Science.gov

Sample records for arsenite oxidase gene

  1. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central

    2010-01-01

    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  2. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  3. Microbial oxidation of arsenite in a subarctic environment: diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser

    PubMed Central

    2010-01-01

    Background Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10°C). Results Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25°C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. Conclusions The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10°C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates. PMID:20673331

  4. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.

    PubMed

    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire

    2003-01-01

    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  5. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  6. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  7. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

  8. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.

    2015-01-01

    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  9. Cold-adapted arsenite oxidase from a psychrotolerant Polaromonas species.

    PubMed

    Osborne, Thomas H; Heath, Matthew D; Martin, Andrew C R; Pankowski, Jaroslaw A; Hudson-Edwards, Karen A; Santini, Joanne M

    2013-04-01

    Polaromonas sp. str. GM1 is an aerobic, psychrotolerant, heterotrophic member of the Betaproteobacteria and is the only isolate capable of oxidising arsenite at temperatures below 10 °C. Sequencing of the aio gene cluster in GM1 revealed the presence of the aioB and aioA genes, which encode the arsenite oxidase but the regulatory genes typically found upstream of aioB in other members of the Proteobacteria were absent. The GM1 Aio was purified to homogeneity and was found to be a heterodimer. The enzyme contained Mo and Fe as cofactors and had, using the artificial electron acceptor 2,6-dichlorophenolindophenol, a Km for arsenite of 111.70 ± 0.88 μM and a Vmax of 12.16 ± 0.30 U mg(-1), which is the highest reported specific activity for any known Aio. The temperature-activity profiles of the arsenite oxidases from GM1 and the mesophilic betaproteobacterium Alcaligenes faecalis were compared and showed that the GM1 Aio was more active at low temperatures than that of A. faecalis. A homology model of the GM1 Aio was made using the X-ray crystal structure of the Aio from A. faecalis as the template. Structural changes that account for cold adaptation were identified and it was found that these resulted in increased enzyme flexibility and a reduction in the hydrophobicity of the core. PMID:23150098

  10. Arsenite Oxidase from Ralstonia sp. 22

    PubMed Central

    Lieutaud, Aurélie; van Lis, Robert; Duval, Simon; Capowiez, Line; Muller, Daniel; Lebrun, Régine; Lignon, Sabrina; Fardeau, Marie-Laure; Lett, Marie-Claire; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

    2010-01-01

    We characterized the aro arsenite oxidation system in the novel strain Ralstonia sp. 22, a β-proteobacterium isolated from soil samples of the Salsigne mine in southern France. The inducible aro system consists of a heterodimeric membrane-associated enzyme reacting with a dedicated soluble cytochrome c554. Our biochemical results suggest that the weak association of the enzyme to the membrane probably arises from a still unknown interaction partner. Analysis of the phylogeny of the aro gene cluster revealed that it results from a lateral gene transfer from a species closely related to Achromobacter sp. SY8. This constitutes the first clear cut case of such a transfer in the Aro phylogeny. The biochemical study of the enzyme demonstrates that it can accommodate in vitro various cytochromes, two of which, c552 and c554, are from the parent species. Cytochrome c552 belongs to the sox and not the aro system. Kinetic studies furthermore established that sulfite and sulfide, substrates of the sox system, are both inhibitors of Aro activity. These results reinforce the idea that sulfur and arsenic metabolism are linked. PMID:20421652

  11. ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

    USGS Publications Warehouse

    Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

    2012-01-01

    Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

  12. Spatio-Temporal Detection of the Thiomonas Population and the Thiomonas Arsenite Oxidase Involved in Natural Arsenite Attenuation Processes in the Carnoulès Acid Mine Drainage.

    PubMed

    Hovasse, Agnès; Bruneel, Odile; Casiot, Corinne; Desoeuvre, Angélique; Farasin, Julien; Hery, Marina; Van Dorsselaer, Alain; Carapito, Christine; Arsène-Ploetze, Florence

    2016-01-01

    The acid mine drainage (AMD) impacted creek of the Carnoulès mine (Southern France) is characterized by acid waters with a high heavy metal content. The microbial community inhabiting this AMD was extensively studied using isolation, metagenomic and metaproteomic methods, and the results showed that a natural arsenic (and iron) attenuation process involving the arsenite oxidase activity of several Thiomonas strains occurs at this site. A sensitive quantitative Selected Reaction Monitoring (SRM)-based proteomic approach was developed for detecting and quantifying the two subunits of the arsenite oxidase and RpoA of two different Thiomonas groups. Using this approach combined with FISH and pyrosequencing-based 16S rRNA gene sequence analysis, it was established here for the first time that these Thiomonas strains are ubiquitously present in minor proportions in this AMD and that they express the key enzymes involved in natural remediation processes at various locations and time points. In addition to these findings, this study also confirms that targeted proteomics applied at the community level can be used to detect weakly abundant proteins in situ. PMID:26870729

  13. Spatio-Temporal Detection of the Thiomonas Population and the Thiomonas Arsenite Oxidase Involved in Natural Arsenite Attenuation Processes in the Carnoulès Acid Mine Drainage

    PubMed Central

    Hovasse, Agnès; Bruneel, Odile; Casiot, Corinne; Desoeuvre, Angélique; Farasin, Julien; Hery, Marina; Van Dorsselaer, Alain; Carapito, Christine; Arsène-Ploetze, Florence

    2016-01-01

    The acid mine drainage (AMD) impacted creek of the Carnoulès mine (Southern France) is characterized by acid waters with a high heavy metal content. The microbial community inhabiting this AMD was extensively studied using isolation, metagenomic and metaproteomic methods, and the results showed that a natural arsenic (and iron) attenuation process involving the arsenite oxidase activity of several Thiomonas strains occurs at this site. A sensitive quantitative Selected Reaction Monitoring (SRM)-based proteomic approach was developed for detecting and quantifying the two subunits of the arsenite oxidase and RpoA of two different Thiomonas groups. Using this approach combined with FISH and pyrosequencing-based 16S rRNA gene sequence analysis, it was established here for the first time that these Thiomonas strains are ubiquitously present in minor proportions in this AMD and that they express the key enzymes involved in natural remediation processes at various locations and time points. In addition to these findings, this study also confirms that targeted proteomics applied at the community level can be used to detect weakly abundant proteins in situ. PMID:26870729

  14. The respiratory arsenite oxidase: structure and the role of residues surrounding the rieske cluster.

    PubMed

    Warelow, Thomas P; Oke, Muse; Schoepp-Cothenet, Barbara; Dahl, Jan U; Bruselat, Nicole; Sivalingam, Ganesh N; Leimkühler, Silke; Thalassinos, Konstantinos; Kappler, Ulrike; Naismith, James H; Santini, Joanne M

    2013-01-01

    The arsenite oxidase (Aio) from the facultative autotrophic Alphaproteobacterium Rhizobium sp. NT-26 is a bioenergetic enzyme involved in the oxidation of arsenite to arsenate. The enzyme from the distantly related heterotroph, Alcaligenes faecalis, which is thought to oxidise arsenite for detoxification, consists of a large α subunit (AioA) with bis-molybdopterin guanine dinucleotide at its active site and a 3Fe-4S cluster, and a small β subunit (AioB) which contains a Rieske 2Fe-2S cluster. The successful heterologous expression of the NT-26 Aio in Escherichia coli has resulted in the solution of its crystal structure. The NT-26 Aio, a heterotetramer, shares high overall similarity to the heterodimeric arsenite oxidase from A. faecalis but there are striking differences in the structure surrounding the Rieske 2Fe-2S cluster which we demonstrate explains the difference in the observed redox potentials (+225 mV vs. +130/160 mV, respectively). A combination of site-directed mutagenesis and electron paramagnetic resonance was used to explore the differences observed in the structure and redox properties of the Rieske cluster. In the NT-26 AioB the substitution of a serine (S126 in NT-26) for a threonine as in the A. faecalis AioB explains a -20 mV decrease in redox potential. The disulphide bridge in the A. faecalis AioB which is conserved in other betaproteobacterial AioB subunits and the Rieske subunit of the cytochrome bc 1 complex is absent in the NT-26 AioB subunit. The introduction of a disulphide bridge had no effect on Aio activity or protein stability but resulted in a decrease in the redox potential of the cluster. These results are in conflict with previous data on the betaproteobacterial AioB subunit and the Rieske of the bc 1 complex where removal of the disulphide bridge had no effect on the redox potential of the former but a decrease in cluster stability was observed in the latter. PMID:24023621

  15. The Respiratory Arsenite Oxidase: Structure and the Role of Residues Surrounding the Rieske Cluster

    PubMed Central

    Warelow, Thomas P.; Oke, Muse; Schoepp-Cothenet, Barbara; Dahl, Jan U.; Bruselat, Nicole; Sivalingam, Ganesh N.; Leimkühler, Silke; Thalassinos, Konstantinos; Kappler, Ulrike; Naismith, James H.; Santini, Joanne M.

    2013-01-01

    The arsenite oxidase (Aio) from the facultative autotrophic Alphaproteobacterium Rhizobium sp. NT-26 is a bioenergetic enzyme involved in the oxidation of arsenite to arsenate. The enzyme from the distantly related heterotroph, Alcaligenes faecalis, which is thought to oxidise arsenite for detoxification, consists of a large α subunit (AioA) with bis-molybdopterin guanine dinucleotide at its active site and a 3Fe-4S cluster, and a small β subunit (AioB) which contains a Rieske 2Fe-2S cluster. The successful heterologous expression of the NT-26 Aio in Escherichia coli has resulted in the solution of its crystal structure. The NT-26 Aio, a heterotetramer, shares high overall similarity to the heterodimeric arsenite oxidase from A. faecalis but there are striking differences in the structure surrounding the Rieske 2Fe-2S cluster which we demonstrate explains the difference in the observed redox potentials (+225 mV vs. +130/160 mV, respectively). A combination of site-directed mutagenesis and electron paramagnetic resonance was used to explore the differences observed in the structure and redox properties of the Rieske cluster. In the NT-26 AioB the substitution of a serine (S126 in NT-26) for a threonine as in the A. faecalis AioB explains a −20 mV decrease in redox potential. The disulphide bridge in the A. faecalis AioB which is conserved in other betaproteobacterial AioB subunits and the Rieske subunit of the cytochrome bc1 complex is absent in the NT-26 AioB subunit. The introduction of a disulphide bridge had no effect on Aio activity or protein stability but resulted in a decrease in the redox potential of the cluster. These results are in conflict with previous data on the betaproteobacterial AioB subunit and the Rieske of the bc1 complex where removal of the disulphide bridge had no effect on the redox potential of the former but a decrease in cluster stability was observed in the latter. PMID:24023621

  16. Unsuspected Diversity of Arsenite-Oxidizing Bacteria as Revealed by Widespread Distribution of the aoxB Gene in Prokaryotes ▿ †

    PubMed Central

    Heinrich-Salmeron, Audrey; Cordi, Audrey; Brochier-Armanet, Céline; Halter, David; Pagnout, Christophe; Abbaszadeh-fard, Elham; Montaut, Didier; Seby, Fabienne; Bertin, Philippe N.; Bauda, Pascale; Arsène-Ploetze, Florence

    2011-01-01

    In this study, new strains were isolated from an environment with elevated arsenic levels, Sainte-Marie-aux-Mines (France), and the diversity of aoxB genes encoding the arsenite oxidase large subunit was investigated. The distribution of bacterial aoxB genes is wider than what was previously thought. AoxB subfamilies characterized by specific signatures were identified. An exhaustive analysis of AoxB sequences from this study and from public databases shows that horizontal gene transfer has likely played a role in the spreading of aoxB in prokaryotic communities. PMID:21571879

  17. An ArsR/SmtB Family Member Is Involved in the Regulation by Arsenic of the Arsenite Oxidase Operon in Thiomonas arsenitoxydans

    PubMed Central

    Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel

    2014-01-01

    The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. PMID:25107975

  18. Global Analysis of Posttranscriptional Gene Expression in Response to Sodium Arsenite

    PubMed Central

    Qiu, Lian-Qun; Abey, Sarah; Harris, Shawn; Shah, Ruchir; Gerrish, Kevin E.

    2014-01-01

    Background: Inorganic arsenic species are potent environmental toxins and causes of numerous health problems. Most studies have assumed that arsenic-induced changes in mRNA levels result from effects on gene transcription. Objectives: We evaluated the prevalence of changes in mRNA stability in response to sodium arsenite in human fibroblasts. Methods: We used microarray analyses to determine changes in steady-state mRNA levels and mRNA decay rates following 24-hr exposure to noncytotoxic concentrations of sodium arsenite, and we confirmed some of these changes using real-time reverse-transcription polymerase chain reaction (RT-PCR). Results: In arsenite-exposed cells, 186 probe set–identified transcripts were significantly increased and 167 were significantly decreased. When decay rates were analyzed after actinomycin D treatment, only 4,992 (9.1%) of probe set–identified transcripts decayed by > 25% after 4 hr. Of these, 70 were among the 353 whose steady-state levels were altered by arsenite, and of these, only 4 exhibited significantly different decay rates between arsenite and control treatment. Real-time RT-PCR confirmed a major, significant arsenite-induced stabilization of the mRNA encoding δ aminolevulinate synthase 1 (ALAS1), the rate-limiting enzyme in heme biosynthesis. This change presumably accounted for at least part of the 2.7-fold increase in steady-state ALAS1 mRNA levels seen after arsenite treatment. This could reflect decreases in cellular heme caused by the massive induction by arsenite of heme oxygenase mRNA (HMOX1; 68-fold increase), the rate-limiting enzyme in heme catabolism. Conclusions: We conclude that arsenite modification of mRNA stability is relatively uncommon, but in some instances can result in significant changes in gene expression. Citation: Qiu LQ, Abey S, Harris S, Shah R, Gerrish KE, Blackshear PJ. 2015. Global analysis of posttranscriptional gene expression in response to sodium arsenite. Environ Health Perspect 123:324

  19. X-ray Crystal Structure of Arsenite-Inhibited Xanthine Oxidase:[mu]-Sulfido,[mu]-Oxo Double Bridge between Molybdenum and Arsenic in the Active Site

    SciTech Connect

    Cao, Hongnan; Hall, James; Hille, Russ

    2012-10-23

    Xanthine oxidoreductase is a molybdenum-containing enzyme that catalyzes the hydroxylation reaction of sp{sup 2}-hybridized carbon centers of a variety of substrates, including purines, aldehydes, and other heterocyclic compounds. The complex of arsenite-inhibited xanthine oxidase has been characterized previously by UV-vis, electron paramagnetic resonance, and X-ray absorption spectroscopy (XAS), and the catalytically essential sulfido ligand of the square-pyrimidal molybdenum center has been suggested to be involved in arsenite binding through either a {mu}-sulfido,{mu}-oxo double bridge or a single {mu}-sulfido bridge. However, this is contrary to the crystallographically observed single {mu}-oxo bridge between molybdenum and arsenic in the desulfo form of aldehyde oxidoreductase from Desulfovibrio gigas (an enzyme closely related to xanthine oxidase), whose molybdenum center has an oxo ligand replacing the catalytically essential sulfur, as seen in the functional form of xanthine oxidase. Here we use X-ray crystallography to characterize the molybdenum center of arsenite-inhibited xanthine oxidase and solve the structures of the oxidized and reduced inhibition complexes at 1.82 and 2.11 {angstrom} resolution, respectively. We observe {mu}-sulfido,{mu}-oxo double bridges between molybdenum and arsenic in the active sites of both complexes. Arsenic is four-coordinate with a distorted trigonal-pyramidal geometry in the oxidized complex and three-coordinate with a distorted trigonal-planar geometry in the reduced complex. The doubly bridged binding mode is in agreement with previous XAS data indicating that the catalytically essential sulfur is also essential for the high affinity of reduced xanthine oxidoreductase for arsenite.

  20. The study of the mechanism of arsenite toxicity in respiration-deficient cells reveals that NADPH oxidase-derived superoxide promotes the same downstream events mediated by mitochondrial superoxide in respiration-proficient cells.

    PubMed

    Guidarelli, Andrea; Fiorani, Mara; Carloni, Silvia; Cerioni, Liana; Balduini, Walter; Cantoni, Orazio

    2016-09-15

    We herein report the results from a comparative study of arsenite toxicity in respiration-proficient (RP) and -deficient (RD) U937 cells. An initial characterization of these cells led to the demonstration that the respiration-deficient phenotype is not associated with apparent changes in mitochondrial mass and membrane potential. In addition, similar levels of superoxide (O2(.-)) were generated by RP and RD cells in response to stimuli specifically triggering respiratory chain-independent mitochondrial mechanisms or extramitochondrial, NADPH-oxidase dependent, mechanisms. At the concentration of 2.5μM, arsenite elicited selective formation of O2(.-) in the respiratory chain of RP cells, with hardly any contribution of the above mechanisms. Under these conditions, O2(.-) triggered downstream events leading to endoplasmic reticulum (ER) stress, autophagy and apoptosis. RD cells challenged with similar levels of arsenite failed to generate O2(.-) because of the lack of a functional respiratory chain and were therefore resistant to the toxic effects mediated by the metalloid. Their resistance, however, was lost after exposure to four fold greater concentrations of arsenite, coincidentally with the release of O2(.-) mediated by NADPH oxidase. Interestingly, extramitochondrial O2(.-) triggered the same downstream events and an identical mode of death previously observed in RP cells. Taken together, the results obtained in this study indicate that arsenite toxicity is strictly dependent on O2(.-) availability that, regardless of whether generated in the mitochondrial or extramitochondrial compartments, triggers similar downstream events leading to ER stress, autophagy and apoptosis. PMID:27450018

  1. Arsenite oxidation by a facultative chemolithoautotrophic Sinorhizobium sp. KGO-5 isolated from arsenic-contaminated soil.

    PubMed

    Dong, Dan; Ohtsuka, Toshihiko; Dong, Dian Tao; Amachi, Seigo

    2014-01-01

    A chemolithoautotrophic arsenite-oxidizing bacterium, designated strain KGO-5, was isolated from arsenic-contaminated industrial soil. Strain KGO-5 was phylogenetically closely related with Sinorhizobium meliloti with 16S rRNA gene similarity of more than 99%, and oxidized 5 mM arsenite under autotrophic condition within 60 h with a doubling time of 3.0 h. Additions of 0.01-0.1% yeast extract enhanced the growth significantly, and the strain still oxidized arsenite efficiently with much lower doubling times of approximately 1.0 h. Arsenite-oxidizing capacities (11.2-54.1 μmol h(-1) mg dry cells(-1)) as well as arsenite oxidase (Aio) activities (1.76-10.0 mU mg protein(-1)) were found in the cells grown with arsenite, but neither could be detected in the cells grown without arsenite. Strain KGO-5 possessed putative aioA gene, which is closely related with AioA of Ensifer adhaerens. These results suggest that strain KGO-5 is a facultative chemolithoautotrophic arsenite oxidizer, and its Aio is induced by arsenic. PMID:25051896

  2. Diversity of Arsenate Respiratory Reductase Genes Along Gradients of Arsenate and Arsenite Within Hypersaline, Alkaline Sediments

    NASA Astrophysics Data System (ADS)

    Saltikov, C. W.; Nilsen, J.; Oremland, R. S.; Kulp, T. R.; Hoeft, S. E.; Miller, L. G.; Switzer Blum, J.; Baesman, S.; Han, S.; Lanoil, B.

    2005-12-01

    There are several soda lakes in western United States that contain high arsenic concentrations (up to 4 mM total As). Interestingly, these lakes have high rates of anaerobic arsenate reduction, which is catalyzed by arsenate respiring prokaryotes. Several cultured arsenate respiring prokaryotes have been shown to respire and reduce arsenate via a membrane-associated enzyme, ArrA. This enzyme is present in many diverse arsenate respiring prokaryotes. To investigate arsenate respiring microbial communities within these extreme environments, we used functional gene analysis to detect the presence, abundance, and diversity of the arrA gene in core samples collected from two arsenic enriched, hypersaline, alkaline lakes, Mono Lake and Searles Lake. Each sample exhibited concentration gradients for dissolved arsenic species and oxygen. Porewater arsenite concentration increased with depth and was correlated with oxygen depletion. To investigate the depth dependency of the arrA gene in these core samples we utilized the Malasarn et al. (2004) polymerase chain reaction (PCR) primers to detect a partial arrA gene fragment in nucleic acids extracted from sediment samples. The arrA gene fragment was detected only in the top 1-2 cm of the Mono Lake core and no detection was observed in the Searles Lake homogenized core. After the primers were redesigned to include the nucleotide codon bias for haloalkaliphilic archaea ( Halobacterium), the arrA gene fragments could be detected at each depth interval throughout the Mono Lake core and in the homogenized core of Searles Lake. Work is currently focused on characterizing the diversity and abundance of the arrA gene fragments obtained in each core sample and at different depths. Although no haloalkaliphilic arsenate respiring archaea have been isolated to date, these results suggest that the arrA gene fragments detected in these soda lakes may be of archaeal origins.

  3. Arsenic Methylation in Arabidopsis thaliana Expressing an Algal Arsenite Methyltransferase Gene Increases Arsenic Phytotoxicity.

    PubMed

    Tang, Zhong; Lv, Yanling; Chen, Fei; Zhang, Wenwen; Rosen, Barry P; Zhao, Fang-Jie

    2016-04-01

    Arsenic (As) contamination in soil can lead to elevated transfer of As to the food chain. One potential mitigation strategy is to genetically engineer plants to enable them to transform inorganic As to methylated and volatile As species. In this study, we genetically engineered two ecotypes of Arabidopsis thaliana with the arsenite (As(III)) S-adenosylmethyltransferase (arsM) gene from the eukaryotic alga Chlamydomonas reinhardtii. The transgenic A. thaliana plants gained a strong ability to methylate As, converting most of the inorganic As into dimethylarsenate [DMA(V)] in the shoots. Small amounts of volatile As were detected from the transgenic plants. However, the transgenic plants became more sensitive to As(III) in the medium, suggesting that DMA(V) is more phytotoxic than inorganic As. The study demonstrates a negative consequence of engineered As methylation in plants and points to a need for arsM genes with a strong ability to methylate As to volatile species. PMID:26998776

  4. APOPTOSIS GENE EXPRESSION IN HUMAN EPDERMAL KERATINOCYTES TREATED WITH SODIUM ARSENITE USING REAL TIME PCR ARRAY

    EPA Science Inventory

    Arsenic exposure via contaminated drinking water is a great public health concern worldwide. Chronic arsenic exposure has been associated with human skin, lung and bladder cancer and other chronic effects. We have previous reported that sodium arsenite stimulated cell proliferati...

  5. Metabolic energy from arsenite oxidation in Alcaligenes faecalis

    NASA Astrophysics Data System (ADS)

    Anderson, G. L.; Love, M.; Zeider, B. K.

    2003-05-01

    The aerobic soil bacterium, Alcaligenes faecalis, survives in cultures containing greater than 10 g/L of aqueous arsenic. Toleration of arsenite occurs by the enzymatic oxidation of arsenite (As^III), to the less toxic arsenate (As^V). In defined media, the bacterium grows faster in the presence of arsenite than in its absence. This suggests that the bacterium uses the redox potential of arsenite oxidation as metabolic energy. The oxidation occurs via periplasmic arsenite oxidase, azurin, and cytochrome c [11] which presumably pass electron equivalents through an electron transport chain involving cytochrome c oxidase aud oxygen as the terminal electron acceptor. The associated proton translocation would allow synthesis of ATP and provide a useful means of harnessing the redox potential of arsenite oxidation. Arsenite and arsenate assays of the media during bacterial growth indicate that arsenite is depleted during the exponential growth phase and occurs concomitantly with the expression of arsenite oxidase. These results suggest that arsenite is detoxified to arsenate during bacterial growth and are inconsistent with previous reported interpretations of growth data. Alcaligenes faecalis is dependent on organic carbon sources and is therefore not chemolithoautotrophic. The relationship between succinate and arsenite utilisation provides evidence for the use of arsenite as a supplemental energy source. Because Alcaligenes faecalis not only tolerates, but thrives, in very high concentrations of arsenic has important implications in bioremediation of environments contaminated by aqueous arsenic.

  6. The H-bond network surrounding the pyranopterins modulates redox cooperativity in the molybdenum-bisPGD cofactor in arsenite oxidase.

    PubMed

    Duval, Simon; Santini, Joanne M; Lemaire, David; Chaspoul, Florence; Russell, Michael J; Grimaldi, Stephane; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

    2016-09-01

    While the molybdenum cofactor in the majority of bisPGD enzymes goes through two consecutive 1-electron redox transitions, previous protein-film voltammetric results indicated the possibility of cooperative (n=2) redox behavior in the bioenergetic enzyme arsenite oxidase (Aio). Combining equilibrium redox titrations, optical and EPR spectroscopies on concentrated samples obtained via heterologous expression, we unambiguously confirm this claim and quantify Aio's redox cooperativity. The stability constant, Ks, of the Mo(V) semi-reduced intermediate is found to be lower than 10(-3). Site-directed mutagenesis of residues in the vicinity of the Mo-cofactor demonstrates that the degree of redox cooperativity is sensitive to H-bonding interactions between the pyranopterin moieties and amino acid residues. Remarkably, in particular replacing the Gln-726 residue by Gly results in stabilization of (low-temperature) EPR-observable Mo(V) with KS=4. As evidenced by comparison of room temperature optical and low temperature EPR titrations, the degree of stabilization is temperature-dependent. This highlights the importance of room-temperature redox characterizations for correctly interpreting catalytic properties in this group of enzymes. Geochemical and phylogenetic data strongly indicate that molybdenum played an essential biocatalytic roles in early life. Molybdenum's redox versatility and in particular the ability to show cooperative (n=2) redox behavior provide a rationale for its paramount catalytic importance throughout the evolutionary history of life. Implications of the H-bonding network modulating Molybdenum's redox properties on details of a putative inorganic metabolism at life's origin are discussed. PMID:27207587

  7. Remodulation of central carbon metabolic pathway in response to arsenite exposure in Rhodococcus sp. strain NAU‐1

    PubMed Central

    Jain, Raina; Adhikary, Hemanta; Jha, Sanjay; Jha, Anamika; Kumar, G. Naresh

    2012-01-01

    Summary Arsenite‐tolerant bacteria were isolated from an organic farm of Navsari Agricultural University (NAU), Gujarat, India (Latitude: 20°55′39.04″N; Longitude: 72°54′6.34″E). One of the isolates, NAU‐1 (aerobic, Gram‐positive, non‐motile, coccobacilli), was hyper‐tolerant to arsenite (AsIII, 23 mM) and arsenate (AsV, 180 mM). 16S rRNA gene of NAU‐1 was 99% similar to the 16S rRNA genes of Rhodococcus (Accession No. HQ659188). Assays confirmed the presence of membrane bound arsenite oxidase and cytoplasmic arsenate reductase in NAU‐1. Genes for arsenite transporters (arsB and ACR3(1)) and arsenite oxidase gene (aoxB) were confirmed by PCR. Arsenite oxidation and arsenite efflux genes help the bacteria to tolerate arsenite. Specific activities of antioxidant enzymes (catalase, ascorbate peroxidase, superoxide dismutase and glutathione S‐transferase) increased in dose‐dependent manner with arsenite, whereas glutathione reductase activity decreased with increase in AsIII concentration. Metabolic studies revealed that Rhodococcus NAU‐1 produces excess of gluconic and succinic acids, and also activities of glucose dehydrogenase, phosphoenol pyruvate carboxylase and isocitrate lyase were increased, to cope with the inhibited activities of glucose‐6‐phosphate dehydrogenase, pyruvate dehydrogenase and α‐ketoglutarate dehydrogenase enzymes respectively, in the presence of AsIII. Enzyme assays revealed the increase in direct oxidative and glyoxylate pathway in Rhodococcus NAU‐1 in the presence of AsIII. PMID:23062201

  8. Characterization of arsenite tolerant Halomonas sp. Alang-4, originated from heavy metal polluted shore of Gulf of Cambay.

    PubMed

    Jain, Raina; Jha, Sanjay; Mahatma, Mahesh K; Jha, Anamika; Kumar, G Naresh

    2016-01-01

    Arsenite [As(III)]-oxidizing bacteria were isolated from heavy metal contaminated shore of Gulf of Cambay at Alang, India. The most efficient bacterial strain Alang-4 could tolerate up to 15 mM arsenite [As(III)] and 200 mM of arsenate [As(V)]. Its 16S rRNA gene sequence was 99% identical to the 16S rRNA genes of genus Halomonas (Accession no. HQ659187). Arsenite oxidase enzyme localized on membrane helped in conversion of As(III) to As(V). Arsenite transporter genes (arsB, acr3(1) and acr3(2)) assisted in extrusion of arsenite from Halomonas sp. Alang-4. Generation of ROS in response to arsenite stress was alleviated by higher activities of catalase, ascorbate peroxidase, superoxide dismutase and glutathione S-transferase enzymes. Down-regulation in the specific activities of nearly all dehydrogenases of carbon assimilatory pathway viz., glucose-6-phosphate, pyruvate, α-ketoglutarate, isocitrate and malate dehydrogenases, was observed in presence of As(III), whereas, the specific activities of phosphoenol pyruvate carboxylase, pyruvate carboxylase and isocitrate lyase enzymes were found to increase two times in As(III) treated cells. The results suggest that in addition to efficient ars operon, alternative pathways of carbon utilization exist in the marine bacterium Halomonas sp. Alang-4 to overcome the toxic effects of arsenite on its dehydrogenase enzymes. PMID:26865328

  9. Coordinated regulation of Nrf2 and histone H3 serine 10 phosphorylation in arsenite-activated transcription of the human heme oxygenase-1 gene.

    PubMed

    Ray, Paul D; Huang, Bo-Wen; Tsuji, Yoshiaki

    2015-10-01

    Expression of the antioxidant gene heme oxygenase-1 (HO-1) is primarily induced through NF-E2-related factor 2 (Nrf2)-mediated activation of the antioxidant response element (ARE). Gene transcription is coordinately regulated by transcription factor activity at enhancer elements and epigenetic alterations such as the posttranslational modification of histone proteins. However, the role of histone modifications in the Nrf2-ARE axis remains largely uncharacterized. The environmental contaminant arsenite is a potent inducer of both HO-1 expression and phosphorylation of histone H3 serine 10 (H3S10); therefore, we investigated the relationships between Nrf2 and H3S10 phosphorylation in arsenite-induced, ARE-dependent, transcriptional activation of the human HO-1 gene. Arsenite increased phosphorylation of H3S10 both globally and at the HO-1 promoter concomitantly with HO-1 transcription in human HaCaT keratinocytes. Conversely, arsenite-induced H3S10 phosphorylation and HO-1 expression were blocked by N-acetylcysteine (NAC), the c-Jun N-terminal kinase (JNK) inhibitor SP600125, and JNK knockdown (siJNK). Interestingly, ablation of arsenite-induced H3S10 phosphorylation by SP600125 or siJNK did not inhibit Nrf2 nuclear accumulation nor ARE binding, despite inhibiting HO-1 expression. In response to arsenite, binding of Nrf2 to the HO-1 ARE preceded phosphorylation of H3S10 at the HO-1 ARE. Furthermore, arsenite-mediated occupancy of phosphorylated H3S10 at the HO-1 ARE was decreased in Nrf2-deficient mouse embryonic fibroblasts. These results suggest the involvement of H3S10 phosphorylation in the Nrf2-ARE axis by proposing that Nrf2 may influence H3S10 phosphorylation at the HO-1 ARE and additional promoter regions. Our data highlights the complex interplay between Nrf2 and H3S10 phosphorylation in arsenite-activated HO-1 transcription. PMID:26291278

  10. Contributions of reactive oxygen species and mitogen-activated protein kinase signaling in arsenite-stimulated hemeoxygenase-1 production

    SciTech Connect

    Cooper, Karen L.; Liu, Ke Jian; Hudson, Laurie G. . E-mail: lhudson@salud.unm.edu

    2007-01-15

    Hemeoxygenase-1 (HO-1) is an oxidative stress responsive gene upregulated by various physiological and exogenous stimuli. HO-1 has cytoprotective activities and arsenite is a potent inducer of HO-1 in many cell types and tissues, including epidermal keratinocytes. We investigated the potential contributions of reactive oxygen species (ROS) generation and mitogen-activated protein kinase (MAPK) activation to arsenite-dependent regulation of HO-1 in HaCaT cells, an immortalized human keratinocyte line. Both epidermal growth factor (EGF) and arsenite stimulated ROS production was detected by dihydroethidium (DHE) staining and fluorescence microscopy. Arsenite induced HO-1 in a time- and concentration-dependent manner, while HO-1 expression in response to EGF was modest and evident at extended time points (48-72 h). Inhibition of EGF receptor, MEK I/II or Src decreased arsenite-stimulated HO-1 expression by 20-30%. In contrast, addition of a superoxide scavenger or inhibition of p38 activity decreased the arsenite-dependent response by 80-90% suggesting that ROS and p38 are required for HO-1 induction. However, ROS generation alone was insufficient for the observed arsenite-dependent response as use of a xanthine/xanthine oxidase system to generate ROS did not produce an equivalent upregulation of HO-1. Cooperation between ERK signaling and ROS generation was demonstrated by synergistic induction of HO-1 in cells co-treated with EGF and xanthine/xanthine oxidase resulting in a response nearly equivalent to that observed with arsenite. These findings suggest that the ERK/MAPK activation is necessary but not sufficient for optimal arsenite-stimulated HO-1 induction. The robust and persistent upregulation of HO-1 may have a role in cellular adaptation to chronic arsenic exposure.

  11. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.

    PubMed

    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N

    1999-04-21

    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a

  12. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  13. Arsenite oxidation by the phyllosphere bacterial community associated with Wolffia australiana.

    PubMed

    Xie, Wan-Ying; Su, Jian-Qiang; Zhu, Yong-Guan

    2014-08-19

    Speciation is a key determinant in the toxicity, behavior, and fate of arsenic (As) in the environment. However, little is known about the transformation of As species mediated by floating macrophytes and the phyllosphere bacteria in aquatic and wetland environment. In this study, Wolffia australiana, a rootless floating duckweed, was cultured with (W+B) or without (W-B) phyllosphere bacteria to investigate its ability in arsenite (As(III)) oxidation. Results showed that sterile W. australiana did not oxidize As(III) in the growth medium or in plant tissue, whereas W. australiana with phyllpsphere bacteria displayed substantial As(III) oxidation in the medium. Quantitative PCR of As redox-related functional genes revealed the dominance of the arsenite oxidase (aioA) gene in the phyllosphere bacterial community. These results demonstrate that the phyllosphere bacteria were responsible for the As(III) oxidation in the W+B system. The rapid oxidation of As(III) by the phyllosphere bacterial community may suppress As accumulation in plant tissues under phosphate rich conditions. The aioA gene library showed that the majority of the phyllosphere arsenite-oxidizing bacteria related either closely to unidentified bacteria found in paddy environments or distantly to known arsenite-oxidizing bacteria. Our research suggests a previously overlooked diversity of arsenite-oxidizing bacteria in the phyllosphere of aquatic macrophytes which may have a substantial impact on As biogeochemistry in water environments, warranting further exploration. PMID:25079094

  14. Effects of Arsenite Resistance on the Growth and Functional Gene Expression of Leptospirillum ferriphilum and Acidithiobacillus thiooxidans in Pure Culture and Coculture

    PubMed Central

    Jiang, Huidan; Liang, Yili; Yin, Huaqun; Xiao, Yunhua; Guo, Xue; Xu, Ying; Hu, Qi; Liu, Hongwei; Liu, Xueduan

    2015-01-01

    The response of iron-oxidizing Leptospirillum ferriphilum YSK and sulfur-oxidizing Acidithiobacillus thiooxidans A01 to arsenite under pure culture and coculture was investigated based on biochemical characterization (concentration of iron ion and pH value) and related gene expression. L. ferriphilum YSK and At. thiooxidans A01 in pure culture could adapt up to 400 mM and 800 mM As(III) after domestication, respectively, although arsenite showed a negative effect on both strains. The coculture showed a stronger sulfur and ferrous ion oxidation activity when exposed to arsenite. In coculture, the pH value showed no significant difference when under 500 mM arsenite stress, and the cell number of At. thiooxidans was higher than that in pure culture benefiting from the interaction with L. ferriphilum. The expression profile showed that the arsenic efflux system in the coculture was more active than that in pure culture, indicating that there is a synergetic interaction between At. thiooxidans A01 and L. ferriphilum YSK. In addition, a model was proposed to illustrate the interaction between arsenite and the ars operon in L. ferriphilum YSK and At. thiooxidans A01. This study will facilitate the effective application of coculture in the bioleaching process by taking advantage of strain-strain communication and coordination. PMID:26064886

  15. Effects of Arsenite Resistance on the Growth and Functional Gene Expression of Leptospirillum ferriphilum and Acidithiobacillus thiooxidans in Pure Culture and Coculture.

    PubMed

    Jiang, Huidan; Liang, Yili; Yin, Huaqun; Xiao, Yunhua; Guo, Xue; Xu, Ying; Hu, Qi; Liu, Hongwei; Liu, Xueduan

    2015-01-01

    The response of iron-oxidizing Leptospirillum ferriphilum YSK and sulfur-oxidizing Acidithiobacillus thiooxidans A01 to arsenite under pure culture and coculture was investigated based on biochemical characterization (concentration of iron ion and pH value) and related gene expression. L. ferriphilum YSK and At. thiooxidans A01 in pure culture could adapt up to 400 mM and 800 mM As(III) after domestication, respectively, although arsenite showed a negative effect on both strains. The coculture showed a stronger sulfur and ferrous ion oxidation activity when exposed to arsenite. In coculture, the pH value showed no significant difference when under 500 mM arsenite stress, and the cell number of At. thiooxidans was higher than that in pure culture benefiting from the interaction with L. ferriphilum. The expression profile showed that the arsenic efflux system in the coculture was more active than that in pure culture, indicating that there is a synergetic interaction between At. thiooxidans A01 and L. ferriphilum YSK. In addition, a model was proposed to illustrate the interaction between arsenite and the ars operon in L. ferriphilum YSK and At. thiooxidans A01. This study will facilitate the effective application of coculture in the bioleaching process by taking advantage of strain-strain communication and coordination. PMID:26064886

  16. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  17. Four novel mutations of the coproporphyrinogen III oxidase gene.

    PubMed

    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

    2009-01-01

    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  18. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  19. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

    PubMed

    Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

    2015-10-01

    Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish. PMID:26057477

  20. Biotransformation of arsenite and bacterial aox activity in drinking water produced from surface water of floating houses: Arsenic contamination in Cambodia.

    PubMed

    Chang, Jin-Soo

    2015-11-01

    The potential arsenite bioteansformation activity of arsenic was investigated by examining bacterial arsenic arsenite-oxidizing gene such as aoxS, aoxR, aoxA, aoxB, aoxC, and aoxD in high arsenic-contaminated drinking water produced from the surface water of floating houses. There is a biogeochemical cycle of activity involving arsenite oxidase aox system and the ars (arsenic resistance system) gene operon and aoxR leader gene activity in Alcaligenes faecalis SRR-11 and aoxS leader gene activity in Achromobacter xylosoxidans TSL-66. Batch experiments showed that SRR-11 and TSL-66 completely oxidized 1 mM of As (III) to As (V) within 35-40 h. The leaders of aoxS and aoxR are important for gene activity, and their effects in arsenic bioremediation and mobility in natural water has a significant ecological role because it allows arsenite oxidase in bacteria to control the biogeochemical cycle of arsenic-contaminated drinking water produced from surface water of floating houses. PMID:26219073

  1. Evolution of the primate cytochrome c oxidase subunit II gene.

    PubMed

    Adkins, R M; Honeycutt, R L

    1994-03-01

    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  2. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation

    PubMed Central

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D. P.

    2009-01-01

    Monoamine oxidase A gene (MAOA) has earned the nickname “warrior gene” because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as “altruistic” punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  3. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  4. Diversity of arsenite oxidizing bacterial communities in arsenic-rich deltaic aquifers in West Bengal, India

    PubMed Central

    Ghosh, Devanita; Bhadury, Punyasloke; Routh, Joyanto

    2014-01-01

    High arsenic (As) concentration in groundwater has affected human health, particularly in South-East Asia putting millions of people at risk. Biogeochemical cycling of As carried out by different bacterial groups are suggested to control the As fluxes in aquifers. A functional diversity approach in link with As precipitation was adopted to study bacterial community structures and their variation within the As contaminated Bengal Delta Plain (BDP) aquifers of India. Groundwater samples collected from two shallow aquifers in Karimpur II (West Bengal, India), during years 2010 and 2011, were investigated to trace the effects immediately after monsoon period (precipitation) on community structure and diversity of bacterial assemblages with a focus on arsenite oxidizing bacterial phyla for two successive years. The study focused on amplification, clone library generation and sequencing of the arsenite oxidase large sub-unit gene aioA and 16S rRNA marker, with respect to changes in elemental concentrations. New set of primers were designed to amplify the aioA gene as a phylogenetic marker to study taxonomically diverse arsenite oxidizing bacterial groups in these aquifers. The overall narrow distribution of bacterial communities based on aioA and 16S rRNA sequences observed was due to poor nutrient status and anoxic conditions in these As contaminated aquifers. Proteobacteria was the dominant phylum detected, within which Acidovorax, Hydrogenophaga, Albidiferax, Bosea, and Polymorphum were the major arsenite oxidizing bacterial genera based on the number of clones sequenced. The structure of bacterial assemblages including those of arsenite oxidizing bacteria seems to have been affected by increase in major elemental concentrations (e.g., As, Fe, S, and Si) within two sampling sessions, which was supported by statistical analyses. One of the significant findings of this study is detection of novel lineages of 16S rRNA-like bacterial sequences indicating presence of

  5. Family-based association study of the arsenite methyltransferase gene (AS3MT, rs11191454) in Korean children with attention-deficit hyperactivity disorder.

    PubMed

    Park, Subin; Park, Jong-Eun; Yoo, Hee Jeong; Kim, Jae-Won; Cho, Soo-Churl; Shin, Min-Sup; Cheong, Jae Hoon; Han, Doug Hyun; Kim, Bung-Nyun

    2015-02-01

    We examined the association between the selected polymorphisms in two candidate genes, the arsenite methyltransferase gene (AS3MT, rs11191454) and the inter-α-trypsin inhibitors heavy chain-3 gene (ITIH3, rs2535629), and attention-deficit hyperactivity disorder (ADHD) in a Korean population. A total of 238 patients with ADHD, along with both of their biological parents, were recruited. The children were administered intelligence quotient tests, whereas their parents completed the Child Behavior Checklist. In the transmission disequilibrium test on 181 trios, we found overtransmission of the A allele at the AS3MT rs11191454 polymorphism in children with ADHD (χ²=8.81, P=0.003). However, there was no preferential transmission at the ITIH3 rs52535629 polymorphism (χ²=0.14, P=0.707). Our results provide preliminary evidence for the overtransmission of the A allele at the AS3MT rs11191454 polymorphism in ADHD. PMID:25461954

  6. The expression of lysyl-oxidase gene family members in myeloproliferative neoplasms.

    PubMed

    Tadmor, T; Bejar, J; Attias, D; Mischenko, E; Sabo, E; Neufeld, G; Vadasz, Z

    2013-05-01

    Myeloproliferative neoplasms (MPNs) are malignant disorders originating from clonal expansion of a single neoplastic stem cell and characteristically show an increase in bone marrow reticulin fibers. Lysyl oxidases (LOXs) are copper-dependent amine oxidases that play a critical role in the biogenesis of connective tissue by crosslinking extracellular matrix proteins, collagen and elastin. Expression of LOX gene family members is increased in disorders associated with increased fibrosis. To evaluate involvement of LOX gene family in various MPNs. In-situ hybridization was used to detect Lysyl-Oxidase family members in bone marrow biopsies from patients with different MPNs. We compared normal bone marrows and those from patients with polycythemia vera, essential thrombocythemia, chronic myeloid leukemia, and primary myelofibrosis (PMF). Serum levels of lysyl-oxidase from patients with PMF and healthy controls were also examined. LOX gene family was not detected in normal bone marrows. All members of the LOX gene family were over expressed in PMF. In other MPNs a differential pattern of expression was observed. Differences in gene expression were statistically significant (P < 0.010). The medianserum LOX levels in normal controls was 28.4 ± 2.5 ng\\ml and 44.6 ± 9.44 ng\\ml in PMF (P = 0.02). The varying pattern of expression of LOX genes may reflect differences in the pathophysiology of bone marrow fibrosis in these MPNs. These observations could be used as the basis for future targeted therapy directed against bone marrow fibrosis. PMID:23494965

  7. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development. PMID:24374939

  8. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

  9. Comparative Functional Genomic Analysis Identifies Distinct and Overlapping Sets of Genes Required for Resistance to Monomethylarsonous Acid (MMAIII) and Arsenite (AsIII) in Yeast

    PubMed Central

    Jo, William J.; Loguinov, Alex; Wintz, Henri; Chang, Michelle; Smith, Allan H.; Kalman, Dave; Zhang, Luoping; Smith, Martyn T.; Vulpe, Chris D.

    2009-01-01

    Arsenic is a human toxin and carcinogen commonly found as a contaminant in drinking water. Arsenite (AsIII) is the most toxic inorganic form, but recent evidence indicates that the metabolite monomethylarsonous acid (MMAIII) is even more toxic. We have used a chemical genomics approach to identify the genes that modulate the cellular toxicity of MMAIII and AsIII in the yeast Saccharomyces cerevisiae. Functional profiling using homozygous deletion mutants provided evidence of the requirement of highly conserved biological processes in the response against both arsenicals including tubulin folding, DNA double-strand break repair, and chromatin modification. At the equitoxic doses of 150μM MMAIII and 300μM AsIII, genes related to glutathione metabolism were essential only for resistance to the former, suggesting a higher potency of MMAIII to disrupt glutathione metabolism than AsIII. Treatments with MMAIII induced a significant increase in glutathione levels in the wild-type strain, which correlated to the requirement of genes from the sulfur and methionine metabolic pathways and was consistent with the induction of oxidative stress. Based on the relative sensitivity of deletion strains deficient in GSH metabolism and tubulin folding processes, oxidative stress appeared to be the primary mechanism of MMAIII toxicity whereas secondary to tubulin disruption in the case of AsIII. Many of the identified yeast genes have orthologs in humans that could potentially modulate arsenic toxicity in a similar manner as their yeast counterparts. PMID:19635755

  10. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel

    1983-01-01

    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  11. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  12. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  13. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  14. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  15. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  16. Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

    PubMed Central

    Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

    2001-01-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  17. Production of dwarf lettuce by overexpressing a pumpkin gibberellin 20-oxidase gene.

    PubMed

    Niki, T; Nishijima, T; Nakayama, M; Hisamatsu, T; Oyama-Okubo, N; Yamazaki, H; Hedden, P; Lange, T; Mander, L N; Koshioka, M

    2001-07-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2-35S-Omega). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T(2) generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T(2) generation, indicating that the transgene was stable and dominant. The endogenous levels of GA(1) and GA(4) were reduced in the dwarfs, whereas large amounts of GA(17) and GA(25), which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  18. Characterization of two peanut oxalate oxidase genes and development of peanut cultivars resistant to stem rot (Sclerotium rolfsii)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

  19. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  20. In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes

    PubMed Central

    Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.

    2014-01-01

    NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

  1. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  2. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.

    PubMed

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-12-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  3. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-01-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  4. Arsenite suppression of BMP signaling in human keratinocytes

    SciTech Connect

    Phillips, Marjorie A.; Qin, Qin; Hu, Qin; Zhao, Bin; Rice, Robert H.

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  5. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  6. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.

    PubMed

    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N

    1995-12-01

    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  7. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  8. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  9. Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

  10. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  11. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  12. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  13. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  14. DOES RESPONSE EVALUATION OF GENE EXPRESSION PROFILES IN THE SKIN OF K6/ODC MICE EXPOSED TO SODIUM ARSENITE

    EPA Science Inventory

    Abstract - Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles were characterized fro...

  15. Characterization of Rice NADPH Oxidase Genes and Their Expression under Various Environmental Conditions

    PubMed Central

    Wang, Gang-Feng; Li, Wen-Qiang; Li, Wen-Yan; Wu, Guo-Li; Zhou, Cong-Yi; Chen, Kun-Ming

    2013-01-01

    Plasma membrane NADPH oxidases (Noxs) are key producers of reactive oxygen species under both normal and stress conditions in plants. We demonstrate that at least eleven genes in the genome of rice (Oryza sativa L.) were predicted to encode Nox proteins, including nine genes (OsNox1–9) that encode typical Noxs and two that encode ancient Nox forms (ferric reduction oxidase 1 and 7, OsFRO1 and OsFRO7). Phylogenetic analysis divided the Noxs from nine plant species into six subfamilies, with rice Nox genes distributed among subfamilies I to V. Gene expression analysis using semi-quantitative RT-PCR and real-time qRT-PCR indicated that the expression of rice Nox genes depends on organs and environmental conditions. Exogenous calcium strongly stimulated the expression of OsNox3, OsNox5, OsNox7, and OsNox8, but depressed the expression of OsFRO1. Drought stress substantially upregulated the expression of OsNox1–3, OsNox5, OsNox9, and OsFRO1, but downregulated OsNox6. High temperature upregulated OsNox5–9, but significantly downregulated OsNox1–3 and OsFRO1. NaCl treatment increased the expression of OsNox2, OsNox8, OsFRO1, and OsFRO7, but decreased that of OsNox1, OsNox3, OsNox5, and OsNox6. These results suggest that the expression profiles of rice Nox genes have unique stress-response characteristics, reflecting their related but distinct functions in response to different environmental stresses. PMID:23629674

  16. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.

    PubMed

    Pu, Xiao-jun; Lv, Xin; Lin, Hong-hui

    2015-11-01

    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors--WRKY, NAC, bZIP and MYB--are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  17. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.

    PubMed

    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S

    2003-01-21

    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  18. A New Chemolithoautotrophic Arsenite-Oxidizing Bacterium Isolated from a Gold Mine: Phylogenetic, Physiological, and Preliminary Biochemical Studies

    PubMed Central

    Santini, Joanne M.; Sly, Lindsay I.; Schnagl, Roger D.; Macy, Joan M.

    2000-01-01

    A previously unknown chemolithoautotrophic arsenite-oxidizing bacterium has been isolated from a gold mine in the Northern Territory of Australia. The organism, designated NT-26, was found to be a gram-negative motile rod with two subterminal flagella. In a minimal medium containing only arsenite as the electron donor (5 mM), oxygen as the electron acceptor, and carbon dioxide-bicarbonate as the carbon source, the doubling time for chemolithoautotrophic growth was 7.6 h. Arsenite oxidation was found to be catalyzed by a periplasmic arsenite oxidase (optimum pH, 5.5). Based upon 16S rDNA phylogenetic sequence analysis, NT-26 belongs to the Agrobacterium/Rhizobium branch of the α-Proteobacteria and may represent a new species. This recently discovered organism is the most rapidly growing chemolithoautotrophic arsenite oxidizer known. PMID:10618208

  19. Arsenite oxidizing multiple metal resistant bacteria isolated from industrial effluent: their potential use in wastewater treatment.

    PubMed

    Naureen, Ayesha; Rehman, Abdul

    2016-08-01

    Arsenite oxidizing bacteria, isolated from industrial wastewater, showed high resistance against arsenite (40 mM) and other heavy metals (10 mM Pb; 8 mM Cd; 6 mM Cr; 10 mM Cu and 26.6 mM As(5+)). Bacterial isolates were characterized, on the basis of morphological, biochemical and 16S rRNA ribotyping, as Bacillus cereus (1.1S) and Acinetobacter junii (1.3S). The optimum temperature and pH for the growth of both strains were found to be 37 °C and 7. Both the strains showed maximum growth after 24 h of incubation. The predominant form of arsenite oxidase was extracellular in B. cereus while in A. junii both types of activities, intracellular and extracellular, were found. The extracellular aresenite oxidase activity was found to be 730 and 750 µM/m for B. cereus and A. junii, respectively. The arsenite oxidase from both bacterial strains showed maximum activity at 37 °C, pH 7 and enhanced in the presence of Zn(2+). The presence of two protein bands with molecular weight of approximately 70 and 14 kDa in the presence of arsenic points out a possible role in arsenite oxidation. Arsenite oxidation potential of B. cereus and A. junii was determined up to 92 and 88 % in industrial wastewater after 6 days of incubation. The bacterial treated wastewater improved the growth of Vigna radiata as compared to the untreated wastewater. It indicates that these bacterial strains may find some potential applications in wastewater treatment systems to transform toxic arsenite into less toxic form, arsenate. PMID:27339314

  20. Anaerobic arsenite oxidation by an autotrophic arsenite-oxidizing bacterium from an arsenic-contaminated paddy soil.

    PubMed

    Zhang, Jun; Zhou, Wuxian; Liu, Bingbing; He, Jian; Shen, Qirong; Zhao, Fang-Jie

    2015-05-19

    Microbe-mediated arsenic (As) redox reactions play an important role in the biogeochemical cycling of As. Reduction of arsenate [As(V)] generally leads to As mobilization in paddy soils and increased As availability to rice plants, whereas oxidation of arsenite [As(III)] results in As immobilization. A novel chemoautotrophic As(III)-oxidizing bacterium, designated strain SY, was isolated from an As-contaminated paddy soil. The isolate was able to derive energy from the oxidation of As(III) to As(V) under both aerobic and anaerobic conditions using O2 or NO3(-) as the respective electron acceptor. Inoculation of the washed SY cells into a flooded soil greatly enhanced As(III) oxidation to As(V) both in the solution and adsorbed phases of the soil. Strain SY is phylogenetically closely related to Paracoccus niistensis with a 16S rRNA gene similarity of 96.79%. The isolate contains both the denitrification and ribulose 1,5-bisphosphate carboxylase/oxygenase gene clusters, underscoring its ability to denitrify and to fix CO2 while coupled to As(III) oxidation. Deletion of the aioA gene encoding the As(III) oxidase subunit A abolished the As(III) oxidation ability of strain SY and led to increased sensitivity to As(III), suggesting that As(III) oxidation is a detoxification mechanism in this bacterium under aerobic and heterotrophic growth conditions. Analysis of the aioA gene clone library revealed that the majority of the As(III)-oxidizing bacteria in the soil were closely related to the genera Paracoccus of α-Proteobacteria. Our results provide direct evidence for As(III) oxidation by Paracoccus species and suggest that these species may play an important role in As(III) oxidation in paddy soils under both aerobic and denitrifying conditions. PMID:25905768

  1. Identification of a nitroalkane oxidase gene: naoA related to the growth of Streptomyces ansochromogenes.

    PubMed

    Li, Yanhua; Zhang, Jihui; Tan, Huarong

    2008-12-01

    naoA, encoding a nitroalkane oxidase that can catalyze toxic nitroalkanes to their corresponding aldehydes or ketones and hydrogen peroxide, was cloned from Streptomyces ansochromogenes, but its function related to the growth of Streptomyces is unknown. naoA was disrupted by the insertion of a kanamycin-resistance gene; the resulting strain can grow earlier than a wild-type strain under the same conditions. It was shown that naoA disruption accelerated growth of the naoA-disruption mutant, which could restore its phenotype and morphology as a wild-type strain by complementation of a single copy number of naoA inserted into the chromosome. The introduction of an extra copy of naoA into the wild-type strain resulted in delayed growth. The result suggested that naoA is an important gene related to the growth of S. ansochromogenes. PMID:18810541

  2. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M

    1998-01-01

    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  3. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  4. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  6. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  7. Bigenomic transcriptional regulation of all thirteen cytochrome c oxidase subunit genes by specificity protein 1

    PubMed Central

    Dhar, Shilpa S.; Johar, Kaid; Wong-Riley, Margaret T. T.

    2013-01-01

    Cytochrome c oxidase (COX) is one of only four known bigenomic proteins, with three mitochondria-encoded subunits and 10 nucleus-encoded ones derived from nine different chromosomes. The mechanism of regulating this multi-subunit, bigenomic enzyme is not fully understood. We hypothesize that specificity protein 1 (Sp1) functionally regulates the 10 nucleus-encoded COX subunit genes directly and the three mitochondrial COX subunit genes indirectly by regulating mitochondrial transcription factors A and B (TFAM, TFB1M and TFB2M) in neurons. By means of in silico analysis, electrophoretic mobility shift and supershift assays, chromatin immunoprecipitation, RNA interference and over-expression experiments, the present study documents that Sp1 is a critical regulator of all 13 COX subunit genes in neurons. This regulation is intimately associated with neuronal activity. Silencing of Sp1 prevented the upregulation of all COX subunits by KCl, and over-expressing Sp1 rescued all COX subunits from being downregulated by tetrodotoxin. Thus, Sp1 and our previously described nuclear respiratory factors 1 and 2 are the three key regulators of all 13 COX subunit genes in neurons. The binding sites for Sp1 on all 10 nucleus-encoded COX subunits, TFAM, TFB1M and TFB2M are highly conserved among mice, rats and humans. PMID:23516108

  8. Kinetics of arsenite removal by halobacteria from a highland Andean Chilean Salar

    PubMed Central

    2013-01-01

    Background The purpose of this study was to identify arsenite-oxidizing halobacteria in samples obtained from Salar de Punta Negra, II Region of Chile. Seven bacterial isolates, numbered as isolates I to VII, grown in a culture medium with 100 ppm as NaAsO2 (As (III)) were tested. Bacterial growth kinetics and the percent of arsenite removal (PAR) were performed simultaneously with the detection of an arsenite oxidase enzyme through Dot Blot analysis. Results An arsenite oxidase enzyme was detected in all isolates, expressed constitutively after 10 generations grown in the absence of As (III). Bacterial growth kinetics and corresponding PAR values showed significant fluctuations over time. PARs close to 100% were shown by isolates V, VI, and VII, at different times of the bacterial growth phase; while isolate II showed PAR values around 40%, remaining constant over time. Conclusion Halobacteria from Salar de Punta Negra showed promising properties as arsenite removers under control conditions, incubation time being a critical parameter. PMID:23547876

  9. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  10. cDNA cloning and gene expression of ascorbate oxidase in tobacco.

    PubMed

    Kato, N; Esaka, M

    1996-02-01

    A cDNA clone for ascorbate oxidase (AAO) has been isolated from a cDNA library of tobacco (Nicotiana tabacum) cells. The identity of the amino acid sequence deduced from tobacco AAO cDNA to that from pumpkin AAO cDNA was 68%, which was much lower than the identity (80%) between pumpkin and cucumber AAO. AAO activity in tobacco cells was much lower than that in pumpkin cells, whereas the immunoreactive protein in tobacco cells was more abundant than that in pumpkin cells. We suppose that AAO protein in tobacco cells may be less active than that in pumpkin cells. Genomic Southern blotting suggested that AAO in tobacco was encoded by a single-copy gene. Nothern blotting revealed that mRNA of AAO was highly expressed in young and growing tissues of tobacco plant. PMID:8624413

  11. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  12. Cloning and Characterization of Three Fatty Alcohol Oxidase Genes from Candida tropicalis Strain ATCC 20336

    PubMed Central

    Eirich, L. Dudley; Craft, David L.; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H.; Stols, Lucy; Donnelly, Mark I.; Wilson, C. Ron

    2004-01-01

    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of ω-hydroxy fatty acids to ω-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and Km values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes ω-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not ω-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the Km values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  13. Arsenite and insulin exhibit opposing effects on epidermal growth factor receptor and keratinocyte proliferative potential

    SciTech Connect

    Patterson, Timothy J.; Rice, Robert H. . E-mail: rhrice@ucdavis.edu

    2007-05-15

    Previous work has suggested that arsenic exposure contributes to skin carcinogenesis by preserving the proliferative potential of human epidermal keratinocytes, thereby slowing the exit of putative target stem cells into the differentiation pathway. To find a molecular basis for this action, present work has explored the influence of arsenite on keratinocyte responses to epidermal growth factor (EGF). The ability of cultured keratinocytes to found colonies upon passaging several days after confluence was preserved by arsenite and EGF in an additive fashion, but neither was effective when the receptor tyrosine kinase activity was inhibited. Arsenite prevented the loss of EGF receptor protein and phosphorylation of tyrosine 1173, preserving its capability to signal. The level of nuclear {beta}-catenin was higher in cells treated with arsenite and EGF in parallel to elevated colony forming ability, and expression of a dominant negative {beta}-catenin suppressed the increase in both colony forming ability and yield of putative stem cells induced by arsenite and EGF. As judged by expression of three genes regulated by {beta}-catenin, this transcription factor had substantially higher activity in the arsenite/EGF-treated cells. Trivalent antimony exhibited the same effects as arsenite. A novel finding is that insulin in the medium induced the loss of EGF receptor protein, which was largely prevented by arsenite exposure.

  14. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

    PubMed

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  15. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  16. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.

    PubMed

    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury

    2016-08-01

    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  17. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  18. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  19. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 μM/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 μM/min and Km (NADH) 51.3 μM, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  20. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  1. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  2. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  3. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  4. The Involvement of Gibberellin 20-Oxidase Genes in Phytochrome-Regulated Petiole Elongation of Arabidopsis

    PubMed Central

    Hisamatsu, Tamotsu; King, Rod W.; Helliwell, Chris A.; Koshioka, Masaji

    2005-01-01

    Long day (LD) exposure of rosette plants causes rapid stem/petiole elongation, a more vertical growth habit, and flowering; all changes are suggestive of a role for the gibberellin (GA) plant growth regulators. For Arabidopsis (Arabidopsis thaliana) L. (Heynh), we show that enhancement of petiole elongation by a far-red (FR)-rich LD is mimicked by a brief (10 min) end-of-day (EOD) FR exposure in short day (SD). The EOD response shows red (R)/FR photoreversibility and is not affected in a phytochrome (PHY) A mutant so it is mediated by PHYB and related PHYs. FR photoconversion of PHYB to an inactive form activates a signaling pathway, leading to increased GA biosynthesis. Of 10 GA biosynthetic genes, expression of the 20-oxidase, AtGA20ox2, responded most to FR (up to a 40-fold increase within 3 h). AtGA20ox1 also responded but to a lesser extent. Stimulation of petiole elongation by EOD FR is reduced in a transgenic AtGA20ox2 hairpin gene silencing line. By contrast, it was only in SD that a T-DNA insertional mutant of AtGA20ox1 (ga5-3) showed reduced response. Circadian entrainment to a daytime pattern provides an explanation for the SD expression of AtGA20ox1. Conversely, the strong EOD/LD FR responses of AtGA20ox2 may reflect its independence of circadian regulation. While FR acting via PHYB increases expression of AtGA20ox2, other GA biosynthetic genes are known to respond to R rather than FR light and/or to other PHYs. Thus, there must be different signal transduction pathways, one at least showing a positive response to active PHYB and another showing a negative response. PMID:15923331

  5. Arsenic-tolerant, arsenite-oxidising bacterial strains in the contaminated soils of West Bengal, India.

    PubMed

    Majumder, Aparajita; Bhattacharyya, K; Bhattacharyya, S; Kole, S C

    2013-10-01

    As biological agents represent an affordable alternative to costly metal decontamination technologies, we isolated arsenic (As) oxidising bacteria from the As-contaminated soils of West Bengal, India. These strains were closely related to various species of Bacillus and Geobacillus based on their 16S rRNA gene sequences. They were found to be hyper-resistant to both As(V) (167-400 mM) and As(III) (16-47 mM). Elevated rates of As(III) oxidation (278-1250 μM h(-1)) and arsenite oxidase activity (2.1-12.5 nM min(-1) mg(-1) protein) were observed in these isolates. Screening identified four strains as superior As-oxidisers. Among them, AMO-10 completely (100%) oxidised 30 mM of As(III) within 24 h. The presence of the aoxB gene was confirmed in the screened isolates. Phylogenetic tree construction based on the aoxB sequence revealed that two strains, AGO-S5 and AGH-02, clustered with Achromobacter and Variovorax, whereas the other two (AMO-10 and ADP-25) remained unclustered. The increased rate of As(III) oxidation by these native strains might be exploited for the remediation of As in contaminated environments. Notably, this study presents the first correlation regarding the presence of the aoxB gene and As(III) oxidation ability in Geobacillus stearothermophilus. PMID:23876545

  6. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  7. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis.

    PubMed

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-05-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  8. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  9. Mitochondrial Cytochrome Oxidase I Gene Sequence Analysis of Aedes Albopictus in Malaysia.

    PubMed

    Ismail, Nurul-Ain; Dom, Nazri Che; Ismail, Rodziah; Ahmad, Abu Hassan; Zaki, Afiq; Camalxaman, Siti Nazrina

    2015-12-01

    A study was conducted to establish polymorphic variation of the mitochondrial DNA encoding the cytochrome oxidase subunit 1 (CO1) gene in Aedes albopictus isolated from 2 hot spot dengue-infested areas in the Subang Jaya District, Malaysia. A phylogenetic analysis was performed with the use of sequences obtained from USJ6 and Taman Subang Mas (TSM). Comparison of the local CO1 sequences with a laboratory strain (USM), alongside reference strains derived from the GenBank database revealed low genetic variation in terms of nucleotide differences and haplotype diversity. Four methods were used to construct a phylogenetic tree and illustrate the genetic relationship of the 37 Ae. albopictus populations based on the CO1 sequences, namely neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian method, which revealed a distinct relationship between isolates from USJ6 and TSM. Our findings provide new information regarding the genetic diversity among morphologically similar Ae. albopictus, which has not been reported to date. PMID:26675451

  10. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  11. Molecular cloning and heterologous expression of the gene encoding dihydrogeodin oxidase, a multicopper blue enzyme from Aspergillus terreus.

    PubMed

    Huang, K X; Fujii, I; Ebizuka, Y; Gomi, K; Sankawa, U

    1995-09-15

    Aspergillus terreus dihydrogeodin oxidase (DHGO) is an enzyme catalyzing the stereospecific phenol oxidative coupling reaction converting dihydrogeodin to (+)- geodin. We previously reported the purification of DHGO from A. terreus and raised polyclonal antibody against DHGO. From the first cDNA library constructed in lambda gt11 using mRNA from 3-day-old mycelium of A. terreus, four clones were identified using anti-DHGO antibody, but all contained partial cDNA inserts around 280 base pairs. This cDNA fragment was used as a probe to clone the genomic DNA and cDNA for dihydrogeodin oxidase from A. terreus. The sequence of the cloned DHGO genomic DNA and cDNA predicted that the DHGO polypeptide consists of 605 amino acids showing significant homology with multicopper blue proteins such as laccase and ascorbate oxidase. Four potential copper binding domains exist in DHGO polypeptide. The DHGO gene consists of seven exons separated by six short introns. Expression of the DHGO gene in Aspergillus nidulans under the starch or maltose-inducible Taka-amylase A promoter as an active enzyme established the functional identity of the gene. Also, introduction of the genomic DNA for DHGO into Penicillium frequentans led to the production of DHGO polypeptide as judged by Western blot analysis. PMID:7665560

  12. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  13. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    PubMed

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants. PMID:27315932

  14. Divergent biochemical and enzymatic properties of oxalate oxidase isoforms encoded by four similar genes in rice.

    PubMed

    Li, Xiao Chun; Liao, Yuan Yang; Leung, David W M; Wang, Hai Yan; Chen, Bai Ling; Peng, Xin Xiang; Liu, E E

    2015-10-01

    The biochemical and enzymatic properties of four highly similar rice oxalate oxidase proteins (OsOxO1-4) were compared after their purification from the leaves of transgenic plants each overexpressing the respective OsOxO1-4 genes. Although alignment of their amino acid sequences has revealed divergence mainly in the signal peptides and they catalyze the same enzymic (oxalate oxidase) reaction, divergence in apparent molecular mass, Km, optimum pH, stability and responses to inhibitors and activators was uncovered by biochemical characterization of the purified OsOxO1-4 proteins. The apparent molecular mass of oligomer OsOxO1 was found to be similar to that of OsOxO3 but lower than the other two. The molecular mass of the subunit of OsOxO1 was lower than that of OsOxO3. The Km value of OsOxO3 was higher than the other three which had similar Km. OsOxO1 and OsOxO4 possessed peak activity at pH 8.5 which was close to that at the optimum pH 4.0. The activity of OsOxO2 at pH 8.5 was only 65% of that at its optimum pH 3.5, while the activity of OsOxO3 did not vary much at pH 6-9 and was also much lower than that at its optimum pH 3. OsOxO2 and OsOxO3 still maintained all their activities after being heated at 70°C for 1h while OsOxO1 and OsOxO4 lost about 30% of their activities. Pyruvate and oxaloacetic acid inhibited the activity of OsOxO3 more strongly than the other three. Interestingly, glucose 6-phosphate, fructose 6-phosphate and fructose 1,6-biphosphate related to photosynthetic assimilation of triose phosphate greatly increased the activities of OsOxO3 and OsOxO4. In addition to the differences in the biochemical properties of the four OsOxO proteins, an intriguing finding is that the purified OsOxO1-4 exhibited substrate inhibition, which is a typical of the classical Michaelis-Menten enzyme kinetics exhibited by a majority of other enzymes. PMID:26347131

  15. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  16. Soft metal thiol chemistry is not involved in the transport of arsenite by the Ars pump.

    PubMed Central

    Chen, Y; Dey, S; Rosen, B P

    1996-01-01

    The single cysteine in the ArsB protein subunit of the arsenite resistance pump was changed to serine and alanine residues. Resistance in cells expressing the two mutant arsB genes was the same as in the wild type, and the serine substitution had no effect on the arsenite transport properties. These results eliminate possible thiol chemistry in translocation. Thus, the pump uses soft metal chemistry for metalloactivation and nonmetal chemistry for oxyanion transport. PMID:8550532

  17. Arsenite exposure accelerates aging process regulated by the transcription factor DAF-16/FOXO in Caenorhabditis elegans.

    PubMed

    Yu, Chan-Wei; How, Chun Ming; Liao, Vivian Hsiu-Chuan

    2016-05-01

    Arsenic is a known human carcinogen and high levels of arsenic contamination in food, soils, water, and air are of toxicology concerns. Nowadays, arsenic is still a contaminant of emerging interest, yet the effects of arsenic on aging process have received little attention. In this study, we investigated the effects and the underlying mechanisms of chronic arsenite exposure on the aging process in Caenorhabditis elegans. The results showed that prolonged arsenite exposure caused significantly decreased lifespan compared to non-exposed ones. In addition, arsenite exposure (100 μM) caused significant changes of age-dependent biomarkers, including a decrease of defecation frequency, accumulations of intestinal lipofuscin and lipid peroxidation in an age-dependent manner in C. elegans. Further evidence revealed that intracellular reactive oxygen species (ROS) level was significantly increased in an age-dependent manner upon 100 μM arsenite exposure. Moreover, the mRNA levels of transcriptional makers of aging (hsp-16.1, hsp-16.49, and hsp-70) were increased in aged worms under arsenite exposure (100 μM). Finally, we showed that daf-16 mutant worms were more sensitive to arsenite exposure (100 μM) on lifespan and failed to induce the expression of its target gene sod-3 in aged daf-16 mutant under arsenite exposure (100 μM). Our study demonstrated that chronic arsenite exposure resulted in accelerated aging process in C. elegans. The overproduction of intracellular ROS and the transcription factor DAF-16/FOXO play roles in mediating the accelerated aging process by arsenite exposure in C. elegans. This study implicates a potential ecotoxicological and health risk of arsenic in the environment. PMID:26796881

  18. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  19. Characterization and Functional Analysis of the poxB Gene, Which Encodes Pyruvate Oxidase in Lactobacillus plantarum

    PubMed Central

    Lorquet, Frédérique; Goffin, Philippe; Muscariello, Lidia; Baudry, Jean-Bernard; Ladero, Victor; Sacco, Margherita; Kleerebezem, Michiel; Hols, Pascal

    2004-01-01

    The pyruvate oxidase gene (poxB) from Lactobacillus plantarum Lp80 was cloned and characterized. Northern blot and primer extension analyses revealed that transcription of poxB is monocistronic and under the control of a vegetative promoter. poxB mRNA expression was strongly induced by aeration and was repressed by glucose. Moreover, Northern blotting performed at different stages of growth showed that poxB expression is maximal in the early stationary phase when glucose is exhausted. Primer extension and in vivo footprint analyses revealed that glucose repression of poxB is mediated by CcpA binding to the cre site identified in the promoter region. The functional role of the PoxB enzyme was studied by using gene overexpression and knockout in order to evaluate its implications for acetate production. Constitutive overproduction of PoxB in L. plantarum revealed the predominant role of pyruvate oxidase in the control of acetate production under aerobic conditions. The ΔpoxB mutant strain exhibited a moderate (20 to 25%) decrease in acetate production when it was grown on glucose as the carbon source, and residual pyruvate oxidase activity that was between 20 and 85% of the wild-type activity was observed with glucose limitation (0.2% glucose). In contrast, when the organism was grown on maltose, the poxB mutation resulted in a large (60 to 80%) decrease in acetate production. In agreement with the latter observation, the level of residual pyruvate oxidase activity with maltose limitation (0.2% maltose) was less than 10% of the wild-type level of activity. PMID:15175288

  20. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.

    PubMed

    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P

    1993-06-01

    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  1. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R

    1984-01-01

    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  2. Expression of WWOX and FHIT is downregulated by exposure to arsenite in human uroepithelial cells.

    PubMed

    Huang, Ya-Chun; Hung, Wen-Chun; Chen, Wan-Tzu; Yu, Hsin-Su; Chai, Chee-Yin

    2013-07-01

    Ecological studies in Taiwan, Chile, Argentina, Bangladesh, and Mexico have confirmed significant dose-dependent associations between ingestion of arsenic-contaminated drinking water and the risk of various human malignancies. The FHIT and WWOX genes are active in common fragile sites FRA3B and FRA16D, respectively. Reduced expression of FHIT or WWOX is known to be an early indicator of carcinogen-induced cancers. However, the effect of arsenite on the expressions and molecular mechanisms of these markers is still unclear. The aims of this study were (i) to observe the expression of ATR, WWOX and FHIT proteins in urothelial carcinoma (UC) between endemic and non-endemic areas of blackfoot disease (BFD) by immunohistochemical analyses; (ii) to compare expression of these genes between arsenite-treated SV-HUC-1 human epithelial cells and rat uroepithelial cells; and (iii) to determine the role of DNMT and MEK inhibitors on expressions of WWOX and FHIT in response to arsenite in SV-HUC-1. The experiments revealed that expressions of ATR, WWOX and FHIT in UC significantly differed between BFD areas and non-BFD areas (p=0.003, 0.009 and 0.021, respectively). In fact, the results for the arsenite-treated groups showed that ATR, WWOX and FHIT are downregulated by arsenite in SV-HUC-1. However, the inhibitors suppressed the effects of arsenite on WWOX and FHIT proteins and mRNA expression. In conclusion, arsenite decreased expressions of ATR, WWOX and FHIT via ERK1/2 activation in SV-HUC-1 cells. These findings confirm that dysregulations of these markers may contribute to arsenite-induced carcinogenesis. PMID:23618899

  3. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  4. DGGE analysis of the coproporphyrinogen oxidase gene: two new mutations in DNA from Danish patients with hereditary coproporphyria.

    PubMed

    Petersen, N E; Käehne, M; Christiansen, L; Brock, A; Hother-Nielsen, O; Rasmussen, K

    2000-11-01

    The knowledge of at least 21 different mutations and several polymorphisms in the coproporphyrinogen oxidase (CPO) gene demonstrates that the molecular basis of hereditary coproporphyria is heterogeneous. We developed a DGGE-based assay for the analysis of exons 2 to 7, including 14-96 nucleotides of the flanking intronic sequences of the CPO gene. To render it suitable for the clinical diagnostic laboratory, we designed the assay to allow use of identical PCR conditions and the same DGGE gel for analyses of all the regions. Using this assay, and subsequent sequencing of gene regions containing interallelic variations, two novel mutations in the CPO gene were identified: a missense mutation (607G-->A), leading to the substitution of an alanine with a threonine, and a nonsense mutation (1281G-->A), giving rise to a stop codon 28 codons upstream to the wild-type stop codon. PMID:11202054

  5. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

    1989-01-01

    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  6. Quantitative GFP fluorescence as an indicator of arsenite developmental toxicity in mosaic heat shock protein 70 transgenic zebrafish

    SciTech Connect

    Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young; Kim, Dong-Jae; Na, Yi-Rang; Noh, Kyoung-Jin; Park, Sung-Hoon; Lee, Hyun-Kyoung; Lee, Byoung-Hee; Ryu, Doug-Young; Park, Jae-Hak

    2007-12-01

    In transgenic zebrafish (Danio rerio), green fluorescent protein (GFP) is a promising marker for environmental pollutants. In using GFP, one of the obstacles which we faced was how to compare toxicity among different toxicants or among a specific toxicant in different model species with the intensity of GFP expression. Using a fluorescence detection method, we first validated our method for estimating the amount of GFP fluorescence present in transgenic fish, which we used as an indicator of developmental toxicity caused by the well-known toxicant, arsenite. To this end, we developed mosaic transgenic zebrafish with the human heat shock response element (HSE) fused to the enhanced GFP (EGFP) reporter gene to indicate exposure to arsenite. We confirmed that EGFP expression sites correlate with gross morphological disruption caused by arsenite exposure. Arsenite (300.0 {mu}M) caused stronger EGFP fluorescence intensity and quantity than 50.0 {mu}M and 10.0 {mu}M arsenite in our transgenic zebrafish. Furthermore, arsenite-induced apoptosis was demonstrated by TUNEL assay. Apoptosis was inhibited by the antioxidant, N-acetyl-cystein (NAC) in this transgenic zebrafish. The distribution of TUNEL-positive cells in embryonic tissues was correlated with the sites of arsenite toxicity and EGFP expression. The EGFP values quantified using the standard curve equation from the known GFP quantity were consistent with the arsenite-induced EGFP expression pattern and arsenite concentration, indicating that this technique can be a reliable and applicable measurement. In conclusion, we propose that fluorescence-based EGFP quantification in transgenic fish containing the hsp70 promoter-EGFP reporter-gene construct is a useful indicator of development toxicity caused by arsenite.

  7. Changes in Cytokinin Content and Cytokinin Oxidase Activity in Response to Derepression of ipt Gene Transcription in Transgenic Tobacco Calli and Plants.

    PubMed Central

    Motyka, V.; Faiss, M.; Strand, M.; Kaminek, M.; Schmulling, T.

    1996-01-01

    Metabolic control of cytokinin oxidase by its substrate was investigated in planta using wild-type (WT) and conditionally ipt gene-expressing transgenic (IPT) tobacco (Nicotiana tabacum L.) callus cultures and plants. The derepression of the tetracycline (Tc)-dependent ipt gene transcription was followed by a progressive, more than 100-fold increase in total cytokinin content in IPT calli. The activity of cytokinin oxidase extracted from these calli began to increase 16 to 20 h after gene derepression, and after 13 d it was 10-fold higher than from Tc-treated WT calli. An increase in cytokinin oxidase activity, as a consequence of elevated cytokinin levels, was found in detached leaves (8-fold after 4 d) and in roots of intact plants (4-fold after 3 d). The partially purified cytokinin oxidase from WT, repressed IPT, and Tc-derepressed IPT tobacco calli exhibited similar characteristics. It had the same broad pH optimum (pH 6.5-8.5), its activity in vitro was enhanced 4-fold in the presence of copper-imidazole, and the apparent Km(N6-[[delta]2iso-pentenyl]adenine) values were in the range of 3.1 to 4.9 [mu]M. The increase in cytokinin oxidase activity in cytokinin-overproducing tissue was associated with the accumulation of a glycosylated form of the enzyme. The present data indicate the substrate induction of cytokinin oxidase activity in different tobacco tissues, which may contribute to hormone homeostasis. PMID:12226431

  8. Draft Genome Sequence of the Arsenite-Oxidizing Strain Aliihoeflea sp. 2WW, Isolated from Arsenic-Contaminated Groundwater

    PubMed Central

    Cavalca, Lucia; Corsini, Anna; Andreoni, Vincenza

    2013-01-01

    Here, we report the draft genome sequence of the arsenite-oxidizing bacterium Aliihoeflea sp. strain 2WW, which consists of a 4.15-Mb chromosome and contains different genes that are involved in arsenic transformations. PMID:24356838

  9. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  10. Long-term performance of rapid oxidation of arsenite in simulated groundwater using a population of arsenite-oxidizing microorganisms in a bioreactor.

    PubMed

    Li, Hao; Zeng, Xian-Chun; He, Zhong; Chen, Xiaoming; E, Guoji; Han, Yiyang; Wang, Yanxin

    2016-09-15

    A population of arsenite-oxidizing microorganisms enriched from the tailing of the Shimen realgar mine was used to generate biofilms on the surfaces of perlites. This bioreactor is able to completely oxidize 1100 μg/L As(III) dissolved in simulated groundwater into As(V) within 10 min; after 140 days of operation, approximately 20 min were required to completely oxidize the same concentration of As(III). Analysis for the 16S rRNA genes of the microbial community showed that Bacteroidetes and Proteobacteria are dominant in the reactor. Six different bacterial strains were randomly isolated from the reactor. Function and gene analysis indicated that all the isolates possess arsenite-oxidizing activity, and five of them are chemoautotrophic. Further analysis showed that a large diversity of AioAs and two types of RuBisCOs are present in the microbial community. This suggests that many chemoautotrophic arsenite-oxidizing microorganisms were responsible for quick oxidation of arsenite in the reactor. We also found that the reactor is easily regenerated and its number is readily expanded. To the best of our knowledge, the arsenite-oxidizing efficiency, which was expressed as the minimum time for complete oxidization of a certain concentration of As(III) under a single operation, of this bioreactor is the highest among the described bioreactors; it is also the most stable, economic and environment-friendly. PMID:27288673

  11. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  12. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  13. Hereditary Coproporphyria Associated with the Q306X Mutation in the Coproporphyrin Oxidase Gene Presenting with Acute Ataxia

    PubMed Central

    Jiménez-Jiménez, Félix Javier; Agúndez, José A. G.; Martínez, Carmen; Navacerrada, Francisco; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Alonso-Navarro, Hortensia; García-Martín, Elena

    2013-01-01

    Background Hereditary coproporphyria (HCPO) is a low-penetrance, autosomal dominant, acute hepatic porphyria characterized by the overproduction and excretion of coproporphyrin. The most common neurological manifestations of this entity include peripheral, predominantly motor dysfunction, and central nervous system dysfunction. Ataxia associated with HCPO has not been reported previously. The aim of this article is to report a patient with HCPO presenting with acute ataxia. Case Report We describe a 44-year-old patient presenting clinically with acute ataxia who was diagnosed with HCPO; mutations were analyzed in the coproporphyrin-oxidase III (CPOX) gene in the patient and in six asymptomatic first-degree relatives. Discussion The patient was heterozygous for a mutation causing the amino acid exchange Q306X in the CPOX gene. No relatives carried the same or another mutation in the CPOX gene. HCPO should be considered in the differential diagnosis for patients presenting with ataxia. PMID:24156084

  14. Arsenite-oxidizing bacteria exhibiting plant growth promoting traits isolated from the rhizosphere of Oryza sativa L.: Implications for mitigation of arsenic contamination in paddies.

    PubMed

    Das, Suvendu; Jean, Jiin-Shuh; Chou, Mon-Lin; Rathod, Jagat; Liu, Chia-Chuan

    2016-01-25

    Arsenite-oxidizing bacteria exhibiting plant growth promoting (PGP) traits can have the advantages of reducing As-uptake by rice and promoting plant growth in As-stressed soil. A gram-positive bacterium Bacillus flexus ASO-6 resistant to high levels of As (32 and 280 mM for arsenite and arsenate, respectively) and exhibiting elevated rates of As(III) oxidation (Vmax=1.34 μM min(-1) 10(-7) cell) was isolated from rhizosphere of rice. The presence of aoxB gene and exhibition of As(III)-oxidase enzyme activity of this strain was observed. The ability of the strain to produce siderophore, IAA, ACC-deaminase and to solubilize phosphate was verified. The rice seed treated with the strain exhibited significantly improved seed germination and seedling vigor compared with the un-inoculated seeds. The bacterial inoculation significantly increased root biomass, straw yield, grain yield, chlorophyll and carotenoid in the rice plant. Moreover, As uptake from root to shoot and As accumulation in straw and grain decreased significantly as a result of the bacterial inoculation. Noteworthy, the inoculation effect is more prominent in non-flooded soil than it is in flooded soil. Owing to its wide action spectrum, this As(III)-oxidizing PGPB could serve as a potential bio-inoculant for mitigation of As in paddies and sustainable rice production in As-contaminated areas. PMID:26448489

  15. Arsenite-induced autophagy is associated with proteotoxicity in human lymphoblastoid cells

    SciTech Connect

    Bolt, Alicia M.; Zhao, Fei; Pacheco, Samantha; Klimecki, Walter T.

    2012-10-15

    Epidemiological studies of arsenic-exposed populations have provided evidence that arsenic exposure in humans is associated with immunosuppression. Previously, we have reported that arsenite-induced toxicity is associated with the induction of autophagy in human lymphoblastoid cell lines (LCL). Autophagy is a cellular process that functions in the degradation of damaged cellular components, including protein aggregates formed by misfolded or damaged proteins. Accumulation of misfolded or damaged proteins in the endoplasmic reticulum (ER) lumen causes ER stress and activates the unfolded protein response (UPR). In an effort to investigate the mechanism of autophagy induction by arsenite in the LCL model, we examined the potential contribution of ER stress and activation of the UPR. LCL exposed to sodium arsenite for 8-days induced expression of UPR-activated genes, including CHOP and GRP78, at the RNA and the protein level. Evidence for activation of the three arms of the UPR was observed. The arsenite-induced activation of the UPR was associated with an accumulation of protein aggregates containing p62 and LC3, proteins with established roles in the sequestration and autophagic clearance of protein aggregates. Taken together, these data provide evidence that arsenite-induced autophagy is associated with the generation of ER stress, activation of the UPR, and formation of protein aggregates that may be targeted to the lysosome for degradation. -- Highlights: ► Arsenite induces endoplasmic reticulum stress and the unfolded protein response. ► Arsenite induces the formation of protein aggregates that contain p62 and LC3-II. ► Time-course data suggests that arsenite-induced autophagy precedes ER stress.

  16. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.

    PubMed

    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

    2013-01-01

    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion. PMID:24265769

  17. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  18. From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.

    PubMed

    Luz, Anthony L; Godebo, Tewodros R; Bhatt, Dhaval P; Ilkayeva, Olga R; Maurer, Laura L; Hirschey, Matthew D; Meyer, Joel N

    2016-08-01

    Millions of people worldwide are chronically exposed to arsenic through contaminated drinking water. Despite decades of research studying the carcinogenic potential of arsenic, the mechanisms by which arsenic causes cancer and other diseases remain poorly understood. Mitochondria appear to be an important target of arsenic toxicity. The trivalent arsenical, arsenite, can induce mitochondrial reactive oxygen species production, inhibit enzymes involved in energy metabolism, and induce aerobic glycolysis in vitro, suggesting that metabolic dysfunction may be important in arsenic-induced disease. Here, using the model organism Caenorhabditis elegans and a novel metabolic inhibition assay, we report an in vivo induction of aerobic glycolysis following arsenite exposure. Furthermore, arsenite exposure induced severe mitochondrial dysfunction, including altered pyruvate metabolism; reduced steady-state ATP levels, ATP-linked respiration and spare respiratory capacity; and increased proton leak. We also found evidence that induction of autophagy is an important protective response to arsenite exposure. Because these results demonstrate that mitochondria are an important in vivo target of arsenite toxicity, we hypothesized that deficiencies in mitochondrial electron transport chain genes, which cause mitochondrial disease in humans, would sensitize nematodes to arsenite. In agreement with this, nematodes deficient in electron transport chain complexes I, II, and III, but not ATP synthase, were sensitive to arsenite exposure, thus identifying a novel class of gene-environment interactions that warrant further investigation in the human populace. PMID:27208080

  19. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.

    2013-01-01

    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  20. A newly identified fatty alcohol oxidase gene is mainly responsible for the oxidation of long-chain ω-hydroxy fatty acids in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Förster, André; Bär, Kati; Winter, Miriam; Otto, Christina; Petzsch, Patrick; Ježková, Michaela; Bahr, Katrin; Pfeiffer, Melanie; Matthäus, Falk; Barth, Gerold

    2014-09-01

    Nine potential (fatty) alcohol dehydrogenase genes and one alcohol oxidase gene were identified in Yarrowia lipolytica by comparative sequence analysis. All relevant genes were deleted in Y. lipolytica H222ΔP which is lacking β-oxidation. Resulting transformants were tested for their ability to accumulate ω-hydroxy fatty acids and dicarboxylic acids in the culture medium. The deletion of eight alcohol dehydrogenase genes (FADH, ADH1-7), which may be involved in ω-oxidation, led only to a slightly increased accumulation of ω-hydroxy fatty acids, whereas the deletion of the fatty alcohol oxidase gene (FAO1), which has not been described yet in Y. lipolytica, exhibited a considerably higher effect. The combined deletion of the eight (fatty) alcohol dehydrogenase genes and the alcohol oxidase gene further reduced the formation of dicarboxylic acids. These results indicate that both (fatty) alcohol dehydrogenases and an alcohol oxidase are involved in ω-oxidation of long-chain fatty acids whereby latter plays the major role. This insight marks the first step toward the biotechnological production of long-chain ω-hydroxy fatty acids with the help of the nonconventional yeast Y. lipolytica. The overexpression of FAO1 can be further used to improve existing strains for the production of dicarboxylic acids. PMID:24931727

  1. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.

    1999-01-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  2. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  3. Diversity of laccase-like multicopper oxidase genes in Morchellaceae: identification of genes potentially involved in extracellular activities related to plant litter decay.

    PubMed

    Kellner, Harald; Luis, Patricia; Buscot, François

    2007-07-01

    Despite the important role played by soil-inhabiting ascomycetes in plant litter decay processes, studies on the diversity and function of their laccase-like multicopper oxidase (LMCO) genes are scarce. In the present work, the LMCO gene diversity in 15 strains representing nine Morchellaceae and one Discinaceae species was evaluated by PCR. One to six different genes were found within the species, representing 26 different sequence types. Cluster analysis revealed LMCO genes belonging to four main gene families encoding different protein classes (Class I-IV). To identify the genes related to extracellular activities and potentially involved in litter decay processes, liquid cultures were induced by different aromatic compounds. Morchella conica and Verpa conica showed the strongest LMCO activity enhancement in the presence of the naturally occurring phenolic compound guaiacol, and their expressed LMCO genes were identified by sequencing. Only genes belonging to the gene families encoding the Class II and III proteins were expressed. Both genes (Class II and III) of the mycorrhizal-like strain M. conica were exclusively expressed in the presence of guaiacol. In contrast to the saprotrophic strain V. conica, the gene encoding the Class III protein was constitutively expressed as it was also found in control cultures without guaiacol. PMID:17466024

  4. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.

    2001-01-01

    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  5. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  6. The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

    PubMed

    Nawathean, P; Maslov, D A

    2000-08-01

    By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs. PMID:10975258

  7. Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission

    PubMed Central

    Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei

    2014-01-01

    Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

  8. THE ISOAMYL OXIDASE GENE IN PENICILLIUM GRISEOFULVUM IS PART OF THE PATULIN BIOSYNTHETIC PATHWAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

  9. Anaerobic oxidation of arsenite in Mono Lake water and by a facultative, arsenite-oxidizing chemoautotroph, strain MLHE-1

    USGS Publications Warehouse

    Oremland, R.S.; Hoeft, S.E.; Santini, J.M.; Bano, N.; Hollibaugh, R.A.; Hollibaugh, J.T.

    2002-01-01

    Arsenite [As(III)]-enriched anoxic bottom water from Mono Lake, California, produced arsenate [As(V)] during incubation with either nitrate or nitrite. No such oxidation occurred in killed controls or in live samples incubated without added nitrate or nitrite. A small amount of biological As(III) oxidation was observed in samples amended with Fe(III) chelated with nitrolotriacetic acid, although some chemical oxidation was also evident in killed controls. A pure culture, strain MLHE-1, that was capable of growth with As(III) as its electron donor and nitrate as its electron acceptor was isolated in a defined mineral salts medium. Cells were also able to grow in nitrate-mineral salts medium by using H2 or sulfide as their electron donor in lieu of As(III). Arsenite-grown cells demonstrated dark 14CO2 fixation, and PCR was used to indicate the presence of a gene encoding ribulose-1,5-biphosphate carboxylase/oxygenase. Strain MLHE-1 is a facultative chemoautotroph, able to grow with these inorganic electron donors and nitrate as its electron acceptor, but heterotrophic growth on acetate was also observed under both aerobic and anaerobic (nitrate) conditions. Phylogenetic analysis of its 16S ribosomal DNA sequence placed strain MLHE-1 within the haloalkaliphilic Ectothiorhodospira of the ??-Proteobacteria. Arsenite oxidation has never been reported for any members of this subgroup of the Proteobacteria.

  10. Nitric oxide mediated amelioration of arsenic toxicity which alters the alternative oxidase (Aox1) gene expression in Hordeum vulgare L.

    PubMed

    Shukla, Pratiksha; Singh, Shalini; Dubey, Pragyan; Singh, Aradhana; Singh, A K

    2015-10-01

    The role of nitric oxide (NO) as a key molecule in the signal transduction pathway of a biotic stress response has already been described. Recent studies indicate that it also participate in the signaling of abiotic stresses. In the present study, we showed the altered expression of stress responsive gene alternative oxidase (Aox1) in seedlings of barley (Hordeum vulgare L.) in response to arsenic toxicity. Arsenic toxicity decreased the germination percentage, biomass, chlorophyll and carotenoid content whereas, arsenic toxicity enhanced the MDA content and proline content in a dose dependent manner. Other enzyme activities like catalase and superoxide dismutase increased with the increase in concentrations but it fell down at higher concentration of arsenic. Pretreatment of nitric oxide results in the enhanced expression of alternative oxidase which showed the adaptation of alternative pathway during the arsenic stress and it also enhances the growth ability and adaptability towards the arsenic stress. The results support the conclusion that nitric oxide ameliorates the arsenic toxicity not only at the level of antioxidant defense but also by affecting other mechanism of detoxification. PMID:26036416

  11. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  12. Characterization and expression of a new class of zinc finger protein that binds to silencer region of ascorbate oxidase gene.

    PubMed

    Kisu, Y; Ono, T; Shimofurutani, N; Suzuki, M; Esaka, M

    1998-10-01

    A unique A/T-rich sequence (5'-AAAAAGTAAAAA-GTAAAAAAGTAAAAAG-3), referred to as the AGTA repeat, is found in the silencer region of the pumpkin ascorbate oxidase gene. A cDNA for protein (AOBP) that binds to the AGTA repeat was isolated from pumpkin by the southwestern method. The AOBP protein has a new class of zinc/DNA-binding domain named Dof/MOA domain that is highly conserved in many plant proteins and is significantly related to those of steroid hormone receptors and GATA1. Gel retardation analysis indicated that AOBP bound to the AGTA repeat through the Dof/MOA domain. Metal chelators, 1,10-phenanthroline and EDTA, specifically inhibited the DNA binding of AOBP, indicating that metal coordination plays an important role in DNA binding of AOBP. Thus, the Dof/MOA domain acts as a zinc/DNA-binding domain in AOBP. Gel retardation analysis with mutated oligonucleotides suggested that the Dof/MOA domain recognized the AGTA core sequence. AOBP mRNA was expressed in mature tissues of pumpkin, but was expressed only in small amounts or was not expressed in growing tissues. Furthermore, the expression was auxin-independent. The expression pattern of AOBP and that of ascorbate oxidase did not show a positive correlation. PMID:9871365

  13. Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish.

    PubMed

    Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto

    2016-08-15

    Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a(fh318). After treatment with 1mM sodium arsenite, the survival of nrf2a(fh318) larvae was significantly shorter than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity. PMID:27306194

  14. Small interference RNA-mediated gene silencing of human biliverdin reductase, but not that of heme oxygenase-1, attenuates arsenite-mediated induction of the oxygenase and increases apoptosis in 293A kidney cells.

    PubMed

    Miralem, Tihomir; Hu, Zhenbo; Torno, Michael D; Lelli, Katherine M; Maines, Mahin D

    2005-04-29

    BVR reduces biliverdin, the HO-1 and HO-2 product, to bilirubin. Human biliverdin (BVR) is a serine/threonine kinase activated by free radicals. It is a leucine zipper (bZip) DNA-binding protein and a regulatory factor for 8/7-bp AP-1-regulated genes, including HO-1 and ATF-2/CREB. Presently, small interference (si) RNA constructs were used to investigate the role of human BVR in sodium arsenite (As)-mediated induction of HO-1 and in cytoprotection against apoptosis. Activation of BVR involved increased serine/threonine phosphorylation but not its protein or transcript levels. The peak activity at 1 h (4-5-fold) after treatment of 293A cells with 5 mum As preceded induction of HO-1 expression by 3 h. The following suggests BVR involvement in regulating oxidative stress response of HO-1: siBVR attenuated As-mediated increase in HO-1 expression; siBVR, but not siHO-1, inhibited As-dependent increased c-jun promoter activity; treatment of cells with As increased AP-1 binding of nuclear proteins; BVR was identified in the DNA-protein complex; and AP-1 binding of the in vitro translated BVR was phosphorylation-dependent and was attenuated by biliverdin. Most unexpectedly, cells transfected with siBVR, but not siHO-1, displayed a 4-fold increase in apoptotic cells when treated with 10 mum As as detected by flow cytometry. The presence of BVR small interference RNA augmented the effect of As on levels of cytochrome c, TRAIL, and DR-5 mRNA and cleavage of poly(ADP-ribose) polymerase. The findings describe the function of BVR in HO-1 oxidative response and, demonstrate, for the first time, not only that BVR advances the role of HO-1 in cytoprotection but also affords cytoprotection independent of heme degradation. PMID:15741166

  15. Roles of mitogen activated protein kinases and EGF receptor in arsenite-stimulated matrix metalloproteinase-9 production

    SciTech Connect

    Cooper, Karen L.; Myers, Terrance Alix; Rosenberg, Martina; Chavez, Miquella; Hudson, Laurie G. . E-mail: lghudson@unm.edu

    2004-11-01

    The dermatotoxicity of arsenic is well established and epidemiological studies identify an increased incidence of keratinocytic tumors (basal cell and squamous cell carcinoma) associated with arsenic exposure. Little is known about the underlying mechanisms of arsenic-mediated skin carcinogenesis, but activation of mitogen-activated protein (MAP) kinases and subsequent regulation of downstream target genes may contribute to tumor promotion and progression. In this study, we investigated activation of the extracellular signal regulated kinase (ERK) and the stress-associated kinase p38 by arsenite in HaCat cells, a spontaneously immortalized human keratinocyte cell line. Arsenite concentrations {>=}100 {mu}M stimulate rapid activation of p38 and ERK MAP kinases. However, upon extended exposure (24 h), persistent stimulation of p38 and ERK MAP kinases was detected at low micromolar concentrations of arsenite. Although ERK and p38 were activated with similar time and concentration dependence, the mechanism of activation differed for these two MAP kinases. ERK activation by arsenite was fully dependent on the catalytic activity of the epidermal growth factor (EGF) receptor and partially dependent on Src-family kinase activity. In contrast, p38 activation was independent of EGF receptor or Src-family kinase activity. Arsenite-stimulated MAP kinase signal transduction resulted in increased production of matrix metalloproteinase (MMP)-9, an AP-1 regulated gene product. MMP-9 induction by arsenite was prevented when EGF receptor or MAP kinase signaling was inhibited. These studies indicate that EGF receptor activation is a component of arsenite-mediated signal transduction and gene expression in keratinocytes and that low micromolar concentrations of arsenite stimulate key signaling pathways upon extended exposure. Stimulation of MAP kinase cascades by arsenic and subsequent regulation of genes including c-fos, c-jun, and the matrix degrading proteases may play an important

  16. The metalloid arsenite induces nuclear export of Id3 possibly via binding to the N-terminal cysteine residues

    SciTech Connect

    Kurooka, Hisanori; Sugai, Manabu; Mori, Kentaro; Yokota, Yoshifumi

    2013-04-19

    Highlights: •Sodium arsenite induces cytoplasmic accumulation of Id3. •Arsenite binds to closely spaced N-terminal cysteine residues of Id3. •N-terminal cysteines are essential for arsenite-induced nuclear export of Id3. •Nuclear export of Id3 counteracts its transcriptional repression activity. -- Abstract: Ids are versatile transcriptional repressors that regulate cell proliferation and differentiation, and appropriate subcellular localization of the Id proteins is important for their functions. We previously identified distinct functional nuclear export signals (NESs) in Id1 and Id2, but no active NES has been reported in Id3. In this study, we found that treatment with the stress-inducing metalloid arsenite led to the accumulation of GFP-tagged Id3 in the cytoplasm. Cytoplasmic accumulation was impaired by a mutation in the Id3 NES-like sequence resembling the Id1 NES, located at the end of the HLH domain. It was also blocked by co-treatment with the CRM1-specific nuclear export inhibitor leptomycin B (LMB), but not with the inhibitors for mitogen-activated protein kinases (MAPKs). Importantly, we showed that the closely spaced N-terminal cysteine residues of Id3 interacted with the arsenic derivative phenylarsine oxide (PAO) and were essential for the arsenite-induced cytoplasmic accumulation, suggesting that arsenite induces the CRM1-dependent nuclear export of Id3 via binding to the N-terminal cysteines. Finally, we demonstrated that Id3 significantly repressed arsenite-stimulated transcription of the immediate-early gene Egr-1 and that this repression activity was inversely correlated with the arsenite-induced nuclear export. Our results imply that Id3 may be involved in the biological action of arsenite.

  17. Cellular Response of Sinorhizobium sp. Strain A2 during Arsenite Oxidation

    PubMed Central

    Fukushima, Koh; Huang, He; Hamamura, Natsuko

    2015-01-01

    Arsenic (As) is a widely distributed toxic element in the environment and microorganisms have developed resistance mechanisms in order to tolerate it. The cellular response of the chemoorganotrophic arsenite (As[III])-oxidizing α-Proteobacteria, Sinorhizobium sp. strain A2, to arsenic was examined in the present study. Several proteins associated with arsenite oxidase and As resistance were shown to be accumulated in the presence of As(III). A shift in central carbon metabolism from the tricarboxylic acid pathway to glyoxylate pathway was also observed in response to oxidative stress. Our results revealed the strategy of the As(III)-oxidizing Sinorhizobium strain to mitigate arsenic toxicity and oxidative damage by multiple metabolic adaptations. PMID:26477790

  18. Isolation and characterization of the human aldehyde oxidase gene: conservation of intron/exon boundaries with the xanthine oxidoreductase gene indicates a common origin.

    PubMed Central

    Terao, M; Kurosaki, M; Demontis, S; Zanotta, S; Garattini, E

    1998-01-01

    Aldehyde oxidase (AO) is a molybdo-flavo enzyme involved in the metabolism of various endogenous and exogenous N-heterocyclic compounds of pharmacological and toxicological importance. The enzyme is the product of a gene which is implicated in the aetio-pathogenesis of familial recessive amyotrophic lateral sclerosis. Here, we report the cloning and structural characterization of the human AO gene. AO is a single copy gene approximately 85 kb long with 35 transcribed exons. The transcription-initiation site and the sequence of the 5'-flanking region, containing several putative regulatory elements, were determined. The 5'-flanking region contains a functional promoter, as assessed by appropriate reporter constructs in transient transfection experiments. Comparison of the AO gene structure shows conservation of the position and type of exon/intron junctions relative to those observed in the gene coding for another molybdo-flavoprotein, i.e. xanthine oxidoreductase (XOR). As the two genes code for proteins with a high level of amino acid identity, our results strongly suggest that the AO and XOR genetic loci arose as the consequence of a duplication event. Southern blot analysis conducted on genomic DNA from various animal species with specific cDNA probes indicates that the AO gene is less conserved than the XOR gene during evolution. PMID:9601067

  19. Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps

    PubMed Central

    Piedade, Ana Paula; Morais, Paula V.

    2015-01-01

    Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification. PMID:26132104

  20. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  1. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  2. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  3. The role of the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of COX (cytochrome c oxidase) I and COX III mRNA.

    PubMed

    Xu, Fenghao; Morin, Charles; Mitchell, Grant; Ackerley, Cameron; Robinson, Brian H

    2004-08-15

    Leigh syndrome French Canadian (LSFC) is a variant of cytochrome oxidase deficiency found in Québec and caused by mutations in the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene. Northern blots showed that the LRPPRC mRNA levels seen in skeletal muscle>heart>placenta>kidney>liver>lung=brain were proportionally almost opposite in strength to the severity of the enzymic cytochrome oxidase defect. The levels of COX (cytochrome c oxidase) I and COX III mRNA visible on Northern blots were reduced in LSFC patients due to the common (A354V, Ala354-->Val) founder mutation. The amount of LRPPRC protein found in both fibroblast and liver mitochondria from LSFC patients was consistently reduced to <30% of control levels. Import of [(35)S]methionine LRPPRC into rat liver mitochondria was slower for the mutant (A354V) protein. A titre of LRPPRC protein was also found in nuclear fractions that could not be easily accounted for by mitochondrial contamination. [35S]Methionine labelling of mitochondrial translation products showed that the translation of COX I, and perhaps COX III, was specifically reduced in the presence of the mutation. These results suggest that the gene product of LRPPRC, like PET 309p, has a role in the translation or stability of the mRNA for mitochondrially encoded COX subunits. A more diffuse distribution of LRPPRC in LSFC cells compared with controls was evident when viewed by immunofluorescence microscopy, with less LRPPRC present in peripheral mitochondria. PMID:15139850

  4. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  5. Molecular characterization of fire ants, Solenopsis spp., from Brazil based on analysis of mtDNA gene cytochrome oxidase I.

    PubMed

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  6. Molecular Characterization of Fire Ants, Solenopsis spp., from Brazil Based on Analysis of mtDNA Gene Cytochrome Oxidase I

    PubMed Central

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  7. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  8. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  9. Effects of hydrogen sulfide on alternative pathway respiration and induction of alternative oxidase gene expression in rice suspension cells.

    PubMed

    Xiao, Man; Ma, Jun; Li, Hongyu; Jin, Han; Feng, Hanqing

    2010-01-01

    The toxic effects of H2S on plants are well documented. However, the molecular mechanisms reponsible for inhibition of plants by H2S are still not completely understood. We determined the effects of NaHS in the range of 0.5-10 mM on the growth of rice suspension culture cells, as well as on the expression of the alternative oxidase (AOX) gene. AOX is the terminal oxidase of the alternative pathway (AP) and exists in plant mitochondria. The results showed that H2S treatment enhanced the AP activity. During the process of H2S treatment for 4 h, the AP activity increased dramatically and achieved the peak value at a concentration of 2 mM NaHS. Then it declined at higher concentrations of NaHS (5-10 mM) and maintained a steady level. The AOX1 gene transcript level also showed a similar change as the AP activity. Interestingly, different NaHS concentrations seemed to have different effects on the expression of AOX1a, AOX1b, and AOX1c. The induction of AOX expression by low concentrations of NaHS was inferred through a reactive oxygen species (ROS)-independent pathway. At the same time, rice cells grown in culture were very sensitive to H2S, different H2S concentrations induced an increase in the cell viability. These results indicate that the H2S-induced AOX induction might play a role in inhibiting the ROS production and have an influence on cell viability. PMID:20737915

  10. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  11. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  12. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    PubMed

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed. PMID:10945344

  13. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

    2013-01-01

    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  14. Mutations of the SCO1 Gene in Mitochondrial Cytochrome c Oxidase Deficiency with Neonatal-Onset Hepatic Failure and Encephalopathy

    PubMed Central

    Valnot, Isabelle; Osmond, Sandrine; Gigarel, Nadine; Mehaye, Blandine; Amiel, Jeanne; Cormier-Daire, Valérie; Munnich, Arnold; Bonnefont, Jean-Paul; Rustin, Pierre; Rötig, Agnès

    2000-01-01

    Cytochrome c oxidase (COX) catalyzes both electron transfer from cytochrome c to molecular oxygen and the concomitant vectorial proton pumping across the inner mitochondrial membrane. Studying a large family with multiple cases of neonatal ketoacidotic comas and isolated COX deficiency, we have mapped the disease locus to chromosome 17p13.1, in a region encompassing two candidate genes involved in COX assembly—namely, SCO1 and COX10. Mutation screening revealed compound heterozygosity for SCO1 gene mutations in the patients. The mutated allele, inherited from the father, harbored a 2-bp frameshift deletion (ΔGA; nt 363–364) resulting in both a premature stop codon and a highly unstable mRNA. The maternally inherited mutation (C520T) changed a highly conserved proline into a leucine in the protein (P174L). This proline, adjacent to the CxxxC copper-binding domain of SCO1, is likely to play a crucial role in the tridimentional structure of the domain. Interestingly, the clinical presentation of SCO1-deficient patients markedly differs from that of patients harboring mutations in other COX assembly and/or maturation genes. PMID:11013136

  15. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  16. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli. PMID:26369789

  17. Dual gene defects involving delta-aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient.

    PubMed

    Akagi, Reiko; Inoue, Rikako; Muranaka, Shikibu; Tahara, Tsuyoshi; Taketani, Shigeru; Anderson, Karl E; Phillips, John D; Sassa, Shigeru

    2006-01-01

    Summary A Caucasian male had symptoms of acute porphyria, with increases in urinary delta-aminolaevulinic acid (ALA), porphobilinogen (PBG) and coproporphyrin that were consistent with hereditary coproporphyria (HCP). However, a greater than expected increase in ALA, compared with PBG, and a substantial increase in erythrocyte zinc protoporphyrin, suggested additional ALA dehydratase (ALAD) deficiency. Nucleotide sequence analysis of coproporphyrinogen oxidase (CPO) cDNA of the patient, but not of the parents, revealed a novel nucleotide transition G835-->C, resulting in an amino acid change, G279R. The mutant CPO protein expressed in Escherichia coli was unstable, and produced about 5% of activity compared with the wild-type CPO. Erythrocyte ALAD activity was 32% of normal in the proband. Nucleotide sequence analysis of cloned ALAD cDNAs from the patient revealed a C36-->G base transition (F12L amino acid change). The F12L ALAD mutation, which was found in the mother and a brother, was previously described, and is known to lack any enzyme activity. This patient thus represents the first case of porphyria where both CPO and ALAD deficiencies were demonstrated at the molecular level. PMID:16398658

  18. Reduction of coproporphyrinogen oxidase level by antisense RNA synthesis leads to deregulated gene expression of plastid proteins and affects the oxidative defense system.

    PubMed Central

    Kruse, E; Mock, H P; Grimm, B

    1995-01-01

    A full-length cDNA sequence encoding coproporphyrinogen oxidase was inserted in inverse orientation behind a CaMV promoter and transferred to tobacco (Nicotiana tabacum) by standard transformation techniques. Transformants showed reduced coproporphyrinogen oxidase activity and accumulation of photosensitive coproporphyrin(ogen), indicating antisense RNA expression. An inverse correlation was observed between the level of coproporphyrinogen oxidase and transformant phenotype. The latter is characterized by a broad range of growth retardation and necrosis, indicating oxidative leaf damage. Coproporphyrinogen is an apparent chromophore and its excitation finally leads to the production of reactive oxygen. Evidence is presented that indicates a direct correlation between the accumulation of non-metabolized coproporphyrinogen and oxidative damage to cellular structural components. Enzymatic and non-enzymatic antioxidants were investigated. Whereas superoxide dismutase activity increased in transgenic plants, catalase and ascorbate peroxidase activity remained constant. Tocopherol, rather than carotene or zeaxanthin, seemed to be involved in detoxification, indicating the putative localization and allocation of coproporphyrinogen. Expression of coproporphyrinogen oxidase antisense RNA did not significantly influence the level of other enzymes in the chlorophyll metabolic pathway, but deregulated gene expression of nuclear encoded plastid proteins. Accumulation of coproporphyrinogen and/or the resulting effects, such as oxidative stress, impairs a plastid/nuclear signal which may adapt gene expression to the plastid state. Images PMID:7641690

  19. [Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].

    PubMed

    Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A

    2014-10-01

    This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

  20. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  1. Induction of heme oxygenase 1 by arsenite inhibits cytokine-induced monocyte adhesion to human endothelial cells

    SciTech Connect

    Sun Xi; Pi Jingbo; Liu Wenlan; Hudson, Laurie G.; Liu Kejian; Feng Changjian

    2009-04-15

    Heme oxygenase-1 (HO-1) is an oxidative stress responsive gene upregulated by various physiological and exogenous stimuli. Arsenite, as an oxidative stressor, is a potent inducer of HO-1 in human and rodent cells. In this study, we investigated the mechanistic role of arsenite-induced HO-1 in modulating tumor necrosis factor {alpha} (TNF-{alpha}) induced monocyte adhesion to human umbilical vein endothelial cells (HUVEC). Arsenite pretreatment, which upregulated HO-1 in a time- and concentration-dependent manner, inhibited TNF-{alpha}-induced monocyte adhesion to HUVEC and intercellular adhesion molecule 1 protein expression by 50% and 40%, respectively. Importantly, knockdown of HO-1 by small interfering RNA abolished the arsenite-induced inhibitory effects. These results indicate that induction of HO-1 by arsenite inhibits the cytokine-induced monocyte adhesion to HUVEC by suppressing adhesion molecule expression. These findings established an important mechanistic link between the functional monocyte adhesion properties of HUVEC and the induction of HO-1 by arsenite.

  2. Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity

    PubMed Central

    Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan

    2013-01-01

    The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

  3. Impact of Arsenite on the Bacterial Community Structure and Diversity in Soil

    PubMed Central

    Dong, Dian-Tao; Yamamura, Shigeki; Amachi, Seigo

    2016-01-01

    The impact of arsenite (As[III]) on the bacterial community structure and diversity in soil was determined by incubating soil slurries with 50, 500, and 5,000 μM As(III). As(III) was oxidized to arsenate (As[V]), and the microbial contribution to As(III) oxidation was 70–100%. PCR-denaturing gradient gel electrophoresis revealed that soil bacterial diversity decreased in the presence of As(III). Bacteria closely related to the family Bacillaceae were predominant in slurry spiked with 5,000 μM As(III). The population size of culturable As(III)-resistant bacteria was 37-fold higher in this slurry than in unspiked slurry (p < 0.01), indicating that high levels of As(III) stimulate the emergence of As(III)-resistant bacteria. As(III)-resistant bacteria isolated from slurry spiked with 5,000 μM As(III) were mainly affiliated with the genus Bacillus; however, no strains showed As(III)-oxidizing capacity. An As(III)-oxidizing bacterial community analysis based on As(III) oxidase gene (aioA) sequences demonstrated that diversity was the lowest in slurry spiked with 5,000 μM As(III). The deduced AioA sequences affiliated with Alphaproteobacteria accounted for 91–93% of all sequences in this slurry, among which those closely related to Bosea spp. were predominant (48–86%). These results suggest that exposure to high levels of As(III) has a significant impact on the composition and diversity of the soil bacterial community, including the As(III)-oxidizing bacterial community. Certain As(III)-oxidizing bacteria with strong As(III) resistance may be enriched under high As(III) levels, while more sensitive As(III) oxidizers are eliminated under these conditions. PMID:26903368

  4. Expression and regulation of the antimonite, arsenite, and arsenate resistance operon of Staphylococcus xylosus plasmid pSX267.

    PubMed Central

    Rosenstein, R; Peschel, A; Wieland, B; Götz, F

    1992-01-01

    The arsenate, arsenite, and antimonite resistance region of the Staphylococcus xylosus plasmid pSX267 was subcloned in Staphylococcus carnosus. The sequenced DNA region revealed three consecutive open reading frames, named arsR, arsB, and arsC. Expression studies in Escherichia coli with the bacteriophage T7 RNA polymerase-promoter system yielded three polypeptides with apparent molecular weights of 8,000, 35,000, and 15,000, which very likely correspond to ArsR, ArsB, and ArsC, respectively. ArsB was distinguished by its overall hydrophobic character, suggesting a membrane association. The arsenate, arsenite, and antimonite resistance was shown to be inducible by all three heavy metal ions. Inactivation of the first gene, arsR, resulted in constitutive expression of resistance. Similar results were obtained with transcriptional fusions of various portions of the ars genes with a lipase reporter gene, indicating a function of ArsR as a negative regulator of a putative promoter in front of arsR. The inactivation of arsR also resulted in reduction of resistance to arsenite and antimonite, while arsenate resistance was unaffected. The three ars genes conferred arsenite resistance in E. coli and arsenite as well as arsenate resistance in Bacillus subtilis. Images PMID:1534327

  5. The lncRNA MALAT1, acting through HIF-1α stabilization, enhances arsenite-induced glycolysis in human hepatic L-02 cells.

    PubMed

    Luo, Fei; Liu, Xinlu; Ling, Min; Lu, Lu; Shi, Le; Lu, Xiaolin; Li, Jun; Zhang, Aihua; Liu, Qizhan

    2016-09-01

    Accelerated glycolysis, a common process in tumor cells called the Warburg effect, is associated with various biological phenomena. However, the role of glycolysis induced by arsenite, a well-established human carcinogen, is unknown. Long non-coding RNAs (lncRNAs) act as regulators in various cancers, but how lncRNAs regulate glucose metabolism remains largely unexplored. We have found that, in human hepatic epithelial (L-02) cells, arsenite increases lactate production; glucose consumption; and expression of glycolysis-related genes, including HK-2, Eno-1, and Glut-4. In L-02 cells exposed to arsenite, the lncRNA, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), and hypoxia inducible factors (HIFs)-α, the transcriptional regulators of cellular response to hypoxia, are over-expressed. In addition, HIF-1α, not HIF-2α, is involved in arsenite-induced glycolysis, and MALAT1 enhances arsenite-induced glycolysis. Although MALAT1 regulates HIF-α and promotes arsenite-induced glycolysis, MALAT1 promotes glycolysis through HIF-1α, not HIF-2α. Moreover, arsenite-increased MALAT1 enhances the disassociation of Von Hippel-Lindau (VHL) tumor suppressor from HIF-1α, alleviating VHL-mediated ubiquitination of HIF-1α, which causes accumulation of HIF-1α. In sum, these findings indicate that MALAT1, acting through HIF-1α stabilization, is a mediator that enhances glycolysis induced by arsenite. These results provide a link between the induction of lncRNAs and the glycolysis in cells exposed to arsenite, and thus establish a previously unknown mechanism for arsenite-induced hepatotoxicity. PMID:27287256

  6. Elevated Transcription of the Gene QSOX1 Encoding Quiescin Q6 Sulfhydryl Oxidase 1 in Breast Cancer

    PubMed Central

    Soloviev, Mikhail; Esteves, Michelle P.; Amiri, Fakhria; Crompton, Mark R.; Rider, Christopher C.

    2013-01-01

    The q arm of chromosome 1 is frequently amplified at the gene level in breast cancer. Since the significance of this is unclear we investigated whether 1q genes are overexpressed in this disease. The cDNA levels of 1q-located genes were analysed in a search for overexpressed genes. 26 genes mapping to the 1q arm show highly significant (P≤0.01) overexpression of transcripts in breast cancer compared to normal breast tissue. Amongst those showing the highest levels of overexpression in both expressed sequence tag (EST) and serial analysis of gene expression (SAGE) databases was enzyme quiescin Q6 sulfhydryl oxidase 1 (QSOX1). We investigated QSOX1 cDNA derived from T47D breast carcinoma cells by RT-PCR and 3′-RACE PCR and identified a novel extended form of QSOX1 transcript, containing a long 3′UTR, nearly double the size of the previously reported QSOX1 cDNA, and confirmed its 3′ end nucleotide sequence using RACE-PCR. We also used quantitative real-time PCR to analyse a panel of cDNAs derived from 50 clinically-graded normal and malignant breast tissue samples for the expression of QSOX1 mRNAs. QSOX1 transcription was elevated in an increasing proportion in the grade 2 and grade 3 tumours (graded according to the Nottingham prognostic index), with 10 of the 15 grade 3 tumours (67%) examined exceeding the normal range. There was a significant correlation between relative transcript level and clinical grade (P≤0.01) for all qPCR primer sets tested. QSOX1 mRNA levels, based on SAGE expression data, did not correlate with either Estrogen Receptor (ER) or Epidermal Growth Factor Receptor 2 (ErbB-2 or HER2/neu) expression. Our data indicate that QSOX1 is a potential new prognostic marker which may prove of use in the staging of breast tumours and the stratification of breast cancer patients. PMID:23460839

  7. Second-order modeling of arsenite transport in soils

    NASA Astrophysics Data System (ADS)

    Zhang, Hua; Magdi Selim, H.

    2011-11-01

    Rate limited processes including kinetic adsorption-desorption can greatly impact the fate and behavior of toxic arsenic compounds in heterogeneous soils. In this study, miscible displacement column experiments were carried out to investigate the extent of reactivity during transport of arsenite in soils. Arsenite breakthrough curves (BTCs) of Olivier and Windsor soils exhibited strong retardation with diffusive effluent fronts followed by slow release or tailing during leaching. Such behavior is indicative of the dominance of kinetic retention reactions for arsenite transport in the soil columns. Sharp decrease or increase in arsenite concentration in response to flow interruptions (stop-flow) further verified that non-equilibrium conditions are dominant. After some 40-60 pore volumes of continued leaching, 30-70% of the applied arsenite was retained by the soil in the columns. Furthermore, continued arsenite slow release for months was evident by the high levels of residual arsenite concentrations observed during leaching. In contrast, arsenite transport in a reference sand material exhibited no retention where complete mass recovery in the effluent solution was attained. A second-order model (SOM) which accounts for equilibrium, reversible, and irreversible retention mechanisms was utilized to describe arsenite transport results from the soil columns. Based on inverse and predictive modeling results, the SOM model successfully depicted arsenite BTCs from several soil columns. Based on inverse and predictive modeling results, a second-order model which accounts for kinetic reversible and irreversible reactions is recommended for describing arsenite transport in soils.

  8. Molecular characterization of Echinococcus granulosus from Peru by sequencing of the mitochondrial cytochrome C oxidase subunit 1 gene.

    PubMed

    Sánchez, Elizabeth; Cáceres, Omar; Náquira, César; Garcia, David; Patiño, Gladys; Silvia, Herrera; Volotão, Aline C; Fernandes, Octavio

    2010-09-01

    Echinococcus granulosus, the etiologic agent of cystic echinococcosis (CE) in humans and other animal species, is distributed worldwide. Ten intra-specific variants, or genotypes (G1-G10), have been defined based on genetic diversity. To determine the genotypes present in endemic areas of Peru, samples were collected from cattle (44), sheep (41) and humans (14) from Junín, Puno Huancavelica, Cusco, Arequipa and Ayacucho. DNA was extracted from protoscolex and/or germinal layers derived from 99 E. granulosus isolates and used as templates to amplify the mitochondrial cytochrome C oxidase subunit 1 gene. The resulting polymerase chain reaction products were sequenced and further examined by sequence analysis. All isolates, independent of the host, exhibited the G1 genotype. Phylogenetic analysis showed that three isolates from Ayacucho shared the same cluster with microvariant G1(4). The G1 genotype is considered the most widespread and infectious form of E. granulosus worldwide and our results confirm that the same patterns apply to this country. Therefore, these findings should be taken into consideration in developing prevention strategies and control programs for CE in Peru. PMID:20944997

  9. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

    PubMed

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-01-01

    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma. PMID:21921941

  10. Mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence of Spirocerca lupi (Nematoda, Spirurida): avenues for potential implications.

    PubMed

    Traversa, Donato; Costanzo, Francesca; Iorio, Raffaella; Aroch, Itamar; Lavy, Eran

    2007-05-31

    Canine spirocercosis is a life-threatening parasitosis caused by Spirocerca lupi (Nematoda, Spirurida) that is presently emerging in several countries. This study characterised an informative region within the mitochondrial (mtDNA) gene encoding for the cytochrome c oxidase subunit 1 (cox1) of S. lupi by Polymerase Chain Reaction (PCR)-coupled sequencing. Specimens from five different countries in Europe, Asia and Africa were examined and two different sequence variants of cox1 (i.e. haplotypes) were determined, displaying nucleotidic variation at 6 of 689 positions. All of these positions were invariable among all the parasite individuals from Europe (haplotype 1) and among the African and Asian individuals (haplotype 2), but differed between Europe and Asia/Africa. The S. lupi cox1 sequences were consistent with those of other common Spirurida previously reported at both nucleotidic and phylogenetic levels. This study provides molecular information essential for identification of the nematode, irrespective of its life cycle stage. Crucial implications for the specific molecular diagnosis of clinical spirocercosis and investigation of the evolution, population genetics, ecology and epidemiology of S. lupi are discussed. PMID:17428608

  11. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs.

    PubMed

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-04-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5' homology arm (HA) of 8 kb and 3'HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3'HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  12. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  13. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  14. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.

    PubMed

    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  15. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    PubMed

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul). PMID:20924414

  16. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  17. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  18. Species delimitation and phylogenetic relationships of Chinese Leishmania isolates reexamined using kinetoplast cytochrome oxidase II gene sequences.

    PubMed

    Cao, De-Ping; Guo, Xian-Guang; Chen, Da-Li; Chen, Jian-Ping

    2011-07-01

    Leishmaniasis is a geographically widespread disease caused by protozoan parasites belonging to the genus Leishmania and transmitted by certain species of sand fly. This disease still remains endemic in China, especially in the west and northwest frontier regions. A recent ITS1 phylogeny of Chinese Leishmania isolates has challenged some aspects for their traditional taxonomy and cladistic hypotheses of their phylogeny. However, disagreement with respect to relationships within Chinese Leishmania isolates highlights the need for additional data and analyses. Here, we test the phylogenetic relationships among Chinese isolates and their relatives by analyzing kinetoplast cytochrome oxidase II (COII) gene sequences, including 14 Chinese isolates and three isolates from other countries plus 17 sequences retrieved from GenBank. The COII gene might have experienced little substitution saturation, and its evolutionary process was likely to have been stationary, reversible, and homogeneous. Both neighbor-joining and Bayesian analyses reveal a moderately supported group comprising ten newly determined isolates, which is closely related to Leishmania tarentolae and Endotrypanum monterogeii. In combination with genetic distance analysis as well as Bayesian hypothesis testing, this further corroborates the occurrence of an undescribed species of Leishmania. Our results also suggest that (1) isolate MHOM/CN/93/GS7 and isolate IPHL/CN/77/XJ771 are Leishmania donovani; (2) isolate MHOM/CN/84/JS1 is Leishmania tropica; (3) the status referring to an isolate MRHO/CN/62/GS-GER20 from a great gerbil in Gansu, China, as Leishmania gerbilli, formerly based on multilocus enzyme electrophoresis, is recognized; and (4) E. monterogeii is nested within the genus Leishmania, resulting in a paraphyletic Leishmania. In addition, the results of this study enrich our understanding of the heterogeneity and relationships of Chinese Leishmania isolates. PMID:21221640

  19. Secretory expression and purification of Aspergillus niger glucose oxidase in Saccharomyces cerevisiae mutant deficient in PMR1 gene.

    PubMed

    Ko, Ji-Hyun; Hahm, Moon Sun; Kang, Hyun Ah; Nam, Soo Wan; Chung, Bong Hyun

    2002-08-01

    The gene encoding glucose oxidase (GOD) from Aspergillus niger was expressed as a secretory product in the yeast Saccharomyces cerevisiae. Six consecutive histidine residues were fused to the C-terminus of GOD to facilitate purification. The recombinant GOD-His(6) secreted by S. cerevisiae migrated as a broad diffuse band on SDS-PAGE, with an apparent molecular weight higher than that in natural A. niger GOD. To investigate the effects of hyperglycosylation on the secretion efficiency and enzyme properties, GOD-His(6) was expressed and secreted in a S. cerevisiae mutant in which the PMR1 gene encoding Ca(++)-ATPase was disrupted. The pmr1 null mutant strain secreted an amount of GOD-His(6) per unit cell mass higher than that in the wild-type strain. In contrast to the hyperglycosylated GOD-His(6) secreted in the wild-type strain, the pmr1 mutant strain secreted GOD-His(6) in a homogeneous form with a protein band pattern similar to that in natural A. niger GOD, based on SDS-PAGE. The hyperglycosylated and pmr1Delta mutant-derived GOD-His(6) enzymes were purified to homogeneity by immobilized metal ion-affinity chromatography and their specific activities and stabilities were compared. The specific activity of the pmr1Delta mutant-derived GOD-His(6) on a protein basis was very similar to that of the hyperglycosylated GOD-His(6), although its pH and thermal stabilities were lower than those of the hyperglycosylated GOD-His(6). PMID:12182830

  20. Effects of nickel, chromate, and arsenite on histone 3 lysine methylation

    SciTech Connect

    Zhou Xue; Li Qin; Arita, Adriana; Sun Hong; Costa, Max

    2009-04-01

    Occupational exposure to nickel (Ni), chromium (Cr), and arsenic (As) containing compounds has been associated with lung cancer and other adverse health effects. Their carcinogenic properties may be attributable in part, to activation and/or repression of gene expression induced by changes in the DNA methylation status and histone tail post-translational modifications. Here we show that individual treatment with nickel, chromate, and arsenite all affect the gene activating mark H3K4 methylation. We found that nickel (1 mM), chromate (10 {mu}M), and arsenite (1 {mu}M) significantly increase tri-methyl H3K4 after 24 h exposure in human lung carcinoma A549 cells. Seven days of exposure to lower levels of nickel (50 and 100 {mu}M), chromate (0.5 and 1 {mu}M) or arsenite (0.1, 0.5 and 1 {mu}M) also increased tri-methylated H3K4 in A549 cells. This mark still remained elevated and inherited through cell division 7 days following removal of 1 {mu}M arsenite. We also demonstrate by dual staining immunofluorescence microscopy that both H3K4 tri-methyl and H3K9 di-methyl marks increase globally after 24 h exposure to each metal treatment in A549 cells. However, the tri-methyl H3K4 and di-methyl H3K9 marks localize in different regions in the nucleus of the cell. Thus, our study provides further evidence that a mechanism(s) of carcinogenicity of nickel, chromate, and arsenite metal compounds may involve alterations of various histone tail modifications that may in turn affect the expression of genes that may cause transformation.

  1. Members of rice plasma membrane intrinsic proteins subfamily are involved in arsenite permeability and tolerance in plants.

    PubMed

    Mosa, Kareem A; Kumar, Kundan; Chhikara, Sudesh; Mcdermott, Joseph; Liu, Zijuan; Musante, Craig; White, Jason C; Dhankher, Om Parkash

    2012-12-01

    Rice accumulates high level of arsenic (As) in its edible parts and thus plays an important role in the transfer of As into the food chain. However, the mechanisms of As uptake and its detoxification in rice are not well understood. Recently, members of the Nodulin 26-like intrinsic protein (NIP) subfamily of plant aquaporins were shown to transport arsenite in rice and Arabidopsis. Here we report that members of the rice plasma membrane intrinsic protein (PIP) subfamily are also involved in As tolerance and transport. Based on the homology search with the mammalian AQP9 and yeast Fps1 arsenite transporters, we identified and cloned five rice PIP gene subfamily members. qRT-PCR analysis of PIPs in rice root and shoot tissues revealed a significant down regulation of transcripts encoding OsPIP1;2, OsPIP1;3, OsPIP2;4, OsPIP2;6, and OsPIP2;7 in response to arsenite treatment. Heterologous expression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Xenopus laevis oocytes significantly increased the uptake of arsenite. Overexpression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Arabidopsis yielded enhanced arsenite tolerance and higher biomass accumulation. Further, these transgenic plants showed no significant accumulation of As in shoot and root tissues in long term uptake assays. Whereas, short duration exposure to arsenite caused both active influx and efflux of As in the roots. The data suggests a bidirectional arsenite permeability of rice PIPs in plants. These rice PIPs genes will be highly useful for engineering important food and biofuel crops for enhanced crop productivity on contaminated soils without increasing the accumulation of toxic As in the biomass or edible tissues. PMID:22350764

  2. Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations.

    PubMed

    Kovářová, Nikola; Cížková Vrbacká, Alena; Pecina, Petr; Stránecký, Viktor; Pronicka, Ewa; Kmoch, Stanislav; Houštěk, Josef

    2012-07-01

    The loss of Surf1 protein leads to a severe COX deficiency manifested as a fatal neurodegenerative disorder, the Leigh syndrome (LS(COX)). Surf1 appears to be involved in the early step of COX assembly but its function remains unknown. The aim of the study was to find out how SURF1 gene mutations influence expression of OXPHOS and other pro-mitochondrial genes and to further characterize the altered COX assembly. Analysis of fibroblast cell lines from 9 patients with SURF1 mutations revealed a 70% decrease of the COX complex content to be associated with 32-54% upregulation of respiratory chain complexes I, III and V and accumulation of Cox5a subunit. Whole genome expression profiling showed a general decrease of transcriptional activity in LS(COX) cells and indicated that the adaptive changes in OXPHOS complexes are due to a posttranscriptional compensatory mechanism. Electrophoretic and WB analysis showed that in mitochondria of LS(COX) cells compared to controls, the assembled COX is present entirely in a supercomplex form, as I-III₂-IV supercomplex but not as larger supercomplexes. The lack of COX also caused an accumulation of I-III₂ supercomplex. The accumulated Cox5a was mainly present as a free subunit. We have found out that the major COX assembly subcomplexes accumulated due to SURF1 mutations range in size between approximately 85-140kDa. In addition to the originally proposed S2 intermediate they might also represent Cox1-containing complexes lacking other COX subunits. Unlike the assembled COX, subcomplexes are unable to associate with complexes I and III. PMID:22465034

  3. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  4. Regulation of arsenite oxidation by the phosphate two-component system PhoBR in Halomonas sp. HAL1.

    PubMed

    Chen, Fang; Cao, Yajing; Wei, Sha; Li, Yanzhi; Li, Xiangyang; Wang, Qian; Wang, Gejiao

    2015-01-01

    Previously, the expression of arsenite [As(III)] oxidase genes aioBA was reported to be regulated by a three-component regulatory system, AioXSR, in a number of As(III)-oxidizing bacterial strains. However, the regulation mechanism is still unknown when aioXSR genes are absent in some As(III)-oxidizing bacterial genomes, such as in Halomonas sp. HAL1. In this study, transposon mutagenesis and gene knock-out mutation were performed, and two mutants, HAL1-phoR 931 and HAL1-▵phoB, were obtained in strain HAL1. The phoR and phoB constitute a two-component system which is responsible for phosphate (Pi) acquisition and assimilation. Both of the mutants showed negative As(III)-oxidation phenotypes in low Pi condition (0.1 mM) but not under normal Pi condition (1 mM). The phoBR complementation strain HAL1-▵phoB-C reversed the mutants' null phenotypes back to wild type status. Meanwhile, lacZ reporter fusions using pCM-lacZ showed that the expression of phoBR and aioBA were both induced by As(III) but were not induced in HAL1-phoR 931 and HAL1-▵phoB. Using 15 consensus Pho box sequences, a putative Pho box was found in the aioBA regulation region. PhoB was able to bind to the putative Pho box in vivo (bacterial one-hybrid detection) and in vitro (electrophoretic mobility gel shift assay), and an 18-bp binding sequence containing nine conserved bases were determined. This study provided the evidence that PhoBR regulates the expression of aioBA in Halomonas sp. HAL1 under low Pi condition. The new regulation model further implies the close metabolic connection between As and Pi. PMID:26441863

  5. Regulation of arsenite oxidation by the phosphate two-component system PhoBR in Halomonas sp. HAL1

    PubMed Central

    Chen, Fang; Cao, Yajing; Wei, Sha; Li, Yanzhi; Li, Xiangyang; Wang, Qian; Wang, Gejiao

    2015-01-01

    Previously, the expression of arsenite [As(III)] oxidase genes aioBA was reported to be regulated by a three-component regulatory system, AioXSR, in a number of As(III)-oxidizing bacterial strains. However, the regulation mechanism is still unknown when aioXSR genes are absent in some As(III)-oxidizing bacterial genomes, such as in Halomonas sp. HAL1. In this study, transposon mutagenesis and gene knock-out mutation were performed, and two mutants, HAL1-phoR931 and HAL1-▵phoB, were obtained in strain HAL1. The phoR and phoB constitute a two-component system which is responsible for phosphate (Pi) acquisition and assimilation. Both of the mutants showed negative As(III)-oxidation phenotypes in low Pi condition (0.1 mM) but not under normal Pi condition (1 mM). The phoBR complementation strain HAL1-▵phoB-C reversed the mutants' null phenotypes back to wild type status. Meanwhile, lacZ reporter fusions using pCM-lacZ showed that the expression of phoBR and aioBA were both induced by As(III) but were not induced in HAL1-phoR931 and HAL1-▵phoB. Using 15 consensus Pho box sequences, a putative Pho box was found in the aioBA regulation region. PhoB was able to bind to the putative Pho box in vivo (bacterial one-hybrid detection) and in vitro (electrophoretic mobility gel shift assay), and an 18-bp binding sequence containing nine conserved bases were determined. This study provided the evidence that PhoBR regulates the expression of aioBA in Halomonas sp. HAL1 under low Pi condition. The new regulation model further implies the close metabolic connection between As and Pi. PMID:26441863

  6. The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase.

    PubMed

    Altamura, N; Capitanio, N; Bonnefoy, N; Papa, S; Dujardin, G

    1996-03-11

    The nuclear gene OXA1 was first isolated in Saccharomyces cerevisiae and found to be required at a post-translational step in cytochrome c oxidase biogenesis, probably at the level of assembly. Mutations in OXA1 lead to a complete respiratory deficiency. The protein Oxa1p is conserved through evolution and a human homolog has been isolated by functional complementation of a yeast oxa1- mutant. In order to further our understanding of the role of Oxa1p, we have constructed two yeast strains in which the OXA1 open reading frame was almost totally deleted. Cytochrome spectra and enzymatic activity measurements show the absence of heme aa3 and of a cytochrome c oxido-reductase activity and dramatic decrease of the oligomycin sensitive ATPase activity. Analysis of the respiratory complexes in non-denaturing gels reveals that Oxa1p is necessary for the correct assembly of the cytochrome c oxidase and the ATP synthase complex. PMID:8612730

  7. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.

    2013-01-01

    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  8. CYP99A3: functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice.

    PubMed

    Wang, Qiang; Hillwig, Matthew L; Peters, Reuben J

    2011-01-01

    Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochrome P450 (CYP) mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNA interference double knock-down of this pair of closely related CYPs reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which was ultimately achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al, and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al, and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene-derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  9. Chemolithoautotrophic arsenite oxidation by a thermophilic Anoxybacillus flavithermus strain TCC9-4 from a hot spring in Tengchong of Yunnan, China

    PubMed Central

    Jiang, Dawei; Li, Ping; Jiang, Zhou; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Guo, Qinghai; Wang, Yanxin

    2015-01-01

    A new facultative chemolithoautotrophic arsenite (AsIII)-oxidizing bacterium TCC9-4 was isolated from a hot spring microbial mat in Tengchong of Yunnan, China. This strain could grow with AsIII as an energy source, CO2–HCO3- as a carbon source and oxygen as the electron acceptor in a minimal salts medium. Under chemolithoautotrophic conditions, more than 90% of 100 mg/L AsIII could be oxidized by the strain TCC9-4 in 36 h. Temperature was an important environmental factor that strongly influenced the AsIII oxidation rate and AsIII oxidase (Aio) activity; the highest Aio activity was found at the temperature of 40∘C. Addition of 0.01% yeast extract enhanced the growth significantly, but delayed the AsIII oxidation. On the basis of 16S rRNA phylogenetic sequence analysis, strain TCC9-4 was identified as Anoxybacillus flavithermus. To our best knowledge, this is the first report of arsenic (As) oxidation by A. flavithermus. The Aio gene in TCC9-4 might be quite novel relative to currently known gene sequences. The results of this study expand our current understanding of microbially mediated As oxidation in hot springs. PMID:25999920

  10. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  11. Cloning and expression in Escherichia coli of the D-aspartate oxidase gene from the yeast Cryptococcus humicola and characterization of the recombinant enzyme.

    PubMed

    Takahashi, Shouji; Takahashi, Toshiyuki; Kera, Yoshio; Matsunaga, Ryuji; Shibuya, Hiroo; Yamada, Ryo-hei

    2004-04-01

    The D-aspartate oxidase (DDO) from the yeast Cryptococcus humicola UJ1 (ChDDO) is highly specific to D-aspartate. The gene encoding ChDDO was cloned and expressed in Escherichia coli. Sequence analysis of the ChDDO gene showed that an open reading frame of 1,110 bp interrupted by two introns encodes a protein of 370 amino acids. The deduced amino acid sequence showed an FAD-binding motif and a peroxisomal targeting signal 1 in the N-terminal region and at the C-terminus, respectively, and also the presence of certain catalytically important amino acid residues corresponding to those catalytically important in D-amino acid oxidase (DAO). The sequence exhibited only a moderate identity to human (27.4%) and bovine (28.0%) DDOs, and a rather higher identity to yeast and fungal DAOs (30.4-33.2%). Similarly, phylogenetic analysis showed that ChDDO is more closely related to yeast and fungal DAOs than to mammalian DDOs. The gene expression was regulated at the transcriptional level and specifically induced by the presence of D-aspartate as the sole nitrogen source. ChDDO was expressed in an active form in E. coli to an approximately 5-fold greater extent than in yeast. The purified recombinant enzyme was identical to the native enzyme in physicochemical and catalytic properties. PMID:15115779

  12. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  13. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  14. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  15. Novel autotrophic arsenite-oxidizing bacteria isolated from soil and sediments.

    PubMed

    Garcia-Dominguez, Elizabeth; Mumford, Adam; Rhine, Elizabeth Danielle; Paschal, Amber; Young, Lily Y

    2008-11-01

    Arsenic oxidation is recognized as being mediated by both heterotrophic and chemoautotrophic microorganisms. Enrichment cultures were established to determine whether chemoautotrophic microorganisms capable of oxidizing arsenite As(III) to arsenate As(V) are present in selected contaminated but nonextreme environments. Three new organisms, designated as strains OL-1, S-1 and CL-3, were isolated and found to oxidize 10 mM arsenite to arsenate under aerobic conditions using CO2-bicarbonate (CO2/HCO3-) as a carbon source. Based on 16S rRNA gene sequence analyses, strain OL-1 was 99% most closely related to the genus Ancylobacter, strain S-1 was 99% related to Thiobacillus and strain CL-3 was 98% related to the genus Hydrogenophaga. The isolates are facultative autotrophs and growth of isolated strains on different inorganic electron donors other than arsenite showed that all three had a strong preference for several sulfur species, while CL-3 was also able to grow on ammonium and nitrite. The RuBisCO Type I (cbbL) gene was positively amplified and sequenced in strain CL-3, and the Type II (cbbM) gene was detected in strains OL-1 and S-1, supporting the autotrophic nature of the organisms. PMID:18717738

  16. Sensitivity to sodium arsenite in human melanoma cells depends upon susceptibility to arsenite-induced mitotic arrest

    SciTech Connect

    McNeely, Samuel C.; Belshoff, Alex C.; Taylor, B. Frazier; Fan, Teresa W-M.; McCabe, Michael J.; Pinhas, Allan R.

    2008-06-01

    Arsenic induces clinical remission in patients with acute promyelocytic leukemia and has potential for treatment of other cancers. The current study examines factors influencing sensitivity to arsenic using human malignant melanoma cell lines. A375 and SK-Mel-2 cells were sensitive to clinically achievable concentrations of arsenite, whereas SK-Mel-3 and SK-Mel-28 cells required supratherapeutic levels for toxicity. Inhibition of glutathione synthesis, glutathione S-transferase (GST) activity, and multidrug resistance protein (MRP) transporter function attenuated arsenite resistance, consistent with studies suggesting that arsenite is extruded from the cell as a glutathione conjugate by MRP-1. However, MRP-1 was not overexpressed in resistant lines and GST-{pi} was only slightly elevated. ICP-MS analysis indicated that arsenite-resistant SK-Mel-28 cells did not accumulate less arsenic than arsenite-sensitive A375 cells, suggesting that resistance was not attributable to reduced arsenic accumulation but rather to intrinsic properties of resistant cell lines. The mode of arsenite-induced cell death was apoptosis. Arsenite-induced apoptosis is associated with cell cycle alterations. Cell cycle analysis revealed arsenite-sensitive cells arrested in mitosis whereas arsenite-resistant cells did not, suggesting that induction of mitotic arrest occurs at lower intracellular arsenic concentrations. Higher intracellular arsenic levels induced cell cycle arrest in the S-phase and G{sub 2}-phase in SK-Mel-3 and SK-Mel-28 cells, respectively. The lack of arsenite-induced mitotic arrest in resistant cell lines was associated with a weakened spindle checkpoint resulting from reduced expression of spindle checkpoint protein BUBR1. These data suggest that arsenite has potential for treatment of solid tumors but a functional spindle checkpoint is a prerequisite for a positive response to its clinical application.

  17. ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    EPA Science Inventory

    ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    Useful biomarkers of arsenic effects in both experimental animals and humans are needed. Arsenate and arsenite are good inducers of rat hepatic and renal heme oxygenase (HO); monomethylarsonic acid (MMA) and dimethylarsi...

  18. METHYLATION OF ARSENITE BY SOME MAMMALIAN CELL LINES

    EPA Science Inventory

    THIS ABSTRACT WAS SUBMITTED ELECTRONICALLY;. SPACE CONSTRAINTS WERE SEVERE)

    Methylation of Arsenite by Some Mammalian Cell Lines.

    Methylation of arsenite is thought to play an important role in the carcinogenicity of arsenic.
    Aim 1: Determine if there is diffe...

  19. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.

    PubMed

    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  20. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  1. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.

    1999-04-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  2. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.

    PubMed

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

    2012-01-01

    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  3. The sequence divergence in cytochrome C oxidase I gene of Culex quinquefasciatus mosquito and its comparison with four other Culex species.

    PubMed

    Tahir, Hafiz Muhammad; Kanwal, Naila; Mehwish

    2016-07-01

    The genetic diversity of Culex quinquefasciatus mosquito based on the standard barcode region of cytochrome C oxidase I (COI) gene fragment was studied in the present study. The COI gene sequences of Cx. quinquefasciatus were also compared with four other species of Genus Culex (i.e. Cx. tritaeniorhynchus, Cx. fuscocephala, Cx. pipiens, and Cx. theileri). Our data set included sequences of Culex mosquitoes from 16 different countries of world. The average intraspecific and interspecific divergences recorded were 0.67% and 8.27%, respectively. The clades for five species were clearly separated except Cx. quinquefasciatus and Cx. pipiens. It is concluded that the DNA barcoding is effective and reliable tool for the identification of selected Culex species but create little problem in case of sister species. PMID:26258502

  4. Facultative anoxygenic photosynthesis in cyanobacteria driven by arsenite and sulfide with evidence for the support of nitrogen fixation

    NASA Astrophysics Data System (ADS)

    Wolfe-Simon, F.; Hoeft, S. E.; Baesman, S. M.; Oremland, R. S.

    2010-12-01

    The rise in atmospheric oxygen (O2) over geologic time is attributed to the evolution and widespread proliferation of oxygenic photosynthesis in cyanobacteria. However, cyanobacteria maintain a metabolic flexibility that may not always result in O2 release. In the environment, cyanobacteria may use a variety of alternative electron donors rather than water that are known to be used by other anoxygenic phototrophs (eg. purple sulfur bacteria) including reduced forms of sulfur, iron, nitrogen, and arsenic. Recent evidence suggests cyanobacteria actively take advantage of at least a few of these alternatives. We used a classical Winogradsky approach to enrich for cyanobacteria from the high salinity, elevated pH and arsenic-enriched waters of Mono Lake (CA). Experiments, optimized for cyanobacteria, revealed light-dependent, anaerobic arsenite-oxidation in sub-cultured sediment-free enrichments dominated by a filamentous cyanobacteria. We isolated and identified the dominant member of this enrichment to be a member of the Oscillatoriales by 16S rDNA. Addition of 1 mM arsenite induced facultative anoxygenic photosynthesis under continuous and circadian light. This isolate also oxidized sulfide under the same light-based conditions. Aerobic conditions elicited no arsenite oxidation in the light or dark and the isolate grew as a typical cyanobacterium using oxygenic photosynthesis. Under near-infrared light (700 nm) there was a direct correlation of enhanced growth with an increase in the rate arsenite or sulfide oxidation suggesting the use of photosystem I. Additionally, to test the wide-spread nature of this metabolism in the Oscillatoriales, we followed similar arsenite- and sulfide-driven facultative anoxygenic photosynthesis as well as nitrogen fixation (C2H2 reduction) in the axenic isolate Oscillatoria sp. CCMP 1731. Future characterization includes axenic isolation of the Mono Lake Oscillatoria sp. as well as the arsenite oxidase responsible for electron

  5. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.

    PubMed

    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing

    2014-09-01

    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function. PMID:24890187

  6. A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

  7. How sodium arsenite improve amyloid β-induced memory deficit?

    PubMed

    Nassireslami, Ehsan; Nikbin, Parmida; Amini, Elham; Payandemehr, Borna; Shaerzadeh, Fatemeh; Khodagholi, Fariba; Yazdi, Behnoosh Bonakdar; Kebriaeezadeh, Abbas; Taghizadeh, Ghorban; Sharifzadeh, Mohammad

    2016-09-01

    Evidence has shown that arsenic exposure, besides its toxic effects results in impairment of learning and memory, but its molecular mechanisms are not fully understood. In the present study, we examined sodium arsenite (1, 5, 10, 100nM) effects on contextual and tone memory of male rats in Pavlovian fear conditioning paradigm alone and in co-administration with β-amyloid. We detected changes in the level of caspase-3, nuclear factor kappa-B (NF-κB), cAMP response element-binding (CREB), heme oxygenase-1 and NF-E2-related factor-2 (Nrf2) by Western blot. Sodium arsenite in high doses induced significant memory impairment 9 and 16days after infusion. By contrast, low doses of sodium arsenite attenuate memory deficit in Aβ injected rats after 16days. Our data revealed that treatment with high concentration of sodium arsenite increased caspase-3 cleavage and NF-κB level, 9days after injection. Whereas, low doses of sodium arsenite cause Nrf2 and HO-1 activation and increased CREB phosphorylation in the hippocampus. These findings suggest the concentration dependent effects of sodium arsenite on contextual and tone memory. Moreover, it seems that the neuroprotective effects of ultra-low concentrations of sodium arsenite on Aβ-induced memory impairment is mediated via an increase Nrf2, HO-1 and CREB phosphorylation levels and decrease caspase-3 and NF-κB amount. PMID:27129674

  8. Effects of arsenic on modification of promyelocytic leukemia (PML): PML responds to low levels of arsenite

    SciTech Connect

    Hirano, Seishiro; Watanabe, Takayuki; Kobayashi, Yayoi

    2013-12-15

    Inorganic arsenite (iAs{sup 3+}) is a two-edged sword. iAs{sup 3+} is a well-known human carcinogen; nevertheless, it has been used as a therapeutic drug for acute promyelocytic leukemia (APL), which is caused by a fusion protein comprising retinoic acid receptor-α and promyelocytic leukemia (PML). PML, a nuclear transcription factor, has a RING finger domain with densely positioned cysteine residues. To examine PML-modulated cellular responses to iAs{sup 3+}, CHO-K1 and HEK293 cells were each used to establish cell lines that expressed ectopic human PML. Overexpression of PML increased susceptibility to iAs{sup 3+} in CHO-K1 cells, but not in HEK293 cells. Exposure of PML-transfected cells to iAs{sup 3+} caused PML to change from a soluble form to less soluble forms, and this modification of PML was observable even with just 0.1 μM iAs{sup 3+} (7.5 ppb). Western blot and immunofluorescent microscopic analyses revealed that the biochemical changes of PML were caused at least in part by conjugation with small ubiquitin-like modifier proteins (SUMOylation). A luciferase reporter gene was used to investigate whether modification of PML was caused by oxidative stress or activation of antioxidant response element (ARE) in CHO-K1 cells. Modification of PML protein occurred faster than activation of the ARE in response to iAs{sup 3+}, suggesting that PML was not modified as a consequence of oxidative stress-induced ARE activation. - Highlights: • PML was found in nuclear microspecles in response to arsenite. • Arsenite triggers SUMOylation of PML. • Arsenite modifies PML at as low as 0.1 μM. • Modification of PML is not caused by ARE activation.

  9. Decreased shoot stature and grain alpha-amylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat.

    PubMed

    Appleford, Nigel E J; Wilkinson, Mark D; Ma, Qian; Evans, Daniel J; Stone, Marlon C; Pearce, Stephen P; Powers, Stephen J; Thomas, Stephen G; Jones, Huw D; Phillips, Andrew L; Hedden, Peter; Lenton, John R

    2007-01-01

    Ectopic expression of a gibberellin 2-oxidase gene (PcGA2ox1) decreased the content of bioactive gibberellins (GAs) in transgenic wheat, producing a range of dwarf plants with different degrees of severity. In at least one case, a single transformation event gave rise to T(1) plants with different degrees of dwarfism, the phenotypes being stably inherited over at least four generations. The dwarf phenotype, which included dark-green leaves, increased tillering and, in severe cases, a prostrate growth habit, was replicated by the application of a GA biosynthesis inhibitor to the wild type. Ear rachis length, grain set, and grain size were also decreased in the wheat transformants, compared with an azygous (null) line. The extent of post-germination alpha-amylase production in grains reflected the severity of the shoot phenotype of the transformants and both developmental processes were restored to normal by the application of gibberellic acid (GA(3)). Expression of two GA biosynthesis genes (TaGA20ox1 and TaGA3ox2) was up-regulated, and that of two alpha-amylase gene families (alpha-Amy1 and alpha-Amy2) down regulated, in scutella of semi-dwarf lines, compared with controls. The marked decline in transcript abundance of both alpha-amylase gene families in aleurone was associated with a decreased content of bioactive GAs in grains of the semi-dwarf lines. PMID:17916639

  10. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  11. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

    PubMed

    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step. PMID:26287950

  12. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  13. A Vacuolar Arsenite Transporter Necessary for Arsenic Tolerance in the Arsenic Hyperaccumulating Fern Pteris vittata Is Missing in Flowering Plants[W][OA

    PubMed Central

    Indriolo, Emily; Na, GunNam; Ellis, Danielle; Salt, David E.; Banks, Jo Ann

    2010-01-01

    The fern Pteris vittata tolerates and hyperaccumulates exceptionally high levels of the toxic metalloid arsenic, and this trait appears unique to the Pteridaceae. Once taken up by the root, arsenate is reduced to arsenite as it is transported to the lamina of the frond, where it is stored in cells as free arsenite. Here, we describe the isolation and characterization of two P. vittata genes, ACR3 and ACR3;1, which encode proteins similar to the ACR3 arsenite effluxer of yeast. Pv ACR3 is able to rescue the arsenic-sensitive phenotypes of yeast deficient for ACR3. ACR3 transcripts are upregulated by arsenic in sporophyte roots and gametophytes, tissues that directly contact soil, whereas ACR3;1 expression is unaffected by arsenic. Knocking down the expression of ACR3, but not ACR3;1, in the gametophyte results in an arsenite-sensitive phenotype, indicating that ACR3 plays a necessary role in arsenic tolerance in the gametophyte. We show that ACR3 localizes to the vacuolar membrane in gametophytes, indicating that it likely effluxes arsenite into the vacuole for sequestration. Whereas single-copy ACR3 genes are present in moss, lycophytes, other ferns, and gymnosperms, none are present in angiosperms. The duplication of ACR3 in P. vittata and the loss of ACR3 in angiosperms may explain arsenic tolerance in this unusual group of ferns while precluding the same trait in angiosperms. PMID:20530755

  14. [Genetic variation and differentiation of wood mice from the genus Sylvaemus inferred from sequencing of the cytochrome oxidase subunit 1 gene fragment].

    PubMed

    Bogdanov, A S; Stakheev, V V; Zykov, A E; Iakimenko, V V; Mal'kova, M G

    2012-02-01

    To ascertain intra- and interspecific differentiation patterns of some Sylvaemus wood mice species (S. uralensis, S. sylvaticus, S. ponticus, S. flavicollis, and S. fulvipectus), sequence variation of the mitochondrial cytochrome oxidase subunit I gene (COI) fragment (654 bp) was analyzed and the data obtained using several molecular genetic markers were compared. Distinct isolation of all Sylvaemus species (including closely related allopatric S. flavicollis and S. ponticus), as well as of the European and Asian races of pygmy wood mouse S. uralensis at the COI gene was demonstrated. However, genetic differences of the Sylvaemus species were 1.5 times and more higher than the distance (D) between the races of S. uralenciis. This finding provides no ample grounds to treat the latter as the independent species. The only specimen of Pamir-Alay subspecies S. uralensis pallipes examined showed closest relatedness to to the Asian race, although was rather distant from it (D = 0.038). No reliable isolation of the eastern European and southern European chromosomal forms, representing the European race of S. uralensis, as well as of their presumptive hybrids from the outskirts of the city of Sal'sk, Rostov region, at the COI gene was revealed. A hybrid origin of the populations of pygmy wood mouse from the outskirts of the Talapker railway station, Novovarshavsky district, Omsk region, was confirmed. In preliminary studies, based on karyotypic characters, these populations were diagnosed as distant hybrids of the eastern European chromosomal form and the Asian race. In yellow-necked wood mouse S. flavicollis from the territory of Russia and Ukraine, weak differentiation into northern and southern lineages (with mean genetic distance between them of 0.020) was observed. Considerably different relative genetic distances between the races of S. uralensis and the S. flavicollis--S. ponticus species pair, inferred from the mitochondrial cytochrome oxidase and cytochrome b gene

  15. Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    PubMed Central

    2013-01-01

    Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

  16. Photoinduced Oxidation of Arsenite to Arsenate on Ferrihydrite

    SciTech Connect

    N Bhandari; R Reeder; D Strongin

    2011-12-31

    The photochemistry of an aqueous suspension of the iron oxyhydroxide, ferrihydrite, in the presence of arsenite has been investigated using attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR), X-ray absorption near edge structure (XANES), and solution phase analysis. Both ATR-FTIR and XANES show that the exposure of ferrihydrite to arsenite in the dark leads to no change in the As oxidation state, but the exposure of this arsenite-bearing surface, which is in contact with pH 5 water, to light leads to the conversion of the majority of the adsorbed arsenite to the As(V) bearing species, arsenate. Analysis of the solution phase shows that ferrous iron is released into solution during the oxidation of arsenite. The photochemical reaction, however, shows the characteristics of a self-terminating reaction in that there is a significant suppression of this redox chemistry before 10% of the total iron making up the ferrihydrite partitions into solution as ferrous iron. The self-terminating behavior exhibited by this photochemical arsenite/ferrihydrite system is likely due to the passivation of the ferrihydrite surface by the strongly bound arsenate product.

  17. Inorganic arsenite alters macrophage generation from human peripheral blood monocytes

    SciTech Connect

    Sakurai, Teruaki . E-mail: sakurai@ls.toyaku.ac.jp; Ohta, Takami; Fujiwara, Kitao

    2005-03-01

    Inorganic arsenite has caused severe inflammatory chronic poisoning in humans through the consumption of contaminated well water. In this study, we examined the effects of arsenite at nanomolar concentrations on the in vitro differentiation of human macrophages from peripheral blood monocytes. While arsenite was found to induce cell death in a culture system containing macrophage colony stimulating factor (M-CSF), macrophages induced by granulocyte-macrophage CSF (GM-CSF) survived the treatment, but were morphologically, phenotypically, and functionally altered. In particular, arsenite-induced cells expressed higher levels of a major histocompatibility complex (MHC) class II antigen, HLA-DR, and CD14. They were more effective at inducing allogeneic or autologous T cell responses and responded more strongly to bacterial lipopolysaccharide (LPS) by inflammatory cytokine release as compared to cells induced by GM-CSF alone. On the other hand, arsenite-induced cells expressed lower levels of CD11b and CD54 and phagocytosed latex beads or zymosan particles less efficiently. We also demonstrated that the optimum amount of cellular reactive oxygen species (ROS) induced by nM arsenite might play an important role in this abnormal monocyte differentiation. This work may have implications in chronic arsenic poisoning because the total peripheral blood arsenic concentrations of these patients are at nM levels.

  18. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  19. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  20. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  1. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  2. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.

    PubMed

    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

    2012-08-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  3. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.

    PubMed

    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A

    2016-08-30

    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  4. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants. PMID:22009051

  5. Sodium arsenite accelerates TRAIL-mediated apoptosis in melanoma cells through upregulation of TRAIL-R1/R2 surface levels and downregulation of cFLIP expression

    SciTech Connect

    Ivanov, Vladimir N. . E-mail: vni3@columbia.edu; Hei, Tom K.

    2006-12-10

    AP-1/cJun, NF-{kappa}B and STAT3 transcription factors control expression of numerous genes, which regulate critical cell functions including proliferation, survival and apoptosis. Sodium arsenite is known to suppress both the IKK-NF-{kappa}B and JAK2-STAT3 signaling pathways and to activate the MAPK/JNK-cJun pathways, thereby committing some cancers to undergo apoptosis. Indeed, sodium arsenite is an effective drug for the treatment of acute promyelocytic leukemia with little nonspecific toxicity. Malignant melanoma is highly refractory to conventional radio- and chemotherapy. In the present study, we observed strong effects of sodium arsenite treatment on upregulation of TRAIL-mediated apoptosis in human and mouse melanomas. Arsenite treatment upregulated surface levels of death receptors, TRAIL-R1 and TRAIL-R2, through increased translocation of these proteins from cytoplasm to the cell surface. Furthermore, activation of cJun and suppression of NF-{kappa}B by sodium arsenite resulted in upregulation of the endogenous TRAIL and downregulation of the cFLIP gene expression (which encodes one of the main anti-apoptotic proteins in melanomas) followed by cFLIP protein degradation and, finally, by acceleration of TRAIL-induced apoptosis. Direct suppression of cFLIP expression by cFLIP RNAi also accelerated TRAIL-induced apoptosis in these melanomas, while COX-2 suppression substantially increased levels of both TRAIL-induced and arsenite-induced apoptosis. In contrast, overexpression of permanently active AKTmyr inhibited TRAIL-mediated apoptosis via downregulation of TRAIL-R1 levels. Finally, AKT overactivation increased melanoma survival in cell culture and dramatically accelerated growth of melanoma transplant in vivo, highlighting a role of AKT suppression for effective anticancer treatment.

  6. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  7. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  8. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

    2012-01-01

    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  9. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  10. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  11. Increased tolerance to oxidative stress in transgenic tobacco expressing a wheat oxalate oxidase gene via induction of antioxidant enzymes is mediated by H2O2.

    PubMed

    Wan, Xiaoqing; Tan, Jiali; Lu, Shaoyun; Lin, Chuyu; Hu, Yihong; Guo, Zhenfei

    2009-05-01

    Hydrogen peroxide (H(2)O(2)) plays a key role in the regulation of plant responses to various environmental stresses and modulates the expression of related genes including those encoding antioxidant enzymes. A wheat oxalate oxidase (OxO) gene was transformed and expressed in tobacco for production of H(2)O(2). The transgenic plants exhibited enhanced OxO activities and H(2)O(2) concentrations, which was blocked by inhibitors of OxO. The transgenic plants showed increased tolerance to methyl viologen (MV) or high light-induced oxidative stress in both short-time and long-time tests by measuring their maximal photochemical efficiency of PSII (F(v)/F(m)), ion leakage and malondialdehyde. Higher activities and transcripts of antioxidant enzymes (superoxide dismutase, catalase, ascorbate peroxidase and glutathione reductase) were observed in the transgenic plants compared to their wild-type controls under normal growth conditions. Pretreatments with inhibitors of OxO and scavenger of H(2)O(2) blocked the increase of tolerance to MV-induced or high light-induced oxidative stress, as well as the induction of antioxidant enzyme activities. Pretreatments with H(2)O(2) increased tolerance to oxidative stresses and antioxidant enzyme activities. It is suggested that H(2)O(2) produced by OxO in the transgenic tobacco plants triggers the signaling pathways to upregulate expressions of antioxidant enzyme genes, which in turn results in the increase of tolerance to MV-induced and high light-induced oxidative stresses. PMID:19508366

  12. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  13. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-08-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  14. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.

    PubMed

    Sagor, G H M; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  15. Constitutive co-suppression of the GA 20-oxidase1 gene in tomato leads to severe defects in vegetative and reproductive development.

    PubMed

    Olimpieri, Irene; Caccia, Riccardo; Picarella, Maurizio Enea; Pucci, Anna; Santangelo, Enrico; Soressi, Gian Piero; Mazzucato, Andrea

    2011-03-01

    To dissect the role of gibberellins in tomato development, we have constitutively down-regulated the gene GA 20-oxidase1 (GA20ox1). Plants co-suppressed for GA20ox1 (referred to as CO-6 plants) showed vegetative defects typical of GA deficiency such as darker and mis-shaped leaves and dwarfism. CO-6 plants flowered as the controls, although their flowers had subtle defects in the pedicel and in organ insertion. Analysis of male development revealed defects before, during and after meiosis, and a final pollen viability of 22%. The development of female organs and gametes appeared normal. Pollination experiments indicated that the pollen produced by CO-6 plants was able to fertilize control ovaries, but the analysis of the progeny showed that the construct was not transmitted. Ovaries of CO-6 plants showed high fruit set and normal fruit development when pollinated with control pollen. However these fruits were completely seedless due to a stenospermocarpic behaviour that was evidenced by callose layering in the endothelium between 7 and 15 days after pollination. We conclude that GA20ox1 in tomato exerts specific developmental roles that are not redundantly shared with other members of this gene family. For reproductive male development, silencing of this gene is detrimental for pollen production and either gametophytically lethal or severely hampering seed germination. In the pistil, the co-suppression construct does not affect the progamic phase, nor fruit set and growth, but it interferes with seed development after fertilization leading to seed abortion. PMID:21421397

  16. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-01-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  17. Regulation of the Alternative Oxidase Aox1 Gene in Chlamydomonas reinhardtii. Role of the Nitrogen Source on the Expression of a Reporter Gene under the Control of the Aox1 Promoter1

    PubMed Central

    Baurain, Denis; Dinant, Monique; Coosemans, Nadine; Matagne, René F.

    2003-01-01

    In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga Chlamydomonas reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless arylsulfatase (Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (−253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source. PMID:12644691

  18. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  19. New restriction fragment length polymorphisms in the cytochrome oxidase I gene facilitate host strain identification of fall armyworm (Lepidoptera: Noctuidae) populations in the southeastern United States.

    PubMed

    Nagoshi, Rod N; Meagher, Robert L; Adamczyk, John J; Braman, S Kristine; Brandenburg, Rick L; Nuessly, Gregg

    2006-06-01

    Several restriction sites in the cytochrome oxidase I gene of fall armyworm, Spodoptera frugiperda (J.E. Smith), were identified by sequence analysis as potentially being specific to one of the two host strains. Strain specificity was demonstrated for populations in Florida, Texas, Mississippi, Georgia, and North Carolina, with an AciI and SacI site specific to the rice (Oryjza spp.)-strain and a BsmI and HinfI site joining an already characterized MspI site as diagnostic of the corn (Zea mays L.)-strain. All four of these sites can be detected by digestion of a single 568-bp polymerase chain reaction-amplified fragment, but the use of two enzymes in separate digests was found to provide accurate and rapid determination of strain identity. The effectiveness of this method was demonstrated by the analysis of almost 200 adult and larval specimens from the Mississippi delta region. The results indicated that the corn-strain is likely to be the primary strain infesting cotton (Gossypium spp.) and that an unexpected outbreak of fall armyworm on the ornamental tree Paulownia tomentosa (Thunb.) Sieb. & Zucc. ex Steud. was due almost entirely to the rice-strain. PMID:16813297

  20. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  1. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  2. Neuron-specific specificity protein 4 (Sp4) bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons

    PubMed Central

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T. T.

    2013-01-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically-regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1, that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. PMID:24032355

  3. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  4. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata)

    PubMed Central

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

    2010-01-01

    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

  5. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  6. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  7. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  8. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  9. Conjugative plasmid in Corynebacterium flaccumfaciens subsp. oortii that confers resistance to arsenite, arsenate, and antimony(III)

    SciTech Connect

    Hendrick, C.A.; Haskins, W.P.; Vidaver, A.K.

    1984-07-01

    Gene transfer systems for phytopathogenic corynebacteria have not been reported previously. In this paper a conjugative 46-megadalton plasmid (pDG101) found in Corynebacterium flaccumfaciens subsp. oorii CO101 is described that mediates resistance to arsenite, arsenate, and antimony(III). Transfer of the plasmid from CO101 to four other strains from the C. flaccumfaciens group occurred between cells immobilized on nitrocellulose filters or on agar surfaces. Transconjugant strains expressed the same levels of metal resistance as the donor strain and were able to act as donor strains in subsequent matings. The physical presence of the plasmid was detected by agarose gel electrophoresis. Arsenite-sensitive derivatives of the donor and transconjugant strains were obtained after heat treatment; these were cured of pDG101.

  10. Silencing of the HvCKX1 gene decreases the cytokinin oxidase/dehydrogenase level in barley and leads to higher plant productivity.

    PubMed

    Zalewski, Wojciech; Galuszka, Petr; Gasparis, Sebastian; Orczyk, Wacław; Nadolska-Orczyk, Anna

    2010-06-01

    Stable RNA interference-based technology was used to silence the expression of the HvCKX1 gene in barley and the TaCKX1 gene in wheat and triticale. The silencing cassettes containing the fragments of these genes in the sense and antisense orientations were cloned into the pMCG161 binary vector and used for Agrobacterium-based transformation. Out of the five cultivars representing the three studied species, transgenic plants were obtained from one barley cultivar Golden Promise, one wheat cultivar Kontesa, and one triticale cultivar Wanad. Almost 80% of 52 regenerated lines of Golden Promise exhibited significantly decreased cytokinin oxidase/dehydrogenase (CKX) enzyme activity in bulked samples of their T(1) roots. There was a positive correlation between the enzyme activity and the plant productivity, expressed as the yield, the number of seeds per plant, and the 1000 grain weight. Additionally, these traits were associated with a greater root mass. Lower CKX activity led to a higher plant yield and root weight. This higher plant productivity and altered plant architecture were maintained in a population of segregating T(1) plants. The levels of HvCKX1 transcript accumulation were measured in various tissues of Golden Promise and Scarlett non-transgenic barley plants in order to choose the most appropriate plant organs to study the expression and/or silencing of the gene in those transgenic lines. The highest levels of the HvCKX1 transcript were detected in spikes 0 days after pollination (0 DAP), 7 DAP, and 14 DAP, and in the seedling roots. The analysis of HvCKX1 gene expression and CKX enzyme activity and the evaluation of the phenotype were performed in the progeny of seven selected transgenic T(1) lines. The relative expression of HvCKX1 measured in the spikes 0 DAP and 14 DAP, respectively, ranged from 0.52+/-0.04 to 1.15+/-0.26 and from 0.47+/-0.07 to 0.89+/-0.15. The lowest relative values were obtained for the enzyme activity in the spikes at 0 DAP

  11. Endoplasmic reticulum stress is involved in arsenite-induced oxidative injury in rat brain

    SciTech Connect

    Lin, Anya M.Y.; Chao, P.L.; Fang, S.F.; Chi, C.W.; Yang, C.H.

    2007-10-15

    The mechanism underlying sodium arsenite (arsenite)-induced neurotoxicity was investigated in rat brain. Arsenite was locally infused in the substantia nigra (SN) of anesthetized rat. Seven days after infusion, lipid peroxidation in the infused SN was elevated and dopamine level in the ipsilateral striatum was reduced in a concentration-dependent manner (0.3-5 nmol). Furthermore, local infusion of arsenite (5 nmol) decreased GSH content and increased expression of heat shock protein 70 and heme oxygenase-1 in the infused SN. Aggregation of {alpha}-synuclein, a putative pathological protein involved in several CNS neurodegenerative diseases, was elevated in the arsenite-infused SN. From the breakdown pattern of {alpha}-spectrin, both necrosis and apoptosis were involved in the arsenite-induced neurotoxicity. Pyknotic nuclei, cellular shrinkage and cytoplasmic disintegration, indicating necrosis, and TUNEL-positive cells and DNA ladder, indicating apoptosis was observed in the arsenite-infused SN. Arsenite-induced apoptosis was mediated via two different organelle pathways, mitochondria and endoplasmic reticulum (ER). For mitochondrial activation, cytosolic cytochrome c and caspase-3 levels were elevated in the arsenite-infused SN. In ER pathway, arsenite increased activating transcription factor-4, X-box binding protein 1, C/EBP homologues protein (CHOP) and cytosolic immunoglobulin binding protein levels. Moreover, arsenite reduced procaspase 12 levels, an ER-specific enzyme in the infused SN. Taken together, our study suggests that arsenite is capable of inducing oxidative injury in CNS. In addition to mitochondria, ER stress was involved in the arsenite-induced apoptosis. Arsenite-induced neurotoxicity clinically implies a pathophysiological role of arsenite in CNS neurodegeneration.

  12. Molecular Phylogeny of Nematodes (Oxyurida: Travassosinematidae) from Orthoptera (Gryllotalpidae) Inferred by Mitochondrial Cytochrome C Oxidase Subunit 1 Gene

    PubMed Central

    Singh, Neetu; Chaudhary, Anshu; Singh, Hridaya Shanker

    2015-01-01

    In this study, we sequenced mt Cox 1 gene sequences of five nematode spp. that were infective to arthropod, Gryllotalpa africana. The nematode belongs to Thelastomatoidea, a group of pinworms that parasitizes only invertebrates. Currently, in India spp. of this group are distinguished mainly on the basis of morphological characters that present possible confusions. Therefore, we identified the species through morphological and genetic analysis. We selected mt Cox 1 gene region to show their phylogenetic position with closely related spp. and confirmed their molecular validation. The present findings are important to confirm the phylogenetic position and relationship among five nematode spp. and avoid misidentification regarding their validation, as it is more necessary in that case when many species harbours the same host. PMID:26339150

  13. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-05-01

    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  14. Physiologic responses and gene diversity indicate olive alternative oxidase as a potential source for markers involved in efficient adventitious root induction.

    PubMed

    Santos Macedo, Elisete; Cardoso, Hélia G; Hernández, Alejandro; Peixe, Augusto A; Polidoros, Alexios; Ferreira, Alexandre; Cordeiro, António; Arnholdt-Schmitt, Birgit

    2009-12-01

    Olive (Olea europaea L.) trees are mainly propagated by adventitious rooting of semi-hardwood cuttings. However, efficient commercial propagation of valuable olive tree cultivars or landraces by semi-hardwood cuttings can often be restricted by a low rooting capacity. We hypothesize that root induction is a plant cell reaction linked to oxidative stress and that activity of stress-induced alternative oxidase (AOX) is importantly involved in adventitious rooting. To identify AOX as a source for potential functional marker sequences that may assist tree breeding, genetic variability has to be demonstrated that can affect gene regulation. The paper presents an applied, multidisciplinary research approach demonstrating first indications of an important relationship between AOX activity and differential adventitious rooting in semi-hardwood cuttings. Root induction in the easy-to-root Portuguese cultivar 'Cobrançosa' could be significantly reduced by treatment with salicyl-hydroxamic acid, an inhibitor of AOX activity. On the contrary, treatment with H2O2 or pyruvate, both known to induce AOX activity, increased the degree of rooting. Recently, identification of several O. europaea (Oe) AOX gene sequences has been reported from our group. Here we present for the first time partial sequences of OeAOX2. To search for polymorphisms inside of OeAOX genes, partial OeAOX2 sequences from the cultivars 'Galega vulgar', 'Cobrançosa' and 'Picual' were cloned from genomic DNA and cDNA, including exon, intron and 3'-untranslated regions (3'-UTRs) sequences. The data revealed polymorphic sites in several regions of OeAOX2. The 3'-UTR was the most important source for polymorphisms showing 5.7% of variability. Variability in the exon region accounted 3.4 and 2% in the intron. Further, analysis performed at the cDNA from microshoots of 'Galega vulgar' revealed transcript length variation for the 3'-UTR of OeAOX2 ranging between 76 and 301 bp. The identified polymorphisms and 3'-UTR

  15. The Diamine Oxidase Gene Is Associated with Hypersensitivity Response to Non-Steroidal Anti-Inflammatory Drugs

    PubMed Central

    Agúndez, José A. G.; Ayuso, Pedro; Cornejo-García, José A.; Blanca, Miguel; Torres, María J.; Doña, Inmaculada; Salas, María; Blanca-López, Natalia; Canto, Gabriela; Rondon, Carmen; Campo, Paloma; Laguna, José J.; Fernández, Javier; Martínez, Carmen; García-Martín, Elena

    2012-01-01

    Non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191), which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR  = 1.7 (95% CI  = 1.3–2.1; Pc  = 0.0003) with a gene-dose effect (P = 0.0001). The association was replicated in two populations from different geographic areas (Pc  = 0.008 and Pc  = 0.004, respectively). Conclusions and implications The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response. PMID:23152756

  16. Contingency tests of neutrality using intra/interspecific gene trees: the rejection of neutrality for the evolution of the mitochondrial cytochrome oxidase II gene in the hominoid primates.

    PubMed

    Templeton, A R

    1996-11-01

    Contingency tests of neutrality are performed using mitochondrial cytochrome oxidase II (COII) DNA sequences from hominoid primates, including humans. An intra-/interspecific haplotype tree is estimated, including a statistical assessment of ambiguities in tree topology and branch lengths. Four functional mutational categories are considered: silent and replacement substitutions in the transmembrane portion of the COII molecule, and silent and replacement substitutions in the cytosolic portion. Three tree topological mutational categories are used: intraspecific tips, intraspecific interiors, and interspecific fixed mutations. A full contingency analysis is performed, followed by nested contingency analyses. The analyses indicate that replacement mutations in the cytosolic portion are deleterious, and replacement mutations in the transmembrane portion and silent mutations throughout tend to be neutral. These conclusions are robust to ambiguities in tree topology and branch lengths. These inferences would have been impossible with an analysis that only contrasts silent and replacement vs. polymorphic and fixed. Also, intraspecific interior mutations have similar evolutionary dynamics to fixed mutations, so pooling tip and interior mutations into a single "polymorphic" class reduces power. Finally, the detected deleterious selection causes lowered inbreeding effective sizes, so arguments for small effective sizes in recent human evolutionary history based upon mitochondrial DNA may be invalid. PMID:8913766

  17. Prophylactic neuroprotective efficiency of co-administration of Ginkgo biloba and Trifolium pretense against sodium arsenite-induced neurotoxicity and dementia in different regions of brain and spinal cord of rats.

    PubMed

    Abdou, Heba M; Yousef, Mokhtar I; El Mekkawy, Desouki A; Al-Shami, Ahmed S

    2016-08-01

    The present study was carried out to evaluate the potential protective role of co-administration of Ginkgo biloba, Trifolium pretenseagainst sodium arsenite-induced neurotoxicity in different parts of brain (Cerebral cortex, Hippocampus, striatum and Hind brain) and in the spinal cord of rats. Sodium arsenite caused impairment in the acquisition and learning in all the behavioral tasks and caused significant increase in tumor necrosis factor-α,thiobarbituric acid-reactive substances andlipid profile, while caused significant decrease in glutathione, total thiol content, total antioxidant capacity, acetylcholinesterase, monoamine oxidase and ATPases activities. These results were confirmed by histopathological, fluorescence and scanning electron microscopy examination of different regions of brain. From these results sodium arsenite-induced neurodegenerative disorder in different regions of brain and spinal cord and this could be mediated through modifying the intracellular brain ions homeostasis, cholinergic dysfunction and oxidative damage. The presence of Ginkgo biloba and/orTrifolium pretense with sodium arsenite minimized its neurological damages. It was pronounced that using Ginkgo biloba and Trifolium pretense in combination was more effective as protective agents compared to use eachone of them alone. PMID:27234133

  18. Inhibition of mitotic-specific histone phophorylation by sodium arsenite

    SciTech Connect

    Cobo, J.M.; Valdez, J.G.; Gurley, L.R.

    1994-10-01

    Synchronized cultures of Chinese hamster cells (line CHO) were used to measure the effects of 10{mu}M sodium arsenite on histone phosphorylation. This treatment caused cell proliferation to be temporarily arrested, after which the cells spontaneously resumed cell proliferation in a radiomimetric manner. Immediately following treatment, it was found that sodium arsenite affected only mitotic-specific HI and H3 phosphorylations. Neither interphase, nor mitotic, H2A and H4 phosphorylations were affected, nor was interphase HI Phosphorylation affected. The phosphorylation of HI was inhibited only in mitosis, reducing HI phosphorylation to 38.1% of control levels, which was the level of interphase HI phosphorylation. The phosphorylation of both H3 variants was inhibited in mitosis, the less hydrophobic H3 to 19% and the more hydrophobic H3 to 24% of control levels. These results suggest that sodium arsenite may inhibite cell proliferation by interfering with the cyclin B/p34{sup cdc2} histone kinase activity which is thought to play a key role in regulating the cell cycle. It has been proposed by our laboratory that HI and H3 phosphorylations play a role in restructuring interphase chromatin into metaphase chromosomes. Interference of this process by sodium arsenite may lead to structurally damaged chromosomes resulting in the increased cancer risks known to be produced by arsenic exposure from the environment.

  19. Proteomic Profiling of Bladders from Mice Exposed with Sodium Arsenite

    EPA Science Inventory

    Arsenic, an environmental contaminant, has been linked with cancer of the bladder in humans. To study the mode of action of arsenic, female CH3 mice were exposed to 85 ppm sodium arsenite in their drinking water for 30 days. Following the exposure a comparative proteomic analysis...

  20. Traveling Waves in the Arsenite-Iodate System.

    ERIC Educational Resources Information Center

    Epstein, Irving R.

    1983-01-01

    The reaction between arsenite and iodate in acidic solution offers an excellent pedagogic introduction to such phenomena as traveling waves. Component reactions, traveling waves, and a mathematical model are discussed. Demonstrations described can easily be elaborated into a full laboratory experiment. (Author/JN)

  1. Pharmacokinetic and Genomic Effects of Arsenite in Drinking Water on Mouse Lung in a 30-Day Exposure

    PubMed Central

    Chilakapati, Jaya; Wallace, Kathleen; Hernandez-Zavala, Araceli; Moore, Tanya; Ren, Hongzu

    2015-01-01

    The 2 objectives of this subchronic study were to determine the arsenite drinking water exposure dependent increases in female C3H mouse liver and lung tissue arsenicals and to characterize the dose response (to 0, 0.05, 0.25, 1, 10, and 85 ppm arsenite in drinking water for 30 days and a purified AIN-93M diet) for genomic mouse lung expression patterns. Mouse lungs were analyzed for inorganic arsenic, monomethylated, and dimethylated arsenicals by hydride generation atomic absorption spectroscopy. The total lung mean arsenical levels were 1.4, 22.5, 30.1, 50.9, 105.3, and 316.4 ng/g lung tissue after 0, 0.05, 0.25, 1, 10, and 85 ppm, respectively. At 85 ppm, the total mean lung arsenical levels increased 14-fold and 131-fold when compared to either the lowest noncontrol dose (0.05 ppm) or the control dose, respectively. We found that arsenic exposure elicited minimal numbers of differentially expressed genes (DEGs; 77, 38, 90, 87, and 87 DEGs) after 0.05, 0.25, 1, 10, and 85 ppm, respectively, which were associated with cardiovascular disease, development, differentiation, apoptosis, proliferation, and stress response. After 30 days of arsenite exposure, this study showed monotonic increases in mouse lung arsenical (total arsenic and dimethylarsinic acid) concentrations but no clear dose-related increases in DEG numbers. PMID:26674514

  2. Identification and catalytic residues of the arsenite methyltransferase from a sulfate-reducing bacterium, Clostridium sp. BXM.

    PubMed

    Wang, Pei-Pei; Bao, Peng; Sun, Guo-Xin

    2015-01-01

    Arsenic methylation is an important process frequently occurring in anaerobic environments. Anaerobic microorganisms have been implicated as the major contributors for As methylation. However, very little information is available regarding the enzymatic mechanism of As methylation by anaerobes. In this study, one novel sulfate-reducing bacterium isolate, Clostridium sp. BXM, which was isolated from a paddy soil in our laboratory, was demonstrated to have the ability of methylating As. One putative arsenite S-Adenosyl-Methionine methyltransferase (ArsM) gene, CsarsM was cloned from Clostridium sp. BXM. Heterologous expression of CsarsM conferred As resistance and the ability of methylating As to an As-sensitive strain of Escherichia coli. Purified methyltransferase CsArsM catalyzed the formation of methylated products from arsenite, further confirming its function of As methylation. Site-directed mutagenesis studies demonstrated that three conserved cysteine residues at positions 65, 153 and 203 in CsArsM are necessary for arsenite methylation, but only Cysteine 153 and Cysteine 203 are required for the methylation of monomethylarsenic to dimethylarsenic. These results provided the characterization of arsenic methyltransferase from anaerobic sulfate-reducing bacterium. Given that sulfate-reducing bacteria are ubiquitous in various wetlands including paddy soils, enzymatic methylation mediated by these anaerobes is proposed to contribute to the arsenic biogeochemical cycling. PMID:25790486

  3. A new oxygen-regulated operon in Escherichia coli comprises the genes for a putative third cytochrome oxidase and for pH 2.5 acid phosphatase (appA)

    PubMed

    Dassa, J; Fsihi, H; Marck, C; Dion, M; Kieffer-Bontemps, M; Boquet, P L

    1991-10-01

    The Escherichia coli acid phosphatase gene appA is expressed in response to oxygen deprivation and is positively controlled by the product of appR (katF) which encodes a putative new sigma transcription-initiation factor. However, transcription of appA from its nearest promoter (P1) did not account for total pH 2.5 acid phosphatase expression and was not subject to regulation. The cloned region upstream of appA was extended and analyzed by insertions of transposon TnphoA and by fusions with lacZ. It contains two new genes, appC and appB, which both encode extracytoplasmic proteins. appC and appB are expressed from a promoter (P2) lying just upstream of appC. Both genes are regulated by oxygen, as is appA, and by appR gene product exactly as previously shown for appA. Analysis of the nucleotide sequence and of the origins of transcription have confirmed that the P2-appC-appB- (ORFX)-P1-appA region is organized on the chromosome as an operon transcribed clockwise from P2 and that P1 is a minor promoter for appA alone. Genes appC and appB encode proteins of Mr 58,133 and 42,377, respectively, which have the characteristics of integral membrane proteins. The deduced amino acid sequences of appC and appB show 60% and 57% homology, respectively, with subunits I and II of the E. coli cytochrome d oxidase (encoded by genes cydA and cydB). The notion that the AppC and AppB proteins constitute a new cytochrome oxidase or a new oxygen-detoxifying system is supported by the observation of enhanced sensitivity to oxygen of mutants lacking all three genes, cyo (cytochrome o oxidase), cyd (cytochrome d oxidase) and appB, compared to that of cyo cyd double mutants. PMID:1658595

  4. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  5. Arsenic Methylation and Volatilization by Arsenite S-Adenosylmethionine Methyltransferase in Pseudomonas alcaligenes NBRC14159

    PubMed Central

    Zhang, Jun; Cao, Tingting; Tang, Zhu; Shen, Qirong; Rosen, Barry P.

    2015-01-01

    Inorganic arsenic (As) is highly toxic and ubiquitous in the environment. Inorganic As can be transformed by microbial methylation, which constitutes an important part of the As biogeochemical cycle. In this study, we investigated As biotransformation by Pseudomonas alcaligenes NBRC14159. P. alcaligenes was able to methylate arsenite [As(III)] rapidly to dimethylarsenate and small amounts of trimethylarsenic oxide. An arsenite S-adenosylmethionine methyltransferase, PaArsM, was identified and functionally characterized. PaArsM shares low similarities with other reported ArsM enzymes (<55%). When P. alcaligenes arsM gene (PaarsM) was disrupted, the mutant lost As methylation ability and became more sensitive to As(III). PaarsM was expressed in the absence of As(III) and the expression was further enhanced by As(III) exposure. Heterologous expression of PaarsM in an As-hypersensitive strain of Escherichia coli conferred As(III) resistance. Purified PaArsM protein methylated As(III) to dimethylarsenate as the main product in the medium and also produced dimethylarsine and trimethylarsine gases. We propose that PaArsM plays a role in As methylation and detoxification of As(III) and could be exploited in bioremediation of As-contaminated environments. PMID:25681184

  6. Arsenite Stress Down-regulates Phosphorylation and 14-3-3 Binding of Leucine-rich Repeat Kinase 2 (LRRK2), Promoting Self-association and Cellular Redistribution*

    PubMed Central

    Mamais, Adamantios; Chia, Ruth; Beilina, Alexandra; Hauser, David N.; Hall, Christine; Lewis, Patrick A.; Cookson, Mark R.; Bandopadhyay, Rina

    2014-01-01

    Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) are a common genetic cause of Parkinson disease, but the mechanisms whereby LRRK2 is regulated are unknown. Phosphorylation of LRRK2 at Ser910/Ser935 mediates interaction with 14-3-3. Pharmacological inhibition of its kinase activity abolishes Ser910/Ser935 phosphorylation and 14-3-3 binding, and this effect is also mimicked by pathogenic mutations. However, physiological situations where dephosphorylation occurs have not been defined. Here, we show that arsenite or H2O2-induced stresses promote loss of Ser910/Ser935 phosphorylation, which is reversed by phosphatase inhibition. Arsenite-induced dephosphorylation is accompanied by loss of 14-3-3 binding and is observed in wild type, G2019S, and kinase-dead D2017A LRRK2. Arsenite stress stimulates LRRK2 self-association and association with protein phosphatase 1α, decreases kinase activity and GTP binding in vitro, and induces translocation of LRRK2 to centrosomes. Our data indicate that signaling events induced by arsenite and oxidative stress may regulate LRRK2 function. PMID:24942733

  7. Characterization of the arsenite oxidizer Aliihoeflea sp. strain 2WW and its potential application in the removal of arsenic from groundwater in combination with Pf-ferritin.

    PubMed

    Corsini, Anna; Colombo, Milena; Muyzer, Gerard; Cavalca, Lucia

    2015-09-01

    A heterotrophic arsenite-oxidizing bacterium, strain 2WW, was isolated from a biofilter treating arsenic-rich groundwater. Comparative analysis of 16S rRNA gene sequences showed that it was closely related (98.7 %) to the alphaproteobacterium Aliihoeflea aesturari strain N8(T). However, it was physiologically different by its ability to grow at relatively low substrate concentrations, low temperatures and by its ability to oxidize arsenite. Here we describe the physiological features of strain 2WW and compare these to its most closely related relative, A. aestuari strain N8(T). In addition, we tested its efficiency to remove arsenic from groundwater in combination with Pf-ferritin. Strain 2WW oxidized arsenite to arsenate between pH 5.0 and 8.0, and from 4 to 30 °C. When the strain was used in combination with a Pf-ferritin-based material for arsenic removal from natural groundwater, the removal efficiency was significantly higher (73 %) than for Pf-ferritin alone (64 %). These results showed that arsenite oxidation by strain 2WW combined with Pf-ferritin-based material has a potential in arsenic removal from contaminated groundwater. PMID:26149126

  8. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  9. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-01-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  10. Mobilization of arsenite by dissimilatory reduction of adsorbed arsenate

    USGS Publications Warehouse

    Zobrist, J.; Dowdle, P.R.; Davis, J.A.; Oremland, R.S.

    2000-01-01

    Sulfurospirillum barnesii is capable of anaerobic growth using ferric iron or arsenate as electron acceptors. Cell suspensions of S. barnesii were able to reduce arsenate to arsenite when the former oxyanion was dissolved in solution, or when it was adsorbed onto the surface of ferrihydrite, a common soil mineral, by a variety of mechanisms (e.g., coprecipitation, presorption). Reduction of Fe(III) in ferrihydrite to soluble Fe(II) also occurred, but dissolution of ferrihydrite was not required in order for adsorbed arsenate reduction to be achieved. This was illustrated by bacterial reduction of arsenate coprecipitated with aluminum hydroxide, a mineral that does not undergo reductive dissolution. The rate of arsenate reduction was influenced by the method in which arsenate became associated with the mineral phases and may have been strongly coupled with arsenate desorption rates. The extent of release of arsenite into solution was governed by adsorption of arsenite onto the ferrihydrite or alumina phases. The results of these experiments have interpretive significance to the mobilization of arsenic in large alluvial aquifers, such as those of the Ganges in India and Bangladesh, and in the hyporheic zones of contaminated streams.Sulfurospirillum barnesii is capable of anaerobic growth using ferric iron or arsenate as electron acceptors. Cell suspensions of S. barnesii were able to reduce arsenate to arsenite when the former oxyanion was dissolved in solution, or when it was adsorbed onto the surface of ferrihydrite a common soil mineral, by a variety of mechanisms (e.g., coprecipitation, presorption). Reduction of Fe(III) in ferrihydrite to soluble Fe(II) also occurred, but dissolution of ferrihydrite was not required in order for adsorbed arsenate reduction to be achieved. This was illustrated by bacterial reduction of arsenate coprecipitated with aluminum hydroxide, a mineral that does not undergo reductive dissolution. The rate of arsenate reduction was

  11. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.

    PubMed

    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr

    2016-02-01

    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be

  12. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  13. Arsenite decreases CYP3A23 induction in cultured rat hepatocytes by transcriptional and translational mechanisms

    SciTech Connect

    Noreault, Trisha L.; Nichols, Ralph C.; Trask, Heidi W.; Wrighton, Steven A.; Sinclair, Peter R.; Evans, Ronald M.; Sinclair, Jacqueline F. . E-mail: JSINC@dartmouth.edu

    2005-12-01

    Arsenic is a naturally occurring, worldwide contaminant implicated in numerous pathological conditions in humans, including cancer and several forms of liver disease. One of the contributing factors to these disorders may be the alteration of cytochrome P450 (CYP) levels by arsenic. In rat and human hepatocyte cultures, arsenic, in the form of arsenite, decreases the induction of several CYPs. The present study investigated whether arsenite utilizes transcriptional or post-transcriptional mechanisms to decrease CYP3A23 in primary cultures of rat hepatocytes. In these cultures, a 6-h treatment with 5 {mu}M arsenite abolished dexamethasone (DEX)-mediated induction of CYP3A23 protein and activity, but did not inhibit general protein synthesis. However, arsenite treatment only reduced DEX-induced levels of CYP3A23 mRNA by 30%. The effects of arsenite on CYP3A23 transcription were examined using a luciferase reporter construct containing 1.4 kb of the CYP3A23 promoter. Arsenite caused a 30% decrease in DEX-induced luciferase expression of this reporter. Since arsenite abolished induction of CYP3A23 protein, but caused only a small decrease in CYP3A23 mRNA, the effects of arsenite on translation of CYP3A23 mRNA were investigated. Polysomal distribution analysis showed that arsenite decreased translation by decreasing the DEX-mediated increase in CYP3A23 mRNA association with polyribosomes. Arsenite did not decrease intracellular glutathione or increase lipid peroxidation, suggesting that the effect of arsenite on CYP3A23 does not involve oxidative stress. Overall, the results suggest that low-level arsenite decreases both transcription and translation of CYP3A23 in primary rat hepatocyte cultures.

  14. Sodium arsenite alters cell cycle and MTHFR, MT1/2, and c-Myc protein levels in MCF-7 cells

    SciTech Connect

    Ruiz-Ramos, Ruben; Lopez-Carrillo, Lizbeth; Albores, Arnulfo; Hernandez-Ramirez, Raul U.; Cebrian, Mariano E.

    2009-12-15

    There is limited available information on the effects of arsenic on enzymes participating in the folate cycle. Therefore, our aim was to evaluate the effects of sodium arsenite on the protein levels of methylenetetrahydrofolate reductase (MTHFR) and dihydrofolate reductase (DHFR) and its further relationship with the expression MT1/2 and c-myc in MCF-7 cells. Arsenite treatment (0-10 muM) for 4 h decreased MTHFR levels in a concentration-dependent fashion without significant effects on DHFR. The effects on MTHFR were observed at arsenite concentrations not significantly affecting cell viability. We also observed an increase in S-phase recruitment at all concentrations probed. Lower concentrations (< 5 muM) induced cell proliferation, showing a high proportion of BrdU-stained cells, indicating a higher DNA synthesis rate. However, higher concentrations (>= 5 muM) or longer treatment periods induced apoptosis. Arsenite also induced dose-dependent increases in MT1/2 and c-Myc protein levels. The levels of MTHFR were inversely correlated to MT1/2 and c-Myc overexpression and increased S-phase recruitment. Our findings indicate that breast epithelial cells are responsive to arsenite and suggest that exposure may pose a risk for breast cancer. The reductions in MTHFR protein levels contribute to understand the mechanisms underlying the induction of genes influencing growth regulation, such as c-myc and MT1/2. However, further research is needed to ascertain if the effects here reported following short-time and high-dose exposure are relevant for human populations chronically exposed to low arsenic concentrations.

  15. Involvement of HIF-2α-mediated inflammation in arsenite-induced transformation of human bronchial epithelial cells

    SciTech Connect

    Xu, Yuan; Zhao, Yue; Xu, Wenchao; Luo, Fei; Wang, Bairu; Li, Yuan; Pang, Ying; Liu, Qizhan

    2013-10-15

    Arsenic is a well established human carcinogen that causes diseases of the lung. Some studies have suggested a link between inflammation and lung cancer; however, it is unknown if arsenite-induced inflammation causally contributes to arsenite-caused malignant transformation of cells. In this study, we investigated the molecular mechanisms underlying inflammation during neoplastic transformation induced in human bronchial epithelial (HBE) cells by chronic exposure to arsenite. The results showed that, on acute or chronic exposure to arsenite, HBE cells over-expressed the pro-inflammatory cytokines, interleukin-6 (IL-6), interleukin-8 (IL-8), and interleukin-1β (IL-1β). The data also indicated that HIF-2α was involved in arsenite-induced inflammation. Moreover, IL-6 and IL-8 were essential for the malignant progression of arsenite-transformed HBE cells. Thus, these experiments show that HIF-2α mediates arsenite-induced inflammation and that such inflammation is involved in arsenite-induced malignant transformation of HBE cells. The results provide a link between the inflammatory response and the acquisition of a malignant transformed phenotype by cells chronically exposed to arsenite and thus establish a previously unknown mechanism for arsenite-induced carcinogenesis. - Highlights: • Arsenite induces inflammation. • Arsenite-induced the increases of IL-6 and IL-8 via HIF-2α. • Inflammation is involved in arsenite-induced carcinogenesis.

  16. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  17. Effect of vitamin E on sperm parameters and DNA integrity in sodium arsenite-treated rats

    PubMed Central

    Momeni, Hamid Reza; Eskandari, Najmeh

    2012-01-01

    Background: Arsenic as an environmental toxicant is able to exert malformations in male reproductive system by inducing oxidative stress. Vitamin E (Vit.E) is known as antioxidant vitamin. Objective: The aim of this study was to investigate the harmful effects of sodium arsenite on sperm parameters and the antioxidant effects of Vit.E on sperm anomalies in sodium arsenite treated rats. Materials and Methods: Adult male rats were divided into 4 groups: control, sodium arsenite (8 mg/kg/day), Vit.E (100 mg/kg/day) and sodium arsenite+Vit.E. Oral treatments were performed till 8 weeks. Body and left testis weight were recorded and then left caudal epididymis was cut in Ham's F10. Released spermatozoa were used to analyze number, motility, viability and abnormalities of the sperm. Sperm chromatin quality was assessed by nuclear staining using acridine orange and aniline blue. Results: Body and testis weight showed no significant change in 4 groups (p>0.05). A significant decrease in the number, motility, viability and normal sperm morphology was found in sodium arsenite-treated rats compared to the control (p<0.001). Sodium arsenite had no effect on sperm DNA integrity and histon-protamine replacement (p>0.05). In sodium arsenite+Vit.E group, Vit.E could significantly compensate the harmful effects of sodium arsenite on sperm number, motility, viability and morphology compared to sodium arsenite group. In addition, sperm viability and motility was significantly increased in rats treated with Vit.E alone compared to the control and sodium arsenite+Vit.E group. Conclusion: Vitamin E could compensate the adverse effects of sodium arsenite on sperm parameters in adult rats. PMID:25243001

  18. Arsenite-induced mitotic death involves stress response and is independent of tubulin polymerization

    SciTech Connect

    Taylor, B. Frazier; McNeely, Samuel C.; Miller, Heather L.; States, J. Christopher

    2008-07-15

    Arsenite, a known mitotic disruptor, causes cell cycle arrest and cell death at anaphase. The mechanism causing mitotic arrest is highly disputed. We compared arsenite to the spindle poisons nocodazole and paclitaxel. Immunofluorescence analysis of {alpha}-tubulin in interphase cells demonstrated that, while nocodazole and paclitaxel disrupt microtubule polymerization through destabilization and hyperpolymerization, respectively, microtubules in arsenite-treated cells remain comparable to untreated cells even at supra-therapeutic concentrations. Immunofluorescence analysis of {alpha}-tubulin in mitotic cells showed spindle formation in arsenite- and paclitaxel-treated cells but not in nocodazole-treated cells. Spindle formation in arsenite-treated cells appeared irregular and multi-polar. {gamma}-tubulin staining showed that cells treated with nocodazole and therapeutic concentrations of paclitaxel contained two centrosomes. In contrast, most arsenite-treated mitotic cells contained more than two centrosomes, similar to centrosome abnormalities induced by heat shock. Of the three drugs tested, only arsenite treatment increased expression of the inducible isoform of heat shock protein 70 (HSP70i). HSP70 and HSP90 proteins are intimately involved in centrosome regulation and mitotic spindle formation. HSP90 inhibitor 17-DMAG sensitized cells to arsenite treatment and increased arsenite-induced centrosome abnormalities. Combined treatment of 17-DMAG and arsenite resulted in a supra-additive effect on viability, mitotic arrest, and centrosome abnormalities. Thus, arsenite-induced abnormal centrosome amplification and subsequent mitotic arrest is independent of effects on tubulin polymerization and may be due to specific stresses that are protected against by HSP90 and HSP70.

  19. Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA

    PubMed Central

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.

    2011-01-01

    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

  20. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-01-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  1. SORPTION OF ARSENITE AND ARSENATE ON A HIGH AFFINITY OXIDE: MACROSCOPIC AND MICROSCOPIC STUDIES

    EPA Science Inventory

    Sorption of arsenate and arsenite was examined on a Ru compound using macroscopic and microscopic techniques. Isotherms were constructed from batch studies at pH 4 through 8. Solution As was measured by ICAP. Samples of the Ru compound were equilibrated with arsenite and arsenate...

  2. Arsenite promotes apoptosis and dysfunction in microvascular endothelial cells via an alteration of intracellular calcium homeostasis.

    PubMed

    Suriyo, Tawit; Watcharasit, Piyajit; Thiantanawat, Apinya; Satayavivad, Jutamaad

    2012-04-01

    Vascular endothelium has been considered as a target for arsenic-induced cardiovascular toxicity. The present study demonstrated that arsenite caused slow and sustained elevation of intracellular free calcium levels ([Ca2+]i) in HMEC-1, a human microvessel-derived endothelial cell line, in a concentration-dependent manner. Pretreatment with U-73122 (a specific PLC inhibitor) or 2-APB (a specific IP3 receptor antagonist) attenuated this effect, suggesting that PLC/IP3 signaling cascade is involved in arsenite-induced elevation of [Ca2+]i. Cytotoxic concentrations of arsenite (5 and 10 μM) significantly enhanced endothelial nitric oxide synthase (eNOS) phosphorylation, nitric oxide (NO) production and apoptosis after 24-h exposure. Additionally, 2-APB attenuated eNOS phosphorylation and apoptosis induced by arsenite, indicating that Ca2+ -mediated eNOS activation participates in arsenite-induced endothelial cell apoptosis. Moreover, we also found that non-apoptotic concentrations of arsenite (0.5 and 1 μM) dramatically mitigated thrombin-induced rapid transient rise of [Ca2+]i, eNOS phosphorylation and NO production, suggesting functional disruption of endothelial by arsenite, and these effects occurred without an alteration of PLC-β1 and thrombin receptor levels. Altogether, the results reveal that arsenite induces apoptotic cell death and endothelial dysfunction as indicated by the reduction of thrombin responses, particularly related to an alteration of intracellular Ca2+ homeostasis. PMID:22244921

  3. DISSOCIATION OF ARSENITE-PEPTIDE COMPLEXES: TRIPHASIC NATURE, RATE CONSTANTS, HALF LIVES AND BIOLOGICAL IMPORTANCE

    EPA Science Inventory

    We determined the number and the dissociation rate constants of different complexes formed from arsenite and two peptides containing either one (RV AVGNDYASGYHYGV for peptide 20) or three cysteines (LE AWQGK VEGTEHLYSMK K for peptide 10) via radioactive 73As labeled arsenite and ...

  4. Complexation of arsenite with phytochelatins reduces arsenite efflux and translocation from roots to shoots in Arabidopsis.

    PubMed

    Liu, Wen-Ju; Wood, B Alan; Raab, Andrea; McGrath, Steve P; Zhao, Fang-Jie; Feldmann, Jörg

    2010-04-01

    Complexation of arsenite [As(III)] with phytochelatins (PCs) is an important mechanism employed by plants to detoxify As; how this complexation affects As mobility was little known. We used high-resolution inductively coupled plasma-mass spectrometry and accurate mass electrospray ionization-mass spectrometry coupled to HPLC to identify and quantify As(III)-thiol complexes and free thiol compounds in Arabidopsis (Arabidopsis thaliana) exposed to arsenate [As(V)]. As(V) was efficiently reduced to As(III) in roots. In wild-type roots, 69% of As was complexed as As(III)-PC4, As(III)-PC3, and As(III)-(PC2)2. Both the glutathione (GSH)-deficient mutant cad2-1 and the PC-deficient mutant cad1-3 were approximately 20 times more sensitive to As(V) than the wild type. In cad1-3 roots, only 8% of As was complexed with GSH as As(III)-(GS)3 and no As(III)-PCs were detected, while in cad2-1 roots, As(III)-PCs accounted for only 25% of the total As. The two mutants had a greater As mobility, with a significantly higher accumulation of As(III) in shoots and 4.5 to 12 times higher shoot-to-root As concentration ratio than the wild type. Roots also effluxed a substantial proportion of the As(V) taken up as As(III) to the external medium, and this efflux was larger in the two mutants. Furthermore, when wild-type plants were exposed to l-buthionine sulfoximine or deprived of sulfur, both As(III) efflux and root-to-shoot translocation were enhanced. The results indicate that complexation of As(III) with PCs in Arabidopsis roots decreases its mobility for both efflux to the external medium and for root-to-shoot translocation. Enhancing PC synthesis in roots may be an effective strategy to reduce As translocation to the edible organs of food crops. PMID:20130102

  5. Arsenite as the probable active species in the human carcinogenicity of arsenic: Mouse micronucleus assays on Na and K arsenite, orpiment, and Fowler's solution

    SciTech Connect

    Tinwell, H.; Ashby, J. ); Stephens, S.C. )

    1991-11-01

    Sodium arsenite, potassium arsenite, and Fowler's solution (arsenic trioxide dissolved in potassium bicarbonate) are equally active in the mouse bone marrow micronucleus assay ({approximately} 10 mg/kg by IP injection). The natural ore orpiment (principally As{sub 2}S{sub 3}) was inactive despite blood levels of arsenic of 300 to 900 mg/mL in treated mice at 24 hr. Sodium arsenite was active in three strains of mice. It is suggested that the human lung cancer observed among arsenic ore smelters and the skin cancer among people exposed therapeutically to Fowler's solution, have, as their common origin, the genotoxic arsenite ion AsO{sub 2}{sup {minus}}. The difficulty experienced when attempting to demonstrate rodent carcinogenicity for derivatives of arsenic suggests that the bone marrow micronucleus assay may act as a useful assay for potentially carcinogenic arsenic derivatives.

  6. Arsenite induces endothelial cytotoxicity by down-regulation of vascular endothelial nitric oxide synthase

    SciTech Connect

    Tsou, T.-C. . E-mail: tctsou@nhri.org.tw; Tsai, F.-Y.; Hsieh, Y.-W.; Li, L.-A.; Yeh, S.C; Chang, L.W.

    2005-11-01

    Epidemiological studies have demonstrated a high association of inorganic arsenic exposure with vascular diseases. Recent research has also linked this vascular damage to impairment of endothelial nitric oxide synthase (eNOS) function by arsenic exposure. However, the role of eNOS in regulating the arsenite-induced vascular dysfunction still remains to be clarified. In our present study, we investigated the effect of arsenite on Akt1 and eNOS and its involvement in cytotoxicity of vascular endothelial cells. Our study demonstrated that arsenite decreased the protein levels of both Akt1 and eNOS accompanied with increased levels of ubiquitination of total cell lysates. We found that inhibition of the ubiquitin-proteasome pathway by MG-132 could partially protect Akt1 and eNOS from degradation by arsenite together with a proportional protection from the arsenite-induced cytoxicity. Moreover, up-regulation of eNOS protein expression significantly attenuated the arsenite-induced cytotoxicity and eNOS activity could be significantly inhibited after incubation with arsenite for 24 h in a cell-free system. Our study indicated that endothelial eNOS activity could be attenuated by arsenite via the ubiquitin-proteasome-mediated degradation of Akt1/eNOS as well as via direct inhibition of eNOS activity. Our study also demonstrated that eNOS actually played a protective role in arsenite-induced cytoxicity. These observations supported the hypothesis that the impairment of eNOS function by arsenite is one of the mechanisms leading to vascular changes and diseases.

  7. Sorption and desorption of arsenate and arsenite on calcite

    NASA Astrophysics Data System (ADS)

    Sø, Helle U.; Postma, Dieke; Jakobsen, Rasmus; Larsen, Flemming

    2008-12-01

    The adsorption and desorption of arsenate (As(V)) and arsenite (As(III)) on calcite was investigated in a series of batch experiments in calcite-equilibrated solutions. The solutions covered a broad range of pH, alkalinity, calcium concentration and ionic strength. The initial arsenic concentrations were kept low (<33 μM) to avoid surface precipitation. The results show that little or no arsenite sorbs on calcite within 24 h at an initial As concentration of 0.67 μM. In contrast, arsenate sorbs readily and quickly on calcite. Likewise, desorption of arsenate from calcite is fast and complete within hours, indicating that arsenate is not readily incorporated into the calcite crystal lattice. The degree of arsenate sorption depends on the solution chemistry. Sorption increases with decreasing alkalinity, indicating a competition for sorption sites between arsenate and (bi)carbonate. pH also affects the sorption behavior, likely in response to changes in arsenate speciation or protonation/deprotonation of the adsorbing arsenate ion. Finally, sorption is influenced by the ionic strength, possibly due to electrostatic effects. The sorption of arsenate on calcite was modeled successfully using a surface complexation model comprising strong and weak sites. In the model, the adsorbing arsenate species were HAsO4- and CaHAsO40. The model was able to correctly predict the adsorption of arsenate in the wide range of calcite-equilibrated solutions used in the batch experiments and to describe the non-linear shape of the sorption isotherms. Extrapolation of the experimental results to calcite bearing aquifers suggests a large variability in the mobility of arsenic. Under reduced conditions, arsenite, which does not sorb on calcite, will dominate and, hence, As will be highly mobile. In contrast, when conditions are oxidizing, arsenate is the predominant species and, because arsenate adsorbs strongly on calcite, As mobility will be significantly retarded. The estimated

  8. Autecology of an Arsenite Chemolithotroph: Sulfide Constraints on Function and Distribution in a Geothermal Spring▿

    PubMed Central

    D'Imperio, Seth; Lehr, Corinne R.; Breary, Michele; McDermott, Timothy R.

    2007-01-01

    Previous studies in an acid-sulfate-chloride spring in Yellowstone National Park found that microbial arsenite [As(III)] oxidation is absent in regions of the spring outflow channel where H2S exceeds ∼5 μM and served as a backdrop for continued efforts in the present study. Ex situ assays with microbial mat samples demonstrated immediate As(III) oxidation activity when H2S was absent or at low concentrations, suggesting the presence of As(III) oxidase enzymes that could be reactivated if H2S is removed. Cultivation experiments initiated with mat samples taken from along the H2S gradient in the outflow channel resulted in the isolation of an As(III)-oxidizing chemolithotroph from the low-H2S region of the gradient. The isolate was phylogenetically related to Acidicaldus and was characterized in vitro for spring-relevant properties, which were then compared to its distribution pattern in the spring as determined by denaturing gradient gel electrophoresis and quantitative PCR. While neither temperature nor oxygen requirements appeared to be related to the occurrence of this organism within the outflow channel, H2S concentration appeared to be an important constraint. This was verified by in vitro pure-culture modeling and kinetic experiments, which suggested that H2S inhibition of As(III) oxidation is uncompetitive in nature. In summary, the studies reported herein illustrate that H2S is a potent inhibitor of As(III) oxidation and will influence the niche opportunities and population distribution of As(III) chemolithotrophs. PMID:17827309

  9. Autecology of an arsenite chemolithotroph: sulfide constraints on function and distribution in a geothermal spring.

    PubMed

    D'Imperio, Seth; Lehr, Corinne R; Breary, Michele; McDermott, Timothy R

    2007-11-01

    Previous studies in an acid-sulfate-chloride spring in Yellowstone National Park found that microbial arsenite [As(III)] oxidation is absent in regions of the spring outflow channel where H(2)S exceeds approximately 5 microM and served as a backdrop for continued efforts in the present study. Ex situ assays with microbial mat samples demonstrated immediate As(III) oxidation activity when H(2)S was absent or at low concentrations, suggesting the presence of As(III) oxidase enzymes that could be reactivated if H(2)S is removed. Cultivation experiments initiated with mat samples taken from along the H(2)S gradient in the outflow channel resulted in the isolation of an As(III)-oxidizing chemolithotroph from the low-H(2)S region of the gradient. The isolate was phylogenetically related to Acidicaldus and was characterized in vitro for spring-relevant properties, which were then compared to its distribution pattern in the spring as determined by denaturing gradient gel electrophoresis and quantitative PCR. While neither temperature nor oxygen requirements appeared to be related to the occurrence of this organism within the outflow channel, H(2)S concentration appeared to be an important constraint. This was verified by in vitro pure-culture modeling and kinetic experiments, which suggested that H(2)S inhibition of As(III) oxidation is uncompetitive in nature. In summary, the studies reported herein illustrate that H(2)S is a potent inhibitor of As(III) oxidation and will influence the niche opportunities and population distribution of As(III) chemolithotrophs. PMID:17827309

  10. Exosomal miR-21 derived from arsenite-transformed human bronchial epithelial cells promotes cell proliferation associated with arsenite carcinogenesis.

    PubMed

    Xu, Yuan; Luo, Fei; Liu, Yi; Shi, Le; Lu, Xiaolin; Xu, Wenchao; Liu, Qizhan

    2015-07-01

    Intercellular communications within the cancer microenvironment coordinate the assembly of various cell types. Exosomes are mediators of intercellular communication in immune signaling, tumor promotion, stress responses, and angiogenesis. The present research aimed to determine whether miRNAs secreted from human bronchial epithelial (HBE) cells transformed by 1.0 μM arsenite are transferred into normal HBE cells and are functionally active in the recipient cells. The results show that miR-21 is involved in exosome-mediated intercellular communication between neoplastic and normal HBE cells. Exosomes derived from transformed HBE cells stimulated proliferation of normal HBE cells, whereas exosomes from miR-21 depleted cells failed to stimulate proliferation. In normal HBE cells, the expression of phosphatase and tensin homolog, a target gene for miR-21, was increased by exosomal miR-21, indicating that exogenous miRNAs, via exosomal transport, function-like endogenous miRNAs. Concordantly, specific reduction of miR-21 content in exosome-producing transformed cells abolished the stimulation of proliferation by exosomes. Collectively, the data indicate that transformed HBE cells release exosomes containing miR-21, stimulating proliferation in neighboring normal HBE cells and supporting the concept that exosomal miRNAs are involved in cell-cell communication during carcinogenesis induced by environmental chemicals. PMID:24912785

  11. Arsenite sorption at the magnetite water interface during aqueous precipitation of magnetite: EXAFS evidence for a new arsenite surface complex

    NASA Astrophysics Data System (ADS)

    Wang, Yuheng; Morin, Guillaume; Ona-Nguema, Georges; Menguy, Nicolas; Juillot, Farid; Aubry, Emmanuel; Guyot, François; Calas, Georges; Brown, Gordon E., Jr.

    2008-06-01

    The interaction of aqueous As(III) with magnetite during its precipitation from aqueous solution at neutral pH has been studied as a function of initial As/Fe ratio. Arsenite is sequestered via surface adsorption and surface precipitation reactions, which in turn influence the crystal growth of magnetite. Sorption samples were characterized using EXAFS spectroscopy at the As K-edge in combination with HRTEM observations, energy dispersive X-ray analysis at the nanoscale, electron energy loss spectroscopy at the Fe L 3-edge, and XRD-Rietveld analyses of reaction products. Our results show that As(III) forms predominantly tridentate hexanuclear As(III)O 3 complexes ( 3C), where the As(III)O 3 pyramids occupy vacant tetrahedral sites on {1 1 1} surfaces of magnetite particles. This is the first time such a tridentate surface complex has been observed for arsenic. This complex, with a dominant As-Fe distance of 3.53 ± 0.02 Å, occurs in all samples examined except the one with the highest As/Fe ratio (0.33). In addition, at the two highest As/Fe ratios (0.133 and 0.333) arsenite tends to form mononuclear edge-sharing As(III)O 3 species ( 2E) within a highly soluble amorphous As(III)-Fe(III,II)-containing precipitate. At the two lowest As/Fe ratios (0.007 and 0.033), our results indicate the presence of additional As(III) species with a dominant As-Fe distance of 3.30 ± 0.02 Å, for which a possible structural model is proposed. The tridentate 3C As(III)O 3 complexes on the {1 1 1} magnetite surface, together with this additional As(III) species, dramatically lower the solubility of arsenite in the anoxic model systems studied. They may thus play an important role in lowering arsenite solubility in putative magnetite-based water treatment processes, as well as in natural iron-rich anoxic media, especially during the reductive dissolution-precipitation of iron minerals in anoxic environments.

  12. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

    PubMed

    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

    2016-04-01

    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  13. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. PMID:25749303

  14. Responses to heat shock, arsenite and cadmium in soybean

    SciTech Connect

    Edelman, L. ); Key, J.L. )

    1989-04-01

    Heat shock (HS), arsenite (As) and cadmium (Cd) treatments induced the HS response in soybean seedlings but differed in their abilities to induce stress tolerance. Pretreatment of seedlings with sub-lethal HS protected them from subsequent normally lethal HS treatment. However, the protection was much more pronounced in 1 day-old than in 2 day-old plants. Sublethal arsenite pretreatment resulted in only a low level of protection against lethal As or HS treatment and severe damage still occurred in specific tissues. Cadmium did not induce any self- or cross-protection. DNA sequence analyses revealed that HS, As and Cd induced the transcription of similar sequences. However, Northern blot analyses of HS mRNAs, and analyses of in vitro translation products and in vivo-labeled proteins by 1D and 2D SDS-PAGE demonstrated that, compared to HS, the response to the chemical stresses was slower, less intense and not as selective. Apparently any causal relationship between HS proteins and induced stress tolerance must also involve developmental-, tissue-, and/or quantitative-specificities.

  15. Induction of apoptotic death and retardation of neuronal differentiation of human neural stem cells by sodium arsenite treatment

    SciTech Connect

    Ivanov, Vladimir N.; Hei, Tom K.

    2013-04-01

    Chronic arsenic toxicity is a global health problem that affects more than 100 million people worldwide. Long-term health effects of inorganic sodium arsenite in drinking water may result in skin, lung and liver cancers and in severe neurological abnormalities. We investigated in the present study whether sodium arsenite affects signaling pathways that control cell survival, proliferation and neuronal differentiation of human neural stem cells (NSC). We demonstrated that the critical signaling pathway, which was suppressed by sodium arsenite in NSC, was the protective PI3K–AKT pathway. Sodium arsenite (2–4 μM) also caused down-regulation of Nanog, one of the key transcription factors that control pluripotency and self-renewal of stem cells. Mitochondrial damage and cytochrome-c release induced by sodium arsenite exposure was followed by initiation of the mitochondrial apoptotic pathway in NSC. Beside caspase-9 and caspase-3 inhibitors, suppression of JNK activity decreased levels of arsenite-induced apoptosis in NSC. Neuronal differentiation of NSC was substantially inhibited by sodium arsenite exposure. Overactivation of JNK1 and ERK1/2 and down-regulation of PI3K–AKT activity induced by sodium arsenite were critical factors that strongly affected neuronal differentiation. In conclusion, sodium arsenite exposure of human NSC induces the mitochondrial apoptotic pathway, which is substantially accelerated due to the simultaneous suppression of PI3K–AKT. Sodium arsenite also negatively affects neuronal differentiation of NSC through overactivation of MEK–ERK and suppression of PI3K–AKT. - Highlights: ► Arsenite induces the mitochondrial apoptotic pathway in human neural stem cells. ► Arsenite-induced apoptosis is strongly upregulated by suppression of PI3K–AKT. ► Arsenite-induced apoptosis is strongly down-regulated by inhibition of JNK–cJun. ► Arsenite negatively affects neuronal differentiation by inhibition of PI3K–AKT.

  16. Mitochondrial hormesis links low-dose arsenite exposure to lifespan extension

    PubMed Central

    Schmeisser, Sebastian; Schmeisser, Kathrin; Weimer, Sandra; Groth, Marco; Priebe, Steffen; Fazius, Eugen; Kuhlow, Doreen; Pick, Denis; Einax, Jürgen W; Guthke, Reinhard; Platzer, Matthias; Zarse, Kim; Ristow, Michael

    2013-01-01

    Arsenite is one of the most toxic chemical substances known and is assumed to exert detrimental effects on viability even at lowest concentrations. By contrast and unlike higher concentrations, we here find that exposure to low-dose arsenite promotes growth of cultured mammalian cells. In the nematode C. elegans, low-dose arsenite promotes resistance against thermal and chemical stressors and extends lifespan of this metazoan, whereas higher concentrations reduce longevity. While arsenite causes a transient increase in reactive oxygen species (ROS) levels in C. elegans, co-exposure to ROS scavengers prevents the lifespan-extending capabilities of arsenite, indicating that transiently increased ROS levels act as transducers of arsenite effects on lifespan, a process known as mitohormesis. This requires two transcription factors, namely DAF-16 and SKN-1, which employ the metallothionein MTL-2 as well as the mitochondrial transporter TIN-9.1 to extend lifespan. Taken together, low-dose arsenite extends lifespan, providing evidence for nonlinear dose-response characteristics of toxin-mediated stress resistance and longevity in a multicellular organism. PMID:23534459

  17. Single strand DNA functionalized single wall carbon nanotubes as sensitive electrochemical labels for arsenite detection.

    PubMed

    Wang, Yonghong; Wang, Ping; Wang, Yiqiang; He, Xiaoxiao; Wang, Kemin

    2015-08-15

    In this work, a simple and sensitive electrochemical strategy for arsenite detection based on the ability of arsenite bound to single-strand DNA (ssDNA) and the signal transduction of single wall carbon nanotubes (SWCNTs) is developed. To realize this purpose, the ssDNA/SWCNTs complexes were formed at first by making ssDNA wrapped around SWCNTs via π-stacking. In the presence of arsenite, the arsenite could strongly bind with the G/T bases of ssDNA and decrease the π-π interaction between ssDNA and SWCNTs, resulting in a certain amount of ssDNA dissociating from the complexes. The separated SWCNTs were selectively assembled on the self-assembled monolayer (SAM) modified Au electrode. Then the SWCNTs onto the SAM-modified Au electrode substantially restored heterogeneous electron transfer that was almost totally blocked by the SAM. The assembled SWCNTs could generate a considerably sensitive and specific tactic for signal transduction, which was related to the concentration of the arsenite. Through detecting the currents mediated by SWCNTs, a linear response to concentration of arsenite ranging from 0.5 to 10ppb and a detection limit of 0.5ppb was readily achieved with desirable specificity and sensitivity. Such a SWCNTs-based biosensor creates a simple, sensitive, nonradioactive route for detection of arsenite. In addition, this demonstration provides a new approach to fabrication of stable biosensors with favorable electrochemical properties believed to be appealing to electroanalytical applications. PMID:25966391

  18. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  19. Diversity and abundance of arsenic biotransformation genes in paddy soils from southern China.

    PubMed

    Zhang, Si-Yu; Zhao, Fang-Jie; Sun, Guo-Xin; Su, Jian-Qiang; Yang, Xiao-Ru; Li, Hu; Zhu, Yong-Guan

    2015-04-01

    Microbe-mediated arsenic (As) biotransformation in paddy soils determines the fate of As in soils and its availability to rice plants, yet little is known about the microbial communities involved in As biotransformation. Here, we revealed wide distribution, high diversity, and abundance of arsenite (As(III)) oxidase genes (aioA), respiratory arsenate (As(V)) reductase genes (arrA), As(V) reductase genes (arsC), and As(III) S-adenosylmethionine methyltransferase genes (arsM) in 13 paddy soils collected across Southern China. Sequences grouped with As biotransformation genes are mainly from rice rhizosphere bacteria, such as some Proteobacteria, Gemmatimonadales, and Firmicutes. A significant correlation of gene abundance between arsC and arsM suggests that the two genes coexist well in the microbial As resistance system. Redundancy analysis (RDA) indicated that soil pH, EC, total C, N, As, and Fe, C/N ratio, SO4(2-)-S, NO3(-)-N, and NH4(+)-N were the key factors driving diverse microbial community compositions. This study for the first time provides an overall picture of microbial communities involved in As biotransformation in paddy soils, and considering the wide distribution of paddy fields in the world, it also provides insights into the critical role of paddy fields in the As biogeochemical cycle. PMID:25738639

  20. Anticancer effect of arsenite on cell migration, cell cycle and apoptosis in human pancreatic cancer cells

    PubMed Central

    HORIBE, YOHEI; ADACHI, SEIJI; YASUDA, ICHIRO; YAMAUCHI, TAKAHIRO; KAWAGUCHI, JUNJI; KOZAWA, OSAMU; SHIMIZU, MASAHITO; MORIWAKI, HISATAKA

    2016-01-01

    The standard treatment for advanced pancreatic cancer is chemotherapy, but its clinical outcome remains unsatisfactory. Therefore, the development of novel treatments for this malignancy is urgently required. In the present study, the anticancer effect of arsenite on platelet-derived growth factor (PDGF)-BB-induced migration, cell cycle and apoptosis was investigated in pancreatic cancer cells (AsPC-1 and BxPC-3), and compared with the effect on normal pancreatic epithelial (PE) cells. In the cell migration assay, arsenite clearly inhibited PDGF-BB-induced cell migration in AsPC-1 cells, but not in BxPC-3 or PE cells. Arsenite also caused cell apoptosis in AsPC-1 cells, but not in BxPC-3 or PE cells. In AsPC-1 cells, the levels of cyclin D1 and phosphorylated retinoblastoma protein decreased following treatment with arsenite, but this was not observed in BxPC-3 cells. To further examine the differences between these two cell lines, the effect of arsenite on upstream p44/p42 mitogen-activated protein kinase (MAPK) and Akt was investigated. PDGF-BB caused phosphorylation of p44/p42 MAPK and Akt in both cell lines. Pretreatment with arsenite significantly suppressed PDGF-BB-induced phosphorylation of Akt, but not of p44/p42 MAPK in AsPC-1 cells. By contrast, arsenite did not affect these molecules in BxPC-3 cells. Since the inhibition of the Akt signaling pathway markedly reduced PDGF-BB-induced migration in AsPC-1 cells, the present results strongly suggest that arsenite inhibits PDGF-BB-induced migration by suppressing the Akt signaling pathway in AsPC-1 cells. Therefore, arsenite may be a useful tool for the treatment of patients with certain types of pancreatic cancer, without causing adverse effects on normal pancreatic cells. PMID:27347121

  1. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    SciTech Connect

    Qin Xujun; Hudson, Laurie G.; Liu Wenlan; Timmins, Graham S.; Liu Kejian

    2008-10-01

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite ({<=} 2 {mu}M) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 {mu}M arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic.

  2. Effect of arsenite-oxidizing bacterium B. laterosporus on arsenite toxicity and arsenic translocation in rice seedlings.

    PubMed

    Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong

    2015-10-01

    Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings. PMID:26024808

  3. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.

    PubMed

    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon

    2015-06-10

    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade. PMID:25980806

  4. Arsenite Sorption by Drinking-Water Treatment Residuals: Redox Effects

    NASA Astrophysics Data System (ADS)

    Makris, K. C.; Sarkar, D.; Datta, R.

    2005-05-01

    Arsenic (As) is a major human carcinogen and could pose a serious human health risk at concentrations as low as 50 ppb in drinking water. Elevated As concentrations in soils currently used for residential purposes (located on former agricultural lands amended with arsenical pesticides) have increased the possibility of human contact with soil-As. Studies have shown that As bioavailability in the environment is primarily a function of its chemical speciation, which depends upon the redox potential. Arsenic toxicity and carcinogenicity to living organisms is primarily due to exposure to the reduced species of As - arsenite, i.e., As(III), rather than the oxidized species - arsenate, i.e., As(V); the mobility of As(III) is much higher than As(V). One of the most promising methods to decrease the mobility of arsenite in the soil-water system is promoting its retention onto amorphous Fe/Al hydroxides. Drinking-Water Treatment Residuals (WTRs) are an inexpensive source of such Fe/Al hydroxides, which can be land-applied following the USEPA-regulated biosolids application rules. The WTRs are byproducts of drinking-water purification processes and generally contain sediment, organic carbon, and Al/Fe hydroxides. The hydroxides are typically amorphous and have tremendous affinity for oxyanions (e.g., arsenate). Preliminary work showed that WTRs are characterized by large internal surface area and porosity that partly explains their high affinity for As(V). The current study examines the potential of two WTRs (Fe-based and Al-based) to adsorb arsenite from solution. We hypothesize that As(III) adsorption onto the Fe-based WTR (whose stability is highly redox-sensitive) would be vastly different from the adsorption of As(III) onto the redox-insensitive Al-based WTR. Our main objective is to characterize As(III) sorption by both Fe- and Al-based WTRs by changing critical factors, such as the solid:solution ratio, contact time, and initial As(III) load. Results from this study

  5. Regulation of cyclooxygenase-2 and cytosolic phospholipase A2 gene expression by lipopolysaccharide through the RNA-binding protein HuR: involvement of NADPH oxidase, reactive oxygen species and mitogen-activated protein kinases

    PubMed Central

    Lin, Wei-Ning; Lin, Chih-Chung; Cheng, Hsin-Yi; Yang, Chuen-Mao

    2011-01-01

    BACKGROUND AND PURPOSE Lipopolysaccharide (LPS)-induced expression of cyclooxygenase-2 (COX-2) and cytosolic phospholipase A2 (cPLA2) has been implicated in several respiratory diseases. HuR is known to enhance the expression of genes by binding to 3′-untranslated region (3′-UTR) of mRNA and stabilizing mRNA. However, the exact mechanisms by which HuR affects the stability of mRNA and modulates LPS-induced COX-2 and cPLA2 expression in human tracheal smooth muscle cells (HTSMCs) are not known. EXPERIMENTAL APPROACH The expression of prostaglandin E2 (PGE2) was measured by ELISA, and pro-inflammatory proteins were determined by use of a promoter assay, PCR or Western blot analysis. Overexpression of siRNAs to knock down the target components was used to manipulate the expression of HuR. Release of reactive oxygen species (ROS) was detected by fluorescence dye. The activation of signalling components was assessed by comparing phosphorylation levels, localization of protein kinases or coimmunoprecipitation assay. KEY RESULTS LPS induced COX-2 and cPLA2 expression via post-translational regulation of mRNA stabilization, which were attenuated by transfection with HuR siRNA in HTSMCs. In addition, LPS-stimulated NADPH oxidase activation and ROS generation were attenuated by the NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and apocynin (APO). Generation of ROS induced phosphorylation of p42/p44 mitogen-activated protein kinase (MAPK), p38 MAPK and JNK1/2, which was attenuated by DPI and APO and the ROS scavenger N-acetylcysteine. CONCLUSIONS AND IMPLICATIONS These results suggested that in HTSMCs, LPS-induced COX-2 and cPLA2 expression is mediated through NADPH oxidase/ROS-dependent MAPKs associated with HuR accumulation in the cytoplasm. Activated MAPKs may regulate the nucleocytoplasmic shuttling of HuR, and thus induce the cytoplasmic accumulation of HuR. PMID:21391979

  6. RAPID ARSENITE OXIDATION BY THERMUS AQUATICUS AND THERMUS THERMOPHILUS: FIELD AND LABORATORY INVESTIGATIONS. (R826189)

    EPA Science Inventory

    Thermus aquaticus and Thermus thermophilus, common inhabitants of terrestrial hot springs and thermally polluted domestic and industrial waters, have been found to rapidly oxidize arsenite to arsenate. Field investigations at a hot spring in Yellowstone National Park revealed ...

  7. ARSENITE BINDING TO SYNTHETIC PEPTIDES: THE EFFECT OF INCREASING LENGTH BETWEEN TWO CYSTEINES

    EPA Science Inventory

    Binding of trivalent arsenicals to peptides and proteins can alter peptide/protein structure and enzyme function and thereby contribute to arsenic toxicity and carcinogenicity. We utilized radioactive 73As- labeled arsenite and vacuum filtration methodology to determine the bindi...

  8. Sodium arsenite potentiates the clastogenicity and mutagenicity of DNA cross linking agents

    SciTech Connect

    Lee, T.C.; Lee, K.C.; Tzeng, Y.J.; Huang, R.Y.; Jan, K.Y.

    1986-01-01

    To see if sodium arsenite enhances the clastogenicity and the mutagenicity of DNA crosslinking agents, Chinese hamster ovary (CHO) cells and human skin fibroblasts were exposed to cis-diamminedichloroplatinum (II) (cis-Pt(II)) or 8-methoxypsoralen (8-MOP) plus long-wave ultraviolet light (UVA) and then to sodium arsenite. The results indicate that the clastogenicity of cis-Pt(II) and 8-MOP pllus UVA are enhanced by the post-treatment with sodium arsenite. Chromatid breaks and exchanges are predominantly increased in doubly treated cells. Furthermore, the mutagenicity of cis-Pt(II) at the hypoxanthine-guanine phosphoribosyl transferase locus is also potentiated by sodium arsenite in CHO cells

  9. De novo microdeletion of Xp11.3 exclusively encompassing the monoamine oxidase A and B genes in a male infant with episodic hypotonia: A genomics approach to personalized medicine

    PubMed Central

    O’Leary, Ryan E.; Shih, Jean C.; Hyland, Keith; Kramer, Nancy; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Monoamine oxidase A and B (MAOA and MAOB) play key roles in deaminating neurotransmitters and various other biogenic amines. Patients deficient in one or both enzymes have distinct metabolic and neurologic profiles. MAOB deficient patients exhibit normal clinical characteristics and behavior, while MAOA deficient patients have borderline intellectual deficiency and impaired impulse control. Patients who lack both MAOA and MAOB have the most extreme laboratory values (urine, blood, and CSF serotonin 4–6 times normal, with elevated O-methylated amine metabolites and reduced deaminated metabolites) in addition to severe intellectual deficiency and behavioral problems. Mice lacking maoa and moab exhibit decreased proliferation of neural stem cells beginning in late gestation and persisting into adulthood These mice show significantly increased monoamine levels, particularly serotonin, as well as anxiety-like behaviors as adults, suggesting that brain maturation in late embryonic development is adversely affected by elevated serotonin levels. We report the case of a male infant with a de novo Xp11.3 microdeletion exclusively encompassing the MAOA and MAOB genes. This newly recognized X-linked disorder is characterized by severe intellectual disability and unusual episodes of hypotonia, which resemble atonic seizures, but have no EEG correlate. A customized low dietary amine diet was implemented in an attempt to prevent the cardiovascular complications that can result from the excessive intake of these compounds. This is the second report of this deletion and the first attempt to maintain the patient’s cardiovascular health through dietary manipulation. Even though a diet low in tyramine, phenylethylamine, and dopa/dopamine is necessary for long-term management, it will not rescue the abnormal monoamine profile seen in combined MAOA and MAOB deficiency. Our patient displays markedly elevated levels of serotonin in blood, serum, urine, and CSF while on this diet

  10. A MALAT1/HIF-2α feedback loop contributes to arsenite carcinogenesis

    PubMed Central

    Xu, Yuan; Liu, Yi; Liu, Xinlu; Lu, Lu; Li, Jun; Wang, Qingling; Wei, Shaofeng; Shi, Le; Lu, Xiaolin; Liu, Qizhan; Zhang, Aihua

    2016-01-01

    Arsenic is well established as a human carcinogen, but the molecular mechanisms leading to arsenic-induced carcinogenesis are complex and elusive. It is also not known if lncRNAs are involved in arsenic-induced liver carcinogenesis. We have found that MALAT1, a non-coding RNA, is over-expressed in the sera of people exposed to arsenite and in hepatocellular carcinomas (HCCs), and MALAT1 has a close relation with the clinicopathological characteristics of HCC. In addition, hypoxia-inducible factor (HIF)-2α is up-regulated in HCCs, and MALAT1 and HIF-2α have a positive correlation in HCC tissues. During the malignant transformation of human hepatic epithelial (L-02) cells induced by a low concentration (2.0 μM) of arsenite, MALAT1 and HIF-2α are increased. In addition, arsenite-induced MALAT1 causes disassociation of the von Hippel-Lindau (VHL) protein from HIF-2α, therefore, alleviating VHL-mediated HIF-2α ubiquitination, which causes HIF-2α accumulation. In turn, HIF-2α transcriptionally regulates MALAT1, thus forming a positive feedback loop to ensure expression of arsenite-induced MALAT1 and HIF-2α, which are involved in malignant transformation. Moreover, MALAT1 and HIF-2α promote the invasive and metastatic capacities of arsenite-induced transformed L-02 cells and in HCC-LM3 cells. The capacities of MALAT1 and HIF-2α to promote tumor growth are validated in mouse xenograft models. In mice, arsenite induces an inflammatory response, and MALAT1 and HIF-2α are over-expressed. Together, these findings suggest that the MALAT1/HIF-2α feedback loop is involved in regulation of arsenite-induced malignant transformation. Our results not only confirm a novel mechanism involving reciprocal regulation between MALAT1 and HIF-2α, but also expand the understanding of the carcinogenic potential of arsenite. PMID:26735578

  11. Silymarin protects plasma membrane and acrosome integrity in sperm treated with sodium arsenite

    PubMed Central

    Eskandari, Farzaneh; Momeni, Hamid Reza

    2016-01-01

    Background: Exposure to arsenic is associated with impairment of male reproductive function by inducing oxidative stress. Silymarin with an antioxidant property scavenges free radicals. Objective: The aim of this study was to investigate if silymarin can prevent the adverse effects of sodium arsenite on ram sperm plasma membrane and acrosome integrity. Materials and Methods: Ram epidydimal spermatozoa were divided into five groups: spermatozoa at 0 hr, spermatozoa at 180 min (control), spermatozoa treated with silymarin (20 μM) + sodium arsenite (10 μM) for 180 min, spermatozoa treated with sodium arsenite (10 μM) for 180 min and spermatozoa treated with silymarin (20 μM) for 180 min. Double staining of Hoechst and propidium iodide was performed to evaluate sperm plasma membrane integrity, whereas comassie brilliant blue staining was used to assess acrosome integrity. Results: Plasma membrane (p< 0.001) and acrosome integrity (p< 0.05) of the spermatozoa were significantly reduced in sodium arsenite group compared to the control. In silymarin + sodium arsenite group, silymarin was able to significantly (p< 0.001) ameliorate the adverse effects of sodium arsenite on these sperm parameters compared to sodium arsenite group. The incubation of sperm for 180 min (control group) showed a significant (p< 0.001) decrease in acrosome integrity compared to the spermatozoa at 0 hour. The application of silymarin alone for 180 min could also significantly (p< 0.05) increase sperm acrosome integrity compared to the control. Conclusion: Silymarin as a potent antioxidant could compensate the adverse effects of sodium arsenite on the ram sperm plasma membrane and acrosome integrity. PMID:27141548

  12. A MALAT1/HIF-2α feedback loop contributes to arsenite carcinogenesis.

    PubMed

    Luo, Fei; Sun, Baofei; Li, Huiqiao; Xu, Yuan; Liu, Yi; Liu, Xinlu; Lu, Lu; Li, Jun; Wang, Qingling; Wei, Shaofeng; Shi, Le; Lu, Xiaolin; Liu, Qizhan; Zhang, Aihua

    2016-02-01

    Arsenic is well established as a human carcinogen, but the molecular mechanisms leading to arsenic-induced carcinogenesis are complex and elusive. It is also not known if lncRNAs are involved in arsenic-induced liver carcinogenesis. We have found that MALAT1, a non-coding RNA, is over-expressed in the sera of people exposed to arsenite and in hepatocellular carcinomas (HCCs), and MALAT1 has a close relation with the clinicopathological characteristics of HCC. In addition, hypoxia-inducible factor (HIF)-2α is up-regulated in HCCs, and MALAT1 and HIF-2α have a positive correlation in HCC tissues. During the malignant transformation of human hepatic epithelial (L-02) cells induced by a low concentration (2.0 μM) of arsenite, MALAT1 and HIF-2α are increased. In addition, arsenite-induced MALAT1 causes disassociation of the von Hippel-Lindau (VHL) protein from HIF-2α, therefore, alleviating VHL-mediated HIF-2α ubiquitination, which causes HIF-2α accumulation. In turn, HIF-2α transcriptionally regulates MALAT1, thus forming a positive feedback loop to ensure expression of arsenite-induced MALAT1 and HIF-2α, which are involved in malignant transformation. Moreover, MALAT1 and HIF-2α promote the invasive and metastatic capacities of arsenite-induced transformed L-02 cells and in HCC-LM3 cells. The capacities of MALAT1 and HIF-2α to promote tumor growth are validated in mouse xenograft models. In mice, arsenite induces an inflammatory response, and MALAT1 and HIF-2α are over-expressed. Together, these findings suggest that the MALAT1/HIF-2α feedback loop is involved in regulation of arsenite-induced malignant transformation. Our results not only confirm a novel mechanism involving reciprocal regulation between MALAT1 and HIF-2α, but also expand the understanding of the carcinogenic potential of arsenite. PMID:26735578

  13. Arsenite suppression of involucrin transcription through AP1 promoter sites in cultured human keratinocytes

    SciTech Connect

    Sinitsyna, Nadezda N.; Reznikova, Tatiana V.; Qin Qin; Song, Hyukhwan; Phillips, Marjorie A.; Rice, Robert H.

    2010-03-15

    While preserving keratinocyte proliferative ability, arsenite suppresses cellular differentiation markers by preventing utilization of AP1 transcriptional response elements. In present experiments, arsenite had a dramatic effect in electrophoretic mobility supershift analysis of proteins binding to an involucrin promoter AP1 response element. Without arsenite treatment, binding of JunB and Fra1 was readily detected in nuclear extracts from preconfluent cultures and was not detected a week after confluence, while c-Fos was detected only after confluence. By contrast, band shift of nuclear extracts from arsenite treated cultures showed only JunB and Fra1 binding in postconfluent as well as preconfluent cultures. Immunoblotting of cell extracts showed that arsenite treatment prevented the loss of Fra1 and the increase in c-Fos proteins that occurred after confluence in untreated cultures. Chromatin immunoprecipitation assays demonstrated substantial reduction of c-Fos and acetylated histone H3 at the proximal and distal AP1 response elements in the involucrin promoter and of coactivator p300 at the proximal element. Alteration of AP1 transcription factors was also examined in response to treatment with four metal containing compounds (chromate, vanadate, hemin, divalent cadmium) that also suppress involucrin transcription. These agents all influenced transcription at AP1 elements in a transcriptional reporter assay, but exhibited less effect than arsenite on binding activity assessed by mobility shift and chromatin immunoprecipitation and displayed variable effects on AP1 protein levels. These findings help trace a mechanism by which transcriptional effects of arsenite become manifest and help rationalize the unique action of arsenite, compared to the other agents, to preserve proliferative ability.

  14. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.

    PubMed

    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  15. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  16. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.

    PubMed

    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio

    2015-11-01

    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487 bp fragment, including part of 5.8 S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma. PMID:26336248

  17. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya

    2008-10-24

    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  18. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population

    PubMed Central

    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande

    2016-01-01

    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  19. Autophagy is the predominant process induced by arsenite in human lymphoblastoid cell lines

    SciTech Connect

    Bolt, Alicia M.; Byrd, Randi M.; Klimecki, Walter T.

    2010-05-01

    Arsenic is a widespread environmental toxicant with a diverse array of molecular targets and associated diseases, making the identification of the critical mechanisms and pathways of arsenic-induced cytotoxicity a challenge. In a variety of experimental models, over a range of arsenic exposure levels, apoptosis is a commonly identified arsenic-induced cytotoxic pathway. Human lymphoblastoid cell lines (LCL) have been used as a model system in arsenic toxicology for many years, but the exact mechanism of arsenic-induced cytotoxicity in LCL is still unknown. We investigated the cytotoxicity of sodium arsenite in LCL 18564 using a set of complementary markers for cell death pathways. Markers indicative of apoptosis (phosphatidylserine externalization, PARP cleavage, and sensitivity to caspase inhibition) were uniformly negative in arsenite exposed cells. Interestingly, electron microscopy, acidic vesicle fluorescence, and expression of LC3 in LCL 18564 identified autophagy as an arsenite-induced process that was associated with cytotoxicity. Autophagy, a cellular programmed response that is associated with both cellular stress adaptation as well as cell death appears to be the predominant process in LCL cytotoxicity induced by arsenite. It is unclear, however, whether LCL autophagy is an effector mechanism of arsenite cytotoxicity or alternatively a cellular compensatory mechanism. The ability of arsenite to induce autophagy in lymphoblastoid cell lines introduces a potentially novel mechanistic explanation of the well-characterized in vitro and in vivo toxicity of arsenic to lymphoid cells.

  20. Immobilization of arsenite and ferric iron by Acidithiobacillus ferrooxidans and its relevance to acid mine drainage.

    PubMed

    Duquesne, K; Lebrun, S; Casiot, C; Bruneel, O; Personné, J-C; Leblanc, M; Elbaz-Poulichet, F; Morin, G; Bonnefoy, V

    2003-10-01

    Weathering of the As-rich pyrite-rich tailings of the abandoned mining site of Carnoulès (southeastern France) results in the formation of acid waters heavily loaded with arsenic. Dissolved arsenic present in the seepage waters precipitates within a few meters from the bottom of the tailing dam in the presence of microorganisms. An Acidithiobacillus ferrooxidans strain, referred to as CC1, was isolated from the effluents. This strain was able to remove arsenic from a defined synthetic medium only when grown on ferrous iron. This A. ferrooxidans strain did not oxidize arsenite to arsenate directly or indirectly. Strain CC1 precipitated arsenic unexpectedly as arsenite but not arsenate, with ferric iron produced by its energy metabolism. Furthermore, arsenite was almost not found adsorbed on jarosite but associated with a poorly ordered schwertmannite. Arsenate is known to efficiently precipitate with ferric iron and sulfate in the form of more or less ordered schwertmannite, depending on the sulfur-to-arsenic ratio. Our data demonstrate that the coprecipitation of arsenite with schwertmannite also appears as a potential mechanism of arsenite removal in heavily contaminated acid waters. The removal of arsenite by coprecipitation with ferric iron appears to be a common property of the A. ferrooxidans species, as such a feature was observed with one private and three collection strains, one of which was the type strain. PMID:14532077

  1. Inhibitory Effects of Sodium Arsenite and Acacia Honey on Acetylcholinesterase in Rats

    PubMed Central

    Odunola, Oyeronke A.; Gbadegesin, Michael A.; Sallau, Abdullahi B.; Ndidi, Uche S.; Ibrahim, Mohammed A.

    2015-01-01

    This study was conducted to investigate the effect of sodium arsenite and Acacia honey on acetylcholinesterase (AChE) activity and electrolytes in the brain and serum of Wistar rats. Male Wistar albino rats in four groups of five rats each were treated with distilled water, sodium arsenite (5 mg/kg body weight), Acacia honey (20% v/v), and sodium arsenite and Acacia honey, daily for one week. The sodium arsenite and Acacia honey significantly (P < 0.05) decreased AChE activity in the brain with the combined treatment being more potent. Furthermore, sodium arsenite and Acacia honey significantly (P < 0.05) decreased AChE activity in the serum. Strong correlation was observed between the sodium and calcium ion levels with acetylcholinesterase activity in the brain and serum. The gas chromatography mass spectrometry analysis of Acacia honey revealed the presence of a number of bioactive compounds such as phenolics, sugar derivatives, and fatty acids. These findings suggest that sodium arsenite and/or Acacia honey modulates acetylcholinesterase activities which may be explored in the management of Alzheimer's diseases but this might be counteracted by the hepatotoxicity induced by arsenics. PMID:25821630

  2. Immobilization of Arsenite and Ferric Iron by Acidithiobacillus ferrooxidans and Its Relevance to Acid Mine Drainage

    PubMed Central

    Duquesne, K.; Lebrun, S.; Casiot, C.; Bruneel, O.; Personné, J.-C.; Leblanc, M.; Elbaz-Poulichet, F.; Morin, G.; Bonnefoy, V.

    2003-01-01

    Weathering of the As-rich pyrite-rich tailings of the abandoned mining site of Carnoulès (southeastern France) results in the formation of acid waters heavily loaded with arsenic. Dissolved arsenic present in the seepage waters precipitates within a few meters from the bottom of the tailing dam in the presence of microorganisms. An Acidithiobacillus ferrooxidans strain, referred to as CC1, was isolated from the effluents. This strain was able to remove arsenic from a defined synthetic medium only when grown on ferrous iron. This A. ferrooxidans strain did not oxidize arsenite to arsenate directly or indirectly. Strain CC1 precipitated arsenic unexpectedly as arsenite but not arsenate, with ferric iron produced by its energy metabolism. Furthermore, arsenite was almost not found adsorbed on jarosite but associated with a poorly ordered schwertmannite. Arsenate is known to efficiently precipitate with ferric iron and sulfate in the form of more or less ordered schwertmannite, depending on the sulfur-to-arsenic ratio. Our data demonstrate that the coprecipitation of arsenite with schwertmannite also appears as a potential mechanism of arsenite removal in heavily contaminated acid waters. The removal of arsenite by coprecipitation with ferric iron appears to be a common property of the A. ferrooxidans species, as such a feature was observed with one private and three collection strains, one of which was the type strain. PMID:14532077

  3. Removal of arsenite by simultaneous electro-oxidation and electro-coagulation process.

    PubMed

    Zhao, Xu; Zhang, Baofeng; Liu, Huijuan; Qu, Jiuhui

    2010-12-15

    An electrochemical reactor was built and used to remove arsenite from water. In this reactor, arsenite can be oxidized into arsenate, which was removed by electro-coagulation process simultaneously. The reactor mainly included dimension stable anode (DSA) and iron plate electrode. Oxidation of arsenite will occur at the DSA electrode in the electrochemical process. Meantime, the iron ions can be generated by the electro-induced process and iron oxides will form. Thus, the arsenic was removed by coagulation process. Influencing factors on the removal of arsenite were investigated. It is found that Ca(2+) and Mg(2+) ions promoted the removal of arsenite. However, Cl(-), CO(3)(2-), SiO(3)(2-), and PO(4)(3-) ions inhibited the arsenic removal. And, it is observed that the inhibition effect was the largest in the presence of PO(4)(3-). Furthermore, it is observed that the removal efficiency of arsenate is the largest in the pH value of 8. Increase or decrease of pH value did not benefit to the arsenite removal. Fourier transform infrared spectra were used to analyze the floc particles, it is suggested that the removal mechanism of As(III) in this system seems to be oxidative of As(III) to As(V) and to be removed by adsorption/complexation with metal hydroxides generated in the process. PMID:20863616

  4. Two novel mutations and coexistence of the 991C>T and the 1339C>T mutation on a single allele in the coproporphyrinogen oxidase gene in Swedish patients with hereditary coproporphyria.

    PubMed

    Wiman, Asa; Floderus, Ylva; Harper, Pauline

    2002-01-01

    Hereditary coproporphyria (HCP) is an autosomal dominant disorder, resulting from a partial deficiency of the enzyme coproporphyrinogen oxidase (CPO). This enzyme catalyzes the sixth step of the heme biosynthetic pathway, and mutations in the CPO gene have been coupled to HCP. The present study was undertaken to identify disease-producing mutations in the CPOgene in nine Swedish families with HCP. Exon 1 of the CPO gene of the nine probands was analyzed directly by sequencing, and exons 2-7 were screened by denaturating gradient gel electrophoresis, followed by sequencing of exons showing abnormal band pattern. Mutations were detected in five of the nine families. In two of these families, the novel mutations 623C>T (S208F, exon 2) and 982C>T (R328C, exon 5) were identified, respectively. In the affected members of the other three families, the previously reported mutations 991C>T (R331W, exon 5) and 1339C>T (R447C, exon 7) were shown to coexist on one allele. The present study contributes 2 novel mutations to the 34 that have been previously reported to cause HCP. In addition, this is the first report on patients carrying two HCP-coupled mutations on one allele. PMID:12181641

  5. Coupling of energy metabolism and synaptic transmission at the transcriptional level: Role of nuclear respiratory factor 1 in regulating both cytochrome c oxidase and NMDA glutamate receptor subunit genes

    PubMed Central

    Dhar, Shilpa S.; Wong-Riley, Margaret T. T.

    2009-01-01

    Neuronal activity and energy metabolism are tightly coupled processes. Regions high in neuronal activity, especially of the glutamatergic type, have high levels of cytochrome c oxidase (COX). Perturbations in neuronal activity affect the expressions of COX and glutamatergic N-methyl-D-aspartate receptor subunit 1 (NR1). The present study sought to test our hypothesis that the coupling extends to the transcriptional level, whereby NR1 and possibly other NR subunits and COX are co-regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), which regulates all COX subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutations, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Grin 1 (NR1), Grin 2b (NR2b) and COX subunit genes, but not of Grin2a and Grin3a genes. These transcripts were up-regulated by KCl and down-regulated by TTX in cultured primary neurons. However, silencing of NRF-1 with small interference RNA blocked the up-regulation of Grin1, Grin2b, and COX induced by KCl, and over-expression of NRF-1 rescued these transcripts that were suppressed by TTX. NRF-1 binding sites on Grin1 and Grin2b genes are also highly conserved among mice, rats, and humans. Thus, NRF-1 is an essential transcription factor critical in the co-regulation of NR1, NR2b, and COX, and coupling exists at the transcriptional level to ensure coordinated expressions of proteins important for synaptic transmission and energy metabolism. PMID:19144849

  6. Inhibition of poly(ADP-ribose) polymerase-1 by arsenite interferes with repair of oxidative DNA damage.

    PubMed

    Ding, Wei; Liu, Wenlan; Cooper, Karen L; Qin, Xu-Jun; de Souza Bergo, Patrícia L; Hudson, Laurie G; Liu, Ke Jian

    2009-03-13

    Arsenic enhances skin tumor formation when combined with other carcinogens, including UV radiation (UVR). In this study we report that low micromolar concentrations of arsenite synergistically increases UVR-induced oxidative DNA damage in human keratinocytes as detected by 8-hydroxyl-2'-deoxyguanine (8-OHdG) formation. Poly(ADP-ribose) polymerase-1 (PARP-1) is involved in base excision repair, a process that repairs 8-OHdG lesions. Arsenite suppresses UVR-induced PARP-1 activation in a concentration-dependent manner. Inhibition of PARP-1 activity by 3-aminobenzamide or small interfering RNA silencing of PARP-1 expression significantly increases UVR-induced 8-OHdG formation, suggesting that inhibition of PARP-1 activity by arsenite contributes to oxidative DNA damage. PARP-1 is a zinc finger protein, and mass spectrometry analysis reveals that arsenite can occupy a synthetic apopeptide representing the first zinc finger of PARP-1 (PARPzf). When the PARPzf peptide is preincubated with Zn(II) followed by incubation with increasing concentrations of arsenite, the ZnPARPzf signal is decreased while the AsPARPzf signal intensity is increased as a function of arsenite dose, suggesting a competition between zinc and arsenite for the same binding site. Addition of Zn(II) abolished arsenite enhancement of UVR-stimulated 8-OHdG generation and restored PARP-1 activity. Our findings demonstrate that arsenite inhibits oxidative DNA damage repair and suggest that interaction of arsenite with the PARP-1 zinc finger domain contributes to the inhibition of PARP-1 activity by arsenite. Arsenite inhibition of poly(ADP-ribosyl)ation is one likely mechanism for the reported co-carcinogenic activities of arsenic in UVR-induced skin carcinogenesis. PMID:19056730

  7. Molecular Characterization and In Situ Quantification of Anoxic Arsenite Oxidizing Denitrifying Enrichment Cultures

    PubMed Central

    Sun, Wenjie; Sierra, Reyes; Fernandez, Nuria; Sanz, Jose Luis; Amils, Ricardo; Legatzki, Antje; Maier, Raina M.; Field, Jim A.

    2015-01-01

    To explore bacteria involved in the oxidation of arsenite (As(III)) under denitrifying conditions, three enrichment cultures (ECs) and one mixed culture (MC) were characterized that originated from anaerobic environmental samples. The oxidation of As(III) (0.5 mM) was dependent on NO3− addition and N2-formation was dependent on As(III) addition. The ratio of N2-N formed to As(III) fed approximated the expected stoichiometry of 2.5. A 16S rRNA gene clone library analysis revealed three predominant phylotypes. The first, related to the genus Azoarcus from the division β-Proteobacteria, was found in the three ECs. The other two predominant phylotypes were closely related to the genera Acidovorax and Diaphorobacter within the Comamonadaceae family of β-Proteobacteria and one of these was present in all of the cultures examined. Fluorescent in situ hybridization (FISH) confirmed that Azoarcus accounted for a large fraction of bacteria present in the ECs. The Azoarcus clones had 96% sequence homology with Azoarcus sp. strain DAO1, an isolate previously reported to oxidize As(III) with nitrate. FISH analysis also confirmed that Comamonadaceae were present in all cultures. Pure cultures of Azoarcus and Diaphorobacter were isolated and shown to be responsible for nitrate-dependent As(III) oxidation. These results taken as a whole suggest that bacteria within the genus Azoarcus and the family Comamonadaceae are involved in the observed anoxic oxidation of As(III). PMID:19187211

  8. NADPH oxidases in the arbuscular mycorrhizal symbiosis.

    PubMed

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-04-01

    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  9. Arsenite-Oxidizing Hydrogenobaculum Strain Isolated from an Acid-Sulfate-Chloride Geothermal Spring in Yellowstone National Park

    PubMed Central

    Donahoe-Christiansen, Jessica; D'Imperio, Seth; Jackson, Colin R.; Inskeep, William P.; McDermott, Timothy R.

    2004-01-01

    An arsenite-oxidizing Hydrogenobaculum strain was isolated from a geothermal spring in Yellowstone National Park, Wyo., that was previously shown to contain microbial populations engaged in arsenite oxidation. The isolate was sensitive to both arsenite and arsenate and behaved as an obligate chemolithoautotroph that used H2 as its sole energy source and had an optimum temperature of 55 to 60°C and an optimum pH of 3.0. The arsenite oxidation in this organism displayed saturation kinetics and was strongly inhibited by H2S. PMID:15006819

  10. Arsenite-oxidizing Hydrogenobaculum strain isolated from an acid-sulfate-chloride geothermal spring in Yellowstone National Park.

    PubMed

    Donahoe-Christiansen, Jessica; D'Imperio, Seth; Jackson, Colin R; Inskeep, William P; McDermott, Timothy R

    2004-03-01

    An arsenite-oxidizing Hydrogenobaculum strain was isolated from a geothermal spring in Yellowstone National Park, Wyo., that was previously shown to contain microbial populations engaged in arsenite oxidation. The isolate was sensitive to both arsenite and arsenate and behaved as an obligate chemolithoautotroph that used H(2) as its sole energy source and had an optimum temperature of 55 to 60 degrees C and an optimum pH of 3.0. The arsenite oxidation in this organism displayed saturation kinetics and was strongly inhibited by H(2)S. PMID:15006819

  11. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.

    PubMed

    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu

    2014-10-01

    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  12. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.

    PubMed

    Papagianni, Maria; Avramidis, Nicholaos

    2012-08-10

    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. PMID:22759530

  13. Curcumin Inhibits The Adverse Effects of Sodium Arsenite in Mouse Epididymal Sperm

    PubMed Central

    Momeni, Hamid Reza; Eskandari, Najmeh

    2016-01-01

    Background The aim of this study was to investigate the effects of curcumin on epididy- mal sperm parameters in adult male Navel Medical Research Institute (NMRI) mice ex- posed to sodium arsenite. Materials and Methods In this experimental study, we divided the animals into four groups: control, sodium arsenite (5 mg/kg), curcumin (100 mg/kg) and curcumin+sodium arsenite. Exposures were performed by intraperitoneal injections for a 5-week period. After the exposure period, we recorded the animals’ body and left testes weights. The left caudal epididymis was used to count the sperm number and analyze motility, viability, morphological abnormalities, acrosome reaction, DNA integrity, and histone-protamine replacement in the spermatozoa. One-way analysis of variance (ANOVA) followed by the Tukey’s test was used to assess the statistical significance of the data with SPSS 16.0. P<0.05 was considered significant. Results Mice exposed to sodium arsenite showed a significant decrease in the num- ber, motility, viability, normal sperm morphology and acrosome integrity of spermato- zoa compared to the control group. In the curcumin+sodium arsenite group, curcumin significantly reversed these adverse effects to the point where they approximated the control. In addition, the application of curcumin alone had no significant difference in these parameters compared to the control and curcumin+sodium arsenite groups. However, we observed no significant differences in the body and the testis weight as well as the DNA integrity and histone-protamine replacement in the spermatozoa of the four groups. Conclusion Curcumin compensated for the toxic effects of sodium arsenite on a number of sperm parameters in adult mice. PMID:27441059

  14. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc.

    PubMed

    Cooper, Karen L; King, Brenee S; Sandoval, Monica M; Liu, Ke Jian; Hudson, Laurie G

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  15. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  16. Transcriptional coupling of synaptic transmission and energy metabolism: Role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons

    PubMed Central

    Dhar, Shilpa S.; Liang, Huan Ling; Wong-Riley, Margaret T. T.

    2009-01-01

    SUMMARY Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts downregulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level. PMID:19615412

  17. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.

    PubMed

    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa

    2015-04-01

    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  18. Overexpression of a GmCnx1 gene enhanced activity of nitrate reductase and aldehyde oxidase, and boosted mosaic virus resistance in soybean.

    PubMed

    Zhou, Zheng; He, Hongli; Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

    2015-01-01

    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g(-1) h(-1) and 30 pmol L(-1), respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  19. Adaptation of a methanogenic consortium to arsenite inhibition

    PubMed Central

    Rodriguez-Freire, Lucia; Moore, Sarah E.; Sierra-Alvarez, Reyes; Field, James A.

    2016-01-01

    Arsenic (As) is a ubiquitous metalloid known for its adverse effects to human health. Microorganisms are also impacted by As toxicity, including methanogenic archaea, which can affect the performance of process in which biological activity is required (i.e. stabilization of activated sludge in wastewater treatment plants). The novel ability of a mixed methanogenic granular sludge consortium to adapt to the inhibitory effect of arsenic (As) was investigated by exposing the culture to approximately 0.92 mM of AsIII for 160 d in an arsenate (AsV) reducing bioreactor using ethanol as the electron donor. The results of shaken batch bioassays indicated that the original, unexposed sludge was severely inhibited by arsenite (AsIII) as evidenced by the low 50% inhibition concentrations (IC50) determined, i.e., 19 and 90 μM for acetoclastic- and hydrogenotrophic methanogenesis, respectively. The tolerance of the acetoclastic and hydrogenotrophic methanogens in the sludge to AsIII increased 47-fold (IC50 = 910 μM) and 12-fold (IC50= 1100 μM), respectively, upon long-term exposure to As. In conclusion, the methanogenic community in the granular sludge demonstrated a considerable ability to adapt to the severe inhibitory effects of As after a prolonged exposure period. PMID:26823637

  20. Characterisation of full-length mitochondrial copies and partial nuclear copies (numts) of the cytochrome b and cytochrome c oxidase subunit I genes of Toxoplasma gondii, Neospora caninum, Hammondia heydorni and Hammondia triffittae (Apicomplexa: Sarcocystidae).

    PubMed

    Gjerde, Bjørn

    2013-04-01

    Genomic DNA was extracted from three oocyst isolates of Hammondia triffittae from foxes and two oocyst isolates of Hammondia heydorni from dogs, as well as from cell culture-derived tachyzoites of Toxoplasma gondii (RH strain) and Neospora caninum (NC-Liverpool strain), and examined by PCR with primers targeting the cytochrome b (cytb) and the cytochrome c oxidase subunit I (cox1) genes in order to characterise both genes and, if possible, the remainder of the mitochondrial genome of these species. Several primers were designed and used in various combinations to amplify regions within and between both genes and to determine gene order. When certain forward primers targeting cytb were used in combination with certain reverse primers targeting cox1, two overlapping sequences were obtained for each species and isolate studied, which showed that a full-length copy of cytb was followed 36-37 bp downstream by a full-length copy of cox1, and these sequences are believed to represent the true mitochondrial genes and the gene order in the mitochondrial genome of the four species examined. The cytb of T. gondii, N. caninum, H. heydorni and H. triffittae comprised a total of 1,080 bp (359 amino acids) and used ATG and TAA as start and stop codon, respectively. The cox1 of these species also used TAA as stop codon, whereas the most likely start codon was ATG, resulting in a gene comprising 1,491 bp (496 amino acids). Pair-wise sequence comparisons based on either cytb or cox1 clearly separated T. gondii from N. caninum and both of these species from the two Hammondia species, whereas the latter two species were 100 % identical at cytb and shared 99.3 % identity at cox1. Phylogenetic analyses using the maximum-likelihood method confirmed these findings and placed T. gondii in a clade separate from the three other species and all four Toxoplasmatinae in a sister clade to Eimeria spp. PCR with other primers and/or primer pairs than those used to obtain the full

  1. Development of Mag-FMBO in clay-reinforced KGM aerogels for arsenite removal.

    PubMed

    Ye, Shuxin; Jin, Weiping; Huang, Qing; Hu, Ying; Shah, Bakht Ramin; Li, Yan; Li, Bin

    2016-06-01

    To seek high-efficient, convenient and robust methods to decontaminate water polluted by arsenite are critically in demand. Here, we developed a series of magnetic konjac glucomannan (KGM) aerogels as adsorbents for arsenite removal. These adsorbents were fabricated based on sodium montmorillonite (Na(+)-MMT) reinforced KGM matrix with magnetic Fe and Mn oxides (Mag-FMBO) inside. The obtained aerogels adsorbents were characterized by using compression test, thermo gravimetric analysis (TGA), vibrating sample magnetometer (VSM), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and scanning electron microscope (SEM). The characteristic results showed that the composite aerogels possessed strong mechanical and magnetic property, excellent thermal characteristic and tunable pore structure. Batch adsorption tests were used to evaluate arsenite removal capacity. The adsorption results exhibited that the arsenite removal process was pH-dependent, followed a pseudo-second-order rate equation and Langmuir monolayer adsorption. The maximum arsenite uptake capacity of magnetic aerogels M1.5 reached 16.03mgg(-1) according to Langmuir isotherm at pH 7 and 323K. Besides, the magnetic composite aerogels can be repeatedly used after the treatment of regenerant (NaOH/NaCl/NaClO solution). PMID:26814828

  2. Label-free signal-on aptasensor for sensitive electrochemical detection of arsenite.

    PubMed

    Cui, Lin; Wu, Jie; Ju, Huangxian

    2016-05-15

    A signal-on aptasensor was fabricated for highly sensitive and selective electrochemical detection of arsenite with a label-free Ars-3 aptamer self-assembled on a screen-printed carbon electrode (SPCE) via Au-S bond. The Ars-3 aptamer could adsorb cationic polydiallyldimethylammonium (PDDA) via electrostatic interaction to repel other cationic species. In the presence of arsenite, the change of Ars-3 conformation due to the formation of Ars-3/arsenite complex led to less adsorption of PDDA, and the complex could adsorb more positively charged [Ru(NH3)6](3+) as an electrochemically active indicator on the aptasensor surface, which produced a sensitive "turn-on" response. The target-induced structure switching could be used for sensitive detection of arsenite with a linear range from 0.2 nM to 100 nM and a detection limit down to 0.15 nM. Benefiting from Ars-3 aptamer, the proposed system exhibited excellent specificity against other heavy metal ions. The SPCE-based aptasensor exhibited the advantages of low cost and simple fabrication, providing potential application of arsenite detection in environment. PMID:26785310

  3. Protective effects of Vernonia amygdalina against sodium arsenite-induced genotoxicity in rat

    PubMed Central

    Adetutu, Adewale; Oyewo, Emmanuel Bukoye; Adesokan, Ayoade A.

    2013-01-01

    Objectives: Contamination of the environment with arsenic (As) from both human and natural sources is known as a global problem. This study investigated the chemoprotective potential of Vernonia amygdalina leave extract against sodium arsenite-induced genotoxicity and hepatotoxicity. Materials and Methods: Genotoxic effects were evaluated in the rat bone marrow using micronuclei. The gamma glutamyl transpeptidase (GGT) and alkaline phosphatase (ALP) activities were assayed in rat serum. Results: Pre-treatment with extract of V. amygdalina at doses 5 mg/kg and 10 mg/kg significantly decreased the frequency of micronucleated polychromatic erythrocytes (PCEs). The GGT and ALP activities were elevated more than fourfold, in the liver of rats treated with sodium arsenite, while it was reduced almost to half when the sodium arsenit-treated rats were fed fresh V. amgdalina leave extracts The phytochemical constituents of V. amygdalina assayed in this study may be responsible for high radical scavenging of the DPPH free radical observed. Conclusion: The present results indicate that V. amygdalina extract is capable of suppressing the chromosomal aberration induced by sodium arsenite in rat. Thus, V. amygdalina may be a potent chemoprotective agent against the toxicity of sodium arsenite in rats. PMID:23900237

  4. Genotoxic effects of sodium arsenite and sodium arsenate after chronic exposure of Drosophila melanogaster larvae

    SciTech Connect

    Ramos-Morales, P.; Ordaz, M.G.; Munoz, A.

    1995-11-01

    Two arsenic compounds, namely: NaAsO{sub 2} (Sodium Arsenite) and Na{sub 2}HAsO{sub 4} (Sodium Arsenate) were tested for its chronic effect in somatic cells of Drosophila melanogaster. In a previous study in Drosophila we found that both compounds induced SLRL mutations, but failed to induce sex chromosome loss. In the SMART, after acute exposure, only sodium arsenite was positive when cells of the wings were used; however, both were positives in cells of the eyes of Drosophila. The genotoxicity of both compounds localized mainly on somatic cells, in agreement with reports on the carcinogenicity potential of arsenical compounds. The Somatic mutation and recombination test (SMART) was run employing cells of the wing imaginal discs from flr{sup 3}/mwh larvae. First instar larvae (24 {plus_minus} 4 h) were treated during 96 hours with sodium arsenite [0.015-4.0 ppm], and sodium arsenate [0.2-10 ppm], negative control was treated with distilled water. The frequency of spots by wing induced by the two arsenic salts were compared with control according with Frei and Wuergler procedure. Data show that sodium arsenite tested negative at all concentrations, but sodium arsenate tested positive at 0.8, 2 and 10 ppm (P<0.05). This results were consistent with the co-mutagenic role of sodium arsenite, but show that sodium arsenate was mutagenic in Drosophila test system under chronic exposure.

  5. Comparative effects of some local food condiments on sodium arsenite-induced clastogenicity.

    PubMed

    Odunola, O A

    2003-03-01

    The modulatory effects of the aqueous extracts of some locally consumed food condiments namely garlic (Allium sativum), ginger (Zingiber officinale), sconio (Pimpinella anisumm LINNE) and cloves (Syzygium aromaticum) on the clastogenic effects of sodium arsenite, a known inorganic clastogen were assessed in mouse bone marrow cells using the micronucleus assay method. Results of preliminary investigation of the clastogenicity of the condiments show that aqueous extracts of these condiments have very mild clastogenic activity in mice in the order garlic > ginger and sconio > cloves and that extracts of ginger and sconio seem to have the same degree of clastogenicity. Pre-treatment of mice for seven days with extracts of the condiments orally before exposure to the oral dose (2.5 mg/kg body wt.) of sodium arsenite resulted in a remarkable reduction of the magnitude of formation of micronuclei in polychromatic erythrocytes of the bone marrow. The degree of reduction of the clastogenic effect of arsenite was of the order ginger > garlic > cloves > sconio. This reduction of arsenite induced clastogenicity by aqueous extracts of the condiments may be due in part to the antioxidant properties of their chemical constituents, thus suggesting that the condiments may be useful in the prevention of arsenite-induced toxicity in areas where arsenic is an environmental contaminant. PMID:15030071

  6. An aquaporin PvTIP4;1 from Pteris vittata may mediate arsenite uptake.

    PubMed

    He, Zhenyan; Yan, Huili; Chen, Yanshan; Shen, Hongling; Xu, Wenxiu; Zhang, Haiyan; Shi, Lei; Zhu, Yong-Guan; Ma, Mi

    2016-01-01

    The fern Pteris vittata is an arsenic hyperaccumulator. The genes involved in arsenite (As(III)) transport are not yet clear. Here, we describe the isolation and characterization of a new P. vittata aquaporin gene, PvTIP4;1, which may mediate As(III) uptake. PvTIP4;1 was identified from yeast functional complement cDNA library of P. vittata. Arsenic toxicity and accumulating activities of PvTIP4;1 were analyzed in Saccharomyces cerevisiae and Arabidopsis. Subcellular localization of PvTIP4;1-GFP fusion protein in P. vittata protoplast and callus was conducted. The tissue expression of PvTIP4;1 was investigated by quantitative real-time PCR. Site-directed mutagenesis of the PvTIP4;1 aromatic/arginine (Ar/R) domain was studied. Heterologous expression in yeast demonstrates that PvTIP4;1 was able to facilitate As(III) diffusion. Transgenic Arabidopsis showed that PvTIP4;1 increases arsenic accumulation and induces arsenic sensitivity. Images and FM4-64 staining suggest that PvTIP4;1 localizes to the plasma membrane in P. vittata cells. A tissue location study shows that PvTIP4;1 transcripts are mainly expressed in roots. Site-directed mutation in yeast further proved that the cysteine at the LE1 position of PvTIP4;1 Ar/R domain is a functional site. PvTIP4;1 is a new represented tonoplast intrinsic protein (TIP) aquaporin from P. vittata and the function and location results imply that PvTIP4;1 may be involved in As(III) uptake. PMID:26372374

  7. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    PubMed Central

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

    2013-01-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  8. Molecular phylogeny of the subfamily Gerbillinae (Muridae, Rodentia) with emphasis on species living in the Xinjiang-Uygur Autonomous Region of China and based on the mitochondrial cytochrome b and cytochrome c oxidase subunit II genes.

    PubMed

    Ito, Mamoru; Jiang, Wei; Sato, Jun J; Zhen, Qiang; Jiao, Wei; Goto, Kazuo; Sato, Hiroshi; Ishiwata, Kenji; Oku, Yuzaburo; Chai, June-Jie; Kamiya, Haruo

    2010-03-01

    Rodents belonging to the subfamily Gerbillinae and living in the Xinjiang-Uygur autonomous region of China were collected in field surveys between 2001 and 2003. We found four Meriones species, including M. chengi M. liycus, M. meridianus, and M. tamariscinus, as well as related species from different genera, Rhombomys opimus and Brachiones przewaliskii For phylogenetic analyses of these gerbilline species, DNA sequences of parts of the mitochondrial cytochrome b (Cytb) and cytochrome c oxidase subunit II (COII) genes were examined with the neighbor Joining, maximum parsimony, maximum likelihood, and Bayesian inference methods. Our phylogenetic analyses suggest that the genus Meriones is not monophyletic and place M. tamaricinus as the sister taxon to a clade comprising Brachiones, Psammomys, Rhombomys, and the other Meriones species. The remaining Meriones species separate into three lineages: M. meridianus (including M. chengi), Meriones unguiculatus, and a clade that includes multiple Meriones species originating from Asia, the Middle East, and Africa. The phylogenetic relationships among the genera Brachines, Meriones, Psammomys, and Rhombomys remain ambiguous, probably due to the saturation of mutations that occurs in fast-evolving mitochondrial DNA. In addition, intraspecific variation was observed for M. meridianus, and this mostly correlated with collection localities, i.e., the northern and southern parts of the Xinjiang region. This variation corresponded to interspecific levels of divergence among other lineages of Meriones. Interestingly, no differences were observed in either the Cytb or COII gene sequences isolated from M. chengi collected from the Turfan Basin in the north and those from M. meridianus in the south, suggesting that M. chengi may be a synonym of M. meridianus. PMID:20192696

  9. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  10. Stimulation of reactive oxygen, but not reactive nitrogen species, in vascular endothelial cells exposed to low levels of arsenite.

    PubMed

    Barchowsky, A; Klei, L R; Dudek, E J; Swartz, H M; James, P E

    1999-12-01

    Elevated levels of arsenite, the trivalent form of arsenic, in drinking water correlates with increased vascular disease and vessel remodeling. Previous studies from this laboratory demonstrated that environmentally relevant concentrations of arsenite caused oxidant-dependent increases in nuclear transcription factor levels in cultured porcine vascular endothelial cells. The current studies characterized the reactive species generated in these cells exposed to levels of arsenite that initiate cell signaling. These exposures did not deplete 5'-triphosphate, nor did they affect basal or bradykinin-stimulated intracellular free Ca2+ levels, indicating that they were not lethal. Electron paramagnetic resonance (EPR) spectroscopy, including spin trapping with carboxy-PTIO (cPTIO), demonstrated that 5 microM or less of arsenite did not increase *NO levels over a 30-min period relative to *NO release stimulated by bradykinin. However, these same levels of arsenite rapidly increased both oxygen consumption and superoxide formation, as measured by EPR oximetry and spin trapping with 5,5-dimethyl-1-pyrroline N-oxide (DMPO), respectively. Pretreatment of the cells with DPI, apocynin, or superoxide dismutase abolished arsenite-stimulated DMPO-OH adduct formation. Finally arsenite increased extracellular accumulation of H2O2, measured as oxidation of homovanillic acid, with the same time and dose dependence, as seen for superoxide formation. These data suggest that superoxide and H2O2 are the predominant reactive species produced by endothelial cells after arsenite exposures that stimulate cell signaling and activate transcription factors. PMID:10641735

  11. Construction of the recombinant broad-host-range plasmids providing their bacterial hosts arsenic resistance and arsenite oxidation ability.

    PubMed

    Drewniak, Lukasz; Ciezkowska, Martyna; Radlinska, Monika; Sklodowska, Aleksandra

    2015-02-20

    The plasmid pSinA of Sinorhizobium sp. M14 was used as a source of functional phenotypic modules, encoding proteins involved in arsenite oxidation and arsenic resistance, to obtain recombinant broad-host-range plasmids providing their bacterial hosts arsenic resistance and arsenite oxidative ability. An arsenite oxidation module was cloned into pBBR1MCS-2 vector yielding plasmid vector pAIO1, while an arsenic resistance module was cloned into pCM62 vector yielding plasmid pARS1. Both plasmid constructs were introduced (separately and together) into the cells of phylogenetically distant (representing Alpha-, Beta-, and Gammaproteobacteria) and physiologically diversified (unable to oxidize arsenite and susceptible/resistant to arsenite and arsenate) bacteria. Functional analysis of the modified strains showed that: (i) the plasmid pARS1 can be used for the construction of strains with an increased resistance to arsenite [up to 20mM of As(III), (ii) the presence of the plasmid pAIO1 in bacteria previously unable to oxidize As(III) to As(V), contributes to the acquisition of arsenite oxidation abilities by these cells, (iii) the highest arsenite utilization rate are observed in the culture of strains harbouring both the plasmids pAIO1 and pARS1, (iv) the strains harbouring the plasmid pAIO1 were able to grow on arsenic-contaminated mine waters (∼ 3.0 mg As L(-1)) without any supplementation. PMID:25617684

  12. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  13. Rapid arsenite oxidation by Thermus aquaticus and Thermus thermophilus: Field and laboratory investigations

    USGS Publications Warehouse

    Gihring, T.M.; Druschel, G.K.; McCleskey, R.B.; Hamers, R.J.; Banfield, J.F.

    2001-01-01

    Thermus aquaticus and Thermus thermophilus, common inhabitants of terrestrial hot springs and thermally polluted domestic and industrial waters, have been found to rapidly oxidize arsenite to arsenate. Field investigations at a hot spring in Yellowstone National Park revealed conserved total arsenic transport and rapid arsenite oxidation occurring within the drainage channel. This environment was heavily colonized by Thermus aquaticus. In laboratory experiments, arsenite oxidation by cultures of Thermus aquaticus YT1 (previously isolated from Yellowstone National Park) and Thermus thermophilus HB8 was accelerated by a factor of over 100 relative to abiotic controls. Thermus aquaticus and Thermus thermophilus may therefore play a large and previously unrecognized role in determining arsenic speciation and bioavailability in thermal environments.

  14. Effect of rosiglitazone in sodium arsenite-induced experimental vascular endothelial dysfunction.

    PubMed

    Kaur, Tajpreet; Goel, Rajesh Kumar; Balakumar, Pitchai

    2010-04-01

    The present study has been designed to investigate the effect of rosiglitazone, a peroxisome proliferator activated receptor gamma agonist in sodium arsenite-induced vascular endothelial dysfunction (VED) in rats. The rats were administered sodium arsenite (1.5 mg/kg/day, i.p., 2 weeks) to induce VED. The development of VED was assessed by employing isolated aortic ring preparation and estimating serum nitrite/nitrate concentration. Further, the integrity of the aortic endothelium was assessed histologically using haematoxylin-eosin staining. Moreover, the oxidative stress was assessed by estimating serum thiobarbituric acid reactive substances, aortic reactive oxygen species and reduced form of glutathione. The administration of sodium arsenite produced VED by impairing acetylcholine-induced endothelium dependent relaxation, diminishing the integrity of vascular endothelium and decreasing the serum nitrite/nitrate concentration. In addition, sodium arsenite was noted to produce oxidative stress as it increased serum thiobarbituric acid reactive substances and aortic reactive oxygen species and consequently decreased glutathione. Treatment with rosiglitazone (3 mg/kg/day, p.o., 2 weeks and 5 mg/kg/day, p.o., 2 weeks) significantly prevented sodium arsenite-induced VED by enhancing acetylcholine-induced endothelium dependent relaxation, improving the integrity of vascular endothelium, increasing the nitrite/nitrate concentration and decreasing the oxidative stress. However, the vascular protective effect of rosiglitazone was markedly abolished by co-administration of nitric oxide synthase inhibitor, N-Omega-Nitro-L-Arginine Methyl Ester (L-NAME) (25 mg/kg/day, i.p., 2 weeks). Thus, it may be concluded that rosiglitazone reduces oxidative stress, activates eNOS and enhances the generation of nitric oxide to prevent sodium arsenite-induced VED in rats. PMID:20422371

  15. Sodium arsenite impairs insulin secretion and transcription in pancreatic {beta}-cells

    SciTech Connect

    Diaz-Villasenor, Andrea; Sanchez-Soto, M. Carmen; Cebrian, Mariano E.; Ostrosky-Wegman, Patricia; Hiriart, Marcia . E-mail: mhiriart@ifc.unam.mx

    2006-07-01

    Human studies have shown that chronic inorganic arsenic (iAs) exposure is associated with a high prevalence and incidence of type 2 diabetes. However, the mechanism(s) underlying this effect are not well understood, and practically, there is no information available on the effects of arsenic on pancreatic {beta}-cells functions. Thus, since insulin secreted by the pancreas plays a crucial role in maintaining glucose homeostasis, our aim was to determine if sodium arsenite impairs insulin secretion and mRNA expression in single adult rat pancreatic {beta}-cells. Cells were treated with 0.5, 1, 2, 5 and 10 {mu}M sodium arsenite and incubated for 72 and 144 h. The highest dose tested (10 {mu}M) decreased {beta}-cell viability, by 33% and 83%, respectively. Insulin secretion and mRNA expression were evaluated in the presence of 1 and 5 {mu}M sodium arsenite. Basal insulin secretion, in 5.6 mM glucose, was not significantly affected by 1 or 5 {mu}M treatment for 72 h, but basal secretion was reduced when cells were exposed to 5 {mu}M sodium arsenite for 144 h. On the other hand, insulin secretion in response to 15.6 mM glucose decreased with sodium arsenite in a dose-dependent manner in such a way that cells were no longer able to distinguish between different glucose concentrations. We also showed a significant decrease in insulin mRNA expression of cells exposed to 5 {mu}M sodium arsenite during 72 h. Our data suggest that arsenic may contribute to the development of diabetes mellitus by impairing pancreatic {beta}-cell functions, particularly insulin synthesis and secretion.

  16. Life in an Arsenic-Containing Gold Mine: Genome and Physiology of the Autotrophic Arsenite-Oxidizing Bacterium Rhizobium sp. NT-26

    PubMed Central

    Andres, Jérémy; Arsène-Ploetze, Florence; Barbe, Valérie; Brochier-Armanet, Céline; Cleiss-Arnold, Jessica; Coppée, Jean-Yves; Dillies, Marie-Agnès; Geist, Lucie; Joublin, Aurélie; Koechler, Sandrine; Lassalle, Florent; Marchal, Marie; Médigue, Claudine; Muller, Daniel; Nesme, Xavier; Plewniak, Frédéric; Proux, Caroline; Ramírez-Bahena, Martha Helena; Schenowitz, Chantal; Sismeiro, Odile; Vallenet, David; Santini, Joanne M.; Bertin, Philippe N.

    2013-01-01

    Arsenic is widespread in the environment and its presence is a result of natural or anthropogenic activities. Microbes have developed different mechanisms to deal with toxic compounds such as arsenic and this is to resist or metabolize the compound. Here, we present the first reference set of genomic, transcriptomic and proteomic data of an Alphaproteobacterium isolated from an arsenic-containing goldmine: Rhizobium sp. NT-26. Although phylogenetically related to the plant-associated bacteria, this organism has lost the major colonizing capabilities needed for symbiosis with legumes. In contrast, the genome of Rhizobium sp. NT-26 comprises a megaplasmid containing the various genes, which enable it to metabolize arsenite. Remarkably, although the genes required for arsenite oxidation and flagellar motility/biofilm formation are carried by the megaplasmid and the chromosome, respectively, a coordinate regulation of these two mechanisms was observed. Taken together, these processes illustrate the impact environmental pressure can have on the evolution of bacterial genomes, improving the fitness of bacterial strains by the acquisition of novel functions. PMID:23589360

  17. HypC, the anthrone oxidase involved in aflatoxin biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

  18. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  19. Enhanced arsenite removal through surface-catalyzed oxidative coagulation treatment.

    PubMed

    Li, Yue; Bland, Garret D; Yan, Weile

    2016-05-01

    Arsenic being a naturally-occurring groundwater contaminant is subject to stringent water quality regulations. Coagulation and adsorption are widely used methods to treat arsenic-contaminated water, however, these treatments have been reported to be less efficient for the removal of arsenite (As(III)) than arsenate (As(V)). In this study, the feasibility of in situ oxidation of As(III) during coagulation was investigated in two systems: Fe(II) or H2O2-assisted oxidative coagulation treatment using ferric chloride as the coagulant. This setup exploits the catalytic property of the fresh formed Fe(III) hydroxide colloids in coagulation suspension to mediate the production of reactive oxidants capable of As(III) oxidation. Fe(II)-assisted coagulation brought about small improvements in As(III) removal compared to treatment with Fe(III) coagulant alone, however, its arsenic removal efficiency is strongly dependent on pH (observed optimal pH = 7-9). Addition of H2O2 together with ferric chloride led to a significant enhancement in arsenic retention at pH 6-8, with final arsenic concentrations well below the U.S.EPA regulatory limit (10 μg/L). H2O2-assisted oxidative coagulation can attain reliable As(III) removal over a broad pH range of 4-9. Radical quenching experiments reveal the participation of superoxide radical in As(III) removal in the oxidative coagulation systems. Phosphate (at > 0.1 mM) strongly suppresses As(III) removal efficiency, whereas carbonate and humic acid pose a minor impact. Overall, the results suggest that a low dose addition of H2O2 along with ferric coagulant is a feasible method for the existing water treatment facilities to achieve improved As(III) removal efficiency. PMID:26897520

  20. In vitro effect of sodium arsenite on Echinococcus granulosus protoscoleces.

    PubMed

    Xing, Guoqiang; Wang, Bo; Lei, Ying; Liu, Chunli; Wang, Zhuo; Shi, Hongjuan; Yang, Rentan; Qin, Wenjuan; Jiang, Yufeng; Lv, Hailong

    2016-06-01

    Cystic echinococcosis (CE) caused by the metacestodes of Echinococcus granulosus is an important cosmopolitan zoonosis. Surgery is the main treatment option for CE. Meanwhile, chemotherapy is used as an significant adjunct to surgery. However, the benzimidazole carbamate group and the existing scolicidal agents may not be as effective as hoped. In this study, we aimed to explore the in vitro effect of sodium arsenite (NaAsO2) on Echinococcus granulosus protoscoleces, the causative agents of CE. Protoscoleces of E. granulosus were incubated in vitro with 4, 8, 12, 16, and 20μM NaAsO2. Viability and changes in morphology were investigated by 0.1% eosin staining. The ultrastructural alterations were observed by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Additionally, caspase-3 activity was measured by colorimetric assay. Obvious protoscolicidal effect was seen with NaAsO2 at concentrations of 16μM and 20μM. Protoscolex mortality was 83.24% (16μM) and 100% (20μM) after 6 days post-incubation. SEM showed that the primary site of drug damage was the tegument of the protoscoleces. TEM analysis demonstrated that the internal tissues were severely affected and revealed an increase in the number of lipid droplets and vacuoles after treatment with 16μM NaAsO2. Meanwhile, the caspase-3 activity significantly increased in protoscoleces after 24h of NaAsO2 incubation compared to the untreated controls. Our study demonstrated the clear in vitro scolicidal effect of NaAsO2 against E. granulosus protoscoleces. However, the in vivo efficacy, specific mechanism, and any possible side effects of NaAsO2 remain to be investigated. PMID:27234209

  1. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells

    PubMed Central

    Dassa, Emmanuel P; Dufour, Eric; Gonçalves, Sérgio; Paupe, Vincent; Hakkaart, Gertjan A J; Jacobs, Howard T; Rustin, Pierre

    2009-01-01

    Cytochrome c oxidase (COX) deficiency is associated with a wide spectrum of clinical conditions, ranging from early onset devastating encephalomyopathy and cardiomyopathy, to neurological diseases in adulthood and in the elderly. No method of compensating successfully for COX deficiency has been reported so far. In vitro, COX-deficient human cells require additional glucose, pyruvate and uridine for normal growth and are specifically sensitive to oxidative stress. Here, we have tested whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) from Ciona intestinalis could alleviate the metabolic abnormalities of COX-deficient human cells either from a patient harbouring a COX15 pathological mutation or rendered deficient by silencing the COX10 gene using shRNA. We demonstrate that the expression of the AOX, well-tolerated by the cells, compensates for both the growth defect and the pronounced oxidant-sensitivity of COX-deficient human cells. PMID:20049701

  2. Xenophilus arseniciresistens sp. nov., an arsenite-resistant bacterium isolated from soil.

    PubMed

    Li, Qin-Fen; Sun, Li-Na; Kwon, Soon-Wo; Chen, Qing; He, Jian; Li, Shun-Peng; Zhang, Jun

    2014-06-01

    A Gram-reaction-negative, aerobic, motile, rod-shaped, arsenite [As(III)]-resistant bacterium, designated strain YW8(T), was isolated from agricultural soil. 16S rRNA gene sequence analysis showed over 97% sequence similarity to strains of the environmental species Xenophilus azovorans, Xenophilus aerolatus, Simplicispira metamorpha, Variovorax soli, and Xylophilus ampelinus. However, the phylogenetic tree indicated that strain YW8(T) formed a separate clade from Xenophilus azovorans. DNA-DNA hybridization experiments showed that the DNA-DNA relatedness values between strain YW8(T) and its closest phylogenetic neighbours were below 24.2-35.5%, which clearly separated the strain from these closely related species. The major cellular fatty acids of strain YW8(T) were C(16 : 0), C(17 : 0) cyclo, C(18 : 1)ω7c, and summed feature 3(C(16 : 1)ω6c and/or C(16 : 1)ω7c). The genomic DNA G+C content was 69.3 mol%, and the major respiratory quinone was ubiquinone-8. The predominant polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, three unknown phospholipids, an unknown polar lipid and phosphatidylserine. The major polyamines were 2-hydroxyputrescine and putrescine. On the basis of morphological, physiological and biochemical characteristics, phylogenetic position, DNA-DNA hybridization and chemotaxonomic data, strain YW8(T) is considered to represent a novel species of the genus Xenophilus, for which the name Xenophilus arseniciresistens sp. nov. is proposed; the type strain is YW8(T) ( = CCTCC AB2012103(T) = KACC 16853(T)). PMID:24585373

  3. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).

    PubMed

    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E

    2013-10-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  4. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  5. Novel genetic diversity within Anopheles punctimacula s.l.: Phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2)

    PubMed Central

    Loaiza, Jose R.; Scott, Marilyn E.; Bermingham, Eldredge; Sanjur, Oris I.; Rovira, Jose R.; Dutari, Larissa C.; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E.

    2013-01-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3´ COI), the Barcode region in the five prime end of the COI (5´ COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3´ COI depicted six highly supported molecular lineages (A–F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5´ COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3´ COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  6. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.

    PubMed

    Kang, J-H; Park, J-Y; Choi, T-J

    2012-01-01

    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

  7. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun

    2016-09-01

    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population. PMID:26394200

  8. Effect of proteasome inhibition on toxicity and CYP3A23 induction in cultured rat hepatocytes: Comparison with arsenite

    SciTech Connect

    Noreault-Conti, Trisha L.; Jacobs, Judith M.; Trask, Heidi W.; Wrighton, Steven A.; Sinclair, Jacqueline F.; Nichols, Ralph C. . E-mail: ralph.c.nichols@dartmouth.edu

    2006-12-15

    Previous work in our laboratory has shown that acute exposure of primary rat hepatocyte cultures to non-toxic concentrations of arsenite causes major decreases in the DEX-mediated induction of CYP3A23 protein, with minor decreases in CYP3A23 mRNA. To elucidate the mechanism for these effects of arsenite, the effects of arsenite and proteasome inhibition, separately and in combination, on induction of CYP3A23 protein were compared. The proteasome inhibitor, MG132, inhibited proteasome activity, but also decreased CYP3A23 mRNA and protein. Lactacystin, another proteasome inhibitor, decreased CYP3A23 protein without affecting CYP3A23 mRNA at a concentration that effectively inhibited proteasome activity. This result, suggesting that the action of lactacystin is similar to arsenite and was post-transcriptional, was confirmed by the finding that lactacystin decreased association of DEX-induced CYP3A23 mRNA with polyribosomes. Both MG132 and lactacystin inhibited total protein synthesis, but did not affect MTT reduction. Arsenite had no effect on ubiquitination of proteins, nor did arsenite significantly affect proteasomal activity. These results suggest that arsenite and lactacystin act by similar mechanisms to inhibit translation of CYP3A23.

  9. Oxidative DNA adducts and DNA-protein cross-links are the major DNA lesions induced by arsenite.

    PubMed

    Bau, Da-Tian; Wang, Tsu-Shing; Chung, Chiao-Hui; Wang, Alexander S S; Wang, Alexander S S; Jan, Kun-Yan

    2002-10-01

    Arsenic is recognized to be a nonmutagenic carcinogen because it induces DNA damage only at very high concentrations. However, many more DNA strand breaks could be detected by digesting the DNA of arsenite-treated cells with endonuclease III, formamidopyrimidine-DNA glycosylase, and proteinase K. By doing so, arsenite could be shown to induce DNA damage in human cells within a pathologically meaningful concentration range. Oxidized guanine products were detected in all arsenite-treated human cells examined. DNA-protein cross-links were also detected in arsenite-treated NB4 and HL60 cells. In human umbilical vein endothelial cells, the induction of oxidized guanine products by arsenite was sensitive to inhibitors of nitric oxide (NO) synthase but not to oxidant modulators, whereas the opposite result was obtained in vascular smooth muscle cells. On the other hand, the arsenite-induced oxidized guanine products and DNA-protein cross-links in NB4 and HL60 cells were sensitive to modulators of calcium, NO synthase, oxidant, and myeloperoxidase. Therefore, although oxidized guanine products were detected in all the human cells treated with arsenite, the pathways could be different in different cell types. Because the sensitivity and the mechanism of arsenic intoxication are cell specific, it is important that target tissues and target cells are used for investigations. It is also important that pathologically or pharmacologically meaningful concentrations of arsenic are used. This is because in most cases we are dealing with the chronic effect rather than acute toxicity. PMID:12426126

  10. NADPH Oxidase-Dependent Mechanism Explains How Arsenic and Other Oxidants Can Activate Aryl Hydrocarbon Receptor Signaling.

    PubMed

    Mohammadi-Bardbori, Afshin; Vikström Bergander, Linda; Rannug, Ulf; Rannug, Agneta

    2015-12-21

    The mechanisms explaining arsenic toxicity are not well understood, but physiological consequences of stimulated aryl hydrocarbon receptor (AHR) signaling both directly and through cross-talk with other pathways have been indicated. The aim of this study was to establish how arsenic interacts with AHR-mediated transcription. The human hepatoma cell line (HepG2-XRE-Luc) carrying a luciferase reporter under the control of two AHR response elements (AHREs) and immortalized human keratinocytes (HaCaT) were exposed to sodium arsenite (NaAsO2; As(3+)), alone or in combination with the endogenous high affinity AHR ligand 6-formylindolo[3,2-b]carbazole (FICZ). Luciferase activity, cytochrome P4501A1 (CYP1A1) activity, oxidative stress-related responses, metabolic clearance of FICZ, and NADPH oxidase (NOX) activity as well as nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-dependent gene expression were measured. Arsenic inhibited CYP1A1 enzyme activity and reduced the metabolic clearance of FICZ. Arsenic also led to activated CYP1A1 transcription but only in cells grown in medium containing trace amounts of the endogenous ligand FICZ, pointing to an indirect mechanism of activation. Initially, arsenic caused dose-dependent inhibition of FICZ-activated AHR signaling, disturbed intracellular GSH status, and increased expression of oxidative stress-related genes. Silencing of NOX4, addition of N-acetylcystein, or pretreatment with arsenic itself attenuated the initial dose-dependent inhibition of AHR signaling. Arsenic pretreatment led to elevated GSH levels and sensitized the cells to ligand-dependent AHR signaling, while silencing of Nrf2 significantly reduced arsenic-mediated activation of the AHR. In addition, influence of NOX on AHR activation was also observed in cells treated with the SH-reactive metals cadmium, mercury, and nickel. Together, the results suggest that SH-reactive agents via a new and possibly general NOX/H2O2-dependent mechanism can interfere with

  11. Protective effect of silymarin on viability, motility and mitochondrial membrane potential of ram sperm treated with sodium arsenite

    PubMed Central

    Eskandari, Farzaneh; Momeni, Hamid Reza

    2016-01-01

    Background: Sodium arsenite can impair male reproductive function by inducing oxidative stress. Silymarin is known as a potent antioxidant. Objective: This study was performed to investigate if silymarin can prevent the adverse effect of sodium arsenite on ram sperm viability, motility and mitochondrial membrane potential. Materials and Methods: Epidydimal spermatozoa obtained from ram were divided into five groups: 1) Spermatozoa at 0 hr, 2) spermatozoa at 180 min (control), 3) spermatozoa treated with sodium arsenite (10 μM) for 180 min, 4) spermatozoa treated with silymarin (20 μM) + sodium arsenite (10 μM) for 180 min and 5) spermatozoa treated with silymarin (20 μM) for 180 min. MTT assay and Rhodamine 123 staining were used to assess sperm viability and mitochondrial membrane potential respectively. Sperm motility was performed according to World Health Organization (WHO) guidelines. Results: Viability (p<0.01), nonprogressive motility (p<0.001) and intact mitochondrial membrane potential (p<0.001) of the spermatozoa were significantly decreased in sodium arsenite treated group compared to control group. In silymarin + sodium arsenite group, silymarin could significantly reverse the adverse effect of sodium arsenite on these sperm parameters compared to sodium arsenite group (p<0.001). In addition, the application of silymarin alone for 180 minutes could significantly increase progressively motile sperm (p<0.001) and decrease non motile sperm (p<0.01) compared to the control. Conclusion: Silymarin could compensate the adverse effect of sodium arsenite on viability, nonprogressive motility and mitochondrial membrane potential of ram sperm. PMID:27525323

  12. COMPARATIVE GENOTOXIC RESPONSES TO ARSENITE IN GUINEA PIG, MOUSE, RAT AND HUMAN LYMPHOCYTES

    EPA Science Inventory

    Comparative genotoxic responses to arsenite in guinea pig, mouse, rat and human
    lymphocytes.

    Inorganic arsenic is a known human carcinogen causing skin, lung, and bladder cancer following chronic exposures. Yet, long-term laboratory animal carcinogenicity studies have ...

  13. ARSENITE BINDING TO SUBSETS OF THE HUMAN ESTROGEN RECEPTOR-ALPHA

    EPA Science Inventory

    Enzyme inhibition by arsenicals has been described many times, but the underlying binding of trivalent arsenicals to peptides and proteins has received little attention. The purpose of this study was to determine Kd and Bmax values for arsenite binding to nine synthetic peptides ...

  14. INFLUENCE OF SODIUM ARSENITE ON GAP JUNCTION COMMUNICATION IN RAT LIVER EPITHELIAL CELLS

    EPA Science Inventory

    Influence of sodium arsenite on gap junction communication in rat-Iiver epitheiial cells.

    Arsenic is known to cause certain types of cancers, hepatitis, cirrhosis and neurological disorders as well as cardiovascular and reproductive effects and skin lesions. The mechanism...

  15. SORPTION OF ARSENATE AND ARSENITE ON RUO2.XH2O: A SPECTROSCOPIC AND MACROSCOPIC STUDY

    EPA Science Inventory

    The sorption of arsenate (As(V)) and arsenite (As(III)) on RuO2 xH2O was examined using macroscopic and microscopic techniques. Constant solid:solution ratio isotherms were constructed from batch sorption experiments to study the sorption of the inorganic arsenic species on RuO2...

  16. ARSENICALS IN MATERNAL AND FETAL MOUSE TISSUES AFTER GESTATIONAL EXPOSURE TO ARSENITE

    EPA Science Inventory

    Exposure of pregnant C3H/HeNCR mice to 42.5- or 85-ppm of arsenic as sodium arsenite in drinking water between days 8 to 18 of gestation markedly increases tumor incidence in their offspring. In the work reported here, distribution of inorganic arsenic and its metabolites, methy...

  17. AN INTEGRATED PHARMACOKINETIC AND PHARMACODYNAMIC STUDY OF ARSENITE ACTION 2. HEME OXYGENASE INDUCTION IN MICE

    EPA Science Inventory

    Heme oxygenase (HO) is the rate-limiting enzyme in heme degradation and its activity has a significant impact on intracellular heme pools. Rat studies indicate that HO induction is a sensitive, dose-dependent response to arsenite (AsIII) exposure in both liver and kidney. The o...

  18. THE EFFECTS OF HEAT SHOCK PROTEIN 70 (HSP70) AND EXPOSURE PROTOCOL ON ARSENITE INDUCED GENOTOXICITY

    EPA Science Inventory

    The Effects of Heat Shock Protein 70 (Hsp70) and Exposure Protocol on Arsenite Induced Genotoxicity

    Barnes, J.A.1,2, Collins, B.W.2, Dix, D.J.3 and Allen J.W2.
    1National Research Council, 2Environmental Carcinogenesis Division, 3Reproductive Toxicology Division, Office...

  19. SORPTION OF ARSENATE AND ARSENITE ON A RUTHENIUM COMPOUND: A MACROSCOPIC AND MICROSCOPIC STUDY

    EPA Science Inventory

    Sorption of arsenate and arsenite was examined on a ruthenium compound using macroscopic and microscopic techniques. Batch sorption experiments at pH 4,5,6, 7 and 8 were employed to construct constant solid solution ratio isotherms (CSI). After equilibration at the appropriate pH...

  20. Sodium arsenite induces chromosome endoreduplication and inhibits protein phosphatase activity in human fibroblasts

    SciTech Connect

    Rong-Nan Huang; I-Ching Ho; Ling-Hui Yih

    1995-08-01

    Arsenic, strongly associated with increased risks of human cancers, is a potent clastogen in a variety of mammalian cell systems. The effect of sodium arsenite (a trivalent arsenic compound) on chromatid separation was studied in human skin fibroblasts (HFW). Human fibroblasts were arrested in S phase by the aid of serum starvation and aphidicolin blocking and then these cells were allowed to synchronously progress into G2 phase. Treatment of the G2-enriched HFW cells with sodium arsenite (0-200 {mu}M) resulted in arrest of cells in the G2 phase, interference with mitotic division, inhibition of spindle assembly, and induction of chromosome endoreduplication in their second mitosis. Sodium arsenite treatment also inhibited the activities of serine/threonine protein phosphatases and enhanced phosphorylation levels of a small heat shock protein (HSP27). These results suggest that sodium arsenite may mimic okadaic acid to induce chromosome endoreduplication through its inhibitory effect on protein phosphatase activity. 61 refs., 6 figs., 2 tabs.

  1. Effects of Sodium Arsenite and Arsenate in Testicular Histomorphometry and Antioxidants Enzymes Activities in Rats.

    PubMed

    Souza, Ana Cláudia Ferreira; Marchesi, Sarah Cozzer; Domingues de Almeida Lima, Graziela; Ferraz, Rafael Penha; Santos, Felipe Couto; da Matta, Sérgio Luis Pinto; Machado-Neves, Mariana

    2016-06-01

    The main source of environmental arsenic exposure in most countries of the world is drinking water in which inorganic forms of arsenic predominate. The present study was aimed to test the impact of two different compounds of inorganic arsenic in histomorphometric and enzymatic parameters in the testes by oral exposition. Adult Wistar male rats were exposed to sodium arsenite and arsenate in drinking water, testing for each chemical form the concentrations of 0.01 and 10 mg/L per 56 days. The animals intoxicated with arsenic, mainly sodium arsenite, showed reduction in the percentage of seminiferous epithelium and in proportion and volume of Leydig cells. Moreover, there was an increase in the percentage of tunica propria, lumen, lymphatic space, blood vessels, and macrophages. The activity of superoxide dismutase (SOD) did not change among the groups. However, the activity of catalase (CAT) decreased in animals exposed to both arsenic compounds. In addition, the higher concentration of arsenic, mainly as sodium arsenite, caused vacuolization in the seminiferous epithelium. The body and testes weight as well as testosterone concentration remained unchanged among the groups. In conclusion, exposition to arsenic, mainly as sodium arsenite, caused alteration in histomorphometric parameters and antioxidant defense system in the testes. PMID:26446860

  2. Electrochemical production of hydrogen coupled with the oxidation of arsenite.

    PubMed

    Kim, Jungwon; Kwon, Daejung; Kim, Kitae; Hoffmann, Michael R

    2014-01-01

    The production of hydrogen accompanied by the simultaneous oxidation of arsenite (As(III)) was achieved using an electrochemical system that employed a BiOx-TiO2 semiconductor anode and a stainless steel (SS) cathode in the presence of sodium chloride (NaCl) electrolyte. The production of H2 was enhanced by the addition of As(III) during the course of water electrolysis. The synergistic effect of As(III) on H2 production can be explained in terms of (1) the scavenging of reactive chlorine species (RCS), which inhibit the production of H2 by competing with water molecules (or protons) for the electrons on the cathode, by As(III) and (2) the generation of protons, which are more favorably reduced on the cathode than water molecules, through the oxidation of As(III). The addition of 1.0 mM As(III) to the electrolyte at a constant cell voltage (E cell) of 3.0 V enhanced the production of H2 by 12% even though the cell current (I cell) was reduced by 5%. The net effect results in an increase in the energy efficiency (EE) for H2 production (ΔEE) by 17.5%. Furthermore, the value ΔEE, which depended on As(III) concentration, also depended on the applied E cell. For example, the ΔEE increased with increasing As(III) concentration in the micromolar range but decreased as a function of E cell. This is attributed to the fact that the reactions between RCS and As(III) are influenced by both RCS concentration depending on E cell and As(III) concentration in the solution. On the other hand, the ΔEE decreased with increasing As(III) concentration in the millimolar range due to the adsorption of As(V) generated from the oxidation of As(III) on the semiconductor anode. In comparison to the electrochemical oxidation of certain organic compounds (e.g., phenol, 4-chlorophenol, 2-chlorophenol, salicylic acid, catechol, maleic acid, oxalate, and urea), the ΔEE obtained during As(III) oxidation (17.5%) was higher than that observed during the oxidation of the above organic compounds

  3. Arsenite enhances tumor necrosis factor-{alpha}-induced expression of vascular cell adhesion molecule-1

    SciTech Connect

    Tsou, T.-C. . E-mail: tctsou@nhri.org.tw; Yeh, Szu Ching; Tsai, E.-M.; Tsai, F.-Y.; Chao, H.-R.; Chang, Louis W.

    2005-11-15

    Epidemiological studies demonstrated a high association of vascular diseases with arsenite exposure. We hypothesize that arsenite potentiates the effect of proinflammatory cytokines on vascular endothelial cells, and hence contributes to atherosclerosis. In this study, we investigated the effect of arsenite and its induction of glutathione (GSH) on vascular cell adhesion molecule-1 (VCAM-1) protein expression in human umbilical vein endothelial cells (HUVECs) in response to tumor necrosis factor-{alpha} (TNF-{alpha}), a typical proinflammatory cytokine. Our study demonstrated that arsenite pretreatment potentiated the TNF-{alpha}-induced VCAM-1 expression with up-regulations of both activator protein-1 (AP-1) and nuclear factor-{kappa}B (NF-{kappa}B). To elucidate the role of GSH in regulation of AP-1, NF-{kappa}B, and VCAM-1 expression, we employed L-buthionine (S,R)-sulfoximine (BSO), a specific {gamma}-glutamylcysteine synthetase ({gamma}-GCS) inhibitor, to block intracellular GSH synthesis. Our investigation revealed that, by depleting GSH, arsenite attenuated the TNF-{alpha}-induced VCAM-1 expression as well as a potentiation of AP-1 and an attenuation of NF-{kappa}B activations by TNF-{alpha}. Moreover, we found that depletion of GSH would also attenuate the TNF-{alpha}-induced VCAM-1 expression with a down-regulation of the TNF-{alpha}-induced NF-{kappa}B activation and without significant effect on AP-1. On the other hand, the TNF-{alpha}-induced VCAM-1 expression could be completely abolished by inhibition of AP-1 or NF-{kappa}B activity, suggesting that activation of both AP-1 and NF-{kappa}B was necessary for VCAM-1 expression. In summary, we demonstrate that arsenite enhances the TNF-{alpha}-induced VCAM-1 expression in HUVECs via regulation of AP-1 and NF-{kappa}B activities in a GSH-sensitive manner. Our present study suggested a potential mechanism for arsenite in the induction of vascular inflammation and vascular diseases via modulating the actions

  4. Adsorption and oxidation of arsenite by iron minerals in the presence of microorganisms

    NASA Astrophysics Data System (ADS)

    Perelomov, Leonid; Corsini, Anna; Andreoni, Vincenza

    2010-05-01

    It is known the two most commonly occurring forms of As in the environment are anionic arsenate [AsO43-, As(V)] and arsenite [AsO33-, As(III)]. Arsenite has been found to be the more mobile and toxic species in soil environments (Tamaki and Frankenberger, 1992). Arsenic speciation and toxicity are functions of pH, redox potential, the presence and type of adsorbing surfaces, and microbial populations. Biotransformation of arsenic species (reduction or oxidation) is mainly enzymatic process, while biosorption is metabolism independent process that governed by physico-chemical interactions on the cell surface. Special ternary bio-mineral systems, consisting of iron minerals (synthetic goethite, and magnetite, which was prepared by oxidation from special commercial product - nano-iron), special strains of arsenite-oxidizing microorganisms (Ancylobacter dichlorometanicus) and arsenite solution, were constructed and processes of arsenic compounds adsorption and oxidation were studied. As control experiments without microorganisms or without minerals were carried out. For determination of arsenic species, adsorbed on the surface of the minerals, desorption experiments were carried out also. Desorption ability of several chemicals, used for arsenic extraction from soils, was tested. Magnetite and goethite, with very small size of particles, have high chemical affinity to arsenite at wide range of pH values, but at pH above 9 adsorption of arsenite decreased in comparison with pH below of the isoelectric points of the minerals. We carried out experiments at initial pH 7,2. Experiments on kinetics of adsorption showed that equilibrium time for adsorption is 2 hours. In the ternary bio-mineral systems consisting of fresh-prepared magnetite,the effect of arsenite-oxidizing microorganisms on the oxidation process was negligible in all cases, because magnetite demonstrated very high oxidation ability in comparison with bacteria. During 4 hours all arsenite, adsorbed on the

  5. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  6. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

    PubMed

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-07-25

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25061821

  7. The Pho4 transcription factor mediates the response to arsenate and arsenite in Candida albicans

    PubMed Central

    Urrialde, Verónica; Prieto, Daniel; Pla, Jesús; Alonso-Monge, Rebeca

    2015-01-01

    Arsenate (As (V)) is the dominant form of the toxic metalloid arsenic (As). Microorganisms have consequently developed mechanisms to detoxify and tolerate this kind of compounds. In the present work, we have explored the arsenate sensing and signaling mechanisms in the pathogenic fungus Candida albicans. Although mutants impaired in the Hog1 or Mkc1-mediated pathways did not show significant sensitivity to this compound, both Hog1 and Mkc1 became phosphorylated upon addition of sodium arsenate to growing cells. Hog1 phosphorylation upon arsenate challenge was shown to be Ssk1-dependent. A screening designed for the identification of transcription factors involved in the arsenate response identified Pho4, a transcription factor of the myc-family, as pho4 mutants were susceptible to As (V). The expression of PHO4 was shortly induced in the presence of sodium arsenate in a Hog1-independent manner. Pho4 level affects Hog1 phosphorylation upon As (V) challenge, suggesting an indirect relationship between Pho4 activity and signaling in C. albicans. Pho4 also mediates the response to arsenite as revealed by the fact that pho4 defective mutants are sensitive to arsenite and Pho4 becomes phosphorylated upon sodium arsenite addition. Arsenite also triggers Hog1 phosphorylation by a process that is, in this case, independent of the Ssk1 kinase. These results indicate that the HOG pathway mediates the response to arsenate and arsenite in C. albicans and that the Pho4 transcription factor can differentiate among As (III), As (V) and Pi, triggering presumably specific responses. PMID:25717325

  8. Coupling in cytochrome c oxidase

    PubMed Central

    Kessler, R. J.; Blondin, G. A.; Zande, H. Vande; Haworth, R. A.; Green, D. E.

    1977-01-01

    Cytochrome c oxidase (ferrocytochrome c: oxygen oxidoreductase; EC 1.9.3.1) can be resolved into an electron transfer complex (ETC) and an ionophore transfer complex (ITC). Coupling requires an interaction between the moving electron in the ETC and a moving, positively charged ionophore-cation adduct in the ITC. The duplex character of cytochrome oxidase facilitates this interaction. The ITC mediates cyclical cation transport. It can be replaced as the coupling partner by the combination of valinomycin and nigericin in the presence of K+ when cytochrome oxidase is incorporated into liposomes containing acidic phospholipids or by the combination of lipid cytochrome c and bile acids in an ITC-resolved preparation of the ETC. Respiratory control can be induced by incorporating cytochrome oxidase into vesicles of unfractionated whole mitochondrial lipid. The activity of the ITC is suppressed by such incorporation and this suppression leads to the emergence of respiratory control. The ionophoroproteins of the ITC can be extracted into organic solvents; some 50% of the total protein of cytochrome oxidase is extractable. The release of free ionophore is achieved by tryptic digestion of the ionophoroprotein. Preliminary to this release the ionophoroprotein is degraded to an ionophoropeptide. Electrogenic ionophores, as well as uncoupler, are liberated by such proteolysis. The ITC contains a set of ionophoroproteins imbedded in a matrix of phospholipid. Images PMID:198794

  9. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  10. Complexation of Arsenite with Phytochelatins Reduces Arsenite Efflux and Translocation from Roots to Shoots in Arabidopsis1[W

    PubMed Central

    Liu, Wen-Ju; Wood, B. Alan; Raab, Andrea; McGrath, Steve P.; Zhao, Fang-Jie; Feldmann, Jörg

    2010-01-01

    Complexation of arsenite [As(III)] with phytochelatins (PCs) is an important mechanism employed by plants to detoxify As; how this complexation affects As mobility was little known. We used high-resolution inductively coupled plasma-mass spectrometry and accurate mass electrospray ionization-mass spectrometry coupled to HPLC to identify and quantify As(III)-thiol complexes and free thiol compounds in Arabidopsis (Arabidopsis thaliana) exposed to arsenate [As(V)]. As(V) was efficiently reduced to As(III) in roots. In wild-type roots, 69% of As was complexed as As(III)-PC4, As(III)-PC3, and As(III)-(PC2)2. Both the glutathione (GSH)-deficient mutant cad2-1 and the PC-deficient mutant cad1-3 were approximately 20 times more sensitive to As(V) than the wild type. In cad1-3 roots, only 8% of As was complexed with GSH as As(III)-(GS)3 and no As(III)-PCs were detected, while in cad2-1 roots, As(III)-PCs accounted for only 25% of the total As. The two mutants had a greater As mobility, with a significantly higher accumulation of As(III) in shoots and 4.5 to 12 times higher shoot-to-root As concentration ratio than the wild type. Roots also effluxed a substantial proportion of the As(V) taken up as As(III) to the external medium, and this efflux was larger in the two mutants. Furthermore, when wild-type plants were exposed to l-buthionine sulfoximine or deprived of sulfur, both As(III) efflux and root-to-shoot translocation were enhanced. The results indicate that complexation of As(III) with PCs in Arabidopsis roots decreases its mobility for both efflux to the external medium and for root-to-shoot translocation. Enhancing PC synthesis in roots may be an effective strategy to reduce As translocation to the edible organs of food crops. PMID:20130102

  11. Involvement of miR528 in the Regulation of Arsenite Tolerance in Rice (Oryza sativa L.).

    PubMed

    Liu, Qingpo; Hu, Haichao; Zhu, Leyi; Li, Ruochen; Feng, Ying; Zhang, Liqing; Yang, Yuyan; Liu, Xingquan; Zhang, Hengmu

    2015-10-14

    Tens of miRNAs were previously established as being arsenic (As) stress responsive in rice. However, their functional role in As tolerance remains unclear. This study demonstrates that transgenic plants overexpressing miR528 (Ubi::MIR528) were more sensitive to arsenite [As(III)] compared with wild-type (WT) rice. Under normal and stress conditions, miR528-5p and -3p were highly up-regulated in both the roots and leaves of transgenic plants, which exhibited a negative correlation with the expression of seven target genes. Compared with WT plants, Ubi::MIR528 plants showed excessive oxidative stress generation and remarkable amino acid content changes in the roots and leaves upon As(III) exposure. Notably, the expression profiles of diverse functional genes were clearly different between WT and transgenic plants. Thus, the observed As(III) sensitivity of Ubi::MIR528 plants was likely due to the strong alteration of antioxidant enzyme activity and amino acid profiles and the impairment of the As(III) uptake, translocation, and tolerance systems of rice. PMID:26403656

  12. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-01-01

    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  13. Cultivable diversity of thermophilic arsenite/ferrous-oxidizing microorganisms in hot springs of Taiwan

    NASA Astrophysics Data System (ADS)

    Lu, G.; Lin, Y.; Chang, Y.; Wang, P.; Lin, L.

    2009-12-01

    Elevated levels of arsenic in groundwater and surface water bodies have posed a stringent threat to the deterioration of the water quality for drinking and agriculture purposes around the world. In particular, arsenic liberated from volcanic and sedimentary rocks at high temperatures would be immobilized through adsorption on iron oxide and/or crystallization of iron-bearing minerals downstream at low temperatures. Understanding how microbially-catalytic reactions are involved in the changes of the redox state of arsenic and iron along a flow path would provide important constraints on the arsenic mobility in natural occurrences. The aims of this study were to isolate and characterize thermophilic arsenite- and iron-oxidizing microbes that would facilitate to establish the linkages between microbial distribution and in situ Fe/As cycling processes. Four source waters (LH05, LH08, SYK and MT) from acid-sulfate springs (pH 2-3, 60-97oC) located in the Tatun volcanic area of northern Taiwan were collected and inoculated into media targeting on autotrophic ferrous iron (FC3), arsenite (AC3 ,ACC3, AC7, ACC7), arsenite-resistant hydrogen (AH23), arsenite-resistant hydrogen-sulfur (AH2S3), and arsenite-resistant sulfur oxidations(AS3), and heterotrophic arsenite oxidation(AH3, AH7) at pH 3, and 7 at temperatures of 50, 70 and 80oC. Samples from the Kuantzuling mud springs (KTL) in southwestern Taiwan known with elevated arsenic levels (0.4 ppm) were also collected, inoculated into the heterotrophic medium and incubated at 50, 60, 70 and 80oC. Isolates obtained from KTL were subject to test on the AH7 and ACC7. Two positive enrichments for iron oxidation at 50oC and 70oC were confirmed by the steadily decrease of ferrous iron and increase of precipitates over 4 transfers for samples from the SYK spring. Diverse morphological types of microbes were enriched in all types of arsenite-bearing media at 50oC except for AH23. At 70oC, positive enrichments were found in media

  14. The novel role of fenofibrate in preventing nicotine- and sodium arsenite-induced vascular endothelial dysfunction in the rat.

    PubMed

    Kaur, Jagdeep; Reddy, Krishna; Balakumar, Pitchai

    2010-09-01

    The present study investigated the effect of fenofibrate, an agonist of PPAR-alpha, in nicotine- and sodium arsenite-induced vascular endothelial dysfunction (VED) in rats. Nicotine (2 mg/kg/day, i.p., 4 weeks) and sodium arsenite (1.5 mg/kg/day, i.p., 2 weeks) were administered to produce VED in rats. The scanning electron microscopy study in thoracic aorta revealed that administration of nicotine or sodium arsenite impaired the integrity of vascular endothelium. Further, administration of nicotine or sodium arsenite significantly decreased serum and aortic concentrations of nitrite/nitrate and subsequently reduced acetylcholine-induced endothelium-dependent relaxation. Moreover, nicotine or sodium arsenite produced oxidative stress by increasing serum thiobarbituric acid reactive substances (TBARS) and aortic superoxide generation. However, treatment with fenofibrate (30 mg/kg/day, p.o.) or atorvastatin (30 mg/kg/day p.o., a standard agent) significantly prevented nicotine- and sodium arsenite-induced VED and oxidative stress by improving the integrity of vascular endothelium, increasing the concentrations of serum and aortic nitrite/nitrate, enhancing the acetylcholine-induced endothelium-dependent relaxation and decreasing serum TBARS and aortic superoxide anion generation. Conversely, co-administration of L-NAME (25 mg/kg/day, i.p.), an inhibitor of nitric oxide synthase, markedly attenuated these vascular protective effects of fenofibrate. The administration of nicotine or sodium arsenite altered the lipid profile by increasing serum cholesterol and triglycerides and consequently decreasing high-density lipoprotein levels, which were significantly prevented by treatment with fenofibrate or atorvastatin. It may be concluded that fenofibrate improves the integrity and function of vascular endothelium, and the vascular protecting potential of fenofibrate in preventing the development of nicotine- and sodium arsenite-induced VED may be attributed to its

  15. Syntheses, crystal structures and characterizations of two new bismuth(III) arsenites

    SciTech Connect

    Liu Junhui; Kong Fang; Gai Yanli; Mao Jianggao

    2013-01-15

    Two new bismuth arsenites with two different structural types, namely, Bi{sub 2}O(AsO{sub 3})Cl (1), Bi{sub 8}O{sub 6}(AsO{sub 3}){sub 2}(AsO{sub 4}){sub 2} (2), have been synthesized by the solid-state reactions. Compound 1 exhibits novel 2D bismuth arsenite layers with Bi{sub 4}O{sub 4} rings capped by oxide anions, which are further interconnected by Bi-Cl-Bi bridges into a 3D network. Compound 2 contains both arsenite and arsenate anions, its 3D structures are based on 1D bismuth arsenite and 1D bismuth arsenate chains both along b-axis, which are interconnected by oxide anions via Bi-O-Bi bridges, forming 1D tunnels of Bi{sub 4}As{sub 4} 8-membered rings (MRs) along b-axis, the lone pairs of the arsenite groups are orientated toward the centers of the above tunnels. Thermogravimetric analysis indicated that both compounds display high thermal stability. Optical property measurements revealed that they are wide band-gap semiconductors. Both compounds display broad green-light emission bands centered at 506 nm under excitation at 380 and 388 nm. - Graphical abstract: Solid state reactions of Bi{sub 2}O{sub 3} (BiCl{sub 3}) and As{sub 2}O{sub 3} yielded two new compounds with two different structural types, namely, Bi{sub 2}O(AsO{sub 3})Cl (1), Bi{sub 8}O{sub 6}(AsO{sub 3}){sub 2}(AsO{sub 4}){sub 2} (2). They represent the first examples of bismuth arsenates. Highlights: Black-Right-Pointing-Pointer Solid state reactions of Bi{sub 2}O{sub 3} (BiCl{sub 3}) and As{sub 2}O{sub 3} yielded two new phases. Black-Right-Pointing-Pointer They represent the first examples of bismuth arsenites. Black-Right-Pointing-Pointer The two compounds exhibit two different structural types.

  16. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  17. Mitotic arrest-associated apoptosis induced by sodium arsenite in A375 melanoma cells is BUBR1-dependent

    SciTech Connect

    McNeely, Samuel C.; Taylor, B. Frazier; States, J. Christopher

    2008-08-15

    A375 human malignant melanoma cells undergo mitotic arrest-associated apoptosis when treated with pharmacological concentrations of sodium arsenite, a chemotherapeutic for acute promyelocytic leukemia. Our previous studies indicated that decreased arsenite sensitivity correlated with reduced mitotic spindle checkpoint function and reduced expression of the checkpoint protein BUBR1. In the current study, arsenite induced securin and cyclin B stabilization, BUBR1 phosphorylation, and spindle checkpoint activation. Arsenite also increased activating cyclin dependent kinase 1 (CDK1) Thr{sup 161} phosphorylation but decreased inhibitory Tyr15 phosphorylation. Mitotic arrest resulted in apoptosis as indicated by colocalization of mitotic phospho-Histone H3 with active caspase 3. Apoptosis was associated with BCL-2 Ser70 phosphorylation. Inhibition of CDK1 with roscovitine in arsenite-treated mitotic cells inhibited spindle checkpoint maintenance as inferred from reduced BUBR1 phosphorylation, reduced cyclin B expression, and diminution of mitotic index. Roscovitine also reduced BCL-2 Ser70 phosphorylation and protected against apoptosis, suggesting mitotic arrest caused by hyperactivation of CDK1 directly or indirectly leads to BCL-2 phosphorylation and apoptosis. In addition, suppression of BUBR1 with siRNA prevented arsenite-induced mitotic arrest and apoptosis. These findings provide insight into the mechanism of arsenic's chemotherapeutic action and indicate a functional spindle checkpoint may be required for arsenic-sensitivity.

  18. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  19. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.

    PubMed

    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki

    2013-01-01

    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments. PMID:23832349

  20. Optimization of glucose oxidase production by Aspergillus niger using genetic- and process-engineering techniques.

    PubMed

    Hellmuth, K; Pluschkell, S; Jung, J K; Ruttkowski, E; Rinas, U

    1995-11-01

    Wild-type Aspergillus niger NRRL-3 was transformed with multiple copies of the glucose oxidase structural gene (god). The gene was placed under the control of the gpdA promoter of A. nidulans. For more efficient secretion the alpha-amylase signal peptide from A. oryzae was inserted in front of god. Compared to the wild type, the recombinant strain NRRL-3 (GOD3-18) produced up to four times more extracellular glucose oxidase under identical culture conditions. Addition of yeast extract (2 gl-1) to a mineral salts medium containing only glucose as carbon source increased volumetric and specific extracellular glucose oxidase activities by 130% and 50% respectively. With the same medium composition and inoculum size, volumetric and specific extracellular glucose oxidase activities increased more than ten times in bioreactor cultivations compared to shake-flask cultures. PMID:8590664

  1. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  2. Drugs related to monoamine oxidase activity.

    PubMed

    Fišar, Zdeněk

    2016-08-01

    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions. PMID:26944656

  3. Chromate reduction by rabbit liver aldehyde oxidase

    SciTech Connect

    Banks, R.B.; Cooke, R.T. Jr.

    1986-05-29

    Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

  4. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )

    1989-04-01

    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  5. Genetically Engineering Bacillus subtilis with a Heat-Resistant Arsenite Methyltransferase for Bioremediation of Arsenic-Contaminated Organic Waste.

    PubMed

    Huang, Ke; Chen, Chuan; Shen, Qirong; Rosen, Barry P; Zhao, Fang-Jie

    2015-10-01

    Organic manures may contain high levels of arsenic (As) due to the use of As-containing growth-promoting substances in animal feed. To develop a bioremediation strategy to remove As from organic waste, Bacillus subtilis 168, a bacterial strain which can grow at high temperature but is unable to methylate and volatilize As, was genetically engineered to express the arsenite S-adenosylmethionine methyltransferase gene (CmarsM) from the thermophilic alga Cyanidioschyzon merolae. The genetically engineered B. subtilis 168 converted most of the inorganic As in the medium into dimethylarsenate and trimethylarsine oxide within 48 h and volatized substantial amounts of dimethylarsine and trimethylarsine. The rate of As methylation and volatilization increased with temperature from 37 to 50°C. When inoculated into an As-contaminated organic manure composted at 50°C, the modified strain significantly enhanced As volatilization. This study provides a proof of concept of using genetically engineered microorganisms for bioremediation of As-contaminated organic waste during composting. PMID:26187966

  6. Genetically Engineering Bacillus subtilis with a Heat-Resistant Arsenite Methyltransferase for Bioremediation of Arsenic-Contaminated Organic Waste

    PubMed Central

    Huang, Ke; Chen, Chuan; Shen, Qirong; Rosen, Barry P.

    2015-01-01

    Organic manures may contain high levels of arsenic (As) due to the use of As-containing growth-promoting substances in animal feed. To develop a bioremediation strategy to remove As from organic waste, Bacillus subtilis 168, a bacterial strain which can grow at high temperature but is unable to methylate and volatilize As, was genetically engineered to express the arsenite S-adenosylmethionine methyltransferase gene (CmarsM) from the thermophilic alga Cyanidioschyzon merolae. The genetically engineered B. subtilis 168 converted most of the inorganic As in the medium into dimethylarsenate and trimethylarsine oxide within 48 h and volatized substantial amounts of dimethylarsine and trimethylarsine. The rate of As methylation and volatilization increased with temperature from 37 to 50°C. When inoculated into an As-contaminated organic manure composted at 50°C, the modified strain significantly enhanced As volatilization. This study provides a proof of concept of using genetically engineered microorganisms for bioremediation of As-contaminated organic waste during composting. PMID:26187966

  7. Uptake, Metabolic Effects and Toxicity of Arsenate and Arsenite in Astrocytes.

    PubMed

    Dringen, Ralf; Spiller, Sabrina; Neumann, Sarah; Koehler, Yvonne

    2016-03-01

    The inorganic arsenic species arsenate and arsenite are common environmental toxins which contaminate the drinking water in many countries. Chronic intoxication with arsenicals has been connected with various diseases, but causes also neurological complications and impairs cognitive development, learning and memory. In brain, astrocytes have a pivotal role as partners of neurons in homeostatic and metabolic processes. In addition, astrocytes are the first parenchymal brain cell type which encounters substances which cross the blood-brain barrier and are considered as first line of defence against the toxic potential of xenobiotics. Therefore, astrocytes are likely to play a prominent role in the metabolism and potential detoxification of arsenicals in brain. This article summarizes the current knowledge on the uptake and toxicity of arsenate and arsenite in astrocytes and discusses the modulation of the astrocytic glucose and glutathione metabolism by arsenicals. PMID:25862194

  8. Arsenite induced poly(ADP-ribosyl)ation of tumor suppressor P53 in human skin keratinocytes as a possible mechanism for carcinogenesis associated with arsenic exposure

    SciTech Connect

    Komissarova, Elena V.; Rossman, Toby G.

    2010-03-15

    Arsenite is an environmental pollutant. Exposure to inorganic arsenic in drinking water is associated with elevated cancer risk, especially in skin. Arsenite alone does not cause skin cancer in animals, but arsenite can enhance the carcinogenicity of solar UV. Arsenite is not a significant mutagen at non-toxic concentrations, but it enhances the mutagenicity of other carcinogens. The tumor suppressor protein P53 and nuclear enzyme PARP-1 are both key players in DNA damage response. This laboratory demonstrated earlier that in cells treated with arsenite, the P53-dependent increase in p21{sup WAF1/CIP1} expression, normally a block to cell cycle progression after DNA damage, is deficient. Here we show that although long-term exposure of human keratinocytes (HaCaT) to a nontoxic concentration (0.1 muM) of arsenite decreases the level of global protein poly(ADP-ribosyl)ation, it increases poly(ADP-ribosyl)ation of P53 protein and PARP-1 protein abundance. We also demonstrate that exposure to 0.1 muM arsenite depresses the constitutive expression of p21 mRNA and P21 protein in HaCaT cells. Poly(ADP-ribosyl)ation of P53 is reported to block its activation, DNA binding and its functioning as a transcription factor. Our results suggest that arsenite's interference with activation of P53 via poly(ADP-ribosyl)ation may play a role in the comutagenic and cocarcinogenic effects of arsenite.

  9. Arsenite promotes centrosome abnormalities under a p53 compromised status induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)

    SciTech Connect

    Liao, W.-T.; Yu, H.-S.; Lin Pinpin; Chang, Louis W.

    2010-02-15

    Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus an interaction between arsenite and cigarette smoking in lung carcinogenesis was suspected. In the present study, we investigated the interactions of a tobacco-specific carcinogen 4- (methylnitrosamino)-1-(3-pyridyl)-1-butanone (nicotine-derived nitrosamine ketone, NNK) and arsenite on lung cell transformation. BEAS-2B, an immortalized human lung epithelial cell line, was selected to test the centrosomal abnormalities and colony formation by NNK and arsenite. We found that NNK, alone, could enhance BEAS-2B cell growth at 1-5 muM. Under NNK exposure, arsenite was able to increase centrosomal abnormality as compared with NNK or arsenite treatment alone. NNK treatment could also reduce arsenite-induced G2/M cell cycle arrest and apoptosis, these cellular effects were found to be correlated with p53 dysfunction. Increased anchorage-independent growth (colony formation) of BEAS-2B cells cotreated with NNK and arsenite was also observed in soft agar. Our present investigation demonstrated that NNK could provide a p53 compromised status. Arsenite would act specifically on this p53 compromised status to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenite under tobacco-specific carcinogen co-exposure.

  10. The Arsenite Oxidation Potential of Native Microbial Communities from Arsenic-Rich Freshwaters.

    PubMed

    Fazi, Stefano; Crognale, Simona; Casentini, Barbara; Amalfitano, Stefano; Lotti, Francesca; Rossetti, Simona

    2016-07-01

    Microorganisms play an important role in speciation and mobility of arsenic in the environment, by mediating redox transformations of both inorganic and organic species. Since arsenite [As(III)] is more toxic than arsenate [As(V)] to the biota, the microbial driven processes of As(V) reduction and As(III) oxidation may play a prominent role in mediating the environmental impact of arsenic contamination. However, little is known about the ecology and dynamics of As(III)-oxidizing populations within native microbial communities exposed to natural high levels of As. In this study, two techniques for single cell quantification (i.e., flow cytometry, CARD-FISH) were used to analyze the structure of aquatic microbial communities across a gradient of arsenic (As) contamination in different freshwater environments (i.e., groundwaters, surface and thermal waters). Moreover, we followed the structural evolution of these communities and their capacity to oxidize arsenite, when experimentally exposed to high As(III) concentrations in experimental microcosms. Betaproteobacteria and Deltaproteobacteria were the main groups retrieved in groundwaters and surface waters, while Beta and Gammaproteobacteria dominated the bacteria community in thermal waters. At the end of microcosm incubations, the communities were able to oxidize up to 95 % of arsenite, with an increase of Alphaproteobacteria in most of the experimental conditions. Finally, heterotrophic As(III)-oxidizing strains (one Alphaproteobacteria and two Gammaproteobacteria) were isolated from As rich waters. Our findings underlined that native microbial communities from different arsenic-contaminated freshwaters can efficiently perform arsenite oxidation, thus contributing to reduce the overall As toxicity to the aquatic biota. PMID:27090902

  11. Quantitative trace-level speciation of arsenite and arsenate in drinking water by ion chromatography.

    PubMed

    Johnson, Rebecca L; Aldstad, Joseph H

    2002-10-01

    We describe an improved method for the determination of inorganic arsenic in drinking water. The method is based on comprehensive optimization of the anion-exchange ion chromatographic (IC) separation of arsenite and arsenate with post-column generation and detection of the arsenate-molybdate heteropoly acid (AMHPA) complex ion. The arsenite capacity factor was improved from 0.081 to 0.13 by using a mobile phase (2.0 mL min(-1)) composed of 2.5 mM Na2CO3 and 0.91 mM NaHCO3 (pH 10.5). A post-column photo-oxidation reactor (2.5 m x 0.7 mm) was optimized (0.37 microM potassium persulfate at 0.50 mL min(-1)) such that arsenite was converted to arsenate with 99.8 +/- 4.2% efficiency. Multi-variate optimization of the complexation reaction conditions yielded the following levels: 1.3 mM ammonium molybdate, 7.7 mM ascorbic acid, 0.48 M nitric acid, 0.17 mM potassium antimony tartrate, and 1.0% (v/v) glycerol. A long-path length flow cell (Teflon AF, 100-cm) was used to measure the absorption of the AMHPA complex (818 +/- 2 nm). Figures of merit for arsenite/arsenate include: limit of detection (1.6/0.40 microg L(-1)): standard error in absorbance (5.1 x 10(-3)/3.5 x 10(-3)); and sensitivity (2.9 x 10(-3)/2.2 x 10(-3) absorbance units per ppb). Successful application of the method to fortified surface and ground waters (100 microL samples) is also described. PMID:12430600

  12. Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity

    PubMed Central

    Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

    2013-01-01

    Abstract A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. PMID:23873697

  13. Bioaccumulation and oxidative stress in Daphnia magna exposed to arsenite and arsenate.

    PubMed

    Fan, Wenhong; Ren, Jinqian; Li, Xiaomin; Wei, Chaoyang; Xue, Feng; Zhang, Nan

    2015-11-01

    Arsenic pollution and its toxicity to aquatic organisms have attracted worldwide attention. The bioavailability and toxicity of arsenic are highly related to its speciation. The present study investigated the differences in bioaccumulation and oxidative stress responses in an aquatic organism, Daphnia magna, induced by 2 inorganic arsenic species (As(III) and As(V)). The bioaccumulation of arsenic, Na(+) /K(+) -adenosine triphosphatase (ATPase) activity, reactive oxygen species (ROS) content, total superoxide dismutase (SOD) activity, total antioxidative capability, and malondialdehyde content in D. magna were determined after exposure to 500 µg/L of arsenite and arsenate for 48 h. The results showed that the oxidative stress and antioxidative process in D. magna exposed to arsenite and arsenate could be divided into 3 phases, which were antioxidative response, oxidation inhibition, and antioxidative recovery. In addition, differences in bioaccumulation, Na(+) /K(+) -ATPase activity, and total SOD activity were also found in D. magna exposed to As(III) and As(V). These differences might have been the result of the high affinity of As(III) with sulfhydryl groups in enzymes and the structural similarity of As(V) to phosphate. Therefore, arsenate could be taken up by organisms through phosphate transporters, could substitute for phosphate in biochemical reactions, and could lead to a change in the bioaccumulation of arsenic and activity of enzymes. These characteristics were the possible reasons for the different toxicity mechanisms in the oxidative stress process of arsenite and arsenate. PMID:26084717

  14. Immobilization of Ochrobactrum tritici As5 on PTFE thin films for arsenite biofiltration.

    PubMed

    Branco, Rita; Sousa, Tânia; Piedade, Ana P; Morais, Paula V

    2016-03-01

    Ochrobactrum tritici SCII24T bacteria is an environmental strain with high capacity to resist to arsenic (As) toxicity, which makes it able to grow in the presence of As(III). The inactivation of the two functional arsenite efflux pumps, ArsB and ACR3_1, resulted in the mutant O. tritici As5 exhibiting a high accumulation of arsenite. This work describes a method for the immobilization of the mutant cells O. tritici As5, on a commercial polymeric net after sputtered modified by the deposition of poly(tetrafluoroethylene) (PTFE) thin films, and demonstrates the capacity of immobilized cells to accumulate arsenic from solutions. Six different set of deposition parameters for PTFE thin films were developed and tested in vitro regarding their ability to immobilize the bacterial cells. The surface that exhibited a mild zeta potential value, hydrophobic characteristics, the lowest surface free energy but with a high polar component and the appropriate ratio of chemical reactive groups allowed cells to proliferate and to grow as a biofilm. These immobilized cells maintained their ability to accumulate the surrounding arsenite, making it a great arsenic biofilter to be used in bioremediation processes. PMID:26735734

  15. Protective effect of Juglans nigra on sodium arsenite-induced toxicity in rats

    PubMed Central

    Owumi, Solomon E.; Odunola, Oyeronke A.; Gbadegesin, Michael A.; Nulah, Kathleen L.

    2013-01-01

    Background: Consumption of arsenic contaminated water has been implicated in metalloid-induced carcinogenesis. Dietary intake of certain plant products with chemoprotective properties may protect against the onset of diseases and promote maintenance of health. Objectives: We investigated the outcome of black walnut Juglans nigra (JN) consumption on sodium arsenite (SA)-induced toxicity in rats. Materials and Methods: Wister albino rats were treated as follows: Control, SA only (positive control) (2.5 mg/kg body weight), JN only (100 mg/kg weight), and JN+SA coadministered. After 5 weeks animals were sacrificed whole blood, femur, liver and testis harvested were assessed for hepatic transaminases and clastogenicity. Histology of the liver, sperm morphology and quality were also assessed. Data were analyzed (ANOVA) and expressed as means ±SD. Results: SA treatment elevated hepatic transaminases level in serum (P < 0.05), induced histological changes in liver: fibroplasia and periportal hepatocytes infiltration by mononuclear cells. These changes were ameliorated by JN (P < 0.05) coadministration. SA induced micronuclei formation (P < 0.05). Again JN decreased (P < 0.05) micronuclei formation by 50%. Sperm count and motility decreased (P < 0.05) in all groups compared to control. Conclusion: JN showed no protection against arsenite effect on sperm quality. Hepatoprotective and anticlastogenic effects were apparent suggesting a chemopreventive potential active against arsenite genotoxicity and chromosomal instability which have implication for metalloid-induced carcinogenesis. PMID:23901214

  16. Dispersion-precipitation synthesis of nanosized magnetic iron oxide for efficient removal of arsenite in water.

    PubMed

    Cheng, Wei; Xu, Jing; Wang, Yajie; Wu, Feng; Xu, Xiuyan; Li, Jinjun

    2015-05-01

    Nanosized magnetic iron oxide was facilely synthesized by a dispersion-precipitation method, which involved acetone-promoted precipitation of colloidal hydrous iron oxide nanoparticles and subsequent calcination of the precipitate at 250°C. Characterization by X-ray diffraction, transmission electron microscopy, Raman spectroscopy, nitrogen sorption, and vibrating-sample magnetometry revealed that the material was a composite of α-Fe2O3 and γ-Fe2O3 with primary particle size of 15-25 nm and specific surface area of 121 m(2)/g, as well as superparamagnetic property. The material was used as adsorbent for the removal of arsenite in water. Batch experiments showed that the adsorption isotherms at pH 3.0-11.0 fit the Langmuir equation and the adsorption obeys pseudo-second-order kinetics. Its maximum sorption capability for arsenite is 46.5 mg/g at pH 7.0. Coexisting nitrate, carbonate, sulfate, chloride, and fluoride have no significant effect on the removal efficiency of arsenite, while phosphate and silicate reduce the removal efficiency to some extent. The As(III) removal mechanism is chemisorption through forming inner-sphere surface complexes. The efficiency of arsenic removal is still maintained after five cycles of regeneration-reuse. PMID:25612934

  17. Sodium meta-arsenite ameliorates hyperglycemia in obese diabetic db/db mice by inhibition of hepatic gluconeogenesis.

    PubMed

    Lee, Young-Sun; Lee, Eun-Kyu; Oh, Hyun-Hee; Choi, Cheol Soo; Kim, Sujong; Jun, Hee-Sook

    2014-01-01

    Sodium meta-arsenite (SA) is implicated in the regulation of hepatic gluconeogenesis-related genes in vitro; however, the effects in vivo have not been studied. We investigated whether SA has antidiabetic effects in a type 2 diabetic mouse model. Diabetic db/db mice were orally intubated with SA (10 mg kg(-1) body weight/day) for 8 weeks. We examined hemoglobin A1c (HbA1c), blood glucose levels, food intake, and body weight. We performed glucose, insulin, and pyruvate tolerance tests and analyzed glucose production and the expression of gluconeogenesis-related genes in hepatocytes. We analyzed energy metabolism using a comprehensive animal metabolic monitoring system. SA-treated diabetic db/db mice had reduced concentrations of HbA1c and blood glucose levels. Exogenous glucose was quickly cleared in glucose tolerance tests. The mRNA expressions of genes for gluconeogenesis-related enzymes, glucose 6-phosphatase (G6Pase), and phosphoenolpyruvate carboxykinase (PEPCK) were significantly reduced in the liver of SA-treated diabetic db/db mice. In primary hepatocytes, SA treatment decreased glucose production and the expression of G6Pase, PEPCK, and hepatocyte nuclear factor 4 alpha (HNF-4α) mRNA. Small heterodimer partner (SHP) mRNA expression was increased in hepatocytes dependent upon the SA concentration. The expression of Sirt1 mRNA and protein was reduced, and acetylated forkhead box protein O1 (FoxO1) was induced by SA treatment in hepatocytes. In addition, SA-treated diabetic db/db mice showed reduced energy expenditure. Oral intubation of SA ameliorates hyperglycemia in db/db mice by reducing hepatic gluconeogenesis through the decrease of Sirt1 expression and increase in acetylated FoxO1. PMID:25610880

  18. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.

    PubMed

    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

    2014-12-01

    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  19. Arsenite induces endothelial cell permeability increase through a reactive oxygen species-vascular endothelial growth factor pathway.

    PubMed

    Bao, Lingzhi; Shi, Honglian

    2010-11-15

    As a potent environmental oxidative stressor, arsenic exposure has been reported to exacerbate cardiovascular diseases and increase vascular endothelial cell monolayer permeability. However, the underlying mechanism of this effect is not well understood. In this paper, we test our hypothesis that reactive oxygen species (ROS)-induced vascular endothelial growth factor (VEGF) expression may play an important role in an arsenic-caused increase of endothelial cell monolayer permeability. The mouse brain vascular endothelial cell bEnd3 monolayer was exposed to arsenite for 1, 3, and 6 days. The monolayer permeability, VEGF protein release, and ROS generation were determined. In addition, VE-cadherin and zonula occludens-1 (ZO-1), two membrane structure proteins, were immunostained to elucidate the effects of arsenite on the cell-cell junction. The roles of ROS and VEGF in arsenite-induced permeability was determined by inhibiting ROS with antioxidants and immuno-depleting VEGF with a VEGF antibody. We observed that arsenite increased bEnd3 monolayer permeability, elevated the production of cellular ROS, and increased VEGF release. VE-cadherin and ZO-1 disruptions were also found in cells treated with arsenite. Furthermore, both antioxidant (N-acetyl cysteine and tempol) and the VEGF antibody treatments significantly lowered the arsenite-induced permeability of the bEnd3 monolayer as well as VEGF expression. VE-cadherin and ZO-1 disruptions were also diminished by N-acetyl cysteine and the VEGF antibody. Our data suggest that the increase in VEGF expression caused by ROS may play an important role in the arsenite-induced increase in endothelial cell permeability. PMID:20954712

  20. Arsenite induces cell transformation by reactive oxygen species, AKT, ERK1/2, and p70S6K1

    SciTech Connect

    Carpenter, Richard L.; Jiang, Yue; Jing, Yi; He, Jun; Rojanasakul, Yon; Liu, Ling-Zhi; Jiang, Bing-Hua

    2011-10-28

    Highlights: Black-Right-Pointing-Pointer Chronic exposure to arsenite induces cell proliferation and transformation. Black-Right-Pointing-Pointer Arsenite-induced transformation increases ROS production and downstream signalings. Black-Right-Pointing-Pointer Inhibition of ROS levels via catalase reduces arsenite-induced cell transformation. Black-Right-Pointing-Pointer Interruption of AKT, ERK, or p70S6K1 inhibits arsenite-induced cell transformation. -- Abstract: Arsenic is naturally occurring element that exists in both organic and inorganic formulations. The inorganic form arsenite has a positive association with development of multiple cancer types. There are significant populations throughout the world with high exposure to arsenite via drinking water. Thus, human exposure to arsenic has become a significant public health problem. Recent evidence suggests that reactive oxygen species (ROS) mediate multiple changes to cell behavior after acute arsenic exposure, including activation of proliferative signaling and angiogenesis. However, the role of ROS in mediating cell transformation by chronic arsenic exposure is unknown. We found that cells chronically exposed to sodium arsenite increased proliferation and gained anchorage-independent growth. This cell transformation phenotype required constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. We also observed these cells constitutively produce ROS, which was required for the constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. Suppression of ROS levels by forced expression of catalase also reduced cell proliferation and anchorage-independent growth. These results indicate cell transformation induced by chronic arsenic exposure is mediated by increased cellular levels of ROS, which mediates activation of AKT, ERK1/2, and p70S6K1.

  1. Syntheses, crystal structures and characterizations of new vanadium arsenites and arsenates

    SciTech Connect

    Liu Junhui; He Zhangzhen; Kong Fang; Xu Xiang; Sun Chuanfu; Mao Jianggao

    2012-08-15

    Systematic explorations in vanadium arsenites and arsenates led to the isolation four new compounds, namely, {alpha}-(V{sup IV}O){sub 3}(As{sup III}O{sub 3}){sub 2} (1), {beta}-(V{sup IV}O){sub 3}(As{sup III}O{sub 3}){sub 2} (2), (V{sup IV}O)[V{sup IV}O(H{sub 2}O)]{sub 2}(As{sup V}O{sub 4}){sub 2} (3), V{sup III}V{sup IV}O{sub 2}(As{sup V}O{sub 4}) (4). Compounds 1, 2 and 4 were synthesized by standard solid-state reactions, and compound 3 is a vanadium arsenate dihydrate synthesized through hydrothermal reactions. Compounds 1 and 2 are isomers, and they represent the first examples of ternary inorganic vanadium(IV) arsenites. Single crystal X-ray diffraction analysis indicated that the four compounds display four different structural types. Magnetic property measurements for compound 1 indicated that it exhibits ferromagnetism with the Curie temperature T{sub c}=65 K. Thermal stability and optical properties for compounds 1 and 3 were also investigated. - Graphical abstract: Hydrothermal or solid state reactions of V{sub 2}O{sub 5} (or VO{sub 2}) and As{sub 2}O{sub 3} yielded four new ternary compounds with four different types of structures, namely, {alpha}-(VO){sub 3}(AsO{sub 3}){sub 2} (1), {beta}-(VO){sub 3}(AsO{sub 3}){sub 2} (2), (VO)[VO(H{sub 2}O)]{sub 2}(AsO{sub 4}){sub 2} (3), (VO){sub 2}(AsO{sub 4}) (4). {alpha}-(VO){sub 3}(AsO{sub 3}){sub 2} (1), {beta}-(VO){sub 3}(AsO{sub 3}){sub 2} (2) represent the first examples of ternary inorganic vanadium(IV) arsenites. Highlights: Black-Right-Pointing-Pointer Hydrothermal or solid state reactions of V{sub 2}O{sub 5} (or VO{sub 2}) and As{sub 2}O{sub 3} yielded two new arsenites. Black-Right-Pointing-Pointer They represent the first examples of ternary vanadium arsenites. Black-Right-Pointing-Pointer Two new ternary vanadium arsenates were also obtained. Black-Right-Pointing-Pointer They exhibit four different structural types.

  2. Sodium arsenite down-regulates the expression of X-linked inhibitor of apoptosis protein via translational and post-translational mechanisms in hepatocellular carcinoma

    SciTech Connect

    Chen, Hong; Hao, Yuqing; Wang, Lijing; Jia, Dongwei; Ruan, Yuanyuan; Gu, Jianxin

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer Sodium arsenite down-regulates the protein expression level of XIAP in HCC. Black-Right-Pointing-Pointer Sodium arsenite inhibits the de novo XIAP synthesis and its IRES activity. Black-Right-Pointing-Pointer Sodium arsenite decreases XIAP stability and promotes its proteasomal degradation. Black-Right-Pointing-Pointer Overexpression of XIAP attenuates the pro-apoptotic effect of sodium arsenite. -- Abstract: X-linked inhibitor of apoptosis protein (XIAP) is a member of the inhibitors of apoptosis protein (IAP) family, and has been reported to exhibit elevated expression levels in hepatocellular carcinoma (HCC) and promote cell survival, metastasis and tumor recurrence. Targeting XIAP has proven effective for the inhibition of cancer cell proliferation and restoration of cancer cell chemosensitivity. Arsenic (or sodium arsenite) is a potent anti-tumor agent used to treat patients with acute promyelocytic leukemia (APL). Additionally, arsenic induces cell growth inhibition, cell cycle arrest and apoptosis in human HCC cells. In this study, we identified XIAP as a target for sodium arsenite-induced cytotoxicity in HCC. The exposure of HCC cell lines to sodium arsenite resulted in inhibition of XIAP expression in both a dose- and time-dependent manner. Sodium arsenite blocked the de novo XIAP synthesis and the activity of its internal ribosome entry site (IRES) element. Moreover, treatment with sodium arsenite decreased the protein stability of XIAP and induced its ubiquitin-proteasomal degradation. Overexpression of XIAP attenuated the pro-apoptotic effect of sodium arsenite in HCC. Taken together, our data demonstrate that sodium arsenite suppresses XIAP expression via translational and post-translational mechanisms in HCC.

  3. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  4. The accumulations of HIF-1α and HIF-2α by JNK and ERK are involved in biphasic effects induced by different levels of arsenite in human bronchial epithelial cells

    SciTech Connect

    Xu, Yuan; Li, Yuan; Li, Huiqiao; Pang, Ying; Zhao, Yue; Jiang, Rongrong; Shen, Lu; Zhou, Jianwei; Wang, Xinru; Liu, Qizhan

    2013-01-15

    The biphasic effects of arsenite, in which low levels of arsenite induce cell proliferation and high levels of arsenite induce DNA damage and apoptosis, apparently contribute to arsenite-induced carcinogenesis. However, the mechanisms underlying this phenomenon are not well understood. In this study, we investigated the effects of different levels of arsenite on cell proliferation, DNA damage and apoptosis as well as on signal transduction pathways in human bronchial epithelial (HBE) cells. Our results show that a low level of arsenite activates extracellular signal-regulated kinases (ERK), which probably mediate arsenite-inhibited degradation of ubiquitinated hypoxia-inducible factor-2α (HIF-2α) in HBE cells. ERK inhibition blocks cell proliferation induced by a low level of arsenite, in part via HIF-2α. In contrast, a high level of arsenite activates c-Jun N-terminal kinases (JNK), which provoke a response to suppress ubiquitinated HIF-1α degradation. Down-regulation of HIF-1α by inhibiting JNK, however, increases the DNA damage but decreases the apoptosis induced by a high level of arsenite. Thus, data in the present study suggest that the accumulations of HIF-1α and HIF-2α by JNK and ERK are involved in different levels of arsenite-induced biphasic effects, with low levels of arsenite inducing cell proliferation and high levels of arsenite inducing DNA damage and apoptosis in HBE cells. -- Highlights: ► Biphasic effects induced by different concentrations of arsenite. ► Different regulation of ERK or JNK signal pathway by arsenite. ► Different regulation of HIF1α or HIF 2α by arsenite.

  5. Ameliorative Effects of Acacia Honey against Sodium Arsenite-Induced Oxidative Stress in Some Viscera of Male Wistar Albino Rats

    PubMed Central

    Aliyu, Muhammad; Ibrahim, Sani; Inuwa, Hajiya M.; Sallau, Abdullahi B.; Abbas, Olagunju; Aimola, Idowu A.; Habila, Nathan; Uche, Ndidi S.

    2013-01-01

    Cancer is a leading cause of death worldwide and its development is frequently associated with oxidative stress-induced by carcinogens such as arsenicals. Most foods are basically health-promoting or disease-preventing and a typical example of such type is honey. This study was undertaken to investigate the ameliorative effects of Acacia honey on sodium arsenite-induced oxidative stress in the heart, lung and kidney tissues of male Wistar rats. Male Wistar albino rats divided into four groups of five rats each were administered distilled water, Acacia honey (20%), sodium arsenite (5 mg/kg body weight), Acacia honey, and sodium arsenite daily for one week. They were sacrificed anesthetically using 60 mg/kg sodium pentothal. The tissues were used for the assessment of glutathione peroxidase, catalase, and superoxide dismutase activities, protein content and lipid peroxidation. Sodium arsenite significantly (P < 0.05) suppressed the glutathione peroxidase, catalase, superoxide dismutase activities with simultaneous induction of lipid peroxidation. Administration of Acacia honey significantly increased (P < 0.05) glutathione peroxidase, catalase, and superoxide dismutase activities with concomitant suppression of lipid peroxidation as evident by the decrease in malondialdehyde level. From the results obtained, Acacia honey mitigates sodium arsenite induced-oxidative stress in male Wistar albino rats, which suggest that it may attenuate oxidative stress implicated in chemical carcinogenesis. PMID:24368942

  6. Human hnRNP Q re-localizes to cytoplasmic granules upon PMA, thapsigargin, arsenite and heat-shock treatments

    SciTech Connect

    Quaresma, Alexandre J.C.; Bressan, G.C.; Gava, L.M.; Lanza, D.C.F.; Ramos, C.H.I; Kobarg, Joerg

    2009-04-01

    Eukaryotic gene expression is regulated on different levels ranging from pre-mRNA processing to translation. One of the most characterized families of RNA-binding proteins is the group of hnRNPs: heterogenous nuclear ribonucleoproteins. Members of this protein family play important roles in gene expression control and mRNAs metabolism. In the cytoplasm, several hnRNPs proteins are involved in RNA-related processes and they can be frequently found in two specialized structures, known as GW-bodies (GWbs), previously known as processing bodies: PBs, and stress granules, which may be formed in response to specific stimuli. GWbs have been early reported to be involved in the mRNA decay process, acting as a site of mRNA degradation. In a similar way, stress granules (SGs) have been described as cytoplasmic aggregates, which contain accumulated mRNAs in cells under stress conditions and present reduced or inhibited translation. Here, we characterized the hnRNP Q localization after different stress conditions. hnRNP Q is a predominantly nuclear protein that exhibits a modular organization and several RNA-related functions. Our data suggest that the nuclear localization of hnRNP Q might be modified after different treatments, such as: PMA, thapsigargin, arsenite and heat shock. Under different stress conditions, hnRNP Q can fully co-localize with the endoplasmatic reticulum specific chaperone, BiP. However, under stress, this protein only co-localizes partially with the proteins: GW182 - GWbs marker protein and TIA-1 stress granule component.

  7. Cholesterol oxidase with high catalytic activity from Pseudomonas aeruginosa: Screening, molecular genetic analysis, expression and characterization.

    PubMed

    Doukyu, Noriyuki; Nihei, Shyou

    2015-07-01

    An extracellular cholesterol oxidase producer, Pseudomonas aeruginosa strain PA157, was isolated by a screening method to detect 6β-hydroperoxycholest-4-en-3-one-forming cholesterol oxidase. On the basis of a putative cholesterol oxidase gene sequence in the genome sequence data of P. aeruginosa strain PAO1, the cholesterol oxidase gene from strain PA157 was cloned. The mature form of the enzyme was overexpressed in Escherichia coli cells. The overexpressed enzyme formed inclusion bodies in recombinant E. coli cells grown at 20 °C and 30 °C. A soluble and active PA157 enzyme was obtained when the recombinant cells were grown at 10 °C. The purified enzyme was stable at pH 5.5 to 10 and was most active at pH 7.5-8.0, showing optimal activity at pH 7.0 and 70 °C. The enzyme retained about 90% of its activity after incubation for 30 min at 70 °C. The enzyme oxidized 3β-hydroxysteroids such as cholesterol, β-cholestanol, and β-sitosterol at high rates. The Km value and Vmax value for the cholesterol were 92.6 μM and 15.9 μmol/min/mg of protein, respectively. The Vmax value of the enzyme was higher than those of commercially available cholesterol oxidases. This is the first report to characterize a cholesterol oxidase from P. aeruginosa. PMID:25573142

  8. Incorporation of copper into lysyl oxidase.

    PubMed

    Kosonen, T; Uriu-Hare, J Y; Clegg, M S; Keen, C L; Rucker, R B

    1997-10-01

    Lysyl oxidase is a copper-dependent enzyme involved in extracellular processing of collagens and elastin. Although it is known that copper is essential for the functional activity of the enzyme, there is little information on the incorporation of copper. In the present study we examined the insertion of copper into lysyl oxidase using 67Cu in cell-free transcription/translation assays and in normal skin fibroblast culture systems. When a full-length lysyl oxidase cDNA was used as a template for transcription/translation reactions in vitro, unprocessed prolysyl oxidase appeared to bind copper. To examine further the post-translational incorporation of copper into lysyl oxidase, confluent skin fibroblasts were incubated with inhibitors of protein synthesis (cycloheximide, 10 microg/ml), glycosylation (tunicamycin, 10 microg/ml), protein secretion (brefeldin A, 10 microg/ml) and prolysyl oxidase processing (procollagen C-peptidase inhibitor, 2.5 microg/ml) together with 300 microCi of carrier-free 67Cu. It was observed that protein synthesis was a prerequisite for copper incorporation, but inhibition of glycosylation by tunicamycin did not affect the secretion of 67Cu as lysyl oxidase. Brefeldin A inhibited the secretion of 67Ci-labelled lysyl oxidase by 46%, but the intracellular incorporation of copper into lysyl oxidase was not affected. In addition, the inhibition of the extracellular proteolytic processing of prolysyl oxidase to lysyl oxidase had minimal effects on the secretion of protein-bound 67Cu. Our results indicate that, similar to caeruloplasmin processing [Sato and Gitlin (1991) J. Biol. Chem. 266, 5128-5134], copper is inserted into prolysyl oxidase independently of glycosylation. PMID:9355764

  9. L-amino acid oxidases with specificity for basic L-amino acids in cyanobacteria.

    PubMed

    Gau, Achim E; Heindl, Achim; Nodop, Anke; Kahmann, Uwe; Pistorius, Elfriede K

    2007-01-01

    The two closely related fresh water cyanobacteria Synechococcus elongatus PCC 6301 and Synechococcus elongatus PCC 7942 have previously been shown to constitutively express a FAD-containing L-amino acid oxidase with high specificity for basic L-amino acids (L-arginine being the best substrate). In this paper we show that such an enzyme is also present in the fresh water cyanobacterium Synechococcus cedrorum PCC 6908. In addition, an improved evaluation of the nucleotide/amino acid sequence of the L-amino acid oxidase of Synechococcus elongatus PCC 6301 (encoded by the aoxA gene) with respect to the FAD-binding site and a translocation pathway signal sequence will be given. Moreover, the genome sequences of 24 cyanobacteria will be evaluated for the occurrence of an aoxA-similar gene. In the evaluated cyanobacteria 15 genes encoding an L-amino acid oxidase-similar protein will be found. PMID:17542496

  10. A new crystal form of human diamine oxidase.

    PubMed

    McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Dooley, David M; Guss, J Mitchell

    2010-02-01

    Copper amine oxidases (CAOs) are ubiquitous in nature and catalyse the oxidative deamination of primary amines to the corresponding aldehydes. Humans have three viable CAO genes (AOC1-3). AOC1 encodes human diamine oxidase (hDAO), which is the frontline enzyme for histamine metabolism. hDAO is unique among CAOs in that it has a distinct substrate preference for diamines. The structure of hDAO in space group P2(1)2(1)2(1) with two molecules in the asymmetric unit has recently been reported. Here, the structure of hDAO refined to 2.1 A resolution in space group C222(1) with one molecule in the asymmetric unit is reported. PMID:20124708

  11. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  12. Origin and evolution of lysyl oxidases.

    PubMed

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea - which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  13. Studies on the Mechanism of Aldehyde Oxidase and Xanthine Oxidase

    PubMed Central

    Alfaro, Joshua F.

    2009-01-01

    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp2 carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the anti-bonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations, and tend to support this mechanism. PMID:18998731

  14. Studies on the mechanism of aldehyde oxidase and xanthine oxidase.

    PubMed

    Alfaro, Joshua F; Jones, Jeffrey P

    2008-12-01

    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp(2) carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the antibonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations and tend to support this mechanism. PMID:18998731

  15. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen

    1990-01-01

    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  16. MicroRNA-21 activation of ERK signaling via PTEN is involved in arsenite-induced autophagy in human hepatic L-02 cells.

    PubMed

    Liu, Xinlu; Luo, Fei; Ling, Min; Lu, Lu; Shi, Le; Lu, Xiaolin; Xu, Hui; Chen, Chao; Yang, Qianlei; Xue, Junchao; Li, Jun; Zhang, Aihua; Liu, Qizhan

    2016-06-11

    Autophagy, an evolutionarily conserved cellular process, has diverse physiological and pathological roles in biological functions. Whether autophagy is induced by arsenite, a well-established human carcinogen, and the molecular mechanisms involved, remain to be established. Further, microRNAs (miRNAs) act as regulators in various cancers, but how miRNAs regulate autophagy remains largely unexplored. We have found that, in human hepatic epithelial (L-02) cells, arsenite increases levels of autophagy-related proteins in a concentration- and time-dependent manner and elevates the number of autophagic vacuoles (AVs). Arsenite also activates the ERK pathway in a dose- and time-dependent manner. In L-02 cells exposed to arsenite, microRNA-21 (miRNA-21) is over-expressed, and its target proteins, PTEN, PDCD4, and Spry1, are decreased. Moreover, inhibition of miR-21 increases levels of PTEN, and reduces levels of Beclin 1 and LC3 II/I, indicating that miR-21 is involved in arsenite-induced autophagy. In addition, ectopic expression of PTEN blocks the effect of miR-21 on the arsenite-induced autophagy and decreases p-ERK levels. Also, ERK promotes the autophagy induced by arsenite. In sum, upon exposure of cells to arsenite, over-expression of miR-21 activates ERK through PTEN, factors that participate in arsenite-induced autophagy. This link, mediated through miRNAs, establishes a mechanism for the development of autophagy that is associated with arsenic toxicity. Such information contributes to an understanding of the liver toxicity caused by arsenite. PMID:27107786

  17. Arsenite Regulates Prolongation of Glycan Residues of Membrane Glycoprotein: A Pivotal Study via Wax Physisorption Kinetics and FTIR Imaging.

    PubMed

    Lee, Chih-Hung; Hsu, Chia-Yen; Huang, Pei-Yu; Chen, Ching-Iue; Lee, Yao-Chang; Yu, Hsin-Su

    2016-01-01

    Arsenic exposure results in several human cancers, including those of the skin, lung, and bladder. As skin cancers are the most common form, epidermal keratinocytes (KC) are the main target of arsenic exposure. The mechanisms by which arsenic induces carcinogenesis remains unclear, but aberrant cell proliferation and dysregulated energy homeostasis play a significant role. Protein glycosylation is involved in many key physiological processes, including cell proliferation and differentiation. To evaluate whether arsenite exposure affected protein glycosylation, the alteration of chain length of glycan residues in arsenite treated skin cells was estimated. Herein we demonstrated that the protein glycosylation was adenosine triphosphate (ATP)-dependent and regulated by arsenite exposure by using Fourier transform infrared (FTIR) reflectance spectroscopy, synchrotron-radiation-based FTIR (SR-FTIR) microspectroscopy, and wax physisorption kinetics coupled with focal-plane-array-based FTIR (WPK-FPA-FTIR) imaging. We were able to estimate the relative length of surface protein-linked glycan residues on arsenite-treated skin cells, including primary KC and two skin cancer cell lines, HSC-1 and HaCaT cells. Differential physisorption of wax adsorbents adhered to long-chain (elongated type) and short-chain (regular type) glycan residues of glycoprotein of skin cell samples treated with various concentration of arsenite was measured. The physisorption ratio of beeswax remain/n-pentacosane remain for KC cells was increased during arsenite exposure. Interestingly, this increase was reversed after oligomycin (an ATP synthase inhibitor) pretreatment, suggesting the chain length of protein-linked glycan residues is likely ATP-dependent. This is the first study to demonstrate the elongation and termination of surface protein-linked glycan residues using WPK-FPA-FTIR imaging in eukaryotes. Herein the result may provide a scientific basis to target surface protein-linked glycan

  18. Long-lasting genomic instability following arsenite exposure in mammalian cells: the role of reactive oxygen species.

    PubMed

    Sciandrello, G; Mauro, M; Catanzaro, I; Saverini, M; Caradonna, F; Barbata, G

    2011-08-01

    Previously, we reported that the progeny of mammalian cells, which has been exposed to sodium arsenite for two cell cycles, exhibited chromosomal instability and concurrent DNA hypomethylation, when they were subsequently investigated after two months of subculturing (about 120 cell generations) in arsenite-free medium. In this work, we continued our investigations of the long-lasting arsenite-induced genomic instability by analyzing additional endpoints at several time points during the cell expanded growth. In addition to the progressive increase of aneuploid cells, we also noted micronucleated and multinucleated cells that continued to accumulate up to the 50th cell generation, as well as dicentric chromosomes and/or telomeric associations and other complex chromosome rearrangements that began to appear much later, at the 90th cell generation following arsenite exposure. The increasing genomic instability was further characterized by an increased frequency of spontaneous mutations. Furthermore, the long-lasting genomic instability was related to elevated levels of reactive oxygen species (ROS), which at the 50th cell generation appeared higher than in stable parental cells. To gain additional insight into the continuing genomic instability, we examined several individual clones isolated at different time points from the growing cell population. Chromosomally and morphologically unstable cell clones, the number of which increased with the expanded growth, were also present at early phases of growth without arsenite. All genomically unstable clones exhibited higher ROS levels than untreated cells suggesting that oxidative stress is an important factor for the progression of genomic instability induced by arsenite. PMID:21520292

  19. Arsenite Regulates Prolongation of Glycan Residues of Membrane Glycoprotein: A Pivotal Study via Wax Physisorption Kinetics and FTIR Imaging

    PubMed Central

    Lee, Chih-Hung; Hsu, Chia-Yen; Huang, Pei-Yu; Chen, Ching-Iue; Lee, Yao-Chang; Yu, Hsin-Su

    2016-01-01

    Arsenic exposure results in several human cancers, including those of the skin, lung, and bladder. As skin cancers are the most common form, epidermal keratinocytes (KC) are the main target of arsenic exposure. The mechanisms by which arsenic induces carcinogenesis remains unclear, but aberrant cell proliferation and dysregulated energy homeostasis play a significant role. Protein glycosylation is involved in many key physiological processes, including cell proliferation and differentiation. To evaluate whether arsenite exposure affected protein glycosylation, the alteration of chain length of glycan residues in arsenite treated skin cells was estimated. Herein we demonstrated that the protein glycosylation was adenosine triphosphate (ATP)-dependent and regulated by arsenite exposure by using Fourier transform infrared (FTIR) reflectance spectroscopy, synchrotron-radiation-based FTIR (SR-FTIR) microspectroscopy, and wax physisorption kinetics coupled with focal-plane-array-based FTIR (WPK-FPA-FTIR) imaging. We were able to estimate the relative length of surface protein-linked glycan residues on arsenite-treated skin cells, including primary KC and two skin cancer cell lines, HSC-1 and HaCaT cells. Differential physisorption of wax adsorbents adhered to long-chain (elongated type) and short-chain (regular type) glycan residues of glycoprotein of skin cell samples treated with various concentration of arsenite was measured. The physisorption ratio of beeswax remain/n-pentacosane remain for KC cells was increased during arsenite exposure. Interestingly, this increase was reversed after oligomycin (an ATP synthase inhibitor) pretreatment, suggesting the chain length of protein-linked glycan residues is likely ATP-dependent. This is the first study to demonstrate the elongation and termination of surface protein-linked glycan residues using WPK-FPA-FTIR imaging in eukaryotes. Herein the result may provide a scientific basis to target surface protein-linked glycan

  20. Zinc adsorption effects on arsenite oxidation kinetics at the birnessite-water interface

    USGS Publications Warehouse

    Power, L.E.; Arai, Y.; Sparks, D.L.

    2005-01-01

    Arsenite is more toxic and mobile than As(V) in soil and sediment environments, and thus it is advantageous to explore factors that enhance oxidation of As(III) to As(V). Previous studies showed that manganese oxides, such as birnessite (??-MnO2), directly oxidized As(III). However, these studies did not explore the role that cation adsorption has on As(III) oxidation. Accordingly, the effects of adsorbed and nonadsorbed Zn on arsenite (As(III)) oxidation kinetics at the birnessite-water interface were investigated using batch adsorption experiments (0.1 g L-1; pH 4.5 and 6.0; I = 0.01 M NaCl). Divalent Zn adsorption on synthetic ??-MnO 2 in the absence of As(III) increased with increasing pH and caused positive shifts in electrophoretic mobility values at pH 4-6, indirectly suggesting inner-sphere Zn adsorption mechanisms. Arsenite was readily oxidized on birnessite in the absence of Zn. The initial As(III) oxidation rate constant decreased with increasing pH from 4.5 to 6.0 and initial As(III) concentrations from 100 to 300 ??M. Similar pH and initial As(III) concentration effects were observed in systems when Zn was present (i.e., presorbed Zn prior to As(III) addition and simultaneously added Zn-As(III) systems), but As(III) oxidation reactions were suppressed compared to the respective control systems. The suppression was more pronounced when Zn was presorbed on the ??-MnO 2 surfaces as opposed to added simultaneously with As(III). This study provides further understanding of As(III) oxidation reactions on manganese oxide surfaces under environmentally applicable conditions where metals compete for reactive sites.

<