxygenase-2 and direct inhibition of the apoptotic executive effectors caspase family protease by S-nitrosylation of the cysteine thiol group in their catalytic site in a cell specific way. Our current understanding of the mechanisms by which NO exerts both pro- and anti-apototic action is discussed in this review article. PMID:16248976

  1. New Analysis of Hydrogen and Deuterium Escape from Venus

    NASA Astrophysics Data System (ADS)

    Donahue, Thomas M.

    1999-10-01

    This paper is concerned with the time required for escape of hydrogen and deuterium to produce the present D/ H ratio in Venus water, the sizes of the original hydrogen reservoirs and their sensitivity to the magnitude of the present escape fluxes, the characteristics of exogenous and endogenous hydrogen sources, and the D/ H ratio for primordial Venus hydrogen. The procedure followed allowed the H escape flux to vary over a large range, the ratio of input to escape flux to vary from 0 to 1, and the fractionation factor, which expresses the relative efficiency of D and H escape, to vary between 0.02 and 0.5. It was found that, unless deuterium escape is very efficient, the present H escape flux (averaged over a solar cycle) cannot be larger than about 10 7 cm -2 s -1 if today's water is to be the remnant of water deposited eons ago. On the other hand if the escape flux is as large as large as 3×10 7 cm -2 s -1, today's water would be the remnant of water outgassed only about 500 million years ago. These conclusions are relatively insensitive to factors other than the magnitude of the escape flux. Since recent analysis of escape fluxes indicates that the H escape fluxes may be in the neighborhood of 3×10 7 cm -2 s -1 and the fractionation factor may be 0.14 or larger, the suggestion of Grinspoon (1993, Nature 363, 1702-1704) that the water now on Venus was created during a recent massive resurfacing event is credible. However, since it is still possible that the average escape flux is as small as 7×10 6 cm -2 s -1, the choice between 4 and 0.5 Gyr must await a resolution of this conflict by reanalysis of Pioneer Venus Lyman α data (Paxton, L., D. E. Anderson, and A. I. F. Stewart 1988, J. Geophys. Res. 93, 1766-1772).

  2. The atmospheric escape at Mars: complementing the scenario

    NASA Astrophysics Data System (ADS)

    Lilensten, Jean; Simon, Cyril; Barthélémy, Mathieu; Thissen, Roland; Ehrenreich, David; Gronoff, Guillaume; Witasse, Olivier

    2013-04-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly ener- getic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. This study assesses the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions.We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO++ for a simplified single constituent atmosphere of a 2 case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering ...), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished but complement the other processes and allow writing the scenario of the Mars escape. We show that the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible.When simulating the hot Jupiter HD209458b, the two processes cannot explain the measured escape flux of C+.

  3. Wind and Rotation Enhanced Escape From the Early Terrestrial Atmospheres

    NASA Astrophysics Data System (ADS)

    Hartle, R. E.

    2001-05-01

    The earliest atmospheres of the terrestrial planets are thought to have been hotter, have stronger winds and rotate faster than atmospheres of today. Since these primitive atmospheres were weakly bound, they evolved rapidly because atmospheric escape was very strong, often referred to as "blowoff." Such escape has been treated as hydrodynamic, transonic flow, similar to solar wind flow dynamics. However, in many cases the outward flow is hydrodynamic at low altitudes only to become collisionless at higher altitudes, well before sonic speeds are ever attained. Recent models dealing with such transition from fluid to kinetic flow have applied the Jeans escape flux at the exobase. This approach has lead to escape rates that are too low due to the fact that thermospheric winds and planetary rotation increase escape fluxes considerably over the corresponding Jeans fluxes (1). In particular, for a given density and temperature at the exobase, the escape flux increases as the wind speed and/or the rotation rate increase. Also, for a given wind speed and rotation rate, the escape flux enhancement over the Jeans flux increases as the mass of an escaping constituent increases, an important factor in isotope fractionation, especially the enrichment of deuterium on Mars. Accounting for a range of possible temperatures, thermospheric wind speeds and planetary rotation rates in the primitive atmospheres of the terrestrial planets, estimates are made of light constituent escape flux increases over the corresponding Jeans fluxes. (1) Hartle, R. E. and H. G. Mayr, J. Geophys. Res., 81, 1207, 1976.

  4. Wind and Rotation Enhanced Escape from the Early Terrestrial Atmospheres

    NASA Technical Reports Server (NTRS)

    Hartle, Richard E.; Einaudi, Franco (Technical Monitor)

    2001-01-01

    The earliest atmospheres of the terrestrial planets are thought to have been hotter, have stronger winds and rotate faster than atmospheres of today. Since these primitive atmospheres were weakly bound, they evolved rapidly because atmospheric escape was very strong, often referred to as "blowoff." Such escape has been treated as hydrodynamic, transonic flow; similar to solar wind flow dynamics. However, in many cases, although the outward flow is hydrodynamic at low altitudes, it becomes collisionless at higher altitudes, before sonic speeds are ever attained. Recent models dealing with the transition from fluid to kinetic flow have applied the Jeans escape flux at the exobase. This approach leads to escape rates that are too low, because thermospheric winds and planetary rotation are known to increase the escape flux above the corresponding Jeans flux. In particular, for a given density and temperature at the exobase, the escape flux increases as the wind speed and/or the rotation rate increase. Also, for a given wind speed and rotation rate, the escape flux enhancement over the Jeans flux increases as the mass of an escaping constituent increases, an important factor in isotope fractionation, especially the enrichment of deuterium on Mars. Accounting for a range of possible temperatures, thermospheric wind speeds and planetary rotation rates in the primitive atmospheres of the terrestrial planets, estimates are made of light constituent escape flux increases over the corresponding Jeans fluxes.

  5. Chaotic Scattering and Escape Times of Marginally Trapped Ultracold Neutrons

    PubMed Central

    Coakley, K. J.; Doyle, J. M.; Dzhosyuk, S. N.; Yang, L.; Huffman, P. R.

    2005-01-01

    We compute classical trajectories of Ultracold neutrons (UCNs) in a superconducting Ioffe-type magnetic trap using a symplectic integration method. We find that the computed escape time for a particular set of initial conditions (momentum and position) does not generally stabilize as the time step parameter is reduced unless the escape time is short (less than approximately 10 s). For energy intervals where more than half of the escape times computed for UCN realizations are numerically well determined, we predict the median escape time as a function of the midpoint of the interval. PMID:27308152

  6. Apoptotic cells selectively uptake minor glycoforms of vitronectin from serum.

    PubMed

    Malagolini, Nadia; Catera, Mariangela; Osorio, Hugo; Reis, Celso A; Chiricolo, Mariella; Dall'Olio, Fabio

    2013-04-01

    Apoptosis profoundly alters the carbohydrate layer coating the membrane of eukaryotic cells. Previously we showed that apoptotic cells became reactive with the α2,6-sialyl-specific lectin from Sambucus nigra agglutinin (SNA), regardless of their histological origin and the nature of the apoptotic stimulus. Here we reveal the basis of the phenomenon by showing that in apoptotic cancer cell lines SNA reactivity was mainly associated with a 67 kDa glycoprotein which we identified by MALDI-TOF/TOF and immunoblot analysis as bovine vitronectin (bVN). bVN was neither present in non-apoptotic cells, nor in cells induced to apoptosis in serum-free medium, indicating that its uptake from the cell culture serum occurred only during apoptosis. The bVN molecules associated with apoptotic cancer cell lines represented minor isoforms, lacking the carboxyterminal sequence and paradoxically containing a few α2,6-linked sialic acid residues. Despite their poor α2,6-sialylation, these bVN molecules were sufficient to turn apoptotic cells to SNA reactivity, which is a late apoptotic event occurring in cells positive to both annexin-V and propidium iodide. Unlike in cancer cell lines, the major bVN form taken up by apoptotic neutrophils and mononuclear cells was a 80 kDa form. In apoptotic SW948 cells we also detected the α2,6-sialylated forms of the stress-70 mitochondrial precursor (mortalin) and of tubulin-β2C. These data indicate that the acquisition of vitronectin isoforms from the environment is a general, although cell specific phenomenon, potentially playing an important role in post-apoptotic events and that the α2,6-sialylation of intracellular proteins is a new kind of posttranslational modification associated with apoptosis. PMID:23381642

  7. The polarization of escaping terrestrial continuum radiation

    NASA Technical Reports Server (NTRS)

    Gurnett, D. A.; Calvert, W.; Huff, R. L.; Jones, D.; Sugiura, M.

    1988-01-01

    The polarization of an escaping terrestrial continuum radiation event that occurred on March 2, 1982, was determined using plasma wave measurements from the DE-1 spacecraft. The source of the radiation was determined to be located near the magnetic equator on the nightside of the earth at a radial distance of about 2.8-3.5 earth radii. Two meridional beams were detected, one directed north at an angle of about 20-30 deg with respect to the magnetic equator, and the other directed south at a comparable angle. Polarization measurements indicated that the radiation is right-hand polarized with respect to an outward directed E plane normal in the Northern Hemisphere and left-hand polarized in the Southern Hemisphere.

  8. Escape of Black Holes from the Brane

    SciTech Connect

    Flachi, Antonino; Tanaka, Takahiro

    2005-10-14

    TeV-scale gravity theories allow the possibility of producing small black holes at energies that soon will be explored at the CERN LHC or at the Auger observatory. One of the expected signatures is the detection of Hawking radiation that might eventually terminate if the black hole, once perturbed, leaves the brane. Here, we study how the 'black hole plus brane' system evolves once the black hole is given an initial velocity that mimics, for instance, the recoil due to the emission of a graviton. The results of our dynamical analysis show that the brane bends around the black hole, suggesting that the black hole eventually escapes into the extra dimensions once two portions of the brane come in contact and reconnect. This gives a dynamical mechanism for the creation of baby branes.

  9. Gated narrow escape time for molecular signaling.

    PubMed

    Reingruber, Jürgen; Holcman, David

    2009-10-01

    The mean time for a diffusing ligand to activate a target protein located on the surface of a microdomain can regulate cellular signaling. When the ligand switches between various states induced by chemical interactions or conformational changes, while target activation occurs in only one state, this activation time is affected. We investigate this dynamics using new equations for the sojourn times spent in each state. For two states, we obtain exact solutions in dimension one, and asymptotic ones confirmed by Brownian simulations in dimension 3. We find that the activation time is quite sensitive to changes of the switching rates, which can be used to modulate signaling. Interestingly, our analysis reveals that activation can be fast although the ligand spends most of the time "hidden" in the nonactivating state. Finally, we obtain a new formula for the narrow escape time in the presence of switching. PMID:19905605

  10. BCL2 suppresses PARP1 function and non-apoptotic cell death

    PubMed Central

    Dutta, Chaitali; Day, Tovah; Kopp, Nadja; van Bodegom, Diederik; Davids, Matthew S.; Ryan, Jeremy; Bird, Liat; Kommajosyula, Naveen; Weigert, Oliver; Yoda, Akinori; Fung, Hua; Brown, Jennifer R.; Shapiro, Geoffrey I.; Letai, Anthony; Weinstock, David M.

    2014-01-01

    BCL2 suppresses apoptosis by binding the BH3 domain of pro-apoptotic factors and thereby regulating outer mitochondrial membrane permeabilization. Many tumor types, including B-cell lymphomas and chronic lymphocytic leukemia, are dependent on BCL2 for survival, but become resistant to apoptosis after treatment. Here we identified a direct interaction between the anti-apoptotic protein BCL2 and the enzyme poly(ADP) ribose polymerase 1 (PARP1), which suppresses PARP1 enzymatic activity and inhibits PARP1-dependent DNA repair in diffuse large B cell lymphoma cells. The BH3 mimetic ABT-737 displaced PARP1 from BCL2 in a dose-dependent manner, re-establishing PARP1 activity and DNA repair and promoting non-apoptotic cell death. This form of cell death was unaffected by resistance to single-agent ABT-737 that results from upregulation of anti-apoptotic BCL2 family members. Based on the ability of BCL2 to suppress PARP1 function, we hypothesized that ectopic BCL2 expression would kill PARP inhibitor-sensitive cells. Strikingly, BCL2 expression reduced the survival of PARP inhibitor-sensitive breast cancer and lung cancer cells by 90-100%, and these effects were reversed by ABT-737. Taken together, our findings demonstrate that a novel interaction between BCL2 and PARP1 blocks PARP1 enzymatic activity and suppresses PARP1-dependent repair. Targeted disruption of the BCL2-PARP1 interaction therefore may represent a potential therapeutic approach for BCL2-expressing tumors resistant to apoptosis. PMID:22689920

  11. Energy Release, Acceleration, and Escape of Solar Energetic Ions

    NASA Astrophysics Data System (ADS)

    de Nolfo, G. A.; Ireland, J.; Ryan, J. M.; Young, C. A.

    2013-12-01

    Solar flares are prodigious producers of energetic particles, and thus a rich laboratory for studying particle acceleration. The acceleration occurs through the release of magnetic energy, a significant fraction of which can go into the acceleration of particles. Coronal mass ejections (CMEs) certainly produce shocks that both accelerate particles and provide a mechanism for escape into the interplanetary medium (IP). What is less well understood is whether accelerated particles produced from the flare reconnection process escape, and if so, how these same particles are related to solar energetic particles (SEPs) detected in-situ. Energetic electron SEPs have been shown to be correlated with Type III radio bursts, hard X-ray emission, and EUV jets, making a very strong case for the connection between acceleration at the flare and escape along open magnetic field lines. Because there has not been a clear signature of ion escape, as is the case with the Type III radio emission for electrons, sorting out the avenues of escape for accelerated flare ions and the possible origin of the impulsive SEPs continues to be a major challenge. The key to building a clear picture of particle escape relies on the ability to map signatures of escape such as EUV jets at the Sun and to follow the progression of these escape signatures as they evolve in time. Furthermore, nuclear γ-ray emissions provide critical context relating ion acceleration to that of escape. With the advent observations from Fermi as well as RHESSI and the Solar Dynamics Observatory (SDO), the challenge of ion escape from the Sun can now be addressed. We present a preliminary study of the relationship of EUV jets with nuclear γ-ray emission and Type III radio observations and discuss the implications for possible magnetic topologies that allow for ion escape from deep inside the corona to the interplanetary medium.

  12. ARTEMIS nuclease facilitates apoptotic chromatin cleavage.

    PubMed

    Britton, Sébastien; Frit, Philippe; Biard, Denis; Salles, Bernard; Calsou, Patrick

    2009-10-15

    One hallmark of apoptosis is DNA degradation that first appears as high molecular weight fragments followed by extensive internucleosomal fragmentation. During apoptosis, the DNA-dependent protein kinase (DNA-PK) is activated. DNA-PK is involved in the repair of DNA double-strand breaks (DSB) and its catalytic subunit is associated with the nuclease ARTEMIS. Here, we report that, on initiation of apoptosis in human cells by agents causing DNA DSB or by staurosporine or other agents, ARTEMIS binds to apoptotic chromatin together with DNA-PK and other DSB repair proteins. ARTEMIS recruitment to chromatin showed a time and dose dependency. It required DNA-PK protein kinase activity and was blocked by antagonizing the onset of apoptosis with a pan-caspase inhibitor or on overexpression of the antiapoptotic BCL2 protein. In the absence of ARTEMIS, no defect in caspase-3, poly(ADP-ribose) polymerase-1, and XRCC4 cleavage or in H2AX phosphorylation was observed and DNA-PK catalytic subunit was still phosphorylated on S2056 in response to staurosporine. However, DNA fragmentation including high molecular weight fragmentation was delayed in ARTEMIS-deficient cells compared with cells expressing ARTEMIS. In addition, ARTEMIS enhanced the kinetics of MLL gene cleavage at a breakage cluster breakpoint that is frequently translocated in acute or therapy-related leukemias. These results show a facilitating role for ARTEMIS at least in early, site-specific chromosome breakage during apoptosis. PMID:19808974

  13. Engineered apoptotic nucleases for chromatin research.

    PubMed

    Xiao, Fei; Widlak, Piotr; Garrard, William T

    2007-01-01

    We have created new genomics tools for chromatin research by genetically engineering the human and mouse major apoptotic nucleases that are responsible for internucleosomal DNA cleavage, DNA fragmentation factor (DFF). Normally, in its inactive form, DFF is a heterodimer composed of a 45-kDa chaperone inhibitor subunit (DFF45 or ICAD), and a 40-kDa latent endonuclease subunit (DFF40 or CAD). Upon caspase-3 cleavage of DFF45, DFF40 forms active endonuclease homo-oligomers. Although Saccharomyces cerevisiae lacks DFF, expression of caspase-3 is lethal in this organism, but expression of the highly sequence-specific tobacco etch virus protease (TEVP) is harmless. Therefore, we inserted TEVP cleavage sites immediately downstream of the two caspase-3 cleavage sites within DFF45, generating a novel form of DFF (DFF-T) whose nuclease activity proved to be exclusively under the control of TEVP. We demonstrate that co-expression of TEVP and DFF-T under galactose control results in nucleosomal DNA laddering and cell death in S. cerevisiae. We also created synthetic DFF genes with optimized codons for high-level expression in Eschericia coli or S. cerevisiae. We further demonstrate the excellence of the synthetic gene products for in vitro mapping of the nucleosome positions and hypersensitive sites in specific genes such as the yeast PHO5. PMID:17626049

  14. Apoptotic Genes are Differentially Expressed in Aged Gingival Tissue

    PubMed Central

    González, O.A.; Stromberg, A.J.; Huggins, P.M.; Gonzalez-Martinez, J.; Novak, M.J.; Ebersole, J.L.

    2011-01-01

    Cellular and molecular changes of the periodontium associated with a higher prevalence of oral diseases (e.g., chronic periodontitis) in aged populations have received little attention. Since impaired apoptosis during aging appears to be related to chronic inflammatory disorders, we hypothesized that the expression of genes associated with apoptotic processes are altered in aged healthy and periodontitis-affected gingival tissue. Ontology analysis of 88 genes related to apoptotic pathways was performed in gingival biopsies of healthy and periodontitis sites from young, adult, and aged non-human primates (Macaca mulatta), using the GeneChip® Rhesus Macaque Genome Array. Lower expression of anti-apoptotic and higher expression of pro-apoptotic genes were associated with healthy gingival tissue from young compared with aged animals. Few differences in gene expression were observed in healthy gingival tissue between adult and aged animals. Comparison between healthy and periodontitis gingival tissues showed that the up- or down-regulated apoptotic genes in diseased gingival tissue are different in adults compared with aged animals. These results suggest that apoptotic events normally occurring in gingival tissues could be reduced in aging,and unique aspects of apoptotic pathways are potentially involved in the pathophysiology of perio-dontal disease in adult vs. aged gingival tissues. PMID:21471327

  15. A new view of the lethal apoptotic pore.

    PubMed

    Basañez, Gorka; Soane, Lucian; Hardwick, J Marie

    2012-01-01

    Cell death by apoptosis is indispensable for proper development and tissue homeostasis in all multicellular organisms, and its deregulation plays a key role in cancer and many other diseases. A crucial event in apoptosis is the formation of protein-permeable pores in the outer mitochondrial membrane that release cytochrome c and other apoptosis-promoting factors into the cytosol. Research efforts over the past two decades have established that apoptotic pores require BCL-2 family proteins, with the proapoptotic BAX-type proteins being direct effectors of pore formation. Accumulating evidence indicates that other cellular components also cooperate with BCL-2 family members to regulate the apoptotic pore. Despite this knowledge, the molecular pathway leading to apoptotic pore formation at the outer mitochondrial membrane and the precise nature of this outer membrane pore remain enigmatic. In this issue of PLOS Biology, Kushnareva and colleagues describe a novel kinetic analysis of the dynamics of BAX-dependent apoptotic pore formation recapitulated in native mitochondrial outer membranes. Their study reveals the existence of a hitherto unknown outer mitochondrial membrane factor that is critical for BAX-mediated apoptotic pore formation, and challenges the currently popular view that the apoptotic pore is a purely proteinaceous multimeric assembly of BAX proteins. It also supports the notion that membrane remodeling events are implicated in the formation of a lipid-containing apoptotic pore. PMID:23049484

  16. Methane attenuates retinal ischemia/reperfusion injury via anti-oxidative and anti-apoptotic pathways.

    PubMed

    Liu, Lin; Sun, Qinglei; Wang, Ruobing; Chen, Zeli; Wu, Jiangchun; Xia, Fangzhou; Fan, Xian-Qun

    2016-09-01

    Retinal ischemia/reperfusion injury (IRI) may cause incurable visual impairment due to neural regeneration limits. Methane was shown to exert a protective effect against IRI in many organs. This study aims to explore the possible protective effects of methane-rich saline against retinal IRI in rat. Retinal IRI was performed on the right eyes of male Sprague-Dawley rats, which were immediately injected intraperitoneally with methane-saturated saline (25ml/kg). At one week after surgery, the number of retinal ganglion cells (RGCs), total retinal thickness, visual function were measured by hematoxylin and eosin staining, FluoroGold anterograde labeling and flash visual evoked potentials. The levels of 8-hydroxy-2-deoxyguanosine (8-OHdG), 4-Hydroxy-2-nonenal (4-HNE), malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), caspase-3, caspase-9, B cell lymphoma/leukemia-2 (Bcl-2) and Bcl-2 associated X protein (Bax) in retinas were assessed by immunofluorescence staining, enzyme-linked immunosorbent assay and quantitative polymerase chain reaction. As expected, methane treatment significantly improved the retinal IRI-induced RGC loss, total retinal layer thinning and visual dysfunction. Moreover, methane treatment significantly reduced the levels of oxidative stress biomarkers (8-OHdG, 4-HNE, MDA) and increased the antioxidant enzyme activities (SOD, CAT, GPx) in the retinas with IRI. Meanwhile, methane treatment significantly increased the anti-apoptotic gene (Bcl-2) expression and decreased the pro-apoptotic gene (Bax) expression, accompanied by the suppression of caspase-3 and caspase-9 activity. Thus, these data demonstrated that methane can exert a neuroprotective role against retinal IRI through anti-oxidative and anti-apoptotic pathways. PMID:27208496

  17. Rapid reuptake of granzyme B leads to emperitosis: an apoptotic cell-in-cell death of immune killer cells inside tumor cells.

    PubMed

    Wang, S; He, M-f; Chen, Y-h; Wang, M-y; Yu, X-M; Bai, J; Zhu, H-y; Wang, Y-y; Zhao, H; Mei, Q; Nie, J; Ma, J; Wang, J-f; Wen, Q; Ma, L; Wang, Y; Wang, X-n

    2013-01-01

    A cell-in-cell process refers to the invasion of one living cell into another homotypic or heterotypic cell. Different from non-apoptotic death processes of internalized cells termed entosis or cannibalism, we previously reported an apoptotic cell-in-cell death occurring during heterotypic cell-in-cell formation. In this study, we further demonstrated that the apoptotic cell-in-cell death occurred only in internalized immune killer cells expressing granzyme B (GzmB). Vacuole wrapping around the internalized cells inside the target cells was the common hallmark during the early stage of all cell-in-cell processes, which resulted in the accumulation of reactive oxygen species and subsequent mitochondrial injury of encapsulated killer or non-cytotoxic immune cells. However, internalized killer cells mediated rapid bubbling of the vacuoles with the subsequent degranulation of GzmB inside the vacuole of the target cells and underwent the reuptake of GzmB by killer cells themselves. The confinement of GzmB inside the vacuole surpassed the lysosome-mediated cell death occurring in heterotypic or homotypic entosis processes, resulting in a GzmB-triggered caspase-dependent apoptotic cell-in-cell death of internalized killer cells. On the contrary, internalized killer cells from GzmB-deficient mice underwent a typical non-apoptotic entotic cell-in-cell death similar to that of non-cytotoxic immune cells or tumor cells. Our results thus demonstrated the critical involvement of immune cells with cytotoxic property in apoptotic cell-in-cell death, which we termed as emperitosis taken from emperipolesis and apoptosis. Whereas entosis or cannibalism may serve as a feed-on mechanism to exacerbate and nourish tumor cells, emperitosis of immune killer cells inside tumor cells may serve as an in-cell danger sensation model to prevent the killing of target cells from inside, implying a unique mechanism for tumor cells to escape from immune surveillance. PMID:24113190

  18. How to Escape a Home Fire (Take This Safety Quiz).

    ERIC Educational Resources Information Center

    PTA Today, 1994

    1994-01-01

    A checklist/safety quiz from the National Fire Protection Association examines individual knowledge of how to escape if a home fire breaks out. The organization recommends that every household develop a fire escape plan and practice it at least twice a year. (SM)

  19. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Means of escape. 143.101 Section 143.101 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES DESIGN AND EQUIPMENT OCS Facilities § 143.101 Means of escape. (a) “Primary...

  20. Green Pea Galaxies Reveal Secrets of Lyα Escape

    NASA Astrophysics Data System (ADS)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Dijkstra, Mark; Jaskot, Anne; Zheng, Zhenya; Wang, Junxian

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  1. [Examination of the escape phenomenon in disease modifying antirheumatic drugs].

    PubMed

    Kawasaki, Yoichi; Moriyama, Masahiro; Shibata, Kazuhiko; Gomita, Yutaka

    2005-03-01

    Although disease-modifying antirheumatic drugs (DMARDs) are used in the treatment of rheumatoid arthritis (RA), the selection of agents in the case of relapse (escape phenomenon) lacks clear-cut standards. Therefore we investigated the rate and conditions of escape as well as the agents used after escapes had occurred. Outpatients of the Matsubara Mayflower Hospital with a history of DMARD administration during the 4 years prior to May 2003 were studied. Those receiving salazosulfapyridine (SASP) had a high escape rate and those receiving methotrexate (MTX) and bucillamine (BC) had a low rate. The continuous duration of administration was long for MTX and BC, but short for sodium aurothiomalate (GST). BC and Actarit (AR) gradually elevated C-reactive protein (CRP) levels and the erythrocyte sedimentation rate (ESR). In patients receiving SASP and MTX, a high level of CRP and high ESR was seen 2 months prior to the occurrence of escape and remained unchanged after escape. With respect to the agents used after escape, SASP and BC were substituted with other DMARDs. A combination with other DMARDs was usually administered to patients who had been receiving MTX. Taken together, the present results clarified the characteristics of DMARD escape and will contribute to the appropriate pharmacotherapy for RA. PMID:15738628

  2. The Origins and Underpinning Principles of E-Scape

    ERIC Educational Resources Information Center

    Kimbell, Richard

    2012-01-01

    In this article I describe the context within which we developed project e-scape and the early work that laid the foundations of the project. E-scape (e-solutions for creative assessment in portfolio environments) is centred on two innovations. The first concerns a web-based approach to portfolio building; allowing learners to build their…

  3. Fire Won't Wait--Plan Your Escape!

    ERIC Educational Resources Information Center

    PTA Today, 1991

    1991-01-01

    Discusses the importance of home fire escape drills, detailing fire safety plans. Early detection and warning (smoke detectors) coupled with well-rehearsed escape plans help prevent serious injury. Children need to be taught about fire safety beginning at a very early age. (SM)

  4. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.445 Alarm and means of escape. (a) Each CO2...

  5. 35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, PRIOR TO ENLARGEMENT OF ROOM AND INSTALLATION OF TRIPLE-LOCK RECOMPRESSION CHAMBER IN 1957 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  6. 29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT POINT JUST ABOVE THE SUBMARINE SECTION AT THE 110-FOOT LEVEL 1929-1930 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  7. 36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING RESCUE BELL SUSPENDED ABOVE TANK, WITH TWO-LOCK RECOMPRESSION CHAMBER AT REAR, LOOKING WEST. Photo taken after installation of recompression chamber in 1956. - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  8. 22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST SIDE OF CUPOLA TOWARD ELEVATOR. TWO-LOCK RECOMPRESSION CHAMBER AT REAR - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  9. 31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF THE ELEVATOR AND PASSAGEWAYS TO THE 18- AND 50-FOOT LOCKS AND CUPOLA 1932 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  10. 7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE FROM 50-FOOT PASSAGEWAY, SHOWING 25-FOOT BLISTER AT LEFT, 18-FOOT PASSAGEWAY AND PLATFORM AT RIGHT - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  11. Teachers Offering Healthy Escape Options for Teenagers in Pain

    ERIC Educational Resources Information Center

    Kaywell, Joan F.

    2005-01-01

    "[T]wenty-five percent of today's teenagers have inordinate emotional baggage beyond the normal angst of adolescence." This burden can lead to unhealthy escapes, including substance abuse, sexual activity, violence, eating disorders, and suicide. One healthy escape, however, lies in books, where students can read about teenagers living in painful…

  12. Cobra venom cytotoxins; apoptotic or necrotic agents?

    PubMed

    Ebrahim, Karim; Shirazi, Farshad H; Mirakabadi, Abbas Zare; Vatanpour, Hossein

    2015-12-15

    Organs homeostasis is controlled by a dynamic balance between cell proliferation and apoptosis. Failure to induction of apoptosis has been implicated in tumor development. Cytotoxin-I (CTX-I) and cytotoxin-II (CTX-II) are two physiologically active polypeptides found in Caspian cobra venom. Anticancer activity and mechanism of cell death induced by these toxins have been studied. The toxins were purified by different chromatographic steps and their cytotoxicity and pattern of cell death were determined by MTT, LDH release, acridine orange/ethidium bromide (AO/EtBr) double staining, flow cytometric analysis, caspase-3 activity and neutral red assays. The IC50 of CTX-II in MCF-7, HepG2, DU-145 and HL-60 was 4.1 ± 1.3, 21.2 ± 4.4, 9.4 ± 1.8 μg/mL and 16.3 ± 1.9 respectively while the IC50 of this toxin in normal MDCK cell line was 54.5 ± 3.9 μg/mL. LDH release suddenly increase after a specific toxins concentrations in all cell lines. AO/EtBr double staining, flow cytometric analysis and caspase-3 activity assay confirm dose and time-dependent induction of apoptosis by both toxins. CTX-I and CTX-II treated cells lost their lysosomal membrane integrity and couldn't uptake neutral red day. CTX-I and CTX-II showed significant anticancer activity with minimum effects on normal cells and better IC50 compared to current anticancer drug; cisplatin. They induce their apoptotic effect via lysosomal pathways and release of cathepsins to cytosol. These effects were seen in limited rage of toxins concentrations and pattern of cell death rapidly changes to necrosis by increase in toxin's concentration. In conclusion, significant apoptogenic effects of these toxins candidate them as a possible anticancer agent. PMID:26482932

  13. Prediction of anti-angiogenesis escape.

    PubMed

    Mitamura, Takashi; Gourley, Charlie; Sood, Anil K

    2016-04-01

    Many clinical trials have demonstrated the benefit of anti-angiogenesis therapy in the treatment of gynecologic cancer. However, these benefits have often been in terms of progression-free rather than overall survival and in some cases, the magnitude of benefit demonstrated in the pivotal phase 3 trials has been disappointing when compared with the percentage of patients who responded in earlier phase 2 trials. Two potential explanations for this are the current inability to stratify patients according to chance of benefit and the development of resistance mechanisms within the tumor. In this article, we review the prediction of response and the proposed resistance and escape mechanisms involved in anti-angiogenesis therapy, including the up-regulation of alternative proangiogenic pathways, vascular co-option, and resistance to hypoxia. These insights may offer a personalized strategy for anti-angiogenesis therapy and help us to consider the best selection of other therapies that should be combined with anti-angiogenesis therapy to improve the outcome of patients with gynecologic cancer. PMID:26748214

  14. WANDERING STARS: AN ORIGIN OF ESCAPED POPULATIONS

    SciTech Connect

    Teyssier, Maureen; Johnston, Kathryn V.; Shara, Michael M.

    2009-12-10

    We demonstrate that stars beyond the virial radii of galaxies may be generated by the gravitational impulse received by a satellite as it passes through the pericenter of its orbit around its parent. These stars may become energetically unbound (escaped stars), or may travel to further than a few virial radii for longer than a few Gyr, but still remain energetically bound to the system (wandering stars). Larger satellites (10%-100% the mass of the parent), and satellites on more radial orbits are responsible for the majority of this ejected population. Wandering stars could be observable on Mpc scales via classical novae, and on 100 Mpc scales via Type Ia supernova. The existence of such stars would imply a corresponding population of barely bound, old, high-velocity stars orbiting the Milky Way, generated by the same physical mechanism during the Galaxy's formation epoch. Sizes and properties of these combined populations should place some constraints on the orbits and masses of the progenitor objects from which they came, providing insight into the merging histories of galaxies in general and the Milky Way in particular.

  15. Escaping the resource curse in China.

    PubMed

    Cao, Shixiong; Li, Shurong; Ma, Hua; Sun, Yutong

    2015-02-01

    Many societies face an income gap between rich regions with access to advanced technology and regions that are rich in natural resources but poorer in technology. This "resource curse" can lead to a Kuznets trap, in which economic inequalities between the rich and the poor increase during the process of socioeconomic development. This can also lead to depletion of natural resources, environmental degradation, social instability, and declining socioeconomic development. These problems will jeopardize China's achievements if the current path continues to be pursued without intervention by the government to solve the problems. To mitigate the socioeconomic development gap between western and eastern China, the government implemented its Western Development Program in 2000. However, recent data suggest that this program has instead worsened the resource curse. Because each region has its own unique strengths and weaknesses, China must escape the resource curse by accounting for this difference; in western China, this can be done by improving education, promoting high-tech industry, adjusting its economic strategy to balance regional development, and seeking more sustainable approaches to socioeconomic development. PMID:24973055

  16. Food Enzymes

    ERIC Educational Resources Information Center

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  17. Zinc Enzymes.

    ERIC Educational Resources Information Center

    Bertini, I.; And Others

    1985-01-01

    Discusses the role of zinc in various enzymes concerned with hydration, hydrolysis, and redox reactions. The binding of zinc to protein residues, properties of noncatalytic zinc(II) and catalytic zinc, and the reactions catalyzed by zinc are among the topics considered. (JN)

  18. Topological Transitions in Mitochondrial Membranes controlled by Apoptotic Proteins

    NASA Astrophysics Data System (ADS)

    Hwee Lai, Ghee; Sanders, Lori K.; Mishra, Abhijit; Schmidt, Nathan W.; Wong, Gerard C. L.; Ivashyna, Olena; Schlesinger, Paul H.

    2010-03-01

    The Bcl-2 family comprises pro-apoptotic proteins, capable of permeabilizing the mitochondrial membrane, and anti-apoptotic members interacting in an antagonistic fashion to regulate programmed cell death (apoptosis). They offer potential therapeutic targets to re-engage cellular suicide in tumor cells but the extensive network of implicated protein-protein interactions has impeded full understanding of the decision pathway. We show, using synchrotron x-ray diffraction, that pro-apoptotic proteins interact with mitochondrial-like model membranes to generate saddle-splay (negative Gaussian) curvature topologically required for pore formation, while anti-apoptotic proteins can deactivate curvature generation by molecules drastically different from Bcl-2 family members and offer evidence for membrane-curvature mediated interactions general enough to affect very disparate systems.

  19. In vitro study of immunosuppressive effect of apoptotic cells*

    PubMed Central

    Zhang, Wen-jin; Zheng, Shu-sen

    2005-01-01

    Recent studies revealed that apoptotic cells are actively involved in immunosuppression and anti-inflammation. After being phagocytosed by macrophages, apoptotic cells can actively regulate cytokines secretion from lipopolysaccharide (LPS)-stimulated macrophages, in which the secretion of immunosuppressive cytokines such as interleukin-10 (IL-10) is increased while the pro-inflammatory cytokines such as tumor necrosis factor-alpha (TNFα), interleukin-1beta (IL-1β) and leukin-8 (IL-8) are suppressed. In this paper, we first present evidence that phagocytosed apoptotic cells regulate cytokine secretion of LPS-stimulated macrophages, but also inhibit the activation of T lymphocytes stimulated by ConA. These data suggest that apoptotic cells can alter the biological behavior of macrophages which gain immunosuppressive property. PMID:16130196

  20. Dications and thermal ions in planetary atmospheric escape

    NASA Astrophysics Data System (ADS)

    Lilensten, J.; Simon Wedlund, C.; Barthélémy, M.; Thissen, R.; Ehrenreich, D.; Gronoff, G.; Witasse, O.

    2013-01-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly energetic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. The goal of this study is to assess the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions. We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO2++ for a simplified single constituent atmosphere of a case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering, etc.), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished and even contribute only marginally to this loss. We show that with these two mechanisms, the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible. When simulating the hot Jupiter HD 209458 b, the two processes cannot explain the measured escape flux of C+. This study shows that the dications may constitute a source of the escape of planetary atmospheres which had not been taken into account until now. This source, although marginal, is not negligible. The influence of the photoionization is of course large, but cannot explain alone the loss of Mars

  1. Apoptotic pathways as a therapeutic target for colorectal cancer treatment

    PubMed Central

    Abraha, Aman M; Ketema, Ezra B

    2016-01-01

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment. PMID:27574550

  2. Comparison of automated haematology analysers for detection of apoptotic lymphocytes.

    PubMed

    Taga, K; Sawaya, M; Yoshida, M; Kaneko, M; Okada, M; Taniho, M

    2002-06-01

    Automated haematology analysers can rapidly provide accurate blood cell counts and white blood cell differentials. In this study, we evaluated four different haematology analysers for the detection of apoptotic lymphocytes in peripheral blood: MAXM A/L Retic, H*2, Cell-Dyn 3500 and NE-8000. With the MAXM A/L Retic haematology analyser, the apoptotic lymphocyte cluster appeared below the original lymphocyte cluster on the volume/DF1, and to the right under the original lymphocyte cluster on the volume/DF2 scattergrams. With the H*2 haematology analyser, the apoptotic polymorphonuclear lymphocytes produced a higher lobularity index on the BASO channel. With the Cell-Dyn 3500 haematology analyser, the apoptotic lymphocyte cluster appeared to the right side of the original lymphocyte cluster on the 0D/10D scattergram and to the left side of the polymorphonuclear cluster on the 90D/10D scattergram. With the NE-8000 haematology analyser, the apoptotic lymphocyte cluster was not distinguishable. Thus, apoptotic lymphocytes are readily detected on scattergrams generated by selected haematology analysers. PMID:12067276

  3. Apoptotic cell death in rat epididymis following epichlorohydrin treatment.

    PubMed

    Lee, I-C; Kim, K-H; Kim, S-H; Baek, H-S; Moon, C; Kim, S-H; Yun, W-K; Nam, K-H; Kim, H-C; Kim, J-C

    2013-06-01

    Epichlorohydrin (ECH) is an antifertility agent that acts both as an epididymal toxicant and an agent capable of directly affecting sperm motility. This study identified the time course of apoptotic cell death in rat epididymides after ECH treatment. Rats were administrated with a single oral dose of ECH (50 mg/kg). ECH-induced apoptotic changes were evaluated by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay and its related mechanism was confirmed by Western blot analysis and colorimetric assay. The TUNEL assay showed that the number of apoptotic cells increased at 8 h, reached a maximum level at 12 h, and then decreased progressively. The Western blot analysis demonstrated no significant changes in proapoptotic Bcl-2-associated X (Bax) and anti-apoptotic Bcl-2 expression during the time course of the study. However, phospho-p38 mitogen-activated protein kinase (p-p38 MAPK) and phospho-c-Jun amino-terminal kinase (p-JNK) expression increased at 8-24 h. Caspase-3 and caspase-8 activities also increased at 8-48 h and 12-48 h, respectively, in the same manner as p-p38 MAPK and p-JNK expression. These results indicate that ECH induced apoptotic changes in rat epididymides and that the apoptotic cell death may be related more to the MAPK pathway than to the mitochondrial pathway. PMID:23386780

  4. Apoptotic pathways as a therapeutic target for colorectal cancer treatment.

    PubMed

    Abraha, Aman M; Ketema, Ezra B

    2016-08-15

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment. PMID:27574550

  5. Evolutionary escape on complex genotype-phenotype networks.

    PubMed

    Ibáñez-Marcelo, Esther; Alarcón, Tomás

    2016-04-01

    We study the problem of evolutionary escape that is the process whereby a population under sudden changes in the selective pressures acting upon it try to evade extinction by evolving from previously well-adapted phenotypes to those that are favoured by the new selective pressure. We perform a comparative analysis between results obtained by modelling genotype space as a regular hypercube (H-graphs), which is the scenario considered in previous work on the subject, to those corresponding to a complex genotype-phenotype network (B-graphs). In order to analyse the properties of the escape process on both these graphs, we apply a general theory based on multi-type branching processes to compute the evolutionary dynamics and probability of escape. We show that the distribution of distances between phenotypes in B-graphs exhibits a much larger degree of heterogeneity than in H-graphs. This property, one of the main structural differences between both types of graphs, causes heterogeneous behaviour in all results associated to the escape problem. We further show that, due to the heterogeneity characterising escape on B-graphs, escape probability can be underestimated by assuming a regular hypercube genotype network, even if we compare phenotypes at the same distance in H-graphs. Similarly, it appears that the complex structure of B-graphs slows down the rate of escape. PMID:26802479

  6. Efficiently estimating salmon escapement uncertainty using systematically sampled data

    USGS Publications Warehouse

    Reynolds, Joel H.; Woody, Carol Ann; Gove, Nancy E.; Fair, Lowell F.

    2007-01-01

    Fish escapement is generally monitored using nonreplicated systematic sampling designs (e.g., via visual counts from towers or hydroacoustic counts). These sampling designs support a variety of methods for estimating the variance of the total escapement. Unfortunately, all the methods give biased results, with the magnitude of the bias being determined by the underlying process patterns. Fish escapement commonly exhibits positive autocorrelation and nonlinear patterns, such as diurnal and seasonal patterns. For these patterns, poor choice of variance estimator can needlessly increase the uncertainty managers have to deal with in sustaining fish populations. We illustrate the effect of sampling design and variance estimator choice on variance estimates of total escapement for anadromous salmonids from systematic samples of fish passage. Using simulated tower counts of sockeye salmon Oncorhynchus nerka escapement on the Kvichak River, Alaska, five variance estimators for nonreplicated systematic samples were compared to determine the least biased. Using the least biased variance estimator, four confidence interval estimators were compared for expected coverage and mean interval width. Finally, five systematic sampling designs were compared to determine the design giving the smallest average variance estimate for total annual escapement. For nonreplicated systematic samples of fish escapement, all variance estimators were positively biased. Compared to the other estimators, the least biased estimator reduced bias by, on average, from 12% to 98%. All confidence intervals gave effectively identical results. Replicated systematic sampling designs consistently provided the smallest average estimated variance among those compared.

  7. Lyman-Werner UV escape fractions from primordial haloes

    NASA Astrophysics Data System (ADS)

    Schauer, Anna T. P.; Whalen, Daniel J.; Glover, Simon C. O.; Klessen, Ralf S.

    2015-12-01

    Population III (Pop III) stars can regulate star formation in the primordial Universe in several ways. They can ionize nearby haloes, and even if their ionizing photons are trapped by their own haloes, their Lyman-Werner (LW) photons can still escape and destroy H2 in other haloes, preventing them from cooling and forming stars. LW escape fractions are thus a key parameter in cosmological simulations of early reionization and star formation but have not yet been parametrized for realistic haloes by halo or stellar mass. To do so, we perform radiation hydrodynamical simulations of LW UV escape from 9-120 M⊙ Pop III stars in 105-107 M⊙ haloes with ZEUS-MP. We find that photons in the LW lines (i.e. those responsible for destroying H2 in nearby systems) have escape fractions ranging from 0 to 85 per cent. No LW photons escape the most massive halo in our sample, even from the most massive star. Escape fractions for photons elsewhere in the 11.18-13.6 eV energy range, which can be redshifted into the LW lines at cosmological distances, are generally much higher, being above 60 per cent for all but the least massive stars in the most massive haloes. We find that shielding of H2 by neutral hydrogen, which has been neglected in most studies to date, produces escape fractions that are up to a factor of 3 smaller than those predicted by H2 self-shielding alone.

  8. Alterations in oxidative, inflammatory and apoptotic events in short-lived and long-lived mice testes

    PubMed Central

    Matzkin, María Eugenia; Miquet, Johanna Gabriela; Fang, Yimin; Hill, Cristal Monique; Turyn, Daniel; Calandra, Ricardo Saúl; Bartke, Andrzej; Frungieri, Mónica Beatriz

    2016-01-01

    Aged testes undergo profound histological and morphological alterations leading to a reduced functionality. Here, we investigated whether variations in longevity affect the development of local inflammatory processes, the oxidative state and the occurrence of apoptotic events in the testis. To this aim, well-established mouse models with delayed (growth hormone releasing hormone-knockout and Ames dwarf mice) or accelerated (growth hormone-transgenic mice) aging were used. We hereby show that the testes of short-lived mice show a significant increase in cyclooxygenase 2 expression, PGD2 production, lipid peroxidation, antioxidant enzymes expression, local macrophages and TUNEL-positive germ cells numbers, and the levels of both pro-caspase-3 and cleaved caspase-3. In contrast, although the expression of antioxidant enzymes remained unchanged in testes of long-lived mice, the remainder of the parameters assessed showed a significant reduction. This study provides novel evidence that longevity confers anti-inflammatory, anti-oxidant and anti-apoptotic capacities to the adult testis. Oppositely, short-lived mice suffer testicular inflammatory, oxidative and apoptotic processes. PMID:26805572

  9. Nerve-racking - apoptotic and non-apoptotic roles of caspases in the nervous system of Drosophila.

    PubMed

    Melzer, Juliane; Broemer, Meike

    2016-07-01

    Studies using Drosophila as a model system have contributed enormously to our knowledge of caspase function and regulation. Caspases are best known as central executioners of apoptosis but also control essential physiological processes in a non-apoptotic manner. The Drosophila genome codes for seven caspases and in this review we provide an overview of current knowledge about caspase function in the nervous system. Caspases regulate neuronal death at all developmental stages and in various neuronal populations. In contrast, non-apoptotic roles are less well understood. The development of new genetically encoded sensors for caspase activity provides unprecedented opportunities to study caspase function in the nervous system in more detail. In light of these new tools we discuss the potential of Drosophila as a model to discover new apoptotic and non-apoptotic neuronal roles of caspases. PMID:26900934

  10. Xenon Fractionation, Hydrogen Escape, and the Oxidation of the Earth

    NASA Astrophysics Data System (ADS)

    Zahnle, K. J.; Catling, D. C.

    2014-12-01

    Xenon in Earth's atmosphere is severely mass fractionated and depleted compared to any plausible solar system source material, yet Kr is unfractionated. These observations seem to imply that Xe has escaped from Earth. Vigorous hydrodynamic hydrogen escape can produce mass fractionation in heavy gases. The required hydrogen flux is very high but within the range permitted by solar EUV heating when Earth was 100 Myrs old or younger. However this model cannot explain why Xe escapes but Kr does not. Recently, what appears to be ancient atmospheric xenon has been recovered from several very ancient (3-3.5 Ga) terrestrial hydrothermal barites and cherts (Pujol 2011, 2013). What is eye-catching about this ancient Xe is that it is less fractionated that Xe in modern air. In other words, it appears that a process was active on Earth some 3 to 3.5 billion years ago that caused xenon to fractionate. By this time the Sun was no longer the EUV source that it used to be. If xenon was being fractionated by escape — currently the only viable hypothesis — it had to be in Earth's Archean atmosphere and under rather modest levels of EUV forcing. It should be possible for Xe, but not Kr, to escape from Earth as an ion. In a hydrodynamically escaping hydrogen wind the hydrogen is partially ionized. The key concepts are that ions are much more strongly coupled to the escaping flow than are neutrals (so that a relatively modest flow of H and H+ to space could carry Xe+ along with it, the flux can be small enough to be consistent with diffusion-limited flux), and that Xe alone among the noble gases is more easily ionized than hydrogen. This sort of escape is possible along the polar field lines, although a weak or absent magnetic field would likely work as well. The extended history of hydrogen escape implicit in Xe escape in the Archean is consistent with other suggestions that hydrogen escape in the Archean was considerable. Hydrogen escape plausibly played the key role in creating

  11. 16. INTERIOR VIEW OF SUBMARINE SECTION AT 110FOOT LEVEL, ESCAPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    16. INTERIOR VIEW OF SUBMARINE SECTION AT 110-FOOT LEVEL, ESCAPE TRAINING TANK, SHOWING LADDER TO ESCAPE TANK, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  12. Low expression of pro-apoptotic Bcl-2 family proteins sets the apoptotic threshold in Waldenström Macroglobulinemia

    PubMed Central

    Gaudette, Brian T.; Dwivedi, Bhakti; Chitta, Kasyapa S.; Poulain, Stéphanie; Powell, Doris; Vertino, Paula; Leleu, Xavier; Lonial, Sagar; Chanan-Khan, Asher A.; Kowalski, Jeanne; Boise, Lawrence H.

    2015-01-01

    Waldenström Macroglobulinemia (WM) is a proliferative disorder of IgM secreting, lymphoplasmacytoid cells that inhabit the lymph nodes and bone marrow. The disease carries a high prevalence of activating mutations in MyD88 (91%) and CXCR4 (28%). Because signaling through these pathways leads to Bcl-xL induction, we examined Bcl-2 family expression in WM patients and cell lines. Unlike other B-lymphocyte-derived malignancies, which become dependent on expression of anti-apoptotic proteins to counter expression of pro-apoptotic proteins, WM samples expressed both pro- and anti-apoptotic Bcl-2 proteins at low levels similar to their normal B-cell and plasma cell counterparts. Three WM cell lines expressed pro-apoptotic Bcl-2 family members Bim or Bax and Bak at low levels which determined their sensitivity to inducers of intrinsic apoptosis. In two cell lines, miR-155 upregulation, which is common in WM, was responsible for inhibition of FOXO3a and Bim expression. Both antagonizing miR-155 to induce Bim and proteasome inhibition increased the sensitivity to ABT-737 in these lines indicating a lowering of the apoptotic threshold. In this manner, treatments that increase pro-apoptotic protein expression increase the efficacy of agents treated in combination in addition to direct killing. PMID:25893290

  13. p53 Protein-mediated regulation of phosphoglycerate dehydrogenase (PHGDH) is crucial for the apoptotic response upon serine starvation.

    PubMed

    Ou, Yang; Wang, Shang-Jui; Jiang, Le; Zheng, Bin; Gu, Wei

    2015-01-01

    Although p53 is frequently mutated in human cancers, about 80% of human melanomas retain wild-type p53. Here we report that PHGDH, the key metabolic enzyme that catalyzes the rate-limiting step of the serine biosynthesis pathway, is a target of p53 in human melanoma cells. p53 suppresses PHGDH expression and inhibits de novo serine biosynthesis. Notably, upon serine starvation, p53-mediated cell death is enhanced dramatically in response to Nutlin-3 treatment. Moreover, PHGDH has been found recently to be amplified frequently in human melanomas. We found that PHGDH overexpression significantly suppresses the apoptotic response, whereas RNAi-mediated knockdown of endogenous PHGDH promotes apoptosis under the same treatment. These results demonstrate an important role of p53 in regulating the serine biosynthesis pathway through suppressing PHGDH expression and reveal serine deprivation as a novel approach to sensitize p53-mediated apoptotic responses in human melanoma cells. PMID:25404730

  14. Surface code—biophysical signals for apoptotic cell clearance

    NASA Astrophysics Data System (ADS)

    Biermann, Mona; Maueröder, Christian; Brauner, Jan M.; Chaurio, Ricardo; Janko, Christina; Herrmann, Martin; Muñoz, Luis E.

    2013-12-01

    Apoptotic cell death and the clearance of dying cells play an important and physiological role in embryonic development and normal tissue turnover. In contrast to necrosis, apoptosis proceeds in an anti-inflammatory manner. It is orchestrated by the timed release and/or exposure of so-called ‘find-me’, ‘eat me’ and ‘tolerate me’ signals. Mononuclear phagocytes are attracted by various ‘find-me’ signals, including proteins, nucleotides, and phospholipids released by the dying cell, whereas the involvement of granulocytes is prevented via ‘stay away’ signals. The exposure of anionic phospholipids like phosphatidylserine (PS) by apoptotic cells on the outer leaflet of the plasma membrane is one of the main ‘eat me’ signals. PS is recognized by a number of innate receptors as well as by soluble bridging molecules on the surface of phagocytes. Importantly, phagocytes are able to discriminate between viable and apoptotic cells both exposing PS. Due to cytoskeleton remodeling PS has a higher lateral mobility on the surfaces of apoptotic cells thereby promoting receptor clustering on the phagocyte. PS not only plays an important role in the engulfment process, but also acts as ‘tolerate me’ signal inducing the release of anti-inflammatory cytokines by phagocytes. An efficient and fast clearance of apoptotic cells is required to prevent secondary necrosis and leakage of intracellular danger signals into the surrounding tissue. Failure or prolongation of the clearance process leads to the release of intracellular antigens into the periphery provoking inflammation and development of systemic inflammatory autoimmune disease like systemic lupus erythematosus. Here we review the current findings concerning apoptosis-inducing pathways, important players of apoptotic cell recognition and clearance as well as the role of membrane remodeling in the engulfment of apoptotic cells by phagocytes.

  15. Prey escaping wolves, Canis lupus, despite close proximity

    USGS Publications Warehouse

    Nelson, M.E.; Mech, L.D.

    1993-01-01

    We describe attacks by wolf (Canis lupus) packs in Minnesota on a white-tailed deer (Odocoileus virginianus) and a moose (Alces alces) in which wolves were within contact distance of the prey but in which the prey escaped.

  16. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... wearing life jackets. There must be no protrusions in means of escape that could cause injury, ensnare clothing, or damage life jackets. (f) The minimum clear opening of a door or passageway used as a means...

  17. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... wearing life jackets. There must be no protrusions in means of escape that could cause injury, ensnare clothing, or damage life jackets. (f) The minimum clear opening of a door or passageway used as a means...

  18. 40. Launch Area, Underground Missile Storage Structure, detail of escape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    40. Launch Area, Underground Missile Storage Structure, detail of escape hatch and decontamination shower VIEW WEST - NIKE Missile Battery PR-79, Launch Area, East Windsor Road south of State Route 101, Foster, Providence County, RI

  19. 10. VIEW OF SILO DOORS, AIR VENTS, AND ESCAPE HATCH, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. VIEW OF SILO DOORS, AIR VENTS, AND ESCAPE HATCH, LOOKING EAST. WHITE STRUCTURES BELONG TO CURRENT OCCUPANTS Everett Weinreb, photographer, April 1988 - Los Pinetos Nike Missile Site, Santa Clara Road, Los Angeles National Forest, Sylmar, Los Angeles County, CA

  20. 3. VIEW OF ESCAPE TUNNEL IN NORTH FACE OF LAUNCH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW OF ESCAPE TUNNEL IN NORTH FACE OF LAUNCH OPERATIONS BUILDING. BUNKER PERISCOPE VISIBLE ABOVE RIGHT CORNER OF TUNNEL. - Vandenberg Air Force Base, Space Launch Complex 3, Launch Operations Building, Napa & Alden Roads, Lompoc, Santa Barbara County, CA

  1. 14. View inside Building 802, the "Escape Hatch" at the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. View inside Building 802, the "Escape Hatch" at the rear of the "Sleeping Quarters", facing south. - Naval Air Station Fallon, 100-man Fallout Shelter, 800 Complex, off Carson Road near intersection of Pasture & Berney Roads, Fallon, Churchill County, NV

  2. 61. View of exhaust air vent (foreground), escape hatch, and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    61. View of exhaust air vent (foreground), escape hatch, and elevator doors at launch pad "A" with building 157, sentry control box on right, looking southwest - Nike Missile Battery MS-40, County Road No. 260, Farmington, Dakota County, MN

  3. Survey of space escape/rescue/survivability capabilities.

    NASA Technical Reports Server (NTRS)

    Fleisig, R.; Bolger, P. H.; Heath, G. W.

    1971-01-01

    Discussion of preventive or remedial systems to achieve safer space flight operations. Escape, rescue, and survival systems are defined by categories: on board, prepositioned aid, and earth-launched concepts. The survey considers separable escape or survival capsules; standby escape or rescue systems; and earth-launched manned and unmanned rescue systems. Reports covering such systems are listed, and the contents are classified as to scope of investigation, space mission, and design approach. Mission classes considered are earth orbit, lunar, and interplanetary. Results of the space escape, rescue, and survivability investigations are summarized in terms of system features and performance, including apparent voids or limitations in rescue capability. Recovery requirements and resources for space rescue are discussed.

  4. Pioneer Venus Orbiter (PVO) Ionosphere Evidence for Atmospheric Escape

    NASA Astrophysics Data System (ADS)

    Grebowsky, J. M.; Hoegy, W. R.

    2009-12-01

    An early estimate of escape of H2O from Venus [McElroy et al., 1982] using observed hot oxygen densities inferred by Nagy et al. [1981] from PVO OUVS 1304 Å dayglow and using ionization rates from photoionization and electron impact. This resulted in an estimated oxygen ionization rate planet-wide above the plasmapause of 3x1025 atoms/s. Based on the energetic O+ being swept up and removed by solar wind, McElroy et al. [1982] gave an estimate of a loss rate for O of 6x106 atoms/cm2/s. Using a different method of estimating escape based data in the ionotail of Venus, Brace et al. [1987] estimated a total planetary O+ escape rate of 5x1025 ions/s. Their estimate was based on PVO measurements of superthermal O+ (energy range 9-16 eV) in the tail ray plasma between 2000 and 3000 km. Their estimated global mean flux was 107 atoms/cm2/s. The two escape rates are remarkably close considering all the errors involved in such estimates of escape. A study of escape by Luhmann et al. [2008] using VEX observations at low solar activity finds modest escape rates, prompting the authors to reconsider the evidence from both PVO and VEX of the possibility of enhanced escape during extreme interplanetary conditions. We reexamine the variation of escape under different solar wind conditions using ion densities and plasma content in the dayside and nightside of Venus using PVO ionosphere density during times of high solar activity. Citations: Brace, L.H., W. T. Kasprzak, H.A. Taylor, R. F. Theis, C. T. Russess, A. Barnes, J. D. Mihalov, and D. M. Hunten, "The Ionotail of Venus: Its Configuration and Evidence for Ion Escape", J. Geophys. Res. 92, 15-26, 1987. Luhmann, J.G., A. Fedorov, S. Barabash, E. Carlsson, Y. Futaana, T.L. Zhang, C.T. Russell, J.G. Lyon, S.A. Ledvina, and D.A. Brain, “Venus Express observations of atmospheric oxygen escape during the passage of several coronal mass ejections”, J. Geophys. Res., 113, 2008. McElroy, M. B., M. J. Prather, J. M. Rodiquez, " Loss

  5. Photoelectron escape fluxes over the equatorial and midlatitude regions

    NASA Technical Reports Server (NTRS)

    Narasingarao, B. C.; Singh, R. N.; Maier, E. J.

    1972-01-01

    Satellite measurements of photoelectron escape flux around noontime made by Explorer 31 in 600-800 km altitude range are reported for the equatorial and midlatitude regions. The pitch angle distributions and the spectral distributions are derived from the data. Analyzed data show that the flux for equatorial regions is lower by a factor 2 to 3 in comparison to that of midlatitude regions. Theoretical calculations are also made to compare with observed escape fluxes.

  6. Initiation and spread of escape waves within animal groups

    PubMed Central

    Herbert-Read, James E.; Buhl, Jerome; Hu, Feng; Ward, Ashley J. W.; Sumpter, David J. T.

    2015-01-01

    The exceptional reactivity of animal collectives to predatory attacks is thought to be owing to rapid, but local, transfer of information between group members. These groups turn together in unison and produce escape waves. However, it is not clear how escape waves are created from local interactions, nor is it understood how these patterns are shaped by natural selection. By startling schools of fish with a simulated attack in an experimental arena, we demonstrate that changes in the direction and speed by a small percentage of individuals that detect the danger initiate an escape wave. This escape wave consists of a densely packed band of individuals that causes other school members to change direction. In the majority of cases, this wave passes through the entire group. We use a simulation model to demonstrate that this mechanism can, through local interactions alone, produce arbitrarily large escape waves. In the model, when we set the group density to that seen in real fish schools, we find that the risk to the members at the edge of the group is roughly equal to the risk of those within the group. Our experiments and modelling results provide a plausible explanation for how escape waves propagate in nature without centralized control. PMID:26064630

  7. Some Possible Cases of Escape Mimicry in Neotropical Butterflies.

    PubMed

    Pinheiro, C E G; Freitas, A V L

    2014-10-01

    The possibility that escape or evasive mimicry evolved in butterflies and other prey insects in a similar fashion to classical Batesian and Müllerian mimicry has long been advanced in the literature. However, there is a general disagreement among lepidopterists and evolutionary biologists on whether or not escape mimicry exists, as well as in which mimicry rings this form of mimicry has evolved. Here, we review some purported cases of escape mimicry in Neotropical butterflies and suggest new mimicry rings involving several species of Archaeoprepona, Prepona, and Doxocopa (the "bright blue bands" ring) and species of Colobura and Hypna (the "creamy bands" ring) where the palatability of butterflies, their ability to escape predator attacks, geographic distribution, relative abundance, and co-occurrence in the same habitats strongly suggest that escape mimicry is involved. In addition, we also indicate other butterfly taxa whose similarities of coloration patterns could be due to escape mimicry and would constitute important case studies for future investigation. PMID:27193948

  8. Foraging behavior delays mechanically-stimulated escape responses in fish.

    PubMed

    Bohórquez-Herrera, Jimena; Kawano, Sandy M; Domenici, Paolo

    2013-11-01

    Foraging and the evasion of predators are fundamental for the survival of organisms, but they impose contrasting demands that can influence performance in each behavior. Previous studies suggested that foraging organisms may experience decreased vigilance to attacks by predators; however, little is known about the effect of foraging on escape performance with respect to the kinematics and the timing of the response. This study tested the hypothesis that engaging in foraging activities affected escape performance by comparing fast-start escape responses of silver-spotted sculpins Blepsias cirrhosus under three conditions: (1) control (no foraging involved), (2) while targeting prey, and (3) immediately after capture of prey. Escape response variables (non-locomotor and locomotor) were analyzed from high-speed videos. Responsiveness was lower immediately after capturing a prey item compared with the other two treatments, and latency of performance was higher in the control treatment than in the other two. Locomotor variables such as maximum speed, maximum acceleration, and turning rates did not show statistical differences among the three groups. Our results demonstrate that foraging can negatively affect two fundamental components of the escape response: (1) responsiveness and (2) latency of escape, suggesting that engaging in foraging may decrease an individual's ability to successfully evade predators. PMID:23624863

  9. Optimal escapement in stage-structured fisheries with environmental stochasticity.

    PubMed

    Holden, Matthew H; Conrad, Jon M

    2015-11-01

    Stage-structured population models are commonly used to understand fish population dynamics and additionally for stock assessment. Unfortunately, there is little theory on the optimal harvest of stage-structured populations, especially in the presence of stochastic fluctuations. In this paper, we find closed form optimal equilibrium escapement policies for a three-dimensional, discrete-time, stage-structured population model with linear growth, post-harvest nonlinear recruitment, and stage-specific pricing and extend the analytic results to structured populations with environmental stochasticity. When only fishing reproductive adults, stochasticity does not affect optimal escapement policies. However, when harvesting immature fish, the addition of stochasticity can increase or decrease optimal escapement depending on the second and third derivative of the recruitment function. For logistic recruitment, stochasticity reduces optimal immature escapement by a multiplicative factor of one over one plus the variance of the environmental noise. Using hard clam, Mercenaria mercenaria, as an example and assuming Beverton-Holt recruitment, we show that optimal fishing of hard clam targets the immature stage class exclusively and that environmental stochasticity increases optimal escapement for low discount rates and decreases optimal escapement for high discount rates. PMID:26362229

  10. Potential of apoptotic pathway-targeted cancer therapeutic research: Where do we stand?

    PubMed Central

    Baig, S; Seevasant, I; Mohamad, J; Mukheem, A; Huri, H Z; Kamarul, T

    2016-01-01

    Underneath the intricacy of every cancer lies mysterious events that impel the tumour cell and its posterity into abnormal growth and tissue invasion. Oncogenic mutations disturb the regulatory circuits responsible for the governance of versatile cellular functions, permitting tumour cells to endure deregulated proliferation, resist to proapoptotic insults, invade and erode normal tissues and above all escape apoptosis. This disruption of apoptosis has been highly implicated in various malignancies and has been exploited as an anticancer strategy. Owing to the fact that apoptosis causes minimal inflammation and damage to the tissue, apoptotic cell death-based therapy has been the centre of attraction for the development of anticancer drugs. Increased understanding of the molecular pathways underlying apoptosis has enabled scientists to establish unique approaches targeting apoptosis pathways in cancer therapeutics. In this review, we reconnoitre the two major pathways (intrinsic and extrinsic) targeted cancer therapeutics, steering toward chief modulators of these pathways, such as B-cell lymphoma 2 protein family members (pro- and antiapoptotic), inhibitor of apoptosis proteins, and the foremost thespian of extrinsic pathway regulator, tumour necrosis factor-related apoptosis-inducing agent. Together, we also will have a look from clinical perspective to address the agents (drugs) and therapeutic strategies adopted to target these specific proteins/pathways that have entered clinical trials. PMID:26775709

  11. Apoptotic effects and glucose-6-phosphate dehydrogenase responses in liver and gill tissues of rainbow trout treated with chlorpyrifos.

    PubMed

    Topal, Ahmet; Atamanalp, Muhammed; Oruç, Ertan; Kırıcı, Muammer; Kocaman, Esat Mahmut

    2014-12-01

    We investigated apoptotic effects and changes in glucose-6-phosphate dehydrogenase (G6PD) enzyme activity in liver and gill tissues of fish exposed to chlorpyrifos. Three different chlorpyrifos doses (2.25, 4.5 and 6.75 μg/L) were administrated to rainbow trout at different time intervals (24, 48, 72 and 96 h). Acute exposure to chlorpyrifos showed time dependent decrease in G6PD enzyme activity at all concentrations (p < 0.05). Immunohistochemical results showed that chlorpyrifos caused mucous cell loss in gill tissue and apoptosis via caspase-3 activation in fish. The present study suggested that chlorpyrifos inhibits G6PD enzyme and causes mucous cell loss in gill and apoptosis in gill and liver tissues. PMID:25438950

  12. Primary enzyme quantitation

    DOEpatents

    Saunders, G.C.

    1982-03-04

    The disclosure relates to the quantitation of a primary enzyme concentration by utilizing a substrate for the primary enzyme labeled with a second enzyme which is an indicator enzyme. Enzyme catalysis of the substrate occurs and results in release of the indicator enzyme in an amount directly proportional to the amount of primary enzyme present. By quantifying the free indicator enzyme one determines the amount of primary enzyme present.

  13. Trade-offs between performance and variability in the escape responses of bluegill sunfish (Lepomis macrochirus)

    PubMed Central

    Hitchcock, Amanda C.; Chen, Tiffany; Connolly, Erin; Darakananda, Karin; Jeong, Janet; Quist, Arbor; Robbins, Allison; Ellerby, David J.

    2015-01-01

    Successful predator evasion is essential to the fitness of many animals. Variation in escape behaviour may be adaptive as it reduces predictability, enhancing escape success. High escape velocities and accelerations also increase escape success, but biomechanical factors likely constrain the behavioural range over which performance can be maximized. There may therefore be a trade-off between variation and performance during escape responses. We have used bluegill sunfish (Lepomis macrochirus) escape responses to examine this potential trade-off, determining the full repertoire of escape behaviour for individual bluegill sunfish and linking this to performance as indicated by escape velocity and acceleration. Fish escapes involve an initial C-bend of the body axis, followed by variable steering movements. These generate thrust and establish the escape direction. Directional changes during the initial C-bend were less variable than the final escape angle, and the most frequent directions were associated with high escape velocity. Significant inter-individual differences in escape angles magnified the overall variation, maintaining unpredictability from a predator perspective. Steering in the latter stages of the escape to establish the final escape trajectory also affected performance, with turns away from the stimulus associated with reduced velocity. This suggests that modulation of escape behaviour by steering may also have an associated performance cost. This has important implications for understanding the scope and control of intra- and inter-individual variation in escape behaviour and the associated costs and benefits. PMID:25910940

  14. Trade-offs between performance and variability in the escape responses of bluegill sunfish (Lepomis macrochirus).

    PubMed

    Hitchcock, Amanda C; Chen, Tiffany; Connolly, Erin; Darakananda, Karin; Jeong, Janet; Quist, Arbor; Robbins, Allison; Ellerby, David J

    2015-01-01

    Successful predator evasion is essential to the fitness of many animals. Variation in escape behaviour may be adaptive as it reduces predictability, enhancing escape success. High escape velocities and accelerations also increase escape success, but biomechanical factors likely constrain the behavioural range over which performance can be maximized. There may therefore be a trade-off between variation and performance during escape responses. We have used bluegill sunfish (Lepomis macrochirus) escape responses to examine this potential trade-off, determining the full repertoire of escape behaviour for individual bluegill sunfish and linking this to performance as indicated by escape velocity and acceleration. Fish escapes involve an initial C-bend of the body axis, followed by variable steering movements. These generate thrust and establish the escape direction. Directional changes during the initial C-bend were less variable than the final escape angle, and the most frequent directions were associated with high escape velocity. Significant inter-individual differences in escape angles magnified the overall variation, maintaining unpredictability from a predator perspective. Steering in the latter stages of the escape to establish the final escape trajectory also affected performance, with turns away from the stimulus associated with reduced velocity. This suggests that modulation of escape behaviour by steering may also have an associated performance cost. This has important implications for understanding the scope and control of intra- and inter-individual variation in escape behaviour and the associated costs and benefits. PMID:25910940

  15. Exocytosis of macrophage lysosomes leads to digestion of apoptotic adipocytes and foam cell formation[S

    PubMed Central

    Haka, Abigail S.; Barbosa-Lorenzi, Valéria C.; Lee, Hyuek Jong; Falcone, Domenick J.; Hudis, Clifford A.; Dannenberg, Andrew J.

    2016-01-01

    Many types of apoptotic cells are phagocytosed and digested by macrophages. Adipocytes can be hundreds of times larger than macrophages, so they are too large to be digested by conventional phagocytic processes. The nature of the interaction between macrophages and apoptotic adipocytes has not been studied in detail. We describe a cellular process, termed exophagy, that is important for macrophage clearance of dead adipocytes and adipose tissue homeostasis. Using mouse models of obesity, human tissue, and a cell culture model, we show that macrophages form hydrolytic extracellular compartments at points of contact with dead adipocytes using local actin polymerization. These compartments are acidic and contain lysosomal enzymes delivered by exocytosis. Uptake and complete degradation of adipocyte fragments, which are released by extracellular hydrolysis, leads to macrophage foam cell formation. Exophagy-mediated foam cell formation is a highly efficient means by which macrophages internalize large amounts of lipid, which may ultimately overwhelm the metabolic capacity of the macrophage. This process provides a mechanism for degradation of objects, such as dead adipocytes, that are too large to be phagocytosed by macrophages. PMID:27044658

  16. Exocytosis of macrophage lysosomes leads to digestion of apoptotic adipocytes and foam cell formation.

    PubMed

    Haka, Abigail S; Barbosa-Lorenzi, Valéria C; Lee, Hyuek Jong; Falcone, Domenick J; Hudis, Clifford A; Dannenberg, Andrew J; Maxfield, Frederick R

    2016-06-01

    Many types of apoptotic cells are phagocytosed and digested by macrophages. Adipocytes can be hundreds of times larger than macrophages, so they are too large to be digested by conventional phagocytic processes. The nature of the interaction between macrophages and apoptotic adipocytes has not been studied in detail. We describe a cellular process, termed exophagy, that is important for macrophage clearance of dead adipocytes and adipose tissue homeostasis. Using mouse models of obesity, human tissue, and a cell culture model, we show that macrophages form hydrolytic extracellular compartments at points of contact with dead adipocytes using local actin polymerization. These compartments are acidic and contain lysosomal enzymes delivered by exocytosis. Uptake and complete degradation of adipocyte fragments, which are released by extracellular hydrolysis, leads to macrophage foam cell formation. Exophagy-mediated foam cell formation is a highly efficient means by which macrophages internalize large amounts of lipid, which may ultimately overwhelm the metabolic capacity of the macrophage. This process provides a mechanism for degradation of objects, such as dead adipocytes, that are too large to be phagocytosed by macrophages. PMID:27044658

  17. Cytotoxic and apoptotic effects of Ebenus boissieri Barbey on human lung cancer cell line A549

    PubMed Central

    Aydemir, Esra Arslan; Simsek, Ece; Imir, Nilüfer; Göktürk, Ramazan Süleyman; Yesilada, Erdem; Fiskin, Kayahan

    2015-01-01

    Background: Fabaceae family members are known to possess preventive and therapeutic potentials against various types of cancers. Objective: The aim of this study was to investigate the cytotoxic and apoptotic effects of hydroalcoholic extracts from the aerial parts and roots of an endemic Ebenus species; Ebenus boissieri Barbey in human lung cancer cell line. Materials and Methods: After treatment with hydroalcoholic extracts cytotoxic activities of both extracts were measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay, whereas caspase-3 activity, tumor necrosis factor-a lpha (TNF-α) and interferon gamma (IFN-γ) releasewere measured by enzyme linked immunosorbent assay. Results: According to in vitro assay results, the increase in all caspases activity suggested that extracts induce cells to undergo apoptosis. Especially, induction in caspase-3 activity was the most remarkable result of this study. Both aerial part and root extracts induced apoptosis by increasing caspase-3 activity, TNF-α and IFN-γ release. When compared to their relative controls, the concentrations of both TNF-α and IFN-γ in extract-treated groups were significantly and dose dependently exalted. Conclusion: Taken together, our results indicate that the hydroalcoholic extracts of E. boissieri can be considered as a source of new anti-apoptotic and therefore anti-carcinogenic agent. PMID:26109772

  18. BAD, a Proapoptotic Protein, Escapes ERK/RSK Phosphorylation in Deguelin and siRNA-Treated HeLa Cells

    PubMed Central

    Hafeez, Samra; Urooj, Mahwish; Saleem, Shamiala; Gillani, Zeeshan; Shaheen, Sumaira; Qazi, Mahmood Husain; Naseer, Muhammad Imran; Iqbal, Zafar; Ansari, Shakeel Ahmed; Haque, Absarul; Asif, Muhammad; Mir, Manzoor Ahmad; Ali, Ashraf; Pushparaj, Peter Natesan; Jamal, Mohammad Sarwar; Rasool, Mahmood

    2016-01-01

    This study has been undertaken to explore the therapeutic effects of deguelin and specific siRNAs in HeLa cells. The data provided clearly show the silencing of ERK 1/2 with siRNAs and inhibition of ERK1/2 with deguelin treatment in HeLa cells. Additionally, we are providing information that deguelin binds directly to anti-apoptotic Bcl-2, Bcl-xl and Mcl-1 in the hydrophobic grooves, thereby releasing BAD and BAX from dimerization with these proteins. This results in increased apoptotic activity through the intrinsic pathway involved in rupture of mitochondrial membrane and release of cytochrome C. Evidence for inhibition of ERK1/2 by deguelin and escape of BAD phosphorylation at serine 112 through ERK/RSK pathway has been further fortified by obtaining similar results by silencing ERK 1/2 each with specific siRNAs. Increase in BAD after treatment with deguelin or siRNAs has been interpreted to mean that deguelin acts through several alternative pathways and therefore can be used as effective therapeutic agent. PMID:26745145

  19. Clearance of apoptotic neutrophils and resolution of inflammation.

    PubMed

    Greenlee-Wacker, Mallary C

    2016-09-01

    The engulfment of apoptotic cells by phagocytes, a process referred to as efferocytosis, is essential for maintenance of normal tissue homeostasis and a prerequisite for the resolution of inflammation. Neutrophils are the predominant circulating white blood cell in humans, and contain an arsenal of toxic substances that kill and degrade microbes. Neutrophils are short-lived and spontaneously die by apoptosis. This review will highlight how the engulfment of apoptotic neutrophils by human phagocytes occurs, how heterogeneity of phagocyte populations influences efferocytosis signaling, and downstream consequences of efferocytosis. The efferocytosis of apoptotic neutrophils by macrophages promotes anti-inflammatory signaling, prevents neutrophil lysis, and dampens immune responses. Given the immunomodulatory properties of efferocytosis, understanding pathways that regulate and enhance efferocytosis could be harnessed to combat infection and chronic inflammatory conditions. PMID:27558346

  20. Opium induces apoptosis in Jurkat cells via promotion of pro-apoptotic and inhibition of anti-apoptotic molecules

    PubMed Central

    Arababadi, Mohammad Kazemi; Asadikaram, Gholamreza

    2016-01-01

    Objective(s): The aim of this study was to determine the important molecules involved in apoptosis induction by opium in Jurkat cell line. Materials and Methods: Jurkat cells were incubated 48 hrs with 2.86×10-5 g/ml concentration of opium and apoptosis as well as expression levels of related molecules were measured. Results: Our results demonstrated that 50.3±0.2 percent of opium treated Jurkat cells were revealed apoptotic features. The levels of mRNA of several pro-apoptotic and anti-apoptotic molecules were increased and decreased, respectively, in the opium treated cells. The results also demonstrated that expression levels of BCL2, DFFA and NOL3 as anti-apoptotic molecules were increased in the opium treated cells. Conclusion: It seems that opium induces apoptosis in Jurkat cells via both intrinsic and extrinsic pathways. Although opium induces apoptosis in the cells but increased expression of some anti-apoptotic molecules may be a normal resistance of the cell for death. PMID:27081468

  1. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects.

    PubMed

    Hamed, Sherifa S; Al-Yhya, Nouf A; El-Khadragy, Manal F; Al-Olayan, Ebtesam M; Alajmi, Reem A; Hassan, Zeinab K; Hassan, Salwa B; Abdel Moneim, Ahmed E

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds. PMID:27547187

  2. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects

    PubMed Central

    Hamed, Sherifa S.; AL-Yhya, Nouf A.; El-Khadragy, Manal F.; Al-Olayan, Ebtesam M.; Alajmi, Reem A.; Hassan, Zeinab K.; Hassan, Salwa B.; Abdel Moneim, Ahmed E.

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds. PMID:27547187

  3. Stars on the run: escaping from stellar clusters

    NASA Astrophysics Data System (ADS)

    Moyano Loyola, Guido R. I.; Hurley, Jarrod R.

    2013-09-01

    A significant proportion of Milky Way stars are born in stellar clusters, which dissolve over time so that the members become part of the disc and halo populations of the Galaxy. In this work, we will assume that these young stellar clusters live mainly within the disc of the Galaxy and that they can have primordial binary percentages ranging from 0 per cent to as high as 70 per cent. We have evolved models of such clusters to an age of 4 Gyr through N-body simulations, paying attention to the stars and binaries that escape in the process. We have quantified the contribution of these escaping stars to the Galaxy population by analysing their escape velocity and evolutionary stage at the moment of escape. In this way, we could analyse the mechanisms that produced these escapers, whether evaporation through weak two-body encounters, energetic close encounters or stellar evolution events, e.g. supernovae. In our models, we found that the percentage of primordial binaries in a star cluster does not produce significant variations in the velocities of the stars that escape in the velocity range of 0-20 km s-1. However, in the high-velocity 20-100 km s-1 range the number of escapers increased markedly as the primordial binary percentage increased. We could also infer that dissolving stellar clusters such as those that we have modelled can populate the Galactic halo with giant stars for which the progenitors were stars of up to 2.4 M⊙. Furthermore, choices made for the velocity kicks of remnants do influence the production of hyper-velocity stars - and to a lesser extent stars in the high-velocity range - but once again the difference for the 99 per cent of stars in the 0-20 km s-1 range is not significant.

  4. Green Pea Galaxies Reveal Secrets of Lyα Escape

    NASA Astrophysics Data System (ADS)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Jaskot, Anne; Zheng, Zhenya; Dijkstra, Mark; Wang, JunXian

    2016-01-01

    In star-forming galaxies, a lot of Lyα photons were generated in HII regions surrounding massive stars. The escape of Lyα photons from galaxies is a key issue in studying high redshift galaxies and probing cosmic reionization with Lyα. To understand Lyα escape, it is valuable to study high quality Lyα profiles in Lyα emitters. However, such studies are rare due to the faintness of high-z Lyα emitters and the lack of local analogs with high Lyα equivalent width. Here we show that "Green Pea" galaxies are the best local analogs of high-z Lyα emitters and their high quality Lyα profiles demonstrate low HI column density is the key to Lyα escape. The Lyα escape fraction shows correlations with the ratio of Lyα blue peak velocity to Hα line width, the normalized flux density at valley of Lyα profile, and a few other features of Lyα profiles. We compared the Lyα profiles with outflowing HI shell radiative transfer model and found that the best-fit HI column density is anti-correlated with the Lyα escape fraction. We also found an anti-correlation between Lyα escape fraction and galactic metallicity. Our results support that LAEs with high Lyα escape fraction have low metallicity, low HI column density, and mild HI gas outflow.

  5. Engulfment of apoptotic cells: signals for a good meal.

    PubMed

    Ravichandran, Kodi S; Lorenz, Ulrike

    2007-12-01

    The clearance of apoptotic cells by phagocytes is an integral component of normal life, and defects in this process can have significant implications for self tolerance and autoimmunity. Recent studies have provided new insights into the engulfment process, including how phagocytes seek apoptotic cells, how they recognize and ingest these targets and how they maintain cellular homeostasis after the 'meal'. Several new factors that regulate engulfment have been identified, whereas the roles of some of the older players require revision. This Review focuses on these recent developments and attempts to highlight some of the important questions in this field. PMID:18037898

  6. MAVEN Measurements of the Ion Escape Rate from Mars

    NASA Astrophysics Data System (ADS)

    Brain, Dave; Dong, Yaxue; Fortier, Kier; Fang, Xiaohua; McFadden, James; Halekas, Jasper; Connerney, Jack; Eparvier, Frank; Dong, Chuanfei; Bougher, Stephen; Ma, Yingjuan; Modolo, Ronan; Lillis, Rob; Luhmann, Janet; Curry, Shannon; Seki, Kanako; Jakosky, Bruce

    2015-04-01

    The loss of atmospheric particles (neutral atoms, neutral molecules, ions) to space is thought to have played a role in the evolution of Martian climate over the past ~4 billion years. Due to the lack of a global magnetic field on Mars, the solar wind has direct access to the upper layers of the Martian atmosphere, and can drive non-thermal escape of charged particles (ions) from the atmosphere. Two spacecraft (Phobos 2 and Mars Express) have previously measured escaping ions at Mars. The recently arrived MAVEN spacecraft is equipped with instruments to measure escaping ions with high time cadence and high energy and mass resolution, as well as instruments to provide contextual information about what controls the variation in escape rates. We report on the total escape rate of heavy planetary ions from the Martian atmosphere measured by MAVEN. Heavy ions are identified in data from the SupraThermal And Thermal Ion Composition (STATIC) instrument. Rudimentary estimates of ion escape rate are obtained by summing the measured ion fluxes over a surface downstream from Mars with respect to the solar wind flow. This estimate can then be refined to account for the limited field of view of the instrument (investigation of measured particle distributions) and the limited spatial coverage of the spacecraft orbit trajectory. Variability in measured escape rates can also be grouped according to upstream conditions and the orientation of Mars (and its crustal magnetic fields) with respect to the solar wind. Important upstream drivers include the solar Extreme Ultraviolet (EUV) flux, solar wind pressure, and the interplanetary magnetic field strength and direction. These drivers are measured directly by MAVEN's EUV, SWIA, and MAG instruments. We will provide an initial estimate of ion escape rates based on the first several months of MAVEN data. We will then report on progress to refine these estimates to correct for instrument field of view and spacecraft coverage effects, as

  7. How embryos escape from danger: the mechanism of rapid, plastic hatching in red-eyed treefrogs.

    PubMed

    Cohen, Kristina L; Seid, Marc A; Warkentin, Karen M

    2016-06-15

    Environmentally cued hatching allows embryos to escape dangers and exploit new opportunities. Such adaptive responses require a flexibly regulated hatching mechanism sufficiently fast to meet relevant challenges. Anurans show widespread, diverse cued hatching responses, but their described hatching mechanisms are slow, and regulation of timing is unknown. Arboreal embryos of red-eyed treefrogs, Agalychnis callidryas, escape from snake attacks and other threats by very rapid premature hatching. We used videography, manipulation of hatching embryos and electron microscopy to investigate their hatching mechanism. High-speed video revealed three stages of the hatching process: pre-rupture shaking and gaping, vitelline membrane rupture near the snout, and muscular thrashing to exit through the hole. Hatching took 6.5-49 s. We hypothesized membrane rupture to be enzymatic, with hatching enzyme released from the snout during shaking. To test this, we displaced hatching embryos to move their snout from its location during shaking. The membrane ruptured at the original snout position and embryos became trapped in collapsed capsules; they either moved repeatedly to relocate the hole or shook again and made a second hole to exit. Electron microscopy revealed that hatching glands are densely concentrated on the snout and absent elsewhere. They are full of vesicles in embryos and release most of their contents rapidly at hatching. Agalychnis callidryas' hatching mechanism contrasts with the slow process described in anurans to date and exemplifies one way in which embryos can achieve rapid, flexibly timed hatching to escape from acute threats. Other amphibians with cued hatching may also have novel hatching mechanisms. PMID:27307544

  8. Verge and Foliot Clock Escapement: A Simple Dynamical System

    NASA Astrophysics Data System (ADS)

    Denny, Mark

    2010-09-01

    The earliest mechanical clocks appeared in Europe in the 13th century. From about 1250 CE to 1670 CE, these simple clocks consisted of a weight suspended from a rope or chain that was wrapped around a horizontal axle. To tell time, the weight must fall with a slow uniform speed, but, under the action of gravity alone, such a suspended weight would accelerate. To prevent this acceleration, an escapement mechanism was required. The best such escapement mechanism was called the verge and foliot escapement, and it was so successful that it lasted until about 1800 CE. These simple weight-driven clocks with verge and foliot escapements were accurate enough to mark the hours but not minutes or seconds. From 1670, significant improvements were made (principally by introducing pendulums and the newly invented anchor escapement) that justified the introduction of hands to mark minutes, and then seconds. By the end of the era of mechanical clocks, in the first half of the 20th century, these much-studied and much-refined machines were accurate to a millisecond a day.

  9. Enhancing endosomal escape for nanoparticle mediated siRNA delivery

    NASA Astrophysics Data System (ADS)

    Ma, Da

    2014-05-01

    Gene therapy with siRNA is a promising biotechnology to treat cancer and other diseases. To realize siRNA-based gene therapy, a safe and efficient delivery method is essential. Nanoparticle mediated siRNA delivery is of great importance to overcome biological barriers for systemic delivery in vivo. Based on recent discoveries, endosomal escape is a critical biological barrier to be overcome for siRNA delivery. This feature article focuses on endosomal escape strategies used for nanoparticle mediated siRNA delivery, including cationic polymers, pH sensitive polymers, calcium phosphate, and cell penetrating peptides. Work has been done to develop different endosomal escape strategies based on nanoparticle types, administration routes, and target organ/cell types. Also, enhancement of endosomal escape has been considered along with other aspects of siRNA delivery to ensure target specific accumulation, high cell uptake, and low toxicity. By enhancing endosomal escape and overcoming other biological barriers, great progress has been achieved in nanoparticle mediated siRNA delivery.

  10. THE ESCAPE FRACTION OF IONIZING RADIATION FROM GALAXIES

    SciTech Connect

    Benson, Andrew; Venkatesan, Aparna; Shull, J. Michael E-mail: avenkatesan@usfca.edu

    2013-06-10

    The escape of ionizing radiation from galaxies plays a critical role in the evolution of gas in galaxies, and the heating and ionization history of the intergalactic medium. We present semi-analytic calculations of the escape fraction of ionizing radiation for both hydrogen and helium from galaxies ranging from primordial systems to disk-type galaxies that are not heavily dust-obscured. We consider variations in the galaxy density profile, source type, location, and spectrum, and gas overdensity/distribution factors. For sufficiently hard first-light sources, the helium ionization fronts closely track or advance beyond that of hydrogen. Key new results in this work include calculations of the escape fractions for He I and He II ionizing radiation, and the impact of partial ionization from X-rays from early active galactic nuclei or stellar clusters on the escape fractions from galaxy halos. When factoring in frequency-dependent effects, we find that X-rays play an important role in boosting the escape fractions for both hydrogen and helium, but especially for He II. We briefly discuss the implications of these results for recent observations of the He II reionization epoch at low redshifts, as well as the UV data and emission-line signatures from early galaxies anticipated from future satellite missions.

  11. Single-File Escape of Colloidal Particles from Microfluidic Channels.

    PubMed

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-15

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10^{-15}  N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions. PMID:27472142

  12. Folding and escape of nascent proteins at ribosomal exit tunnel

    NASA Astrophysics Data System (ADS)

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein.

  13. Folding and escape of nascent proteins at ribosomal exit tunnel.

    PubMed

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein. PMID:26957181

  14. History of oxygen and carbon escape from the Martian atmosphere

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.; Zhang, M. H. G.; Johnson, R. E.; Bougher, S. W.; Nagy, A. F.

    1992-01-01

    A fraction of the oxygen in the Martian atmosphere continually escapes to space because dissociative recombination of the O2(+) ions in the ionosphere can impart sufficient energy to the product O atoms. In addition, ionization of the extended atomic oxygen corona resulting from the above process adds to escape since the solar wind can carry away O(+) ions born above a few hundred km altitude. A further by-product of this ion-pickup by the solar wind is an additional population of escaping oxygen atoms that are sputtered from the atmosphere near the exobase by pickup ions that are on reentry rather than escaping trajectories. This sputtering process can also remove carbon in the form of intact or dissociated CO2 since all atoms and molecules in the 'target' gas are subject to the collisional energy transfer that characterizes sputtering. We have estimated the present rates of escape of oxygen and carbon due to these mechanisms, as well as the rates at several epochs in the history of the solar system.

  15. Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics.

    PubMed

    Lönn, Peter; Kacsinta, Apollo D; Cui, Xian-Shu; Hamil, Alexander S; Kaulich, Manuel; Gogoi, Khirud; Dowdy, Steven F

    2016-01-01

    Bioactive macromolecular peptides and oligonucleotides have significant therapeutic potential. However, due to their size, they have no ability to enter the cytoplasm of cells. Peptide/Protein transduction domains (PTDs), also called cell-penetrating peptides (CPPs), can promote uptake of macromolecules via endocytosis. However, overcoming the rate-limiting step of endosomal escape into the cytoplasm remains a major challenge. Hydrophobic amino acid R groups are known to play a vital role in viral escape from endosomes. Here we utilize a real-time, quantitative live cell split-GFP fluorescence complementation phenotypic assay to systematically analyze and optimize a series of synthetic endosomal escape domains (EEDs). By conjugating EEDs to a TAT-PTD/CPP spilt-GFP peptide complementation assay, we were able to quantitatively measure endosomal escape into the cytoplasm of live cells via restoration of GFP fluorescence by intracellular molecular complementation. We found that EEDs containing two aromatic indole rings or one indole ring and two aromatic phenyl groups at a fixed distance of six polyethylene glycol (PEG) units from the TAT-PTD-cargo significantly enhanced cytoplasmic delivery in the absence of cytotoxicity. EEDs address the critical rate-limiting step of endosomal escape in delivery of macromolecular biologic peptide, protein and siRNA therapeutics into cells. PMID:27604151

  16. Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics

    PubMed Central

    Lönn, Peter; Kacsinta, Apollo D.; Cui, Xian-Shu; Hamil, Alexander S.; Kaulich, Manuel; Gogoi, Khirud; Dowdy, Steven F.

    2016-01-01

    Bioactive macromolecular peptides and oligonucleotides have significant therapeutic potential. However, due to their size, they have no ability to enter the cytoplasm of cells. Peptide/Protein transduction domains (PTDs), also called cell-penetrating peptides (CPPs), can promote uptake of macromolecules via endocytosis. However, overcoming the rate-limiting step of endosomal escape into the cytoplasm remains a major challenge. Hydrophobic amino acid R groups are known to play a vital role in viral escape from endosomes. Here we utilize a real-time, quantitative live cell split-GFP fluorescence complementation phenotypic assay to systematically analyze and optimize a series of synthetic endosomal escape domains (EEDs). By conjugating EEDs to a TAT-PTD/CPP spilt-GFP peptide complementation assay, we were able to quantitatively measure endosomal escape into the cytoplasm of live cells via restoration of GFP fluorescence by intracellular molecular complementation. We found that EEDs containing two aromatic indole rings or one indole ring and two aromatic phenyl groups at a fixed distance of six polyethylene glycol (PEG) units from the TAT-PTD-cargo significantly enhanced cytoplasmic delivery in the absence of cytotoxicity. EEDs address the critical rate-limiting step of endosomal escape in delivery of macromolecular biologic peptide, protein and siRNA therapeutics into cells. PMID:27604151

  17. Loss of water from Venus. I - Hydrodynamic escape of hydrogen

    NASA Technical Reports Server (NTRS)

    Kasting, J. F.; Pollack, J. B.

    1983-01-01

    A one-dimensional photochemical-dynamic model is used to study hydrodynamic loss of hydrogen from a primitive, water-rich atmosphere on Venus. The escape flux is calculated as a function of the H2O mixing ratio at the atmospheric cold trap. The cold trap mixing ratio is then related in an approximate fashion to the H2O concentration in the lower atmosphere. Hydrodynamic escape should have been the dominant loss process for hydroogen when the H2O mass mixing ratio in the lower atmosphere exceeded approximately 0.1. The escape rate would have depended upon the magnitude of the solar ultraviolet flux and the atmospheric EUV heating efficiency and, to a lesser extent, on the O2 content of the atmosphere. The time required for Venus to have lost the bulk of a terrestrial ocean of water is on the order of a billion years. Deuterium would have been swept away along with hydrogen if the escape rate was high enough, but some D/H enrichment should have occurred as the escape rate slowed down.

  18. Escape Rates in a Stochastic Environment with Multiple Scales

    NASA Astrophysics Data System (ADS)

    Forgoston, Eric; Schwartz, Ira B.

    2009-01-01

    We consider a stochastic environment with two time scales and outline a general theory that compares two methods to reduce the dimension of the original system. The first method involves the computation of the underlying deterministic center manifold followed by a naive replacement of the stochastic term. The second method allows one to more accurately describe the stochastic effects and involves the derivation of a normal form coordinate transform that is used to find the stochastic center manifold. The results of both methods are used along with the path integral formalism of large fluctuation theory to predict the escape rate from one basin of attraction to another. The general theory is applied to the example of a surface flow described by a generic, singularly perturbed, damped, nonlinear oscillator with additive, Gaussian noise. We show how both nonlinear reduction methods compare in escape rate scaling. Additionally, the center manifolds are shown to predict high prehistory probability regions of escape. The theoretical results are confirmed using numerical computation of the mean escape time and escape prehistory, and we briefly discuss the extension of the theory to stochastic control.

  19. Mars atmospheric escape constrained using MAVEN IUVS coronal observations

    NASA Astrophysics Data System (ADS)

    Chaffin, Michael S.; Deighan, Justin; Chaufray, Jean-Yves; Jain, Sonal; Stewart, Ian; McClintock, Bill; Crismani, Matteo; Stiepen, Arnaud; Holsclaw, Greg; Clarke, John; Montmessin, Franck; Eparvier, Frank; Thiemann, Ed; Chamberlain, Phil; Schneider, Nick; Jakosky, Bruce

    2015-11-01

    Every planetary atmosphere is capped by a corona: an extended, extremely tenuous region where collisions are negligible and particles follow ballistic trajectories. At Mars, the corona is especially extended due to the low gravity of the planet, and a large number of coronal particles are on escaping trajectories. Such escape has played a critical role in the history of the Mars system, likely removing a substantial fraction of the water initially present on the planet, but the mechanism and magnitude of this escape remains poorly constrained. Currently in orbit at Mars, MAVEN's Imaging Ultraviolet Spectrograph (IUVS) is mapping the distribution of oxygen and hydrogen above 200 km at a high spatial and temporal cadence, revealing a dynamic corona in unprecedented detail. Results will be presented demonstrating that the H in the corona is not spherically symmetric in its distribution, and can potentially be used as a tracer of thermospheric general circulation; and that non-thermal "hot" O (in contrast with more spatially confined "cold" thermal O) is ionospherically sourced with a characteristic energy of 1.1 eV and responds to solar EUV forcing. These results will be interpreted in terms of their impact on our current understanding of how atmospheric escape operates today. We will also discuss how these processes may have acted in the past to deplete Mars' initial water inventory, potentially altering the redox balance of the planet and atmosphere through differential escape of H and O.

  20. Immunosuppressive cells in tumor immune escape and metastasis.

    PubMed

    Liu, Yang; Cao, Xuetao

    2016-05-01

    Tumor immune escape and the initiation of metastasis are critical steps in malignant progression of tumors and have been implicated in the failure of some clinical cancer immunotherapy. Tumors develop numerous strategies to escape immune surveillance or metastasize: Tumors not only modulate the recruitment and expansion of immunosuppressive cell populations to develop the tumor microenvironment or pre-metastatic niche but also switch the phenotype and function of normal immune cells from a potentially tumor-reactive state to a tumor-promoting state. Immunosuppressive cells facilitate tumor immune escape by inhibiting antitumor immune responses and furthermore promote tumor metastasis by inducing immunosuppression, promoting tumor cell invasion and intravasation, establishing a pre-metastatic niche, facilitating epithelial-mesenchymal transition, and inducing angiogenesis at primary tumor or metastatic sites. Numerous translational studies indicate that it is possible to inhibit tumor immune escape and prevent tumor metastasis by blocking immunosuppressive cells and eliminating immunosuppressive mechanisms that are induced by either immunosuppressive cells or tumor cells. Furthermore, many clinical trials targeting immunosuppressive cells have also achieved good outcome. In this review, we focus on the underlying mechanisms of immunosuppressive cells in promoting tumor immune escape and metastasis, discuss our current understanding of the interactions between immunosuppressive cells and tumor cells in the tumor microenvironment, and suggest future research directions as well as potential clinical strategies in cancer immunotherapy. PMID:26689709

  1. Single-File Escape of Colloidal Particles from Microfluidic Channels

    NASA Astrophysics Data System (ADS)

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-01

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10-15 N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions.

  2. MAVEN measurements of photochemical escape of oxygen from the Martian atmosphere

    NASA Astrophysics Data System (ADS)

    Lillis, R. J.; Deighan, J.; Fox, J. L.; Bougher, S. W.; Cravens, T. E.; Lee, Y.; Mahaffy, P. R.; Benna, M.; Elrod, M. K.; Andersson, L.; McFadden, J.

    2015-10-01

    One of the primary goals of the Mars Atmosphere and Volatile Evolution Mission (MAVEN) mission is to characterize rates of atmospheric escape at the present epoch and relate those escape rates to solar drivers [1]. One of the major escape processes is known as photochemical escape, which is broadly defined as a process by which a) an exothermic reaction in the atmosphere/ionosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through any subsequent collisions[2].At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher[3]. Thus characterizing this escape process is central to understanding the role escape to space has played in Mars' climate evolution.

  3. Differential nitric oxide synthesis and host apoptotic events correlate with bleaching susceptibility in reef corals

    NASA Astrophysics Data System (ADS)

    Hawkins, T. D.; Krueger, T.; Becker, S.; Fisher, P. L.; Davy, S. K.

    2014-03-01

    Coral bleaching poses a threat to coral reefs worldwide. As a consequence of the temperature-induced breakdown in coral-dinoflagellate symbiosis, bleaching can have extensive effects on reef communities. However, our understanding of bleaching at a cellular level is limited, and this is particularly true regarding differential susceptibility among coral species. Recent work suggests that bleaching may represent a host innate immune-like response to symbiont dysfunction that involves synthesis of the signalling compound nitric oxide (NO) and the induction of host apoptotic-like cell death. In this study, we examined the activity of apoptosis-regulating enzymes alongside oxidised NO accumulation (a proxy for NO synthesis) in the reef corals Acropora millepora, Montipora digitata, and Pocillopora damicornis during experimental thermal stress. P. damicornis was the most sensitive species, suffering mortality (tissue sloughing) after 5 days at 33 °C but non-lethal bleaching after 9 days at 31.5 °C. A. millepora bleached at 33 °C but remained structurally intact, while M. digitata showed little evidence of bleaching. P. damicornis and A. millepora both exhibited evidence of temperature-induced NO synthesis and, after 5 days of heating, levels of oxidised NO in both species were fivefold higher than in controls maintained at 28.5 °C. These responses preceded bleaching by a number of days and may have occurred before symbiont dysfunction (measured as chlorophyll a degradation and oxidised NO accumulation). In A. millepora, apparent NO synthesis correlated with the induction of host apoptotic-like pathways, while in P. damicornis, the upregulation of apoptotic pathways occurred later. No evidence of elevated NO production or apoptosis was observed in M. digitata at 33 °C and baseline activity of apoptosis-regulating enzymes was negligible in this species. These findings provide important physiological data in the context of the responses of corals to global change and

  4. Emerging roles for lipids in non-apoptotic cell death.

    PubMed

    Magtanong, L; Ko, P J; Dixon, S J

    2016-07-01

    Non-apoptotic regulated cell death (RCD) is essential to maintain organismal homeostasis and may be aberrantly activated during certain pathological states. Lipids are emerging as key components of several non-apoptotic RCD pathways. For example, a direct interaction between membrane phospholipids and the pore-forming protein mixed lineage kinase domain-like (MLKL) is needed for the execution of necroptosis, while the oxidative destruction of membrane polyunsaturated fatty acids (PUFAs), following the inactivation of glutathione peroxidase 4 (GPX4), is a requisite gateway to ferroptosis. Here, we review the roles of lipids in the initiation and execution of these and other forms of non-apoptotic cell death. We also consider new technologies that are allowing for the roles of lipids and lipid metabolism in RCD to be probed in increasingly sophisticated ways. In certain cases, this new knowledge may enable the development of therapies that target lipids and lipid metabolic processes to enhance or suppress specific non-apoptotic RCD pathways. PMID:26967968

  5. A novel role for synaptic acetylcholinesterase as an apoptotic deoxyribonuclease

    PubMed Central

    Du, Aiying; Xie, Jing; Guo, Kaijie; Yang, Lei; Wan, Yihan; OuYang, Qi; Zhang, Xuejin; Niu, Xin; Lu, Lu; Wu, Jun; Zhang, Xuejun

    2015-01-01

    In addition to terminating neurotransmission by hydrolyzing acetylcholine, synaptic acetylcholinesterase (AChES) has been found to have a pro-apoptotic role. However, the underlying mechanism has rarely been investigated. Here, we report a nuclear translocation-dependent role for AChES as an apoptotic deoxyribonuclease (DNase). AChES polypeptide binds to and cleaves naked DNA at physiological pH in a Ca2+–Mg2+-dependent manner. It also cleaves chromosomal DNA both in pre-fixed and in apoptotic cells. In the presence of a pan-caspase inhibitor, the cleavage still occurred after nuclear translocation of AChES, implying that AChES-DNase acts in a CAD- and EndoG-independent manner. AChE gene knockout impairs apoptotic DNA cleavage; this impairment is rescued by overexpression of the wild-type but not (aa 32–138)-deleted AChES. Furthermore, in comparison with the nuclear-localized wild-type AChES, (aa 32–138)-deleted AChES loses the capacity to initiate apoptosis. These observations confirm that AChES mediates apoptosis via its DNase activity. PMID:27462404

  6. Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

    PubMed Central

    Dlamini, Zodwa; Tshidino, Shonisani C.; Hull, Rodney

    2015-01-01

    Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets. PMID:26580598

  7. Monitoring circulating apoptotic cells by in-vivo flow cytometry

    NASA Astrophysics Data System (ADS)

    Wei, Xunbin; Tan, Yuan; Chen, Yun; Zhang, Li; Li, Yan; Liu, Guangda; Wu, Bin; Wang, Chen

    2008-02-01

    Chemotherapies currently constitute one main venue of cancer treatment. For a large number of adult and elderly patients, however, treatment options are poor. These patients may suffer from disease that is resistant to conventional chemotherapy or may not be candidates for curative therapies because of advanced age or poor medical conditions. To control disease in these patients, new therapies must be developed that are selectively targeted to unique characteristics of tumor cell growth and metastasis. A reliable early evaluation and prediction of response to the chemotherapy is critical to its success. Chemotherapies induce apoptosis in tumor cells and a portion of such apoptotic cancer cells may be present in the circulation. However, the fate of circulating tumor cells is difficult to assess with conventional methods that require blood sampling. We report the in situ measurement of circulating apoptotic cells in live animals using in vivo flow cytometry, a novel method that enables real-time detection and quantification of circulating cells without blood extraction. Apoptotic cells are rapidly cleared from the circulation with a half-life of ~10 minutes. Real-time monitoring of circulating apoptotic cells can be useful for detecting early changes in disease processes, as well as for monitoring response to therapeutic intervention.

  8. The apoptotic thanatotranscriptome associated with the liver of cadavers.

    PubMed

    Javan, Gulnaz T; Can, Ismail; Finley, Sheree J; Soni, Shivani

    2015-12-01

    Gene expression investigations are well-established components of ante mortem studies with broad applications ranging from elucidating basic mechanisms responsible for normal physiological processes to discovering therapeutic targets in pathophysiological conditions. However, gene expression studies and their application in the medico-legal field are still in their infancy. Therefore, the present study focuses on RNA using PCR array in the analysis of gene expression associated with tissues taken from actual criminal cases. RNA was extracted from the liver tissues of bodies with PMIs between 6 and 48 h. The results demonstrated that mRNA was stable up to 48 h postmortem. Further, as cell death is an indispensable and necessary part of the biological life cycle, apoptotic gene expression profiles were investigated. The gene expression related to the programmed cell death found in body tissues after death is defined as the apoptotic thanatotranscriptome (thanatos-, Greek for death). On comparison of control and decaying tissues, the results show that with time, pro-apoptotic genes such as caspases are up-regulated and the expression of genes responsible for anti-apoptosis such as BCL2 and BAG3 were down-regulated. Thus, this current work gives a unique perspective of the apoptotic thanatotranscriptome that is affected after death. Up to the present time, gene expression in bodies from criminal cases has not been reported in literature using PCR array techniques. Thus, this thanatotranscriptome study provides insight into postmortem gene activity with potential applications in medico-legal investigations. PMID:26318598

  9. Regulation of Apoptotic Endonucleases by EndoG

    PubMed Central

    Zhdanov, Dmitry D.; Fahmi, Tariq; Wang, Xiaoying; Apostolov, Eugene O.; Sokolov, Nikolai N.; Javadov, Sabzali

    2015-01-01

    Cells contain several apoptotic endonucleases, which appear to act simultaneously before and after cell death by destroying the host cell DNA. It is largely unknown how the endonucleases are being induced and whether they can regulate each other. This study was performed to determine whether apoptotic mitochondrial endonuclease G (EndoG) can regulate expression of other apoptotic endonucleases. The study showed that overexpression of mature EndoG in kidney tubular epithelial NRK-52E cells can increase expression of caspase-activated DNase (CAD) and four endonucleases that belong to DNase I group including DNase I, DNase X, DNase IL2, and DNase γ, but not endonucleases of the DNase 2 group. The induction of DNase I-type endonucleases was associated with DNA degradation in promoter/exon 1 regions of the endonuclease genes. These results together with findings on colocalization of immunostained endonucleases and TUNEL suggest that DNA fragmentation after EndoG overexpression was caused by DNase I endonucleases and CAD in addition to EndoG itself. Overall, these data provide first evidence for the existence of the integral network of apoptotic endonucleases regulated by EndoG. PMID:25849439

  10. Coexisting chaotic and periodic dynamics in clock escapements.

    PubMed

    Moon, Francis C; Stiefel, Preston D

    2006-09-15

    This paper addresses the nature of noise in machines. As a concrete example, we examine the dynamics of clock escapements from experimental, historical and analytical points of view. Experiments on two escapement mechanisms from the Reuleaux kinematic collection at Cornell University are used to illustrate chaotic-like noise in clocks. These vibrations coexist with the periodic dynamics of the balance wheel or pendulum. A mathematical model is presented that shows how self-generated chaos in clocks can break the dry friction in the gear train. This model is shown to exhibit a strange attractor in the structural vibration of the clock. The internal feedback between the oscillator and the escapement structure is similar to anti-control of chaos models. PMID:16893802

  11. Neural Circuits Underlying Visually Evoked Escapes in Larval Zebrafish.

    PubMed

    Dunn, Timothy W; Gebhardt, Christoph; Naumann, Eva A; Riegler, Clemens; Ahrens, Misha B; Engert, Florian; Del Bene, Filippo

    2016-02-01

    Escape behaviors deliver organisms away from imminent catastrophe. Here, we characterize behavioral responses of freely swimming larval zebrafish to looming visual stimuli simulating predators. We report that the visual system alone can recruit lateralized, rapid escape motor programs, similar to those elicited by mechanosensory modalities. Two-photon calcium imaging of retino-recipient midbrain regions isolated the optic tectum as an important center processing looming stimuli, with ensemble activity encoding the critical image size determining escape latency. Furthermore, we describe activity in retinal ganglion cell terminals and superficial inhibitory interneurons in the tectum during looming and propose a model for how temporal dynamics in tectal periventricular neurons might arise from computations between these two fundamental constituents. Finally, laser ablations of hindbrain circuitry confirmed that visual and mechanosensory modalities share the same premotor output network. We establish a circuit for the processing of aversive stimuli in the context of an innate visual behavior. PMID:26804997

  12. Fractal templates in the escape dynamics of trapped ultracold atoms

    SciTech Connect

    Mitchell, Kevin A.; Steck, Daniel A.

    2007-09-15

    We consider the dynamic escape of a small packet of ultracold atoms launched from within an optical dipole trap. Based on a theoretical analysis of the underlying nonlinear dynamics, we predict that fractal behavior can be seen in experimental escape data. These data can be collected by measuring the time-dependent escape rate for packets launched over a range of angles. This fractal pattern is particularly well resolved below the Bose-Einstein transition temperature - a direct result of the extreme phase-space localization of the condensate. We predict that several self-similar layers of this novel fractal should be measurable, and we explain how this fractal pattern can be predicted and analyzed with recently developed techniques in symbolic dynamics.

  13. Leaflet escape in a revised Edwards-Duromedics mitral prosthesis.

    PubMed

    Mert, Murat; Ozkara, Ahmet; Hatemi, AliCan

    2003-07-01

    The original Duromedics-Edwards bileaflet valve was withdrawn from the market in 1988 after 12 reports of leaflet escape. The leaflet was modified by the manufacturer, and the revised Edwards-Duromedics and Edwards TEKNA valves were introduced in 1990 and 1993, respectively. However, problems of leaflet escape have now been reported with the new models. A case is reported of sudden leaflet fracture of a revised Duromedics mitral valve 86 months after implantation; this was managed successfully by emergency replacement with a St. Jude Medical mechanical prosthesis. The fracture had occurred transversely, with the two fragments embolizing bilaterally to the right common iliac and left external iliac arteries. In the absence of an exact diagnosis, but with a high index of suspicion, the key to survival of patients with leaflet escape is immediate reoperation. PMID:12918855

  14. Group nightmares about escape from ex-homeland.

    PubMed

    Cernovsky, Z

    1990-09-01

    Escape nightmares (recurrent nightmares about re-escaping ex-homeland) were studied via a 79-item questionnaire administered to 83 Czechoslovak refugees who were living in Switzerland. The key features of the nightmare were not related significantly to the refugees' age, gender, occupation, or educational level. Further analyses dealt with mutual relationships of the various reported aspects of the escape nightmares. The reports of dreaming about arrival in the ex-homeland by a "mistake," such as boarding a wrong airplane (i.e., a Freudian parapraxis), were associated with higher levels of (subsequent) dream anxiety, with waking up due to mounting dream tension, and with the dreamer not knowing at first upon awakening whether he was now in the free world or elsewhere. PMID:2246363

  15. Behavior of Ants Escaping from a Single-Exit Room

    PubMed Central

    Wang, Shujie; Lv, Wei; Song, Weiguo

    2015-01-01

    To study the rules of ant behavior and group-formation phenomena, we examined the behaviors of Camponotus japonicus, a species of large ant, in a range of situations. For these experiments, ants were placed inside a rectangular chamber with a single exit that also contained a filter paper soaked in citronella oil, a powerful repellent. The ants formed several groups as they moved toward the exit to escape. We measured the time intervals between individual escapes in six versions of the experiment, each containing an exit of a different width, to quantify the movement of the groups. As the ants exited the chamber, the time intervals between individual escapes changed and the frequency distribution of the time intervals exhibited exponential decay. We also investigated the relationship between the number of ants in a group and the group flow rate. PMID:26125191

  16. Kramers escape of a self-propelled particle

    NASA Astrophysics Data System (ADS)

    Geiseler, Alexander; Hänggi, Peter; Schmid, Gerhard

    2016-08-01

    We investigate the escape rate of an overdamped, self-propelled spherical Brownian particle on a surface from a metastable potential well. Within a modeling in terms of a 1D constant speed of the particle's active dynamics we consider the associated rate using both numerical and analytical approaches. Regarding the properties of the stationary state in the potential well, two major timescales exist, each governing the translational and the rotational dynamics of the particle, respectively. The particle radius is identified to present the essential quantity in charge of regulating the ratio between those timescales. For very small and very large particle radii, approximate analytic expressions for the particle's escape rate can be derived, which, within their respective range of validity, compare favorably with the precise escape numerics of the underlying full two-dimensional Fokker-Planck description.

  17. Fractionation of the Early Terrestrial Atmospheres: Dynamical Escape

    NASA Technical Reports Server (NTRS)

    Hartle, Richard E.

    2002-01-01

    Hydrodynamic escape may have played a significant role in the early fractionation of the atmospheres of the terrestrial planets. This possibility has been demonstrated in the last two decades by numerous models that show radial, transonic flow of hydrogen can occur in the presence of sufficient solar EUV Hydrodynamic escape may have played a significant role in the early fractionation of the atmospheres of the terrestrial planets. This possibility has been demonstrated in the last two decades by numerous models that show radial, transonic flow of hydrogen can occur in the presence of sufficient solar EUV flux, thought to exist in the first 500 My. The models show that the larger the solar flux the greater the mass of the fractionating species, which are accelerated to escape speeds by the hydrogen wind through drag processes. As the atmospheres evolve and the solar EUV flux wanes, the maximum mass of flowing gas constituents decreases until all gases become static. We show that fractionation can continue beyond this point when non-radial flow and dynamically enhanced Jeans escape are considered. For example, the early terrestrial atmospheres are thought to have had large hydrogen contents, resulting in exobase altitudes of a planetary radius or more. In this case, rotational speeds at the exobases of Earth and Mars would be large enough so that light constituents would "spin" off and fractionate, especially at equatorial latitudes. Also, in the presence of transonic flow of hydrogen only, non-radial expansion throws heavier gases to high altitudes in the exosphere, accompanied by strong bulk speeds at the exobase, which results in enhanced thermal escape fluxes and fractionation. flux, thought to exist in the first 500 My. The models show that the larger the solar flux the greater the mass of the fractionating species, which are accelerated to escape speeds by the hydrogen wind through drag processes. As the atmospheres evolve and the solar EUV flux wanes, the

  18. SOYUZ escape trajectory analysis from Space Station Freedom

    NASA Technical Reports Server (NTRS)

    Heck, Michael L.

    1993-01-01

    It has been proposed to utilize the Russian built SOYUZ as an assured crew return vehicle (ACRV) for Space Station Freedom. Three departure directions (nadir, zenith, minus velocity) are evaluated to determine escape path clearances. In addition, the effects of the following parameters were also evaluated: delta-V magnitude, configuration dependent ballistic coefficients, atmospheric density, Freedom attitude control, and canted docking adaptors. The primary factor influencing the escape trajectory was station contingency attitude rate. The nadir and zenith departures were preferable to minus velocity. The impact of atmospheric density and relative ballistic coefficients was minimal.

  19. Exploring the Escape of Hydrogen Ionizing Photons from Local Galaxies

    NASA Astrophysics Data System (ADS)

    Davis, Jesse A.; Rosenberg, Jessica L.; Venkatesan, Aparna; Cannon, John M.; Salzer, John Joseph

    2016-01-01

    Low-mass galaxies dominate the universe by number and many of these systems have large star formation rates per unit mass. Measurements of the escape fraction of ionizing radiation from dwarf galaxies are an important input to cosmological simulations and theoretical studies but are largely unconstrained by observations. As a result, the role of low-mass galaxies in cosmological reionization and the ionization state of the intergalactic medium (IGM) at high and low redshifts remains poorly understood. Here we study a sample of 18 star-forming galaxies (12 from the Lyman-Alpha Reference Sample, Rivera-Thorsen et al. 2015; 6 from the KISS sample, Salzer et al. 2001), some of which are low-mass systems (10 with M_star < 5 x 10^9 M_sun). All of the sample galaxies were observed in the FUV with the HST/COS spectrograph and these measurements were used to derive limits on their escaping Lyman-alpha radiation (Rivera-Thorsen et al. 2015, Wofford et al. 2013). Using the numerical radiative transfer simulations of Yajima et al. 2014, we relate the escape of Lyman-alpha radiation to limits on the fraction of escaping H-ionizing radiation from these galaxies. This correlation is stronger for low-redshift galaxies (Yajima et al. 2014) and these galaxies are more accessible observationally for these studies. Although the Yajima et al. (2014) study focuses on high-mass galaxies, we derive tentative limits on the escape fraction for H-ionizing radiation for all of the galaxies in this sample. From our analysis, we find escape fractions of less than 5% in all but two extreme cases where the escape fractions are greater than 14%. Our sample averaged escape fraction is insufficient for what reionization requires, although our values are likely to be lower limits and the two outliers are two of the lowest mass systems from the LARS sample. We discuss future directions, including further modeling of the radiative transfer and the galaxy's physical conditions, to better understand the

  20. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery

    NASA Astrophysics Data System (ADS)

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-06-01

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds’ escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds’ cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier.

  1. Conditional Immune Escape during Chronic Simian Immunodeficiency Virus Infection

    PubMed Central

    Gellerup, Dane D.; Balgeman, Alexis J.; Nelson, Chase W.; Ericsen, Adam J.; Scarlotta, Matthew; Hughes, Austin L.

    2015-01-01

    ABSTRACT Anti-HIV CD8 T cells included in therapeutic treatments will need to target epitopes that do not accumulate escape mutations. Identifying the epitopes that do not accumulate variants but retain immunogenicity depends on both host major histocompatibility complex (MHC) genetics and the likelihood for an epitope to tolerate variation. We previously found that immune escape during acute SIV infection is conditional; the accumulation of mutations in T cell epitopes is limited, and the rate of accumulation depends on the number of epitopes being targeted. We have now tested the hypothesis that conditional immune escape extends into chronic SIV infection and that epitopes with a preserved wild-type sequence have the potential to elicit epitope-specific CD8 T cells. We deep sequenced simian immunodeficiency virus (SIV) from Mauritian cynomolgus macaques (MCMs) that were homozygous and heterozygous for the M3 MHC haplotype and had been infected with SIV for about 1 year. When interrogating variation within individual epitopes restricted by M3 MHC alleles, we found three categories of epitopes, which we called categories A, B, and C. Category B epitopes readily accumulated variants in M3-homozygous MCMs, but this was less common in M3-heterozygous MCMs. We then determined that chronic CD8 T cells specific for these epitopes were more likely preserved in the M3-heterozygous MCMs than M3-homozygous MCMs. We provide evidence that epitopes known to escape from chronic CD8 T cell responses in animals that are homozygous for a set of MHC alleles are preserved and retain immunogenicity in a host that is heterozygous for the same MHC alleles. IMPORTANCE Anti-HIV CD8 T cells that are part of therapeutic treatments will need to target epitopes that do not accumulate escape mutations. Defining these epitope sequences is a necessary precursor to designing approaches that enhance the functionality of CD8 T cells with the potential to control virus replication during chronic

  2. Water-escape velocities in jumping blacktip sharks.

    PubMed

    Brunnschweiler, Juerg M

    2005-09-22

    This paper describes the first determination of water-escape velocities in free-ranging sharks. Two approximations are used to estimate the final swimming speed at the moment of penetrating the water surface. Blacktip sharks were videotaped from below the surface and parameters were estimated by analysing the sequences frame by frame. Water-escape velocities averaged 6.3 ms(-1). These velocities for blacktip sharks seem accurate and are similar to estimates obtained for other shark species of similar size. PMID:16849197

  3. Blockade of the granzyme B/perforin pathway through overexpression of the serine protease inhibitor PI-9/SPI-6 constitutes a mechanism for immune escape by tumors

    PubMed Central

    Medema, J. P.; de Jong, J.; Peltenburg, L. T. C.; Verdegaal, E. M. E.; Gorter, A.; Bres, S. A.; Franken, K. L. M. C.; Hahne, M.; Albar, J. P.; Melief, C. J. M.; Offringa, R.

    2001-01-01

    The concept for cellular immunotherapy of solid tumors relies heavily on the capacity of class I MHC-restricted cytotoxic T lymphocytes (CTLs) to eliminate tumor cells. However, tumors often have managed to escape from the cytolytic machinery of these effector cells. Therefore, it is very important to chart the mechanisms through which this escape can occur. Target-cell killing by CTLs involves the induction of apoptosis by two major mechanisms: through death receptors and the perforin/granzyme B (GrB) pathway. Whereas tumors previously were shown to exhibit mechanisms for blocking the death receptor pathway, we now demonstrate that they also can resist CTL-mediated killing through interference with the perforin/GrB pathway. This escape mechanism involves expression of the serine protease inhibitor PI-9/SPI-6, which inactivates the apoptotic effector molecule GrB. Expression of PI-9 was observed in a variety of human and murine tumors. Moreover, we show that, indeed, expression results in the resistance of tumor cells to CTL-mediated killing both in vitro and in vivo. Our data reveal that PI-9/SPI-6 is an important parameter determining the success of T cell-based immunotherapeutic modalities against cancer. PMID:11562487

  4. HIV-1 RT-dependent DNAzyme expression inhibits HIV-1 replication without the emergence of escape viruses

    PubMed Central

    Sugiyama, Ryuichi; Hayafune, Masaaki; Habu, Yuichiro; Yamamoto, Norio; Takaku, Hiroshi

    2011-01-01

    DNAzymes are easier to prepare and less sensitive to chemical and enzymatic degradation than ribozymes; however, a DNA enzyme expression system has not yet been developed. In this study, we exploited the mechanism of HIV-1 reverse transcription (RT) in a DNA enzyme expression system. We constructed HIV-1 RT-dependent lentiviral DNAzyme expression vectors including the HIV-1 primer binding site, the DNA enzyme, and either a native tRNA (Lys-3), tRMDtRL, or one of two truncated tRNAs (Lys-3), tRMDΔARMtRL or tRMD3′-endtRL. Lentiviral vector-mediated DNAzyme expression showed high levels of inhibition of HIV-1 replication in SupT1 cells. We also demonstrated the usefulness of this approach in a long-term assay, in which we found that the DNAzymes prevented escape from inhibition of HIV. These results suggest that HIV-1 RT-dependent lentiviral vector-derived DNAzymes prevent the emergence of escape mutations. PMID:20833635

  5. Functional antagonism between pro-apoptotic BIM and anti-apoptotic BCL-XL in MYC-induced lymphomagenesis.

    PubMed

    Delbridge, A R D; Grabow, S; Bouillet, P; Adams, J M; Strasser, A

    2015-04-01

    Genomic analyses revealed that many cancers have acquired abnormalities in their expression of pro- or anti-apoptotic members of the BCL-2 protein family. It is, however, unknown whether changes in pro- or anti-apoptotic BCL-2 family members have similar impact on tumorigenesis or whether changes in one subgroup have disproportionate impact. We compared the consequences of concomitant loss of anti-apoptotic Bclx and pro-apoptotic Bim on MYC-induced lymphomagenesis. Whereas only loss of both Bclx alleles markedly forestalled tumorigenesis, loss of a single Bim allele overcame this blockade. Conversely, loss of even a single Bim allele sufficed to substantially accelerate lymphomagenesis, and only loss of both but not loss of a single allele of Bclx could attenuate this acceleration. The evidence that modest (two-fold) monoallelic changes in the expression of at least some BH3-only proteins can profoundly impact tumorigenesis suggests that such aberrations, imposed by epigenetic or genetic changes, may expedite tumorigenesis more effectively than elevated expression of pro-survival BCL-2 family members. These findings further our understanding of the mechanisms of lymphomagenesis and possibly also cancer therapy. PMID:24858047

  6. Chronic MDMA induces neurochemical changes in the hippocampus of adolescent and young adult rats: Down-regulation of apoptotic markers.

    PubMed

    García-Cabrerizo, Rubén; García-Fuster, M Julia

    2015-07-01

    While hippocampus is a brain region particularly susceptible to the effects of MDMA, the cellular and molecular changes induced by MDMA are still to be fully elucidated, being the dosage regimen, the species and the developmental stage under study great variables. This study compared the effects of one and four days of MDMA administration following a binge paradigm (3×5 mg/kg, i.p., every 2 h) on inducing hippocampal neurochemical changes in adolescent (PND 37) and young adult (PND 58) rats. The results showed that chronic MDMA caused hippocampal protein deficits in adolescent and young adult rats at different levels: (1) impaired serotonergic (5-HT2A and 5-HT2C post-synaptic receptors) and GABAergic (GAD2 enzyme) signaling, and (2) decreased structural cytoskeletal neurofilament proteins (NF-H, NF-M and NF-L). Interestingly, these effects were not accompanied by an increase in apoptotic markers. In fact, chronic MDMA inhibited proteins of the apoptotic pathway (i.e., pro-apoptotic FADD, Bax and cytochrome c) leading to an inhibition of cell death markers (i.e., p-JNK1/2, cleavage of PARP-1) and suggesting regulatory mechanisms in response to the neurochemical changes caused by the drug. The data, together with the observed lack of GFAP activation, support the view that chronic MDMA effects, regardless of the rat developmental age, extends beyond neurotransmitter systems to impair other hippocampal structural cell markers. Interestingly, inhibitory changes in proteins from the apoptotic pathway might be taking place to overcome the protein deficits caused by MDMA. PMID:26068050

  7. Autocrine secretion of 15d-PGJ2 mediates simvastatin-induced apoptotic burst in human metastatic melanoma cells

    PubMed Central

    Wasinger, Christine; Künzl, Martin; Minichsdorfer, Christoph; Höller, Christoph; Zellner, Maria; Hohenegger, Martin

    2014-01-01

    Background and Purpose Despite new therapeutic approaches, metastatic melanomas still have a poor prognosis. Statins reduce low-density lipoprotein cholesterol and exert anti-inflammatory and anti-proliferative actions. We have recently shown that simvastatin triggers an apoptotic burst in human metastatic melanoma cells by the synthesis of an autocrine factor. Experimental Approach The current in vitro study was performed in human metastatic melanoma cell lines (A375, 518a2) and primary human melanocytes and melanoma cells. The secretome of simvastatin-stressed cells was analysed with two-dimensional difference gel electrophoresis and MS. The signalling pathways involved were analysed at the protein and mRNA level using pharmacological approaches and siRNA technology. Key Results Simvastatin was shown to activate a stress cascade, leading to the synthesis of 15-deoxy-12,14-PGJ2 (15d-PGJ2), in a p38- and COX-2-dependent manner. Significant concentrations of 15d-PGJ2 were reached in the medium of melanoma cells, which were sufficient to activate caspase 8 and the mitochondrial pathway of apoptosis. Inhibition of lipocalin-type PGD synthase, a key enzyme for 15d-PGJ2 synthesis, abolished the apoptotic effect of simvastatin. Moreover, 15d-PGJ2 was shown to bind to the fatty acid-binding protein 5 (FABP5), which was up-regulated and predominantly detected in the secretome of simvastatin-stressed cells. Knockdown of FABP5 abolished simvastatin-induced activation of PPAR-γ and amplified the apoptotic response. Conclusions and Implications We characterized simvastatin-induced activation of the 15d-PGJ2/FABP5 signalling cascades, which triggered an apoptotic burst in melanoma cells but did not affect primary human melanocytes. These data support the rationale for the pharmacological targeting of 15d-PGJ2 in metastatic melanoma. PMID:25091578

  8. A Functional Yeast Survival Screen of Tumor-Derived cDNA Libraries Designed to Identify Anti-Apoptotic Mammalian Oncogenes

    PubMed Central

    Melzer, Inga Maria; Moser, Julia; Siele, Dagmar; Köhl, Ulrike; Rieker, Ralf Joachim; Wachter, David Lukas; Agaimy, Abbas; Herpel, Esther; Baumgarten, Peter; Mittelbronn, Michel; Rakel, Stefanie; Kögel, Donat; Böhm, Stefanie; Gutschner, Tony; Diederichs, Sven; Zörnig, Martin

    2013-01-01

    Yeast cells can be killed upon expression of pro-apoptotic mammalian proteins. We have established a functional yeast survival screen that was used to isolate novel human anti-apoptotic genes overexpressed in treatment-resistant tumors. The screening of three different cDNA libraries prepared from metastatic melanoma, glioblastomas and leukemic blasts allowed for the identification of many yeast cell death-repressing cDNAs, including 28% of genes that are already known to inhibit apoptosis, 35% of genes upregulated in at least one tumor entity and 16% of genes described as both anti-apoptotic in function and upregulated in tumors. These results confirm the great potential of this screening tool to identify novel anti-apoptotic and tumor-relevant molecules. Three of the isolated candidate genes were further analyzed regarding their anti-apoptotic function in cell culture and their potential as a therapeutic target for molecular therapy. PAICS, an enzyme required for de novo purine biosynthesis, the long non-coding RNA MALAT1 and the MAST2 kinase are overexpressed in certain tumor entities and capable of suppressing apoptosis in human cells. Using a subcutaneous xenograft mouse model, we also demonstrated that glioblastoma tumor growth requires MAST2 expression. An additional advantage of the yeast survival screen is its universal applicability. By using various inducible pro-apoptotic killer proteins and screening the appropriate cDNA library prepared from normal or pathologic tissue of interest, the survival screen can be used to identify apoptosis inhibitors in many different systems. PMID:23717670

  9. Brain size as a driver of avian escape strategy

    PubMed Central

    Samia, Diogo S. M.; Pape Møller, Anders; Blumstein, Daniel T.

    2015-01-01

    After detecting an approaching predator, animals make a decision when to flee. Prey will initiate flight soon after detecting a predator so as to minimize attentional costs related to on-going monitoring of the whereabouts of the predator. Such costs may compete with foraging and other maintenance activities and hence be larger than the costs of immediate flight. The drivers of interspecific variation in escape strategy are poorly known. Here we investigated the morphological, life history and natural history traits that correlate with variation in avian escape strategy across a sample of 96 species of birds. Brain mass, body size, habitat structure and group size were the main predictors of escape strategy. The direction of the effect of these traits was consistent with selection for a reduction of monitoring costs. Therefore, attentional costs depend on relative brain size, which determines the ability to monitor the whereabouts of potential predators and the difficulty of this task as reflected by habitat and social complexity. Thus brain size, and the cognitive functions associated with it, constitute a general framework for explaining the effects of body size, habitat structure and sociality identified as determinants of avian escape strategy. PMID:26139474

  10. Speed kills: ineffective avian escape responses to oncoming vehicles

    PubMed Central

    DeVault, Travis L.; Blackwell, Bradley F.; Seamans, Thomas W.; Lima, Steven L.; Fernández-Juricic, Esteban

    2015-01-01

    Animal–vehicle collisions cause high levels of vertebrate mortality worldwide, and what goes wrong when animals fail to escape and ultimately collide with vehicles is not well understood. We investigated alert and escape behaviours of captive brown-headed cowbirds (Molothrus ater) in response to virtual vehicle approaches of different sizes and at speeds ranging from 60 to 360 km h−1. Alert and flight initiation distances remained similar across vehicle speeds, and accordingly, alert and flight initiation times decreased at higher vehicle speeds. Thus, avoidance behaviours in cowbirds appeared to be based on distance rather than time available for escape, particularly at 60–150 km h−1; however, at higher speeds (more than or equal to 180 km h−1) no trend in response behaviour was discernible. As vehicle speed increased, cowbirds did not have enough time to assess the approaching vehicle, and cowbirds generally did not initiate flight with enough time to avoid collision when vehicle speed exceeded 120 km h−1. Although potentially effective for evading predators, the decision-making process used by cowbirds in our study appears maladaptive in the context of avoiding fast-moving vehicles. Our methodological approach and findings provide a framework to assess how novel management strategies could affect escape rules, and the sensory and cognitive abilities animals use to avoid vehicle collisions. PMID:25567648

  11. 6. UNDERGROUND FIRING CONTROL ROOM, INTERIOR. Looking southeast to escape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. UNDERGROUND FIRING CONTROL ROOM, INTERIOR. Looking southeast to escape tunnel. - Edwards Air Force Base, Air Force Rocket Propulsion Laboratory, Firing Control Building, Test Area 1-100, northeast end of Test Area 1-100 Road, Boron, Kern County, CA

  12. 12. CLOSEUP VIEW FROM NORTHWEST, SHOWING DETAILS OF FIRE ESCAPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. CLOSE-UP VIEW FROM NORTHWEST, SHOWING DETAILS OF FIRE ESCAPE NEAR CORNER OF MILLS HALL MAIN WING NORTH WALL, AND MILLS HALL NORTH WING WEST WALL. - Mills Hall, Mills College, 5000 MacArthur Boulevard, Oakland, Alameda County, CA

  13. Entrapment and Escape: Inventional Metaphors in Ronald Reagan's Economic Rhetoric.

    ERIC Educational Resources Information Center

    Aden, Roger C.

    1989-01-01

    Examines Ronald Reagan's use of inventional metaphors of entrapment and escape, language meshing with the American public's perception of the economy in the early 1980s. Notes that Reagan's reliance on inventional metaphors produced a rigidity in his approach to new situations, ultimately damaging his ability to lead the nation. (MM)

  14. Enuresis Control through Fading, Escape, and Avoidance Training.

    ERIC Educational Resources Information Center

    Hansen, Gordon D.

    1979-01-01

    A twin signal device that provides both escape and avoidance conditioning in enuresis control was documented with case studies of two enuretic children (eight and nine years old). In addition, a technique of fading as an adjunct to the process was utilized with one subject. (Author/SBH)

  15. Action of cocaine and chronic sympathetic denervation on vagal escape

    PubMed Central

    Campos, H. A.; Urquilla, P. R.

    1969-01-01

    1. The effect of cocaine has been studied on vagal escape and on the tachycardia due to vagal stimulation in the atropinized dog. All the dogs were submitted to acute cervical section of the spinal cord and acute or chronic sympathetic denervation. 2. Cocaine, 5 mg/kg or 40 μg/kg/min, I.V., induces a significant enhancement of the ventricular escape. The effects of a continuous infusion of cocaine are more reproducible than those of a single injection of the drug. 3. Cocaine, 40 μg/kg/min, I.V., potentiates the tachycardia due to vagal stimulation in the atropinized dog. 4. Chronic thoracic sympathectomy markedly retards the recovery of the ventricular rate from the inhibitory action of the vagus. Under this condition, the infusion of cocaine does not significantly enhance the ventricular escape. 5. These findings suggest that an adrenergic mechanism located at the sympathetic nerves supplying the heart is substantially involved in the phenomenon of vagal escape. PMID:5249864

  16. Speed kills: ineffective avian escape responses to oncoming vehicles.

    PubMed

    DeVault, Travis L; Blackwell, Bradley F; Seamans, Thomas W; Lima, Steven L; Fernández-Juricic, Esteban

    2015-02-22

    Animal-vehicle collisions cause high levels of vertebrate mortality worldwide, and what goes wrong when animals fail to escape and ultimately collide with vehicles is not well understood. We investigated alert and escape behaviours of captive brown-headed cowbirds (Molothrus ater) in response to virtual vehicle approaches of different sizes and at speeds ranging from 60 to 360 km h(-1). Alert and flight initiation distances remained similar across vehicle speeds, and accordingly, alert and flight initiation times decreased at higher vehicle speeds. Thus, avoidance behaviours in cowbirds appeared to be based on distance rather than time available for escape, particularly at 60-150 km h(-1); however, at higher speeds (more than or equal to 180 km h(-1)) no trend in response behaviour was discernible. As vehicle speed increased, cowbirds did not have enough time to assess the approaching vehicle, and cowbirds generally did not initiate flight with enough time to avoid collision when vehicle speed exceeded 120 km h(-1). Although potentially effective for evading predators, the decision-making process used by cowbirds in our study appears maladaptive in the context of avoiding fast-moving vehicles. Our methodological approach and findings provide a framework to assess how novel management strategies could affect escape rules, and the sensory and cognitive abilities animals use to avoid vehicle collisions. PMID:25567648

  17. Hepatitis B escape mutants in Scottish blood donors.

    PubMed

    Larralde, Osmany; Dow, Brian; Jarvis, Lisa; Davidson, Fiona; Petrik, Juraj

    2013-06-01

    Hepatitis B virus (HBV) remains as the viral infection with the highest risk of transmission by transfusion. This risk is associated with window period donations, occult HBV infection (OBI) and the emergence of escape mutants, which render blood donations false negative for hepatitis B surface antigen (HBsAg) serological testing. A retrospective study was conducted to gain insights into the molecular epidemiology of HBV escape mutants in Scottish blood donors. The criterion for selection was HBV positivity either by serology or nucleic acid testing (NAT). HBsAg detection was compared across several commercial immunoassays. The full length S gene from plasma samples was PCR amplified, cloned and expressed in HepG2 cells. Eight samples showed HBsAg discordant results, while 5 OBI samples were found. Four escape mutants, containing missense mutations in the S gene, are described here. These mutations impaired HBsAg detection both from HBV infected plasma samples and from recombinant proteins derived from its infected donors. Phylogenetic analysis showed that most of the mutants were clustered in the genotype D and were closely related to strains from Asia and the Middle East. We report here a proline substitution, outside the major hydrophilic region, that impaired HBsAg detection in vivo and in vitro, warning about the risk for the emergence of vaccine escape mutants with mutations outside the major neutralisation site. PMID:23274404

  18. The magnetic anomalies significantrly reduce the Martian ionospheric escape rate

    NASA Astrophysics Data System (ADS)

    Fedorov, A.; Barabash, S.; Sauvaud, J.-A.

    2012-09-01

    Looking forward to the MAVEN mission, it seems very useful to return to Mars Express data to refresh an important problem of Martian atmosphere escape: what role the crustal magnetic field may play in this process? There are several publications on this topic with completely opposite conclusions. The last hybrid simulations show that the magnetic anomalies significantly reduce the ion loss rate during solar minimum. We are trying to use a new approach to Mars Express IMA data analysis to check how it is possible. On the base of a statistical study of the ion distributions in the Martian magnetotail we show that the characteristic accelerated ions are not associated with the magnetic anomalies but only with interplanetary magnetic field clock angle. Moreover the magnetic anomalies screen and deviate the escaping flow leading to reducing of the total loss rate. We have calculated a "quasiexperimental" escaping rate in an assumption of the total absence of the magnetic anomalies. We are comparing this value with a real measured escape rate.

  19. Overcoming Antigen Escape with CAR T-cell Therapy.

    PubMed

    Jackson, Hollie J; Brentjens, Renier J

    2015-12-01

    Sotillo and colleagues describe the molecular events associated with apparent loss of target antigen expression following CAR T-cell therapy. We propose that broader immune activation is required to prevent outgrowth of tumor antigen escape variants following targeted therapies. PMID:26637657

  20. Escaping Embarrassment: Face-Work in the Rap Cipher

    ERIC Educational Resources Information Center

    Lee, Jooyoung

    2009-01-01

    How do individuals escape embarrassing moments in interaction? Drawing from ethnographic fieldwork, in-depth interviews, and video recordings of weekly street corner ciphers (impromptu rap sessions), this paper expands Goffman's theory of defensive and protective face-work. The findings reveal formulaic and indirect dimensions of face-work. First,…

  1. Spatial and Nonspatial Escape Strategies in the Barnes Maze

    ERIC Educational Resources Information Center

    Harrison, Fiona E.; Reiserer, Randall S.; Tomarken, Andrew J.; McDonald, Michael P.

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either…

  2. Magnetic buoyancy and the escape of magnetic fields from stars

    NASA Astrophysics Data System (ADS)

    Parker, E. N.

    1984-06-01

    Magnetic buoyancy causes the azimuthal magnetic fields of stars to rise rapidly to the surface, from where they are generally assumed to escape freely into space. However, a closer look at the problem reveals the simple fact that disengagement of the field from the gas, and escape into space, require a convoluted field configuration, producing neutral point reconnection of the flux in the tenuous gas above the surface of the star. Only that flux which reconnects can escape. Recent observations of the magnetic fields emerging through the surface of the Sun show that even at sunspot maximum the gaps in longitude between bipolar magnetic regions are so wide as to limit severely the reconnection between regions. We suggest from the observations that no more than perhaps 3% of the flux that is observed to emerge through the surface is able to reconnect and escape. Hence the surface of the Sun approximates to an impenetrable barrier rather than an open surface, with quantitative consequences for theoretical dynamo models. Recent observations of the retraction of bipolar fields at the end of their appearance at the surface suggest active dynamical control by the convection beneath the surface.

  3. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  4. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  5. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  6. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  7. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  8. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems §...

  9. 30 CFR 57.11053 - Escape and evacuation plans.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Escape and evacuation plans. 57.11053 Section 57.11053 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Travelways and Escapeways Escapeways-Underground Only §...

  10. 2. WEST REAR, WITH PORTHOLE ESCAPE HATCH ABOVE ENTRY DOOR. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. WEST REAR, WITH PORTHOLE ESCAPE HATCH ABOVE ENTRY DOOR. - Edwards Air Force Base, South Base Sled Track, Firing & Control Blockhouse for 10,000-foot Track, South of Sled Track at midpoint of 20,000-foot track, Lancaster, Los Angeles County, CA

  11. Plasma-induced Escape and Alterations of Planetary Atmospheres

    NASA Astrophysics Data System (ADS)

    Johnson, R. E.; Tucker, O. J.; Ewrin, J.; Cassidy, T. A.; Leblanc, F.

    2009-12-01

    The atmospheres of planets and planetary satellites are typically imbedded in space plasmas. Depending on the interaction with the induced or intrinsic fields energetic ions can have access to the thermosphere and the corona affecting their composition and thermal structure and causing loss to space. These processes are often lumped together as ‘atmospheric sputtering’ (Johnson 1994). In this talk I will review the results of simulations of the plasma bombardment at a number of solar system bodies and use those data to describe the effect on the upper atmosphere and on escape. Of considerable recent interest is the modeling of escape from Titan. Prior to Cassini’s tour of the Saturnian system, plasma-induced escape was suggested to be the dominant loss process, but recent models of enhanced thermal escape, often referred to as ‘slow hydrodynamic’ escape, have been suggested to lead to much larger Titan atmospheric loss rates (Strobel 2008; Cui et al. 2008). Such a process has been suggested to be active at some point in time on a number of solar system bodies. I will present hybrid fluid/ kinetic models of the upper atmosphere of certain bodies in order to test both the plasma-induced and thermal escape processes. Preliminary results suggest that the loss rates estimated using the ‘slow hydrodynamic’ escape process can be orders of magnitude too large. The implications for Mars, Titan and Pluto will be discussed. Background for this talk is contained in the following papers (Johnson 2004; 2009; Chaufray et al. 2007; Johnson et al. 2008; 2009; Tucker and Johnson 2009). References: Chaufray, J.Y., R. Modolo, F. Leblanc, G. Chanteur, R.E. Johnson, and J.G. Luhmann, Mars Solar Wind interaction: formation of the Martian corona and atmosphric loss to space, JGR 112, E09009, doi:10.1029/2007JE002915 (2007) Cui, J., Yelle, R. V., Volk, K. Distribution and escape of molecular hydrogen in Titan's thermosphere and exosphere. J. Geophys. Res. 113, doi:10

  12. [Effectiveness of methotrexate for the escape by salazosulfapyridine].

    PubMed

    Kawasaki, Yoichi; Moriyama, Masahiro; Shibata, Kazuhiko; Gomita, Yutaka

    2005-07-01

    Although disease modifying anti-rheumatic drugs (DMARDs) are used in the treatment of rheumatoid arthritis (RA), the selection of agents in the case of relapse (escape phenomenon) lacks clear-cut standards. We compared the effectiveness in a salazosulfapyridine and then methotrexate (SASP-->MTX) group with that in the mothotrexate (SASP+MTX) group after escape phenomenon expression in C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) data. Outpatients of the Matsubara Mayflower Hospital with a history of DMARD administration during the 4 years prior to May 2003 were studied. The CRP level in the SASP-->MTX group (n=8) after the escape phenomenon expression showed a decline after 3 months, but no decline was seen even after 3 months the two in the CRP level in the SASP+MTX group (n=10). However, the difference between groups was not significant. The fluctuation in ESR was similar to that in CRP. However, ESR was significantly lower in the SASP-->MTX group 20 weeks after escape phenomenon expression. In evaluating treatment effectiveness after escape phenomenon expression in each group, SASP-->MTX was effective in 10 and SASP+MTX in 7 patients. Side effects necessitated cessation of treatment in 1 patient in the SASP-->MTX group. Treatment continued in 4 patients in the SASP-->MTX group and 2 in the SASP+MTX group, even though side effects occurred. It should be borne in mind that combination therapy often has greater clinical benefit than single agent therapy but not always. PMID:15997214

  13. In situ and remote measurements of ions escaping from Venus

    NASA Astrophysics Data System (ADS)

    Kollmann, P.; Brandt, P. C.

    2013-12-01

    Venus is thought to lose a large fraction of its atmosphere in the form ions, mainly via pickup. The relative loss rate of the exosphere as neutrals or ions is not known, nor is the flux of escaping ions well constrained. Knowledge of these processes will shed light on the role an intrinsic magnetic field has in atmospheric erosion. We use the complementary in-situ plasma and energetic neutral atom (ENA) measurements from the Venus Express (VEx) spacecraft in order to constrain the ion escape. VEx completed about 2500 orbits to date and reached altitudes as low as 200km. The ASPERA/IMA instrument measured directional proton and oxygen ion spectra in the 10eV to 40keV range. We bin the data accumulated over the mission in space and bulk flow direction, yielding a direct measure of the local ion escape flux. While such in-situ measurements provide data without ambiguity, they are limited by the orbital coverage. This is why we include remote ENA measurements from the ASPERA/NPD (100eV to 10keV) instrument to our study. ENAs are created when escaping ions charge exchange with the high atmosphere atoms or molecules. We have done an exhaustive analysis of the data, excluding time periods of instrument contamination. Most ENA emission originates from low altitudes above Venus' limb. These measurements will be compared with the in-situ data, which allows constraining the atmospheric density at high altitudes. Interestingly, there are also ENA emissions from other directions, which were not sampled in-situ. This allows us to put a lower limit to the escape from these regions.

  14. Hydrodynamic Vs. Evaporative Escape: Exoplanets And The Ex-planet

    NASA Astrophysics Data System (ADS)

    Johnson, Robert E.; Volkov, A.; Erwin, J.; Tucker, O.

    2012-10-01

    In studies of exoplanets, early terrestrial atmospheres, and even Pluto’s atmosphere it has been convenient to use the equations of fluid dynamics, rather than a more detailed molecular kinetic model, to describe the loss of atmosphere over long time periods. However, the boundary conditions in the far field are always problematic. Therefore, it is assumed that the upward flow either goes through a sonic point or that the loss is Jeans-like at the exobase. The so-called energy limited loss rate, an approximation obtained from the fluid equations, is also often used. Therefore, in a series of molecular kinetic studies of Pluto’s atmosphere, we confirmed that the energy limited loss rate gives a reasonable estimate over a broad range of solar heating conditions, but the flow did not go sonic although the Jeans parameter was relatively small and the escape rates large (Tucker et al. 2012; Erwin et al. 2012). Because the nature of the flow, and not just escape rate, determines the structure of the upper atmosphere, and because the simulation results scale (Volkov et al. 2011), we developed a criterion for determining when the flow associated with atmospheric escape goes sonic or remains Jeans-like. This criterion is verified in a series of kinetic simulations performed using a range of heating rates. In this talk we will discuss the validity of the energy limited escape rate and the nature of the criterion with applications to escape from a variety of exoplanet atmospheres. Erwin, J. et al. Icarus submitted (2012); Tucker, O.J.et al. Icarus 217, 408 (2012); Volkov et al. ApJLetts 729,L24 (2012)

  15. Spatial and nonspatial escape strategies in the Barnes maze.

    PubMed

    Harrison, Fiona E; Reiserer, Randall S; Tomarken, Andrew J; McDonald, Michael P

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either with or without a discrete visible cue marking the location of the escape hole, which was either in a fixed or variable location across trials. In Experiment 2, all mice were trained with the discrete visible cue marking the target hole location. Two groups were identical to the cued-target groups from Experiment 1, with either fixed or variable escape locations. For these mice, the discrete cue either was the sole predictor of the target location or was perfectly confounded with the spatial extra-maze cues. The third group also used a cued variable target, but a curtain was drawn around the maze to prevent the use of spatial cues to guide navigation. Probe trials with all escape holes blocked were conducted to dissociate the use of spatial and discrete proximal cues. We conclude that the Barnes maze can be solved efficiently using spatial, visual cue, or serial-search strategies. However, mice showed a strong preference for using the distal room cues, even when a discrete visible cue clearly marked the escape location. Importantly, these data show that the cued-target control version of the Barnes maze as typically conducted does not dissociate spatial from nonspatial abilities. PMID:17101874

  16. Erratum: The Escape of Ionizing Photons from the Galaxy

    NASA Astrophysics Data System (ADS)

    Bland-Hawthorn, J.; Maloney, P. R.

    2001-04-01

    In the Letter ``The Escape of Ionizing Photons from the Galaxy'' by J. Bland-Hawthorn & P. R. Maloney (ApJ, 510, L33 [1999]), there is an error in Figure 4 that bears on the derived escape fraction of ionizing photons from star-forming regions in the Galaxy's disk. For the quoted distance (55 kpc) of the Magellanic Stream, the predicted emission measures should be reduced by a factor of (20/55)2. Our derived value of fesc~6%, the escape fraction normal to the disk, must be raised by the inverse of this factor, which makes it unlikely that the Stream Hα arises from UV produced by the Galaxy's young stellar disk. This is exacerbated by new Hα observations that show that the Stream is even brighter than originally thought (Weiner, Vogel, & Williams 2001). Bland-Hawthorn & Putman (2001) discuss possible sources of ionization for the Magellanic Stream. We note with interest that high-velocity clouds have now been detected in Hα (e.g., Tufte, Reynolds, & Haffner 1998). Some of these have well-established distance bounds. Bland-Hawthorn & Putman (2001) and Weiner et al. (2001) find that the observed Hα is roughly consistent with fesc~5%, although the present uncertainties are about a factor of 2. It should be noted that fesc refers to the escape fraction normal to the disk. The escape fraction averaged over 4π sr, fesc, is about a factor of 3 smaller and depends on the details of the opacity model (Bland-Hawthorn 1998, Appendix 1). The present uncertainties on fesc for the Galaxy mean that we cannot determine whether star-forming regions dominate the extragalactic UV background (cf. Shull et al. 1999).

  17. Recording Field Potentials From Zebrafish Larvae During Escape Responses

    PubMed Central

    Monesson-Olson, Bryan D.; Troconis, Eileen L.; Trapani, Josef G.

    2014-01-01

    Among vertebrates, startle responses are a ubiquitous method for alerting, and avoiding or escaping from alarming or dangerous stimuli. In zebrafish larvae, fast escape behavior is easily evoked through either acoustic or tactile stimuli. For example, a light touch to the head will excite trigeminal neurons that in turn excite a large reticulospinal neuron in the hindbrain called the Mauthner cell (M-cell). The M-cell action potential then travels down the contralateral trunk of the larva exciting motoneurons, which subsequently excite the entire axial musculature, producing a large amplitude body bend away from the source of the stimulus. This body conformation is known as the “C-bend” due to the shape of the larva during the behavior. As a result of the semi-synchronized activation of the M-cell, the population of motor neurons, and the axial trunk muscles, a large field potential is generated and can be recorded from free-swimming or fixed-position larvae. Undergraduate laboratories that record field potentials during escape responses in larval zebrafish are relatively simple to setup and allow students to observe and study the escape reflex circuit. Furthermore, by testing hypotheses, analyzing data and writing journal-style laboratory reports, students have multiple opportunities to learn about many neuroscience topics including vertebrate reflexes; sensory transduction; synaptic-, neuro-, and muscle-physiology; the M-cell mediated escape response; and the zebrafish as a model organism. Here, we detail the equipment, software, and recording setup necessary to observe field potentials in an undergraduate teaching lab. Additionally, we discuss potential advanced laboratory exercises and pedagogical outcomes. Finally, we note possible low-cost alternatives for recording field potentials. PMID:25565920

  18. Escape manoeuvres in the spiny dogfish (Squalus acanthias).

    PubMed

    Domenici, Paolo; Standen, Emily M; Levine, Robert P

    2004-06-01

    The locomotor performance of dogfish during escape responses was observed by means of high-speed video. Dogfish show C-type escape responses that are comparable with those shown previously in teleosts. Dogfish show high variability of turning rates of the anterior part of the body (head to centre of mass), i.e. with peak values from 434 to 1023 deg. s(-1). We suggest that this variability may be due to the presence of two types of escape manoeuvres, i.e. responses with high and low turning rates, as previously found in a teleost species. Fast responses (i.e. with high maximum turning rates, ranging between 766 and 1023 deg. s(-1)) showed significantly higher locomotor performance than slow responses (i.e. with low maximum turning rates, ranging between 434 and 593 deg. s(-1)) in terms of distance covered, speed and acceleration, although no differences were found in the turning radius of the centre of mass during the escape manoeuvres. The existence of two types of escape responses would have implications in terms of both neural control and muscular activation patterns. When compared with literature data for the locomotor performance of bony fishes, dogfish showed relatively low speed and acceleration, comparable turning rates and a turning radius that is in the low part of the range when compared with teleosts, indicating relatively high manoeuvrability. The locomotor performance observed in dogfish is consistent with their morphological characteristics: (1) low locomotor performance associated with low thrust developed by their relatively small posterior depth of section and (2) relatively high manoeuvrability associated with their high flexibility. PMID:15159438

  19. Reducing VDAC1 expression induces a non-apoptotic role for pro-apoptotic proteins in cancer cell differentiation.

    PubMed

    Arif, Tasleem; Krelin, Yakov; Shoshan-Barmatz, Varda

    2016-08-01

    Proteins initially identified as essential for apoptosis also mediate a wide range of non-apoptotic functions that include cell cycle progression, differentiation and metabolism. As this phenomenon was mostly reported with non-cancer cells, we considered non-conventional roles for the apoptotic machinery in the cancer setting. We found that treating glioblastoma (GBM) tumors with siRNA against VDAC1, a mitochondrial protein found at the crossroads of metabolic and survival pathways and involved in apoptosis, inhibited tumor growth while leading to differentiation of tumor cells into neuronal-like cells, as reflected in the expression of specific markers. Although VDAC1 depletion did not induce apoptosis, the expression levels of several pro-apoptotic regulatory proteins were changed. Specifically, VDAC1 deletion led to up-regulation of caspases, p53, cytochrome c, and down-regulation of SMAC/Diablo, AIF and TSPO. The down-regulated group was highly expressed in U-87MG xenografts, as well as in GBMs from human patients. We also showed that the rewired cancer-cell metabolism resulting from VDAC1 depletion reinforced cell growth arrest and differentiation via alterations in the transcription factors p53, c-Myc, HIF-1α and NF-κB. The decrease in c-Myc, HIF-1α and NF-κB levels was in accord with reduced cell proliferation, whereas increased p53 expression promoted differentiation. Thus, upon metabolic re-programing induced by VDAC1 depletion, the levels of pro-apoptotic proteins associated with cell growth decreased, while those connected to cell differentiation increased, converting GBM cells into astrocyte- and neuron-like cells. The results reveal that in tumors, pro-apoptotic proteins can perform non-apoptotic functions, acting as regulators of cell growth and differentiation, making these molecules potential new targets for cancer therapy. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy

  20. Expression of apoptotic regulatory molecules in renal cell carcinoma: elevated expression of Fas ligand.

    PubMed

    Olive, C; Cheung, C; Nicol, D; Falk, M C

    1999-02-01

    Renal cell carcinoma (RCC) is the most common renal neoplasm. Despite being infiltrated by tumour infiltrating lymphocytes (TIL), these TIL are unable to control tumour growth in vivo, suggesting that the cytotoxic capacity of TIL against RCC is impaired, or that the tumour cells are resistant to killing and therefore escape detection by the immune system. It is postulated that the expression of apoptotic regulatory molecules in RCC favours tumour cell survival. The present study has therefore determined the expression of Fas (APO-1/CD95), Fas ligand (Fas L) and bcl-2 in these tumours. The expression of Fas, Fas L and bcl-2 mRNA transcripts was determined in RCC, normal kidney and peripheral blood by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR), following RNA extraction and cDNA synthesis from tissues and cell samples. Transcript levels were measured by densitometry after Southern blot hybridization of PCR products with internal radio-labelled oligonucleotide probes; a densitometry score was assigned to each hybridizing DNA band and expressed as a ratio of the glyceraldehyde-3-phosphate dehydrogenase content. In peripheral blood, the expression of Fas L and bcl-2 transcripts was similar between patients and normal healthy individuals; however, Fas transcript expression was significantly down-regulated in the patients' versus normal peripheral blood (P = 0.026). Most interestingly, significantly up-regulated Fas L expression was observed in RCC compared to normal kidney (P = 0.041). In contrast, bcl-2 transcripts were well represented in normal kidney but markedly decreased in RCC (P = 0.021). The expression of Fas transcripts in normal kidney and RCC was variable. These data demonstrate elevated expression of Fas L transcripts in RCC, but the functional relevance of this remains to be investigated. PMID:10101681

  1. Pro-apoptotic Action of Corticosterone in Hippocampal Organotypic Cultures.

    PubMed

    Kurek, Anna; Kucharczyk, Mateusz; Detka, Jan; Ślusarczyk, Joanna; Trojan, Ewa; Głombik, Katarzyna; Bojarski, Bartosz; Ludwikowska, Agnieszka; Lasoń, Władysław; Budziszewska, Bogusława

    2016-08-01

    Elevated levels of glucocorticoids exert neurotoxic effects, and the hippocampus is particularly sensitive to the effects of glucocorticoids. Because some data have indicated that an increased action of glucocorticoids in the perinatal period enhances the susceptibility of brain tissue to adverse substances later in life, the main purpose of the present study was to compare necrotic/apoptotic corticosterone action in hippocampal organotypic cultures obtained from control animals with the effect of this steroid in tissue from prenatally stressed rats. Because the adverse effects of glucocorticoid action on nerve cell viability appear to result mainly from an increase in the intensity of the effects of glutamate and changes in growth factor and pro-inflammatory cytokine synthesis, the involvement of these factors in corticosterone action were also determined. In stress-like concentration (1 μM), corticosterone, when added to hippocampal cultures for 1 and 3 days, alone or jointly with glutamate, did not induce necrosis. In contrast, in 3-day cultures, corticosterone (1 μM) increased caspase-3 activity and the mRNA expression of the pro-apoptotic Bax. Moreover, corticosterone's effect on caspase-3 activity was stronger in hippocampal cultures from prenatally stressed compared to control rats. Additionally, 24 h of exposure to corticosterone and glutamate, when applied separately and together, increased Bdnf, Ngf, and Tnf-α expression. In contrast, after 72 h, a strong decrease in the expression of both growth factors was observed, while the expression of TNF-α remained high. The present study showed that in stress-like concentrations, corticosterone exerted pro-apoptotic but not necrotic effects in hippocampal organotypic cultures. Prenatal stress increased the pro-apoptotic effects of corticosterone. Increased synthesis of the pro-inflammatory cytokine TNF-α may be connected with the adverse effects of corticosterone on brain cell viability. PMID:27189478

  2. Evaluation of apoptotic activity of new condensed pyrazole derivatives.

    PubMed

    Toton, E; Ignatowicz, E; Bernard, M K; Kujawski, J; Rybczynska, M

    2013-02-01

    Cyclic pyrazoles exhibit cytotoxicity to human cancer cells through apoptosis induction. We investigated the proapoptotic activities of two novel synthetic pyrazoles: 5-(p-toluenesulfonyl)pyrazolo[4,3-f]quinoline (tospyrquin) and 5-chloro-3-(p-toluenesulfonyl)indazole (tosind) in HT29 colon cancer cells which are characterised by point mutation (G/A in codon 273) in the p53 gene, which causes the lack of functionality of the p53 protein. Cell viability was evaluated in the MTT assay, cell morphology was assessed by DAPI staining, flow cytometry was used to study the cell cycle, Western blot techniques were applied for measurements of the Bax, Bcl-2, caspase-8, caspase-9 and PARP-1 proteins and DNA damage was evaluated in the Comet assay. Tospyrquin or tosind in a concentration range of 2.5 μM-15 μM caused an approximately 20% diminishment in cell growth, but in higher concentrations (25-100 μM) the observed effect depended on the pyrazole structure and time of treatment. In cell cycle analysis, tosind caused 23.7% of apoptotic death and tospyrquin - 14.9%. These data were supported by an increased level of the pro-apoptotic protein Bax, a decreased level of the anti-apoptotic Bcl-2 and enhanced caspase-8, caspase-9, PARP-1 cleavage. DNA damage was dose-dependent for both tested compounds. The results suggest that the pro-apoptotic activity of tospyrquin and tosind is probably regulated by the extrinsic and the intrinsic pathways. PMID:23568979

  3. Apoptotic Death of Cancer Stem Cells for Cancer Therapy

    PubMed Central

    He, Ying-Chun; Zhou, Fang-Liang; Shen, Yi; Liao, Duan-Fang; Cao, Deliang

    2014-01-01

    Cancer stem cells (CSCs) play crucial roles in tumor progression, chemo- and radiotherapy resistance, and recurrence. Recent studies on CSCs have advanced understanding of molecular oncology and development of novel therapeutic strategies. This review article updates the hypothesis and paradigm of CSCs with a focus on major signaling pathways and effectors that regulate CSC apoptosis. Selective CSC apoptotic inducers are introduced and their therapeutic potentials are discussed. These include synthetic and natural compounds, antibodies and recombinant proteins, and oligonucleotides. PMID:24823879

  4. Pro-apoptotic function of the retinoblastoma tumor suppressor protein

    PubMed Central

    Ianari, Alessandra; Natale, Tiziana; Calo, Eliezer; Ferretti, Elisabetta; Alesse, Edoardo; Screpanti, Isabella; Haigis, Kevin; Gulino, Alberto; Lees, Jacqueline A.

    2009-01-01

    SUMMARY The retinoblastoma protein (pRB) tumor suppressor blocks cell proliferation by repressing the E2F transcription factors. This inhibition is relieved through mitogen-induced phosphorylation of pRB, triggering E2F release and activation of cell cycle genes. E2F1 can also activate pro-apoptotic genes in response to genotoxic or oncogenic stress. However, pRB’s role in this context has not been established. Here we show that DNA damage and E1A-induced oncogenic stress promotes formation of a pRB-E2F1 complex even in proliferating cells. Moreover, pRB is bound to pro-apoptotic promoters that are transcriptional active and pRB is required for maximal apoptotic response in vitro and in vivo. Together, these data reveal a direct role for pRB in the induction of apoptosis in response to genotoxic or oncogenic stress. SIGNIFICANCE pRB function is disrupted in many human tumors through either inactivation of the Rb gene or alterations in its upstream regulators. pRB’s tumor suppressive activity is at least partially dependent upon its ability to arrest cells through E2F inhibition. Our data now establish a second role for pRB as a stress-induced activator of apoptosis. Notably, pRB’s ability to promote either arrest versus apoptosis seems to be context dependent, with apoptosis being favored in proliferating cells. This finding has the potential to explain why cells are typically more resistant to apoptosis when in the arrested state. Most importantly, our observations suggest that Rb status will influence tumor response to chemotherapy by impairing both the arrest and apoptotic checkpoint responses. PMID:19249677

  5. A mathematical model for apoptotic switch in Drosophila

    NASA Astrophysics Data System (ADS)

    Ziraldo, Riccardo; Ma, Lan

    2015-10-01

    Apoptosis is an evolutionarily-conserved process of autonomous cell death. The molecular switch mechanism underlying the fate decision of apoptosis in mammalian cells has been intensively studied by mathematical modeling. In contrast, the apoptotic switch in invertebrates, with highly conserved signaling proteins and pathway, remains poorly understood mechanistically and calls for theoretical elucidation. In this study, we develop a mathematical model of the apoptosis pathway in Drosophila and compare the switch mechanism to that in mammals. Enumeration of the elementary reactions for the model demonstrates that the molecular interactions among the signaling components are considerably different from their mammalian counterparts. A notable distinction in network organization is that the direct positive feedback from the effector caspase (EC) to the initiator caspase in mammalian pathway is replaced by a double-negative regulation in Drosophila. The model is calibrated by experimental input-output relationship and the simulated trajectories exhibit all-or-none bimodal behavior. Bifurcation diagrams confirm that the model of Drosophila apoptotic switch possesses bistability, a well-recognized feature for an apoptosis system. Since the apoptotic protease activating factor-1 (APAF1) induced irreversible activation of caspase is an essential and beneficial property for the mammalian apoptotic switch, we perform analysis of the bistable caspase activation with respect to the input of DARK protein, the Drosophila homolog of APAF1. Interestingly, this bistable behavior in Drosophila is predicted to be reversible. Further analysis suggests that the mechanism underlying the systems property of reversibility is the double-negative feedback from the EC to the initiator caspase. Using theoretical modeling, our study proposes plausible evolution of the switch mechanism for apoptosis between organisms.

  6. Histopathological, Ultrastructural and Apoptotic Changes in Diabetic Rat Placenta

    PubMed Central

    Gül, Mehmet; Bayat, Nuray; Çetin, Aslı; Kepekçi, Remziye Aysun; Şimşek, Yavuz; Kayhan, Başak; Turhan, Uğur; Otlu, Ali

    2015-01-01

    Background: The exchange of substances between mother and fetus via the placenta plays a vital role during development. A number of developmental disorders in the fetus and placenta are observed during diabetic pregnancies. Diabetes, together with placental apoptosis, can lead to developmental and functional disorders. Aims: Histological, ultrastructural and apoptotic changes were investigated in the placenta of streptozotocin (STZ) induced diabetic rats. Study Design: Animal experimentation. Methods: In this study, a total of 12 female Wistar Albino rats (control (n=6) and diabetic (n=6)) were used. Rats in the diabetic group, following the administration of a single dose of STZ, showed blood glucose levels higher than 200 mg/dL after 72 hours. When pregnancy was detected after the rats were bred, two pieces of placenta and the fetuses were collected on the 20th day of pregnancy by cesarean incision under ketamine/ xylazine anesthesia from in four rats from the control and diabetic groups. Placenta tissues were processed for light microscopy and transmission electron microscopy (TEM). Hematoxylin-eosin (HE) and periodic acid Schiff-diastase (PAS-D) staining for light microscopic and caspase-3 staining for immunohistochemical investigations were performed for each placenta. Electron microscopy was performed on thin sections contrasted with uranyl acetate and lead nitrate. Results: Weight gain in the placenta and fetuses of diabetic rats and thinning of the decidual layer, thickening of the hemal membrane, apoptotic bodies, congestion in intervillous spaces, increased PAS-D staining in decidual cells and caspase-3 immunoreactivity were observed in the diabetic group. After the ultrastructural examination, the apoptotic appearance of the nuclei of trophoblastic cells, edema and intracytoplasmic vacuolization, glycogen accumulation, dilation of the endoplasmic reticulum and myelin figures were observed. In addition, capillary basement membrane thickening, capillary

  7. UVA1 radiation triggers two different final apoptotic pathways.

    PubMed

    Godar, D E

    1999-01-01

    Because ultraviolet-A1 (UVA1; 340-400 nm) radiation is used therapeutically, this in vitro study addressed the question "how does it work?" To begin addressing this question, UVA1 radiation was first established to reduce the survival of transformed T and B lymphocytes in a linear dose-dependent manner using clonogenic reproductive assays, and that cell death occurs by apoptosis using transmission electron microscopy, Annexin V, and flow cytometry. The primary mechanism was determined to be immediate pre-programmed cell death, an apoptotic mechanism that does not require protein synthesis post-insult, by quantifying the apoptotic cells over time in the absence or presence of a translation inhibitor. To explore how UVA1 radiation induces immediate pre-programmed cell death apoptosis, reactive oxygen species and mitochondrial activity were altered during exposure using a variety of agents, while a specific fluorescent probe, 5,5',6,6'tetrachloro- 1,1',3,3'-tetraethylbenzimidazolcarbocyanine iodide, was used to examine mitochondrial transmembrane depolarization. To show that UVA1 mediates singlet-oxygen damage to the mitochondrial membranes, X-rays, UVB (290-320 nm), 8-methoxypsoralen and UVA, vitamin K3, anti-Fas antibody, and blocking antibody were the negative controls, while rose bengal or protoporphyrin IX with visible light were the positive controls. Cyclosporine A, which inhibits the mitochondrial megapore from opening, was used with singlet-oxygen and superoxide-anion generators to distinguish between the two final apoptotic pathways. The collective results show that UVA1 radiation primarily mediates singlet-oxygen damage triggering immediate pre-programmed cell death apoptosis (T < 20 min) by immediately opening the cyclosporine A-sensitive ("S" site) mitochondrial megapore, while superoxide anions initiate another cyclosporine A-insensitive ("P" site) final apoptotic pathway. PMID:9886256

  8. PDT-treated apoptotic cells induce macrophage synthesis NO

    NASA Astrophysics Data System (ADS)

    Song, S.; Xing, D.; Zhou, F. F.; Chen, W. R.

    2009-11-01

    Nitric oxide (NO) is a biologically active molecule which has multi-functional in different species. As a second messenger and neurotransmitter, NO is not only an important regulatory factor between cells' information transmission, but also an important messenger in cell-mediated immunity and cytotoxicity. On the other side, NO is involving in some diseases' pathological process. In pathological conditions, the macrophages are activated to produce a large quantity of nitric oxide synthase (iNOS), which can use L-arginine to produce an excessive amount of NO, thereby killing bacteria, viruses, parasites, fungi, tumor cells, as well as in other series of the immune process. In this paper, photofrin-based photodynamic therapy (PDT) was used to treat EMT6 mammary tumors in vitro to induce apoptotic cells, and then co-incubation both apoptotic cells and macrophages, which could activate macrophage to induce a series of cytotoxic factors, especially NO. This, in turn, utilizes macrophages to activate a cytotoxic response towards neighboring tumor cells. These results provided a new idea for us to further study the immunological mechanism involved in damaging effects of PDT, also revealed the important function of the immune effect of apoptotic cells in PDT.

  9. Apoptotic cell signaling in cancer progression and therapy.

    PubMed

    Plati, Jessica; Bucur, Octavian; Khosravi-Far, Roya

    2011-04-01

    Apoptosis is a tightly regulated cell suicide program that plays an essential role in the development and maintenance of tissue homeostasis by eliminating unnecessary or harmful cells. Impairment of this native defense mechanism promotes aberrant cellular proliferation and the accumulation of genetic defects, ultimately resulting in tumorigenesis, and frequently confers drug resistance to cancer cells. The regulation of apoptosis at several levels is essential to maintain the delicate balance between cellular survival and death signaling that is required to prevent disease. Complex networks of signaling pathways act to promote or inhibit apoptosis in response to various cues. Apoptosis can be triggered by signals from within the cell, such as genotoxic stress, or by extrinsic signals, such as the binding of ligands to cell surface death receptors. Various upstream signaling pathways can modulate apoptosis by converging on, and thereby altering the activity of, common central control points within the apoptotic signaling pathways, which involve the BCL-2 family proteins, inhibitor of apoptosis (IAP) proteins, and FLICE-inhibitory protein (c-FLIP). This review highlights the role of these fundamental regulators of apoptosis in the context of both normal apoptotic signaling mechanisms and dysregulated apoptotic pathways that can render cancer cells resistant to cell death. In addition, therapeutic strategies aimed at modulating the activity of BCL-2 family proteins, IAPs, and c-FLIP for the targeted induction of apoptosis are briefly discussed. PMID:21340093

  10. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway.

    PubMed

    Guo, Yinsheng; Wang, Wei; Dong, Yu; Zhang, Zhen; Zhou, Yijun; Chen, Guoyuan

    2014-08-01

    Carbon disulfide (CS2), one of the most important volatile organic chemicals, was shown to have serious impairment to male reproductive system. But the underline mechanism is still unclear. In the present study, we aim to investigate the male germ cell apoptosis induced by CS2 exposure alone and by co-administration with cyclosporin A (CsA), which is the inhibitor of membrane permeability transition pore (MPTP). It was shown that CS2 exposure impaired ultrastructure of germ cells, increased the numbers of apoptotic germ cells, accumulated intracellular level of calcium, elevated ROS level, and increased activities of complexes of respiratory chain. Meanwhile, exposure to CS2 dramatically decreased the mitochondrial transmembrane potential (ΔΨm) and levels of ATP and MPTP opening. Exposure to CS2 can also cause a significantly dose-dependent increase in the expression levels of Bax, Cytc, Caspase-9, and Caspase-3, but decreased the expression level of Bcl-2. Moreover, co-administration of CsA with CS2 can reverse or alleviate the above apoptotic damage effects of CS2 on testicular germ cells. Taken together, our findings suggested that CS2 can cause damage to testicular germ cells via mitochondrial apoptotic pathway, and MPTP play a crucial role in this process. PMID:24582363

  11. ELMO1 signaling in apoptotic germ cell clearance and spermatogenesis.

    PubMed

    Elliott, Michael R; Ravichandran, Kodi S

    2010-10-01

    Apoptosis and the subsequent removal of dying cells are crucial processes for tissue development and maintenance. Although we are beginning to understand the signaling pathways that control the phagocytic clearance of apoptotic cells, the physiological relevance of these pathways is lacking. During spermatogenesis, over half of the developing germ cells eventually die by apoptosis, yet the signaling pathways that regulate the phagocytic clearance of these dying cells or the impact of this clearance on development and maintenance of the germ cell population is not well understood. The ELMO1/Dock180 proteins form an evolutionarily conserved signaling module that functions as a bipartite guanine nucleotide exchange factor for the small GTPase Rac. The subsequent Rac-dependent cytoskeletal changes play an important role in the physical engulfment of apoptotic cells. Recent findings demonstrate an in vivo role for ELMO1-dependent clearance in the testes, with implications for spermatogenesis. Here we will discuss the role of apoptotic cell clearance during spermatogenesis, with a particular emphasis on ELMO1/Dock180 signaling. PMID:20958313

  12. Apoptotic and autophagic cell death induced by glucolaxogenin in cervical cancer cells.

    PubMed

    Sánchez-Sánchez, L; Escobar, M L; Sandoval-Ramírez, J; López-Muñoz, H; Fernández-Herrera, M A; Hernández-Vázquez, J M V; Hilario-Martínez, C; Zenteno, E

    2015-12-01

    The antiproliferative and cytotoxic activity of glucolaxogenin and its ability to induce apoptosis and autophagy in cervical cancer cells are reported. We ascertained that glucolaxogenin exerts an inhibitory effect on the proliferation of HeLa, CaSki and ViBo cells in a dose-dependent manner. Analysis of DNA distribution in the cell-cycle phase of tumor cells treated with glucolaxogenin suggests that the anti-proliferative activity of this steroid is not always dependent on the cell cycle. Cytotoxic activity was evaluated by detection of the lactate dehydrogenase enzyme in supernatants from tumor cell cultures treated with the steroid. Glucolaxogenin exhibited null cytotoxic activity. With respect to the apoptotic activity, the generation of apoptotic bodies, the presence of active caspase-3 and annexin-V, as well as the DNA fragmentation observed in all tumor lines after treatment with glucolaxogenin suggests that this compound does indeed induce cell death by apoptosis. Also, a significantly increased presence of the LC3-II, LC3 and Lamp-1 proteins was evidenced with the ultrastructural existence of autophagic vacuoles in cells treated with this steroidal glycoside, indicating that glucolaxogenin also induces autophagic cell death. It is important to note that this compound showed no cytotoxic effect and did not affect the proliferative capacity of mononuclear cells obtained from normal human peripheral blood activated by phytohaemagglutinin. Thus, glucolaxogenin is a compound with anti-proliferative properties that induces programmed cell death in cancer cell lines, though it is selective with respect to normal lymphocytic cells. These findings indicate that this glycoside could have a selective action on tumor cells and, therefore, be worthy of consideration as a therapeutic candidate with anti-tumor potential. PMID:26437916

  13. The expression patterns of pro-apoptotic and anti-apoptotic factors in human fetal and adult ovary.

    PubMed

    Poljicanin, Ana; Vukusic Pusic, Tanja; Vukojevic, Katarina; Caric, Ana; Vilovic, Katarina; Tomic, Snjezana; Soljic, Violeta; Saraga-Babic, Mirna

    2013-07-01

    The influence of pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins on the cell death (caspase-3, TUNEL) of different ovarian cell lineages was immunohistochemically analyzed in six fetal and five adult human ovaries in order to disclose possible mechanisms of cell number control. Mild to moderate expression of Bcl-2 characterized ovarian surface epithelium, follicular cells and oocytes of 15 and 22 week human ovaries, while expression of Bax and caspase-3 gradually increased in all ovarian cell populations, except caspase-3 in the ovarian surface epithelium. Different levels of Bax and Bcl-2 proteins co-expression characterized fetal ovarian cells, while TUNEL and caspase-3 co-expression was found only in some of them. In adult ovaries, Bcl-2 was moderately and Bax strongly expressed in the surface ovarian epithelium and stroma. Bcl-2 and Bax expression in granulosa and theca interna cells varied depending on the stage of follicular atresia. Caspase-3 apoptotic cells characterized granulosa cells of adult atretic follicles. Our results indicate that intracellular levels of Bcl-2 and Bax protein might regulate the final destiny of developing germ cells. Caspase-3 dependent apoptosis seems to be the most important, but not the only cell death pathway in ovaries. In adult ovaries, caspase-dependent cell death characterized granulosa cells, but not the germ cells. PMID:23295106

  14. Evidence for local regulatory control of escape from imprinted X chromosome inactivation.

    PubMed

    Mugford, Joshua W; Starmer, Joshua; Williams, Rex L; Calabrese, J Mauro; Mieczkowski, Piotr; Yee, Della; Magnuson, Terry

    2014-06-01

    X chromosome inactivation (XCI) is an epigenetic process that almost completely inactivates one of two X chromosomes in somatic cells of mammalian females. A few genes are known to escape XCI and the mechanism for this escape remains unclear. Here, using mouse trophoblast stem (TS) cells, we address whether particular chromosomal interactions facilitate escape from imprinted XCI. We demonstrate that promoters of genes escaping XCI do not congregate to any particular region of the genome in TS cells. Further, the escape status of a gene was uncorrelated with the types of genomic features and gene activity located in contacted regions. Our results suggest that genes escaping imprinted XCI do so by using the same regulatory sequences as their expressed alleles on the active X chromosome. We suggest a model where regulatory control of escape from imprinted XCI is mediated by genomic elements located in close linear proximity to escaping genes. PMID:24653000

  15. Evidence for Local Regulatory Control of Escape from Imprinted X Chromosome Inactivation

    PubMed Central

    Mugford, Joshua W.; Starmer, Joshua; Williams, Rex L.; Calabrese, J. Mauro; Mieczkowski, Piotr; Yee, Della; Magnuson, Terry

    2014-01-01

    X chromosome inactivation (XCI) is an epigenetic process that almost completely inactivates one of two X chromosomes in somatic cells of mammalian females. A few genes are known to escape XCI and the mechanism for this escape remains unclear. Here, using mouse trophoblast stem (TS) cells, we address whether particular chromosomal interactions facilitate escape from imprinted XCI. We demonstrate that promoters of genes escaping XCI do not congregate to any particular region of the genome in TS cells. Further, the escape status of a gene was uncorrelated with the types of genomic features and gene activity located in contacted regions. Our results suggest that genes escaping imprinted XCI do so by using the same regulatory sequences as their expressed alleles on the active X chromosome. We suggest a model where regulatory control of escape from imprinted XCI is mediated by genomic elements located in close linear proximity to escaping genes. PMID:24653000

  16. 20. DETAIL VIEW IN 18FOOT LOCK, ESCAPE TRAINING TANK, SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. DETAIL VIEW IN 18-FOOT LOCK, ESCAPE TRAINING TANK, SHOWING DOOR INTO TANK AT RIGHT - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  17. The anti-apoptotic effect of leukotriene D4 involves the prevention of caspase 8 activation and Bid cleavage.

    PubMed Central

    Wikström, Katarina; Juhas, Maria; Sjölander, Anita

    2003-01-01

    We have shown in a previous study that leukotriene D(4) (LTD(4)) signalling increases cell survival and proliferation in intestinal epithelial cells [Ohd, Wikström and Sjölander (2000) Gastroenterology 119, 1007-1018]. This is highly interesting since inflammatory conditions of the bowel are associated with an increased risk of developing colon cancer. The enzyme cyclo-oxygenase 2 (COX-2) is important in this context since it is up-regulated in colon cancer tissues and in tumour cell lines. Treatment with the COX-2-specific inhibitor N -(2-cyclohexyloxy-4-nitrophenyl)methane sulphonamide has been shown previously to cause apoptosis in intestinal epithelial cells. In the present study, we attempted to elucidate the underlying mechanisms and we can now show that a mitochondrial pathway is employed. Inhibition of COX-2 causes release of cytochrome c, as shown by both Western-blot and microscopy studies, and as with apoptosis, this is significantly decreased by LTD(4). Since previous studies showed increased Bcl-2 levels on LTD(4) stimulation, we further studied apoptotic regulation at the mitochondrial level. From this we could exclude the involvement of the anti-apoptotic protein Bcl-X(L) as well as its pro-apoptotic counterpart Bax, since they are not expressed. Furthermore, the activity of the pro-apoptotic protein Bad (Bcl-2/Bcl-X(L)-antagonist, causing cell death) was completely unaffected. However, inhibition of COX-2 caused cleavage of caspase 8 into a 41 kDa fragment associated with activation and caused the appearance of an activated 15 kDa fragment of Bid. This indicates that N -(2-cyclohexyloxy-4-nitrophenyl)methane sulphonamide-induced apoptosis is mediated by the activation of caspase 8, via generation of truncated Bid, and thereafter release of cytochrome c. Interestingly, LTD(4) not only reverses the effects induced by inhibition of COX-2 but also reduces the apoptotic potential by lowering the basal level of caspase 8 activation and truncated Bid

  18. Escape of heated ions upstream of quasi-parallel shocks

    NASA Technical Reports Server (NTRS)

    Edmiston, J. P.; Kennel, C. F.; Eichler, D.

    1982-01-01

    A simple theoretical criterion by which quasi-parallel and quasi-perpendicular collisionless shocks may be distinguished is proposed on the basis of an investigation of the free escape of ions from the post-shock plasma into the region upstream of a fast collisionless shock. It was determined that the accessibility of downstream ions to the upstream region depends on upstream magnetic field shock normal angle, in addition to the upstream plasma parameters, with post-shock ions escaping upstream for shock normal angles of less than 45 deg, in agreement with the observed transition between quasi-parallel and quasi-perpendicular shock structure. Upstream ion distribution functions resembling those of observed intermediate ions and beams are also calculated.

  19. Facilities and capabilities catalog for landing and escape systems

    NASA Technical Reports Server (NTRS)

    Meyerson, Robert E. (Editor)

    1992-01-01

    This catalog serves as a single source reference for designers of landing and escape systems for spacecraft, aircraft, weapons, and airdrop system. It includes those facilities which may be required by a system designer in planning a development test program for many applications. The primary objective of this catalog is to provide a means for identifying critical facilities with the U.S. which can be used for the development of landing and escape systems. A secondary objective is to provide a useful tool to the system designer for picking and choosing facilities and capabilities. The six chapters in this volume include wind tunnels, drop zones, test aircraft, fabrication facilities, design tools, and other miscellaneous facilities. A different data sheet format is used for each of the chapters which provides information on performance, location, special capabilities, and a local point of contact. All inputs were solicited from the individual facilities and have not been independently verified for accuracy.

  20. Self-organized escape of oscillator chains in nonlinear potentials.

    PubMed

    Hennig, D; Fugmann, S; Schimansky-Geier, L; Hänggi, P

    2007-10-01

    We present the noise-free escape of a chain of linearly interacting units from a metastable state over a cubic on-site potential barrier. The underlying dynamics is conservative and purely deterministic. The mutual interplay between nonlinearity and harmonic interactions causes an initially uniform lattice state to become unstable, leading to an energy redistribution with strong localization. As a result, a spontaneously emerging localized mode grows into a critical nucleus. By surpassing this transition state, the nonlinear chain manages a self-organized, deterministic barrier crossing. Most strikingly, these noise-free, collective nonlinear escape events proceed generally by far faster than transitions assisted by thermal noise when the ratio between the average energy supplied per unit in the chain and the potential barrier energy assumes small values. PMID:17994939

  1. The production and escape of nitrogen atoms on Mars

    NASA Astrophysics Data System (ADS)

    Fox, J. L.

    1993-02-01

    Updated rate coefficients and a revised ionosphere-thermosphere model are used to compute the production rates and densities of odd nitrogen species in the Martian atmosphere. Computed density profiles for N(4S), N(2D), N(2P), and NO are presented. The model NO densities are found to be about a factor of 2-3 less than those measured by the Viking 1 mass spectrometer. Revised values for the escape rates of N atoms from dissociative recombination and ionospheric reactions are also computed. Dissociative recombination is found to be comparable in importance to photodissociation at low solar activity, but it is still the most important escape mechanism for N-14 at high solar activity.

  2. Ionospheric Flow and Escape of Ions from Titan and Venus

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Intriligator, D. S.; Grebowsky, Joseph M.; Vondrak, Richard R. (Technical Monitor)

    2001-01-01

    Knowledge gained from measurements and models is used to study the high-speed plasmas interacting with the atmospheres and ionospheres of Titan and Venus. Considering the similarities of the interactions, comparative analysis is used to support the interpretations of observations made at each body. Ionospheric flow inferred to exist by analysis of measurements made from the Pioneer Venus Orbiter supports the interpretation of similar flow in the ionosphere of Titan. The concept that cold ions escape from the ionosphere of Venus is supported by the Voyager I observation that cold ions escape down the magnetic tail of Titan. Pickup O+ ion energy distributions observed at their source in the ionosheath of Venus are shown to be influenced by finite gyroradius effects. The signatures of such effects are expected to be retained as the ions move into the wakes of Titan and Venus.

  3. The production and escape of nitrogen atoms on Mars

    NASA Technical Reports Server (NTRS)

    Fox, J. L.

    1993-01-01

    Updated rate coefficients and a revised ionosphere-thermosphere model are used to compute the production rates and densities of odd nitrogen species in the Martian atmosphere. Computed density profiles for N(4S), N(2D), N(2P), and NO are presented. The model NO densities are found to be about a factor of 2-3 less than those measured by the Viking 1 mass spectrometer. Revised values for the escape rates of N atoms from dissociative recombination and ionospheric reactions are also computed. Dissociative recombination is found to be comparable in importance to photodissociation at low solar activity, but it is still the most important escape mechanism for N-14 at high solar activity.

  4. Behavioral analysis of the escape response in larval zebrafish

    NASA Astrophysics Data System (ADS)

    Feng, Ruopei; Girdhar, Kiran; Chemla, Yann; Gruebele, Martin

    The behavior of larval zebrafish is of great interest because the limited number of locomotor neurons in larval zebrafish couples with its rich repertoire of movements as a vertebrate animal. Current research uses a priori-selected parameters to describe their swimming behavior while our lab has built a parameter-free model based on singular value decomposition analysis to characterize it. Our previous work has analyzed the free swimming of larval zebrafish and presented a different picture from the current classification of larval zebrafish locomotion. Now we are extending this work to the studies of their escape response to acoustic stimulus. Analysis has shown intrinsic difference in the locomotion between escape response and free swimming.

  5. Camouflage and sabotage: tumor escape from the immune system.

    PubMed

    Poschke, Isabel; Mougiakakos, Dimitrios; Kiessling, Rolf

    2011-08-01

    The field of tumor immunology has made great progress in understanding tumor immune interactions. As a consequence a number of immuno-therapeutic approaches have been successfully introduced into the clinic and a large number of promising therapeutic strategies are investigated in ongoing clinical trials. Evaluation of anti-tumor immunity in such trials as well as in animal models has shown that tumor escape from immune recognition and tumor-mediated suppression of anti-tumor immunity can pose a significant obstacle to successful cancer therapy. Here, we review mechanisms of tumor immune escape and immune-subversion with a focus on the research interests in our laboratory: loss of MHC class I on tumor cells, increased oxidative stress, recruitment of myeloid-derived suppressor cells, and regulatory T cells. PMID:21626032

  6. Escape of Mars atmospheric carbon through time by photochemical means

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.; Kim, J.; Nagy, A. F.

    1993-01-01

    Luhmann et al. recently suggested that sputtering of the Martian atmosphere by re-entering O(+) pickup ions could have provided a significant route of escape for CO2 and its products throughout Mars' history. They estimated that the equivalent of C in an approximately 140-mbar CO2 atmosphere should have been lost this way if the Sun and solar wind evolved according to available models. Another source of escaping C (and O) that is potentially important is the dissociative recombination of ionospheric CO(+) near the exobase. We have evaluated the loss rates due to this process for 'ancient' solar EUV radiation fluxes of 1, 3, and 6 times the present flux in order to calculate the possible cumulative loss over the last 3.5 Gyr.

  7. Planetary loss from light ion escape on Venus

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Grebowsky, J. M.

    1995-01-01

    Using Pioneer Venus data, hydrogen and deuterium ions are shown to escape from the hydrogen bulge region in the nightside ionosphere. The polarization electric field propels these light ions upward through the ionosphere and into the ion-exosphere, where H(+) and D(+) continue to be accelerated away from Venus and move into the ionotail and beyond. The vertical flow speeds of H(+) and D(+) are found to be about the same; therefore, selective escape between H(+) and D(+) is negligible for this mechanism. Present day planetary loss rates of about 8.6 x 10(exp 25)/s and 3.2 X 10(exp 23)/s were obtained for H(+) and D(+), respectively. Such rates, persisting over a few billion years, should have significantly affected the planetary water budget.

  8. Escape of Mars atmospheric carbon through time by photochemical means

    NASA Astrophysics Data System (ADS)

    Luhmann, J. G.; Kim, J.; Nagy, A. F.

    Luhmann et al. recently suggested that sputtering of the Martian atmosphere by re-entering O(+) pickup ions could have provided a significant route of escape for CO2 and its products throughout Mars' history. They estimated that the equivalent of C in an approximately 140-mbar CO2 atmosphere should have been lost this way if the Sun and solar wind evolved according to available models. Another source of escaping C (and O) that is potentially important is the dissociative recombination of ionospheric CO(+) near the exobase. We have evaluated the loss rates due to this process for 'ancient' solar EUV radiation fluxes of 1, 3, and 6 times the present flux in order to calculate the possible cumulative loss over the last 3.5 Gyr.

  9. NAMPT inhibition synergizes with NQO1-targeting agents in inducing apoptotic cell death in non-small cell lung cancer cells.

    PubMed

    Liu, Hui-Ying; Li, Qing-Ran; Cheng, Xue-Fang; Wang, Guang-Ji; Hao, Hai-Ping

    2016-08-01

    Nicotinamide phosphoribosyltransferase (NAMPT) catalyzes the first rate-limiting step in converting nicotinamide to NAD(+), essential for a number of enzymes and regulatory proteins involved in a variety of cellular processes, including deacetylation enzyme SIRT1 which modulates several tumor suppressors such as p53 and FOXO. Herein we report that NQO1 substrates Tanshione IIA (TSA) and β-lapachone (β-lap) induced a rapid depletion of NAD(+) pool but adaptively a significant upregulation of NAMPT. NAMPT inhibition by FK866 at a nontoxic dose significantly enhanced NQO1-targeting agent-induced apoptotic cell death. Compared with TSA or β-lap treatment alone, co-treatment with FK866 induced a more dramatic depletion of NAD(+), repression of SIRT1 activity, and thereby the increased accumulation of acetylated FOXO1 and the activation of apoptotic pathway. In conclusion, the results from the present study support that NAMPT inhibition can synergize with NQO1 activation to induce apoptotic cell death, thereby providing a new rationale for the development of combinative therapeutic drugs in combating non-small lung cancer. PMID:27608947

  10. Escaping radio emission from pulsars: Possible role of velocity shear

    SciTech Connect

    Mahajan, S.M. |; Machabeli, G.Z.; Rogava, A.D. |

    1997-01-01

    It is demonstrated that the velocity shear, intrinsic to the e{sup +}e{sup {minus}} plasma present in the pulsar magnetosphere, can efficiently convert the nonescaping longitudinal Langmuir waves (produced by some kind of a beam or stream instability) into propagating (escaping) electromagnetic waves. It is suggested that this shear induced transformation may be the basic mechanism needed for the eventual generation of the observed pulsar radio emission.

  11. Fleeing to refuge: Escape decisions in the race for life.

    PubMed

    Cooper, William E

    2016-10-01

    Economic escape theory that predicts that flight initiation distance (FID=predator-prey distance when a prey begins to flee from an approaching predator) increases as predation risk increases has been overwhelmingly supported. However, the vast majority of empirical tests have focused on effects of single predation risk factors. Even studies that have included multiple risk factors have not predicted how they jointly affect FID. I present a model that predicts joint effects of several predation risk factors that affect the outcome of a race between predator and prey to the prey's refuge. As a prey's distance to refuge and predator attack speed increase, and as the prey's location forces it to flee more toward a predator to reach refuge, FID increases. A published model proposed and experiment showed that FID is longer when prey flee directly toward than directly away from a predator to a refuge. We present a new geometric model that predicts FID for all angles between the prey's and predator's paths to refuge, distance of the prey from refuge when escape begins, predator and prey speeds, and a margin of safety allowing the prey to reach refuge before the predator. The model provides many new, testable predictions about relationships among its variables and FID. Most notably, it predicts that FID increases sigmoidally as the angle between predator and prey paths to refuge increases. Although the model is not economic (cost-benefit), we discuss its relationship to economic escape theory. PMID:27343624

  12. A Treatment Package without Escape Extinction to Address Food Selectivity.

    PubMed

    Weber, Jessica; Gutierrez, Anibal

    2015-01-01

    Feeding difficulties and feeding disorders are a commonly occurring problem for young children, particularly children with developmental delays including autism. Behavior analytic interventions for the treatment of feeding difficulties oftentimes include escape extinction as a primary component of treatment. The use of escape extinction, while effective, may be problematic as it is also associated with the emergence of challenging behavior (e.g., extinction burst). Such challenging behavior may be an acceptable side effect in treatment cases where feeding problems are severe and chronic (e.g., failure to thrive). However, in more acute cases (e.g., selective eating), the negative side effect may be unwarranted and undesired. More recent research on the behavioral treatment of food selectivity has begun to evaluate treatments for feeding difficulties that do not include escape extinction (e.g., demand fading, behavioral momentum), with some success. However, research to date reveals individual differences in responsiveness to such treatments and no clear preferable treatment has emerged. This manuscript describes a multi-component treatment package that includes shaping, sequential presentation and simultaneous presentation, for the treatment of food selectivity in four young children with developmental delays. This treatment package extends the literature on the behavioral treatment for food selectivity and offers a multi-component treatment protocol that may be clinically applicable across a range of treatment scenarios and settings. PMID:26325108

  13. Changes in escape fire occurrence rate under climate change

    NASA Astrophysics Data System (ADS)

    Wotton, B. M.; Gowman, L.

    2009-04-01

    There has been considerable study of the general impacts of climate change on the circumpolar boreal forest, and in particular on potential changes in the level of forest fire activity. Recent studies have shown that overall fire occurrence (from both human and lightning causes) is expected to increase across the boreal forest in Canada (and in many other regions of the world) under the changed fire weather expected to accompany climate change over the 21st Century. In terms of fire on a managed forest landscape, it is not so much the total number of fires occurring but that very small number of fires that escape initial attack that have the greatest impact in terms of area burned or loss of values. We developed models of the probability of fire occurrences escaping initial attack based on weather-based outputs of the Canadian FWI System and general fire cause type. Using these with outputs from recent GCM scenarios from the Hadley and Canadian Climate Centre we find an overall increase in expected fire escapes as well across the forested region of Canada. Increases in some areas can be higher that the increases expected in total number of fires. Assumptions going into this analysis are that fire management agency effort in terms of response time and suppression resource levels remains constant over time.

  14. Transitions between three swimming gaits in Paramecium escape.

    PubMed

    Hamel, Amandine; Fisch, Cathy; Combettes, Laurent; Dupuis-Williams, Pascale; Baroud, Charles N

    2011-05-01

    Paramecium and other protists are able to swim at velocities reaching several times their body size per second by beating their cilia in an organized fashion. The cilia beat in an asymmetric stroke, which breaks the time reversal symmetry of small scale flows. Here we show that Paramecium uses three different swimming gaits to escape from an aggression, applied in the form of a focused laser heating. For a weak aggression, normal swimming is sufficient and produces a steady swimming velocity. As the heating amplitude is increased, a higher acceleration and faster swimming are achieved through synchronized beating of the cilia, which begin by producing oscillating swimming velocities and later give way to the usual gait. Finally, escape from a life-threatening aggression is achieved by a "jumping" gait, which does not rely on the cilia but is achieved through the explosive release of a group of trichocysts in the direction of the hot spot. Measurements through high-speed video explain the role of trichocysts in defending against aggressions while showing unexpected transitions in the swimming of microorganisms. These measurements also demonstrate that Paramecium optimizes its escape pattern by taking advantage of its inertia. PMID:21464291

  15. Self-assembling dual component nanoparticles with endosomal escape capability.

    PubMed

    Wong, Adelene S M; Mann, Sarah K; Czuba, Ewa; Sahut, Audrey; Liu, Haiyin; Suekama, Tiffany C; Bickerton, Tayla; Johnston, Angus P R; Such, Georgina K

    2015-04-21

    This study reports a novel nanoparticle system with simple and modular one-step assembly, which can respond intelligently to biologically relevant variations in pH. Importantly, these particles also show the ability to induce escape from the endosomal/lysosomal compartments of the cell, which is integral to the design of efficient polymeric delivery systems. The nanoparticles were formed by the nanoprecipitation of pH-responsive poly(2-(diethylamino)ethyl methacrylate) (PDEAEMA) and poly(2-(diethylamino)ethyl methacrylate)-b-poly(ethylene glycol) (PDEAEMA-b-PEG). Rhodamine B octadecyl ester perchlorate was successfully encapsulated within the hydrophobic core of the nanoparticle upon nanoprecipitation into PBS at pH 8. These particles disassembled when the pH was reduced below 6.8 at 37 °C. Cellular experiments showed the successful uptake of the nanoparticles into the endosomal/lysosomal compartments of 3T3 fibroblast cells. The ability to induce escape from the endosomes was demonstrated by the use of calcein, a membrane-impermeable fluorophore. The modular nature of these particles combined with promising endosomal escape capabilities make these dual component PDEAEMA nanoparticles useful for drug and gene delivery applications. PMID:25731820

  16. 46 CFR 108.155 - Restrictions on means of escape utilized.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Restrictions on means of escape utilized. 108.155 Section 108.155 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE... means of escape utilized. A required means of escape may not be a vertical ladder or deck...

  17. Escape Performance Following Exposure to Inescapable Shock: Deficits in Motor Response Maintenance

    ERIC Educational Resources Information Center

    Anisman, Hymie; And Others

    1978-01-01

    A series of 13 experiments employing mice systematically investigated shock-elicited activity in a circular field and escape performance in a shuttle box following exposure to either escapable or inescapable shock. Results show that escape interference induced by inescapable shock may be comfortably interpreted in terms of a decreased tendency for…

  18. 78 FR 13811 - Safety Zone; Underwater Escape Event, Seaport, East River, NY

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-01

    ... Federal Register on November 9, 2011 (76 FR 69614). ] Table 1 1. Merlini Underwater Escape Launch site... SECURITY Coast Guard 33 CFR Part 165 Safety Zone; Underwater Escape Event, Seaport, East River, NY AGENCY... escape artist event and associated pyrotechnics display. During the enforcement period, no person...

  19. Escape Geography--Developing Middle-School Students' Sense of Place.

    ERIC Educational Resources Information Center

    Allen, Rodney F.; Molina, Laurie E. S.

    1992-01-01

    Suggests a social studies unit on escaping geography. Examines escape from dangerous places including an airliner, hotel fire, or war zone or from a social situation such as a boring speech or party. Describes historic escapes such as the Underground Railroad and the Berlin Wall. Lists learning strategies such as awareness of space and cognitive…

  20. 78 FR 54585 - Safety Zone; Escape to Miami Triathlon, Biscayne Bay, Miami, FL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-05

    .... SUPPLEMENTARY INFORMATION: Table of Acronyms DHS Department of Homeland Security FR Federal Register NPRM Notice... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Escape to Miami Triathlon, Biscayne Bay... during the Publix Escape to Miami Triathlon. The Publix Escape to Miami Triathlon is scheduled to...

  1. Apoptotic Cells Initiate Endothelial Cell Sprouting via Electrostatic Signaling

    PubMed Central

    Weihua, Zhang; Tsan, Rachel; Schroit, Alan J.; Fidler, Isaiah J.

    2006-01-01

    Angiogenesis, the development of new blood vessels from preexisting vessels, is crucial to tissue growth, repair, and maintenance. This process begins with the formation of endothelial cell sprouts followed by the proliferation and migration of neighboring endothelial cells along the pre-formed extensions. The initiating event and mechanism of sprouting is not known. We demonstrate that the phenotypic expression of negative-charged membrane surface in apoptotic cells initiates the formation of directional endothelial cell sprouts that extend toward the dying cells by a mechanism that involves endothelial cell membrane hyperpolarization and cytoskeleton reorganization but is independent of diffusible molecules. PMID:16357162

  2. Lunar mission safety and rescue: Escape/rescue analysis and plan

    NASA Technical Reports Server (NTRS)

    1971-01-01

    The results are presented of the technical analysis of escape/rescue/survival situations, crew survival techniques, alternate escape/rescue approaches and vehicles, and the advantages and disadvantages of each for advanced lunar exploration. Candidate escape/rescue guidelines are proposed and elements of a rescue plan developed. The areas of discussions include the following: lunar arrival/departure operations, lunar orbiter operations, lunar surface operations, lunar surface base escape/rescue analysis, lander tug location operations, portable airlock, emergency pressure suit, and the effects of no orbiting lunar station, no lunar surface base, and no foreign lunar orbit/surface operations on the escape/rescue plan.

  3. Potent antitumor efficacy of ST13 for colorectal cancer mediated by oncolytic adenovirus via mitochondrial apoptotic cell death.

    PubMed

    Yang, Min; Cao, Xin; Yu, Ming Can; Gu, Jin Fa; Shen, Zong Hou; Ding, Miao; Yu, De Bing; Zheng, Shu; Liu, Xin yuan

    2008-04-01

    ST13 is a cofactor of heat shock protein 70 (Hsp70). To date, all data since the discovery of ST13 in 1993 until more recent studies in 2007 have proved that ST13 is downregulated in tumors and it was proposed to be a tumor suppressor gene, but no work reported its antitumor effect and apoptotic mechanism. In the work described in this paper, ST13 was inserted into ZD55, an oncolytic adenovirus with the E1B 55-kDa gene deleted, to form ZD55-ST13, which exerts an excellent antitumor effect in vitro and in an animal model of colorectal carcinoma SW620 xenograft. ZD55-ST13 inhibited tumor cells 100-fold more than Ad-ST13 and ZD55-EGFP in vitro. However, ZD55-ST13 showed no damage of normal fibroblast MRC5 cells. In exploring the mechanism of ZD55-ST13 in tumor cell killing, we found that ZD55-ST13-infected SW620 cells formed apoptotic bodies and presented obvious apoptosis phenomena. ZD55-ST13 induced the upregulation of Hsp70, the downregulation of antiapoptotic gene Bcl-2, and the release of cytochrome c. Cytochrome c triggered apoptosis by activating caspase-9 and caspase-3, which cleave the enzyme poly(ADP-ribose) polymerase in ZD55-ST13-infected SW620 cells. In summary, overexpressed ST13 as mediated by oncolytic adenovirus could exert potent antitumor activity via the intrinsic apoptotic pathway and has the potential to become a novel therapeutic for colorectal cancer gene therapy. PMID:18355116

  4. Insolubilization process increases enzyme stability

    NASA Technical Reports Server (NTRS)

    Billingham, J.; Lyn, J.

    1971-01-01

    Enzymes complexed with polymeric matrices contain properties suggesting application to enzyme-controlled reactions. Stability of insolubilized enzyme derivatives is markedly greater than that of soluble enzymes and physical form of insolubilized enzymes is useful in column and batch processes.

  5. In vitro apoptotic and DNA damaging potential of nanobarium oxide

    PubMed Central

    Alarifi, Saud; Ali, Daoud; Al-Bishri, Widad

    2016-01-01

    Barium oxide nanoparticles (BaONPs) are an important industrial compound and are widely used in polymers and paints. In this study, apoptotic and genotoxic effects of BaONPs in mouse embryonic fibroblast (L929) cells were determined by using single-cell gel test. In vitro cytotoxicity assays were performed to assess BaONPs’ toxicity in L929 cells. Mild cytotoxicity was observed in L929 cells due to BaONPs. BaONPs increased lipid peroxidation, catalase, and superoxide dismutase levels and lowered glutathione levels in L929 cells. This was accompanied by concomitant generation of reactive oxygen species and activation of caspase-3 in BaONPs-treated L929 cells. On the other hand, when we exposed L929 cells to BaONPs for 24 and 48 hours (comet assay), there was a duration- and dose-dependent increase in DNA impairment detected in the single-cell gel test. Thus, BaONPs exhibit genotoxic and apoptotic effects in L929 cells, most likely due to initiation of oxidative damage. PMID:26834473

  6. Interaction of Late Apoptotic and Necrotic Cells with Vitronectin

    PubMed Central

    Stepanek, Ondrej; Brdicka, Tomas; Angelisova, Pavla; Horvath, Ondrej; Spicka, Jiri; Stockbauer, Petr; Man, Petr; Horejsi, Vaclav

    2011-01-01

    Background Vitronectin is an abundant plasma glycoprotein identified also as a part of extracellular matrix. Vitronectin is substantially enriched at sites of injured, fibrosing, inflamed, and tumor tissues where it is believed to be involved in wound healing and tissue remodeling. Little is known about the mechanism of vitronectin localization into the damaged tissues. Methodology/Principal Findings 2E12 antibody has been described to bind a subset of late apoptotic cells. Using immunoisolation followed by mass spectrometry, we identified the antigen recognized by 2E12 antibody as vitronectin. Based on flow cytometry, we described that vitronectin binds to the late apoptotic and necrotic cells in cell cultures in vitro as well as in murine thymus and spleen in vivo. Confocal microscopy revealed that vitronectin binds to an intracellular cytoplasmic structure after the membrane rupture. Conclusions/Significance We propose that vitronectin could serve as a marker of membrane disruption in necrosis and apoptosis for flow cytometry analysis. Moreover, we suggest that vitronectin binding to dead cells may represent one of the mechanisms of vitronectin incorporation into the injured tissues. PMID:21573223

  7. A stapled BIM peptide overcomes apoptotic resistance in hematologic cancers

    PubMed Central

    LaBelle, James L.; Katz, Samuel G.; Bird, Gregory H.; Gavathiotis, Evripidis; Stewart, Michelle L.; Lawrence, Chelsea; Fisher, Jill K.; Godes, Marina; Pitter, Kenneth; Kung, Andrew L.; Walensky, Loren D.

    2012-01-01

    Cancer cells subvert the natural balance between cellular life and death, achieving immortality through pathologic enforcement of survival pathways and blockade of cell death mechanisms. Pro-apoptotic BCL-2 family proteins are frequently disarmed in relapsed and refractory cancer through genetic deletion or interaction-based neutralization by overexpressed antiapoptotic proteins, resulting in resistance to chemotherapy and radiation treatments. New pharmacologic strategies are urgently needed to overcome these formidable apoptotic blockades. We harnessed the natural killing activity of BCL-2–interacting mediator of cell death (BIM), which contains one of the most potent BH3 death domains of the BCL-2 protein family, to restore BH3-dependent cell death in resistant hematologic cancers. A hydrocarbon-stapled peptide modeled after the BIM BH3 helix broadly targeted BCL-2 family proteins with high affinity, blocked inhibitory antiapoptotic interactions, directly triggered proapoptotic activity, and induced dose-responsive and BH3 sequence–specific cell death of hematologic cancer cells. The therapeutic potential of stapled BIM BH3 was highlighted by the selective activation of cell death in the aberrant lymphoid infiltrates of mice reconstituted with BIM-deficient bone marrow and in a human AML xenograft model. Thus, we found that broad and multimodal targeting of the BCL-2 family pathway can overcome pathologic barriers to cell death. PMID:22622039

  8. Development of novel cyclic peptides as pro-apoptotic agents.

    PubMed

    Brindisi, Margherita; Maramai, Samuele; Brogi, Simone; Fanigliulo, Emanuela; Butini, Stefania; Guarino, Egeria; Casagni, Alice; Lamponi, Stefania; Bonechi, Claudia; Nathwani, Seema M; Finetti, Federica; Ragonese, Francesco; Arcidiacono, Paola; Campiglia, Pietro; Valenti, Salvatore; Novellino, Ettore; Spaccapelo, Roberta; Morbidelli, Lucia; Zisterer, Daniela M; Williams, Clive D; Donati, Alessandro; Baldari, Cosima; Campiani, Giuseppe; Ulivieri, Cristina; Gemma, Sandra

    2016-07-19

    Our recent finding that paclitaxel behaves as a peptidomimetic of the endogenous protein Nur77 inspired the design of two peptides (PEP1 and PEP2) reproducing the effects of paclitaxel on Bcl-2 and tubulin, proving the peptidomimetic nature of paclitaxel. Starting from these peptide-hits, we herein describe the synthesis and the biological investigation of linear and cyclic peptides structurally related to PEP2. While linear peptides (2a,b, 3a,b, 4, 6a-f) were found inactive in cell-based assays, biological analysis revealed a pro-apoptotic effect for most of the cyclic peptides (5a-g). Cellular permeability of 5a (and also of 2a,b) on HL60 cells was assessed through confocal microscopy analysis. Further cellular studies on a panel of leukemic cell lines (HL60, Jurkat, MEC, EBVB) and solid tumor cell lines (breast cancer MCF-7 cells, human melanoma A375 and 501Mel cells, and murine melanoma B16F1 cells) confirmed the pro-apoptotic effect of the cyclic peptides. Cell cycle analysis revealed that treatment with 5a, 5c, 5d or 5f resulted in an increase in the number of cells in the sub-G0/G1 peak. Direct interaction with tubulin (turbidimetric assay) and with microtubules (immunostaining experiments) was assessed in vitro for the most promising compounds. PMID:27150036

  9. The ENZYME data bank.

    PubMed Central

    Bairoch, A

    1994-01-01

    The ENZYME data bank is a repository of information relative to the nomenclature of enzymes. It is primarily based on the recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (IUBMB) and it contains the following data for each type of characterized enzyme for which an EC (Enzyme Commission) number has been provided: EC number Recommended name Alternative names (if any) Catalytic activity Cofactors (if any) Pointers to the SWISS-PROT protein sequence entrie(s) that correspond to the enzyme (if any) Pointers to human disease(s) associated with a deficiency of the enzyme (if any). PMID:7937072

  10. Allograft tolerance induced by donor apoptotic lymphocytes requires phagocytosis in the recipient

    NASA Technical Reports Server (NTRS)

    Sun, E.; Gao, Y.; Chen, J.; Roberts, A. I.; Wang, X.; Chen, Z.; Shi, Y.

    2004-01-01

    Cell death through apoptosis plays a critical role in regulating cellular homeostasis. Whether the disposal of apoptotic cells through phagocytosis can actively induce immune tolerance in vivo, however, remains controversial. Here, we report in a rat model that without using immunosuppressants, transfusion of apoptotic splenocytes from the donor strain prior to transplant dramatically prolonged survival of heart allografts. Histological analysis verified that rejection signs were significantly ameliorated. Splenocytes from rats transfused with donor apoptotic cells showed a dramatically decreased response to donor lymphocyte stimulation. Most importantly, blockade of phagocytosis in vivo, either with gadolinium chloride to disrupt phagocyte function or with annexin V to block binding of exposed phosphotidylserine to its receptor on phagocytes, abolished the beneficial effect of transfused apoptotic cells on heart allograft survival. Our results demonstrate that donor apoptotic cells promote specific allograft acceptance and that phagocytosis of apoptotic cells in vivo plays a crucial role in maintaining immune tolerance.

  11. Allograft tolerance induced by donor apoptotic lymphocytes requires phagocytosis in the recipient.

    PubMed

    Sun, E; Gao, Y; Chen, J; Roberts, A I; Wang, X; Chen, Z; Shi, Y

    2004-12-01

    Cell death through apoptosis plays a critical role in regulating cellular homeostasis. Whether the disposal of apoptotic cells through phagocytosis can actively induce immune tolerance in vivo, however, remains controversial. Here, we report in a rat model that without using immunosuppressants, transfusion of apoptotic splenocytes from the donor strain prior to transplant dramatically prolonged survival of heart allografts. Histological analysis verified that rejection signs were significantly ameliorated. Splenocytes from rats transfused with donor apoptotic cells showed a dramatically decreased response to donor lymphocyte stimulation. Most importantly, blockade of phagocytosis in vivo, either with gadolinium chloride to disrupt phagocyte function or with annexin V to block binding of exposed phosphotidylserine to its receptor on phagocytes, abolished the beneficial effect of transfused apoptotic cells on heart allograft survival. Our results demonstrate that donor apoptotic cells promote specific allograft acceptance and that phagocytosis of apoptotic cells in vivo plays a crucial role in maintaining immune tolerance. PMID:15375386

  12. Escape erosion and relaxation of craters on Pluto

    NASA Astrophysics Data System (ADS)

    Porter, S.; Zangari, A.; Stern, A.

    2014-07-01

    Pluto and its major satellite Charon will be the most distant objects ever visited when NASA's New Horizons spacecraft flies past them in mid-2015. Both bodies should have suffered impacts from other transneptunian objects, though those impacts are of much lower velocity than typical on giant-planet satellites. New Horizons will image the illuminated hemispheres of Pluto and Charon seen at closest approach at better than 0.5 km/pix and 1.0 km/pix, respectively. We compare new different predictions of the impactor population on Pluto and Charon, including the effects of escape erosion from Pluto, and examine the crater size distributions those impactors would produce over the range observable to the imagers on New Horizons. The impact distribution models diverge the most for craters smaller than 10 km. We expect the crater size distribution on Charon to be determined by the impactor distribution and the rheology of the surface. Inverting the Charon size distribution seen by New Horizons will then constrain the overall size frequency distribution in the Kuiper belt, and the location of any break in that size frequency distribution. However, owing to escape erosion, craters on Pluto may be much more modified than on Charon. To constrain this modification, we present a range of possible Pluto crater distributions, as a function of impactor distribution, atmospheric escape rate, and surface ice viscosity. Pluto's atmosphere is primarily made of molecular nitrogen and is currently escaping at between 10^{27} and 10^{28} N_2/s according to model estimates. To sustain these escape rates for 3.5 billion years, a global layer of N_2 ice 0.3 to 3 km thick would need to have sublimated from the surface. We show that this gradual mass loss could have erased many of the smaller craters on Pluto, especially craters with diameters smaller than 10 km. This sublimation erosion process does not occur on Charon, which has a water ice surface and no observed atmosphere. We also show

  13. Containing the accidental laboratory escape of potential pandemic influenza viruses

    PubMed Central

    2013-01-01

    Background The recent work on the modified H5N1 has stirred an intense debate on the risk associated with the accidental release from biosafety laboratory of potential pandemic pathogens. Here, we assess the risk that the accidental escape of a novel transmissible influenza strain would not be contained in the local community. Methods We develop here a detailed agent-based model that specifically considers laboratory workers and their contacts in microsimulations of the epidemic onset. We consider the following non-pharmaceutical interventions: isolation of the laboratory, laboratory workers’ household quarantine, contact tracing of cases and subsequent household quarantine of identified secondary cases, and school and workplace closure both preventive and reactive. Results Model simulations suggest that there is a non-negligible probability (5% to 15%), strongly dependent on reproduction number and probability of developing clinical symptoms, that the escape event is not detected at all. We find that the containment depends on the timely implementation of non-pharmaceutical interventions and contact tracing and it may be effective (>90% probability per event) only for pathogens with moderate transmissibility (reproductive number no larger than R0 = 1.5). Containment depends on population density and structure as well, with a probability of giving rise to a global event that is three to five times lower in rural areas. Conclusions Results suggest that controllability of escape events is not guaranteed and, given the rapid increase of biosafety laboratories worldwide, this poses a serious threat to human health. Our findings may be relevant to policy makers when designing adequate preparedness plans and may have important implications for determining the location of new biosafety laboratories worldwide. PMID:24283203

  14. The production and escape of nitrogen atoms on Mars

    NASA Technical Reports Server (NTRS)

    Fox, J. L.

    1992-01-01

    The lack of agreement between our previously computed values and those measured by Viking of the N-15:N-14 isotope enhancement ratio has led us to reevaluate our model of the Martian ionosphere. In previous models, we were unable to reproduce the ion profiles measured by the RPA on Viking using electron temperatures that were higher that the ion temperatures. When we increased the electron temperatures to 2500-3000 K and with a zero flux upper boundary condition, the ion densities at high altitudes exceeded the measured values by a large factor. We found that we can better fit the observed profiles if we impose a loss process at the upper boundary of our model. If the horizontal fluxes of ions do not constitute a net loss of ions, then the escape of N due to dissociative recombination is also inhibited and better agreement with the measured isotope ratio is found. The production of escaping nitrogen atoms is closely related to the production of thermospheric odd nitrogen; therefore, the densities of NO measured by Viking provide a convenient check on our nitrogen escape model. Our standard model NO densities are less that the measured values by a factor of 2-3, as are those of previous models. We find that reasonable agreement can be obtained by assuming that the rate coefficient for loss of odd nitrogen in the reaction of N with NO is smaller at temperatures that prevail in the lower Martian thermosphere than the standard value, which applies to temperatures of 200-400 K. Other aspects of this investigation are presented.

  15. Thimerosal induces apoptotic and fibrotic changes to kidney epithelial cells in vitro.

    PubMed

    Carneiro, Maria Fernanda Hornos; Morais, Christudas; Small, David M; Vesey, David A; Barbosa, Fernando; Gobe, Glenda C

    2015-12-01

    Thimerosal is an ethyl mercury-containing compound used mainly in vaccines as a bactericide. Although the kidney is a key target for mercury toxicity, thimerosal nephrotoxicity has not received the same attention as other mercury species. The aim of this study was to determine the potential cytotoxic mechanisms of thimerosal on human kidney cells. Human kidney proximal tubular epithelial (HK2) cells were exposed for 24 h to thimerosal (0-2 µM), and assessed for cell viability, apoptosis, and cell proliferation; expression of proteins Bax, nuclear factor-κB subunits, and transforming growth factor-β1 (TGFβ1); mitochondrial health (JC-1, MitoTracker Red CMXRos); and fibronectin levels (enzyme-linked immunosorbent assay). Thimerosal diminished HK2 cell viability and mitosis, promoted apoptosis, impaired the mitochondrial permeability transition, enhanced Bax and TGFβ1 expression, and augmented fibronectin secretion. This is the first report about kidney cell death and pro-fibrotic mechanisms promoted by thimerosal. Collectively, these in vitro results demonstrate that (1) thimerosal induces kidney epithelial cell apoptosis via upregulating Bax and the mitochondrial apoptotic pathway, and (2) thimerosal is a potential pro-fibrotic agent in human kidney cells. We suggest that new evidence on toxicity as well as continuous surveillance in terms of fibrogenesis is required concerning thimerosal use. PMID:24942245

  16. Pre-B-cell colony-enhancing factor protects against apoptotic neuronal death and mitochondrial damage in ischemia.

    PubMed

    Wang, Xiaowan; Li, Hailong; Ding, Shinghua

    2016-01-01

    We previously demonstrated that Pre-B-cell colony-enhancing factor (PBEF), also known as nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in mammalian NAD(+) biosynthesis pathway, plays a brain and neuronal protective role in ischemic stroke. In this study, we further investigated the mechanism of its neuroprotective effect after ischemia in the primary cultured mouse cortical neurons. Using apoptotic cell death assay, fluorescent imaging, molecular biology, mitochondrial biogenesis measurements and Western blotting analysis, our results show that the overexpression of PBEF in neurons can significantly promote neuronal survival, reduce the translocation of apoptosis inducing factor (AIF) from mitochondria to nuclei and inhibit the activation of capase-3 after glutamate-induced excitotoxicity. We further found that the overexpression of PBEF can suppress glutamate-induced mitochondrial fragmentation, the loss of mitochondrial DNA (mtDNA) content and the reduction of PGC-1 and NRF-1 expressions. Furthermore, these beneficial effects by PBEF are dependent on its enzymatic activity of NAD(+) synthesis. In summary, our study demonstrated that PBEF ameliorates ischemia-induced neuronal death through inhibiting caspase-dependent and independent apoptotic signaling pathways and suppressing mitochondrial damage and dysfunction. Our study provides novel insights into the mechanisms underlying the neuroprotective effect of PBEF, and helps to identify potential targets for ischemic stroke therapy. PMID:27576732

  17. Tuberin and PRAS40 are anti-apoptotic gatekeepers during early human amniotic fluid stem-cell differentiation.

    PubMed

    Fuchs, Christiane; Rosner, Margit; Dolznig, Helmut; Mikula, Mario; Kramer, Nina; Hengstschläger, Markus

    2012-03-01

    Embryoid bodies (EBs) are three-dimensional multicellular aggregates allowing the in vitro investigation of stem-cell differentiation processes mimicking early embryogenesis. Human amniotic fluid stem (AFS) cells harbor high proliferation potential, do not raise the ethical issues of embryonic stem cells, have a lower risk for tumor development, do not need exogenic induction of pluripotency and are chromosomal stable. Starting from a single human AFS cell, EBs can be formed accompanied by the differentiation into cells of all three embryonic germ layers. Here, we report that siRNA-mediated knockdown of the endogenous tuberous sclerosis complex-2 (TSC2) gene product tuberin or of proline-rich Akt substrate of 40 kDa (PRAS40), the two major negative regulators of mammalian target of rapamycin (mTOR), leads to massive apoptotic cell death during EB development of human AFS cells without affecting the endodermal, mesodermal and ectodermal cell differentiation spectrum. Co-knockdown of endogenous mTOR demonstrated these effects to be mTOR-dependent. Our findings prove this enzyme cascade to be an essential anti-apoptotic gatekeeper of stem-cell differentiation during EB formation. These data allow new insights into the regulation of early stem-cell maintenance and differentiation and identify a new role of the tumor suppressor tuberin and the oncogenic protein PRAS40 with the relevance for a more detailed understanding of the pathogenesis of diseases associated with altered activities of these gene products. PMID:22090422

  18. Atorvastatin induced hepatic oxidative stress and apoptotic damage via MAPKs, mitochondria, calpain and caspase12 dependent pathways.

    PubMed

    Pal, Sankhadeep; Ghosh, Manoranjan; Ghosh, Shatadal; Bhattacharyya, Sudip; Sil, Parames C

    2015-09-01

    Atorvastatin (ATO), a 3-hydroxy-3-methylglutaryl-CoA reductase inhibitor, is used widely for the treatment of hypercholesterolemia and hypertriglyceridemia. Application of this drug has now been made somehow limited because of ATO associated several acute and chronic side effects. The present study has been carried out to investigate the dose-dependent hepatic tissue toxicity in ATO induced oxidative impairment and cell death in mice. Administration of ATO enhanced ALT, ALP level, increased reactive oxygen species (ROS) production and altered the pro oxidant-antioxidant status of liver by reducing intracellular GSH level, anti-oxidant enzymes activities and increasing intracellular lipid peroxidation. Our experimental evidence suggests that ATO markedly decreased mitochondrial membrane potential, disturbed the Bcl-2 family protein balance, enhanced cytochrome c release in the cytosol, increased the levels of Apaf1, caspase-9, -3, cleaved PARP protein and ultimately led to apoptotic cell death. Besides, ATO distinctly increased the phosphorylation of p38, JNK, and ERK MAPKs, enhanced Caspase12 and calpain level. Histological studies also support the dose-dependent toxic effect of ATO in these organs pathophysiology. These results reveal that ATO induces hepatic tissue toxicity via MAPKs, mitochondria and ER dependent signaling pathway, in which calcium ions and ROS act as the pivotal mediators of the apoptotic signaling. PMID:26051349

  19. PKC{eta} confers protection against apoptosis by inhibiting the pro-apoptotic JNK activity in MCF-7 cells

    SciTech Connect

    Rotem-Dai, Noa; Oberkovitz, Galia; Abu-Ghanem, Sara; Livneh, Etta

    2009-09-10

    Apoptosis is frequently regulated by different protein kinases including protein kinase C family enzymes. Both inhibitory and stimulatory effects were demonstrated for several of the different PKC isoforms. Here we show that the novel PKC isoform, PKC{eta}, confers protection against apoptosis induced by the DNA damaging agents, UVC irradiation and the anti-cancer drug - Camptothecin, of the breast epithelial adenocarcinoma MCF-7 cells. The induced expression of PKC{eta} in MCF-7 cells, under the control of the tetracycline-responsive promoter, resulted in increased cell survival and inhibition of cleavage of the apoptotic marker PARP-1. Activation of caspase-7 and 9 and the release of cytochrome c were also inhibited by the inducible expression of PKC{eta}. Furthermore, JNK activity, required for apoptosis in MCF-7, as indicated by the inhibition of both caspase-7 cleavage and cytochrome c release from the mitochondria in the presence of the JNK inhibitor SP600125, was also suppressed by PKC{eta} expression. Hence, in contrast to most PKC isoforms enhancing JNK activation, our studies show that PKC{eta} is an anti-apoptotic protein, acting as a negative regulator of JNK activity. Thus, PKC{eta} could represent a target for intervention aimed to reduce resistance to anti-cancer treatments.

  20. Krabbe disease: involvement of connexin43 in the apoptotic effects of sphingolipid psychosine on mouse oligodendrocyte precursors.

    PubMed

    Graziano, A C E; Parenti, R; Avola, R; Cardile, V

    2016-01-01

    Krabbe disease is a genetic demyelinating syndrome characterized by deficiency of the enzyme β-galactosylceramidase, lysosomal psychosine accumulation, and loss of myelin-forming cells. In this study, some apoptotic markers such as apoptotic index (AI), DNA fragmentation, caspase-3, PTEN, Bad, and PI3K were determined in oligodendrocyte precursors from wild type or twitcher mice untreated or treated with psychosine. Twitcher is a natural mouse model of Krabbe disease containing a premature stop codon (W339X) in the β-galactosylceramidase gene. Moreover, a possible involvement of connexin (Cx)43 in cell death of oligodendrocyte precursors induced by psychosine was investigated with the final aim to provide a contribution to the knowledge of the molecular mechanisms and pathophysiological events that occur in Krabbe disease. Connexins are a multigene family of structurally related trans-membrane proteins able to modulate essential cellular processes such as proliferation, differentiation and migration. Among these, Cx43 is the predominant isoform in many cell types, including neural progenitor cells. Our results showed an increase of AI, DNA fragmentation, caspase-3, PTEN, Bad, and Cx43 associated to a decrease of PI3K, pAKT and pBad. Taken together, these findings suggest an involvement of Cx43 in the psychosine-mediated apoptosis of primary oligodendrocyte progenitors from wild type or twitcher mice, used for the first time as cell models in comparison. It could open unexplored perspective also for other demyelinating diseases. PMID:26459425

  1. Pre-B-cell colony-enhancing factor protects against apoptotic neuronal death and mitochondrial damage in ischemia

    PubMed Central

    Wang, Xiaowan; Li, Hailong; Ding, Shinghua

    2016-01-01

    We previously demonstrated that Pre-B-cell colony-enhancing factor (PBEF), also known as nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in mammalian NAD+ biosynthesis pathway, plays a brain and neuronal protective role in ischemic stroke. In this study, we further investigated the mechanism of its neuroprotective effect after ischemia in the primary cultured mouse cortical neurons. Using apoptotic cell death assay, fluorescent imaging, molecular biology, mitochondrial biogenesis measurements and Western blotting analysis, our results show that the overexpression of PBEF in neurons can significantly promote neuronal survival, reduce the translocation of apoptosis inducing factor (AIF) from mitochondria to nuclei and inhibit the activation of capase-3 after glutamate-induced excitotoxicity. We further found that the overexpression of PBEF can suppress glutamate-induced mitochondrial fragmentation, the loss of mitochondrial DNA (mtDNA) content and the reduction of PGC-1 and NRF-1 expressions. Furthermore, these beneficial effects by PBEF are dependent on its enzymatic activity of NAD+ synthesis. In summary, our study demonstrated that PBEF ameliorates ischemia-induced neuronal death through inhibiting caspase-dependent and independent apoptotic signaling pathways and suppressing mitochondrial damage and dysfunction. Our study provides novel insights into the mechanisms underlying the neuroprotective effect of PBEF, and helps to identify potential targets for ischemic stroke therapy. PMID:27576732

  2. Overcoming resistance of targeted EGFR monotherapy by inhibition of STAT3 escape pathway in soft tissue sarcoma

    PubMed Central

    Wang, Xiaochun; Goldstein, David; Crowe, Philip J.; Yang, Mark; Garrett, Kerryn; Zeps, Nikolajs; Yang, Jia-Lin

    2016-01-01

    Although epidermal growth factor receptor (EGFR) is often over-expressed in soft tissue sarcoma (STS), a phase II trial using an EGFR inhibitor gefitinib showed a low response rate. This study identified a new secondary resistance mechanism of gefitinib in STS, and developed new strategies to improve the effectiveness of EGFR inhibition particularly by blocking the STAT3 pathway. We demonstrated that seven STS cell lines of diverse histological origin showed resistance to gefitinib despite blockade of phosphorylated EGFR (pEGFR) and downstream signal transducers (pAKT and pERK) in PI3K/AKT and RAS/ERK pathways. Gefitinib exposure was not associated with decrease in the ratio of pSTAT3/pSTAT1. The relative STAT3 abundance and activation may be responsible for the drug resistance. We therefore hypothesized that the addition of a STAT3 inhibitor could overcome the STAT3 escape pathway. We found that the addition of STAT3 inhibitor S3I-201 to gefitinib achieved synergistic anti-proliferative and pro-apoptotic effects in all three STS cell lines examined. This was confirmed in a fibrosarcoma xenografted mouse model, where the tumours from the combination group (418mm3) were significantly smaller than those from untreated (1032mm3) or single drug (912 and 798mm3) groups. Our findings may have clinical implications for optimising EGFR-targeted therapy in STS. PMID:26909593

  3. Cold Ion Escape from the Martian Ionosphere - 2005-2014

    NASA Astrophysics Data System (ADS)

    Fränz, Markus; Dubinin, Eduard; Andrews, David; Nilsson, Hans; Fedorov, Andrei

    2015-04-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. The ion sensor IMA of this experiment has in principle a low-energy cut-off at 10eV but in negative spacecraft charging cold ions are lifted into the range of measurement but the field of view is restricted to about 4x360 deg. In a recent paper Nilsson et al. (Earth Planets Space, 64, 135, 2012) tried to use the method of long-time averaged distribution functions to overcome these constraints. In this paper we first use the same method to show that we get results consistent with this when using ASPERA-3 observations only. But then we can show that these results are inconsistent with observations of the local plasma density by the MARSIS radar instrument on board Mars Express. We demonstrate that the method of averaged distribution function can deliver the mean flow speed of the plasma but the low-energy cut-off does usually not allow to reconstruct the density. We then combine measurements of the cold ion flow speed with the plasma density observations of MARSIS to derive the cold ion flux. In an analysis of the combined nightside datasets we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 RM the flux settles at a constant value which indicates that about half of the transterminator ionospheric flow escapes from the planet. To derive the mean escape flux we include all combined observations of ASPERA-3 and MARSIS from 2005 to 2014. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  4. The Zonal Satellite Problem. I. Near-Escape Flow

    NASA Astrophysics Data System (ADS)

    Mioc, V.; Stavinschi, M.

    The study of the zonal satellite problem is continued by tackling the situation r-> infty. New equations of motion (for which the infinite distance is a singularity) and the corresponding first integrals of energy and angular momentum are set up. The infinity singularity is blown up via McGehee-type transformations, and the infinity manifold is pasted on the phase space. The fictitious flow on this manifold is described. Then, resorting to the rotational symmetry of the problem and to the angular momentum integral, the near-escape local flow is depicted. The corresponding phase curves are interpreted as physical motions.

  5. Service-Life Extension of Explosive Escape Devices

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Schimmel, M. L.

    1987-01-01

    Chemical and functional tests yield conservative service-life estimates. Approach to extension of service lives of explosive devices in aircraft escape system developed, supported by testing of representative candidate devices to evaluate quantitatively effects of service, age, and degradation, and to enable responsible, conservative service-life determinations. Five types of explosive components evaluated: rigid and flexible explosive transfer lines; one-way transfers; flexible, linear-shaped charges; and initiation-handles. Extension of service in realistic manner provides both cost savings and increased system reliability.

  6. Approximate formula for the escape function for nearly conservative scattering

    NASA Astrophysics Data System (ADS)

    Yanovitskij, E. G.

    2002-02-01

    The escape function u(μ) (i.e., the boundary solution of the Milne problem for a semi-infinite atmosphere) is considered. It is presented in the form u(μ) = u0 (μ ) + √ {1 - λ}u1(μ) + (1-λ)u2(μ) + ldots, where λ is the single-scattering albedo. A rather accurate approximate formula for a the function u0 (μ) is obtained for not highly elongated phase function. An approximate expression for the function u2 (μ) is also derived, it is exact in the case of the most simple anisotropic scattering.

  7. Development of a canine nociceptive thermal escape model.

    PubMed

    Wegner, Kirsten; Horais, Kjersti A; Tozier, Nicolle A; Rathbun, Michael L; Shtaerman, Yuri; Yaksh, Tony L

    2008-02-15

    Acute nociceptive models which have been validated for large animal species are limited, yet nociceptive assessment in non-rodent species is important in analgesic drug development where larger animals may be necessary because of the technical requirements of the study. Here we report development and validation of a canine hind paw thermal escape model and the effect of analgesics on withdrawal latencies. Individual focused projection bulbs were used as left and right voltage-adjusted thermal stimuli placed below a glass plate in a specifically designed canine holding apparatus. After acclimation, dogs were lightly restrained in a fabric sling while standing on the glass plate. The anterior center of the metatarsal pad of the left and right hind paw was positioned on the glass over each light, and duration of stimulation tolerance timed. For every trial, the escape latency from lamp actuation to paw withdrawal was recorded twice for each hind paw. The mean population baseline withdrawal latency of 9.3+/-1.7s (mean+/-S.D., n=12 dogs) was shown to be repeatable between paws, within and between individual animals, and between test days. This latency corresponded to a glass surface temperature of 49.5 degrees C. A cut-off time of 20s (corresponding to a glass surface temperature of 56.5 degrees C) was set to prevent tissue damage. Intravenous administration (mg/kg) of morphine (1.0), hydromorphone (0.2), butorphanol (0.4), fentanyl (0.01), and dexmedetomidine (0.01) significantly (p<0.05) increased withdrawal latency from baseline within 15-30 min of administration while buprenorphine (0.03) produced a delayed, modest but significant latency increase. Rank order of opioid analgesic duration was morphine=hydromorphone>butorphanol>bupenorphine>fentanyl=saline. A dose-effect curve for hydromorphone was generated and corresponded to previously described dose-effect relationships in other species. The non-analgesic tranquilizer acepromazine (0.1mg/kg) produced mild sedation

  8. Enzyme Therapy: Current Perspectives.

    PubMed

    UmaMaheswari, Thiyagamoorthy; Hemalatha, Thiagarajan; Sankaranarayanan, Palavesam; Puvanakrishnan, Rengarajulu

    2016-01-01

    Enzymes control all metabolic processes in human system from simple digestion of food to highly complex immune response. Physiological reactions occuring in healthy individuals are disturbed when enzymes are deficient or absent. Enzymes are administered for normalizing biological function in certain pathologies. Initially, crude proteolytic enzymes were used for the treatment of gastrointestinal disorders. Recent advances have enabled enzyme therapy as a promising tool in the treatment of cardiovascular, oncological and hereditary diseases. Now, a spectrum of other diseases are also covered under enzyme therapy. But, the available information on the use of enzymes as therapeutic agents for different diseases is scanty. This review details the enzymes which have been used to treat various diseases/disorders. PMID:26891548

  9. Persistence of apoptotic cells without autoimmune disease or inflammation in CD14−/− mice

    PubMed Central

    Devitt, Andrew; Parker, Kate G.; Ogden, Carol Anne; Oldreive, Ceri; Clay, Michael F.; Melville, Lynsey A.; Bellamy, Christopher O.; Lacy-Hulbert, Adam; Gangloff, Sophie C.; Goyert, Sanna M.; Gregory, Christopher D.

    2004-01-01

    Interaction of macrophages with apoptotic cells involves multiple steps including recognition, tethering, phagocytosis, and anti-inflammatory macrophage responses. Defective apoptotic cell clearance is associated with pathogenesis of autoimmune disease. CD14 is a surface receptor that functions in vitro in the removal of apoptotic cells by human and murine macrophages, but its mechanism of action has not been defined. Here, we demonstrate that CD14 functions as a macrophage tethering receptor for apoptotic cells. Significantly, CD14−/− macrophages in vivo are defective in clearing apoptotic cells in multiple tissues, suggesting a broad role for CD14 in the clearance process. However, the resultant persistence of apoptotic cells does not lead to inflammation or increased autoantibody production, most likely because, as we show, CD14−/− macrophages retain the ability to generate anti-inflammatory signals in response to apoptotic cells. We conclude that CD14 plays a broad tethering role in apoptotic cell clearance in vivo and that apoptotic cells can persist in the absence of proinflammatory consequences. PMID:15611337

  10. Apoptotic cells are cleared by directional migration and elmo1- dependent macrophage engulfment.

    PubMed

    van Ham, Tjakko J; Kokel, David; Peterson, Randall T

    2012-05-01

    Apoptotic cell death is essential for development and tissue homeostasis. Failure to clear apoptotic cells can ultimately cause inflammation and autoimmunity. Apoptosis has primarily been studied by staining of fixed tissue sections, and a clear understanding of the behavior of apoptotic cells in living tissue has been elusive. Here, we use a newly developed technique to track apoptotic cells in real time as they emerge and are cleared from the zebrafish brain. We find that apoptotic cells are remarkably motile, frequently migrating several cell diameters to the periphery of living tissues. F-actin remodeling occurs in surrounding cells, but also within the apoptotic cells themselves, suggesting a cell-autonomous component of motility. During the first 2 days of development, engulfment is rare, and most apoptotic cells lyse at the brain periphery. By 3 days postfertilization, most cell corpses are rapidly engulfed by macrophages. This engulfment requires the guanine nucleotide exchange factor elmo1. In elmo1-deficient macrophages, engulfment is rare and may occur through macropinocytosis rather than directed engulfment. These findings suggest that clearance of apoptotic cells in living vertebrates is accomplished by the combined actions of apoptotic cell migration and elmo1-dependent macrophage engulfment. PMID:22503503

  11. Peroxiredoxin 6 is a potent cytoprotective enzyme in the epidermis.

    PubMed

    Kümin, Angelika; Huber, Christine; Rülicke, Thomas; Wolf, Eckhard; Werner, Sabine

    2006-10-01

    Peroxiredoxin 6 is an enzyme that detoxifies hydrogen peroxide and various organic peroxides. In previous studies we found strongly increased expression of peroxiredoxin 6 in the hyperproliferative epidermis of wounded and psoriatic skin, suggesting a role of this enzyme in epidermal homeostasis. To address this question, we generated transgenic mice overexpressing peroxiredoxin 6 in the epidermis. Cultured keratinocytes from transgenic mice showed enhanced resistance to the toxicity of various agents that induce oxidative stress. However, overexpression of peroxiredoxin 6 did not affect skin morphogenesis or homeostasis. On skin injury, enhancement of wound closure was observed in aged animals. Most importantly, peroxiredoxin 6 overexpression strongly reduced the number of apoptotic cells after UVA or UVB irradiation. These findings demonstrate that peroxiredoxin 6 protects keratinocytes from cell death induced by reactive oxygen species in vitro and in vivo, suggesting that activation of this enzyme could be a novel strategy for skin protection under stress conditions. PMID:17003478

  12. Developments in Enzyme Technology.

    ERIC Educational Resources Information Center

    Chaplin, M. F.

    1984-01-01

    Enzyme technology has a well-established industrial base, with applications that have survived competition. The most prominent applications of enzymes in biotechnology are examined with an explanation of some theoretical background. Topics include extending an enzyme's useful life, partition and diffusion, industrial uses, and therapeutic uses.…

  13. Myotonic dystrophy protein kinase (DMPK) induces actin cytoskeletal reorganization and apoptotic-like blebbing in lens cells

    NASA Technical Reports Server (NTRS)

    Jin, S.; Shimizu, M.; Balasubramanyam, A.; Epstein, H. F.

    2000-01-01

    DMPK, the product of the DM locus, is a member of the same family of serine-threonine protein kinases as the Rho-associated enzymes. In DM, membrane inclusions accumulate in lens fiber cells producing cataracts. Overexpression of DMPK in cultured lens epithelial cells led to apoptotic-like blebbing of the plasma membrane and reorganization of the actin cytoskeleton. Enzymatically active DMPK was necessary for both effects; inactive mutant DMPK protein did not produce either effect. Active RhoA but not constitutive GDP-state mutant protein produced similar effects as DMPK. The similar actions of DMPK and RhoA suggest that they may function in the same regulatory network. The observed effects of DMPK may be relevant to the removal of membrane organelles during normal lens differentiation and the retention of intracellular membranes in DM lenses. Copyright 2000 Wiley-Liss, Inc.

  14. Involvement of caspase-12-dependent apoptotic pathway in ionic radiocontrast urografin-induced renal tubular cell injury

    SciTech Connect

    Wu, Cheng Tien; Weng, Te I.; Chen, Li Ping; Chiang, Chih Kang; Liu, Shing Hwa

    2013-01-01

    Contrast medium (CM) induces a direct toxic effect on renal tubular cells. This toxic effect subjects in the disorder of CM-induced nephropathy. Our previous work has demonstrated that CM shows to activate the endoplasmic reticulum (ER)-related adaptive unfolding protein response (UPR) activators. Glucose-regulated protein 78 (GRP78)/eukaryotic initiation factor 2α (eIF2α)-related pathways play a protective role during the urografin (an ionic CM)-induced renal tubular injury. However, the involvement of ER stress-related apoptotic signals in the urografin-induced renal tubular cell injury remains unclear. Here, we examined by the in vivo and in vitro experiments to explore whether ER stress-regulated pro-apoptotic activators participate in urografin-induced renal injury. Urografin induced renal tubular dilation, tubular cells detachment, and necrosis in the kidneys of rats. The tubular apoptosis, ER stress-related pro-apoptotic transcriptional factors, and kidney injury marker-1 (kim-1) were also conspicuously up-regulated in urografin-treated rats. Furthermore, treatment of normal rat kidney (NRK)-52E tubular cells with urografin augmented the expressions of activating transcription factor-6 (ATF-6), C/EBP homologous protein (CHOP), Bax, caspase-12, JNK, and inositol-requiring enzyme (IRE) 1 signals. Urografin-induced renal tubular cell apoptosis was not reversed by the inhibitors of ATF-6, JNK signals or CHOP siRNA transfection, but it could be partially reversed by the inhibitor of caspase-12. Taken together, the present results and our previous findings suggest that exposure of CM/urografin activates the ER stress-regulated survival- and apoptosis-related signaling pathways in renal tubular cells. Caspase-12-dependent apoptotic pathway may be partially involved in the urografin-induced nephropathy. -- Highlights: ► Ionic contrast medium-urografin induces renal tubular cell apoptosis. ► Urografin induces the ER stress-regulated survival and apoptosis

  15. Numerical simulation of a self-propelled copepod during escape

    NASA Astrophysics Data System (ADS)

    Sotiropoulos, Fotis; Borazjani, Iman; Malkiel, Edwin; Katz, Josef

    2008-11-01

    Obtaining the 3D flow field, forces, and power is essential for understanding the high accelerations of a copepod during the escap. We carry out numerical simulations to study a free swimming copepod using the sharp-interface immersed boundary, fluid-structure interaction (FSI) approach of Borazjani et al. (J Compu Phys, 2008, 227, p 7587-7620). We use our previous tethered copepod model with a realistic copepod-like body, including all the appendages with the appendages motion prescribed from high-resolution, cinematic dual digital holography. The simulations are performed in a frame of reference attached to the copepod whose velocity is calculated by considering the forces acting on the copepod. The self-propelled simulations are challenging due to the destabilizing effects of the large added mass resulting from the low copepod mass and fast acceleration during the escape. Strongly-coupled FSI with under-relaxation and the Aitken acceleration technique is used to obtain stable and robust FSI iterations. The computed results for the self-propelled model are analyzed and compared with our earlier results for the tethered model.

  16. Pair interaction of catalytically active colloids: from assembly to escape

    NASA Astrophysics Data System (ADS)

    Sharifi-Mood, Nima; Mozaffari, Ali; Córdova-Figueroa, Ubaldo M.

    2016-07-01

    The dynamics and pair trajectory of two self-propelled colloids are reported. The autonomous motions of the colloids are due to a catalytic chemical reaction taking place asymmetrically on their surfaces that generates a concentration gradient of interactive solutes around the particles and actuate particle propulsion. We consider two spherical particles with symmetric catalytic caps extending over the local polar angles $\\theta^1_{cap}$ and $\\theta^2_{cap}$ from the centers of active sectors in an otherwise quiescent fluid. A combined analytical-numerical technique was developed to solve the coupled mass transfer equation and the hydrodynamics in the Stokes flow regime. The ensuing pair trajectory of the colloids is controlled by the reacting coverages $\\theta^j_{cap}$ and their initial relative orientation with respect to each other. Our analysis indicates two possible scenarios for pair trajectories of catalytic self-propelled particles: either the particles approach, come into contact and assemble or they interact and move away from each other (escape). For arbitrary motions of the colloids, it is found that the direction of particle rotations is the key factor in determining the escape or assembly scenario. Based on the analysis, a phase diagram is sketched for the pair trajectory of the catalytically active particles as a function of active coverages and their initial relative orientations. We believe this study has important implications in elucidation of collective behaviors of auotophoretically self-propelled colloids.

  17. FEM analysis of escape capsule suffered to gas explosion

    NASA Astrophysics Data System (ADS)

    Li, Chang-lu; Mei, Rui-bin; Li, Chang-sheng; Cai, Ban; Liu, Xiang-hua

    2013-05-01

    Escape capsules are new devices for underground coal mines that provide air, water, food and supplies in the event of an emergency in where miners are unable to escape. It is difficult to carry out the experiments of explosion and safety because the danger and nonrepeatability of explosion. The structure deformation and distribution of equivalent stress has been investigated under different impact pressure conditions including unimodal and bimodal loads based on the FEM and software LS-DYNA. The results show that the distribution of deformation and equivalent stress has the same trend on the same surface with the increment of explosion pressure. The deformation and stress are larger with side impact pressure compared with that of the same front impact pressure. Furthermore, the maximum equivalent stress is 246MPa and 260MPa on the front and sides of capsule with five times for national standard impact pressure 1.5MPa. Under these conditions, the deformation is less than about 9.97mm and 10.47mm, respectively. When the front impact pressure is 2.0MPa, the deformation of capsule still belongs to elasticity but the less plastic deformation occurs on the Ushape stiffening channels with the same side impact pressure. However, it is safe for capsule structure because the equivalent stress 283MPa is much less than the tensile strength. It is noted that bimodal load accelerates the capsule deformation so that it is more dangerous compared with unimodal load.

  18. Trapped subsurface oil plumes and critical escape phenomena

    NASA Astrophysics Data System (ADS)

    Tzou, Chung-Nan; Camassa, Roberto; Lin, Zhi; McLaughlin, Rich; Mertens, Keith; White, Brian

    2012-11-01

    A critical phenomenon concerning the escape/trap of buoyant miscible plumes rising through strongly stratified fluids is presented experimentally and theoretically. The criticality is determined by the distance between plume release height and depth of ambient density transition. For fluid released closer to the background density transition than this critical distance, the buoyant fluid escapes and rises indefinitely. For fluid released further than this critical distance, the buoyant fluid is forever trapped within the fluid. Two new mathematically exact formulas will be presented for the cases of linear and sharp ambient stratification and they show quantitative agreement with experiments. The new solution for linear stratification is analyzed in the limit of vanishing transition layer thickness. The analytic solution for sharp stratification is shown to accurately estimate the depth at which subsurface plumes trapped during the Deepwater Horizon oil disaster. Also, a dimensional analysis argument is presented which captures the essential physics to provide a simple understanding of this phenomenon. We gratefully acknowledge support from NSF CMG ARC-1025523, NSF RAPID CBET-1045653, NSF DMS-1009750 and NSF RTG DMS-0943851.

  19. Viral resistance evolution fully escapes a rationally designed lethal inhibitor.

    PubMed

    Keller, Thomas E; Molineux, Ian J; Bull, James J

    2009-09-01

    Viruses are notoriously capable of evolving resistance to drugs. However, if the endpoint of resistance evolution is only partial escape, a feasible strategy should be to stack drugs, so the combined effect of partial inhibition by several drugs results in net inhibition. Assessing the feasibility of this approach requires quantitative data on viral fitness before and after evolution of resistance to a drug, as done here with bacteriophage T7. An inhibitory gene expressed from a phage promoter aborts wild-type T7 infections. The effect is so severe that the phage population declines when exposed to the inhibitor but expands a billion-fold per hour in its absence. In prior work, T7 evolved modest resistance to this inhibitor, an expected result. Given the nature of the inhibitor, that it used the phage's own promoter to target the phage's destruction, we anticipated that resistance evolution would be limited as the phage may need to evolve a new regulatory system, with simultaneous changes in its RNA polymerase (RNAP) and many of its promoters to fully escape inhibition. We show here that further adaptation of the partially resistant phage led to complete resistance. Resistance evolution was due to three mutations in the RNAP gene and two other genes; unexpectedly, no changes were observed in promoters. Consideration of other mechanisms of T7 inhibition leaves hope that permanent inhibition of viral growth with drugs can in principle be achieved. PMID:19494036

  20. Quantification of Nociceptive Escape Response in C.elegans

    NASA Astrophysics Data System (ADS)

    Leung, Kawai; Mohammadi, Aylia; Ryu, William; Nemenman, Ilya

    2013-03-01

    Animals cannot rank and communicate their pain consciously. Thus in pain studies on animal models, one must infer the pain level from high precision experimental characterization of behavior. This is not trivial since behaviors are very complex and multidimensional. Here we explore the feasibility of C.elegans as a model for pain transduction. The nematode has a robust neurally mediated noxious escape response, which we show to be partially decoupled from other sensory behaviors. We develop a nociceptive behavioral response assay that allows us to apply controlled levels of pain by locally heating worms with an IR laser. The worms' motions are captured by machine vision programming with high spatiotemporal resolution. The resulting behavioral quantification allows us to build a statistical model for inference of the experienced pain level from the behavioral response. Based on the measured nociceptive escape of over 400 worms, we conclude that none of the simple characteristics of the response are reliable indicators of the laser pulse strength. Nonetheless, a more reliable statistical inference of the pain stimulus level from the measured behavior is possible based on a complexity-controlled regression model that takes into account the entire worm behavioral output. This work was partially supported by NSF grant No. IOS/1208126 and HFSP grant No. RGY0084/2011.

  1. Tectonic escape in the evolution of the continental crust

    NASA Technical Reports Server (NTRS)

    Burke, K.; Sengor, C.

    1986-01-01

    The continental crust originated by processes similar to those operating today and continents consist of material most of which originated long ago in arc-systems that have later been modified, especially at Andean margins and in continental collisions where crustal thickening is common. Collision-related strike-slip motion is a general process in continental evolution. Because buoyant continental (or arc) material generally moves during collision toward a nearby oceanic margin where less buoyant lithosphere crops out, the process of major strike-slip dominated motion toward a 'free-face' is called 'tectonic escape'. Tectonic escape is and has been an element in continental evolution throughout recorded earth-history. It promotes: (1) rifting and the formation of rift-basins with thinning of thickened crust; (2) pervasive strike-slip faulting late in orogenic history which breaks up mountain belts across strike and may juxtapose unrelated sectors in cross-section; (3) localized compressional mountains and related foreland-trough basins.

  2. Group chase and escape model with chasers' interaction

    NASA Astrophysics Data System (ADS)

    Saito, Takuya; Nakamura, Tomomichi; Ohira, Toru

    2016-04-01

    Group chase and escape is a new direction of studying collective behaviors merged with the traditional mathematical problems of chases and escapes proposed by Kamimura and Ohira in 2010. In their model, the chasers recognize only the escapees and pursue the nearest neighbor escapee, and the escapees recognize only the chasers and flee from the nearest neighbor chaser. We call the basic moving rule the nearest opponent interaction (NOI) strategy. In this paper we introduce a new strategy in the model. It is a local interaction that the chasers do not get too close each other, where we call the chasers' local interaction (CLI) strategy. The result of comparisons of the two strategies shows that when the number of the chasers is relatively small compared to the number of the escapees, the trapping time by the CLI strategy is much shorter than that by the NOI strategy. On the other hand, when the number of the chasers is larger than that of the escapees, this advantage of the CLI strategy does not appear. Also, we find that although chasers form clusters (spatial aggregates of chasers) when we apply the NOI strategy, the clusters appear less when we apply the CLI strategy.

  3. Magnetic buoyancy and the escape of magnetic fields from stars

    NASA Technical Reports Server (NTRS)

    Parker, E. N.

    1984-01-01

    A loss of magnetic flux through the free surface of a star into the surrounding space has important implications for the generation of the field within the star. The present investigation is concerned with the physics of the escape of net azimuthal flux from a star. The obtained results are used as a basis for the interpretation of some recent observations of the detailed behavior of magnetic fields emerging through the surface of the sun. The buoyancy of an isolated horizontal magnetic flux tube beneath the surface of a star causes the tube to rise at a rate comparable to the Alfven speed. The necessary conditions for escape of the flux are considered along with aspects of magnetic buoyancy, and the conditions on the sun. It appears that the observed retraction of bipolar magnetic fields at the end of their life at the surface is the one phenomenon which requires dynamical intervention. Attention is given to known dynamical effects which suppress the buoyant rise of an azimuthal magnetic field.

  4. The C. elegans touch response facilitates escape from predacious fungi.

    PubMed

    Maguire, Sean M; Clark, Christopher M; Nunnari, John; Pirri, Jennifer K; Alkema, Mark J

    2011-08-01

    Predator-prey interactions are vital determinants in the natural selection of behavioral traits. Gentle touch to the anterior half of the body of Caenorhabditis elegans elicits an escape response in which the animal quickly reverses and suppresses exploratory head movements [1, 2]. Here, we investigate the ecological significance of the touch response in predator-prey interactions between C. elegans and predacious fungi that catch nematodes using constricting hyphal rings. We show that the constricting rings of Drechslerella doedycoides catch early larval stages with a diameter similar to the trap opening. There is a delay between the ring entry and ring closure, which allows the animal to withdraw from the trap before being caught. Mutants that fail to suppress head movements in response to touch are caught more efficiently than the wild-type. This demonstrates that the coordination of motor programs allows C. elegans to smoothly retract from a fungal noose and evade capture. Our results suggest that selective pressures imposed by predacious fungi have shaped the evolution of C. elegans escape behavior. PMID:21802299

  5. Ultra-fast Escape of a Octopus-inspired Rocket

    NASA Astrophysics Data System (ADS)

    Weymouth, Gabriel; Triantafyllou, Michael

    2013-11-01

    The octopus, squid, and other cephalopods inflate with water and then release a jet to accelerate in the opposite direction. This escape mechanism is particularly interesting in the octopus because they become initially quite bluff, yet this does not hinder them in achieving impressive bursts of speed. We examine this somewhat paradoxical maneuver using a simple deflating spheroid model in both potential and viscous flow. We demonstrate that the dynamic reduction of the width of the body completely changes the flow and forces acting on the escaping rocket in three ways. First, a body which reduces in size can generate an added mass thrust which counteracts the added mass inertia. Second, the motion of the shrinking wall acts similar to suction on a static wall, reducing separation and drag forces in a viscous fluid, but that this effects depends on the rate of size change. Third, using a combination of these two features it is possible to initially load the fluid with kinetic energy when heavy and bluff and then recover that energy when streamlined and light, enabling ultra-fast accelerations. As a notable example, these mechanisms allow a shrinking spheroid rocket in a heavy inviscid fluid to achieve speeds greater than an identical rocket in the vacuum of space. Southampton Marine and Maritime Institute.

  6. Autoimmunity as a result of escape from RNA surveillance.

    PubMed

    Bachmann, Michael P; Bartsch, Holger; Gross, Joanne K; Maier, Shannon M; Gross, Timothy F; Workman, Jennifer L; James, Judith A; Farris, A Darise; Jung, Bettina; Franke, Claudia; Conrad, Karsten; Schmitz, Marc; Büttner, Cordula; Buyon, Jill P; Semsei, Imre; Harley, John B; Rieber, E Peter

    2006-08-01

    In previous studies, we detected a frame shift mutation in the gene encoding the autoantigen La of a patient with systemic lupus erythematosus. The mutant La mRNA contains a premature termination codon. mRNAs that prematurely terminate translation should be eliminated by RNA quality control mechanisms. As we find Abs specific for the mutant La form in approximately 30% of sera from anti-La-positive patients, we expected that mutant La mRNAs circumvent RNA control and the expression of mutant La protein could become harmful. Indeed, real-time PCR, immunostaining, and immunoblotting data of mice transgenic for the mutant La form show that mutant La mRNAs are not repressed in these animals and are translated to mutant La protein. In addition to the mutant La protein, we detected a minor portion of native human La in the mutant La-transgenic mice. Therefore, ribosomal frame shifting may allow the mutant La mRNA to escape from RNA control. Interestingly, expression of the mutant La mRNA results in a lupus-like disease in the experimental mice. Consequently, escape of mutant La mRNA from RNA control can have two effects: it 1) results in the expression of an immunogenic (neo)epitope, and 2) predisposes to autoimmunity. PMID:16849479

  7. Autoimmunity as a Result of Escape from RNA Surveillance

    PubMed Central

    Bachmann, Michael P.; Bartsch, Holger; Gross, Joanne K.; Maier, Shannon M.; Gross, Timothy F.; Workman, Jennifer L.; James, Judith A.; Farris, A. Darise; Jung, Bettina; Franke, Claudia; Conrad, Karsten; Schmitz, Marc; Büttner, Cordula; Buyon, Jill P.; Semsei, Imre; Harley, John B.; Rieber, E. Peter

    2006-01-01

    In previous studies we detected a frame shift mutation in the gene encoding the autoantigen La of a patient with systemic lupus erythematosus. The mutant La mRNA contains a premature termination codon. mRNAs that prematurely terminate translation should be eliminated by RNA quality control mechanisms. As we find Abs specific for the mutant La form in about 30% of sera from anti-La positive patients we expected that mutant La mRNAs circumvent RNA control and the expression of mutant La protein could become harmful. Indeed, realtime PCR, immunostaining, and immunoblotting data of mice transgenic for the mutant La form show that mutant La mRNAs are not repressed in these animals and are translated to mutant La protein. In addition to the mutant La protein, we detected a minor portion of native human La in the mutant La transgenic mice. Therefore, ribosomal frame shifting may allow the mutant La mRNA to escape from RNA control. Interestingly, expression of the mutant La mRNA results in a lupus like disease in the experimental mice. Consequently, escape of mutant La mRNA from RNA control can have two effects: It (i) results in the expression of an immunogenic (neo)epitope, and (ii) predisposes to autoimmunity. PMID:16849479

  8. Escape of a mesoscopic particle from a modulated optical trap

    NASA Astrophysics Data System (ADS)

    Kruse, J. R.; Dykman, M. I.; Golding, B.

    2003-03-01

    We describe experiments on noise-induced escape of a mesoscopic particle from a bistable potential well. The potential is created by the interaction of two focused laser beams with a glass sphere of diameter ˜ 1 μm. The trapping potential is mapped quantitatively in 3-dimensions by a statistical method [1]. The dynamics of the particle can be varied from highly overdamped to underdamped by tuning the density of the surrounding environment. The eigenfrequencies of the trapped particle, as well as over-barrier transition rates W, have been directly measured as a function of damping. When the potential is modulated, the escape probability of the particle over the potential barrier becomes synchronized with the driving field. At large modulation amplitude, we find that the system approaches a saddle-node bifurcation. We have measured the critical exponent that describes the amplitude dependence of ln W as the bifurcation point is approached. By varying the modulation frequency, it is possible to probe the non-adiabatic region where the critical exponent has been predicted to change, with results in agreement with theory and numerical simulations. [1] L.I. McCann, M.I. Dykman, and B. Golding, Nature 402, 785 (1999).

  9. Cholesterol biosynthesis and the pro-apoptotic effects of the p75 nerve growth factor receptor in PC12 pheochromocytoma cells.

    PubMed

    Yan, Chaohua; Mirnics, Zeljka Korade; Portugal, Carmel F; Liang, Ye; Nylander, Karen D; Rudzinski, Marcelo; Zaccaro, Clara; Saragovi, H Uri; Schor, Nina Felice

    2005-10-01

    Neocarzinostatin (NCS), an enediyne antimitotic agent, induces cell death in both p75NTR neurotrophin receptor (NTR)-positive and p75NTR-negative PC12 cells in a concentration-dependent fashion. However, p75NTR-positive cells demonstrate a higher susceptibility to NCS-induced cell damage. Furthermore, treatment of p75NTR-positive cells with the p75NTR-specific ligand, MC192, resulted in apoptosis, while treatment of these cells with the TrkA-specific ligand, NGF-mAbNGF30, protected them from NCS-induced death, implying that both the naked and liganded p75NTR receptors have a pro-apoptotic effect on PC12 cells. Microarray studies aimed at examining differential gene expression between p75NTR-positive and p75NTR-negative cells suggested that enzymes of the cholesterol biosynthetic pathway are differentially expressed. We therefore tested the hypothesis that altered cholesterol biosynthesis contributes directly to the pro-apoptotic effects of p75NTR in this PC12 cell-NCS model. Subsequent Northern blotting studies confirmed that the expression of p75NTR is associated with the upregulation of cholesterol biosynthetic enzymes including 3-hydroxy-3-methylglutaryl CoA reductase (HMG CoA reductase), farnesyl-diphosphate synthase, and 7-dehydro-cholesterol reductase. Mevastatin, an HMG CoA reductase inhibitor, converts the apoptosis susceptibility of p75NTR-positive cells to that of p75NTR-negative cells. It does so at concentrations that do not themselves alter cell survival. These studies provide evidence that the pro-apoptotic effects of p75NTR in PC12 cells are related to the upregulation of cholesterol biosynthetic enzymes and consequent increased cholesterol biosynthesis. PMID:15967538

  10. Formation and Internal Structure of Terrestrial Planets, and Atmospheric Escape

    NASA Astrophysics Data System (ADS)

    Jin, S.

    2014-11-01

    As of 2014 April 21, over 1490 confirmed exoplanets and 3705 Kepler candidates have been detected. This implies that exoplanets may be ubiquitous in the universe. In this paper, we focus on the formation, evolution, and internal structure of terrestrial planets, and the atmospheric escape of close-in planets. In chapter 2, we investigate the dynamical evolution of planetary system after the protoplanetary disk has dissipated. We find that in the final assembly stage, the occurrence of terrestrial planets is quite common and in 40% of our simulations finally at least one planet is formed in the habitable zone. We also find that if there is a highly-inclined giant planet in the system, a great many bodies will be either driven out of the system, or collide with the giant planet or the central star. This will lead to the difficulty in planetary accretion. Moreover, our results show that planetary migration can lead to the formation of close-in planets. Besides migration, close-in terrestrial planets can also be formed by a collision-merger mechanism, which means that planetary embryos can kick terrestrial planets directly into orbits that are extremely close to their parent stars. In chapter 3, we construct numerically an internal structure model for terrestrial planets, and provide three kinds of possible internal structures of Europa (Jupiter's moon) based on this model. Then, we calculate the radii of low-mass exoplanets for various mass combinations of core and mantle, and find that some of them are inconsistent with the observed radius of rocky planets. This phenomenon can be explained only if there exists a large amount of water in the core, or they own gaseous envelopes. In chapter 4, we improve our planetary evolution codes using the semi-gray model of Guillot (2010), which includes the incident flux from the host star as a heating source in planetary atmosphere. The updated codes can solve the structure of the top radiative zone of intensely irradiated

  11. Role of protein kinase C δ in apoptotic signaling of oxidized phospholipids in RAW 264.7 macrophages.

    PubMed

    Vogl, F; Humpolícková, J; Amaro, M; Koller, D; Köfeler, H; Zenzmaier, E; Hof, M; Hermetter, A

    2016-04-01

    The oxidized phospholipids (oxPl) 1-palmitoyl-2-glutaroyl-sn-glycero-3-phosphocholine (PGPC) and 1-palmitoyl-2-(5-oxovaleroyl)-sn-glycero-3-phosphocholine (POVPC) are cytotoxic components of oxidized LDL (oxLDL). Sustained exposure to oxLDL or isolated oxPl induces apoptotic signaling in vascular cells, which is a hallmark of the late phase of atherosclerosis. Activation of sphingomyelinase, the coordinate formation of ceramide and activation of caspase 3/7 as well as the activation of stress-associated kinases are causally involved in this process. Here, we provide evidence for a role of PKCδ in oxPl cytotoxicity. Silencing of the enzyme by siRNA significantly reduced caspase 3/7 activation in RAW 264.7 macrophages under the influence of oxPl. Concomitantly, PKCδ was phosphorylated as a consequence of cell exposure to PGPC or POVPC. Single molecule fluorescence microscopy provided direct evidence for oxPl-protein interaction. Both oxPl recruited an RFP-tagged PKCδ to the plasma membrane in a concentration-dependent manner. In addition, two color cross-correlation number and brightness (ccN&B) analysis of the molecular motions revealed that fluorescently labeled PGPC or POVPC analogs co-diffuse and are associated with the fluorescent protein kinase in live cells. The underlying lipid-protein interactions may be due to chemical bonding (imine formation between the phospholipid aldehyde POVPC with protein amino groups) and physical association (with POVPC or PGPC). In summary, our data supports the assumption that PKCδ acts as a proapototic kinase in oxPl-included apoptosis of RAW 264.7 macrophages. The direct association of the bioactive lipids with this enzyme seems to be an important step in the early phase of apoptotic signaling. PMID:26707247

  12. Radiation-induced formation of apoptotic bodies in rat thymus

    SciTech Connect

    Ohyama, H.; Yamada, T.; Ohkawa, A.; Watanabe, I.

    1985-01-01

    The process of interphase death of thymocytes in whole-body X-irradiated rats were studied. Cell size distribution analysis indicates that cell fragments (=apoptotic bodies) appeared in the thymus and increased in number depending on dose (200-1000 R) and time (2-6 hr) after irradiation with corresponding decrease in normal-size thymocytes. Occurrence of nuclear fragmentation in association with the cellular fragmentation was proved with cytofluorometric determination of DNA content in individual cells. Scanning electron microscopic observations also revealed extensive fragmentation of cells in the irradiated rat thymus. The results show clearly that cells as well as nuclei fragments rapidly into smaller pieces of various sizes in the irradiated rat thymus as commonly observed with apoptosis.

  13. Dynamical contribution into enzyme catalytic efficiency

    NASA Astrophysics Data System (ADS)

    Sitnitsky, A. E.

    2006-11-01

    A realistic physical model for the so-called rate-promoting vibration (RPV) at enzyme action is constructed. The origin of the RPV is assumed to be an oscillating electric field produced by long-lived localized vibrational modes in protein dynamics, namely, by the so-called discrete breather (DB) in secondary structure. The strength of interaction of the RPV with the reaction coordinate is evaluated and its effect on the reaction acceleration is assessed within the framework of modern theory for thermally activated escape rate at periodic driving. We reveal the phenomenon of resonant activation in our model elucidating why the frequency of the RPV in the range 100÷200 cm-1 was chosen by the evolution of enzymes as an optimal one. The effect of the RPV on the reaction acceleration is shown to vary from moderate one (up to 103÷104) in the case of three-site DB to enormous (up to 106÷108) in the case of five-site DB and thus can significantly contribute into enzyme catalytic efficiency. Also the model is shown to be compatible with the known functional dependence of enzymatic reaction rates on solvent viscosity.

  14. Ras Homolog Enriched in Brain (Rheb) Enhances Apoptotic Signaling*

    PubMed Central

    Karassek, Sascha; Berghaus, Carsten; Schwarten, Melanie; Goemans, Christoph G.; Ohse, Nadine; Kock, Gerd; Jockers, Katharina; Neumann, Sebastian; Gottfried, Sebastian; Herrmann, Christian; Heumann, Rolf; Stoll, Raphael

    2010-01-01

    Rheb is a homolog of Ras GTPase that regulates cell growth, proliferation, and regeneration via mammalian target of rapamycin (mTOR). Because of the well established potential of activated Ras to promote survival, we sought to investigate the ability of Rheb signaling to phenocopy Ras. We found that overexpression of lipid-anchored Rheb enhanced the apoptotic effects induced by UV light, TNFα, or tunicamycin in an mTOR complex 1 (mTORC1)-dependent manner. Knocking down endogenous Rheb or applying rapamycin led to partial protection, identifying Rheb as a mediator of cell death. Ras and c-Raf kinase opposed the apoptotic effects induced by UV light or TNFα but did not prevent Rheb-mediated apoptosis. To gain structural insight into the signaling mechanisms, we determined the structure of Rheb-GDP by NMR. The complex adopts the typical canonical fold of RasGTPases and displays the characteristic GDP-dependent picosecond to nanosecond backbone dynamics of the switch I and switch II regions. NMR revealed Ras effector-like binding of activated Rheb to the c-Raf-Ras-binding domain (RBD), but the affinity was 1000-fold lower than the Ras/RBD interaction, suggesting a lack of functional interaction. shRNA-mediated knockdown of apoptosis signal-regulating kinase 1 (ASK-1) strongly reduced UV or TNFα-induced apoptosis and suppressed enhancement by Rheb overexpression. In conclusion, Rheb-mTOR activation not only promotes normal cell growth but also enhances apoptosis in response to diverse toxic stimuli via an ASK-1-mediated mechanism. Pharmacological regulation of the Rheb/mTORC1 pathway using rapamycin should take the presence of cellular stress into consideration, as this may have clinical implications. PMID:20685651

  15. In vitro apoptotic cell death during erythroid differentiation.

    PubMed

    Zamai, L; Burattini, S; Luchetti, F; Canonico, B; Ferri, P; Melloni, E; Gonelli, A; Guidotti, L; Papa, S; Falcieri, E

    2004-03-01

    Erythropoiesis occurs in bone marrow and it has been shown that during in vivo erythroid differentiation some immature erythroblasts undergo apoptosis. In this regard, it is known that immature erythroblasts are FasL- and TRAIL-sensitive and can be killed by cells expressing these ligand molecules. In the present study, we have investigated the cell death phenomenon that occurs during a common unilineage model of erythroid development. Purified CD34+ human haemopoietic progenitors were cultured in vitro in the presence of SCF, IL-3 and erythropoietin. Their differentiation stages and apoptosis were followed by multiple technical approaches. Flow cytometric evaluation of surface and intracellular molecules revealed that glycophorin A appeared at day 3-4 of incubation and about 75% of viable cells co-expressed high density glycophorin A (Gly(bright)) and adult haemoglobin at day 14 of culture, indicating that this system reasonably recapitulates in vivo normal erythropoiesis. Interestingly, when mature (Gly(bright)) erythroid cells reached their higher percentages (day 14) almost half of cultured cells were apoptotic. Morphological studies indicated that the majority of dead cells contained cytoplasmic granular material typical of basophilic stage, and DNA analysis by flow cytometry and TUNEL reaction revealed nuclear fragmentation. These observations indicate that in vitro unilineage erythroid differentiation, as in vivo, is associated with apoptotic cell death of cells with characteristics of basophilic erythroblasts. We suggest that the interactions between different death receptors on immature basophilic erythroblasts with their ligands on more mature erythroblasts may contribute to induce apoptosis in vitro. PMID:15004520

  16. PARP Inhibition Restores Extrinsic Apoptotic Sensitivity in Glioblastoma

    PubMed Central

    Karpel-Massler, Georg; Pareja, Fresia; Aimé, Pascaline; Shu, Chang; Chau, Lily; Westhoff, Mike-Andrew; Halatsch, Marc-Eric; Crary, John F.; Canoll, Peter; Siegelin, Markus D.

    2014-01-01

    Background Resistance to apoptosis is a paramount issue in the treatment of Glioblastoma (GBM). We show that targeting PARP by the small molecule inhibitors, Olaparib (AZD-2281) or PJ34, reduces proliferation and lowers the apoptotic threshold of GBM cells in vitro and in vivo. Methods The sensitizing effects of PARP inhibition on TRAIL-mediated apoptosis and potential toxicity were analyzed using viability assays and flow cytometry in established GBM cell lines, low-passage neurospheres and astrocytes in vitro. Molecular analyses included western blots and gene silencing. In vivo, effects on tumor growth were examined in a murine subcutaneous xenograft model. Results The combination treatment of PARP inhibitors and TRAIL led to an increased cell death with activation of caspases and inhibition of formation of neurospheres when compared to single-agent treatment. Mechanistically, pharmacological PARP inhibition elicited a nuclear stress response with up-regulation of down-stream DNA-stress response proteins, e.g., CCAAT enhancer binding protein (C/EBP) homology protein (CHOP). Furthermore, Olaparib and PJ34 increased protein levels of DR5 in a concentration and time-dependent manner. In turn, siRNA-mediated suppression of DR5 mitigated the effects of TRAIL/PARP inhibitor-mediated apoptosis. In addition, suppression of PARP-1 levels enhanced TRAIL-mediated apoptosis in malignant glioma cells. Treatment of human astrocytes with the combination of TRAIL/PARP inhibitors did not cause toxicity. Finally, the combination treatment of TRAIL and PJ34 significantly reduced tumor growth in vivo when compared to treatment with each agent alone. Conclusions PARP inhibition represents a promising avenue to overcome apoptotic resistance in GBM. PMID:25531448

  17. Role of apoptotic hepatocytes in HCV dissemination: regulation by acetaldehyde.

    PubMed

    Ganesan, Murali; Natarajan, Sathish Kumar; Zhang, Jinjin; Mott, Justin L; Poluektova, Larisa I; McVicker, Benita L; Kharbanda, Kusum K; Tuma, Dean J; Osna, Natalia A

    2016-06-01

    Alcohol consumption exacerbates hepatitis C virus (HCV) pathogenesis and promotes disease progression, although the mechanisms are not quite clear. We have previously observed that acetaldehyde (Ach) continuously produced by the acetaldehyde-generating system (AGS), temporarily enhanced HCV RNA levels, followed by a decrease to normal or lower levels, which corresponded to apoptosis induction. Here, we studied whether Ach-induced apoptosis caused depletion of HCV-infected cells and what role apoptotic bodies (AB) play in HCV-alcohol crosstalk. In liver cells exposed to AGS, we observed the induction of miR-122 and miR-34a. As miR-34a has been associated with apoptotic signaling and miR-122 with HCV replication, these findings may suggest that cells with intensive viral replication undergo apoptosis. Furthermore, when AGS-induced apoptosis was blocked by a pan-caspase inhibitor, the expression of HCV RNA was not changed. AB from HCV-infected cells contained HCV core protein and the assembled HCV particle that infect intact hepatocytes, thereby promoting the spread of infection. In addition, AB are captured by macrophages to switch their cytokine profile to the proinflammatory one. Macrophages exposed to HCV(+) AB expressed more IL-1β, IL-18, IL-6, and IL-10 mRNAs compared with those exposed to HCV(-) AB. The generation of AB from AGS-treated HCV-infected cells even enhanced the induction of aforementioned cytokines. We conclude that HCV and alcohol metabolites trigger the formation of AB containing HCV particles. The consequent spread of HCV to neighboring hepatocytes via infected AB, as well as the induction of liver inflammation by AB-mediated macrophage activation potentially exacerbate the HCV infection course by alcohol and worsen disease progression. PMID:27056722

  18. Exploitation of an ancient escape circuit by an avian predator: relationships between taxon-specific prey escape circuits and the sensitivity to visual cues from the predator.

    PubMed

    Jabłoński, P G; Strausfeld, N J

    2001-01-01

    The painted redstart Myioborus pictus uses visual displays to flush, pursue, and then capture an abundance of brachyceran Diptera that are equipped with giant fiber escape circuits. This paper investigates the relationships between features of the giant fiber system, the structure of visual stimuli produced by redstarts and their effectiveness in eliciting escape reactions by flies. The results show that dipterous taxa having large-diameter giant fibers extending short distances from the brain to motor neurons involved in escape are flushed at greater distances than taxa with longer and small-diameter giant fibers. The results of behavioral tests show the importance of angular acceleration of expanding image edges on the compound eye in eliciting escape responses. Lateral motion of stimulus profile edges as well as structured visual profiles additionally contribute to the sensitivity of one or more neural systems that trigger escape. Retinal subtense and angular velocity are known to trigger physiological responses in fly giant fiber circuits, but the contributions of edge length and lateral motion in a looming stimulus suggest that escape pathways might also receive inputs from circuits that are tuned to different types of motion. The present results suggest that these several properties of escape pathways have contributed to the evolution of foraging displays and plumage patterns in flush-pursuing birds. PMID:11964498

  19. Strong plume fluxes at Mars observed by MAVEN: An important planetary ion escape channel

    NASA Astrophysics Data System (ADS)

    Dong, Y.; Fang, X.; Brain, D. A.; McFadden, J. P.; Halekas, J. S.; Connerney, J. E.; Curry, S. M.; Harada, Y.; Luhmann, J. G.; Jakosky, B. M.

    2015-11-01

    We present observations by the Mars Atmosphere and Volatile EvolutioN (MAVEN) mission of a substantial plume-like distribution of escaping ions from the Martian atmosphere, organized by the upstream solar wind convection electric field. From a case study of MAVEN particle-and-field data during one spacecraft orbit, we identified three escaping planetary ion populations: plume fluxes mainly along the upstream electric field over the north pole region of the Mars-Sun-Electric field (MSE) coordinate system, antisunward ion fluxes in the tail region, and much weaker upstream pickup ion fluxes. A statistical study of O+ fluxes using 3 month MAVEN data shows that the plume is a constant structure with strong fluxes widely distributed in the MSE northern hemisphere, which constitutes an important planetary ion escape channel. The escape rate through the plume is estimated to be ~30% of the tailward escape and ~23% of the total escape for > 25 eV O+ ions.

  20. Endoplasmic reticulum stress-induced apoptotic pathway and mitochondrial dysregulation in HeLa cells treated with dichloromethane extract of Dillenia suffruticosa

    PubMed Central

    Wan Nor Hafiza, Wan Abd Ghani; Yazan, Latifah Saiful; Tor, Yin Sim; Foo, Jhi Biau; Armania, Nurdin; Rahman, Heshu Sulaiman

    2016-01-01

    Ethyl acetate and dichloromethane extract of Dillenia suffruticosa (EADS and DCMDS, respectively) can be a potential anticancer agent. The effects of EADS and DCMDS on the growth of HeLa cervical cancer cells and the expression of apoptotic-related proteins had been investigated in vitro. Cytotoxicity of the extracts toward the cells was determined by 5-diphenyltetrazolium bromide assay, the effects on cell cycle progression and the mode of cell death were analyzed by flow cytometry technique, while the effects on apoptotic-related genes and proteins were evaluated by quantitative real-time polymerase chain reaction, and Western blot and enzyme-linked immunosorbent assay, respectively. Treatment with DCMDS inhibited (P < 0.05) proliferation and induced apoptosis in HeLa cells. The expression of cyclin B1 was downregulated that led to G2/M arrest in the cells after treatment with DCMDA. In summary, DCMDS induced apoptosis in HeLa cells via endoplasmic reticulum stress-induced apoptotic pathway and dysregulation of mitochondria. The data suggest the potential application of DCMDS in the treatment of cervical cancer. PMID:27041866

  1. Endoplasmic reticulum stress-induced apoptotic pathway and mitochondrial dysregulation in HeLa cells treated with dichloromethane extract of Dillenia suffruticosa.

    PubMed

    Wan Nor Hafiza, Wan Abd Ghani; Yazan, Latifah Saiful; Tor, Yin Sim; Foo, Jhi Biau; Armania, Nurdin; Rahman, Heshu Sulaiman

    2016-01-01

    Ethyl acetate and dichloromethane extract of Dillenia suffruticosa (EADS and DCMDS, respectively) can be a potential anticancer agent. The effects of EADS and DCMDS on the growth of HeLa cervical cancer cells and the expression of apoptotic-related proteins had been investigated in vitro. Cytotoxicity of the extracts toward the cells was determined by 5-diphenyltetrazolium bromide assay, the effects on cell cycle progression and the mode of cell death were analyzed by flow cytometry technique, while the effects on apoptotic-related genes and proteins were evaluated by quantitative real-time polymerase chain reaction, and Western blot and enzyme-linked immunosorbent assay, respectively. Treatment with DCMDS inhibited (P < 0.05) proliferation and induced apoptosis in HeLa cells. The expression of cyclin B1 was downregulated that led to G2/M arrest in the cells after treatment with DCMDA. In summary, DCMDS induced apoptosis in HeLa cells via endoplasmic reticulum stress-induced apoptotic pathway and dysregulation of mitochondria. The data suggest the potential application of DCMDS in the treatment of cervical cancer. PMID:27041866

  2. Signal transduction induced by apoptotic cells inhibits HIV transcription in monocytes/macrophages.

    PubMed

    Gekonge, Bethsebah N; Schiralli, Gillian; Schlegel, Robert A; Henderson, Andrew J

    2006-10-01

    The primary targets of HIV are CD4(+) T cells and macrophages. HIV infection is associated with an increase in apoptosis of infected and uninfected CD4(+) T cells, and these infected cells undergo apoptosis and produce HIV virions with phosphatidylserine (PS) on their surface. During phagocytosis of apoptotic cells, macrophages, using an array of receptors, are able to perceive various surface changes on apoptotic cells. The engagement of phagocytic receptors by ligands on the apoptotic cell surface results in the activation of signaling cascades, which facilitate engulfment. In this study, we examined how PS associated with virions and apoptotic cells influences HIV replication. We demonstrate that virus-associated PS is required for HIV infection of macrophages at a step prior to integration but following strong-stop, indicating that PS-initiated signals alter the establishment of HIV provirus. Conversely, apoptotic cells inhibited HIV transcription in infected macrophages, although this ability to suppress transcription was independent of PS. Furthermore, we show that ELMO, a key signaling molecule that participates in the phagocytosis of apoptotic cells, inhibited HIV transcription; however, knocking down endogenous ELMO expression in infected U937 cells rescued HIV transcription when these cells were coincubated with apoptotic targets. Taken together, these data show that apoptotic cells and the signals, which they initiate upon recognition by macrophages, influence the successful establishment of HIV infection and provirus transcription. PMID:16885500

  3. Two roads to death - Bax targets mitochondria by distinct routes before or during apoptotic cell death.

    PubMed

    Dewson, Grant

    2015-01-01

    Recent studies have revolutionized our understanding of how the crucial apoptosis effectors Bax and Bak target mitochondria to kill cells. We recently reported that an important determinant of the localization, oligomerization, and apoptotic function of Bax is an interaction with either mitochondrial voltage-dependent anion channel 2 (VDAC2) (in healthy cells) or Bak (in apoptotic cells).(1). PMID:27308408

  4. Concise Review: Apoptotic Cell-Based Therapies-Rationale, Preclinical Results and Future Clinical Developments.

    PubMed

    Saas, Philippe; Daguindau, Etienne; Perruche, Sylvain

    2016-06-01

    The objectives of this review are to summarize the experimental data obtained using apoptotic cell-based therapies, and then to discuss future clinical developments. Indeed, apoptotic cells exhibit immunomodulatory properties that are reviewed here by focusing on more recent mechanisms. These immunomodulatory mechanisms are in particular linked to the clearance of apoptotic cells (called also efferocytosis) by phagocytes, such as macrophages, and the induction of regulatory T cells. Thus, apoptotic cell-based therapies have been used to prevent or treat experimental inflammatory diseases. Based on these studies, we have identified critical steps to design future clinical trials. This includes: the administration route, the number and schedule of administration, the appropriate apoptotic cell type to be used, as well as the apoptotic signal. We also have analyzed the clinical relevancy of apoptotic-cell-based therapies in experimental models. Additional experimental data are required concerning the treatment of inflammatory diseases (excepted for sepsis) before considering future clinical trials. In contrast, apoptotic cells have been shown to favor engraftment and to reduce acute graft-versus-host disease (GvHD) in different relevant models of transplantation. This has led to the conduct of a phase 1/2a clinical trial to alleviate GvHD. The absence of toxic effects obtained in this trial may support the development of other clinical studies based on this new cell therapy. Stem Cells 2016;34:1464-1473. PMID:27018198

  5. Pro-apoptotic gene regulation in the Caribbean fruit fly, Anastrepha suspensa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional activation of pro-apoptotic genes in response to cytotoxic stimuli is a conserved feature of the cell death pathway proposed for metazoans. However, understanding the extent of this conservation in insects, as well as other organisms, has been limited by the lack of known pro-apoptot...

  6. Escape through a time-dependent hole in the doubling map

    NASA Astrophysics Data System (ADS)

    Livorati, André L. P.; Georgiou, Orestis; Dettmann, Carl P.; Leonel, Edson D.

    2014-05-01

    We investigate the escape dynamics of the doubling map with a time-periodic hole. Ulam's method was used to calculate the escape rate as a function of the control parameters. We consider two cases, oscillating or breathing holes, where the sides of the hole are moving in or out of phase respectively. We find out that the escape rate is well described by the overlap of the hole with its images, for holes centered at periodic orbits.

  7. A non-apoptotic role for BAX and BAK in eicosanoid metabolism

    PubMed Central

    Zhang, Tejia; Walensky, Loren D.; Saghatelian, Alan

    2015-01-01

    BCL-2 proteins are key regulators of programmed cell death. The interplay between pro- and anti-apoptotic BCL-2 members has important roles in many cancers. In addition to their apoptotic function, recent evidence supports key non-apoptotic roles for several BCL-2 proteins. We used an unbiased lipidomics strategy to reveal that the pro-apoptotic proteins BAX, and to a lesser extent BAK, regulate the cellular inflammatory response by mediating COX-2 expression and prostaglandin biosynthesis. COX-2 upregulation in response to the bacterial endotoxin lipopolysaccharide is blunted in the absence of BAX, and Bax−/− mouse embryonic fibroblasts display altered kinetics of NFκB and MAPK signaling following endotoxin treatment. Our approach uncovers a novel, non-apoptotic function for BAX in regulation of the cellular inflammatory response and suggests that inflammation and apoptosis are more tightly connected than previously anticipated. PMID:25815636

  8. Cooperative binding of Annexin A5 to phosphatidylserine on apoptotic cell membranes

    NASA Astrophysics Data System (ADS)

    Janko, Christina; Jeremic, Ivica; Biermann, Mona; Chaurio, Ricardo; Schorn, Christine; Muñoz, Luis E.; Herrmann, Martin

    2013-12-01

    Healthy cells exhibit an asymmetric plasma membrane with phosphatidylserine (PS) located on the cytoplasmic leaflet of the plasma membrane bilayer. Annexin A5-FITC, a PS binding protein, is commonly used to evaluate apoptosis in flow cytometry. PS exposed by apoptotic cells serves as a major ‘eat-me’ signal for phagocytes. Although exposition of PS has been observed after alternative stimuli, no clearance of viable, PS exposing cells has been detected. Thus, besides PS exposure, membranes of viable and apoptotic cells might exhibit specific characteristics. Here, we show that Annexin A5 binds in a cooperative manner to different types of dead cells. Shrunken apoptotic cells thereby showed the highest Hill coefficient values. Contrarily, parafomaldehyde fixation of apoptotic cells completely abrogates the cooperativity effect seen with dead and dying cells. We tend to speculate that the cooperative binding of Annexin A5 to the membranes of apoptotic cells reflects higher fluidity of the exposed membranes facilitating PS clustering.

  9. Escape dynamics and fractal basin boundaries in the planar Earth-Moon system

    NASA Astrophysics Data System (ADS)

    de Assis, Sheila C.; Terra, Maisa O.

    2014-10-01

    The escape of trajectories of a spacecraft, or comet or asteroid in the presence of the Earth-Moon system is investigated in detail in the context of the planar circular restricted three-body problem, in a scattering region around the Moon. The escape through the necks around the collinear points and as well as the leaking produced by considering collisions with the Moon surface, taking the lunar mean radius into account, were considered. Given that different transport channels are available as a function of the Jacobi constant, four distinct escape regimes are analyzed. Besides the calculation of exit basins and of the spatial distribution of escape time, the qualitative dynamical investigation through Poincaré sections is performed in order to elucidate the escape process. Our analyses reveal the dependence of the properties of the considered escape basins with the energy, with a remarkable presence of fractal basin boundaries along all the escape regimes. Finally, we observe the plentiful presence of stickiness motion near stability islands which plays a remarkable role in the longest escape time behavior. The application of this analysis is important both in space mission design and study of natural systems, given that fractal boundaries are related with high sensitivity to initial conditions, implying in uncertainty between safe and unsafe solutions, as well as between escaping solutions that evolve to different phase space regions.

  10. The Martian escape rate as a function of upstream solar conditions

    NASA Astrophysics Data System (ADS)

    Ramstad, R.; Barabash, S.; Futaana, Y.; Nilsson, H.; Holmstrom, M.

    2014-12-01

    We investigate potential factors for influence on the Martian heavy ion escape rate (Q) by integrating Mars Express ASPERA-3/IMA heavy ion flux measurements in the Martian tail, taken at similar (binned) solar wind density (n), velocity (v) and EUV radiation flux (FEUV) upstream conditions. In the best sampled cases, with v and FEUV constrained, we find a statistically significant decrease in heavy ion escape rate with increased solar wind density. An empirical-analytical model for atmospheric escape is developed by fitting calculated escape rates to all sufficiently sampled solar conditions, indicating an overall negative dependence on solar wind density.

  11. On the hydrodynamic model of thermal escape from planetary atmospheres and its comparison with kinetic simulations

    NASA Astrophysics Data System (ADS)

    Volkov, A. N.

    2016-06-01

    Parkers' model of thermal escape implies the search of solutions of one-dimensional hydrodynamic equations for an inviscid but thermally conducting gas with a critical point and vanishing temperature far from the source. The properties of solutions of this model are studied for neutral mon- and diatomic gases with the viscosity index varying from 1/2 to 1. The domains of existence and uniqueness of solutions in terms of the source Jeans escape parameter and Knudsen number are established. The solutions are found to exist only in a narrow range of the critical point Jeans parameter. The lower and upper limits of this range correspond to solutions that are dominated by either heat conduction or adiabatic expansion. Thermal escape described by Parker's model occurs in two asymptotic regimes: the low-density (LD) regime, when escape is dominated by heat conduction, and the high-density (HD) regime, when escape is dominated by adiabatic expansion. Expressions for the mass and energy escape rates in these regimes are found theoretically. The comparison of results of hydrodynamic and kinetic simulations performed in identical conditions shows that Parker's model is capable of describing thermal escape only in the HD regime, providing decent agreement with the kinetic model in terms of the atmospheric structure below the exobase and the mass and energy escape rates. In the LD regime, Parker's model predicts a much faster drop in atmospheric temperature and less extended atmospheres, and can both over- and underestimate the escape rates in orders of magnitude.

  12. Sharks modulate their escape behavior in response to predator size, speed and approach orientation.

    PubMed

    Seamone, Scott; Blaine, Tristan; Higham, Timothy E

    2014-12-01

    Escape responses are often critical for surviving predator-prey interactions. Nevertheless, little is known about how predator size, speed and approach orientation impact escape performance, especially in larger prey that are primarily viewed as predators. We used realistic shark models to examine how altering predatory behavior and morphology (size, speed and approach orientation) influences escape behavior and performance in Squalus acanthias, a shark that is preyed upon by apex marine predators. Predator models induced C-start escape responses, and increasing the size and speed of the models triggered a more intense response (increased escape turning rate and acceleration). In addition, increased predator size resulted in greater responsiveness from the sharks. Among the responses, predator approach orientation had the most significant impact on escapes, such that the head-on approach, as compared to the tail-on approach, induced greater reaction distances and increased escape turning rate, speed and acceleration. Thus, the anterior binocular vision in sharks renders them less effective at detecting predators approaching from behind. However, it appears that sharks compensate by performing high-intensity escapes, likely induced by the lateral line system, or by a sudden visual flash of the predator entering their field of view. Our study reveals key aspects of escape behavior in sharks, highlighting the modulation of performance in response to predator approach. PMID:25041843

  13. Angiogenesis in cancer: Anti-VEGF escape mechanisms

    PubMed Central

    Poettler, Marina; Unseld, Matthias; Zielinski, Christoph C.

    2012-01-01

    It is now widely accepted that tumor-angiogenesis plays a crucial role in tumor growth, tumor propagation and metastasis formation. Among several angiogenic activators, the vascular endothelial growth factor (VEGF) and its receptors represent one of the major inducers of tumor angiogenesis. Thus, this system has become the focus of therapeutic interventions, which led to the approval of the anti-VEGF blocking antibody bevacizumab and the VEGFR-2 pathway inhibitors pazopanib, sorafenib and sunitinib. However, not every cancer patient benefits from such treatment or finally becomes resistant to anti-VEGF approaches; others are suffering from adverse effects. Thus, there is an urgent need for a better understanding of VEGF-independent mechanisms leading to angiogenesis in cancer. This review focuses on anti-VEGF escape mechanisms of tumor cells and its microenvironment. PMID:25806151

  14. Sources of polar plume ion escape on Mars

    NASA Astrophysics Data System (ADS)

    Curry, S.; Liemohn, M.; Ma, Y.; Fang, X.

    2011-10-01

    The Mars pick-up ion transport model has been developed to study the relative role of kinetic processes on ion transport through near-Mars space. Mars does not have a strong, intrinsic dipole magnetic field and consequently the solar wind directly interacts with the dayside upper atmosphere causing particles to be stripped away from the atmosphere. The Mars Pickup Ion Model calculates the detailed ion velocity space distribution (VSD) through a background magnetic and electric field model at specific locations. The main objective of this work is to robustly probe the sources of polar plume ion escape relative to loss down the central tail. Because the VSDs are non-Maxwellian and reveal asymmetric, non-gyrotropic features, our simulation can investigate the role of kinetics in polar plume loss without using the Maxwellian assumptions of current MHD models.

  15. Energetic particle recurrence and escape during solar cycle 20

    NASA Astrophysics Data System (ADS)

    Gold, R. E.; Roelof, E. C.

    1980-10-01

    Low-energy solar particle data have been combined from a multi-spacecraft near-earth data set covering most of solar cycle 20 (1966-1976). Particle intensity profiles have been ordered in the natural heliographic coordinate system of the estimated high coronal connection longitude of the foot point of the interplanetary field line. The recurrence trends of approximately 1-MeV solar particles become more apparent in this coordinate system than when plotted versus time, and thereby extend the evidence for regions of continual injection and escape from the corona. Intercomparison of solar particles and solar wind streams in heliographic longitude suggests that the origin of stream-associated spatial particle events seen at 1 AU is solar rather than interplanetary.

  16. Lightning tests of the orbiter pyrotechnic escape system

    NASA Technical Reports Server (NTRS)

    Cohen, R.; Schulte, E. H.

    1977-01-01

    An experimental test program was undertaken to demonstrate that the Space Shuttle Orbiter Vehicle pyrotechnics actuated Crew Escape System was not subject to failure resulting from a lightning strike in the vicinity of the cockpit. A test sample representing a full-scale portion of the Orbiter Outer Panel was preheated to 325 F and struck with three different current waveforms to simulate the various effects of lightning: (1) 2 micro sec risetime, to 180 kA pulse to evaluate fast current rise shock effects; (2) a 205 kA, 100 micro sec wide pulse to evaluate full energy shock effects; and (3) a 490 ampere, 370 msec continuing current to evaluate the thermal effects of a lightning strike. These tests show that the Orbiter outer panel pyrotechnics are adequately protected against damage resulting from a lightning strike.

  17. Test of time: what if little Albert had escaped?

    PubMed

    Field, Andy P; Nightingale, Zoë C

    2009-04-01

    Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him. PMID:19293325

  18. Extended narrow escape problem: Boundary homogenization-based analysis

    PubMed Central

    Berezhkovskii, A. M.; Barzykin, A. V.

    2016-01-01

    Diffusion of particles in confined domains with absorbing spots on the otherwise reflecting boundaries is ubiquitous in nature and technology. Because of nonuniform boundary conditions, the problem of finding the mean first passage time (MFPT) of the particle to one of the spots is extremely complicated. We show how the difficulties can be overcome by means of boundary homogenization when the domain is a circular disk whose boundary contains n nonoverlapping identical absorbing arcs, which may occupy an arbitrary fraction of the boundary. We find the MFPT as a function of the fraction of the boundary occupied by the arcs (i) for n evenly spaced arcs and (ii) for two arcs arbitrarily located on the boundary. As the arc length tends to zero, our approximate solution reduces to the known asymptotic formula for the MFPT rigorously derived in studies devoted of the narrow escape problem. PMID:20866572

  19. Fatal leaflet escape in an Edwards TEKNA aortic prosthesis.

    PubMed

    Pfeiffer, Heidi; Bertolini, Julia; Scheld, Hans Heinrich; Brinkmann, Bernd

    2006-01-01

    The case is reported of a 26-year-old male patient who died eight years after the replacement of an aortic valve with a bileaflet mechanical valve (TEKNA; Edwards, USA). Following prosthesis implantation, the patient had been in a good state of health, and his death occurred unexpectedly. Forensic autopsy revealed a leaflet escape, with two fragments of the leaflet being found bilaterally in the common iliac arteries. Death occurred due to an acute cardiac insufficiency. Immunohistochemical investigations revealed fresh myocardial fiber necroses. Stereomicroscopic and scanning electron microscopic investigations demonstrated surface erosions of the leaflet. Although the valve was withdrawn from the market in June 2000, it had previously been implanted in over 18,000 patients. Thus, from a clinical viewpoint, the question of using a prophylactic replacement in affected patients must be discussed. PMID:16480019

  20. Aggregation increases prey survival time in group chase and escape

    NASA Astrophysics Data System (ADS)

    Yang, Sicong; Jiang, Shijie; Jiang, Li; Li, Geng; Han, Zhangang

    2014-08-01

    Recently developed chase-and-escape models have addressed a fascinating pursuit-and-evasion problem that may have both theoretical significance and potential applications. We introduce three aggregation strategies for the prey in a group chase model on a lattice. Simulation results show that aggregation dramatically increases the group survival time, even allowing immortal prey. The average survival time τ and the aggregation probability P have a power-law dependence of \\tau \\sim {{(1-P)}^{-1}} for P\\in [0.9,0.997]. With increasing numbers of predators, there is still a phase transition. When the number of predators is less than the critical point value, the prey group survival time increases significantly.

  1. Escaping Antiangiogenic Therapy: Strategies Employed by Cancer Cells.

    PubMed

    Pinto, Mauricio P; Sotomayor, Paula; Carrasco-Avino, Gonzalo; Corvalan, Alejandro H; Owen, Gareth I

    2016-01-01

    Tumor angiogenesis is widely recognized as one of the "hallmarks of cancer". Consequently, during the last decades the development and testing of commercial angiogenic inhibitors has been a central focus for both basic and clinical cancer research. While antiangiogenic drugs are now incorporated into standard clinical practice, as with all cancer therapies, tumors can eventually become resistant by employing a variety of strategies to receive nutrients and oxygen in the event of therapeutic assault. Herein, we concentrate and review in detail three of the principal mechanisms of antiangiogenic therapy escape: (1) upregulation of compensatory/alternative pathways for angiogenesis; (2) vasculogenic mimicry; and (3) vessel co-option. We suggest that an understanding of how a cancer cell adapts to antiangiogenic therapy may also parallel the mechanisms employed in the bourgeoning tumor and isolated metastatic cells delivering responsible for residual disease. Finally, we speculate on strategies to adapt antiangiogenic therapy for future clinical uses. PMID:27608016

  2. Novel Anti-Melanoma Immunotherapies: Disarming Tumor Escape Mechanisms

    PubMed Central

    Sapoznik, Sivan; Hammer, Ohad; Ortenberg, Rona; Besser, Michal J.; Ben-Moshe, Tehila; Schachter, Jacob; Markel, Gal

    2012-01-01

    The immune system fights cancer and sometimes temporarily eliminates it or reaches an equilibrium stage of tumor growth. However, continuous immunological pressure also selects poorly immunogenic tumor variants that eventually escape the immune control system. Here, we focus on metastatic melanoma, a highly immunogenic tumor, and on anti-melanoma immunotherapies, which recently, especially following the FDA approval of Ipilimumab, gained interest from drug development companies. We describe new immunomodulatory approaches currently in the development pipeline, focus on the novel CEACAM1 immune checkpoint, and compare its potential to the extensively described targets, CTLA4 and PD1. This paper combines multi-disciplinary approaches and describes anti-melanoma immunotherapies from molecular, medical, and business angles. PMID:22778766

  3. Bacillus cereus immune escape: a journey within macrophages.

    PubMed

    Tran, Seav-Ly; Ramarao, Nalini

    2013-10-01

    During bacterial infection, professional phagocytes are attracted to the site of infection, where they constitute a first line of host cell defense. Their function is to engulf and destroy the pathogens. Thus, bacteria must withstand the bactericidal activity of professional phagocytes, including macrophages to counteract the host immune system. Bacillus cereus infections are characterized by bacteremia despite the accumulation of inflammatory cells at the site of infection. This implies that the bacteria have developed means of resisting the host immune system. Bacillus cereus spores survive, germinate, and multiply in contact with macrophages, eventually producing toxins that kill these cells. However, the exact mechanism by which B. cereus evades immune attack remains unclear. This review addresses the interaction between B. cereus and macrophages, highlighting, in particular, the ways in which the bacteria escape the microbicidal activities of professional phagocytes. PMID:23827020

  4. Molecular motor with a built-in escapement device

    NASA Astrophysics Data System (ADS)

    Oshanin, G.; Klafter, J.; Urbakh, M.

    2004-10-01

    We study the dynamics of a classical particle in a one-dimensional potential composed of two identical spatially periodic components, one of which is externally driven by a random force. We demonstrate that, under certain conditions, the particle may move unidirectionally with a constant velocity, despite the fact that the average external force is zero. We show that the physical mechanism underlying such a phenomenon resembles the work of an escapement-type device in watches; upon reaching a certain level, random fluctuations exercise a locking function creating points of irreversibility which the particle cannot overpass. Repeated (randomly) in each cycle, this results in a saltatory ballistic-type motion. In the overdamped limit, we work out simple analytical estimates for the particle's terminal velocity. Our analytical results are in a very good agreement with Monte Carlo results.

  5. STS-100 crew members practice emergency escape from the pad

    NASA Technical Reports Server (NTRS)

    2001-01-01

    KENNEDY SPACE CENTER, Fla. - As part of emergency escape training at Launch Pad 39A, the STS-100 crew climb into slidewire baskets that, during a real emergency, would propel them off the Fixed Service Structure to a landing area away from the pad. The crew is taking part in Terminal Countdown Demonstration Test activities that also include a simulated launch countdown. The mission is carrying the Multi-Purpose Logistics Module Raffaello and the SSRMS, to the International Space Station. Raffaello carries six system racks and two storage racks for the U.S. Lab. The SSRMS is crucial to the continued assembly of the orbiting complex. Launch of mission STS-100 is scheduled for April 19 at 2:41 p.m. EDT from Launch Pad 39A.

  6. STS-100 crew members practice emergency escape from the pad

    NASA Technical Reports Server (NTRS)

    2001-01-01

    KENNEDY SPACE CENTER, Fla. - During emergency escape training at Launch Pad 39A, STS-100 Pilot Jeffrey S. Ashby (left) and Commander Kent V. Rominger are in their slidewire basket that, during a real emergency, would propel them off the Fixed Service Structure to a landing area away from the pad. The crew is taking part in Terminal Countdown Demonstration Test activities that also include a simulated launch countdown. The mission is carrying the Multi-Purpose Logistics Module Raffaello and the SSRMS, to the International Space Station. Raffaello carries six system racks and two storage racks for the U.S. Lab. The SSRMS is crucial to the continued assembly of the orbiting complex. Launch of mission STS-100 is scheduled for April 19 at 2:41 p.m. EDT from Launch Pad 39A.

  7. Enzymes for improved biomass conversion

    DOEpatents

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  8. ESCAP holds expert group meeting on population issues facing adolescents.

    PubMed

    1997-01-01

    This article summarizes the activities at the ESCAP Population Division Expert Group Meeting on Adolescents that was held during September-October 1997 in Bangkok, Thailand. The meeting was a follow-up to the 1994 International Conference on Population and Development (ICPD). The meeting considered 1) the ICPD recommendations; 2) the recommendations contained in the Jakarta Plan of Action on Human Resource Development; and 3) the Proposals for Action on Human Resources Development for Youth in Asia and the Pacific. Participants included about 25 people from Australia, Bangladesh, China, India, Indonesia, Philippines, Sri Lanka, and Thailand. The conference relied on 8 invited experts, two resource persons, advisors from the UNFPA Country Support Team for East and Southeast Asia, and representatives of UNFPA, the Population Council, and the East-West Center. A concern was the declining age of menarche of girls in the ESCAP region and the increasing age of marriage. During the time of menarche and marriage, girls are migrating and moving away from their family and community in rural areas. Family structure and relationships are changing. Increases are observed in adolescent premarital sexual activity, the incidence of sexually transmitted diseases, substance abuse, teenage pregnancy, and abortion. The mass media and information technologies have both a positive and a negative influence on adolescents. Parent-child communication exchanges and teacher-student exchanges are "less than ideal." Old traditions and practices change slower than people change. Boys and girls are affected differently by the sociocultural and economic environment. The societal norms set expectations for behavior that may conflict with individual beliefs and practices. Changes brought by globalization and rapid economic growth provide greater opportunity for young girls and women to obtain employment and autonomy. PMID:12293003

  9. Flare Particle Escape in 3D Solar Eruptive Events

    NASA Astrophysics Data System (ADS)

    Antiochos, Spiro K.; Masson, Sophie; DeVore, C. R.

    2015-04-01

    Among the most important, but least understood forms of space weather are the so-called Impulsive Solar Energetic Particle (SEP) events, which can be especially hazardous to deep-space astronauts. These energetic particles are generally believed to be produced by the flare reconnection that is the primary driver of solar eruptive events (SEE). A key point is that in the standard model of SEEs, the particles should remain trapped in the coronal flare loops and in the ejected plasmoid, the CME. However, flare-accelerated particles frequently reach the Earth long before the CME does. In previous 2.5D calculations we showed how the external reconnection that is an essential element of the breakout model for CME initiation could lead to the escape of flare-accelerated particles. The problem, however, is that in 2.5D this reconnection also tends to destroy the plasmoid, which disagrees with the observation that SEP events are often associated with well-defined plasmoids at 1 AU known as “magnetic clouds”. Consequently, we have extended our model to a fully 3D topology that includes a multi-polar coronal field suitable for a breakout SEE near a coronal hole region. We performed high-resolution 3D MHD numerical simulations with the Adaptively Refined MHD Solver (ARMS). Our results demonstrate that the model allows for the effective escape of energetic particles from deep within an ejecting well-defined plasmoid. We show how the complex interactions between the flare and breakout reconnection reproduce all the main observational features of SEEs and SEPs. We discuss the implications of our calculations for the upcoming Solar Orbiter and Solar Probe Plus missions, which will measure SEEs and SEPs near the Sun, thereby, mitigating propagation effects.This research was supported, in part, by the NASA SR&T and TR&T Programs.

  10. Initiating a watch list for Ebola virus antibody escape mutations.

    PubMed

    Miller, Craig R; Johnson, Erin L; Burke, Aran Z; Martin, Kyle P; Miura, Tanya A; Wichman, Holly A; Brown, Celeste J; Ytreberg, F Marty

    2016-01-01

    The 2014 Ebola virus (EBOV) outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP) of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans) at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens. PMID:26925318

  11. Initiating a watch list for Ebola virus antibody escape mutations

    PubMed Central

    Johnson, Erin L.; Burke, Aran Z.; Martin, Kyle P.; Miura, Tanya A.; Wichman, Holly A.; Brown, Celeste J.

    2016-01-01

    The 2014 Ebola virus (EBOV) outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP) of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans) at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens. PMID:26925318

  12. The retinoic acid-metabolizing enzyme CYP26A1 upregulates fascin and promotes the malignant behavior of breast carcinoma cells.

    PubMed

    Osanai, Makoto; Lee, Gang-Hong

    2015-08-01

    The retinoic acid (RA)-metabolizing enzyme CYP26A1 has been shown to efficiently enhance the oncogenic potential of breast cancer, suggesting a potential oncogenic function. We previously demonstrated that CYP26A1 confers unique cell survival properties by modulating the expression of a variety of genes and identified a number of genes that drive the cells into the oncogenic state. Accumulating evidence suggested that fascin is overexpressed in various types of cancer, primarily leading to increased cell motility. Therefore, in the present study, we examined fascin, an actin-bundling protein, using immunohistochemical and SA-β-gal staining as well as TUNEL and colony forming assays. The results of the present study showed that the expression levels of fascin increased significantly in response to CYP26A1 overexpression and, conversely, treatment with all-trans RA downregulated the expression of fascin. In addition, primary breast carcinoma samples, particularly hormone receptor-negative carcinomas and CYP26A1-overexpressing cancers, expressed elevated levels of fascin. Notably, fascin contributed to the ability of breast carcinoma cells to escape premature senescence and exhibit enhanced cell apoptotic resistance, promoting anchorage-independent growth properties. Fascin also promoted cell motility and the invasiveness of CYP26A1-expressing breast carcinoma cells. These data suggest that fascin expression is modulated by the intracellular RA status regulated by the expression of CYP26A1 and plays a significant role in the malignant behavior of CYP26A1-expressing breast carcinoma cells. CYP26A1 exerts oncogenic functions during breast carcinogenesis. Therefore, CYP26A1-mediated oncogenic characteristics may be partially responsible for the elevated expression of fascin. PMID:26058854

  13. Catalyzed enzyme electrodes

    DOEpatents

    Zawodzinski, Thomas A.; Wilson, Mahlon S.; Rishpon, Judith; Gottesfeld, Shimshon

    1993-01-01

    An enzyme electrode is prepared with a composite coating on an electrical conductor. The composite coating is formed from a casting solution of a perfluorosulfonic acid polymer, an enzyme, and a carbon supported catalyst. The solution may be cast directly on the conductor surface or may be formed as a membrane and applied to the surface. The perfluorosulfonic acid ionomer formed from the casting solution provides an insoluble biocompatible protective matrix for the enzyme and acts to retain the enzyme for long term availability in the electrode structure. The carbon supported catalyst provides catalytic sites throughout the layer for the oxidation of hydrogen peroxide from the enzyme reactions. The carbon support then provides a conductive path for establishing an electrical signal to the electrical conductor. In one embodiment, the electrical conductor is a carbon cloth that permits oxygen or other gas to be introduced to the perfluorosulfonic polymer to promote the enzyme reaction independent of oxygen in the solution being tested.

  14. Rational enzyme redesign

    SciTech Connect

    Ornstein, R.L.

    1994-05-01

    Protein engineering is first a means of elucidating structure-function relations in an enzyme, and second, a means of changing a protein to make it serve a different, but generally related, purpose. In principle, one may change the functional characteristics of an enzyme by altering its substrate specificity, kinetics, optimum range of activity, and chemical mechanism. Obviously one cannot make all possible combinations of amino acid changes for even the smallest enzyme, so the essential question is which changes to make. The intent of rational protein/enzyme redesign is to alter a protein/enzyme in a timely and premeditated fashion. This article provides an outline of the process of rational enzyme redesign.

  15. Magnetically responsive enzyme powders

    NASA Astrophysics Data System (ADS)

    Pospiskova, Kristyna; Safarik, Ivo

    2015-04-01

    Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (-20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties.

  16. Chloroplast and Cytoplasmic Enzymes

    PubMed Central

    Anderson, Louise E.; Pacold, Ivan

    1972-01-01

    Several peaks of aldolase activity are found in the isoelectric focusing pattern of pea (Pisum sativum) leaf chloroplast extracts. One peak, separated by 0.5 pH unit from the major chloroplast aldolase peak, is found when cytoplasmic extracts are focused. The chloroplast and cytoplasmic enzymes have a pH 7.4 optimum with fructose 1,6-diphosphate. The Michaelis constant for fructose-1,6-diphosphate is 19 μM for the chloroplast, 21 μM for the cytoplasmic enzyme, and for sedoheptulose 1,7-diphosphate, 8 μM for the chloroplast enzyme, 18 μM for the cytoplasmic enzyme. Both enzymes are inhibited by d-glyceraldehyde 3-phosphate and by ribulose 1,5-diphosphate. The similarity in the catalytic properties of the isoenzymes suggests that both enzymes have an amphibolic role in carbon metabolism in the green leaf. PMID:16657968

  17. Catalyzed enzyme electrodes

    SciTech Connect

    Zawodzinski, T.A.; Wilson, M.S.; Rishpon, J.; Gottesfeld, S.

    1992-12-31

    An enzyme electrode is prepared with a composite coating on an electrical conductor. The composite coating is formed from a casting solution of a perfluorosulfonic acid, polymer, an enzyme, and a carbon supported catalyst. The solution may be cast directly on the conductor surface or may be formed as a membrane and applied to the surface. The perfluorosulfonic acid ionomer formed from the casting solution provides an insoluble biocompatible protective matrix for the enzyme and acts to retain the enzyme for long term availability in the electrode structure. The carbon supported catalyst provides catalytic sites throughout the layer for the oxidation of hydrogen peroxide from the enzyme reactions. The carbon support then provides a conductive path for establishing an electrical signal to the electrical conductor. In one embodiment, the electrical conductor is a carbon cloth that permits oxygen or other gas to be introduced to the perfluorosulfonic polymer to promote the enzyme reaction independent of oxygen in the solution being tested.

  18. Catalyzed enzyme electrodes

    SciTech Connect

    Zawodzinski, T.A.; Wilson, M.S.; Rishpon, J.; Gottesfeld, S.

    1993-07-13

    An enzyme electrode is prepared with a composite coating on an electrical conductor. The composite coating is formed from a casting solution of a perfluorosulfonic acid polymer, an enzyme, and a carbon supported catalyst. The solution may be cast directly on the conductor surface or may be formed as a membrane and applied to the surface. The perfluorosulfonic acid ionomer formed from the casting solution provides an insoluble biocompatible protective matrix for the enzyme and acts to retain the enzyme for long term availability in the electrode structure. The carbon supported catalyst provides catalytic sites throughout the layer for the oxidation of hydrogen peroxide from the enzyme reactions. The carbon support then provides a conductive path for establishing an electrical signal to the electrical conductor. In one embodiment, the electrical conductor is a carbon cloth that permits oxygen or other gas to be introduced to the perfluorosulfonic polymer to promote the enzyme reaction independent of oxygen in the solution being tested.

  19. Host cell killing by the West Nile Virus NS2B-NS3 proteolytic complex: NS3 alone is sufficient to recruit caspase-8-based apoptotic pathway

    SciTech Connect

    Ramanathan, Mathura P.; Chambers, Jerome A.; Pankhong, Panyupa; Chattergoon, Michael; Attatippaholkun, Watcharee; Dang, Kesen; Shah, Neelima; Weiner, David B. . E-mail: dbweiner@mail.med.upenn.edu

    2006-02-05

    The West Nile Virus (WNV) non-structural proteins 2B and 3 (NS2B-NS3) constitute the proteolytic complex that mediates the cleavage and processing of the viral polyprotein. NS3 recruits NS2B and NS5 proteins to direct protease and replication activities. In an effort to investigate the biology of the viral protease, we cloned cDNA encoding the NS2B-NS3 proteolytic complex from brain tissue of a WNV-infected dead crow, collected from the Lower Merion area (Merion strain). Expression of the NS2B-NS3 gene cassette induced apoptosis within 48 h of transfection. Electron microscopic analysis of NS2B-NS3-transfected cells revealed ultra-structural changes that are typical of apoptotic cells including membrane blebbing, nuclear disintegration and cytoplasmic vacuolations. The role of NS3 or NS2B in contributing to host cell apoptosis was examined. NS3 alone triggers the apoptotic pathways involving caspases-8 and -3. Experimental results from the use of caspase-specific inhibitors and caspase-8 siRNA demonstrated that the activation of caspase-8 was essential to initiate apoptotic signaling in NS3-expressing cells. Downstream of caspase-3 activation, we observed nuclear membrane ruptures and cleavage of the DNA-repair enzyme, PARP in NS3-expressing cells. Nuclear herniations due to NS3 expression were absent in the cells treated with a caspase-3 inhibitor. Expression of protease and helicase domains themselves was sufficient to trigger apoptosis generating insight into the apoptotic pathways triggered by NS3 from WNV.

  20. Human Photoreactivating Enzyme

    PubMed Central

    Sutherland, J. C.; Sutherland, B. M.

    1975-01-01

    The action spectrum for photoreactivation by enzymes from human leukocytes and fibroblasts extends from 300 to approximately 600 nm with a maximum near 400 nm. The ability of the human enzymes to utilize light of wavelengths greater than 500 nm suggested that yellow or gold lights conventionally used as safelights for photoreactivation might serve as sources of photoreactivating light for these enzymes. Experiments using lights with a range of spectral outputs confirm that the standard yellow “safe” lights do produce photoreactivation by the human but not the Escherichia coli enzyme. PMID:19211015

  1. Adenylate-forming enzymes.

    PubMed

    Schmelz, Stefan; Naismith, James H

    2009-12-01

    Thioesters, amides, and esters are common chemical building blocks in a wide array of natural products. The formation of these bonds can be catalyzed in a variety of ways. For chemists, the use of an activating group is a common strategy and adenylate enzymes are exemplars of this approach. Adenylating enzymes activate the otherwise unreactive carboxylic acid by transforming the normal hydroxyl leaving group into adenosine monophosphate. Recently there have been a number of studies of such enzymes and in this review we suggest a new classification scheme. The review highlights the diversity in enzyme fold, active site architecture, and metal coordination that has evolved to catalyze this particular reaction. PMID:19836944

  2. Nanostructures for enzyme stabilization

    SciTech Connect

    Kim, Jungbae; Grate, Jay W.; Wang, Ping

    2006-02-02

    The last decade has witnessed notable breakthroughs in nanotechnology with development of various nanostructured materials such as mesoporous materials and nanoparticles. These nanostructures have been used as a host for enzyme immobilization via various approaches, such as enzyme adsorption, covalent attachment, enzyme encapsulation, and sophisticated combinations of methods. This review discusses the stabilization mechanisms behind these diverse approaches; such as confinement, pore size and volume, charge interaction, hydrophobic interaction, and multipoint attachment. In addition, we will introduce recent rigorous approaches to improve the enzyme stability in these nanostructures or develop new nanostructures for the enzyme stabilization. Especially, we will introduce our recent invention of a nanostructure, called single enzyme nanoparticles (SENs). In the form of SENs, each enzyme molecule is surrounded with a nanometer scale network, resulting in stabilization of enzyme activity without any serious limitation for the substrate transfer from solution to the active site. SENs can be further immobilized into mesoporous silica with a large surface area, providing a hierarchical approach for stable, immobilized enzyme systems for various applications, such as bioconversion, bioremediation, and biosensors.

  3. Apoptotic effect of noscapine in breast cancer cell lines.

    PubMed

    Quisbert-Valenzuela, Edwin O; Calaf, Gloria M

    2016-06-01

    Cancer is a public health problem in the world and breast cancer is the most frequently cancer in women. Approximately 15% of the breast cancers are triple-negative. Apoptosis regulates normal growth, homeostasis, development, embryogenesis and appropriate strategy to treat cancer. Bax is a protein pro-apoptotic enhancer of apoptosis in contrast to Bcl-2 with antiapoptotic properties. Initiator caspase-9 and caspase-8 are features of intrinsic and extrinsic apoptosis pathway, respectively. NF-κB is a transcription factor known to be involved in the initiation and progression of breast cancer. Noscapine, an alkaloid derived from opium is used as antitussive and showed antitumor properties that induced apoptosis in cancer cell lines. The aim of the present study was to determine the apoptotic effect of noscapine in breast cancer cell lines compared to breast normal cell line. Three cell lines were used: i) a control breast cell line MCF-10F; ii) a luminal-like adenocarcinoma triple-positive breast cell line MCF-7; iii) breast cancer triple-negative cell line MDA-MB-231. Our results showed that noscapine had lower toxicity in normal cells and was an effective anticancer agent that induced apoptosis in breast cancer cells because it increases Bax gene and protein expression in three cell lines, while decreases Bcl-xL gene expression, and Bcl-2 protein expression decreased in breast cancer cell lines. Therefore, Bax/Bcl-2 ratio increased in the three cell lines. This drug increased caspase-9 gene expression in breast cancer cell lines and caspase-8 gene expression increased in MCF-10F and MDA-MB-231. Furthermore, it increased cleavage of caspase-8, suggesting that noscapine-induced apoptosis is probably due to the involvement of extrinsic and intrinsic apoptosis pathways. Antiapoptotic gene and protein expression diminished and proapoptotic gene and protein expression increased noscapine-induced expression, probably due to decrease in NF-κB gene and protein expression

  4. Photochemical escape of oxygen from the Martian atmosphere: first results from MAVEN

    NASA Astrophysics Data System (ADS)

    Lillis, Rob; Deigan, Justin; Fox, Jane; Bougher, Steve; Lee, Yuni; Cravens, Thomas; Rahmati, Ali; Jakosky, Bruce

    2015-04-01

    One of the primary goals of the MAVEN mission is to characterize rates of atmospheric escape at the present epoch and relate those escape rates to solar drivers. One of the major escape processes is known as photochemical escape, which is broadly defined as a process by which a) an exothermic reaction in the atmosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through any subsequent collisions. At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher. Thus characterizing this escape process is central to understanding the role escape to space has played in Mars' climate evolution. Because escaping hot atoms cannot easily be directly measured, models of production and transport (through the atmosphere) of such atoms must be used to constrain escape rates. These models require altitude profiles of neutral densities and electron and ion densities and temperatures, as well as compositional information. All the relevant quantities upon which photochemical escape depends will be measured by MAVEN at the relevant altitudes (150-250 km). LPW will measure electron density and temperature, NGIMS will measure neutral and ion density and STATIC will measure ion density and temperature. 4 separate calculations must be made for every altitude profile: Profiles of O2+dissociative recombination (DR) rates will be calculated straightforwardly from electron temperature, electron density and O2+density. Profiles of rotational and vibrational distributions of O2+ ions will be calculated from profiles of CO2, O, O2, O+, CO2+ and CO+ via a lookup table from an empirical model. Profiles of energy distributions of hot O atoms will be calculated from the results of step 2 and from profiles of electron and ion temperatures. Profiles of all neutral

  5. The density and thermal structure of Pluto's atmosphere and associated escape processes and rates

    NASA Astrophysics Data System (ADS)

    Zhu, Xun; Strobel, Darrell F.; Erwin, Justin T.

    2014-01-01

    The original Strobel et al. (Strobel, D.F., Zhu, X., Summers, M.E., Stevens, M.E. [1996]. Icarus 120, 266-289) model for Pluto's stratospheric density and thermal structure is augmented to include a radial momentum equation with radial velocity associated with atmospheric escape of N2 and in the energy equation to also include the solar far ultraviolet and extreme ultraviolet (FUV-EUV) heating in the upper atmosphere and adiabatic cooling due to hydrodynamic expansion. The inclusion of radial velocity introduces important negative feedback processes such as increased solar heating leading to enhanced escape rate and higher radial velocity with stronger adiabatic cooling in the upper atmosphere accompanied by reduced temperature. The coupled set of equations for mass, momentum, and energy are solved subject to two types of upper boundary conditions that represent two different descriptions of atmospheric escape: Jeans escape and hydrodynamic escape. For the former which is physically correct, an enhanced Jeans escape rate is prescribed at the exobase and parameterized according to the direct simulation Monte Carlo kinetic model results. For the latter, the atmosphere is assumed to remain a fluid to infinity with the escape rate determined by the temperature and density at the transonic point subject to vanishing temperature and pressure at infinity. For Pluto, the two escape descriptions approach the same limit when the exobase coincides with the transonic level and merge to a common escape rate ˜1028 N2 s-1 under elevated energy input. For Pluto's current atmosphere, the hydrodynamic approach underestimates the escape rate by about 13%. In all cases, the escape rate is limited by the solar FUV-EUV power input.

  6. MAVEN in situ measurements of photochemical escape of oxygen from Mars

    NASA Astrophysics Data System (ADS)

    Lillis, Robert; Deighan, Justin; Fox, Jane; Bougher, Stephen; Lee, Yuni; Cravens, Thomas; Rahmati, Ali; Mahaffy, Paul; Benna, Mehdi; Groller, Hannes; Jakosky, Bruce

    2016-04-01

    One of the primary goals of the MAVEN mission is to characterize rates of atmospheric escape from Mars at the present epoch and relate those escape rates to solar drivers. One of the known escape processes is photochemical escape, where a) an exothermic chemical reaction in the atmosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through subsequent collisions. At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher. Thus characterizing this escape process and its variability with solar drivers is central to understanding the role escape to space has played in Mars' climate evolution. We use near-periapsis (<400 km altitude) data from three MAVEN instruments: the Langmuir Probe and Waves (LPW) instrument measures electron density and temperature, the Suprathermal And Thermal Ion Composition (STATIC) experiment measures ion temperature and the Neutral Gas and Ion Mass Spectrometer (NGIMS) measures neutral and ion densities. For each profile of in situ measurements, we make several calculations, each as a function of altitude. The first uses electron and temperatures and simulates the dissociative recombination of both O2+ and CO2+ to calculate the probability distribution for the initial energies of the resulting hot oxygen atoms. The second is a Monte Carlo hot atom transport model that takes that distribution of initial O energies and the measured neutral density profiles and calculates the probability that a hot atom born at that altitude will escape. The third takes the measured electron and ion densities and electron temperatures and calculates the production rate of hot O atoms. We then multiply together the profiles of hot atom production and escape probability to get profiles of the production rate of escaping atoms

  7. Bak apoptotic function is not directly regulated by phosphorylation.

    PubMed

    Tran, V H; Bartolo, R; Westphal, D; Alsop, A; Dewson, G; Kluck, R M

    2013-01-01

    During apoptosis, Bak and Bax permeabilize the mitochondrial outer membrane by undergoing major conformational change and oligomerization. This activation process in Bak is reported to require dephosphorylation of tyrosine-108 close to an activation trigger site. To investigate how dephosphorylation of Bak contributes to its activation and conformational change, one-dimensional isoelectric focusing (1D-IEF) and mutagenesis was used to monitor Bak phosphorylation. On 1D-IEF, Bak extracted from a range of cell types migrated as a single band near the predicted isoelectric point of 5.6 both before and after phosphatase treatment, indicating that Bak is not significantly phosphorylated at any residue. In contrast, three engineered 'phosphotagged' Bak variants showed a second band at lower pI, indicating phosphorylation. Apoptosis induced by several stimuli failed to alter Bak pI, indicating little change in phosphorylation status. In addition, alanine substitution of tyrosine-108 and other putative phosphorylation sites failed to enhance Bak activation or pro-apoptotic function. In summary, Bak is not significantly phosphorylated at any residue, and Bak activation during apoptosis does not require dephosphorylation. PMID:23303126

  8. A review on antiproliferative and apoptotic activities of natural honey.

    PubMed

    Jaganathan, Saravana Kumar; Balaji, Arunpandian; Vellayappan, Muthu Vignesh; Asokan, Manjesh Kumar; Subramanian, Aruna Priyadharshni; John, Agnes Aruna; Supriyanto, Eko; Razak, Saiful Izwan Abd; Marvibaigi, Mohsen

    2015-01-01

    Recent statistics revealed that cancer is one among the main reasons for death throughout the world. Several treatments are available but still there is no cure when it is detected at late stages. One of the treatment modes for cancer is chemotherapy which utilizes anticancer drugs in order to eradicate the cancer cells by apoptosis. Apoptosis is a programmed cell death through which body maintains homeostasis or kills cancer cells by utilizing its cell machinery. Recent researches have concluded that dietary agents have a putative role in instituting apoptosis of cancer cells. Honey, one of the victuals rich in antioxidants, has a long-standing exposure to humans and its role in cancer prevention and treatment is a topic of current interest. Various researchers have been experimenting honey against different cancers and provided valuable insights about the apoptosis induced by the honey. This review will highlight the recent findings of apoptotic mechanism involved in different cancer cells. Further it also reports antitumor activity of honey in some animal models. Hence it is high-time to initiate more preclinical trials as well as clinical experiments which would further add to the knowledge of anticancer nature of honey and also endorse honey as a potential candidate in the war against cancer. PMID:25052987

  9. Synthesis, antiproliferative and pro-apoptotic activity of 2-phenylindoles.

    PubMed

    Kelly, Patrick M; Bright, Sandra A; Fayne, Darren; Pollock, Jade K; Zisterer, Daniela M; Williams, D Clive; Meegan, Mary J

    2016-09-15

    Breast cancer is the second most common cancer worldwide after lung cancer with the vast majority of early stage breast cancers being hormone-dependent. One of the major therapeutic advances in the clinical treatment of breast cancer has been the introduction of selective estrogen receptor modulators (SERMs). We describe the design and synthesis of novel SERM type ligands based on the 2-arylindole scaffold to selectively target the estrogen receptor in hormone dependent breast cancers. Some of these novel compounds are designed as bisindole type structures, while others are conjugated to a cytotoxic agent based on combretastatin A4 (CA4) which is a potent inhibitor of tubulin polymerisation. The indole compounds synthesised within this project such as 31 and 86 demonstrate estrogen receptor (ER) binding and strong antiproliferative activity in the ER positive MCF-7 breast cancer cell line with IC50 values of 2.71μM and 1.86μM respectively. These active compounds induce apoptotic activity in MCF-7 cells with minimal effects on normal peripheral blood cells. Their strong anti-cancer effect is likely mediated by the presence of two ER binding ligands for 31 and an ER binding ligand combined with a cytotoxic agent for 86. PMID:27407030

  10. Non-apoptotic cell death associated with perturbations of macropinocytosis

    PubMed Central

    Maltese, William A.; Overmeyer, Jean H.

    2015-01-01

    Although macropinocytosis is widely recognized as a distinct form of fluid-phase endocytosis in antigen-presenting dendritic cells, it also occurs constitutively in many other normal and transformed cell types. Recent studies have established that various genetic or pharmacological manipulations can hyperstimulate macropinocytosis or disrupt normal macropinosome trafficking pathways, leading to accumulation of greatly enlarged cytoplasmic vacuoles. In some cases, this extreme vacuolization is associated with a unique form of non-apoptotic cell death termed “methuosis,” from the Greek methuo (to drink to intoxication). It remains unclear whether cell death related to dysfunctional macropinocytosis occurs in normal physiological contexts. However, the finding that some types of cancer cells are particularly vulnerable to this unusual form of cell death has raised the possibility that small molecules capable of altering macropinosome trafficking or function might be useful as therapeutic agents against cancers that are resistant to drugs that work by inducing apoptosis. Herein we review examples of cell death associated with dysfunctional macropinocytosis and summarize what is known about the underlying mechanisms. PMID:25762935

  11. Microparticles from apoptotic platelets promote resident macrophage differentiation

    PubMed Central

    Vasina, E M; Cauwenberghs, S; Feijge, M A H; Heemskerk, J W M; Weber, C; Koenen, R R

    2011-01-01

    Platelets shed microparticles not only upon activation, but also upon ageing by an apoptosis-like process (apoptosis-induced platelet microparticles, PMap). While the activation-induced microparticles have widely been studied, not much is known about the (patho)physiological consequences of PMap formation. Flow cytometry and scanning electron microscopy demonstrated that PMap display activated integrins and interact to form microparticle aggregates. PMap were chemotactic for monocytic cells, bound to these cells, an furthermore stimulated cell adhesion and spreading on a fibronectin surface. After prolonged incubation, PMap promoted cell differentiation, but inhibited proliferation. Monocyte membrane receptor analysis revealed increased expression levels of CD11b (integrin αMβ2), CD14 and CD31 (platelet endothelial cell adhesion molecule-1), and the chemokine receptors CCR5 and CXCR4, but not of CCR2. This indicated that PMap polarized the cells into resident M2 monocytes. Cells treated with PMap actively consumed oxidized low-density lipoprotein (oxLDL), and released matrix metalloproteinases and hydrogen peroxide. Further confirmation for the differentiation towards resident professional phagocytes came from the finding that PMap stimulated the expression of the (ox)LDL receptors, CD36 and CD68, and the production of proinflammatory and immunomodulating cytokines by monocytes. In conclusion, interaction of PMap with monocytic cells has an immunomodulating potential. The apoptotic microparticles polarize the cells into a resident M2 subset, and induce differentiation to resident professional phagocytes. PMID:21956548

  12. v-Src Generates a p53-Independent Apoptotic Signal

    PubMed Central

    Webb, Brian L.; Jimenez, Elsa; Martin, G. Steven

    2000-01-01

    Evasion of apoptosis appears to be a necessary event in tumor progression. Some oncogenes, such as c-myc and E1A, induce apoptosis in the absence of survival factors. However, others, such as bcl-2 and v-src, activate antiapoptotic pathways. For v-Src, these antiapoptotic pathways are dependent on the function of Ras, phosphatidylinositol (PI) 3-kinase, and Stat3. Here we asked whether v-Src can activate a proapoptotic signal when survival signaling is inhibited. We show that when the functions of Ras and PI 3-kinase are inhibited, v-src-transformed Rat-2 fibroblasts undergo apoptosis, evidenced by loss of adherence, nuclear fragmentation, and chromosomal DNA degradation. The apoptotic response is dependent on activation of caspase 3. Under similar conditions nontransformed Rat-2 cells undergo considerably lower levels of apoptosis. Apoptosis induced by v-Src is accompanied by a loss of mitochondrial membrane potential and release of cytochrome c and is blocked by overexpression of bcl-2, indicating that it is mediated by the mitochondrial pathway. However apoptosis induced by v-Src is not accompanied by an increase in the level of p53 and is not dependent on p53 function. Thus v-Src generates a p53-independent proapoptotic signal. PMID:11094078

  13. Cytoprotective and pro-apoptotic activities of native Australian herbs polyphenolic-rich extracts.

    PubMed

    Sakulnarmrat, Karunrat; Fenech, Michael; Thomas, Philip; Konczak, Izabela

    2013-01-01

    Three commercially grown native herbs unique to Australia, Tasmannia pepper leaf (Tasmannia lanceolata R. Br., Winteracea; TPL), anise myrtle (Syzygium anisatum Vickery, Craven & Biffen, Myrtaceae; AM) and lemon myrtle (Backhousia citriodora F. Muell, Myrtaceae; LM) as well as a reference sample bay leaf (Laurus nobilis L., Lauraceae; BL) were examined for potential cytoprotective properties. All native herbs exhibited greater cellular antioxidant activity as measured by the cellular antioxidant activity (CAA) assay than bay leaf and reduced the hydrogen peroxide (H(2)O(2)) induced death of hepatocellular carcinoma (HepG2) cells by 25-50%. All herb extracts reduced the proliferation of colon (HT-29; IC(50)=0.75-1.39mg/ml), stomach (AGS; IC(50)=0.59-1.88mg/ml), bladder (BL13; IC(50)=0.56-1.12mg/ml) and liver (HepG2; IC(50)=0.38-1.36mg/ml) cancer cells. No significant reduction of cell viability of non-transformed colon (CCD-18Co; IC(50)>2.0mg/ml) and mixed stomach and intestine (Hs 738.St/Int; IC(50)>2.0mg/ml) cells was observed. Flow cytometry analysis and the results of the cytokinesis block micronucleus cytome (CBMNCyt) assay conducted with respectively, promyelocytic leukaemia (HL-60) and colon adenocarcinoma (HT-29) cells suggest an increase in apoptosis following treatment with the herb extracts. The occurrence of apoptotic cells coincided with an increase in caspase-3 enzyme activity. The results of the CBMNCyt assay suggested no direct DNA damage in colon adenocarcinoma (HT-29) cells as a result of treatment with all extracts, applied at final concentrations of 0.5 and 1.0mg/ml. PMID:23017386

  14. Apoptotic cells trigger a membrane-initiated pathway to increase ABCA1.

    PubMed

    Fond, Aaron M; Lee, Chang Sup; Schulman, Ira G; Kiss, Robert S; Ravichandran, Kodi S

    2015-07-01

    Macrophages clear millions of apoptotic cells daily and, during this process, take up large quantities of cholesterol. The membrane transporter ABCA1 is a key player in cholesterol efflux from macrophages and has been shown via human genetic studies to provide protection against cardiovascular disease. How the apoptotic cell clearance process is linked to macrophage ABCA1 expression is not known. Here, we identified a plasma membrane-initiated signaling pathway that drives a rapid upregulation of ABCA1 mRNA and protein. This pathway involves the phagocytic receptor brain-specific angiogenesis inhibitor 1 (BAI1), which recognizes phosphatidylserine on apoptotic cells, and the intracellular signaling intermediates engulfment cell motility 1 (ELMO1) and Rac1, as ABCA1 induction was attenuated in primary macrophages from mice lacking these molecules. Moreover, this apoptotic cell-initiated pathway functioned independently of the liver X receptor (LXR) sterol-sensing machinery that is known to regulate ABCA1 expression and cholesterol efflux. When placed on a high-fat diet, mice lacking BAI1 had increased numbers of apoptotic cells in their aortic roots, which correlated with altered lipid profiles. In contrast, macrophages from engineered mice with transgenic BAI1 overexpression showed greater ABCA1 induction in response to apoptotic cells compared with those from control animals. Collectively, these data identify a membrane-initiated pathway that is triggered by apoptotic cells to enhance ABCA1 within engulfing phagocytes and with functional consequences in vivo. PMID:26075824

  15. Apoptotic cells trigger a membrane-initiated pathway to increase ABCA1

    PubMed Central

    Fond, Aaron M.; Lee, Chang Sup; Schulman, Ira G.; Kiss, Robert S.; Ravichandran, Kodi S.

    2015-01-01

    Macrophages clear millions of apoptotic cells daily and, during this process, take up large quantities of cholesterol. The membrane transporter ABCA1 is a key player in cholesterol efflux from macrophages and has been shown via human genetic studies to provide protection against cardiovascular disease. How the apoptotic cell clearance process is linked to macrophage ABCA1 expression is not known. Here, we identified a plasma membrane–initiated signaling pathway that drives a rapid upregulation of ABCA1 mRNA and protein. This pathway involves the phagocytic receptor brain-specific angiogenesis inhibitor 1 (BAI1), which recognizes phosphatidylserine on apoptotic cells, and the intracellular signaling intermediates engulfment cell motility 1 (ELMO1) and Rac1, as ABCA1 induction was attenuated in primary macrophages from mice lacking these molecules. Moreover, this apoptotic cell–initiated pathway functioned independently of the liver X receptor (LXR) sterol–sensing machinery that is known to regulate ABCA1 expression and cholesterol efflux. When placed on a high-fat diet, mice lacking BAI1 had increased numbers of apoptotic cells in their aortic roots, which correlated with altered lipid profiles. In contrast, macrophages from engineered mice with transgenic BAI1 overexpression showed greater ABCA1 induction in response to apoptotic cells compared with those from control animals. Collectively, these data identify a membrane-initiated pathway that is triggered by apoptotic cells to enhance ABCA1 within engulfing phagocytes and with functional consequences in vivo. PMID:26075824

  16. O Death Where Is Thy Sting? Immunologic Tolerance To Apoptotic Self

    PubMed Central

    Ravishankar, Buvana; McGaha, Tracy L.

    2013-01-01

    In higher organisms, innate scavenging cells maintain physiologic homeostasis by removal of the billions of apoptotic cells generated on a daily basis. Apoptotic cell removal requires efficient recognition and uptake by professional and non-professional phagocytic cells, which are governed by an array of soluble and apoptotic cell-integral signals resulting in immunologically silent clearance. While apoptosis is associated with profound suppression of adaptive and innate inflammatory immunity, we have only begun to scratch the surface in understanding how immunologic tolerance to apoptotic self manifest at either the molecular or cellular level. In the last 10 years data has emerged implicating professional phagocytes, most notably stromal macrophages and CD8α+CD103+ dendritic cells, as critical in initiation of the regulatory cascade that will ultimately lead to long-term whole animal immune tolerance. Importantly, recent work by our lab and others has shown that alterations in apoptotic cell perception by the innate immune system either by removal of critical phagocytic sentinels in secondary lymphoid organs or blockage of immunosuppressive pathways leads to pronounced inflammation with a breakdown of tolerance towards self. This challenges the paradigm that apoptotic cells are inherently immunosuppressive suggesting that apoptotic cell tolerance is a “context dependent” event. PMID:23377225

  17. Molecular dynamics simulation and automated docking of the pro-apoptotic Bax protein and its complex with a peptide designed from the Bax-binding domain of anti-apoptotic Ku70.

    PubMed

    Mancinelli, Fabrizio; Caraglia, Michele; Budillon, Alfredo; Abbruzzese, Alberto; Bismuto, Ettore

    2006-09-01

    Bax, a multi-domain protein belonging to the large family of Bcl-2 proteins, has a pivotal role for the initiation of the cytochrome c-mediated apoptosis, a vital physiologic process to eliminate damaged or unwanted cells. In response to specific stimuli Bax translocates from cytosol to mitochondria outer membrane where a process of oligomerization occurs with pore formation through which cytochrome c and other death molecules escape. The pro-death action of Bax is regulated by the interaction with other pro-survival proteins. However, the conformational changes and the structural details necessary for homo and hetero interaction with other regulating proteins are largely unknown. This article reports a combined investigation of molecular dynamics (MD) simulation and automated docking that evidence the molecular regions of Bax involved in the binding with anti-apoptotic exapeptide (Bip) designed from Ku70, a subunit of the protein complex essential for non-homologous DNA repair but that inhibits also the Bax translocation to mitochondria. Since Bip suppresses apoptosis induced by several anti-cancer drugs, it appears relevant to achieve a better understanding of the structural and dynamical aspects that characterize the Bip-Bax complex in view of potential therapeutic implications. The present results show that the Bax region with the highest affinity for Bip is located in proximity of BH3 homology domain of Bax and also involves the alpha-helices 1 and 8. Moreover, the comparison of essential motions of Bax at 300 and 400 K before and after the formation of the complex with Bip evidences how the binding with the exa-peptide affects the collective motions of specific molecular districts of Bax considered to have functional relevance. PMID:16619258

  18. 50 CFR Figure 12 to Part 223 - Escape Opening & Cover Dimensions for 71-inch TED

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 9 2011-10-01 2011-10-01 false Escape Opening & Cover Dimensions for 71-inch TED 12 Figure 12 to Part 223 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL... ANADROMOUS SPECIES Pt. 223, Fig. 12 Figure 12 to Part 223—Escape Opening & Cover Dimensions for 71-inch...

  19. 50 CFR Figure 12 to Part 223 - Escape Opening & Cover Dimensions for 71-inch TED

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Escape Opening & Cover Dimensions for 71-inch TED 12 Figure 12 to Part 223 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL... ANADROMOUS SPECIES Pt. 223, Fig. 12 Figure 12 to Part 223—Escape Opening & Cover Dimensions for 71-inch...

  20. Computer Self-Efficacy, Competitive Anxiety and Flow State: Escaping from Firing Online Game

    ERIC Educational Resources Information Center

    Hong, Jon-Chao; Pei-Yu, Chiu; Shih, Hsiao-Feng; Lin, Pei-Shin; Hong, Jon-Chao

    2012-01-01

    Flow state in game playing affected by computer self-efficacy and game competitive anxiety was studied. In order to examine the effect of those constructs with high competition, this study select "Escaping from firing online game" which require college students to escape from fire and rescue people and eliminate the fire damage along the way of…