Science.gov

Sample records for apoptotic enzymes escape

  1. Evidence for genes associated with the ability of Mycobacterium avium subsp. hominissuis to escape apoptotic macrophages

    PubMed Central

    Bermudez, Luiz E.; Danelishvili, Lia; Babrack, Lmar; Pham, Tuan

    2015-01-01

    Mycobacterium avium subsp. hominissuis (MAH) is an environmental bacteria that infects immunocompromised humans. MAH cases are increasing in incidence, making it crucial to gain knowledge of the pathogenic mechanisms associated with the bacterium. MAH infects macrophages and after several days the infection triggers the phagocyte apoptosis. Many of the intracellular MAH escape the cell undergoing apoptosis leading to infection of neighboring macrophages. We screened a transposon bank of MAH mutants in U937 mononuclear phagocytes for the inability to escape macrophages undergoing apoptosis. Mutations in genes; MAV_2235, MAV_2120, MAV_2410, and MAV_4563 resulted in the inability of the bacteria to exit macrophages upon apoptosis. Complementation of the mutations corrected the phenotype either completely or partially. Testing for the ability of the mutants to survive in macrophages compared to the wild-type bacterium revealed that the mutant clones were not attenuated up to 4 days of infection. Testing in vivo, however, demonstrated that all the MAH clones were attenuated compared with the wild-type MAC 104 in tissues of mice. Although the mechanism associated with the bacterial inability to leave apoptotic macrophages is unknown, the identification of macrophage cytoplasm targets for the MAH proteins suggest that they interfere either with protein degradation machinery or post-translation mechanisms. The identification of tatC as a MAH protein involved in the ability of MAH to leave macrophages, suggests that secreted effector(s) are involved in the process. The study reveals a pathway of escape from macrophages, not shared with Mycobacterium tuberculosis. PMID:26380226

  2. Echinacoside induces apoptotic cancer cell death by inhibiting the nucleotide pool sanitizing enzyme MTH1

    PubMed Central

    Dong, Liwei; Wang, Hongge; Niu, Jiajing; Zou, Mingwei; Wu, Nuoting; Yu, Debin; Wang, Ye; Zou, Zhihua

    2015-01-01

    Inhibition of the nucleotide pool sanitizing enzyme MTH1 causes extensive oxidative DNA damages and apoptosis in cancer cells and hence may be used as an anticancer strategy. As natural products have been a rich source of medicinal chemicals, in the present study, we used the MTH1-catalyzed enzymatic reaction as a high-throughput in vitro screening assay to search for natural compounds capable of inhibiting MTH1. Echinacoside, a compound derived from the medicinal plants Cistanche and Echinacea, effectively inhibited the catalytic activity of MTH1 in an in vitro assay. Treatment of various human cancer cell lines with Echinacoside resulted in a significant increase in the cellular level of oxidized guanine (8-oxoguanine), while cellular reactive oxygen species level remained unchanged, indicating that Echinacoside also inhibited the activity of cellular MTH1. Consequently, Echinacoside treatment induced an immediate and dramatic increase in DNA damage markers and upregulation of the G1/S-CDK inhibitor p21, which were followed by marked apoptotic cell death and cell cycle arrest in cancer but not in noncancer cells. Taken together, these studies identified a natural compound as an MTH1 inhibitor and suggest that natural products can be an important source of anticancer agents. PMID:26677335

  3. Induced resistance enzymes in wild plants-do `early birds' escape from pathogen attack?

    NASA Astrophysics Data System (ADS)

    Heil, Martin; Ploss, Kerstin

    2006-09-01

    Systemic acquired resistance (SAR) of plants to pathogens is a well-defined phenomenon. The underlying signalling pathways and its application in crop protection are intensively studied. However, most studies are conducted on crop plants or on Arabidopsis as a model plant. The taxonomic distribution of this phenomenon and its dependence on life history are thus largely unknown. We quantified activities of three classes of resistance-related enzymes in 18 plant species to investigate whether plants with varying life histories differ in their investment in disease resistance. Enzyme activities were quantified in untreated plants, and in plants induced with BION, a chemical resistance elicitor. All species showed constitutive activities of chitinase, peroxidase, or glucanase. However, constitutive chitinase activities varied by 30 times, and peroxidase by 50 times, among species. Several species did not respond to the induction treatment, while enzyme activities in other species increased more than threefold after BION application. Plant species differ dramatically in the presence and inducibility of resistance enzymes. This variation could be related to life history: While all resistance enzymes were significantly induced in larger perennial plants that flower during summer, spring geophytes hardly showed inducible resistance. These plants grow in an environment that is characterised by a low-pathogen pressure, and thus may simply ‘escape’ from infection. Our study presents the first comparative data set on resistance-related enzymes in noncultivated plants. The current view on SAR—narrowed by the concentration on cultivated crops—is not sufficient to understand the ecological and evolutionary relevance of this widespread plant trait.

  4. A new insight into phagocytosis of apoptotic cells: proteolytic enzymes divert the recognition and clearance of polymorphonuclear leukocytes by macrophages.

    PubMed

    Guzik, K; Bzowska, M; Smagur, J; Krupa, O; Sieprawska, M; Travis, J; Potempa, J

    2007-01-01

    The recognition of phosphatidylserine (PS) on the surface of any apoptotic cell is considered to be a key event for its clearance. We challenge this concept by showing that pretreatment of neutrophils with either host or bacterial protease affects their uptake by human monocyte-derived macrophages without having an effect on cell-surface PS presentation. Specifically, whereas preincubation of apoptotic neutrophils with cathepsin G or thrombin significantly inhibited their uptake, gingipains R or clostripain enhanced phagocytosis by macrophages. Moreover, bacterial proteinases sensitized healthy neutrophils for uptake by macrophages, whereas endogenous proteinases were unable to elicit this effect. This stimulation was apparently owing to the combined effect of proteolytic cleavage of an antiphagocytic signal (CD31) and the generation of a novel 'eat-me' signal on the neutrophil surface. These results argue that neutrophil recognition and phagocytosis by macrophages is mediated by a protein ligand whose proteolytic modification could affect the local inflammatory process. PMID:16628232

  5. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  6. Enzyme

    MedlinePlus

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  7. Inhibition of ROS-induced apoptosis in endothelial cells by nitrone spin traps via induction of phase II enzymes and suppression of mitochondria-dependent pro-apoptotic signaling

    PubMed Central

    Das, Amlan; Gopalakrishnan, Bhavani; Voss, Oliver H.; Doseff, Andrea I.; Villamena, Frederick A.

    2012-01-01

    Oxidative stress is the main etiological factor behind the pathogenesis of various diseases including inflammation, cancer, cardiovascular and neurodegenerative disorders. Due to the spin trapping abilities and various pharmacological properties of nitrones, their application as therapeutic agent has been gaining attention. Though the antioxidant properties of the nitrones are well known, the mechanisms by which they modulate the cellular defense machinery against oxidative stress is not well investigated and requires further elucidation. Here, we have investigated the mechanisms of cytoprotection of the nitrone spin traps against oxidative stress in bovine aortic endothelial cells (BAEC). Cytoprotective properties of both the cyclic nitrone 5,5-dimethyl-pyrroline N-oxide (DMPO) and linear nitrone alpha-phenyl N-tert-butyl nitrone (PBN) against H2O2-induced cytoxicity were investigated. Preincubation of BAEC with PBN or DMPO resulted in the inhibition of H2O2–mediated cytotoxicity and apoptosis. Nitrone-treatment resulted in the induction and restoration of phase II antioxidant enzymes via nuclear translocation of NF-E2-related factor 2 (Nrf-2) in oxidatively-challenged cells. Furthermore, the nitrones were found to inhibit the mitochondrial depolarization and subsequent activation of caspase-3 induced by H2O2. Significant down-regulation of the pro-apoptotic proteins p53 and Bax, and up-regulation of the anti-apoptotic proteins Bcl-2 and p-Bad were observed when the cells were preincubated with the nitrones prior to H2O2–treatment. It was also observed that Nrf-2 silencing completely abolished the protective effects of nitrones. Hence, these findings suggest that nitrones confer protection to the endothelial cells against oxidative stress by modulating phase II antioxidant enzymes and subsequently inhibiting mitochondria-dependent apoptotic cascade. PMID:22580046

  8. Single oral acute fluoride exposure causes changes in cardiac expression of oxidant and antioxidant enzymes, apoptotic and necrotic markers in male rats.

    PubMed

    Panneerselvam, Lakshmikanthan; Govindarajan, Vimal; Ameeramja, Jaishabanu; Nair, Harikumaran Raveendran; Perumal, Ekambaram

    2015-12-01

    Several studies have shown that acute fluoride (F(-)) exposure impairs cardiac function, but the molecular mechanism is not clear. In order to study this, male Wistar rats were treated with single oral doses of 45 and 90 mg/kg F(-) for 24 h. A significant accumulation of F(-) was found in the serum and myocardium of experimental rats. F(-) treatment causes myocardial necrosis as evident from increased levels of myocardial troponin I, creatine kinase, lactate dehydrogenase and aspartate transaminase. In addition, F(-) induces myocardial oxidative stress via increased reactive oxygen species, lipid peroxidation, protein carbonyl content and nitrate levels along with decreased in the levels of enzymatic (superoxide dismutase 2, catalase, glutathione peroxidase and glutathione s transferase pi class) and non-enzymatic (reduced glutathione) antioxidants. Notably, F(-) triggers myocardial apoptosis through altered Bax/Bcl2 ratio and increased cytochrome c, caspase 3p20 and terminal deoxynucleotidyl transferase dUTP nick end labeled positive cells. An increased cardiac expression of Nox4 and p38α MAPK in F(-) treated rats indicates the oxidative and apoptotic damage. Moreover, ultra-structural changes, histopathological and luxol fast blue staining demonstrates the degree of myocardial damage at subcellular level. Taken together, these findings reveal that acute F(-) exposure causes cardiac impairment by altering the expression of oxidative stress, apoptosis and necrotic markers. PMID:26455266

  9. Biochemical identification of a neutral sphingomyelinase 1 (NSM1)-like enzyme as the major NSM activity in the DT40 B-cell line: absence of a role in the apoptotic response to endoplasmic reticulum stress.

    PubMed Central

    Fensome, Amanda C; Josephs, Michelle; Katan, Matilda; Rodrigues-Lima, Fernando

    2002-01-01

    DT40 cells have approx. 10-fold higher Mg2+-dependent neutral sphingomyelinase (NSM) activity in comparison with other B-cell lines and contain very low acidic sphingomyelinase activity. Purification of this activity from DT40 cell membranes suggested the presence of one major NSM isoform. Although complete purification of this isoform could not be achieved, partially purified fractions were examined further with regard to the known characteristics of previously partially purified NSMs and the two cloned enzymes exhibiting in vitro NSM activity (NSM1 and NSM2). For a direct comparative study, highly purified brain preparations, purified NSM1 protein and Bacillus cereus enzyme were used. Analysis of the enzymic properties of the partially purified DT40 NSM, such as cation dependence, substrate specificity, redox regulation and stimulation by phosphatidylserine, together with the localization of this enzyme to the endoplasmic reticulum (ER), suggested that this NSM from DT40 cells corresponds to NSM1. Further studies aimed to correlate presence of the high levels of this NSM1-like activity in DT40 cells with the ability of these cells to accumulate ceramide and undergo apoptosis. When DT40 cells were stimulated to apoptose by a variety of agents, including the ER stress, an increase in endogenous ceramide levels was observed. However, these responses were not enhanced compared with another B-cell line (Nalm-6), characterized by low sphingomyelinase activity. In addition, DT40 cells were not more susceptible to ceramide accumulation and apoptosis when exposed to the ER stress compared with other apoptotic agents. Inhibition of de novo synthesis of ceramide partially inhibited its accumulation, indicating that the ceramide production in DT40 cells could be complex and, under some conditions, could involve both sphingomyelin hydrolysis and ceramide synthesis. PMID:12071841

  10. In the absence of cellular poly (A) binding protein, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53

    SciTech Connect

    Thangima Zannat, Mst.; Bhattacharjee, Rumpa B.; Bag, Jnanankur

    2011-06-03

    Highlights: {yields} PABP knock down and cell apoptosis. {yields} Nuclear translocation of GAPDH in PABP depleted cells. {yields} Role of p53 in apoptosis of PABP depleted cells. {yields} Bax translocation and cytochrome C release and caspase 3 activation following PABP depletion. {yields} Association of p53 with Bcl2 and Bax. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) interacts with 3' poly (A) tract of eukaryotic mRNA and is important for both translation and stability of mRNA. Previously, we have shown that depletion of PABP by siRNA prevents protein synthesis and consequently leads to cell death through apoptosis. In the present investigation, we studied the mechanism of cell apoptosis. We show that in the absence of PABP, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53. As a result, p53 translocated to the mitochondria to initiate Bax mediated apoptosis.

  11. Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis.

    PubMed

    Nath, R; Raser, K J; Stafford, D; Hajimohammadreza, I; Posner, A; Allen, H; Talanian, R V; Yuen, P; Gilbertsen, R B; Wang, K K

    1996-11-01

    The cytoskeletal protein non-erythroid alpha-spectrin is well documented as an endogenous calpain substrate, especially under pathophysiological conditions. In cell necrosis (e.g. maitotoxin-treated neuroblastoma SH-SY5Y cells), alpha-spectrin breakdown products (SBDPs) of 150 kDa and 145 kDa were produced by cellular calpains. In contrast, in neuronal cells undergoing apoptosis (cerebellar granule neurons subjected to low potassium and SH-SY5Y cells treated with staurosporine), an additional SBDP of 120 kDa was also observed. The formation of the 120 kDa SBDP was insensitive to calpain inhibitors but was completely blocked by an interleukin 1 beta-converting-enzyme (ICE)-like protease inhibitor, Z-Asp-CH2OC(O)-2,6-dichlorobenzene. Autolytic activation of both calpain and the ICE homologue CPP32 was also observed in apoptotic cells. alpha-Spectrin can also be cleaved in vitro by purified calpains to produce the SBDP doublet of 150/145 kDa and by ICE and ICE homologues [ICH-1, ICH-2 and CPP32(beta)] to produce a 150 kDa SBDP. In addition, CPP32 and ICE also produced a 120 kDa SBDP. Furthermore inhibition of either ICE-like protease(s) or calpain protects both granule neurons and SH-SY5Y cells against apoptosis. Our results suggest that both protease families participate in the expression of neuronal apoptosis. PMID:8920967

  12. The great escape

    PubMed Central

    Sin, Ho-Su; Namekawa, Satoshi H

    2013-01-01

    Epigenetic mechanisms precisely regulate sex chromosome inactivation as well as genes that escape the silencing process. In male germ cells, DNA damage response factor RNF8 establishes active epigenetic modifications on the silent sex chromosomes during meiosis, and activates escape genes during a state of sex chromosome-wide silencing in postmeiotic spermatids. During the course of evolution, the gene content of escape genes in postmeiotic spermatids recently diverged on the sex chromosomes. This evolutionary feature mirrors the epigenetic processes of sex chromosomes in germ cells. In this article, we describe how epigenetic processes have helped to shape the evolution of sex chromosome-linked genes. Furthermore, we compare features of escape genes on sex chromosomes in male germ cells to escape genes located on the single X chromosome silenced during X-inactivation in females, clarifying the distinct evolutionary implications between male and female escape genes. PMID:23880818

  13. Crew Escape Certification Test

    NASA Technical Reports Server (NTRS)

    1988-01-01

    This video tape shows the Shuttle hatch jettison test at Rockwell facilities. The video also shows a Shuttle escape pole deployment test from a NASA aircraft, and an emergency egress test performed by a volunteer Navy parachutist using the pole and a parachute escape system.

  14. Dust escape from Io

    NASA Astrophysics Data System (ADS)

    Flandes, Alberto

    2004-08-01

    The Dust ballerina skirt is a set of well defined streams composed of nanometric sized dust particles that escape from the Jovian system and may be accelerated up to >=200 km/s. The source of this dust is Jupiter's moon Io, the most volcanically active body in the Solar system. The escape of dust grains from Jupiter requires first the escape of these grains from Io. This work is basically devoted to explain this escape given that the driving of dust particles to great heights and later injection into the ionosphere of Io may give the particles an equilibrium potential that allow the magnetic field to accelerate them away from Io. The grain sizes obtained through this study match very well to the values required for the particles to escape from the Jovian system.

  15. THERMALLY DRIVEN ATMOSPHERIC ESCAPE

    SciTech Connect

    Johnson, Robert E.

    2010-06-20

    Accurately determining the escape rate from a planet's atmosphere is critical for determining its evolution. A large amount of Cassini data is now available for Titan's upper atmosphere and a wealth of data is expected within the next decade on escape from Pluto, Mars, and extra-solar planets. Escape can be driven by upward thermal conduction of energy deposited well below the exobase, as well as by nonthermal processes produced by energy deposited in the exobase region. Recent applications of a model for escape driven by upward thermal conduction, called the slow hydrodynamic escape model, have resulted in surprisingly large loss rates for the atmosphere of Titan, Saturn's largest moon. Based on a molecular kinetic simulation of the exobase region, these rates appear to be orders of magnitude too large. Therefore, the slow hydrodynamic model is evaluated here. It is shown that such a model cannot give a reliable description of the atmospheric temperature profile unless it is coupled to a molecular kinetic description of the exobase region. Therefore, the present escape rates for Titan and Pluto must be re-evaluated using the atmospheric model described here.

  16. Escape behaviors in insects.

    PubMed

    Card, Gwyneth M

    2012-04-01

    Escape behaviors are, by necessity, fast and robust, making them excellent systems with which to study the neural basis of behavior. This is especially true in insects, which have comparatively tractable nervous systems and members who are amenable to manipulation with genetic tools. Recent technical developments in high-speed video reveal that, despite their short duration, insect escape behaviors are more complex than previously appreciated. For example, before initiating an escape jump, a fly performs sophisticated posture and stimulus-dependent preparatory leg movements that enable it to jump away from a looming threat. This newfound flexibility raises the question of how the nervous system generates a behavior that is both rapid and flexible. Recordings from the cricket nervous system suggest that synchrony between the activity of specific interneuron pairs may provide a rapid cue for the cricket to detect the direction of an approaching predator and thus which direction it should run. Technical advances make possible wireless recording from neurons while locusts escape from a looming threat, enabling, for the first time, a direct correlation between the activity of multiple neurons and the time-course of an insect escape behavior. PMID:22226514

  17. Escape and rescue model

    NASA Astrophysics Data System (ADS)

    Alvord, D.; Nelson, H. E.

    The Escape and Rescue model is a discrete-event simulation program written in Simscript. It was developed to simulate the emergency movement involved in escape and/or rescue of people from a Board and Care Home housing a group of persons with varying degrees of physical or mental disabilities along with a small live-in staff. It may, however, be used in a much more general setting. It can reasonably handle a building with up to 100 residents and 100 rooms.

  18. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis

    PubMed Central

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia; Erler, Silvio; Kryger, Per; Lewkowski, Oleg; Müller, Thomas; Widder, Miriam; Moritz, Robin F. A.

    2015-01-01

    Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host’s apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap)-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion. PMID:26445372

  19. Spacecraft Escape Capsule

    NASA Technical Reports Server (NTRS)

    Robertson, Edward A.; Charles, Dingell W.; Bufkin, Ann L.; Rodriggs, Liana M.; Peterson, Wayne; Cuthbert, Peter; Lee, David E.; Westhelle, Carlos

    2006-01-01

    A report discusses the Gumdrop capsule a conceptual spacecraft that would enable the crew to escape safely in the event of a major equipment failure at any time from launch through atmospheric re-entry. The scaleable Gumdrop capsule would comprise a command module (CM), a service module (SM), and a crew escape system (CES). The CM would contain a pressurized crew environment that would include avionic, life-support, thermal control, propulsive attitude control, and recovery systems. The SM would provide the primary propulsion and would also supply electrical power, life-support resources, and active thermal control to the CM. The CES would include a solid rocket motor, embedded within the SM, for pushing the CM away from the SM in the event of a critical thermal-protection-system failure or loss of control. The CM and SM would normally remain integrated with each other from launch through recovery, but could be separated using the CES, if necessary, to enable the safe recovery of the crew in the CM. The crew escape motor could be used, alternatively, as a redundant means of de-orbit propulsion for the CM in the event of a major system failure in the SM.

  20. Advanced Crew Escape Suit.

    PubMed

    1995-09-01

    Design of the S1032 Launch Entry Suit (LES) began following the Challenger loss and NASA's decision to incorporate a Shuttle crew escape system. The LES (see Figure 1) has successfully supported Shuttle missions since NASA's Return to Flight with STS-26 in September 1988. In 1990, engineers began developing the S1035 Advanced Crew Escape Suit (ACES) to serve as a replacement for the LES. The ACES was designed to be a simplified, lightweight, low-bulk pressure suit which aided self donning/doffing, provided improved comfort, and enhanced overall performance to reduce crew member stress and fatigue. Favorable crew member evaluations of a prototype led to full-scale development and qualification of the S1035 ACES between 1990 and 1992. Production of the S1035 ACES began in February 1993, with the first unit delivered to NASA in May 1994. The S1035 ACES first flew aboard STS-68 in August 1994 and will become the primary crew escape suit when the S1032 LES ends its service life in late 1995. The primary goal of the S1035 development program was to provide improved performance over that of the S1032 to minimize the stress and fatigue typically experienced by crew members. To achieve this, five fundamental design objectives were established, resulting in various material/configuration changes. PMID:11540717

  1. Orbiter escape pole

    NASA Technical Reports Server (NTRS)

    Goodrich, Winston D. (Inventor); Wesselski, Clarence J. (Inventor); Pelischek, Timothy E. (Inventor); Becker, Bruce H. (Inventor); Kahn, Jon B. (Inventor); Grimaldi, Margaret E. (Inventor); McManamen, John P. (Inventor); Castro, Edgar O. (Inventor)

    1989-01-01

    A Shuttle type of aircraft (10) with an escape hatch (12) has an arcuately shaped pole housing (16) attachable to an interior wall and ceiling with its open end adjacent to the escape hatch. The pole housing 16 contains a telescopically arranged and arcuately shaped primary pole member (22) and extension pole member (23) which are guided by roller assemblies (30,35). The extension pole member (23) is slidable and extendable relative to the primary pole member (22). For actuation, a spring actuated system includes a spring (52) in the pole housing. A locking member (90) engages both pole members (22,23) through notch portions (85,86) in the pole members. The locking member selectively releases the extension pole member (23) and the primary pole member (22). An internal one-way clutch or anti-return mechanism prevents retraction of the extension pole member from an extended position. Shock absorbers (54)(150,152) are for absoring the energy of the springs. A manual backup deployment system is provided which includes a canted ring (104) biased by a spring member (108). A lever member (100) with a slot and pin connection (102) permits the mechanical manipulation of the canted ring to move the primary pole member. The ring (104) also prevents retraction of the main pole. The crew escape mechanism includes a magazine (60) and a number of lanyards (62), each lanyard being mounted by a roller loop (68) over the primary pole member (22). The strap on the roller loop has stitching for controlled release, a protection sheath (74) to prevent tangling and a hook member (69) for attachment to a crew harness.

  2. Inhibitors of apoptotic proteins: new targets for anticancer therapy.

    PubMed

    Saleem, Mohammad; Qadir, Muhammad Imran; Perveen, Nadia; Ahmad, Bashir; Saleem, Uzma; Irshad, Tehseen; Ahmad, Bashir

    2013-09-01

    Inhibitors of apoptotic proteins (IAPs) can play an important role in inhibiting apoptosis by exerting their negative action on caspases (apoptotic proteins). There are eight proteins in this family: NAIP/BIRC1/NLRB, cellular IAP1 (cIAP1)/human IAP2/BIRC2, cellular IAP2 (cIAP2)/human IAP1/BIRC3, X-linked IAP (XIAP)/BIRC4, survivin/BIRC5, baculoviral IAP repeat (BIR)-containing ubiquitin-conjugating enzyme/apollon/BIRC6, livin/melanoma-IAP (ML-IAP)/BIRC7/KIAP, and testis-specific IAP (Ts-IAP)/hILP-2/BIRC8. Deregulation of these inhibitors of apoptotic proteins (IAPs) may push cell toward cancer and neurodegenerative disorders. Inhibitors of apoptotic proteins (IAPs) may provide new target for anticancer therapy. Drugs may be developed that are inhibiting these IAPs to induce apoptosis in cancerous cells. PMID:23790005

  3. Endosomal escape: a bottleneck in intracellular delivery.

    PubMed

    Shete, Harshad K; Prabhu, Rashmi H; Patravale, Vandana B

    2014-01-01

    With advances in therapeutic science, apart from drugs, newer bioactive moieties like oligonucleotides, proteins, peptides, enzymes and antibodies are constantly being introduced for the betterment of therapeutic efficacy. These moieties have intracellular components of the cells like cytoplasm and nucleus as one of their pharmacological sites for exhibiting therapeutic activity. Despite their promising efficacy, their intracellular bioavailability has been critically hampered leading to failure in the treatment of numerous diseases and disorders. The endosomal uptake pathway is known to be a rate-limiting barrier for such systems. Bioactive molecules get trapped in the endosomal vesicles and degraded in the lysosomal compartment, necessitating the need for effective strategies that facilitate the endosomal escape and enhance the cytosolic bioavailability of bioactives. Microbes like viruses and bacteria have developed their innate mechanistic tactics to translocate their genome and toxins by efficiently penetrating the host cell membrane. Understanding this mechanism and exploring it further for intracellular delivery has opened new avenues to surmount the endosomal barrier. These strategies include membrane fusion, pore formation and proton sponge effects. On the other hand, progress in designing a novel smart polymeric carrier system that triggers endosomal escape by undergoing modulations in the intracellular milieu has further led to an improvement in intracellular delivery. These comprise pH, enzyme and temperature-induced modulators, synthetic cationic lipids and photo-induced physical disruption. Each of the aforementioned strategies has its own unique mechanism to escape the endosome. This review recapitulates the numerous strategies designed to surmount the bottleneck of endosomal escape and thereby achieve successful intracellular uptake of bioactives. PMID:24730275

  4. [Sphingolipid-mediated apoptotic signaling pathways].

    PubMed

    Cuvillier, Olivier; Andrieu-Abadie, Nathalie; Ségui, Bruno; Malagarie-Cazenave, Sophie; Tardy, Claudine; Bonhoure, Elisabeth; Levade, Thierry

    2003-01-01

    Various sphingolipids are being viewed as bioactive molecules and/or second messengers. Among them, ceramide (or N-acylsphingosine) and sphingosine generally behave as pro-apoptotic mediators. Indeed, ceramide mediates the death signal initiated by numerous stress agents which either stimulate its de novo synthesis or activate sphingomyelinases that release ceramide from sphingomyelin. For instance, the early generation of ceramide promoted by TNF is mediated by a neutral sphingomyelinase the activity of which is regulated by the FAN adaptor protein, thereby controlling caspase activation and the cell death programme. In addition, the activity of this neutral sphingomyelinase is negatively modulated by caveolin, a major constituent of some membrane microdomains. The enzyme sphingosine kinase also plays a crucial role in apoptosis signalling by regulating the intracellular levels of two sphingolipids having opposite effects, namely the pro-apoptotic sphingosine and the anti-apoptotic sphingosine 1-phosphate molecule. Ceramide and sphingosine metabolism therefore appears as a pivotal regulatory pathway in the determination of cell fate. PMID:14708343

  5. Reconstructing the Alcatraz escape

    NASA Astrophysics Data System (ADS)

    Baart, F.; Hoes, O.; Hut, R.; Donchyts, G.; van Leeuwen, E.

    2014-12-01

    In the night of June 12, 1962 three inmates used a raft made of raincoatsto escaped the ultimate maximum security prison island Alcatraz in SanFrancisco, United States. History is unclear about what happened tothe escapees. At what time did they step into the water, did theysurvive, if so, where did they reach land? The fate of the escapees has been the subject of much debate: did theymake landfall on Angel Island, or did the current sweep them out ofthe bay and into the cold pacific ocean? In this presentation, we try to shed light on this historic case using avisualization of a high-resolution hydrodynamic simulation of the San Francisco Bay, combined with historical tidal records. By reconstructing the hydrodynamic conditions and using a particle based simulation of the escapees we show possible scenarios. The interactive model is visualized using both a 3D photorealistic and web based visualization. The "Escape from Alcatraz" scenario demonstrates the capabilities of the 3Di platform. This platform is normally used for overland flooding (1D/2D). The model engine uses a quad tree structure, resulting in an order of magnitude speedup. The subgrid approach takes detailed bathymetry information into account. The inter-model variability is tested by comparing the results with the DFlow Flexible Mesh (DFlowFM) San Francisco Bay model. Interactivity is implemented by converting the models from static programs to interactive libraries, adhering to the Basic ModelInterface (BMI). Interactive models are more suitable for answeringexploratory research questions such as this reconstruction effort. Although these hydrodynamic simulations only provide circumstantialevidence for solving the mystery of what happened during the foggy darknight of June 12, 1962, it can be used as a guidance and provides aninteresting testcase to apply interactive modelling.

  6. THERMALLY DRIVEN ATMOSPHERIC ESCAPE: TRANSITION FROM HYDRODYNAMIC TO JEANS ESCAPE

    SciTech Connect

    Volkov, Alexey N.; Johnson, Robert E.; Tucker, Orenthal J.; Erwin, Justin T.

    2011-03-10

    Thermally driven escape from planetary atmospheres changes in nature from an organized outflow (hydrodynamic escape) to escape on a molecule-by-molecule basis (Jeans escape) with increasing Jeans parameter, {lambda}, the ratio of the gravitational to thermal energy of the atmospheric molecules. This change is described here for the first time using the direct simulation Monte Carlo method. When heating is predominantly below the lower boundary of the simulation region, R{sub 0}, and well below the exobase of a single-component atmosphere, the nature of the escape process changes over a surprisingly narrow range of Jeans parameters, {lambda}{sub 0}, evaluated at R{sub 0}. For an atomic gas, the transition occurs over {lambda}{sub 0} {approx} 2-3, where the lower bound, {lambda}{sub 0} {approx} 2.1, corresponds to the upper limit for isentropic, supersonic outflow. For {lambda}{sub 0} > 3 escape occurs on a molecule-by-molecule basis and we show that, contrary to earlier suggestions, for {lambda}{sub 0} > {approx}6 the escape rate does not deviate significantly from the familiar Jeans rate. In a gas composed of diatomic molecules, the transition shifts to {lambda}{sub 0} {approx} 2.4-3.6 and at {lambda}{sub 0} > {approx}4 the escape rate increases a few tens of percent over that for the monatomic gas. Scaling by the Jeans parameter and the Knudsen number, these results can be applied to thermally induced escape of the major species from solar and extrasolar planets.

  7. Escape from Vela X

    SciTech Connect

    Hinton, J.; Funk, S.; Parsons, R.D.; Ohm, S.; /Leicester U. /Leeds U.

    2012-02-15

    While the Vela pulsar and its associated nebula are often considered as the archetype of a system powered by a {approx} 10{sup 4} year old isolated neutron star, many features of the spectral energy distribution of this pulsar wind nebula are both puzzling and unusual. Here we develop a model that for the first time relates the main structures in the system, the extended radio nebula (ERN) and the X-ray cocoon through continuous injection of particles with a fixed spectral shape. We argue that diffusive escape of particles from the ERN can explain the steep Fermi-LAT spectrum. In this scenario Vela X should produce a distinct feature in the locally-measured cosmic ray electron spectrum at very high energies. This prediction can be tested in the future using the Cherenkov Telescope Array (CTA). If particles are indeed released early in the evolution of PWNe and can avoid severe adiabatic losses, PWN provide a natural explanation for the rising positron fraction in the local CR spectrum.

  8. An escape from crowding.

    PubMed

    Freeman, Jeremy; Pelli, Denis G

    2007-01-01

    Crowding occurs when nearby flankers jumble the appearance of a target object, making it hard to identify. Crowding is feature integration over an inappropriately large region. What determines the size of that region? According to bottom-up proposals, the size is that of an anatomically determined isolation field. According to top-down proposals, the size is that of the spotlight of attention. Intriligator and Cavanagh (2001) proposed the latter, but we show that their conclusion rests on an implausible assumption. Here we investigate the role of attention in crowding using the change blindness paradigm. We measure capacity for widely and narrowly spaced letters during a change detection task, both with and without an interstimulus cue. We find that standard crowding manipulations-reducing spacing and adding flankers-severely impair uncued change detection but have no effect on cued change detection. Because crowded letters look less familiar, we must use longer internal descriptions (less compact representations) to remember them. Thus, fewer fit into working memory. The memory limit does not apply to the cued condition because the observer need remember only the cued letter. Cued performance escapes the effects of crowding, as predicted by a top-down account. However, our most parsimonious account of the results is bottom-up: Cued change detection is so easy that the observer can tolerate feature degradation and letter distortion, making the observer immune to crowding. The change detection task enhances the classic partial report paradigm by making the test easier (same/different instead of identifying one of many possible targets), which increases its sensitivity, so it can reveal degraded memory traces. PMID:18217837

  9. Suicide as Escape from Self.

    ERIC Educational Resources Information Center

    Baumeister, Roy F.

    1990-01-01

    Suicide is analyzed as a motivation to escape from adversive self-awareness. The causal chain is traced from initial failures that are attributed internally because of a cognitively deconstructed state. (SLD)

  10. Immunosuppressive effects of apoptotic cells

    NASA Astrophysics Data System (ADS)

    Voll, Reinhard E.; Herrmann, Martin; Roth, Edith A.; Stach, Christian; Kalden, Joachim R.; Girkontaite, Irute

    1997-11-01

    Apoptotic cell death is important in the development and homeostasis of multicellular organisms and is a highly controlled means of eliminating dangerous, damaged or unnecessary cells without causing an inflammatory response or tissue damage,. We now show that the presence of apoptotic cells during monocyte activation increases their secretion of the anti-inflammatory and immunoregulatory cytokine interleukin 10 (IL-10) and decreases secretion of the proinflammatory cytokines tumour necrosis factor-α (TNF-α), IL-1 and IL-12. This may inhibit inflammation and contribute to impaired cell-mediated immunity in conditions associated with increased apoptosis, such as viral infections, pregnancy, cancer and exposure to radiation.

  11. Plasma Escape from Unmagnetized Bodies

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Grebowsky, J. M.; Intriligator, D. S.

    1998-01-01

    A considerable fraction of atmospheric loss at Venus and Titan is in the form of plasma escape. This is due in part to the fact that the ionospheres of these unmagnetized bodies interact directly with the high speed plasmas flowing around them. The similarities of the interactions help reinforce interpretations of measurements made at each body, especially when instruments and measurement sites differ. For example, it is well established through this method that ions born in the exospheres above the ionopauses are picked up and carried away by the solar wind at Venus and the rotating plasma in Saturn's magnetosphere. On the other hand, it is more difficult to relate the observations associated with escape of cooler ionospheric plasma down the ionotails of each body. A clear example of ionospheric plasma escaping Titan was observed as it flowed down its ionotail (1). Measurements at Venus have not as yet clearly distinguished between ionospheric and pickup ion escape in the ionotail; however, cold ions detected in the distant wake at 1 AU by the CELIAS/CTOF instrument on SOHO have been interpreted as ionospheric in origin (2). An algorithm to determine ionospheric flow from Pioneer Venus aeronomical measurements is used to show that escape of cold ionospheric plasma is likely to occur. These results along with plasma flow measurements made in the ionotail of Venus are combined and compared to the corresponding flow at Titan.

  12. Viral escape from antisense RNA.

    PubMed

    Bull, J J; Jacobson, A; Badgett, M R; Molineux, I J

    1998-05-01

    RNA coliphage SP was propagated for several generations on a host expressing an inhibitory antisense RNA complementary to bases 31-270 of the positive-stranded genome. Phages evolved that escaped inhibition. Typically, these escape mutants contained 3-4 base substitutions, but different sequences were observed among different isolates. The mutations were located within three different types of structural features within the predicted secondary structure of SP genomic RNA: (i) hairpin loops; (ii) hairpin stems; and (iii) the 5' region of the phage genome complementary to the antisense molecule. Computer modelling of the mutant genomic RNAs showed that all of the substitutions within hairpin stems improved the Watson-Crick pairing of the stem. No major structural rearrangements were predicted for any of the mutant genomes, and most substitutions in coding regions did not alter the amino acid sequence. Although the evolved phage populations were polymorphic for substitutions, many substitutions appeared independently in two selected lines. The creation of a new, perfect, antisense RNA against an escape mutant resulted in the inhibition of that mutant but not of other escape mutants nor of the ancestral, unevolved phage. Thus, at least in this system, a population of viruses that evolved to escape from a single antisense RNA would require a cocktail of several antisense RNAs for inhibition. PMID:9643550

  13. Collective Predation and Escape Strategies

    NASA Astrophysics Data System (ADS)

    Angelani, Luca

    2012-09-01

    The phenomenon of collective predation is analyzed by using a simple individual-based model reproducing spatial animal movements. Two groups of self-propelled organisms are simulated by using Vicseklike models including steric intragroup repulsion. Chase and escape are described by intergroups interactions, attraction (for predators) or repulsion (for preys) from nearest particles of the opposite group. The quantitative analysis of some relevant quantities (total catch time, lifetime distribution, predation rate) allows us to characterize many aspects of the predation phenomenon and gives insights into the study of efficient escape strategies. The reported findings could be of relevance for many basic and applied disciplines, from statistical physics, to ecology, and robotics.

  14. Automated Escape Guidance Algorithms for An Escape Vehicle

    NASA Technical Reports Server (NTRS)

    Flanary, Ronald; Hammen, David; Ito, Daigoro; Rabalais, Bruce; Rishikof, Brian; Siebold, Karl

    2002-01-01

    An escape vehicle was designed to provide an emergency evacuation for crew members living on a space station. For maximum escape capability, the escape vehicle needs to have the ability to safely evacuate a station in a contingency scenario such as an uncontrolled (e.g., tumbling) station. This emergency escape sequence will typically be divided into three events: The fust separation event (SEP1), the navigation reconstruction event, and the second separation event (SEP2). SEP1 is responsible for taking the spacecraft from its docking port to a distance greater than the maximum radius of the rotating station. The navigation reconstruction event takes place prior to the SEP2 event and establishes the orbital state to within the tolerance limits necessary for SEP2. The SEP2 event calculates and performs an avoidance burn to prevent station recontact during the next several orbits. This paper presents the tools and results for the whole separation sequence with an emphasis on the two separation events. The fust challenge includes collision avoidance during the escape sequence while the station is in an uncontrolled rotational state, with rotation rates of up to 2 degrees per second. The task of avoiding a collision may require the use of the Vehicle's de-orbit propulsion system for maximum thrust and minimum dwell time within the vicinity of the station vicinity. The thrust of the propulsion system is in a single direction, and can be controlled only by the attitude of the spacecraft. Escape algorithms based on a look-up table or analytical guidance can be implemented since the rotation rate and the angular momentum vector can be sensed onboard and a-priori knowledge of the position and relative orientation are available. In addition, crew intervention has been provided for in the event of unforeseen obstacles in the escape path. The purpose of the SEP2 burn is to avoid re-contact with the station over an extended period of time. Performing this maneuver properly

  15. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  16. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  17. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  18. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  19. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  20. Lise Meitner's escape from Germany

    NASA Astrophysics Data System (ADS)

    Sime, Ruth Lewin

    1990-03-01

    Lise Meitner (1878-1968) achieved prominence as a nuclear physicist in Germany; although of Jewish origin, her Austrian citizenship exempted her from Nazi racial laws until the annexation of Austria in 1938 precipitated her dismissal. Forbidden to emigrate, she narrowly escaped to the Netherlands with the help of concerned friends in the international physics community.

  1. Lunar escape systems feasibility study

    NASA Technical Reports Server (NTRS)

    Matzenauer, J. O.

    1976-01-01

    Results are presented for a study conducted to determine the feasibility of simple lunar escape system concepts, to develop a spectrum of operational data, and to identify techniques and configurations suitable for the emergency escape mission. The study demonstrated the feasibility of the lunar emergency escape-to-orbit system (LESS) designed to provide a means for the two-man crew of a lunar module (LM) or extended-stay LM (ELM) to escape from the lunar surface in the event that the LM/ELM ascent stage becomes unsafe or is otherwise unable to take off. The LESS is to carry the two astronauts to a safe lunar orbit, where the Apollo command and service modules (CSM) are to be used for rendezvous and rescue, all within the lifetime of the backpack life support system (about 4 hr). It is concluded that simple manual control modes are sufficient, that simple boost profiles are acceptable, and that one man can deploy and set up the LESS. Initial guidance data can be calculated for the LESS by Mission Control and transmitted via the LM/ELM uplink.

  2. Mechanisms of Ionospheric Mass Escape

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Khazanov, G. V.

    2010-01-01

    The dependence of ionospheric O+ escape flux on electromagnetic energy flux and electron precipitation into the ionosphere is derived for a hypothetical ambipolar pick-up process, powered the relative motion of plasmas and neutral upper atmosphere, and by electron precipitation, at heights where the ions are magnetized but influenced by photo-ionization, collisions with gas atoms, ambipolar and centrifugal acceleration. Ion pick-up by the convection electric field produces "ring-beam" or toroidal velocity distributions, as inferred from direct plasma measurements, from observations of the associated waves, and from the spectra of incoherent radar echoes. Ring-beams are unstable to plasma wave growth, resulting in rapid relaxation via transverse velocity diffusion, into transversely accelerated ion populations. Ion escape is substantially facilitated by the ambipolar potential, but is only weakly affected by centrifugal acceleration. If, as cited simulations suggest, ion ring beams relax into non-thermal velocity distributions with characteristic speed equal to the local ion-neutral flow speed, a generalized "Jeans escape" calculation shows that the escape flux of ionospheric O+ increases with Poynting flux and with precipitating electron density in rough agreement with observations.

  3. Apoptotic Cell Death in Neuroblastoma

    PubMed Central

    Li, Yuanyuan; Nakagawara, Akira

    2013-01-01

    Neuroblastoma (NB) is one of the most common malignant solid tumors in childhood, which derives from the sympathoadrenal lineage of the neural crest and exhibits extremely heterogeneous biological and clinical behaviors. The infant patients frequently undergo spontaneous regression even with metastatic disease, whereas the patients of more than one year of age who suffer from disseminated disease have a poor outcome despite intensive multimodal treatment. Spontaneous regression in favorable NBs has been proposed to be triggered by nerve growth factor (NGF) deficiency in the tumor with NGF dependency for survival, while aggressive NBs have defective apoptotic machinery which enables the tumor cells to evade apoptosis and confers the resistance to treatment. This paper reviews the molecules and pathways that have been recently identified to be involved in apoptotic cell death in NB and discusses their potential prospects for developing more effective therapeutic strategies against aggressive NB. PMID:24709709

  4. Apoptotic markers in protozoan parasites

    PubMed Central

    2010-01-01

    The execution of the apoptotic death program in metazoans is characterized by a sequence of morphological and biochemical changes that include cell shrinkage, presentation of phosphatidylserine at the cell surface, mitochondrial alterations, chromatin condensation, nuclear fragmentation, membrane blebbing and the formation of apoptotic bodies. Methodologies for measuring apoptosis are based on these markers. Except for membrane blebbing and formation of apoptotic bodies, all other events have been observed in most protozoan parasites undergoing cell death. However, while techniques exist to detect these markers, they are often optimised for metazoan cells and therefore may not pick up subtle differences between the events occurring in unicellular organisms and multi-cellular organisms. In this review we discuss the markers most frequently used to analyze cell death in protozoan parasites, paying special attention to changes in cell morphology, mitochondrial activity, chromatin structure and plasma membrane structure/permeability. Regarding classical regulators/executors of apoptosis, we have reviewed the present knowledge of caspase-like and nuclease activities. PMID:21062457

  5. Blue Origin Conducts Pad Escape Test

    NASA Video Gallery

    Blue Origin conducted a successful pad escape test Oct. 19 at the company's West Texas launch site, firing its pusher escape motor and launching a full-scale suborbital crew capsule from a simulate...

  6. Genetic Algorithms with Local Minimum Escaping Technique

    NASA Astrophysics Data System (ADS)

    Tamura, Hiroki; Sakata, Kenichiro; Tang, Zheng; Ishii, Masahiro

    In this paper, we propose a genetic algorithm(GA) with local minimum escaping technique. This proposed method uses the local minimum escaping techique. It can escape from the local minimum by correcting parameters when genetic algorithm falls into a local minimum. Simulations are performed to scheduling problem without buffer capacity using this proposed method, and its validity is shown.

  7. [Escape Behaviors and Its Underlying Neuronal Circuits].

    PubMed

    Oda, Yoichi

    2015-10-01

    Escape behaviors are crucial to survive predator encounters or aversive stimuli. The neural circuits mediating escape behaviors of different animal species have a common framework to trigger extremely fast and robust movement with minimum delay. Thus, the neuronal escape circuits possibly represent functional architectures that perform the most efficient sensory-motor processing in the brain. Here, I review the escape behaviors and underlying neuronal circuits of several invertebrates and fish by focusing on the Mauthner cells, a pair of giant reticulospinal neurons in the hindbrain, that trigger fast escape behavior in goldfish and zebrafish. PMID:26450070

  8. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, Riku

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics. Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects? One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  9. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, R.

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics.Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects?One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  10. Escape Dynamics in Quasihomogeneous Fields

    NASA Astrophysics Data System (ADS)

    Mioc, Vasile; Stavinschi, Magda

    The escape in the two-body problem associated to a quasihomogeneous potential (a sum of homogeneous potentials) is being tackled. The basic equations of the problem are put in a form for which the infinity is a singularity, then they are regularized via McGehee-type transformations. The singularity is replaced by a manifold pasted on the phase space, and the flow on this manifold is described; it is identical with the analogous flows corresponding to already studied concrete astronomical and physical situations.

  11. Mars atmosphere evolution: Escape to space

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.

    1992-01-01

    The loss mechanisms and the rates of escape, to space, of Martian atmosphere constituents have changed throughout the history of the solar system. For the first billion years, Mars' atmosphere escape was probably dominated by impact erosion related to the presence of debris left over from the accretionary phase. This loss was further augmented by hydrodynamic outflows related to the presence of an early denser atmosphere and a sun that was brighter in the EUV wavelengths. Following this initial 'catastrophic' phase, during which a large fraction of the original atmosphere was lost but then replaced by volcanism and cometary impact, the 'modern' loss mechanisms which still operate today would have taken over. Those mechanisms that now contribute to escape to space consist of classical thermal or Jeans escape, nonthermal escape due to chemical reaction in the atmosphere, and solar wind-related losses. Both the loss mechanisms and the rates of escape are discussed.

  12. Wind-Induced Atmospheric Escape: Titan

    NASA Technical Reports Server (NTRS)

    Hartle, Richard; Johnson, Robert; Sittler, Edward, Jr.; Sarantos, Menelaos; Simpson, David

    2012-01-01

    Rapid thermospheric flows can significantly enhance the estimates of the atmospheric loss rate and the structure of the atmospheric corona of a planetary body. In particular, rapid horizontal flow at the exobase can increase the corresponding constituent escape rate. Here we show that such corrections, for both thermal and non-thermal escape, cannot be ignored when calculating the escape of methane from Titan, for which drastically different rates have been proposed. Such enhancements are also relevant to Pluto and exoplanets.

  13. Escape nightmares and postescape stressful events.

    PubMed

    Cernovsky, Z Z

    1988-04-01

    Correlation matrix based on questionnaire item responses by 38 Czechoslovak refugees suggested that "escape nightmares" (recurrent nightmares about being back in the exhomeland, wanting to or trying to re-escape to the free world) are unrelated to postescape incidence of various stressful events (e.g., illness, job difficulties, financial problems). However, refugees who reported a greater number of the stressful events also reported a somewhat higher incidence of nightmares on themes other than escape from homeland (r = .34). PMID:3399334

  14. Model of a mechanical clock escapement

    NASA Astrophysics Data System (ADS)

    Moline, David; Wagner, John; Volk, Eugene

    2012-07-01

    The mechanical tower clock originated in Europe during the 14th century to sound hourly bells and later display hands on a dial. An important innovation was the escapement mechanism, which converts stored energy into oscillatory motion for fixed time intervals through the pendulum swing. Previous work has modeled the escapement mechanism in terms of inelastic and elastic collisions. We derive and experimentally verify a theoretical model in terms of impulsive differential equations for the Graham escapement mechanism in a Seth Thomas tower clock. The model offers insight into the clock's mechanical behavior and the functionality of the deadbeat escapement mechanism.

  15. Electronic Escape Trails for Firefighters

    NASA Technical Reports Server (NTRS)

    Jorgensen, Charles; Schipper, John; Betts, Bradley

    2008-01-01

    A proposed wireless-communication and data-processing system would exploit recent advances in radio-frequency identification devices (RFIDs) and software to establish information lifelines between firefighters in a burning building and a fire chief at a control station near but outside the building. The system would enable identification of trails that firefighters and others could follow to escape from the building, including identification of new trails should previously established trails become blocked. The system would include a transceiver unit and a computer at the control station, portable transceiver units carried by the firefighters in the building, and RFID tags that the firefighters would place at multiple locations as they move into and through the building (see figure). Each RFID tag, having a size of the order of a few centimeters, would include at least standard RFID circuitry and possibly sensors for measuring such other relevant environmental parameters as temperature, levels of light and sound, concentration of oxygen, concentrations of hazardous chemicals in smoke, and/or levels of nuclear radiation. The RFID tags would be activated and interrogated by the firefighters and control-station transceivers. Preferably, RFID tags would be configured to communicate with each other and with the firefighters units and the control station in an ordered sequence, with built-in redundancy. In a typical scenario, as firefighters moved through a building, they would scatter many RFID tags into smoke-obscured areas by use of a compressed-air gun. Alternatively or in addition, they would mark escape trails by dropping RFID tags at such points of interest as mantraps, hot spots, and trail waypoints. The RFID tags could be of different types, operating at different frequencies to identify their functions, and possibly responding by emitting audible beeps when activated by signals transmitted by transceiver units carried by nearby firefighters.

  16. Exploiting death: apoptotic immunity in microbial pathogenesis.

    PubMed

    Ucker, D S

    2016-06-01

    Innate immunity typically is responsible for initial host responses against infections. Independently, nucleated cells that die normally as part of the physiological process of homeostasis in mammals (including humans) suppress immunity. Specifically, the physiological process of cell death (apoptosis) generates cells that are recognized specifically by viable cells of all types and elicit a profound transient suppression of host immunity (termed 'innate apoptotic immunity' (IAI)). IAI appears to be important normally for the maintenance of self-tolerance and for the resolution of inflammation. In addition, pathogens are able to take advantage of IAI through a variety of distinct mechanisms, to enable their proliferation within the host and enhance pathogenicity. For example, the protist pathogen Leishmania amazonensis, at its infective stage, mimics apoptotic cells by expressing apoptotic-like protein determinants on the cell surface, triggering immunosuppression directly. In contrast, the pathogenic bacterium Listeria monocytogenes triggers cell death in host lymphocytes, relying on those apoptotic cells to suppress host immune control and facilitate bacterial expansion. Finally, although the inhibition of apoptotic cell death is a common attribute of many viruses which facilitates their extended replication, it is clear that adenoviruses also reprogram the non-apoptotic dead cells that arise subsequently to manifest apoptotic-like immunosuppressive properties. These three instances represent diverse strategies used by microbial pathogens to exploit IAI, focusing attention on the potency of this facet of host immune control. Further examination of these cases will be revealing both of varied mechanisms of pathogenesis and the processes involved in IAI control. PMID:26943319

  17. Escape as Reinforcement and Escape Extinction in the Treatment of Feeding Problems

    ERIC Educational Resources Information Center

    LaRue, Robert H.; Stewart, Victoria; Piazza, Cathleen C.; Volkert, Valerie M.; Patel, Meeta R.; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of…

  18. Cooperation between Apoptotic and Viable Metacyclics Enhances the Pathogenesis of Leishmaniasis

    PubMed Central

    Wanderley, João Luiz Mendes; Pinto da Silva, Lucia Helena; Deolindo, Poliana; Soong, Lynn; Borges, Valéria Matos; Prates, Deboraci Brito; de Souza, Ana Paula Almeida; Barral, Aldina; de Freitas Balanco, José Mario; do Nascimento, Michelle Tanny Cunha; Saraiva, Elvira Maria; Barcinski, Marcello André

    2009-01-01

    Mimicking mammalian apoptotic cells by exposing phosphatidylserine (PS) is a strategy used by virus and parasitic protozoa to escape host protective inflammatory responses. With Leishmania amazonensis (La), apoptotic mimicry is a prerogative of the intramacrophagic amastigote form of the parasite and is modulated by the host. Now we show that differently from what happens with amastigotes, promastigotes exposing PS are non-viable, non-infective cells, undergoing apoptotic death. As part of the normal metacyclogenic process occurring in axenic cultures and in the gut of sand fly vectors, a sub-population of metacyclic promastigotes exposes PS. Apoptotic death of the purified PS-positive (PSPOS) sub-population was confirmed by TUNEL staining and DNA laddering. Transmission electron microscopy revealed morphological alterations in PSPOS metacyclics such as DNA condensation, cytoplasm degradation and mitochondrion and kinetoplast destruction, both in in vitro cultures and in sand fly guts. TUNELPOS promastigotes were detected only in the anterior midgut to foregut boundary of infected sand flies. Interestingly, caspase inhibitors modulated parasite death and PS exposure, when added to parasite cultures in a specific time window. Efficient in vitro macrophage infections and in vivo lesions only occur when PSPOS and PS-negative (PSNEG) parasites were simultaneously added to the cell culture or inoculated in the mammalian host. The viable PSNEG promastigote was the infective form, as shown by following the fate of fluorescently labeled parasites, while the PSPOS apoptotic sub-population inhibited host macrophage inflammatory response. PS exposure and macrophage inhibition by a subpopulation of promastigotes is a different mechanism than the one previously described with amastigotes, where the entire population exposes PS. Both mechanisms co-exist and play a role in the transmission and development of the disease in case of infection by La. Since both processes confer

  19. MEMO: Mars Escape and Magnetic Orbiter

    NASA Astrophysics Data System (ADS)

    Leblanc, F.; Langlais, B.; Chassefiere, E.; Sotin, C.; Barabash, S.; Dehant, V.; Dougherty, M.; Lammer, H.; Mandea, M.; Vennerstrom, S.

    2007-03-01

    MEMO is a new orbiter devoted to the characterization of present atmospheric escape and of the fossile magnetic field. The low periapsis (~130 km) is required to detect and quantify atoms and molecules involved in the escape, and to measure the magnetic f

  20. Escaping Homelessness: Anticipated and Perceived Facilitators

    ERIC Educational Resources Information Center

    Patterson, Allisha; Tweed, Roger

    2009-01-01

    One study with two distinct sections was conducted to identify factors facilitating escape from homelessness. In Section 1, 58 homeless individuals rated possible facilitators of escape (factors they believed would help them become more independent and self-sufficient). In Section 2, 80 participants who had already exited homelessness rated the…

  1. Submarine 'safe to escape' studies in man.

    PubMed

    Jurd, K M; Seddon, F M; Thacker, J C; Blogg, S L; Stansfield, M R D; White, M G; Loveman, G A M

    2014-01-01

    The Royal Navy requires reliable advice on the safe limits of escape from a distressed submarine (DISSUB). Flooding in a DISSUB may cause a rise in ambient pressure, increasing the risk of decompression sickness (DCS) and decreasing the maximum depth from which it is safe to escape. The aim of this study was to investigate the pressure/depth limits to escape following saturation at raised ambient pressure. Exposure to saturation pressures up to 1.6 bar (a) (160 kPa) (n = 38); escapes from depths down to 120 meters of sea water (msw) (n = 254) and a combination of saturation followed by escape (n = 90) was carried out in the QinetiQ Submarine Escape Simulator, Alverstoke, United Kingdom. Doppler ultrasound monitoring was used to judge the severity of decompression stress. The trials confirmed the previously untested advice, in the Guardbook, that if a DISSUB was lying at a depth of 90 msw, then it was safe to escape when the pressure in the DISSUB was 1.5 bar (a), but also indicated that this advice may be overly conservative. This study demonstrated that the upper DISSUB saturation pressure limit to safe escape from 90 msw was 1.6 bar (a), resulting in two cases of DCS. PMID:25109084

  2. Atmospheric escape, redox evolution, and planetary habitability

    NASA Astrophysics Data System (ADS)

    Catling, D. C.; Zahnle, K. J.

    2011-12-01

    Through the greenhouse effect, the presence and composition of an atmosphere is critical for defining a (conventional) circumstellar habitable zone in terms of planetary surface temperatures suitable for liquid water. Lack of knowledge of planetary atmospheres is likely to frustrate attempts to say with any certainty whether detected terrestrial-sized exoplanets may or may not be habitable. Perhaps an underappreciated role in such considerations is the evolutionary effect of atmospheric escape for determining atmospheric composition or whether an atmosphere exists in the first place. Whether atmospheres exist at all on planets is demonstrably connected to the effect of integrated atmospheric escape. When we observe our own Solar System and transiting exoplanets, the existence of an atmosphere is clearly delineated by a relative vulnerability to thermal escape and impact erosion. The prevalence of thermal escape as a key evolutionary determinant for the presence of planetary atmosphere is shown by a relationship between the relative solar (or stellar) heating and the escape velocity. Those bodies with too much stellar heating and too smaller escape velocity end up devoid of atmospheres. Impact erosion is evident in the relationship between impact velocity and escape velocity. Escape due to impacts is particularly important for understanding the large differences in the atmospheres of giant planet moons, such as Ganymede versus Titan. It is also significant for Mars-sized planets. The oxidation state of atmospheres is important for some theories of the origin of life (where an early reducing atmosphere is helpful for organic synthesis) and the evolution of advanced life (where free molecular oxygen is the best source of high energy metabolism). Surfaces on some relatively small planets and moons are observed to have evolved to an oxidized state, which theory and observation can explain through atmospheric escape. There are several examples in the Solar System where a

  3. Intercellular transfer of apoptotic signals via electrofusion

    SciTech Connect

    Park, Jin Suk; Lee, Wilson; McCulloch, Christopher A.

    2012-05-01

    We determined whether cells that are induced to undergo anoikis by matrix detachment can initiate apoptosis in healthy cells following electroporation-induced fusion. Separate populations of MDCK cells undergoing anoikis and stained with FITC-annexin or viable MDCK cells that were labeled with spectrally discrete fluorescent beads were electroporated. Cells were analyzed by flow cytometry for enumeration of viable cells with beads, apoptotic cells or fused cells. Electroporation promoted a 49-fold increase of the percentage of viable cells that had fused with apoptotic cells. Apoptotic cell-viable cell fusions were 8-fold more likely to not attach to cell culture plastic and 2.3-fold less likely to proliferate after 24 hr incubation than viable cell fusion controls. These data demonstrate that apoptotic signals can be transferred between cells by electrofusion, possibly suggesting a novel investigative approach for optimizing targeted cell deletion in cancer treatment.

  4. Clusterin facilitates apoptotic cell clearance and prevents apoptotic cell-induced autoimmune responses.

    PubMed

    Cunin, P; Beauvillain, C; Miot, C; Augusto, J-F; Preisser, L; Blanchard, S; Pignon, P; Scotet, M; Garo, E; Fremaux, I; Chevailler, A; Subra, J-F; Blanco, P; Wilson, M R; Jeannin, P; Delneste, Y

    2016-01-01

    Clusterin (Clu), an extracellular chaperone, exhibits characteristics of soluble innate immunity receptors, as assessed by its ability to bind some bacteria strains. In this study, we report that Clu also binds specifically to late apoptotic cells but not to live, early apoptotic, or necrotic cells. Histones, which accumulate on blebs during the apoptotic process, represent privileged Clu-binding motifs at the surface of late apoptotic cells. As a consequence, Clu potentiates, both in vitro and in vivo, the phagocytosis of late apoptotic cells by macrophages. Moreover, the increased phagocytosis of late apoptotic cells induced by Clu favors the presentation and cross-presentation of apoptotic cell-associated antigens. Finally, we observed that, in a model of apoptotic cell-induced autoimmunity, and relative to control mice, Clu(-/-) mice develop symptoms of autoimmunity, including the generation of anti-dsDNA antibodies, deposition of immunoglobulins and complement components within kidneys, and splenomegaly. These results identify Clu as a new molecule partner involved in apoptotic cell efferocytosis and suggest a protective role for Clu in inflammation and autoimmune diseases. PMID:27148688

  5. Clusterin facilitates apoptotic cell clearance and prevents apoptotic cell-induced autoimmune responses

    PubMed Central

    Cunin, P; Beauvillain, C; Miot, C; Augusto, J-F; Preisser, L; Blanchard, S; Pignon, P; Scotet, M; Garo, E; Fremaux, I; Chevailler, A; Subra, J-F; Blanco, P; Wilson, M R; Jeannin, P; Delneste, Y

    2016-01-01

    Clusterin (Clu), an extracellular chaperone, exhibits characteristics of soluble innate immunity receptors, as assessed by its ability to bind some bacteria strains. In this study, we report that Clu also binds specifically to late apoptotic cells but not to live, early apoptotic, or necrotic cells. Histones, which accumulate on blebs during the apoptotic process, represent privileged Clu-binding motifs at the surface of late apoptotic cells. As a consequence, Clu potentiates, both in vitro and in vivo, the phagocytosis of late apoptotic cells by macrophages. Moreover, the increased phagocytosis of late apoptotic cells induced by Clu favors the presentation and cross-presentation of apoptotic cell-associated antigens. Finally, we observed that, in a model of apoptotic cell-induced autoimmunity, and relative to control mice, Clu−/− mice develop symptoms of autoimmunity, including the generation of anti-dsDNA antibodies, deposition of immunoglobulins and complement components within kidneys, and splenomegaly. These results identify Clu as a new molecule partner involved in apoptotic cell efferocytosis and suggest a protective role for Clu in inflammation and autoimmune diseases. PMID:27148688

  6. Light weight escape capsule for fighter aircraft

    NASA Technical Reports Server (NTRS)

    Robert, James A.

    1988-01-01

    Emergency crew escape capabilities have been less than adequate for fighter aircraft since before WW II. From the over-the-side bailout of those days through the current ejection seat with a rocket catapult, escaping from a disabled aircraft has been risky at best. Current efforts are underway toward developing a high-tech, smart ejection seat that will give fighter pilots more room to live in the sky, but an escape capsule is needed to meet current and future fighter envelopes. Escape capsules have a bad reputation due to past examples of high weight, poor performance and great complexity. However, the advantages available demand that a capsule be developed. This capsule concept will minimize the inherent disavantages and incorporate the benefits while integrating all aspects of crew station design. The resulting design is appropriate for a crew station of the year 2010 and includes improved combat acceleration protection, chemical or biological combat capability, improved aircraft to escape system interaction, and the highest level of escape performance achievable. The capsule is compact, which can allow a reduced aircraft size and weighs only 1200 lb. The escape system weight penalty is only 120 lb higher than that for the next ejection seat and the capsule has a corresponding increase in performance.

  7. In situ apoptosis of adaptive immune cells and the cellular escape of rabies virus in CNS from patients with human rabies transmitted by Desmodus rotundus.

    PubMed

    Fernandes, Elaine Raniero; de Andrade, Heitor Franco; Lancellotti, Carmen Lúcia Penteado; Quaresma, Juarez Antônio Simões; Demachki, Samia; da Costa Vasconcelos, Pedro Fernando; Duarte, Maria Irma Seixas

    2011-03-01

    The aim of the current study was to investigate the apoptosis of neurons, astrocytes and immune cells from human patients that were infected with rabies virus by vampire bats bite. Apoptotic neurons were identified by their morphology and immune cells were identified using double immunostaining. There were very few apoptotic neurons present in infected tissue samples, but there was an increase of apoptotic infiltrating CD4+ and TCD8+ adaptive immune cells in the rabies infected tissue. No apoptosis was present in NK, macrophage and astrocytes. The dissemination of the human rabies virus within an infected host may be mediated by viral escape of the virus from an infected cell and may involve an anti-apoptotic mechanism, which does not kill the neuron or pro-apoptosis of TCD4+ and TCD8+ lymphocytes and which allows for increased proliferation of the virus within the CNS by attenuation of the adaptive immune response. PMID:21255623

  8. Wind enhanced planetary escape: Collisional modifications

    NASA Technical Reports Server (NTRS)

    Curtis, S. A.; Hartle, R. E.

    1976-01-01

    The problem of thermal escape is considered in which both the effects of thermospheric winds at the exobase and collisions below the exobase are included in a Monte Carlo calculation. The collisions are included by means of a collisional relaxation layer of a background gas which models the transition region between the exosphere and the thermosphere. The wind effects are considered in the limiting cases of vertical and horizontal flows. Two species are considered: terrestrial hydrogen and terrestrial helium. In the cases of terrestrial hydrogen the escape fluxes were found to be strongly filtered or throttled by collisions at high exospheric temperatures. The model is applied to molecular hydrogen diffusing through a methane relaxation layer under conditions possible on Titan. The results are similar to the case of terrestrial hydrogen with wind enhanced escape being strongly suppressed by collisions. It is concluded that wind enhanced escape is not an important process on Titan.

  9. Apollo experience report: Launch escape propulsion subsystem

    NASA Technical Reports Server (NTRS)

    Townsend, N. A.

    1973-01-01

    The Apollo launch escape propulsion subsystem contained three solid rocket motors. The general design, development, and qualification of the solid-propellant pitch-control, tower-jettison, and launch-escape motors of the Apollo launch escape propulsion subsystem were completed during years 1961 to 1966. The launch escape system components are described in general terms, and the sequence of events through the ground-based test programs and flight-test programs is discussed. The initial ground rules established for this system were that it should use existing technology and designs as much as possible. The practicality of this decision is proved by the minimum number of problems that were encountered during the development and qualification program.

  10. Biogeochemistry: Nocturnal escape route for marsh gas

    NASA Astrophysics Data System (ADS)

    Anthony, Katey Walter; MacIntyre, Sally

    2016-07-01

    A field study of methane emissions from wetlands reveals that more of the gas escapes through diffusive processes than was thought, mostly at night. Because methane is a greenhouse gas, the findings have implications for global warming.

  11. Polymer escape from a confining potential

    NASA Astrophysics Data System (ADS)

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-02-01

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  12. Polymer escape from a confining potential

    SciTech Connect

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-02-07

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  13. Submarine tower escape decompression sickness risk estimation.

    PubMed

    Loveman, G A M; Seddon, E M; Thacker, J C; Stansfield, M R; Jurd, K M

    2014-01-01

    Actions to enhance survival in a distressed submarine (DISSUB) scenario may be guided in part by knowledge of the likely risk of decompression sickness (DCS) should the crew attempt tower escape. A mathematical model for DCS risk estimation has been calibrated against DCS outcome data from 3,738 exposures of either men or goats to raised pressure. Body mass was used to scale DCS risk. The calibration data included more than 1,000 actual or simulated submarine escape exposures and no exposures with substantial staged decompression. Cases of pulmonary barotrauma were removed from the calibration data. The calibrated model was used to estimate the likelihood of DCS occurrence following submarine escape from the United Kingdom Royal Navy tower escape system. Where internal DISSUB pressure remains at - 0.1 MPa, escape from DISSUB depths < 200 meters is estimated to have DCS risk < 6%. Saturation at raised DISSUB pressure markedly increases risk, with > 60% DCS risk predicted for a 200-meter escape from saturation at 0.21 MPa. Using the calibrated model to predict DCS for direct ascent from saturation gives similar risk estimates to other published models. PMID:25109085

  14. Apoptotic processes during mammalian preimplantation development.

    PubMed

    Fabian, Dusan; Koppel, Juraj; Maddox-Hyttel, Poul

    2005-07-15

    The paper provides a review of the current state of knowledge on apoptosis during normal preimplantation development based on the literature and on the authors' own findings. Information is focused on the occurrence and the characteristics of spontaneous apoptotic processes. Reports concerning the chronology and the incidence of programmed cell death in mouse, cow, pig and human embryos in early preimplantation stages up to the blastocyst stage are summarized. In addition, specific attributes of the apoptotic process in mammalian preimplantation development are provided, including the description of both morphological and biochemical features of cell death. PMID:15955348

  15. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... Operate With More Than 16 Individuals on Board § 28.390 Means of escape. (a) Each space which is used by... two widely separated means of escape. At least one of the means of escape must be independent...

  16. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 1 2013-10-01 2013-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... Operate With More Than 16 Individuals on Board § 28.390 Means of escape. (a) Each space which is used by... two widely separated means of escape. At least one of the means of escape must be independent...

  17. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  18. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  19. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  20. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  1. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  2. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 1 2012-10-01 2012-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... Operate With More Than 16 Individuals on Board § 28.390 Means of escape. (a) Each space which is used by... two widely separated means of escape. At least one of the means of escape must be independent...

  3. Hydrogen Escape from early Earth and Mars

    NASA Astrophysics Data System (ADS)

    Zugger, M. E.; Ramirez, R. M.; Kasting, J. F.

    2012-12-01

    A controversy regarding hydrodynamic escape rates arose when Tian et al. (2005) published transonic escape rates for an atmosphere composed of pure H2. Tian et al. concluded that the hydrogen escape rate from early Earth would have been a factor of 20 or more slower than the diffusion limit, even if the solar EUV (extreme ultraviolet) flux was enhanced by a factor of 5 relative to today. This conclusion was challenged by Catling (2006), who pointed out that solar EUV fluxes could have been much higher than this so that plenty of energy should have been available to power escape. This controversy has remained unresolved to date. Hydrogen escape from early Mars is also of interest. As discussed in this session in a complementary paper by Ramirez et al., collision-induced absorption by molecular hydrogen could have helped to warm early Mars, perhaps explaining the formation of valleys and valley networks. Ramirez et al. have shown that a mixture of 90% CO2 and 10% H2 is capable raising early Mars' surface temperature above the freezing point of water, for surface pressures exceeding ~3 bar. However, we need to understand whether H2 mixing ratios of 10% are physically plausible. The H2 partial pressure in Mars' early atmosphere would have been determined by the balance between volcanic outgassing and escape to space. The 10% mixing ratio is high compared to the value of ~10-3 typically assumed for early Earth. But Mars' early atmosphere may have been more reduced than Earth's (Wadwha, 2001); if the hydrogen escape rate on Mars was also slower than on Earth, then additional increases in atmospheric hydrogen concentration are possible. To answer these questions about the early atmospheres of Earth and Mars, we have modified an existing model of hydrodynamic escape, developed by F. Tian, J. Kasting, and others, to converge for atmospheres with a wide range of hydrogen mixing ratios. The model finds subsonic solutions to the hydrodynamic equations; these can be shown to

  4. MEMO: Mars Escape and Magnetic Orbiter

    NASA Astrophysics Data System (ADS)

    Chassefiere, E.; Langlais, B.; Leblanc, F.; Sotin, C.; Barabash, S.; Dehant, V.; Dougherty, M.; Lammer, H.; Mandea, M.; Vennerstrom, S.

    There are several reasons to believe that Mars could have become an Earth like planet rather than the present dry and cold planet. In particular, many elements suggest the presence of liquid water at the Martian surface during a relatively short period at an early stage of its history. Since liquid water may have been the birthplace for life on Earth, the fate of Martian water is one of the major key and yet unanswered question to be solved. Mars Escape and Magnetic Orbiter (MEMO) is a low periapsis orbiter of Mars devoted to the measurement of present escape and the characterization of the fossil magnetic field of Mars. The use of a low periapsis altitude orbit (120-150 km) is required to detect and quantify all populations of atoms and molecules involved in escape. It is also required to measure the magnetic field of Mars with an unprecedented spatial resolution that would allow getting a more precise timing of the dynamo and its disappearance. Achieving a full characterization of atmospheric escape, and extrapolating it back to the past requires: (i) to measure escape fluxes of neutral and ion species, and characterize the dynamics and chemistry of the regions of the atmosphere where escape occurs (thermosphere, ionosphere, exosphere), as well as their responses to solar activity, and (ii) to characterize the lateral variations of the magnetic field of lithospheric origin, and by extension, the timing of the Martian dynamo. Of particular interest is the extinction of the dynamo that is thought to have enhanced the atmospheric escape processes still operating today. The proposed low-periapsis orbiter will consist of the following elements: • An "Escape Package" to characterize by both in-situ and remote measurements the thermosphere, ionosphere, exosphere and solar wind interaction regions (from one hundred to several thousand km), including thermal, suprathermal 1 and energetic particles. • A "Magnetic Field Package", to characterize the magnetization of the

  5. Enzyme markers

    MedlinePlus

    ... or defects passed down through families (inherited) can affect how enzymes work. Some enzymes are affected by several genes. Test results are usually reported as a percentage of normal enzyme activity.

  6. Compensatory escape mechanism at low Reynolds number

    PubMed Central

    Gemmell, Brad J.; Sheng, Jian; Buskey, Edward J.

    2013-01-01

    Despite high predation pressure, planktonic copepods remain one of the most abundant groups on the planet. Their escape response provides one of most effective mechanisms to maximize evolutionary fitness. Owing to their small size (100 µm) compared with their predators (>1 mm), increasing viscosity is believed to have detrimental effects on copepods’ fitness at lower temperature. Using high-speed digital holography we acquire 3D kinematics of the nauplius escape including both location and detailed appendage motion. By independently varying temperature and viscosity we demonstrate that at natural thermal extremes, contrary to conventional views, nauplii achieve equivalent escape distance while maintaining optimal velocity. Using experimental results and kinematic simulations from a resistive force theory propulsion model, we demonstrate that a shift in appendage timing creates an increase in power stroke duration relative to recovery stroke duration. This change allows the nauplius to limit losses in velocity and maintain distance during escapes at the lower bound of its natural thermal range. The shift in power stroke duration relative to recovery stroke duration is found to be regulated by the temperature dependence of swimming appendage muscle groups, not a dynamic response to viscosity change. These results show that copepod nauplii have natural adaptive mechanisms to compensate for viscosity variations with temperature but not in situations in which viscosity varies independent of temperature, such as in some phytoplankton blooms. Understanding the robustness of escapes in the wake of environmental changes such as temperature and viscosity has implications in assessing the future health of performance compensation. PMID:23487740

  7. Cerebrospinal Fluid HIV Escape from Antiretroviral Therapy.

    PubMed

    Ferretti, Francesca; Gisslen, Magnus; Cinque, Paola; Price, Richard W

    2015-06-01

    CNS infection is a nearly constant facet of systemic CNS infection and is generally well controlled by suppressive systemic antiretroviral therapy (ART). However, there are instances when HIV can be detected in the cerebrospinal fluid (CSF) despite suppression of plasma viruses below the clinical limits of measurement. We review three types of CSF viral escape: asymptomatic, neuro-symptomatic, and secondary. The first, asymptomatic CSF escape, is seemingly benign and characterized by lack of discernable neurological deterioration or subsequent CNS disease progression. Neuro-symptomatic CSF escape is an uncommon, but important, entity characterized by new or progressive CNS disease that is critical to recognize clinically because of its management implications. Finally, secondary CSF escape, which may be even more uncommon, is defined by an increase of CSF HIV replication in association with a concomitant non-HIV infection, as a consequence of the local inflammatory response. Understanding these CSF escape settings not only is important for clinical diagnosis and management but also may provide insight into the CNS HIV reservoir. PMID:25860317

  8. Radiative equilibrium and escape of Pluto's atmosphere

    NASA Astrophysics Data System (ADS)

    Erwin, Justin; Koskinen, Tommi T.; Yelle, Roger V.

    2015-11-01

    Observations of Pluto’s extend atmosphere by the New Horizons spacecraft motivate an update to our modeling effort on Pluto’s atmosphere. New Horizons observations have already improved our constraints on planet radius and surface pressure, which are key to modeling the atmospheric structure. We model the radiative conductive equilibrium in the lower atmosphere combined with the UV driven escape model of the upper atmosphere. The non-LTE radiative transfer model in the lower atmosphere include heating and cooling by CH4, CO, and HCN. The escape model of the upper atmosphere is updated to include diffusion and escape of each molecular component. These results will be used to aid in the analysis and better understanding of the full atmospheric structure.

  9. Thermal escape from extrasolar giant planets.

    PubMed

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres. PMID:24664923

  10. Thermal escape from extrasolar giant planets

    PubMed Central

    Koskinen, Tommi T.; Lavvas, Panayotis; Harris, Matthew J.; Yelle, Roger V.

    2014-01-01

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres. PMID:24664923

  11. Apoptotic and proliferation indexes in canine lymphoma.

    PubMed

    Phillips, B S; Kass, P H; Naydan, D K; Winthrop, M D; Griffey, S M; Madewell, B R

    2000-03-01

    Proliferative and apoptotic fractions of tumors were evaluated in 41 dogs with lymphoma for prediction of response to chemotherapy. All dogs had advanced clinical stage tumors, were untreated prior to study, and received identical induction-remission chemotherapy. Tumor cell proliferation was determined in all pretreatment biopsy specimens and in 18 specimens collected at the time of clinical relapse from remission. Quantitative measures included mitotic index and immunoreactivities for proliferating cell nuclear antigen (PCNA) and Ki-67. Apoptotic index was evaluated from 40 dogs pretreatment and from 16 dogs at the time of first relapse. Pretreatment tumor values for Ki-67, PCNA, and apoptosis were compared with posttreatment values. The median first relapse-free interval (RFI) and overall survival (OS) time were 174 days and 445 days, respectively. Of the proliferation markers, only the results of the Ki-67 analysis were predictive for duration of the first RFI but not OS. Pretreatment apoptotic index was also predictive of the duration of first RFI but not OS. No significant predictive value for comparison of the pretreatment and postrelapse values was demonstrated. Ki-67 labeling index and apoptotic indexes were combined to form both a proliferation/apoptotic ratio (PAR) and a sum, or turnover index. Only the PAR was predictive for duration of first RFI on multivariate analysis. Other variables that were evaluated for their influence on treatment outcome included patient age, weight, gender, clinical stage, clinical substage, and tumor immunophenotype. Of these variables, only immunophenotype was found to be of value for predicting duration of first RFI and OS. PMID:10730938

  12. Statistical theory of asteroid escape rates.

    PubMed

    Jaffé, Charles; Ross, Shane D; Lo, Martin W; Marsden, Jerrold; Farrelly, David; Uzer, T

    2002-07-01

    Transition states in phase space are identified and shown to regulate the rate of escape of asteroids temporarily captured in circumplanetary orbits. The transition states, similar to those occurring in chemical reaction dynamics, are then used to develop a statistical semianalytical theory for the rate of escape of asteroids temporarily captured by Mars. Theory and numerical simulations are found to agree to better than 1%. These calculations suggest that further development of transition state theory in celestial mechanics, as an alternative to large-scale numerical simulations, will be a fruitful approach to mass transport calculations. PMID:12097024

  13. Martian Atmospheric and Ionospheric plasma Escape

    NASA Astrophysics Data System (ADS)

    Lundin, Rickard

    2016-04-01

    Solar forcing is responsible for the heating, ionization, photochemistry, and erosion processes in the upper atmosphere throughout the lifetime of the terrestrial planets. Of the four terrestrial planets, the Earth is the only one with a fully developed biosphere, while our kin Venus and Mars have evolved into arid inhabitable planets. As for Mars, there are ample evidences for an early Noachian, water rich period on Mars. The question is, what made Mars evolve so differently compared to the Earth? Various hydrosphere and atmospheric evolution scenarios for Mars have been forwarded based on surface morphology, chemical composition, simulations, semi-empiric (in-situ data) models, and the long-term evolution of the Sun. Progress has been made, but the case is still open regarding the changes that led to the present arid surface and tenuous atmosphere at Mars. This presentation addresses the long-term variability of the Sun, the solar forcing impact on the Martian atmosphere, and its interaction with the space environment - an electromagnetic wave and particle interaction with the upper atmosphere that has implications for its photochemistry, composition, and energization that governs thermal and non-thermal escape. Non-thermal escape implies an electromagnetic upward energization of planetary ions and molecules to velocities above escape velocity, a process governed by a combination of solar EUV radiation (ionization), and energy and momentum transfer by the solar wind. The ion escape issue dates back to the early Soviet and US-missions to Mars, but the first more accurate estimates of escape rates came with the Phobos-2 mission in 1989. Better-quality ion composition measurement results of atmospheric/ionospheric ion escape from Mars, obtained from ESA Mars Express (MEX) instruments, have improved our understanding of the ion escape mechanism. With the NASA MAVEN spacecraft orbiting Mars since Sept. 2014, dual in-situ measurement with plasma instruments are now

  14. Stabilization of apoptotic cells: generation of zombie cells.

    PubMed

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-01-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn(2+) (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy. PMID:25118929

  15. Stabilization of apoptotic cells: generation of zombie cells

    PubMed Central

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-01-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn2+ (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy. PMID:25118929

  16. Centrifugally Stimulated Exospheric Ion Escape at Mercury

    NASA Technical Reports Server (NTRS)

    Delcourt, Dominique; Seki, K.; Terada, N.; Moore, Thomas E.

    2012-01-01

    We investigate the transport of ions in the low-altitude magnetosphere magnetosphere of Mercury. We show that, because of small spatial scales, the centrifugal effect due to curvature of the E B drift paths can lead to significant particle energization in the parallel direction. We demonstrate that because of this effect, ions with initial speed smaller than the escape speed such as those produced via thermal desorption can overcome gravity and escape into the magnetosphere. The escape route of this low-energy exosphere originating material is largely controlled by the magnetospheric convection rate. This escape route spreads over a narrower range of altitudes when the convection rate increases. Bulk transport of low-energy planetary material thus occurs within a limited region of space once moderate magnetospheric convection is established. These results suggest that, via release of material otherwise gravitationally trapped, the E B related centrifugal acceleration is an important mechanism for the net supply of plasma to the magnetosphere of Mercury.

  17. Developing the E-Scape Software System

    ERIC Educational Resources Information Center

    Derrick, Karim

    2012-01-01

    Most innovations have contextual pre-cursors that prompt new ways of thinking and in their turn help to give form to the new reality. This was the case with the e-scape software development process. The origins of the system existed in software components and ideas that we had developed through previous projects, but the ultimate direction we took…

  18. Nociception and escape behavior in planarians

    NASA Astrophysics Data System (ADS)

    Schoetz Collins, Eva-Maria

    2015-03-01

    Planarians are famous and widely studied for their regenerative capabilities. When a moving planarian is cut through the middle, the resulting head and tail pieces instantaneously retract and exhibit a characteristic escape response that differs from normal locomotion. In asexual animals, a similar reaction is observed when the planarian undergoes fission, suggesting that reproduction through self-tearing is a rather traumatic event for the animal. Using a multiscale approach, we unravel the dynamics, mechanics, and functional aspects of the planarian escape response. This musculature-driven gait was found to be a dominating response that supersedes the urge to feed or reproduce and quantitatively differs from other modes of planarian locomotion (gliding, peristalsis). We show that this escape gait constitutes the animal's pain response mediated by TRP like receptors and the neurotransmitter histamine, and that it can be induced through adverse thermal, mechanical, electrical or chemical stimuli. Ultimately, we will examine the neuronal subpopulations involved in mediating escape reflexes in planarians and how they are functionally restored during regeneration, thereby gaining mechanistic insight into the neuronal circuits required for specific behaviors. Supported by BWF CASI and Sloan Foundation.

  19. Evolution: Escaping the Inevitability of Ageing.

    PubMed

    Archer, C Ruth; Hosken, David J

    2016-03-01

    William Hamilton argued that even species inhabiting the farthest flung corners of the universe should age. However, a recent study shows that to find a species that escapes ageing, you only need to look as far as your local pond. PMID:26954440

  20. Animal escapology II: escape trajectory case studies

    PubMed Central

    Domenici, Paolo; Blagburn, Jonathan M.; Bacon, Jonathan P.

    2011-01-01

    Summary Escape trajectories (ETs; measured as the angle relative to the direction of the threat) have been studied in many taxa using a variety of methodologies and definitions. Here, we provide a review of methodological issues followed by a survey of ET studies across animal taxa, including insects, crustaceans, molluscs, lizards, fish, amphibians, birds and mammals. Variability in ETs is examined in terms of ecological significance and morpho-physiological constraints. The survey shows that certain escape strategies (single ETs and highly variable ETs within a limited angular sector) are found in most taxa reviewed here, suggesting that at least some of these ET distributions are the result of convergent evolution. High variability in ETs is found to be associated with multiple preferred trajectories in species from all taxa, and is suggested to provide unpredictability in the escape response. Random ETs are relatively rare and may be related to constraints in the manoeuvrability of the prey. Similarly, reports of the effect of refuges in the immediate environment are relatively uncommon, and mainly confined to lizards and mammals. This may be related to the fact that work on ETs carried out in laboratory settings has rarely provided shelters. Although there are a relatively large number of examples in the literature that suggest trends in the distribution of ETs, our understanding of animal escape strategies would benefit from a standardization of the analytical approach in the study of ETs, using circular statistics and related tests, in addition to the generation of large data sets. PMID:21753040

  1. Elevated Levels of Uterine Anti-Apoptotic Signaling May Activate NFKB and Potentially Confer Resistance to Caspase 3-Mediated Apoptotic Cell Death During Pregnancy in Mice1

    PubMed Central

    Jeyasuria, Pancharatnam; Subedi, Kalpana; Suresh, Arvind; Condon, Jennifer C.

    2011-01-01

    Preserving the uterus in a state of relative quiescence is vital to the maintenance of a successful pregnancy. Elevated cytoplasmic levels of uterine caspase 3 during pregnancy have been proposed as a potential regulator of uterine quiescence through direct targeting and disabling of the uterine contractile architecture. However, despite highly elevated levels of uterine caspase 3 during pregnancy, there is minimal evidence of apoptosis. This current study defines the mechanism whereby the pregnant uterine myocyte may harness the tocolytic activity of active caspases while avoiding apoptotic cell death. Using the pregnant mouse model, we have analyzed the uterus for changes in pro- and antiapoptotic signaling patterns associated with the advancing stages of pregnancy. Briefly, we have found that members of the IAP family, such as SURVIVIN and XIAP, and the Bcl2 family members, such as MCL1, are elevated in the uterine myocyte during late gestation. The IAP family members are the only endogenous inhibitors of active caspase 3, and MCL1 limits activation of caspase 3 by suppressing proapoptotic signaling. Elevated XIAP levels partner with SURVIVIN, resulting in increased levels of the antiapoptotic MCL1 via NFKB activation; these together have the potential to limit both the activity and level of active caspase 3 in the pregnant uterus as term approaches. We propose that modification of these antiapoptotic signaling partners allows the pregnant uterus to escape the apoptotic action of elevated active caspase 3 levels but also functions to limit the levels of active uterine caspase 3 near term. PMID:21566000

  2. Apoptotic pathways in pancreatic ductal adenocarcinoma

    PubMed Central

    Hamacher, Rainer; Schmid, Roland M; Saur, Dieter; Schneider, Günter

    2008-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is one of the most common causes of cancer related death. Despite the advances in understanding of the molecular pathogenesis, pancreatic cancer remains a major unsolved health problem. Overall, the 5-year survival rate is less than 5% demonstrating the insufficiency of current therapies. Most cytotoxic therapies induce apoptosis and PDAC cells have evolved a plethora of molecular mechanisms to assure survival. We will present anti-apoptotic strategies working at the level of the death receptors, the mitochondria or involving the caspase inhibitors of the IAP family. Furthermore, the survival function of the phosphotidylinositol-3' kinase (PI3K)/AKT- and NF-kappaB-pathways are illustrated. A detailed molecular knowledge of the anti-apoptotic mechanisms of PDAC cells will help to improve therapies for this dismal disease and therapeutic strategies targeting the programmed cell death machinery are in early preclinical and clinical development. PMID:18652674

  3. Conjugated Polyelectrolyte Nanoparticles for Apoptotic Cell Imaging.

    PubMed

    Liu, Yu; Wu, Pan; Jiang, Jianhua; Wu, Jiatao; Chen, Yan; Tan, Ying; Tan, Chunyan; Jiang, Yuyang

    2016-08-31

    Three anionic conjugated polyelectrolytes (CPEs) with poly(p-phenylene ethynylene thiophene) backbones were designed and synthesized, among which PPET3-CO2Na showed greater molar extinction coefficient with red-shifted bands in both absorption and emission spectra compared to the well-studied PPE-CO2Na polymer. PPET3-CO2Na was thus chosen to construct CPE-based nanoparticles (CPNs) with cationic octaarginine (R8) peptide through electrostatic-interaction-induced self-assembly. Due to plasma membrane permeabilization and mitochondrial outer membrane permeabilization (MOMP) in early apoptotic cells, PPET3/R8 CPNs demonstrated excellent colocalization with MitoTracker Red in apoptotic cells instead of normal cells, which had potential application in cell imaging for early apoptosis recognition. PMID:27525500

  4. Assembly of the Bak Apoptotic Pore

    PubMed Central

    Ma, Stephen; Hockings, Colin; Anwari, Khatira; Kratina, Tobias; Fennell, Stephanie; Lazarou, Michael; Ryan, Michael T.; Kluck, Ruth M.; Dewson, Grant

    2013-01-01

    Bak and Bax are the essential effectors of the intrinsic pathway of apoptosis. Following an apoptotic stimulus, both undergo significant changes in conformation that facilitates their self-association to form pores in the mitochondrial outer membrane. However, the molecular structures of Bak and Bax oligomeric pores remain elusive. To characterize how Bak forms pores during apoptosis, we investigated its oligomerization under native conditions using blue native PAGE. We report that, in a healthy cell, inactive Bak is either monomeric or in a large complex involving VDAC2. Following an apoptotic stimulus, activated Bak forms BH3:groove homodimers that represent the basic stable oligomeric unit. These dimers multimerize to higher-order oligomers via a labile interface independent of both the BH3 domain and groove. Linkage of the α6:α6 interface is sufficient to stabilize higher-order Bak oligomers on native PAGE, suggesting an important role in the Bak oligomeric pore. Mutagenesis of the α6 helix disrupted apoptotic function because a chimera of Bak with the α6 derived from Bcl-2 could be activated by truncated Bid (tBid) and could form BH3:groove homodimers but could not form high molecular weight oligomers or mediate cell death. An α6 peptide could block Bak function but did so upstream of dimerization, potentially implicating α6 as a site for activation by BH3-only proteins. Our examination of native Bak oligomers indicates that the Bak apoptotic pore forms by the multimerization of BH3:groove homodimers and reveals that Bak α6 is not only important for Bak oligomerization and function but may also be involved in how Bak is activated by BH3-only proteins. PMID:23893415

  5. The Dynamics of Apoptotic Cell Clearance.

    PubMed

    Elliott, Michael R; Ravichandran, Kodi S

    2016-07-25

    The phagocytic clearance of dying cells in a tissue is a highly orchestrated series of intercellular events coordinated by a complex signaling network. Recent data from genetic, biochemical, and live-imaging approaches have greatly enhanced our understanding of the dynamics of cell clearance and how the process is orchestrated at the cellular and tissue levels. We discuss how networks regulating apoptotic cell clearance are integrated to enable a rapid, efficient, and high-capacity clearance system within tissues. PMID:27459067

  6. The amino acid sensor GCN2 inhibits inflammatory responses to apoptotic cells promoting tolerance and suppressing systemic autoimmunity.

    PubMed

    Ravishankar, Buvana; Liu, Haiyun; Shinde, Rahul; Chaudhary, Kapil; Xiao, Wei; Bradley, Jillian; Koritzinsky, Marianne; Madaio, Michael P; McGaha, Tracy L

    2015-08-25

    Efficient apoptotic cell clearance and induction of immunologic tolerance is a critical mechanism preventing autoimmunity and associated pathology. Our laboratory has reported that apoptotic cells induce tolerance by a mechanism dependent on the tryptophan catabolizing enzyme indoleamine 2,3 dioxygenase 1 (IDO1) in splenic macrophages (MΦ). The metabolic-stress sensing protein kinase GCN2 is a primary downstream effector of IDO1; thus, we tested its role in apoptotic cell-driven immune suppression. In vitro, expression of IDO1 in MΦs significantly enhanced apoptotic cell-driven IL-10 and suppressed IL-12 production in a GCN2-dependent mechanism. Suppression of IL-12 protein production was due to attenuation of IL-12 mRNA association with polyribosomes inhibiting translation while IL-10 mRNA association with polyribosomes was not affected. In vivo, apoptotic cell challenge drove a rapid, GCN2-dependent stress response in splenic MΦs with increased IL-10 and TGF-β production, whereas myeloid-specific deletion of GCN2 abrogated regulatory cytokine production with provocation of inflammatory T-cell responses to apoptotic cell antigens and failure of long-tolerance induction. Consistent with a role in prevention of apoptotic cell driven autoreactivity, myeloid deletion of GCN2 in lupus-prone mice resulted in increased immune cell activation, humoral autoimmunity, renal pathology, and mortality. In contrast, activation of GCN2 with an agonist significantly reduced anti-DNA autoantibodies and protected mice from disease. Thus, this study implicates a key role for GCN2 signals in regulating the tolerogenic response to apoptotic cells and limiting autoimmunity. PMID:26261340

  7. The amino acid sensor GCN2 inhibits inflammatory responses to apoptotic cells promoting tolerance and suppressing systemic autoimmunity

    PubMed Central

    Ravishankar, Buvana; Liu, Haiyun; Shinde, Rahul; Chaudhary, Kapil; Xiao, Wei; Bradley, Jillian; Koritzinsky, Marianne; Madaio, Michael P.; McGaha, Tracy L.

    2015-01-01

    Efficient apoptotic cell clearance and induction of immunologic tolerance is a critical mechanism preventing autoimmunity and associated pathology. Our laboratory has reported that apoptotic cells induce tolerance by a mechanism dependent on the tryptophan catabolizing enzyme indoleamine 2,3 dioxygenase 1 (IDO1) in splenic macrophages (MΦ). The metabolic-stress sensing protein kinase GCN2 is a primary downstream effector of IDO1; thus, we tested its role in apoptotic cell-driven immune suppression. In vitro, expression of IDO1 in MΦs significantly enhanced apoptotic cell-driven IL-10 and suppressed IL-12 production in a GCN2-dependent mechanism. Suppression of IL-12 protein production was due to attenuation of IL-12 mRNA association with polyribosomes inhibiting translation while IL-10 mRNA association with polyribosomes was not affected. In vivo, apoptotic cell challenge drove a rapid, GCN2-dependent stress response in splenic MΦs with increased IL-10 and TGF-β production, whereas myeloid-specific deletion of GCN2 abrogated regulatory cytokine production with provocation of inflammatory T-cell responses to apoptotic cell antigens and failure of long-tolerance induction. Consistent with a role in prevention of apoptotic cell driven autoreactivity, myeloid deletion of GCN2 in lupus-prone mice resulted in increased immune cell activation, humoral autoimmunity, renal pathology, and mortality. In contrast, activation of GCN2 with an agonist significantly reduced anti-DNA autoantibodies and protected mice from disease. Thus, this study implicates a key role for GCN2 signals in regulating the tolerogenic response to apoptotic cells and limiting autoimmunity. PMID:26261340

  8. Launch Pad Escape System Design (Human Spaceflight)

    NASA Technical Reports Server (NTRS)

    Maloney, Kelli

    2011-01-01

    A launch pad escape system for human spaceflight is one of those things that everyone hopes they will never need but is critical for every manned space program. Since men were first put into space in the early 1960s, the need for such an Emergency Escape System (EES) has become apparent. The National Aeronautics and Space Administration (NASA) has made use of various types of these EESs over the past 50 years. Early programs, like Mercury and Gemini, did not have an official launch pad escape system. Rather, they relied on a Launch Escape System (LES) of a separate solid rocket motor attached to the manned capsule that could pull the astronauts to safety in the event of an emergency. This could only occur after hatch closure at the launch pad or during the first stage of flight. A version of a LES, now called a Launch Abort System (LAS) is still used today for all manned capsule type launch vehicles. However, this system is very limited in that it can only be used after hatch closure and it is for flight crew only. In addition, the forces necessary for the LES/LAS to get the capsule away from a rocket during the first stage of flight are quite high and can cause injury to the crew. These shortcomings led to the development of a ground based EES for the flight crew and ground support personnel as well. This way, a much less dangerous mode of egress is available for any flight or ground personnel up to a few seconds before launch. The early EESs were fairly simple, gravity-powered systems to use when thing's go bad. And things can go bad very quickly and catastrophically when dealing with a flight vehicle fueled with millions of pounds of hazardous propellant. With this in mind, early EES designers saw such a passive/unpowered system as a must for last minute escapes. This and other design requirements had to be derived for an EES, and this section will take a look at the safety design requirements had to be derived for an EES, and this section will take a look at

  9. 17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ELEVATOR TO 18-FOOT LOCK, LOOKING EAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  10. 14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLDDOWN RODS, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLD-DOWN RODS, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  11. 15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, SHOWING ENTRANCE TO SUBMARINE SECTION AT 110-FOOT LEVEL - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  12. 34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION OF BLISTERS IN 1959, LOOKING SOUTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  13. 21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA AND TOP OF THE TANK, LOOKING NORTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  14. 18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM 50-FOOT LOCK TO ELEVATOR, LOOKING WEST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  15. 23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWOLOCK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWO-LOCK RECOMPRESSION CHAMBER IN PASSAGEWAY FROM ELEVATOR TO CUPOLA - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  16. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  17. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  18. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  19. Enzyme Kinetics.

    ERIC Educational Resources Information Center

    Moe, Owen; Cornelius, Richard

    1988-01-01

    Conveys an appreciation of enzyme kinetic analysis by using a practical and intuitive approach. Discusses enzyme assays, kinetic models and rate laws, the kinetic constants (V, velocity, and Km, Michaels constant), evaluation of V and Km from experimental data, and enzyme inhibition. (CW)

  20. BCDO2 acts as a carotenoid scavenger and gatekeeper for the mitochondrial apoptotic pathway

    PubMed Central

    Lobo, Glenn P.; Isken, Andrea; Hoff, Sylvia; Babino, Darwin; von Lintig, Johannes

    2012-01-01

    Carotenoids and their metabolites are widespread and exert key biological functions in living organisms. In vertebrates, the carotenoid oxygenase BCMO1 converts carotenoids such as β,β-carotene to retinoids, which are required for embryonic pattern formation and cell differentiation. Vertebrate genomes encode a structurally related protein named BCDO2 but its physiological function remains undefined. Here, we show that BCDO2 is expressed as an oxidative stress-regulated protein during zebrafish development. Targeted knockdown of this mitochondrial enzyme resulted in anemia at larval stages. Marker gene analysis and staining for hemoglobin revealed that erythropoiesis was not impaired but that erythrocytes underwent apoptosis in BCDO2-deficient larvae. To define the mechanism of this defect, we have analyzed the role of BCDO2 in human cell lines. We found that carotenoids caused oxidative stress in mitochondria that eventually led to cytochrome c release, proteolytic activation of caspase 3 and PARP1, and execution of the apoptotic pathway. Moreover, BCDO2 prevented this induction of the apoptotic pathway by carotenoids. Thus, our study identifying BCDO2 as a crucial protective component against oxidative stress establishes this enzyme as mitochondrial carotenoid scavenger and a gatekeeper of the intrinsic apoptotic pathway. PMID:22764054

  1. [Escape mutants of hepatitis B virus].

    PubMed

    Jaramillo, Carlos Mario; Navas, María-Cristina

    2015-04-01

    The hepatitis B virus (HBV) infection is a public health problem worldwide. Considering HBV morbidity and mortality and the economic consequences .of this infection, policies and strategies to control it have been implemented, especially in regions where HBV infection is endemic, with high rates of vertical and horizontal infection. One of these strategies is the development of the recombinant vaccine. A 92% of the countries in the world have implemented the vaccine with a global coverage of 69%. The escape variants of HBV correspond to isolates with mutations in the sequence coding for the "a" determinant; these mutations result in changes in the amino acid sequence of the surface antigen (HBsAg) that prevent neutralization of viral particles by antibodies generated in response to vaccination or infection. The escape variants can infect vaccinated individuals and have been identified in the population of countries with different epidemiological patterns. PMID:26065452

  2. Escape of atmospheres and loss of water

    NASA Technical Reports Server (NTRS)

    Hunten, D. M.; Donahue, T. M.; Walker, J. C. G.; Kasting, J. F.

    1989-01-01

    The properties and limitations of several loss processes for atmospheric gases are presented and discussed. They include thermal loss (Jeans and hydrodynamic); nonthermal loss (all processes involve charged particles); and impact erosion, including thermal escape from a molten body heated by rapid accretion. Hydrodynamic escape, or 'blowoff', is of particular interest because it offers the prospect of processing large quantities of gas and enriching the remainder in heavy elements and isotopes. In a second part, the water budgets and likely evolutionary histories of Venus, Earth and Mars are assessed. Although it is tempting to associate the great D/H enrichment on Venus with loss of a large initial endowment, a steady state with juvenile water (perhaps from comets) is equally probable.

  3. CRV Escape Trajectories from the ISS

    NASA Technical Reports Server (NTRS)

    Foti, Tony M.

    1999-01-01

    The Crew Return Vehicle (CRV) slated for use on the International Space Station (ISS) provides a safe return for up to seven crew members under various emergency conditions. One of the most demanding situations for executing the escape involves separating from a tumbling ISS Current requirements specify a maximum Root Sum Square (RSS) tumble rate of 2 degrees/second, with the additional requirement for an expedited departure from any ISS attitude. The design of a trajectory that ensures no re-contact with the ISS poses many challenges on the Guidance, Navigation, and Control (GN&C) system of the vehicle. To ensure no re-contact the trajectory design employs a two burn sequence, with the first burn preventing near-term collision and the second burn preventing far-field re-contact This presentation describes the approach used to design and to evaluate trajectories for CRV departure from the baselined location on the ISS Node 3 starboard. This approach involved performing a parametric search of selected control variables vital in escaping the tumbling ISS The presentation provides a candidate targeting methodology for escape using minimal information from available navigation devices, and presents the quantitative results from the analysis.

  4. Scrunching: a novel escape gait in planarians

    NASA Astrophysics Data System (ADS)

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J.; Collins, Eva-Maria S.

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, ‘scrunching’, which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration.

  5. Cold ion escape from the Martian ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, M.; Dubinin, E.; Andrews, D.; Barabash, S.; Nilsson, H.; Fedorov, A.

    2015-12-01

    We here report on new measurements of the escape flux of oxygen ions from Mars by combining the observations of the ASPERA-3 and MARSIS experiments on board the European Mars Express spacecraft. We show that in previous estimates of the total heavy ion escape flow the contribution of the cold ionospheric outflow with energies below 10 eV has been underestimated. Both case studies and the derived flow pattern indicate that the cold plasma observed by MARSIS and the superthermal plasma observed by ASPERA-3 move with the same bulk speed in most regions of the Martian tail. We determine maps of the tailside heavy ion flux distribution derived from mean ion velocity distributions sampled over 7 years. If we assume that the superthermal bulk speed derived from these long time averages of the ion distribution function represent the total plasma bulk speed we derive the total tailside plasma flux. Assuming cylindrical symmetry we determine the mean total escape rate for the years 2007-2014 at 2.8 ± 0.4 ×1025 atoms / s which is in good agreement with model estimates. A possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside.

  6. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, M.; Dubinin, E.; Andrews, D.; Nilsson, H.; Barabash, S.; Fedorov, A.

    2015-10-01

    We here report on new measurements of the escape flux of oxygen ions from Mars by combining the observations of the ASPERA-3 and MARSIS experiments on board the European Mars Express spacecraft. We show that in previous estimates of the total heavy ion escape flow the contribution of the coldionospheric outflow with energies below 10 eV has been underestimated. Both case studies and the derived flow pattern indicate that the cold plasma observed by MARSIS and the superthermal plasma observed by ASPERA-3 move with the same bulk speed in most regions of the Martian tail. We determine maps of the tailside heavy ion flux distribution derived from mean ion velocity distributions sampled over 7 years. If we assume that the superthermal bulk speed derived from these long time averages of the ion distribution function represent the total plasma bulk speed we derive the total tailside plasma flux. Assuming cylindrical symmetry we determine the mean total escape rate for the years 2007 to 2014 at 2.9±0.2×10 25 atoms/s which is in good agreement with model estimates. In this talk we will also try to compare these results with more recent observations by the MAVEN spacecraft. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  7. Xenon Fractionation and Archean Hydrogen Escape

    NASA Technical Reports Server (NTRS)

    Zahnle, K. J.

    2015-01-01

    Xenon is the heaviest gas found in significant quantities in natural planetary atmospheres. It would seem the least likely to escape. Yet there is more evidence for xenon escape from Earth than for any element other than helium and perhaps neon. The most straightforward evidence is that most of the radiogenic Xe from the decay of (129)I (half-life 15.7 Myr) and (244)Pu (half-life 81 Myr) that is Earth's birthright is missing. The missing xenon is often attributed to the impact erosion of early atmospheres of Earth and its ancestors. It is obvious that if most of the radiogenic xenon were driven off by impacts, most of the rest of the atmophiles fared the same fate. The other line of evidence is in the nonradiogenic isotopes of xenon and its silent partner, krypton. Atmospheric xenon is strongly mass fractionated (at about 4% per amu) compared to any known solar system source (Figure 1). This is in stark contrast to krypton, which may not be fractionated at all: atmospheric Kr is slightly heavier than solar Kr (at about 0.5% per amu), but it is the same as in carbonaceous chondrites. Nonradiogenic xenon is also under abundant relative to krypton (the so-called "missing xenon" problem). Together these observations imply that xenon has been subject to fractionating escape and krypton not.

  8. Scrunching: a novel escape gait in planarians.

    PubMed

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J; Collins, Eva-Maria S

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, 'scrunching', which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration. PMID:26356147

  9. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape...

  10. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape...

  11. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  12. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  13. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  14. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  15. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... controls. (b) Every mechanical escape facility with a platform, cage, or other device shall be equipped with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities...

  16. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  17. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST... Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l) and (m) of this section, there must be at least two means of escape, exclusive of windows...

  18. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST... Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l) and (m) of this section, there must be at least two means of escape, exclusive of windows...

  19. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST... Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l) and (m) of this section, there must be at least two means of escape, exclusive of windows...

  20. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  1. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Means of escape. 116.500 Section 116.500 Shipping COAST... and Embarkation Station Requirements § 116.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  2. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  3. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Means of escape. 116.500 Section 116.500 Shipping COAST... and Embarkation Station Requirements § 116.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  4. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  5. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Means of escape. 116.500 Section 116.500 Shipping COAST... and Embarkation Station Requirements § 116.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means...

  6. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST... and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f) of this section, there must be at least two means of escape from all areas generally accessible to...

  7. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fraenz, M.; Dubinin, E.; Wei, Y.; Woch, J. G.; Morgan, D. D.; Barabash, S. V.; Lundin, R. N.; Fedorov, A.

    2012-12-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. We first use support from the MARSIS radar experiment for some orbits with fortunate observation geometry. Here we have observed a transterminator flow of O+ and O2+ ions with a super-sonic velocity of around 5km/s and fluxes of 0.8x10^9/cm^2s. If we assume a symmetric flux around the terminator this corresponds to an ion flow of 3.1x10^25/s half of which is expected to escape from Mars (Fraenz et al, 2010). This escape flux is significantly higher than previously observed on the tailside of Mars, we discuss possible reasons for the difference. Since 2008 the MARSIS radar does nightside local plasma density measurement which often coincide with ASPERA-3 measurements. In a new analysis of the combined nightside datasets (Fig. 1) we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 R_M the flux settles at a constant value (Fig. 2) which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvenic regime.; Median oxygen ion flux reconstructed by combining ion velocity observations of the Mars Express ASPERA-3 IMA sensor and local plasma density observations by the MARSIS radar. Each bin value is the median from observations on about 3000 orbits between May 2007 and July 2011. Horizontal axis is MSO X-axis (Sun towards the left), vertical axis is vertical distance from MSO X-axis. ; Ring median flux of cylindrical ring regions of all bins shown in previous figure. The different colors show median fluxes

  8. Hydrodynamical Modeling of Hydrogen Escape from Rocky Planets

    NASA Astrophysics Data System (ADS)

    Barringer, Daniel; Zugger, M.; Kasting, J.

    2013-01-01

    Hydrogen escape affects both the composition of primitive atmospheres of terrestrial planets and the planet’s state of oxidation. On Mars, hydrogen escape played a critical role in how long the planet remained in a warm wet state amenable to life. For both solar and extrasolar planets, hydrogen-rich atmospheres are better candidates for originating life by way of Miller-Urey-type prebiotic synthesis. However, calculating the rate of atmospheric hydrogen escape is difficult, for a number of reasons. First, the escape can be controlled either by diffusion through the homopause or by conditions in the upper atmosphere, whichever is slower. Second, both thermal and non-thermal escape mechanisms are typically important. Third, thermal escape itself can be subdivided into Jeans escape (thin upper atmosphere), and hydrodynamic escape, and hydrodynamic escape can be further subdivided into transonic escape and slower subsonic escape, depending on whether the exobase occurs above or below the sonic point. Additionally, the rate of escape for real terrestrial planet atmospheres, which are not 100% hydrogen, depends upon the concentration of infrared coolants, and upon heating and photochemistry driven largely by extreme ultraviolet (EUV) radiation. We have modified an existing 1-D model of hydrodynamic escape (F. Tian et al., JGR, 2008) to work in the high- hydrogen regime. Calculations are underway to determine hydrogen escape rates as a function of atmospheric H2 mixing ratio and the solar EUV flux. We will compare these rates with the estimated upper limit on the escape rate based on diffusion. Initial results for early Earth and Mars will later be extended to rocky exoplanets.

  9. Risks incurred by hydrogen escaping from containers and conduits

    SciTech Connect

    Swain, M.R.; Grilliot, E.S.; Swain, M.N.

    1998-08-01

    This paper is a discussion of a method for hydrogen leak classification. Leaks are classified as; gas escapes into enclosed spaces, gas escapes into partially enclosed spaces (vented), and gas escapes into unenclosed spaces. Each of the three enclosure classifications is further divided into two subclasses; total volume of hydrogen escaped and flow rate of escaping hydrogen. A method to aid in risk assessment determination in partially enclosed spaces is proposed and verified for several enclosure geometries. Examples are discussed for additional enclosure geometries.

  10. Enzyme Informatics

    PubMed Central

    Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika

    2012-01-01

    Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471

  11. Apoptotic cell death induced by intracellular proteolysis.

    PubMed

    Williams, M S; Henkart, P A

    1994-11-01

    To mimic the injection of granzymes into target cells by cytotoxic lymphocytes or the activation of endogenous proteases in programmed cell death, the proteases chymotrypsin, proteinase K, or trypsin were loaded into the cytoplasm of several different cell types using the osmotic lysis of pinosomes technique. Internalization of these proteases caused cell lysis within several hours, accompanied by extensive nuclear damage in most but not all combinations of target cells and proteases. This nuclear damage, quantitated by DNA release from nuclei, was associated with apoptotic features including DNA fragmentation into nucleosomal ladders, chromatin condensation, nuclear fragmentation, and membrane blebbing. Agents reported to block programmed cell death, including aurintricarboxylic acid, inhibitors of energy metabolism, and protein or RNA synthesis, failed to block this protease-induced death, although some inhibited nuclear damage. In separate experiments, introduction of staphylococcal nuclease into cells led to near complete (at least 75% of total) nucleosomal DNA fragmentation within 6 to 8 h. Condensation of chromatin did not accompany this fragmentation to the same extent, and there was approximately a 10-h lag between half-maximal DNA fragmentation and 50% loss of membrane integrity. The results suggest that activation of intracellular proteases during cell death by any molecular pathway could give rise to apoptotic morphology and DNA fragmentation. PMID:7930626

  12. Organization of the Mitochondrial Apoptotic BAK Pore

    PubMed Central

    Aluvila, Sreevidya; Mandal, Tirtha; Hustedt, Eric; Fajer, Peter; Choe, Jun Yong; Oh, Kyoung Joon

    2014-01-01

    The multidomain pro-apoptotic Bcl-2 family proteins BAK and BAX are believed to form large oligomeric pores in the mitochondrial outer membrane during apoptosis. Formation of these pores results in the release of apoptotic factors including cytochrome c from the intermembrane space into the cytoplasm, where they initiate the cascade of events that lead to cell death. Using the site-directed spin labeling method of electron paramagnetic resonance (EPR) spectroscopy, we have determined the conformational changes that occur in BAK when the protein targets to the membrane and forms pores. The data showed that helices α1 and α6 disengage from the rest of the domain, leaving helices α2-α5 as a folded unit. Helices α2-α5 were shown to form a dimeric structure, which is structurally homologous to the recently reported BAX “BH3-in-groove homodimer.” Furthermore, the EPR data and a chemical cross-linking study demonstrated the existence of a hitherto unknown interface between BAK BH3-in-groove homodimers in the oligomeric BAK. This novel interface involves the C termini of α3 and α5 helices. The results provide further insights into the organization of the BAK oligomeric pores by the BAK homodimers during mitochondrial apoptosis, enabling the proposal of a BAK-induced lipidic pore with the topography of a “worm hole.” PMID:24337568

  13. The Modulation of Apoptotic Pathways by Gammaherpesviruses

    PubMed Central

    Banerjee, Shuvomoy; Uppal, Timsy; Strahan, Roxanne; Dabral, Prerna; Verma, Subhash C.

    2016-01-01

    Apoptosis or programmed cell death is a tightly regulated process fundamental for cellular development and elimination of damaged or infected cells during the maintenance of cellular homeostasis. It is also an important cellular defense mechanism against viral invasion. In many instances, abnormal regulation of apoptosis has been associated with a number of diseases, including cancer development. Following infection of host cells, persistent and oncogenic viruses such as the members of the Gammaherpesvirus family employ a number of different mechanisms to avoid the host cell’s “burglar” alarm and to alter the extrinsic and intrinsic apoptotic pathways by either deregulating the expressions of cellular signaling genes or by encoding the viral homologs of cellular genes. In this review, we summarize the recent findings on how gammaherpesviruses inhibit cellular apoptosis via virus-encoded proteins by mediating modification of numerous signal transduction pathways. We also list the key viral anti-apoptotic proteins that could be exploited as effective targets for novel antiviral therapies in order to stimulate apoptosis in different types of cancer cells. PMID:27199919

  14. Genistein suppresses the mitochondrial apoptotic pathway in hippocampal neurons in rats with Alzheimer's disease

    PubMed Central

    Wang, Yan; Cai, Biao; Shao, Jing; Wang, Ting-ting; Cai, Run-ze; Ma, Chang-ju; Han, Tao; Du, Jun

    2016-01-01

    Genistein is effective against amyloid-β toxicity, but the underlying mechanisms are unclear. We hypothesized that genistein may protect neurons by inhibiting the mitochondrial apoptotic pathway, and thereby play a role in the prevention of Alzheimer’s disease. A rat model of Alzheimer’s disease was established by intraperitoneal injection of D-galactose and intracerebral injection of amyloid-β peptide (25–35). In the genistein treatment groups, a 7-day pretreatment with genistein (10, 30, 90 mg/kg) was given prior to establishing Alzheimer’s disease model, for 49 consecutive days. Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling assay demonstrated a reduction in apoptosis in the hippocampus of rats treated with genistein. Western blot analysis showed that expression levels of capase-3, Bax and cytochrome c were decreased compared with the model group. Furthermore, immunohistochemical staining revealed reductions in cytochrome c and Bax immunoreactivity in these rats. Morris water maze revealed a substantial shortening of escape latency by genistein in Alzheimer’s disease rats. These findings suggest that genistein decreases neuronal loss in the hippocampus, and improves learning and memory ability. The neuroprotective effects of genistein are associated with the inhibition of the mitochondrial apoptotic pathway, as shown by its ability to reduce levels of caspase-3, Bax and cytochrome c.

  15. Galectin-1 and Galectin-3 induce mitochondrial apoptotic pathway in Jurkat cells

    NASA Astrophysics Data System (ADS)

    Vasil'eva, O. A.; Isaeva, A. V.; Prokhorenko, T. S.; Zima, A. P.; Novitsky, V. V.

    2016-08-01

    Cellular malignant transformation is often accompanied by increased gene expression of low-molecular proteins of lectins family-galectins. But it is unknown how galectins promote tumor growth and malignization. Galectins-1 and galectin-3 are thought to be possible immunoregulators exerting their effects by regulating the balance of CD4+ lymphocytes. In addition it is known that tumor cells overexpressing galectins are capable of escaping immunological control, causing apoptosis of lymphocytes. The aim of the study is to investigate the role of galectin-1 and galectin-3 in the implementation of mitochondrial apoptotic pathway in Jurkat cells. Methods: Jurkat cells were used as a model for the study of T-lymphocytes. Jurkat cells were activated with antibodies to CD3 and CD28 and cultured with recombinant galectin-1 and -3. Apoptosis of Jurkat cells and depolarization of the mitochondrial membrane were assessed by flow cytometry. It was found that galectin-1 and galectin-3 have a dose-dependent pro-apoptotic effect on Jurkat cells in vitro and enlarge the number of cells with decreased mitochondrial membrane potential compared with intact cells.

  16. Apoptotic cell clearance: basic biology and therapeutic potential

    PubMed Central

    Poon, Ivan K. H.; Lucas, Christopher D.

    2014-01-01

    Prompt removal of apoptotic cells by phagocytes is important for maintaining tissue homeostasis. The molecular and cellular events that underpin apoptotic cell recognition and uptake, and the subsequent biological responses are increasingly better defined. The detection and disposal of apoptotic cells generally promote an anti-inflammatory response at the tissue level, as well as immunological tolerance. Consequently, defects in apoptotic cell clearance have been linked with a variety of inflammatory diseases and autoimmunity. Conversely, under certain conditions such as killing tumour cells by specific cell death inducers, the recognition of apoptotic tumour cells can promote an immunogenic response and anti-tumour immunity. Here, we review the current understanding of the complex process of apoptotic cell clearance in physiology and pathology, and discuss how this knowledge could be harnessed for new therapeutic strategies. PMID:24481336

  17. Dual-functional bio-derived nanoparticulates for apoptotic antitumor therapy.

    PubMed

    Ding, Yang; Wang, Yazhe; Opoku-Damoah, Yaw; Wang, Cheng; Shen, Lingjia; Yin, Lifang; Zhou, Jianping

    2015-12-01

    The application of bio-derived nanoparticulates has gained a remarkable degree of interest as a promising sustained-release, site-targeted and completely biodegradable delivery system for chemotherapeutics. We hereby introduce a dual-functionalized biomimetic nanovector, cell-penetrating peptide (CPP)-anchored recombinant high density lipoproteins (cp-rHDL), which affords high payload and improved targeting of gambogic acid (GA), a therapeutic agent for apoptotic antitumor therapy. GA-loaded cp-rHDL nanoparticles (cp-rHDL/GA) consisted of hydrophobic core modulating GA, apolipoprotein A-I (apo A-I) for attractive integrating and tumor-homing, and lipophilic anchored R6H4 (RRRRRRHHHH, a pH-responsive CPP) offering a pH-controlled penetrating potential. Upon stepwise incubation with apo A-I and R6H4, cp-rHDL/GA presented several merits, including desirable physicochemical properties, superior biostability, and favorable buffering capacity resulting in proton sponge effect. Synergistic intracellular mechanism for scavenger receptor class B type I (SR-BI)-mediated direct transmembrane delivery, and pH-responsive R6H4 associated endocytotic pathway with rapid endo-lysosomal escape was also observed. This tailored cp-rHDL/GA displayed remarkable cytotoxicity and apoptotic effect via triggering p53 pathway, and provided approximately 5-fold increase in IC50 compared to free GA. Moreover, this rational biomimetic therapeutic strategy attained superior tumor accumulation and significant inhibition of tumor growth in HepG2 xenograft tumor animal models without measurable adverse effect. Results of this study demonstrated that bio-derived cp-rHDL/GA presents pH-responsive penetrating potential and efficient cellular internalization. This dual-functionalization model will open an avenue for exploration of multi-functional bio-derived drug delivery, thereby rendering potential broad applications in apoptotic anticancer therapy. PMID:26344366

  18. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, Markus; Dubinin, Eduard; Andrews, David; Nilsson, Hans; Fedorov, Andrei

    2014-05-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. The ion sensor IMA of this experiment has in principle a low-energy cut-off at 10eV but in negative spacecraft charging cold ions are lifted into the range of measurement but the field of view is restricted to about 4x360 deg. In a recent paper Nilsson et al. (Earth Planets Space, 64, 135, 2012) tried to use the method of long-time averaged distribution functions to overcome these constraints. In this paper we first use the same method to show that we get results consistent with this when using ASPERA-3 observations only. But then we can show that these results are inconsistent with observations of the local plasma density by the MARSIS radar instrument on board Mars Express. We demonstrate that the method of averaged distribution function can deliver the mean flow speed of the plasma but the low-energy cut-off does usually not allow to reconstruct the density. We then combine measurements of the cold ion flow speed with the plasma density observations of MARSIS to derive the cold ion flux. In an analysis of the combined nightside datasets we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 Martian radii the flux settles at a constant value which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  19. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    PubMed Central

    2011-01-01

    Background Runt-related transcription factor 3 (RUNX3) is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC). Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91%) and tissues (90%). RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis. PMID:21205319

  20. Suicide as escape from psychotic panic.

    PubMed

    Goldblatt, Mark J; Ronningstam, Elsa; Schechter, Mark; Herbstman, Benjamin; Maltsberger, John T

    2016-01-01

    Suicides of patients in states of acute persecutory panic may be provoked by a subjective experience of helpless terror threatening imminent annihilation or dismemberment. These patients are literally scared to death and try to run away. They imagine suicide is survivable and desperately attempt to escape from imaginary enemies. These states of terror occur in a wide range of psychotic illnesses and are often associated with command hallucinations and delusions. In this article, the authors consider the subjective experience of persecutory panic and the suicide response as an attempt to flee from danger. PMID:27294586

  1. X-chromosome inactivation and escape

    PubMed Central

    DISTECHE, CHRISTINE M.; BERLETCH, JOEL B.

    2016-01-01

    X-chromosome inactivation, which was discovered by Mary Lyon in 1961 results in random silencing of one X chromosome in female mammals. This review is dedicated to Mary Lyon, who passed away last year. She predicted many of the features of X inactivation, for e.g., the existence of an X inactivation center, the role of L1 elements in spreading of silencing and the existence of genes that escape X inactivation. Starting from her published work here we summarize advances in the field. PMID:26690513

  2. Escape Artists of the X Chromosome.

    PubMed

    Balaton, Bradley P; Brown, Carolyn J

    2016-06-01

    Inactivation of one X chromosome in mammalian females achieves dosage compensation between XX females and XY males; however, over 15% of human X-linked genes continue to be expressed from the inactive X chromosome. New genomic methodologies have improved our identification and characterization of these escape genes, revealing the importance of DNA sequence, chromatin structure, and chromosome ultrastructure in regulating expression from an otherwise inactive chromosome. Study of these exceptions to the rule of silencing highlights the interconnectedness of chromatin and chromosome structure in X-chromosome inactivation (XCI). Recent advances also demonstrate the importance of these genes in sexually dimorphic disease risk, particularly cancer. PMID:27103486

  3. Serial Escape System For Aircraft Crews

    NASA Technical Reports Server (NTRS)

    Wood, Kenneth E.

    1990-01-01

    Emergency escape system for aircraft and aerospace vehicles ejects up to seven crewmembers, one by one, within 120 s. Intended for emergencies in which disabled craft still in stable flight at no more than 220 kn (113 m/s) equivalent airspeed and sinking no faster than 110 ft/s (33.5 m/s) at altitudes up to 50,000 ft (15.2 km). Ejection rockets load themselves from magazine after each crewmember ejected. Jumpmaster queues other crewmembers and helps them position themselves on egress ramp. Rockets pull crewmembers clear of aircraft structure. Provides orderly, controlled exit and avoids ditching at sea or landing in rough terrain.

  4. Intracellular Staphylococcus aureus Escapes the Endosome and Induces Apoptosis in Epithelial Cells

    PubMed Central

    Bayles, Kenneth W.; Wesson, Carla A.; Liou, Linda E.; Fox, Lawrence K.; Bohach, Gregory A.; Trumble, W. R.

    1998-01-01

    We examined the invasion of an established bovine mammary epithelial cell line (MAC-T) by a Staphylococcus aureus mastitis isolate to study the potential role of intracellular survival in the persistence of staphylococcal infections. S. aureus cells displayed dose-dependent invasion of MAC-T cells and intracellular survival. An electron microscopic examination of infected cells indicated that the bacteria induced internalization via a mechanism involving membrane pseudopod formation and then escaped into the cytoplasm following lysis of the endosomal membrane. Two hours after the internalization of S. aureus, MAC-T cells exhibited detachment from the matrix, rounding, a mottled cell membrane, and vacuolization of the cytoplasm, all of which are indicative of cells undergoing programmed cell death (apoptosis). By 18 h, the majority of the MAC-T cell population exhibited an apoptotic morphology. Other evidence for apoptosis was the generation of MAC-T cell DNA fragments differing in size by increments of approximately 180 bp and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling of the fragmented nuclear DNA of the infected host cells. These results demonstrate that after internalization S. aureus escapes the endosome and induces apoptosis in nonprofessional phagocytes. PMID:9423876

  5. Enzymes, Industrial

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes serve key roles in numerous biotechnology processes and products that are commonly encountered in the forms of food and beverages, cleaning supplies, clothing, paper products, transportation fuels, pharmaceuticals, and monitoring devices. Enzymes can display regio- and stereo-specificity, p...

  6. Understanding Enzymes.

    ERIC Educational Resources Information Center

    Sinnott, M. L.

    1979-01-01

    Describes the way enzymes operate through reaction energetics, and explains that most of the catalytic power of enzymes lies in the strong noncovalent forces responsible for initial binding of substrate, which are only manifested at the transition state of the reaction. (Author/GA)

  7. Soil Enzymes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The functionality and resilience of natural and managed ecosystems mainly rely on the metabolic abilities of microbial communities, the main source of enzymes in soils. Enzyme mediated reactions are critical in the decomposition of organic matter, cycling of nutrients, and in the breakdown of herbic...

  8. The effects of steady swimming on fish escape performance.

    PubMed

    Anwar, Sanam B; Cathcart, Kelsey; Darakananda, Karin; Gaing, Ashley N; Shin, Seo Yim; Vronay, Xena; Wright, Dania N; Ellerby, David J

    2016-06-01

    Escape maneuvers are essential to the survival and fitness of many animals. Escapes are frequently initiated when an animal is already in motion. This may introduce constraints that alter the escape performance. In fish, escape maneuvers and steady, body caudal fin (BCF) swimming are driven by distinct patterns of curvature of the body axis. Pre-existing muscle activity may therefore delay or diminish a response. To quantify the performance consequences of escaping in flow, escape behavior was examined in bluegill sunfish (Lepomis macrochirus) in both still-water and during steady swimming. Escapes executed during swimming were kinematically less variable than those made in still-water. Swimming escapes also had increased response latencies and lower peak velocities and accelerations than those made in still-water. Performance was also lower for escapes made up rather than down-stream, and a preference for down-stream escapes may be associated with maximizing performance. The constraints imposed by pre-existing motion and flow, therefore, have the potential to shape predator-prey interactions under field conditions by shifting the optimal strategies for both predators and prey. PMID:27161016

  9. Escape from X Inactivation Varies in Mouse Tissues

    PubMed Central

    Yang, Fan; Shendure, Jay; Noble, William S.; Disteche, Christine M.; Deng, Xinxian

    2015-01-01

    X chromosome inactivation (XCI) silences most genes on one X chromosome in female mammals, but some genes escape XCI. To identify escape genes in vivo and to explore molecular mechanisms that regulate this process we analyzed the allele-specific expression and chromatin structure of X-linked genes in mouse tissues and cells with skewed XCI and distinguishable alleles based on single nucleotide polymorphisms. Using a binomial model to assess allelic expression, we demonstrate a continuum between complete silencing and expression from the inactive X (Xi). The validity of the RNA-seq approach was verified using RT-PCR with species-specific primers or Sanger sequencing. Both common escape genes and genes with significant differences in XCI status between tissues were identified. Such genes may be candidates for tissue-specific sex differences. Overall, few genes (3–7%) escape XCI in any of the mouse tissues examined, suggesting stringent silencing and escape controls. In contrast, an in vitro system represented by the embryonic-kidney-derived Patski cell line showed a higher density of escape genes (21%), representing both kidney-specific escape genes and cell-line specific escape genes. Allele-specific RNA polymerase II occupancy and DNase I hypersensitivity at the promoter of genes on the Xi correlated well with levels of escape, consistent with an open chromatin structure at escape genes. Allele-specific CTCF binding on the Xi clustered at escape genes and was denser in brain compared to the Patski cell line, possibly contributing to a more compartmentalized structure of the Xi and fewer escape genes in brain compared to the cell line where larger domains of escape were observed. PMID:25785854

  10. Structured Observations Reveal Slow HIV-1 CTL Escape

    PubMed Central

    Roberts, Hannah E.; Hurst, Jacob; Robinson, Nicola; Brown, Helen; Flanagan, Peter; Vass, Laura; Fidler, Sarah; Weber, Jonathan; Babiker, Abdel; Phillips, Rodney E.; McLean, Angela R.; Frater, John

    2015-01-01

    The existence of viral variants that escape from the selection pressures imposed by cytotoxic T-lymphocytes (CTLs) in HIV-1 infection is well documented, but it is unclear when they arise, with reported measures of the time to escape in individuals ranging from days to years. A study of participants enrolled in the SPARTAC (Short Pulse Anti-Retroviral Therapy at HIV Seroconversion) clinical trial allowed direct observation of the evolution of CTL escape variants in 125 adults with primary HIV-1 infection observed for up to three years. Patient HLA-type, longitudinal CD8+ T-cell responses measured by IFN-γ ELISpot and longitudinal HIV-1 gag, pol, and nef sequence data were used to study the timing and prevalence of CTL escape in the participants whilst untreated. Results showed that sequence variation within CTL epitopes at the first time point (within six months of the estimated date of seroconversion) was consistent with most mutations being transmitted in the infecting viral strain rather than with escape arising within the first few weeks of infection. Escape arose throughout the first three years of infection, but slowly and steadily. Approximately one third of patients did not drive any new escape in an HLA-restricted epitope in just under two years. Patients driving several escape mutations during these two years were rare and the median and modal numbers of new escape events in each patient were one and zero respectively. Survival analysis of time to escape found that possession of a protective HLA type significantly reduced time to first escape in a patient (p = 0.01), and epitopes escaped faster in the face of a measurable CD8+ ELISpot response (p = 0.001). However, even in an HLA matched host who mounted a measurable, specific, CD8+ response the average time before the targeted epitope evolved an escape mutation was longer than two years. PMID:25642847

  11. The escape model for Galactic cosmic rays

    NASA Astrophysics Data System (ADS)

    Giacinti, G.; Kachelrieß, M.; Semikoz, D. V.

    2015-08-01

    The escape model explains the cosmic ray (CR) knee by energy-dependent CR leakage from the Milky Way, with an excellent fit to all existing data. We test this model calculating the trajectories of individual CRs in the Galactic magnetic field. We find that the CR escape time τesc(E) exhibits a knee-like structure around E/Z = few × 1015 eV for small coherence lengths and strengths of the turbulent magnetic field. The resulting intensities for different groups of nuclei are consistent with the ones determined by KASCADE and KASCADE-Grande, using simple power-laws as injection spectra. The transition from Galactic to extragalactic CRs happens in this model at low energies and is terminated below ≈ 3 × 1018 eV. The intermediate energy region up to the ankle is populated by CRs accelerated in starburst galaxies. This model provides a good fit to ln(A) data, while the estimated CR dipole anisotropy is close to, or below, upper limits in the energy range 1017 - 1018 eV. The phase of the dipole is expected to change between 1 × 1017 and 3 × 1018 eV.

  12. A New Maneuver for Escape Trajectories

    NASA Technical Reports Server (NTRS)

    Adams, Robert B.

    2008-01-01

    This presentation put forth a new maneuver for escape trajectories and specifically sought to find an analytical approximation for medium thrust trajectories. In most low thrust derivations the idea is that escape velocity is best achieved by accelerating along the velocity vector. The reason for this is that change in specific orbital energy is a function of velocity and acceleration. However, Levin (1952) suggested that while this is a locally optimal solution it might not be a globally optimal one. Turning acceleration inward would drop periapse giving a higher velocity later in the trajectory. Acceleration at that point would be dotted against a higher magnitude V giving a greater rate of change of mechanical energy. The author then hypothesized that decelerating from the initial orbit and then accelerating at periapse would not lead to a gain in greater specific orbital energy--however, the hypothesis was incorrect. After considerable derivation it was determined that this new maneuver outperforms a direct burn when the overall DeltaV budget exceeds the initial orbital velocity (the author has termed this the Heinlein maneuver). The author provides a physical explanation for this maneuver and presents optimization analyses.

  13. Orbital Effects on Mercury's Escaping Sodium Exosphere

    NASA Technical Reports Server (NTRS)

    Schmidt, Carl A.; Wilson, Jody K.; Baumgardner, Jeffrey; Mendillo, Michael

    2009-01-01

    We present results from coronagraphic imaging of Mercury's sodium tail over a 7 deg field of view. Several sets of observations made at the McDonald Observatory since May 2007 show a tail of neutral sodium atoms stretching more than 1000 Mercury radii (R(sub m)) in length, or a full degree of sky. However, no tail was observed extending beyond 120 R(sub m) during the January 2008 MESSENGER Fly-by period, or during a similar orbital phase of Mercury in July 2008. Large changes in Mercury's heliocentric radial velocity cause Doppler shifts about the Fraunhofer absorption features; the resultant change in solar flux and radiation pressure is the primary cause of the observed variation in tail brightness. Smaller fluctuations in brightness may exist due to changing source rates at the surface, but we have no explicit evidence for such changes in this data set. The effects of radiation pressure on Mercury's escaping atmosphere are investigated using seven observations spanning different orbital phases. Total escape rates of atmospheric sodium are estimated to be between 5 and 13 x 10(exp 23) atoms/s and show a correlation to radiation pressure. Candidate sources of Mercury's sodium exosphere include desorption by UV sunlight, thermal desorption, solar wind channeled along Mercury's magnetic field lines, and micro-meteor impacts. Wide-angle observations of the full extent of Mercury's sodium tail offer opportunities to enhance our understanding of the time histories of these source rates.

  14. How some T cells escape tolerance induction.

    PubMed

    Gammon, G; Sercarz, E

    1989-11-01

    A feature common to many animal models of autoimmune disease, for example, experimental allergic encephalomyelitis, experimental autoimmune myasthenia gravis and collagen-induced arthritis, is the presence of self-reactive T cells in healthy animals, which are activated to produce disease by immunization with exogenous antigen. It is unclear why these T cells are not deleted during ontogeny in the thymus and, having escaped tolerance induction, why they are not spontaneously activated by self-antigen. To investigate these questions, we have examined an experimental model in which mice are tolerant to an antigen despite the presence of antigen-reactive T cells. We find that the T cells that escape tolerance induction are specific for minor determinants on the antigen. We propose that these T cells evade tolerance induction because some minor determinants are only available in relatively low amounts after in vivo processing of the whole antigen. For the same reason, these T cells are not normally activated but can be stimulated under special circumstances to circumvent tolerance. PMID:2478888

  15. F111 Crew Escape Module pilot parachute

    SciTech Connect

    Tadios, E.L.

    1991-01-01

    A successfully deployment of a parachute system highly depends on the efficiency of the deployment device and/or method. There are several existing methods and devices that may be considered for a deployment system. For the F111 Crew Escape Module (CEM), the recovery parachute system deployment is initiated by the firing of a catapult that ejects the complete system from the CEM. At first motion of the pack, a drogue gun is fired, which deploys the pilot parachute system. The pilot parachute system then deploys the main parachute system, which consists of a cluster of three 49-ft diameter parachutes. The pilot parachute system which extracts the F111 Crew Escape Module recovery parachute system must provide reasonable bag strip velocities throughout the flight envelope (10 psf to 300 psf). The pilot parachute system must, therefore, have sufficient drag area at the lower dynamic pressures and a reduced drag area at the high end of the flight envelope. The final design that was developed was a dual parachute system which consists of a 5-ft diameter guide surface parachute tethered inside a 10-ft diameter flat circular parachute. The high drag area is sustained at the low dynamic pressures by keeping both parachutes intact. The drag area is reduced at the higher extreme by allowing the 10-ft parachute attachment to fail. The discussions to follow describe in detail how the system was developed. 4 refs., 10 figs., 2 tabs.

  16. Escape mechanisms of dust in Io

    NASA Astrophysics Data System (ADS)

    Flandes, A.

    The injection of material into the jovian magnetosphere through Io's volcanic activity makes possible the formation of structures such as the plasma torus and the dust ballerina skirt. Io's high temperature volcanism produces spectacular plumes, but even the tallest plumes, as those of Pelen Patera, will not produce enough energy to defeat the gravitational attraction of Io. The fact is that dust escapes from Io, which implies that a second mechanism is acting on the grains. Grains brought to the top of the highest plumes by the volcanic forces are still under Io's gravitational pull, but need only a minimum charge (~10-1 4 C) so that the Lorentz force due to the Jovian magnetic field equilibrates this attraction. In the volcanic vents, the escape velocity of the ejected material and its own density produces enough collisions to create charges. On top of the highest plumes (~500km) charged grains are exposed to the plasma torus that co-rotates rigidly with Jupiter and, due to the relative velocity among Io and the torus, the grains will be dragged away from Io. As it is well known, these dust grains will also be dragged away from Jupiter.

  17. Escape dynamics of many hard disks.

    PubMed

    Taniguchi, Tooru; Murata, Hiroki; Sawada, Shin-Ichi

    2014-11-01

    Many-particle effects in escapes of hard disks from a square box via a hole are discussed in a viewpoint of dynamical systems. Starting from N disks in the box at the initial time, we calculate the probability P_{n}(t) for at least n disks to remain inside the box at time t for n=1,2,...,N. At early times, the probabilities P_{n}(t),n=2,3,...,N-1, are described by superpositions of exponential decay functions. On the other hand, after a long time the probability P_{n}(t) shows a power-law decay ∼t^{-2n} for n≠1, in contrast to the fact that it decays with a different power law ∼t^{-n} for cases without any disk-disk collision. Chaotic or nonchaotic properties of the escape systems are discussed by the dynamics of a finite-time largest Lyapunov exponent, whose decay properties are related with those of the probability P_{n}(t). PMID:25493874

  18. Circulating IgM Requires Plasma Membrane Disruption to Bind Apoptotic and Non-Apoptotic Nucleated Cells and Erythrocytes

    PubMed Central

    Hesketh, Emily E.; Dransfield, Ian; Kluth, David C.; Hughes, Jeremy

    2015-01-01

    Autoimmunity is associated with defective phagocytic clearance of apoptotic cells. IgM deficient mice exhibit an autoimmune phenotype consistent with a role for circulating IgM antibodies in apoptotic cell clearance. We have extensively characterised IgM binding to non-apoptotic and apoptotic mouse thymocytes and human Jurkat cells using flow cytometry, confocal imaging and electron microscopy. We demonstrate strong specific IgM binding to a subset of Annexin-V (AnnV)+PI (Propidium Iodide)+ apoptotic cells with disrupted cell membranes. Electron microscopy studies indicated that IgM+AnnV+PI+ apoptotic cells exhibited morphologically advanced apoptosis with marked plasma membrane disruption compared to IgM-AnnV+PI+ apoptotic cells, suggesting that access to intracellular epitopes is required for IgM to bind. Strong and comparable binding of IgM to permeabilised non-apoptotic and apoptotic cells suggests that IgM bound epitopes are 'apoptosis independent' such that IgM may bind any cell with profound disruption of cell plasma membrane integrity. In addition, permeabilised erythrocytes exhibited significant IgM binding thus supporting the importance of cell membrane epitopes. These data suggest that IgM may recognize and tag damaged nucleated cells or erythrocytes that exhibit significant cell membrane disruption. The role of IgM in vivo in conditions characterized by severe cell damage such as ischemic injury, sepsis and thrombotic microangiopathies merits further exploration. PMID:26121639

  19. Crystal Structure of CRN-4: Implications for Domain Function in Apoptotic DNA Degradation▿

    PubMed Central

    Hsiao, Yu-Yuan; Nakagawa, Akihisa; Shi, Zhonghao; Mitani, Shohei; Xue, Ding; Yuan, Hanna S.

    2009-01-01

    Cell death related nuclease 4 (CRN-4) is one of the apoptotic nucleases involved in DNA degradation in Caenorhabditis elegans. To understand how CRN-4 is involved in apoptotic DNA fragmentation, we analyzed CRN-4's biochemical properties, in vivo cell functions, and the crystal structures of CRN-4 in apo-form, Mn2+-bound active form, and Er3+-bound inactive form. CRN-4 is a dimeric nuclease with the optimal enzyme activity in cleaving double-stranded DNA in apoptotic salt conditions. Both mutational studies and the structures of the Mn2+-bound CRN-4 revealed the geometry of the functional nuclease active site in the N-terminal DEDDh domain. The C-terminal domain, termed the Zn-domain, contains basic surface residues ideal for nucleic acid recognition and is involved in DNA binding, as confirmed by deletion assays. Cell death analysis in C. elegans further demonstrated that both the nuclease active site and the Zn-domain are required for crn-4's function in apoptosis. Combining all of the data, we suggest a structural model where chromosomal DNA is bound at the Zn-domain and cleaved at the DEDDh nuclease domain in CRN-4 when the cell is undergoing apoptosis. PMID:18981218

  20. Nitric oxide as a pro-apoptotic as well as anti-apoptotic modulator.

    PubMed

    Choi, Byung-Min; Pae, Hyun-Ock; Jang, Seon Il; Kim, Young-Myeong; Chung, Hun-Taeg

    2002-01-31

    Nitric oxide (NO), synthesized from L-arginine by NO synthases, is a small, lipophilic, diffusible, highly reactive molecule with dichotomous regulatory roles in many biological events under physiological and pathological conditions. NO can promote apoptosis (pro-apoptosis) in some cells, whereas it inhibits apoptosis (anti-apoptosis) in other cells. This complexity is a consequence of the rate of NO production and the interaction with biological molecules such as metal ion, thiol, protein tyrosine, and reactive oxygen species. Long-lasting overproduction of NO acts as a pro-apoptotic modulator, activating caspase family proteases through the release of mitochondrial cytochrome c into cytosol, up-regulation of the p53 expression, and alterations in the expression of apoptosis-associated proteins, including the Bcl-2 family. However, low or physiological concentrations of NO prevent cells from apoptosis that is induced by the trophic factor withdrawal, Fas, TNFalpha/ActD, and LPS. The anti-apoptotic mechanism is understood on the basis of gene transcription of protective proteins. These include: heat shock protein, hemeoxygenase, or cyclooxygenase-2 and direct inhibition of the apoptotic executive effectors caspase family protease by S-nitrosylation of the cysteine thiol group in their catalytic site in a cell specific way. Our current understanding of the mechanisms by which NO exerts both pro- and anti-apototic action is discussed in this review article. PMID:16248976

  1. The atmospheric escape at Mars: complementing the scenario

    NASA Astrophysics Data System (ADS)

    Lilensten, Jean; Simon, Cyril; Barthélémy, Mathieu; Thissen, Roland; Ehrenreich, David; Gronoff, Guillaume; Witasse, Olivier

    2013-04-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly ener- getic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. This study assesses the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions.We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO++ for a simplified single constituent atmosphere of a 2 case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering ...), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished but complement the other processes and allow writing the scenario of the Mars escape. We show that the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible.When simulating the hot Jupiter HD209458b, the two processes cannot explain the measured escape flux of C+.

  2. New Analysis of Hydrogen and Deuterium Escape from Venus

    NASA Astrophysics Data System (ADS)

    Donahue, Thomas M.

    1999-10-01

    This paper is concerned with the time required for escape of hydrogen and deuterium to produce the present D/ H ratio in Venus water, the sizes of the original hydrogen reservoirs and their sensitivity to the magnitude of the present escape fluxes, the characteristics of exogenous and endogenous hydrogen sources, and the D/ H ratio for primordial Venus hydrogen. The procedure followed allowed the H escape flux to vary over a large range, the ratio of input to escape flux to vary from 0 to 1, and the fractionation factor, which expresses the relative efficiency of D and H escape, to vary between 0.02 and 0.5. It was found that, unless deuterium escape is very efficient, the present H escape flux (averaged over a solar cycle) cannot be larger than about 10 7 cm -2 s -1 if today's water is to be the remnant of water deposited eons ago. On the other hand if the escape flux is as large as large as 3×10 7 cm -2 s -1, today's water would be the remnant of water outgassed only about 500 million years ago. These conclusions are relatively insensitive to factors other than the magnitude of the escape flux. Since recent analysis of escape fluxes indicates that the H escape fluxes may be in the neighborhood of 3×10 7 cm -2 s -1 and the fractionation factor may be 0.14 or larger, the suggestion of Grinspoon (1993, Nature 363, 1702-1704) that the water now on Venus was created during a recent massive resurfacing event is credible. However, since it is still possible that the average escape flux is as small as 7×10 6 cm -2 s -1, the choice between 4 and 0.5 Gyr must await a resolution of this conflict by reanalysis of Pioneer Venus Lyman α data (Paxton, L., D. E. Anderson, and A. I. F. Stewart 1988, J. Geophys. Res. 93, 1766-1772).

  3. Wind and Rotation Enhanced Escape from the Early Terrestrial Atmospheres

    NASA Technical Reports Server (NTRS)

    Hartle, Richard E.; Einaudi, Franco (Technical Monitor)

    2001-01-01

    The earliest atmospheres of the terrestrial planets are thought to have been hotter, have stronger winds and rotate faster than atmospheres of today. Since these primitive atmospheres were weakly bound, they evolved rapidly because atmospheric escape was very strong, often referred to as "blowoff." Such escape has been treated as hydrodynamic, transonic flow; similar to solar wind flow dynamics. However, in many cases, although the outward flow is hydrodynamic at low altitudes, it becomes collisionless at higher altitudes, before sonic speeds are ever attained. Recent models dealing with the transition from fluid to kinetic flow have applied the Jeans escape flux at the exobase. This approach leads to escape rates that are too low, because thermospheric winds and planetary rotation are known to increase the escape flux above the corresponding Jeans flux. In particular, for a given density and temperature at the exobase, the escape flux increases as the wind speed and/or the rotation rate increase. Also, for a given wind speed and rotation rate, the escape flux enhancement over the Jeans flux increases as the mass of an escaping constituent increases, an important factor in isotope fractionation, especially the enrichment of deuterium on Mars. Accounting for a range of possible temperatures, thermospheric wind speeds and planetary rotation rates in the primitive atmospheres of the terrestrial planets, estimates are made of light constituent escape flux increases over the corresponding Jeans fluxes.

  4. Wind and Rotation Enhanced Escape From the Early Terrestrial Atmospheres

    NASA Astrophysics Data System (ADS)

    Hartle, R. E.

    2001-05-01

    The earliest atmospheres of the terrestrial planets are thought to have been hotter, have stronger winds and rotate faster than atmospheres of today. Since these primitive atmospheres were weakly bound, they evolved rapidly because atmospheric escape was very strong, often referred to as "blowoff." Such escape has been treated as hydrodynamic, transonic flow, similar to solar wind flow dynamics. However, in many cases the outward flow is hydrodynamic at low altitudes only to become collisionless at higher altitudes, well before sonic speeds are ever attained. Recent models dealing with such transition from fluid to kinetic flow have applied the Jeans escape flux at the exobase. This approach has lead to escape rates that are too low due to the fact that thermospheric winds and planetary rotation increase escape fluxes considerably over the corresponding Jeans fluxes (1). In particular, for a given density and temperature at the exobase, the escape flux increases as the wind speed and/or the rotation rate increase. Also, for a given wind speed and rotation rate, the escape flux enhancement over the Jeans flux increases as the mass of an escaping constituent increases, an important factor in isotope fractionation, especially the enrichment of deuterium on Mars. Accounting for a range of possible temperatures, thermospheric wind speeds and planetary rotation rates in the primitive atmospheres of the terrestrial planets, estimates are made of light constituent escape flux increases over the corresponding Jeans fluxes. (1) Hartle, R. E. and H. G. Mayr, J. Geophys. Res., 81, 1207, 1976.

  5. Chaotic Scattering and Escape Times of Marginally Trapped Ultracold Neutrons

    PubMed Central

    Coakley, K. J.; Doyle, J. M.; Dzhosyuk, S. N.; Yang, L.; Huffman, P. R.

    2005-01-01

    We compute classical trajectories of Ultracold neutrons (UCNs) in a superconducting Ioffe-type magnetic trap using a symplectic integration method. We find that the computed escape time for a particular set of initial conditions (momentum and position) does not generally stabilize as the time step parameter is reduced unless the escape time is short (less than approximately 10 s). For energy intervals where more than half of the escape times computed for UCN realizations are numerically well determined, we predict the median escape time as a function of the midpoint of the interval. PMID:27308152

  6. Apoptotic cells selectively uptake minor glycoforms of vitronectin from serum.

    PubMed

    Malagolini, Nadia; Catera, Mariangela; Osorio, Hugo; Reis, Celso A; Chiricolo, Mariella; Dall'Olio, Fabio

    2013-04-01

    Apoptosis profoundly alters the carbohydrate layer coating the membrane of eukaryotic cells. Previously we showed that apoptotic cells became reactive with the α2,6-sialyl-specific lectin from Sambucus nigra agglutinin (SNA), regardless of their histological origin and the nature of the apoptotic stimulus. Here we reveal the basis of the phenomenon by showing that in apoptotic cancer cell lines SNA reactivity was mainly associated with a 67 kDa glycoprotein which we identified by MALDI-TOF/TOF and immunoblot analysis as bovine vitronectin (bVN). bVN was neither present in non-apoptotic cells, nor in cells induced to apoptosis in serum-free medium, indicating that its uptake from the cell culture serum occurred only during apoptosis. The bVN molecules associated with apoptotic cancer cell lines represented minor isoforms, lacking the carboxyterminal sequence and paradoxically containing a few α2,6-linked sialic acid residues. Despite their poor α2,6-sialylation, these bVN molecules were sufficient to turn apoptotic cells to SNA reactivity, which is a late apoptotic event occurring in cells positive to both annexin-V and propidium iodide. Unlike in cancer cell lines, the major bVN form taken up by apoptotic neutrophils and mononuclear cells was a 80 kDa form. In apoptotic SW948 cells we also detected the α2,6-sialylated forms of the stress-70 mitochondrial precursor (mortalin) and of tubulin-β2C. These data indicate that the acquisition of vitronectin isoforms from the environment is a general, although cell specific phenomenon, potentially playing an important role in post-apoptotic events and that the α2,6-sialylation of intracellular proteins is a new kind of posttranslational modification associated with apoptosis. PMID:23381642

  7. Gated narrow escape time for molecular signaling.

    PubMed

    Reingruber, Jürgen; Holcman, David

    2009-10-01

    The mean time for a diffusing ligand to activate a target protein located on the surface of a microdomain can regulate cellular signaling. When the ligand switches between various states induced by chemical interactions or conformational changes, while target activation occurs in only one state, this activation time is affected. We investigate this dynamics using new equations for the sojourn times spent in each state. For two states, we obtain exact solutions in dimension one, and asymptotic ones confirmed by Brownian simulations in dimension 3. We find that the activation time is quite sensitive to changes of the switching rates, which can be used to modulate signaling. Interestingly, our analysis reveals that activation can be fast although the ligand spends most of the time "hidden" in the nonactivating state. Finally, we obtain a new formula for the narrow escape time in the presence of switching. PMID:19905605

  8. The polarization of escaping terrestrial continuum radiation

    NASA Technical Reports Server (NTRS)

    Gurnett, D. A.; Calvert, W.; Huff, R. L.; Jones, D.; Sugiura, M.

    1988-01-01

    The polarization of an escaping terrestrial continuum radiation event that occurred on March 2, 1982, was determined using plasma wave measurements from the DE-1 spacecraft. The source of the radiation was determined to be located near the magnetic equator on the nightside of the earth at a radial distance of about 2.8-3.5 earth radii. Two meridional beams were detected, one directed north at an angle of about 20-30 deg with respect to the magnetic equator, and the other directed south at a comparable angle. Polarization measurements indicated that the radiation is right-hand polarized with respect to an outward directed E plane normal in the Northern Hemisphere and left-hand polarized in the Southern Hemisphere.

  9. Escape of Black Holes from the Brane

    SciTech Connect

    Flachi, Antonino; Tanaka, Takahiro

    2005-10-14

    TeV-scale gravity theories allow the possibility of producing small black holes at energies that soon will be explored at the CERN LHC or at the Auger observatory. One of the expected signatures is the detection of Hawking radiation that might eventually terminate if the black hole, once perturbed, leaves the brane. Here, we study how the 'black hole plus brane' system evolves once the black hole is given an initial velocity that mimics, for instance, the recoil due to the emission of a graviton. The results of our dynamical analysis show that the brane bends around the black hole, suggesting that the black hole eventually escapes into the extra dimensions once two portions of the brane come in contact and reconnect. This gives a dynamical mechanism for the creation of baby branes.

  10. BCL2 suppresses PARP1 function and non-apoptotic cell death

    PubMed Central

    Dutta, Chaitali; Day, Tovah; Kopp, Nadja; van Bodegom, Diederik; Davids, Matthew S.; Ryan, Jeremy; Bird, Liat; Kommajosyula, Naveen; Weigert, Oliver; Yoda, Akinori; Fung, Hua; Brown, Jennifer R.; Shapiro, Geoffrey I.; Letai, Anthony; Weinstock, David M.

    2014-01-01

    BCL2 suppresses apoptosis by binding the BH3 domain of pro-apoptotic factors and thereby regulating outer mitochondrial membrane permeabilization. Many tumor types, including B-cell lymphomas and chronic lymphocytic leukemia, are dependent on BCL2 for survival, but become resistant to apoptosis after treatment. Here we identified a direct interaction between the anti-apoptotic protein BCL2 and the enzyme poly(ADP) ribose polymerase 1 (PARP1), which suppresses PARP1 enzymatic activity and inhibits PARP1-dependent DNA repair in diffuse large B cell lymphoma cells. The BH3 mimetic ABT-737 displaced PARP1 from BCL2 in a dose-dependent manner, re-establishing PARP1 activity and DNA repair and promoting non-apoptotic cell death. This form of cell death was unaffected by resistance to single-agent ABT-737 that results from upregulation of anti-apoptotic BCL2 family members. Based on the ability of BCL2 to suppress PARP1 function, we hypothesized that ectopic BCL2 expression would kill PARP inhibitor-sensitive cells. Strikingly, BCL2 expression reduced the survival of PARP inhibitor-sensitive breast cancer and lung cancer cells by 90-100%, and these effects were reversed by ABT-737. Taken together, our findings demonstrate that a novel interaction between BCL2 and PARP1 blocks PARP1 enzymatic activity and suppresses PARP1-dependent repair. Targeted disruption of the BCL2-PARP1 interaction therefore may represent a potential therapeutic approach for BCL2-expressing tumors resistant to apoptosis. PMID:22689920

  11. Energy Release, Acceleration, and Escape of Solar Energetic Ions

    NASA Astrophysics Data System (ADS)

    de Nolfo, G. A.; Ireland, J.; Ryan, J. M.; Young, C. A.

    2013-12-01

    Solar flares are prodigious producers of energetic particles, and thus a rich laboratory for studying particle acceleration. The acceleration occurs through the release of magnetic energy, a significant fraction of which can go into the acceleration of particles. Coronal mass ejections (CMEs) certainly produce shocks that both accelerate particles and provide a mechanism for escape into the interplanetary medium (IP). What is less well understood is whether accelerated particles produced from the flare reconnection process escape, and if so, how these same particles are related to solar energetic particles (SEPs) detected in-situ. Energetic electron SEPs have been shown to be correlated with Type III radio bursts, hard X-ray emission, and EUV jets, making a very strong case for the connection between acceleration at the flare and escape along open magnetic field lines. Because there has not been a clear signature of ion escape, as is the case with the Type III radio emission for electrons, sorting out the avenues of escape for accelerated flare ions and the possible origin of the impulsive SEPs continues to be a major challenge. The key to building a clear picture of particle escape relies on the ability to map signatures of escape such as EUV jets at the Sun and to follow the progression of these escape signatures as they evolve in time. Furthermore, nuclear γ-ray emissions provide critical context relating ion acceleration to that of escape. With the advent observations from Fermi as well as RHESSI and the Solar Dynamics Observatory (SDO), the challenge of ion escape from the Sun can now be addressed. We present a preliminary study of the relationship of EUV jets with nuclear γ-ray emission and Type III radio observations and discuss the implications for possible magnetic topologies that allow for ion escape from deep inside the corona to the interplanetary medium.

  12. Engineered apoptotic nucleases for chromatin research.

    PubMed

    Xiao, Fei; Widlak, Piotr; Garrard, William T

    2007-01-01

    We have created new genomics tools for chromatin research by genetically engineering the human and mouse major apoptotic nucleases that are responsible for internucleosomal DNA cleavage, DNA fragmentation factor (DFF). Normally, in its inactive form, DFF is a heterodimer composed of a 45-kDa chaperone inhibitor subunit (DFF45 or ICAD), and a 40-kDa latent endonuclease subunit (DFF40 or CAD). Upon caspase-3 cleavage of DFF45, DFF40 forms active endonuclease homo-oligomers. Although Saccharomyces cerevisiae lacks DFF, expression of caspase-3 is lethal in this organism, but expression of the highly sequence-specific tobacco etch virus protease (TEVP) is harmless. Therefore, we inserted TEVP cleavage sites immediately downstream of the two caspase-3 cleavage sites within DFF45, generating a novel form of DFF (DFF-T) whose nuclease activity proved to be exclusively under the control of TEVP. We demonstrate that co-expression of TEVP and DFF-T under galactose control results in nucleosomal DNA laddering and cell death in S. cerevisiae. We also created synthetic DFF genes with optimized codons for high-level expression in Eschericia coli or S. cerevisiae. We further demonstrate the excellence of the synthetic gene products for in vitro mapping of the nucleosome positions and hypersensitive sites in specific genes such as the yeast PHO5. PMID:17626049

  13. ARTEMIS nuclease facilitates apoptotic chromatin cleavage.

    PubMed

    Britton, Sébastien; Frit, Philippe; Biard, Denis; Salles, Bernard; Calsou, Patrick

    2009-10-15

    One hallmark of apoptosis is DNA degradation that first appears as high molecular weight fragments followed by extensive internucleosomal fragmentation. During apoptosis, the DNA-dependent protein kinase (DNA-PK) is activated. DNA-PK is involved in the repair of DNA double-strand breaks (DSB) and its catalytic subunit is associated with the nuclease ARTEMIS. Here, we report that, on initiation of apoptosis in human cells by agents causing DNA DSB or by staurosporine or other agents, ARTEMIS binds to apoptotic chromatin together with DNA-PK and other DSB repair proteins. ARTEMIS recruitment to chromatin showed a time and dose dependency. It required DNA-PK protein kinase activity and was blocked by antagonizing the onset of apoptosis with a pan-caspase inhibitor or on overexpression of the antiapoptotic BCL2 protein. In the absence of ARTEMIS, no defect in caspase-3, poly(ADP-ribose) polymerase-1, and XRCC4 cleavage or in H2AX phosphorylation was observed and DNA-PK catalytic subunit was still phosphorylated on S2056 in response to staurosporine. However, DNA fragmentation including high molecular weight fragmentation was delayed in ARTEMIS-deficient cells compared with cells expressing ARTEMIS. In addition, ARTEMIS enhanced the kinetics of MLL gene cleavage at a breakage cluster breakpoint that is frequently translocated in acute or therapy-related leukemias. These results show a facilitating role for ARTEMIS at least in early, site-specific chromosome breakage during apoptosis. PMID:19808974

  14. Apoptotic Genes are Differentially Expressed in Aged Gingival Tissue

    PubMed Central

    González, O.A.; Stromberg, A.J.; Huggins, P.M.; Gonzalez-Martinez, J.; Novak, M.J.; Ebersole, J.L.

    2011-01-01

    Cellular and molecular changes of the periodontium associated with a higher prevalence of oral diseases (e.g., chronic periodontitis) in aged populations have received little attention. Since impaired apoptosis during aging appears to be related to chronic inflammatory disorders, we hypothesized that the expression of genes associated with apoptotic processes are altered in aged healthy and periodontitis-affected gingival tissue. Ontology analysis of 88 genes related to apoptotic pathways was performed in gingival biopsies of healthy and periodontitis sites from young, adult, and aged non-human primates (Macaca mulatta), using the GeneChip® Rhesus Macaque Genome Array. Lower expression of anti-apoptotic and higher expression of pro-apoptotic genes were associated with healthy gingival tissue from young compared with aged animals. Few differences in gene expression were observed in healthy gingival tissue between adult and aged animals. Comparison between healthy and periodontitis gingival tissues showed that the up- or down-regulated apoptotic genes in diseased gingival tissue are different in adults compared with aged animals. These results suggest that apoptotic events normally occurring in gingival tissues could be reduced in aging,and unique aspects of apoptotic pathways are potentially involved in the pathophysiology of perio-dontal disease in adult vs. aged gingival tissues. PMID:21471327

  15. A new view of the lethal apoptotic pore.

    PubMed

    Basañez, Gorka; Soane, Lucian; Hardwick, J Marie

    2012-01-01

    Cell death by apoptosis is indispensable for proper development and tissue homeostasis in all multicellular organisms, and its deregulation plays a key role in cancer and many other diseases. A crucial event in apoptosis is the formation of protein-permeable pores in the outer mitochondrial membrane that release cytochrome c and other apoptosis-promoting factors into the cytosol. Research efforts over the past two decades have established that apoptotic pores require BCL-2 family proteins, with the proapoptotic BAX-type proteins being direct effectors of pore formation. Accumulating evidence indicates that other cellular components also cooperate with BCL-2 family members to regulate the apoptotic pore. Despite this knowledge, the molecular pathway leading to apoptotic pore formation at the outer mitochondrial membrane and the precise nature of this outer membrane pore remain enigmatic. In this issue of PLOS Biology, Kushnareva and colleagues describe a novel kinetic analysis of the dynamics of BAX-dependent apoptotic pore formation recapitulated in native mitochondrial outer membranes. Their study reveals the existence of a hitherto unknown outer mitochondrial membrane factor that is critical for BAX-mediated apoptotic pore formation, and challenges the currently popular view that the apoptotic pore is a purely proteinaceous multimeric assembly of BAX proteins. It also supports the notion that membrane remodeling events are implicated in the formation of a lipid-containing apoptotic pore. PMID:23049484

  16. Methane attenuates retinal ischemia/reperfusion injury via anti-oxidative and anti-apoptotic pathways.

    PubMed

    Liu, Lin; Sun, Qinglei; Wang, Ruobing; Chen, Zeli; Wu, Jiangchun; Xia, Fangzhou; Fan, Xian-Qun

    2016-09-01

    Retinal ischemia/reperfusion injury (IRI) may cause incurable visual impairment due to neural regeneration limits. Methane was shown to exert a protective effect against IRI in many organs. This study aims to explore the possible protective effects of methane-rich saline against retinal IRI in rat. Retinal IRI was performed on the right eyes of male Sprague-Dawley rats, which were immediately injected intraperitoneally with methane-saturated saline (25ml/kg). At one week after surgery, the number of retinal ganglion cells (RGCs), total retinal thickness, visual function were measured by hematoxylin and eosin staining, FluoroGold anterograde labeling and flash visual evoked potentials. The levels of 8-hydroxy-2-deoxyguanosine (8-OHdG), 4-Hydroxy-2-nonenal (4-HNE), malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), caspase-3, caspase-9, B cell lymphoma/leukemia-2 (Bcl-2) and Bcl-2 associated X protein (Bax) in retinas were assessed by immunofluorescence staining, enzyme-linked immunosorbent assay and quantitative polymerase chain reaction. As expected, methane treatment significantly improved the retinal IRI-induced RGC loss, total retinal layer thinning and visual dysfunction. Moreover, methane treatment significantly reduced the levels of oxidative stress biomarkers (8-OHdG, 4-HNE, MDA) and increased the antioxidant enzyme activities (SOD, CAT, GPx) in the retinas with IRI. Meanwhile, methane treatment significantly increased the anti-apoptotic gene (Bcl-2) expression and decreased the pro-apoptotic gene (Bax) expression, accompanied by the suppression of caspase-3 and caspase-9 activity. Thus, these data demonstrated that methane can exert a neuroprotective role against retinal IRI through anti-oxidative and anti-apoptotic pathways. PMID:27208496

  17. Rapid reuptake of granzyme B leads to emperitosis: an apoptotic cell-in-cell death of immune killer cells inside tumor cells.

    PubMed

    Wang, S; He, M-f; Chen, Y-h; Wang, M-y; Yu, X-M; Bai, J; Zhu, H-y; Wang, Y-y; Zhao, H; Mei, Q; Nie, J; Ma, J; Wang, J-f; Wen, Q; Ma, L; Wang, Y; Wang, X-n

    2013-01-01

    A cell-in-cell process refers to the invasion of one living cell into another homotypic or heterotypic cell. Different from non-apoptotic death processes of internalized cells termed entosis or cannibalism, we previously reported an apoptotic cell-in-cell death occurring during heterotypic cell-in-cell formation. In this study, we further demonstrated that the apoptotic cell-in-cell death occurred only in internalized immune killer cells expressing granzyme B (GzmB). Vacuole wrapping around the internalized cells inside the target cells was the common hallmark during the early stage of all cell-in-cell processes, which resulted in the accumulation of reactive oxygen species and subsequent mitochondrial injury of encapsulated killer or non-cytotoxic immune cells. However, internalized killer cells mediated rapid bubbling of the vacuoles with the subsequent degranulation of GzmB inside the vacuole of the target cells and underwent the reuptake of GzmB by killer cells themselves. The confinement of GzmB inside the vacuole surpassed the lysosome-mediated cell death occurring in heterotypic or homotypic entosis processes, resulting in a GzmB-triggered caspase-dependent apoptotic cell-in-cell death of internalized killer cells. On the contrary, internalized killer cells from GzmB-deficient mice underwent a typical non-apoptotic entotic cell-in-cell death similar to that of non-cytotoxic immune cells or tumor cells. Our results thus demonstrated the critical involvement of immune cells with cytotoxic property in apoptotic cell-in-cell death, which we termed as emperitosis taken from emperipolesis and apoptosis. Whereas entosis or cannibalism may serve as a feed-on mechanism to exacerbate and nourish tumor cells, emperitosis of immune killer cells inside tumor cells may serve as an in-cell danger sensation model to prevent the killing of target cells from inside, implying a unique mechanism for tumor cells to escape from immune surveillance. PMID:24113190

  18. 7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE FROM 50-FOOT PASSAGEWAY, SHOWING 25-FOOT BLISTER AT LEFT, 18-FOOT PASSAGEWAY AND PLATFORM AT RIGHT - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  19. 35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, PRIOR TO ENLARGEMENT OF ROOM AND INSTALLATION OF TRIPLE-LOCK RECOMPRESSION CHAMBER IN 1957 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  20. 29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT POINT JUST ABOVE THE SUBMARINE SECTION AT THE 110-FOOT LEVEL 1929-1930 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  1. 36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING RESCUE BELL SUSPENDED ABOVE TANK, WITH TWO-LOCK RECOMPRESSION CHAMBER AT REAR, LOOKING WEST. Photo taken after installation of recompression chamber in 1956. - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  2. 22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST SIDE OF CUPOLA TOWARD ELEVATOR. TWO-LOCK RECOMPRESSION CHAMBER AT REAR - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  3. 31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF THE ELEVATOR AND PASSAGEWAYS TO THE 18- AND 50-FOOT LOCKS AND CUPOLA 1932 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  4. The Origins and Underpinning Principles of E-Scape

    ERIC Educational Resources Information Center

    Kimbell, Richard

    2012-01-01

    In this article I describe the context within which we developed project e-scape and the early work that laid the foundations of the project. E-scape (e-solutions for creative assessment in portfolio environments) is centred on two innovations. The first concerns a web-based approach to portfolio building; allowing learners to build their…

  5. How to Escape a Home Fire (Take This Safety Quiz).

    ERIC Educational Resources Information Center

    PTA Today, 1994

    1994-01-01

    A checklist/safety quiz from the National Fire Protection Association examines individual knowledge of how to escape if a home fire breaks out. The organization recommends that every household develop a fire escape plan and practice it at least twice a year. (SM)

  6. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Means of escape. 143.101 Section 143.101 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES DESIGN AND EQUIPMENT OCS Facilities § 143.101 Means of escape. (a) “Primary...

  7. Green Pea Galaxies Reveal Secrets of Lyα Escape

    NASA Astrophysics Data System (ADS)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Dijkstra, Mark; Jaskot, Anne; Zheng, Zhenya; Wang, Junxian

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  8. [Examination of the escape phenomenon in disease modifying antirheumatic drugs].

    PubMed

    Kawasaki, Yoichi; Moriyama, Masahiro; Shibata, Kazuhiko; Gomita, Yutaka

    2005-03-01

    Although disease-modifying antirheumatic drugs (DMARDs) are used in the treatment of rheumatoid arthritis (RA), the selection of agents in the case of relapse (escape phenomenon) lacks clear-cut standards. Therefore we investigated the rate and conditions of escape as well as the agents used after escapes had occurred. Outpatients of the Matsubara Mayflower Hospital with a history of DMARD administration during the 4 years prior to May 2003 were studied. Those receiving salazosulfapyridine (SASP) had a high escape rate and those receiving methotrexate (MTX) and bucillamine (BC) had a low rate. The continuous duration of administration was long for MTX and BC, but short for sodium aurothiomalate (GST). BC and Actarit (AR) gradually elevated C-reactive protein (CRP) levels and the erythrocyte sedimentation rate (ESR). In patients receiving SASP and MTX, a high level of CRP and high ESR was seen 2 months prior to the occurrence of escape and remained unchanged after escape. With respect to the agents used after escape, SASP and BC were substituted with other DMARDs. A combination with other DMARDs was usually administered to patients who had been receiving MTX. Taken together, the present results clarified the characteristics of DMARD escape and will contribute to the appropriate pharmacotherapy for RA. PMID:15738628

  9. Teachers Offering Healthy Escape Options for Teenagers in Pain

    ERIC Educational Resources Information Center

    Kaywell, Joan F.

    2005-01-01

    "[T]wenty-five percent of today's teenagers have inordinate emotional baggage beyond the normal angst of adolescence." This burden can lead to unhealthy escapes, including substance abuse, sexual activity, violence, eating disorders, and suicide. One healthy escape, however, lies in books, where students can read about teenagers living in painful…

  10. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.445 Alarm and means of escape. (a) Each CO2...

  11. Fire Won't Wait--Plan Your Escape!

    ERIC Educational Resources Information Center

    PTA Today, 1991

    1991-01-01

    Discusses the importance of home fire escape drills, detailing fire safety plans. Early detection and warning (smoke detectors) coupled with well-rehearsed escape plans help prevent serious injury. Children need to be taught about fire safety beginning at a very early age. (SM)

  12. Cobra venom cytotoxins; apoptotic or necrotic agents?

    PubMed

    Ebrahim, Karim; Shirazi, Farshad H; Mirakabadi, Abbas Zare; Vatanpour, Hossein

    2015-12-15

    Organs homeostasis is controlled by a dynamic balance between cell proliferation and apoptosis. Failure to induction of apoptosis has been implicated in tumor development. Cytotoxin-I (CTX-I) and cytotoxin-II (CTX-II) are two physiologically active polypeptides found in Caspian cobra venom. Anticancer activity and mechanism of cell death induced by these toxins have been studied. The toxins were purified by different chromatographic steps and their cytotoxicity and pattern of cell death were determined by MTT, LDH release, acridine orange/ethidium bromide (AO/EtBr) double staining, flow cytometric analysis, caspase-3 activity and neutral red assays. The IC50 of CTX-II in MCF-7, HepG2, DU-145 and HL-60 was 4.1 ± 1.3, 21.2 ± 4.4, 9.4 ± 1.8 μg/mL and 16.3 ± 1.9 respectively while the IC50 of this toxin in normal MDCK cell line was 54.5 ± 3.9 μg/mL. LDH release suddenly increase after a specific toxins concentrations in all cell lines. AO/EtBr double staining, flow cytometric analysis and caspase-3 activity assay confirm dose and time-dependent induction of apoptosis by both toxins. CTX-I and CTX-II treated cells lost their lysosomal membrane integrity and couldn't uptake neutral red day. CTX-I and CTX-II showed significant anticancer activity with minimum effects on normal cells and better IC50 compared to current anticancer drug; cisplatin. They induce their apoptotic effect via lysosomal pathways and release of cathepsins to cytosol. These effects were seen in limited rage of toxins concentrations and pattern of cell death rapidly changes to necrosis by increase in toxin's concentration. In conclusion, significant apoptogenic effects of these toxins candidate them as a possible anticancer agent. PMID:26482932

  13. WANDERING STARS: AN ORIGIN OF ESCAPED POPULATIONS

    SciTech Connect

    Teyssier, Maureen; Johnston, Kathryn V.; Shara, Michael M.

    2009-12-10

    We demonstrate that stars beyond the virial radii of galaxies may be generated by the gravitational impulse received by a satellite as it passes through the pericenter of its orbit around its parent. These stars may become energetically unbound (escaped stars), or may travel to further than a few virial radii for longer than a few Gyr, but still remain energetically bound to the system (wandering stars). Larger satellites (10%-100% the mass of the parent), and satellites on more radial orbits are responsible for the majority of this ejected population. Wandering stars could be observable on Mpc scales via classical novae, and on 100 Mpc scales via Type Ia supernova. The existence of such stars would imply a corresponding population of barely bound, old, high-velocity stars orbiting the Milky Way, generated by the same physical mechanism during the Galaxy's formation epoch. Sizes and properties of these combined populations should place some constraints on the orbits and masses of the progenitor objects from which they came, providing insight into the merging histories of galaxies in general and the Milky Way in particular.

  14. Escaping the resource curse in China.

    PubMed

    Cao, Shixiong; Li, Shurong; Ma, Hua; Sun, Yutong

    2015-02-01

    Many societies face an income gap between rich regions with access to advanced technology and regions that are rich in natural resources but poorer in technology. This "resource curse" can lead to a Kuznets trap, in which economic inequalities between the rich and the poor increase during the process of socioeconomic development. This can also lead to depletion of natural resources, environmental degradation, social instability, and declining socioeconomic development. These problems will jeopardize China's achievements if the current path continues to be pursued without intervention by the government to solve the problems. To mitigate the socioeconomic development gap between western and eastern China, the government implemented its Western Development Program in 2000. However, recent data suggest that this program has instead worsened the resource curse. Because each region has its own unique strengths and weaknesses, China must escape the resource curse by accounting for this difference; in western China, this can be done by improving education, promoting high-tech industry, adjusting its economic strategy to balance regional development, and seeking more sustainable approaches to socioeconomic development. PMID:24973055

  15. Prediction of anti-angiogenesis escape.

    PubMed

    Mitamura, Takashi; Gourley, Charlie; Sood, Anil K

    2016-04-01

    Many clinical trials have demonstrated the benefit of anti-angiogenesis therapy in the treatment of gynecologic cancer. However, these benefits have often been in terms of progression-free rather than overall survival and in some cases, the magnitude of benefit demonstrated in the pivotal phase 3 trials has been disappointing when compared with the percentage of patients who responded in earlier phase 2 trials. Two potential explanations for this are the current inability to stratify patients according to chance of benefit and the development of resistance mechanisms within the tumor. In this article, we review the prediction of response and the proposed resistance and escape mechanisms involved in anti-angiogenesis therapy, including the up-regulation of alternative proangiogenic pathways, vascular co-option, and resistance to hypoxia. These insights may offer a personalized strategy for anti-angiogenesis therapy and help us to consider the best selection of other therapies that should be combined with anti-angiogenesis therapy to improve the outcome of patients with gynecologic cancer. PMID:26748214

  16. Food Enzymes

    ERIC Educational Resources Information Center

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  17. Zinc Enzymes.

    ERIC Educational Resources Information Center

    Bertini, I.; And Others

    1985-01-01

    Discusses the role of zinc in various enzymes concerned with hydration, hydrolysis, and redox reactions. The binding of zinc to protein residues, properties of noncatalytic zinc(II) and catalytic zinc, and the reactions catalyzed by zinc are among the topics considered. (JN)

  18. Topological Transitions in Mitochondrial Membranes controlled by Apoptotic Proteins

    NASA Astrophysics Data System (ADS)

    Hwee Lai, Ghee; Sanders, Lori K.; Mishra, Abhijit; Schmidt, Nathan W.; Wong, Gerard C. L.; Ivashyna, Olena; Schlesinger, Paul H.

    2010-03-01

    The Bcl-2 family comprises pro-apoptotic proteins, capable of permeabilizing the mitochondrial membrane, and anti-apoptotic members interacting in an antagonistic fashion to regulate programmed cell death (apoptosis). They offer potential therapeutic targets to re-engage cellular suicide in tumor cells but the extensive network of implicated protein-protein interactions has impeded full understanding of the decision pathway. We show, using synchrotron x-ray diffraction, that pro-apoptotic proteins interact with mitochondrial-like model membranes to generate saddle-splay (negative Gaussian) curvature topologically required for pore formation, while anti-apoptotic proteins can deactivate curvature generation by molecules drastically different from Bcl-2 family members and offer evidence for membrane-curvature mediated interactions general enough to affect very disparate systems.

  19. In vitro study of immunosuppressive effect of apoptotic cells*

    PubMed Central

    Zhang, Wen-jin; Zheng, Shu-sen

    2005-01-01

    Recent studies revealed that apoptotic cells are actively involved in immunosuppression and anti-inflammation. After being phagocytosed by macrophages, apoptotic cells can actively regulate cytokines secretion from lipopolysaccharide (LPS)-stimulated macrophages, in which the secretion of immunosuppressive cytokines such as interleukin-10 (IL-10) is increased while the pro-inflammatory cytokines such as tumor necrosis factor-alpha (TNFα), interleukin-1beta (IL-1β) and leukin-8 (IL-8) are suppressed. In this paper, we first present evidence that phagocytosed apoptotic cells regulate cytokine secretion of LPS-stimulated macrophages, but also inhibit the activation of T lymphocytes stimulated by ConA. These data suggest that apoptotic cells can alter the biological behavior of macrophages which gain immunosuppressive property. PMID:16130196

  20. Dications and thermal ions in planetary atmospheric escape

    NASA Astrophysics Data System (ADS)

    Lilensten, J.; Simon Wedlund, C.; Barthélémy, M.; Thissen, R.; Ehrenreich, D.; Gronoff, G.; Witasse, O.

    2013-01-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly energetic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. The goal of this study is to assess the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions. We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO2++ for a simplified single constituent atmosphere of a case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering, etc.), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished and even contribute only marginally to this loss. We show that with these two mechanisms, the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible. When simulating the hot Jupiter HD 209458 b, the two processes cannot explain the measured escape flux of C+. This study shows that the dications may constitute a source of the escape of planetary atmospheres which had not been taken into account until now. This source, although marginal, is not negligible. The influence of the photoionization is of course large, but cannot explain alone the loss of Mars

  1. Apoptotic pathways as a therapeutic target for colorectal cancer treatment

    PubMed Central

    Abraha, Aman M; Ketema, Ezra B

    2016-01-01

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment. PMID:27574550

  2. Comparison of automated haematology analysers for detection of apoptotic lymphocytes.

    PubMed

    Taga, K; Sawaya, M; Yoshida, M; Kaneko, M; Okada, M; Taniho, M

    2002-06-01

    Automated haematology analysers can rapidly provide accurate blood cell counts and white blood cell differentials. In this study, we evaluated four different haematology analysers for the detection of apoptotic lymphocytes in peripheral blood: MAXM A/L Retic, H*2, Cell-Dyn 3500 and NE-8000. With the MAXM A/L Retic haematology analyser, the apoptotic lymphocyte cluster appeared below the original lymphocyte cluster on the volume/DF1, and to the right under the original lymphocyte cluster on the volume/DF2 scattergrams. With the H*2 haematology analyser, the apoptotic polymorphonuclear lymphocytes produced a higher lobularity index on the BASO channel. With the Cell-Dyn 3500 haematology analyser, the apoptotic lymphocyte cluster appeared to the right side of the original lymphocyte cluster on the 0D/10D scattergram and to the left side of the polymorphonuclear cluster on the 90D/10D scattergram. With the NE-8000 haematology analyser, the apoptotic lymphocyte cluster was not distinguishable. Thus, apoptotic lymphocytes are readily detected on scattergrams generated by selected haematology analysers. PMID:12067276

  3. Apoptotic cell death in rat epididymis following epichlorohydrin treatment.

    PubMed

    Lee, I-C; Kim, K-H; Kim, S-H; Baek, H-S; Moon, C; Kim, S-H; Yun, W-K; Nam, K-H; Kim, H-C; Kim, J-C

    2013-06-01

    Epichlorohydrin (ECH) is an antifertility agent that acts both as an epididymal toxicant and an agent capable of directly affecting sperm motility. This study identified the time course of apoptotic cell death in rat epididymides after ECH treatment. Rats were administrated with a single oral dose of ECH (50 mg/kg). ECH-induced apoptotic changes were evaluated by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay and its related mechanism was confirmed by Western blot analysis and colorimetric assay. The TUNEL assay showed that the number of apoptotic cells increased at 8 h, reached a maximum level at 12 h, and then decreased progressively. The Western blot analysis demonstrated no significant changes in proapoptotic Bcl-2-associated X (Bax) and anti-apoptotic Bcl-2 expression during the time course of the study. However, phospho-p38 mitogen-activated protein kinase (p-p38 MAPK) and phospho-c-Jun amino-terminal kinase (p-JNK) expression increased at 8-24 h. Caspase-3 and caspase-8 activities also increased at 8-48 h and 12-48 h, respectively, in the same manner as p-p38 MAPK and p-JNK expression. These results indicate that ECH induced apoptotic changes in rat epididymides and that the apoptotic cell death may be related more to the MAPK pathway than to the mitochondrial pathway. PMID:23386780

  4. Apoptotic pathways as a therapeutic target for colorectal cancer treatment.

    PubMed

    Abraha, Aman M; Ketema, Ezra B

    2016-08-15

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment. PMID:27574550

  5. Efficiently estimating salmon escapement uncertainty using systematically sampled data

    USGS Publications Warehouse

    Reynolds, Joel H.; Woody, Carol Ann; Gove, Nancy E.; Fair, Lowell F.

    2007-01-01

    Fish escapement is generally monitored using nonreplicated systematic sampling designs (e.g., via visual counts from towers or hydroacoustic counts). These sampling designs support a variety of methods for estimating the variance of the total escapement. Unfortunately, all the methods give biased results, with the magnitude of the bias being determined by the underlying process patterns. Fish escapement commonly exhibits positive autocorrelation and nonlinear patterns, such as diurnal and seasonal patterns. For these patterns, poor choice of variance estimator can needlessly increase the uncertainty managers have to deal with in sustaining fish populations. We illustrate the effect of sampling design and variance estimator choice on variance estimates of total escapement for anadromous salmonids from systematic samples of fish passage. Using simulated tower counts of sockeye salmon Oncorhynchus nerka escapement on the Kvichak River, Alaska, five variance estimators for nonreplicated systematic samples were compared to determine the least biased. Using the least biased variance estimator, four confidence interval estimators were compared for expected coverage and mean interval width. Finally, five systematic sampling designs were compared to determine the design giving the smallest average variance estimate for total annual escapement. For nonreplicated systematic samples of fish escapement, all variance estimators were positively biased. Compared to the other estimators, the least biased estimator reduced bias by, on average, from 12% to 98%. All confidence intervals gave effectively identical results. Replicated systematic sampling designs consistently provided the smallest average estimated variance among those compared.

  6. Lyman-Werner UV escape fractions from primordial haloes

    NASA Astrophysics Data System (ADS)

    Schauer, Anna T. P.; Whalen, Daniel J.; Glover, Simon C. O.; Klessen, Ralf S.

    2015-12-01

    Population III (Pop III) stars can regulate star formation in the primordial Universe in several ways. They can ionize nearby haloes, and even if their ionizing photons are trapped by their own haloes, their Lyman-Werner (LW) photons can still escape and destroy H2 in other haloes, preventing them from cooling and forming stars. LW escape fractions are thus a key parameter in cosmological simulations of early reionization and star formation but have not yet been parametrized for realistic haloes by halo or stellar mass. To do so, we perform radiation hydrodynamical simulations of LW UV escape from 9-120 M⊙ Pop III stars in 105-107 M⊙ haloes with ZEUS-MP. We find that photons in the LW lines (i.e. those responsible for destroying H2 in nearby systems) have escape fractions ranging from 0 to 85 per cent. No LW photons escape the most massive halo in our sample, even from the most massive star. Escape fractions for photons elsewhere in the 11.18-13.6 eV energy range, which can be redshifted into the LW lines at cosmological distances, are generally much higher, being above 60 per cent for all but the least massive stars in the most massive haloes. We find that shielding of H2 by neutral hydrogen, which has been neglected in most studies to date, produces escape fractions that are up to a factor of 3 smaller than those predicted by H2 self-shielding alone.

  7. Evolutionary escape on complex genotype-phenotype networks.

    PubMed

    Ibáñez-Marcelo, Esther; Alarcón, Tomás

    2016-04-01

    We study the problem of evolutionary escape that is the process whereby a population under sudden changes in the selective pressures acting upon it try to evade extinction by evolving from previously well-adapted phenotypes to those that are favoured by the new selective pressure. We perform a comparative analysis between results obtained by modelling genotype space as a regular hypercube (H-graphs), which is the scenario considered in previous work on the subject, to those corresponding to a complex genotype-phenotype network (B-graphs). In order to analyse the properties of the escape process on both these graphs, we apply a general theory based on multi-type branching processes to compute the evolutionary dynamics and probability of escape. We show that the distribution of distances between phenotypes in B-graphs exhibits a much larger degree of heterogeneity than in H-graphs. This property, one of the main structural differences between both types of graphs, causes heterogeneous behaviour in all results associated to the escape problem. We further show that, due to the heterogeneity characterising escape on B-graphs, escape probability can be underestimated by assuming a regular hypercube genotype network, even if we compare phenotypes at the same distance in H-graphs. Similarly, it appears that the complex structure of B-graphs slows down the rate of escape. PMID:26802479

  8. Alterations in oxidative, inflammatory and apoptotic events in short-lived and long-lived mice testes

    PubMed Central

    Matzkin, María Eugenia; Miquet, Johanna Gabriela; Fang, Yimin; Hill, Cristal Monique; Turyn, Daniel; Calandra, Ricardo Saúl; Bartke, Andrzej; Frungieri, Mónica Beatriz

    2016-01-01

    Aged testes undergo profound histological and morphological alterations leading to a reduced functionality. Here, we investigated whether variations in longevity affect the development of local inflammatory processes, the oxidative state and the occurrence of apoptotic events in the testis. To this aim, well-established mouse models with delayed (growth hormone releasing hormone-knockout and Ames dwarf mice) or accelerated (growth hormone-transgenic mice) aging were used. We hereby show that the testes of short-lived mice show a significant increase in cyclooxygenase 2 expression, PGD2 production, lipid peroxidation, antioxidant enzymes expression, local macrophages and TUNEL-positive germ cells numbers, and the levels of both pro-caspase-3 and cleaved caspase-3. In contrast, although the expression of antioxidant enzymes remained unchanged in testes of long-lived mice, the remainder of the parameters assessed showed a significant reduction. This study provides novel evidence that longevity confers anti-inflammatory, anti-oxidant and anti-apoptotic capacities to the adult testis. Oppositely, short-lived mice suffer testicular inflammatory, oxidative and apoptotic processes. PMID:26805572

  9. Nerve-racking - apoptotic and non-apoptotic roles of caspases in the nervous system of Drosophila.

    PubMed

    Melzer, Juliane; Broemer, Meike

    2016-07-01

    Studies using Drosophila as a model system have contributed enormously to our knowledge of caspase function and regulation. Caspases are best known as central executioners of apoptosis but also control essential physiological processes in a non-apoptotic manner. The Drosophila genome codes for seven caspases and in this review we provide an overview of current knowledge about caspase function in the nervous system. Caspases regulate neuronal death at all developmental stages and in various neuronal populations. In contrast, non-apoptotic roles are less well understood. The development of new genetically encoded sensors for caspase activity provides unprecedented opportunities to study caspase function in the nervous system in more detail. In light of these new tools we discuss the potential of Drosophila as a model to discover new apoptotic and non-apoptotic neuronal roles of caspases. PMID:26900934

  10. Xenon Fractionation, Hydrogen Escape, and the Oxidation of the Earth

    NASA Astrophysics Data System (ADS)

    Zahnle, K. J.; Catling, D. C.

    2014-12-01

    Xenon in Earth's atmosphere is severely mass fractionated and depleted compared to any plausible solar system source material, yet Kr is unfractionated. These observations seem to imply that Xe has escaped from Earth. Vigorous hydrodynamic hydrogen escape can produce mass fractionation in heavy gases. The required hydrogen flux is very high but within the range permitted by solar EUV heating when Earth was 100 Myrs old or younger. However this model cannot explain why Xe escapes but Kr does not. Recently, what appears to be ancient atmospheric xenon has been recovered from several very ancient (3-3.5 Ga) terrestrial hydrothermal barites and cherts (Pujol 2011, 2013). What is eye-catching about this ancient Xe is that it is less fractionated that Xe in modern air. In other words, it appears that a process was active on Earth some 3 to 3.5 billion years ago that caused xenon to fractionate. By this time the Sun was no longer the EUV source that it used to be. If xenon was being fractionated by escape — currently the only viable hypothesis — it had to be in Earth's Archean atmosphere and under rather modest levels of EUV forcing. It should be possible for Xe, but not Kr, to escape from Earth as an ion. In a hydrodynamically escaping hydrogen wind the hydrogen is partially ionized. The key concepts are that ions are much more strongly coupled to the escaping flow than are neutrals (so that a relatively modest flow of H and H+ to space could carry Xe+ along with it, the flux can be small enough to be consistent with diffusion-limited flux), and that Xe alone among the noble gases is more easily ionized than hydrogen. This sort of escape is possible along the polar field lines, although a weak or absent magnetic field would likely work as well. The extended history of hydrogen escape implicit in Xe escape in the Archean is consistent with other suggestions that hydrogen escape in the Archean was considerable. Hydrogen escape plausibly played the key role in creating

  11. 16. INTERIOR VIEW OF SUBMARINE SECTION AT 110FOOT LEVEL, ESCAPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    16. INTERIOR VIEW OF SUBMARINE SECTION AT 110-FOOT LEVEL, ESCAPE TRAINING TANK, SHOWING LADDER TO ESCAPE TANK, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  12. Low expression of pro-apoptotic Bcl-2 family proteins sets the apoptotic threshold in Waldenström Macroglobulinemia

    PubMed Central

    Gaudette, Brian T.; Dwivedi, Bhakti; Chitta, Kasyapa S.; Poulain, Stéphanie; Powell, Doris; Vertino, Paula; Leleu, Xavier; Lonial, Sagar; Chanan-Khan, Asher A.; Kowalski, Jeanne; Boise, Lawrence H.

    2015-01-01

    Waldenström Macroglobulinemia (WM) is a proliferative disorder of IgM secreting, lymphoplasmacytoid cells that inhabit the lymph nodes and bone marrow. The disease carries a high prevalence of activating mutations in MyD88 (91%) and CXCR4 (28%). Because signaling through these pathways leads to Bcl-xL induction, we examined Bcl-2 family expression in WM patients and cell lines. Unlike other B-lymphocyte-derived malignancies, which become dependent on expression of anti-apoptotic proteins to counter expression of pro-apoptotic proteins, WM samples expressed both pro- and anti-apoptotic Bcl-2 proteins at low levels similar to their normal B-cell and plasma cell counterparts. Three WM cell lines expressed pro-apoptotic Bcl-2 family members Bim or Bax and Bak at low levels which determined their sensitivity to inducers of intrinsic apoptosis. In two cell lines, miR-155 upregulation, which is common in WM, was responsible for inhibition of FOXO3a and Bim expression. Both antagonizing miR-155 to induce Bim and proteasome inhibition increased the sensitivity to ABT-737 in these lines indicating a lowering of the apoptotic threshold. In this manner, treatments that increase pro-apoptotic protein expression increase the efficacy of agents treated in combination in addition to direct killing. PMID:25893290

  13. p53 Protein-mediated regulation of phosphoglycerate dehydrogenase (PHGDH) is crucial for the apoptotic response upon serine starvation.

    PubMed

    Ou, Yang; Wang, Shang-Jui; Jiang, Le; Zheng, Bin; Gu, Wei

    2015-01-01

    Although p53 is frequently mutated in human cancers, about 80% of human melanomas retain wild-type p53. Here we report that PHGDH, the key metabolic enzyme that catalyzes the rate-limiting step of the serine biosynthesis pathway, is a target of p53 in human melanoma cells. p53 suppresses PHGDH expression and inhibits de novo serine biosynthesis. Notably, upon serine starvation, p53-mediated cell death is enhanced dramatically in response to Nutlin-3 treatment. Moreover, PHGDH has been found recently to be amplified frequently in human melanomas. We found that PHGDH overexpression significantly suppresses the apoptotic response, whereas RNAi-mediated knockdown of endogenous PHGDH promotes apoptosis under the same treatment. These results demonstrate an important role of p53 in regulating the serine biosynthesis pathway through suppressing PHGDH expression and reveal serine deprivation as a novel approach to sensitize p53-mediated apoptotic responses in human melanoma cells. PMID:25404730

  14. Surface code—biophysical signals for apoptotic cell clearance

    NASA Astrophysics Data System (ADS)

    Biermann, Mona; Maueröder, Christian; Brauner, Jan M.; Chaurio, Ricardo; Janko, Christina; Herrmann, Martin; Muñoz, Luis E.

    2013-12-01

    Apoptotic cell death and the clearance of dying cells play an important and physiological role in embryonic development and normal tissue turnover. In contrast to necrosis, apoptosis proceeds in an anti-inflammatory manner. It is orchestrated by the timed release and/or exposure of so-called ‘find-me’, ‘eat me’ and ‘tolerate me’ signals. Mononuclear phagocytes are attracted by various ‘find-me’ signals, including proteins, nucleotides, and phospholipids released by the dying cell, whereas the involvement of granulocytes is prevented via ‘stay away’ signals. The exposure of anionic phospholipids like phosphatidylserine (PS) by apoptotic cells on the outer leaflet of the plasma membrane is one of the main ‘eat me’ signals. PS is recognized by a number of innate receptors as well as by soluble bridging molecules on the surface of phagocytes. Importantly, phagocytes are able to discriminate between viable and apoptotic cells both exposing PS. Due to cytoskeleton remodeling PS has a higher lateral mobility on the surfaces of apoptotic cells thereby promoting receptor clustering on the phagocyte. PS not only plays an important role in the engulfment process, but also acts as ‘tolerate me’ signal inducing the release of anti-inflammatory cytokines by phagocytes. An efficient and fast clearance of apoptotic cells is required to prevent secondary necrosis and leakage of intracellular danger signals into the surrounding tissue. Failure or prolongation of the clearance process leads to the release of intracellular antigens into the periphery provoking inflammation and development of systemic inflammatory autoimmune disease like systemic lupus erythematosus. Here we review the current findings concerning apoptosis-inducing pathways, important players of apoptotic cell recognition and clearance as well as the role of membrane remodeling in the engulfment of apoptotic cells by phagocytes.

  15. 3. VIEW OF ESCAPE TUNNEL IN NORTH FACE OF LAUNCH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW OF ESCAPE TUNNEL IN NORTH FACE OF LAUNCH OPERATIONS BUILDING. BUNKER PERISCOPE VISIBLE ABOVE RIGHT CORNER OF TUNNEL. - Vandenberg Air Force Base, Space Launch Complex 3, Launch Operations Building, Napa & Alden Roads, Lompoc, Santa Barbara County, CA

  16. 14. View inside Building 802, the "Escape Hatch" at the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. View inside Building 802, the "Escape Hatch" at the rear of the "Sleeping Quarters", facing south. - Naval Air Station Fallon, 100-man Fallout Shelter, 800 Complex, off Carson Road near intersection of Pasture & Berney Roads, Fallon, Churchill County, NV

  17. Prey escaping wolves, Canis lupus, despite close proximity

    USGS Publications Warehouse

    Nelson, M.E.; Mech, L.D.

    1993-01-01

    We describe attacks by wolf (Canis lupus) packs in Minnesota on a white-tailed deer (Odocoileus virginianus) and a moose (Alces alces) in which wolves were within contact distance of the prey but in which the prey escaped.

  18. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... wearing life jackets. There must be no protrusions in means of escape that could cause injury, ensnare clothing, or damage life jackets. (f) The minimum clear opening of a door or passageway used as a means...

  19. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... wearing life jackets. There must be no protrusions in means of escape that could cause injury, ensnare clothing, or damage life jackets. (f) The minimum clear opening of a door or passageway used as a means...

  20. 40. Launch Area, Underground Missile Storage Structure, detail of escape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    40. Launch Area, Underground Missile Storage Structure, detail of escape hatch and decontamination shower VIEW WEST - NIKE Missile Battery PR-79, Launch Area, East Windsor Road south of State Route 101, Foster, Providence County, RI

  1. 10. VIEW OF SILO DOORS, AIR VENTS, AND ESCAPE HATCH, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. VIEW OF SILO DOORS, AIR VENTS, AND ESCAPE HATCH, LOOKING EAST. WHITE STRUCTURES BELONG TO CURRENT OCCUPANTS Everett Weinreb, photographer, April 1988 - Los Pinetos Nike Missile Site, Santa Clara Road, Los Angeles National Forest, Sylmar, Los Angeles County, CA

  2. 61. View of exhaust air vent (foreground), escape hatch, and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    61. View of exhaust air vent (foreground), escape hatch, and elevator doors at launch pad "A" with building 157, sentry control box on right, looking southwest - Nike Missile Battery MS-40, County Road No. 260, Farmington, Dakota County, MN

  3. Survey of space escape/rescue/survivability capabilities.

    NASA Technical Reports Server (NTRS)

    Fleisig, R.; Bolger, P. H.; Heath, G. W.

    1971-01-01

    Discussion of preventive or remedial systems to achieve safer space flight operations. Escape, rescue, and survival systems are defined by categories: on board, prepositioned aid, and earth-launched concepts. The survey considers separable escape or survival capsules; standby escape or rescue systems; and earth-launched manned and unmanned rescue systems. Reports covering such systems are listed, and the contents are classified as to scope of investigation, space mission, and design approach. Mission classes considered are earth orbit, lunar, and interplanetary. Results of the space escape, rescue, and survivability investigations are summarized in terms of system features and performance, including apparent voids or limitations in rescue capability. Recovery requirements and resources for space rescue are discussed.

  4. Pioneer Venus Orbiter (PVO) Ionosphere Evidence for Atmospheric Escape

    NASA Astrophysics Data System (ADS)

    Grebowsky, J. M.; Hoegy, W. R.

    2009-12-01

    An early estimate of escape of H2O from Venus [McElroy et al., 1982] using observed hot oxygen densities inferred by Nagy et al. [1981] from PVO OUVS 1304 Å dayglow and using ionization rates from photoionization and electron impact. This resulted in an estimated oxygen ionization rate planet-wide above the plasmapause of 3x1025 atoms/s. Based on the energetic O+ being swept up and removed by solar wind, McElroy et al. [1982] gave an estimate of a loss rate for O of 6x106 atoms/cm2/s. Using a different method of estimating escape based data in the ionotail of Venus, Brace et al. [1987] estimated a total planetary O+ escape rate of 5x1025 ions/s. Their estimate was based on PVO measurements of superthermal O+ (energy range 9-16 eV) in the tail ray plasma between 2000 and 3000 km. Their estimated global mean flux was 107 atoms/cm2/s. The two escape rates are remarkably close considering all the errors involved in such estimates of escape. A study of escape by Luhmann et al. [2008] using VEX observations at low solar activity finds modest escape rates, prompting the authors to reconsider the evidence from both PVO and VEX of the possibility of enhanced escape during extreme interplanetary conditions. We reexamine the variation of escape under different solar wind conditions using ion densities and plasma content in the dayside and nightside of Venus using PVO ionosphere density during times of high solar activity. Citations: Brace, L.H., W. T. Kasprzak, H.A. Taylor, R. F. Theis, C. T. Russess, A. Barnes, J. D. Mihalov, and D. M. Hunten, "The Ionotail of Venus: Its Configuration and Evidence for Ion Escape", J. Geophys. Res. 92, 15-26, 1987. Luhmann, J.G., A. Fedorov, S. Barabash, E. Carlsson, Y. Futaana, T.L. Zhang, C.T. Russell, J.G. Lyon, S.A. Ledvina, and D.A. Brain, “Venus Express observations of atmospheric oxygen escape during the passage of several coronal mass ejections”, J. Geophys. Res., 113, 2008. McElroy, M. B., M. J. Prather, J. M. Rodiquez, " Loss

  5. Photoelectron escape fluxes over the equatorial and midlatitude regions

    NASA Technical Reports Server (NTRS)

    Narasingarao, B. C.; Singh, R. N.; Maier, E. J.

    1972-01-01

    Satellite measurements of photoelectron escape flux around noontime made by Explorer 31 in 600-800 km altitude range are reported for the equatorial and midlatitude regions. The pitch angle distributions and the spectral distributions are derived from the data. Analyzed data show that the flux for equatorial regions is lower by a factor 2 to 3 in comparison to that of midlatitude regions. Theoretical calculations are also made to compare with observed escape fluxes.

  6. Optimal escapement in stage-structured fisheries with environmental stochasticity.

    PubMed

    Holden, Matthew H; Conrad, Jon M

    2015-11-01

    Stage-structured population models are commonly used to understand fish population dynamics and additionally for stock assessment. Unfortunately, there is little theory on the optimal harvest of stage-structured populations, especially in the presence of stochastic fluctuations. In this paper, we find closed form optimal equilibrium escapement policies for a three-dimensional, discrete-time, stage-structured population model with linear growth, post-harvest nonlinear recruitment, and stage-specific pricing and extend the analytic results to structured populations with environmental stochasticity. When only fishing reproductive adults, stochasticity does not affect optimal escapement policies. However, when harvesting immature fish, the addition of stochasticity can increase or decrease optimal escapement depending on the second and third derivative of the recruitment function. For logistic recruitment, stochasticity reduces optimal immature escapement by a multiplicative factor of one over one plus the variance of the environmental noise. Using hard clam, Mercenaria mercenaria, as an example and assuming Beverton-Holt recruitment, we show that optimal fishing of hard clam targets the immature stage class exclusively and that environmental stochasticity increases optimal escapement for low discount rates and decreases optimal escapement for high discount rates. PMID:26362229

  7. Initiation and spread of escape waves within animal groups

    PubMed Central

    Herbert-Read, James E.; Buhl, Jerome; Hu, Feng; Ward, Ashley J. W.; Sumpter, David J. T.

    2015-01-01

    The exceptional reactivity of animal collectives to predatory attacks is thought to be owing to rapid, but local, transfer of information between group members. These groups turn together in unison and produce escape waves. However, it is not clear how escape waves are created from local interactions, nor is it understood how these patterns are shaped by natural selection. By startling schools of fish with a simulated attack in an experimental arena, we demonstrate that changes in the direction and speed by a small percentage of individuals that detect the danger initiate an escape wave. This escape wave consists of a densely packed band of individuals that causes other school members to change direction. In the majority of cases, this wave passes through the entire group. We use a simulation model to demonstrate that this mechanism can, through local interactions alone, produce arbitrarily large escape waves. In the model, when we set the group density to that seen in real fish schools, we find that the risk to the members at the edge of the group is roughly equal to the risk of those within the group. Our experiments and modelling results provide a plausible explanation for how escape waves propagate in nature without centralized control. PMID:26064630

  8. Some Possible Cases of Escape Mimicry in Neotropical Butterflies.

    PubMed

    Pinheiro, C E G; Freitas, A V L

    2014-10-01

    The possibility that escape or evasive mimicry evolved in butterflies and other prey insects in a similar fashion to classical Batesian and Müllerian mimicry has long been advanced in the literature. However, there is a general disagreement among lepidopterists and evolutionary biologists on whether or not escape mimicry exists, as well as in which mimicry rings this form of mimicry has evolved. Here, we review some purported cases of escape mimicry in Neotropical butterflies and suggest new mimicry rings involving several species of Archaeoprepona, Prepona, and Doxocopa (the "bright blue bands" ring) and species of Colobura and Hypna (the "creamy bands" ring) where the palatability of butterflies, their ability to escape predator attacks, geographic distribution, relative abundance, and co-occurrence in the same habitats strongly suggest that escape mimicry is involved. In addition, we also indicate other butterfly taxa whose similarities of coloration patterns could be due to escape mimicry and would constitute important case studies for future investigation. PMID:27193948

  9. Foraging behavior delays mechanically-stimulated escape responses in fish.

    PubMed

    Bohórquez-Herrera, Jimena; Kawano, Sandy M; Domenici, Paolo

    2013-11-01

    Foraging and the evasion of predators are fundamental for the survival of organisms, but they impose contrasting demands that can influence performance in each behavior. Previous studies suggested that foraging organisms may experience decreased vigilance to attacks by predators; however, little is known about the effect of foraging on escape performance with respect to the kinematics and the timing of the response. This study tested the hypothesis that engaging in foraging activities affected escape performance by comparing fast-start escape responses of silver-spotted sculpins Blepsias cirrhosus under three conditions: (1) control (no foraging involved), (2) while targeting prey, and (3) immediately after capture of prey. Escape response variables (non-locomotor and locomotor) were analyzed from high-speed videos. Responsiveness was lower immediately after capturing a prey item compared with the other two treatments, and latency of performance was higher in the control treatment than in the other two. Locomotor variables such as maximum speed, maximum acceleration, and turning rates did not show statistical differences among the three groups. Our results demonstrate that foraging can negatively affect two fundamental components of the escape response: (1) responsiveness and (2) latency of escape, suggesting that engaging in foraging may decrease an individual's ability to successfully evade predators. PMID:23624863

  10. Potential of apoptotic pathway-targeted cancer therapeutic research: Where do we stand?

    PubMed Central

    Baig, S; Seevasant, I; Mohamad, J; Mukheem, A; Huri, H Z; Kamarul, T

    2016-01-01

    Underneath the intricacy of every cancer lies mysterious events that impel the tumour cell and its posterity into abnormal growth and tissue invasion. Oncogenic mutations disturb the regulatory circuits responsible for the governance of versatile cellular functions, permitting tumour cells to endure deregulated proliferation, resist to proapoptotic insults, invade and erode normal tissues and above all escape apoptosis. This disruption of apoptosis has been highly implicated in various malignancies and has been exploited as an anticancer strategy. Owing to the fact that apoptosis causes minimal inflammation and damage to the tissue, apoptotic cell death-based therapy has been the centre of attraction for the development of anticancer drugs. Increased understanding of the molecular pathways underlying apoptosis has enabled scientists to establish unique approaches targeting apoptosis pathways in cancer therapeutics. In this review, we reconnoitre the two major pathways (intrinsic and extrinsic) targeted cancer therapeutics, steering toward chief modulators of these pathways, such as B-cell lymphoma 2 protein family members (pro- and antiapoptotic), inhibitor of apoptosis proteins, and the foremost thespian of extrinsic pathway regulator, tumour necrosis factor-related apoptosis-inducing agent. Together, we also will have a look from clinical perspective to address the agents (drugs) and therapeutic strategies adopted to target these specific proteins/pathways that have entered clinical trials. PMID:26775709