Note: This page contains sample records for the topic ascomycete podospora anserina from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: August 15, 2014.
1

The genome sequence of the model ascomycete fungus Podospora anserina  

PubMed Central

Background The dung-inhabiting ascomycete fungus Podospora anserina is a model used to study various aspects of eukaryotic and fungal biology, such as ageing, prions and sexual development. Results We present a 10X draft sequence of P. anserina genome, linked to the sequences of a large expressed sequence tag collection. Similar to higher eukaryotes, the P. anserina transcription/splicing machinery generates numerous non-conventional transcripts. Comparison of the P. anserina genome and orthologous gene set with the one of its close relatives, Neurospora crassa, shows that synteny is poorly conserved, the main result of evolution being gene shuffling in the same chromosome. The P. anserina genome contains fewer repeated sequences and has evolved new genes by duplication since its separation from N. crassa, despite the presence of the repeat induced point mutation mechanism that mutates duplicated sequences. We also provide evidence that frequent gene loss took place in the lineages leading to P. anserina and N. crassa. P. anserina contains a large and highly specialized set of genes involved in utilization of natural carbon sources commonly found in its natural biotope. It includes genes potentially involved in lignin degradation and efficient cellulose breakdown. Conclusion The features of the P. anserina genome indicate a highly dynamic evolution since the divergence of P. anserina and N. crassa, leading to the ability of the former to use specific complex carbon sources that match its needs in its natural biotope.

Espagne, Eric; Lespinet, Olivier; Malagnac, Fabienne; Da Silva, Corinne; Jaillon, Olivier; Porcel, Betina M; Couloux, Arnaud; Aury, Jean-Marc; Segurens, Beatrice; Poulain, Julie; Anthouard, Veronique; Grossetete, Sandrine; Khalili, Hamid; Coppin, Evelyne; Dequard-Chablat, Michelle; Picard, Marguerite; Contamine, Veronique; Arnaise, Sylvie; Bourdais, Anne; Berteaux-Lecellier, Veronique; Gautheret, Daniel; de Vries, Ronald P; Battaglia, Evy; Coutinho, Pedro M; Danchin, Etienne GJ; Henrissat, Bernard; Khoury, Riyad EL; Sainsard-Chanet, Annie; Boivin, Antoine; Pinan-Lucarre, Berangere; Sellem, Carole H; Debuchy, Robert; Wincker, Patrick; Weissenbach, Jean; Silar, Philippe

2008-01-01

2

Age-Related Cellular Copper Dynamics in the Fungal Ageing Model Podospora anserina and in Ageing Human Fibroblasts  

Microsoft Academic Search

In previous investigations an impact of cellular copper homeostasis on ageing of the ascomycete Podospora anserina has been demonstrated. Here we provide new data indicating that mitochondria play a major role in this process. Determination of copper in the cytosolic fraction using total reflection X-ray fluorescence spectroscopy analysis and eGfp reporter gene studies indicate an age-related increase of cytosolic copper

Christian Q. Scheckhuber; Jürgen Grief; Emmanuelle Boilan; Karin Luce; Florence Debacq-Chainiaux; Claudia Rittmeyer; Ricardo Gredilla; Bernd O. Kolbesen; Olivier Toussaint; Heinz D. Osiewacz; Mikhail V. Blagosklonny

2009-01-01

3

What is a bona fide mating-type gene? Internuclear complementation of mat mutants in Podospora anserina  

Microsoft Academic Search

In the heterothallic ascomycete Podospora anserina, the mating-type locus is occupied by two mutually exclusive sequences termed mat+ and mat–. The mat+ sequence contains only one gene, FPR1, while the mat– sequence contains three genes: FMR1, SMR1 and SMR2. Previous studies have demonstrated that FPR1 and FMR1 are required for fertilization. Further analyses have led to the hypothesis that mat+

S. Arnaise; R. Debuchy; M. Picard

1997-01-01

4

Infectious Fold and Amyloid Propagation in Podospora anserina  

PubMed Central

Amyloid protein aggregation is involved in serious neurodegenerative disorders such as Alzheimer's disease and transmissible encephalopathies. The concept of an infectious protein (prion) being the scrapie agent was successfully validated for several yeast and fungi proteins. Ure2, Sup35 and Rnq1 in Saccharomyces cerevisiae and HET-s in Podospora anserina have been genetically and biochemically identified as prion proteins. Studies on these proteins have revealed critical information on the mechanisms of prions appearance and propagation. The prion phenotype correlates with the aggregation state of these particular proteins. In vitro, the recombinant prion proteins form amyloid fibers characterized by rich ? sheet content. In a previous work on the HET-s prion protein Podospora, we demonstrated the infectivity of HET-s recombinant amyloid aggregates. More recently, the structural analysis of the HET-s prion domain associated with in vivo mutagenesis allowed us to propose a model for the infectious fold of the HET-s prion domain. Further investigations to complete this model are discussed in this review, as are relevant questions about the [Het-s] system of Podospora anserina.

2007-01-01

5

Systematic Deletion of Homeobox Genes in Podospora anserina Uncovers Their Roles in Shaping the Fruiting Body  

PubMed Central

Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

Coppin, Evelyne; Berteaux-Lecellier, Veronique; Bidard, Frederique; Brun, Sylvain; Ruprich-Robert, Gwenael; Espagne, Eric; Ait-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

2012-01-01

6

Effect of a mitochondria-targeted antioxidant on ageing of Podospora anserina : Ultrastructural study  

Microsoft Academic Search

A beneficial effect of mitochondria targeted antioxidant (MTA) SkQ1 added to the culture medium on life span of Podospora anserina was revealed. As was shown earlier, optimal concentration was 400 nM. SkQ1 was shown to increase P. anserina life span 2.4 times, at the same time maintaining native cell ultrastructure: degradative alterations were not revealed.\\u000a Significant reorganization of P. anserina

S. M. Ojovan; L. E. Bakeeva; O. V. Shtaer; O. V. Kamzolkina; M. Yu. Vyssokikh

2010-01-01

7

Insights into Exo- and Endoglucanase Activities of Family 6 Glycoside Hydrolases from Podospora anserina  

PubMed Central

The ascomycete Podospora anserina is a coprophilous fungus that grows at late stages on droppings of herbivores. Its genome encodes a large diversity of carbohydrate-active enzymes. Among them, four genes encode glycoside hydrolases from family 6 (GH6), the members of which comprise putative endoglucanases and exoglucanases, some of them exerting important functions for biomass degradation in fungi. Therefore, this family was selected for functional analysis. Three of the enzymes, P. anserina Cel6A (PaCel6A), PaCel6B, and PaCel6C, were functionally expressed in the yeast Pichia pastoris. All three GH6 enzymes hydrolyzed crystalline and amorphous cellulose but were inactive on hydroxyethyl cellulose, mannan, galactomannan, xyloglucan, arabinoxylan, arabinan, xylan, and pectin. PaCel6A had a catalytic efficiency on cellotetraose comparable to that of Trichoderma reesei Cel6A (TrCel6A), but PaCel6B and PaCel6C were clearly less efficient. PaCel6A was the enzyme with the highest stability at 45°C, while PaCel6C was the least stable enzyme, losing more than 50% of its activity after incubation at temperatures above 30°C for 24 h. In contrast to TrCel6A, all three studied P. anserina GH6 cellulases were stable over a wide range of pHs and conserved high activity at pH values of up to 9. Each enzyme displayed a distinct substrate and product profile, highlighting different modes of action, with PaCel6A being the enzyme most similar to TrCel6A. PaCel6B was the only enzyme with higher specific activity on carboxymethylcellulose (CMC) than on Avicel and showed lower processivity than the others. Structural modeling predicts an open catalytic cleft, suggesting that PaCel6B is an endoglucanase.

Poidevin, Laetitia; Feliu, Julia; Doan, Annick; Berrin, Jean-Guy; Bey, Mathieu; Coutinho, Pedro M.; Henrissat, Bernard; Record, Eric

2013-01-01

8

Natural variation of heterokaryon incompatibility gene het-c in Podospora anserina reveals diversifying selection.  

PubMed

In filamentous fungi, allorecognition takes the form of heterokaryon incompatibility, a cell death reaction triggered when genetically distinct hyphae fuse. Heterokaryon incompatibility is controlled by specific loci termed het-loci. In this article, we analyzed the natural variation in one such fungal allorecognition determinant, the het-c heterokaryon incompatibility locus of the filamentous ascomycete Podospora anserina. The het-c locus determines an allogenic incompatibility reaction together with two unlinked loci termed het-d and het-e. Each het-c allele is incompatible with a specific subset of the het-d and het-e alleles. We analyzed variability at the het-c locus in a population of 110 individuals, and in additional isolates from various localities. We identified a total of 11 het-c alleles, which define 7 distinct incompatibility specificity classes in combination with the known het-d and het-e alleles. We found that the het-c allorecognition gene of P. anserina is under diversifying selection. We find a highly unequal allele distribution of het-c in the population, which contrasts with the more balanced distribution of functional groups of het-c based on their allorecognition function. One explanation for the observed het-c diversity in the population is its function in allorecognition. However, alleles that are most efficient in allorecognition are rare. An alternative and not exclusive explanation for the observed diversity is that het-c is involved in pathogen recognition. In Arabidopsis thaliana, a homolog of het-c is a pathogen effector target, supporting this hypothesis. We hypothesize that the het-c diversity in P. anserina results from both its functions in pathogen-defense, and allorecognition. PMID:24448643

Bastiaans, Eric; Debets, Alfons J M; Aanen, Duur K; van Diepeningen, Anne D; Saupe, Sven J; Paoletti, Mathieu

2014-04-01

9

Natural Variation of Heterokaryon Incompatibility Gene het-c in Podospora anserina Reveals Diversifying Selection  

PubMed Central

In filamentous fungi, allorecognition takes the form of heterokaryon incompatibility, a cell death reaction triggered when genetically distinct hyphae fuse. Heterokaryon incompatibility is controlled by specific loci termed het-loci. In this article, we analyzed the natural variation in one such fungal allorecognition determinant, the het-c heterokaryon incompatibility locus of the filamentous ascomycete Podospora anserina. The het-c locus determines an allogenic incompatibility reaction together with two unlinked loci termed het-d and het-e. Each het-c allele is incompatible with a specific subset of the het-d and het-e alleles. We analyzed variability at the het-c locus in a population of 110 individuals, and in additional isolates from various localities. We identified a total of 11 het-c alleles, which define 7 distinct incompatibility specificity classes in combination with the known het-d and het-e alleles. We found that the het-c allorecognition gene of P. anserina is under diversifying selection. We find a highly unequal allele distribution of het-c in the population, which contrasts with the more balanced distribution of functional groups of het-c based on their allorecognition function. One explanation for the observed het-c diversity in the population is its function in allorecognition. However, alleles that are most efficient in allorecognition are rare. An alternative and not exclusive explanation for the observed diversity is that het-c is involved in pathogen recognition. In Arabidopsis thaliana, a homolog of het-c is a pathogen effector target, supporting this hypothesis. We hypothesize that the het-c diversity in P. anserina results from both its functions in pathogen-defense, and allorecognition.

Bastiaans, Eric; Debets, Alfons J.M.; Aanen, Duur K.; van Diepeningen, Anne D.; Saupe, Sven J.; Paoletti, Mathieu

2014-01-01

10

A network of HMG-box transcription factors regulates sexual cycle in the fungus Podospora anserina.  

PubMed

High-mobility group (HMG) B proteins are eukaryotic DNA-binding proteins characterized by the HMG-box functional motif. These transcription factors play a pivotal role in global genomic functions and in the control of genes involved in specific developmental or metabolic pathways. The filamentous ascomycete Podospora anserina contains 12 HMG-box genes. Of these, four have been previously characterized; three are mating-type genes that control fertilization and development of the fruit-body, whereas the last one encodes a factor involved in mitochondrial DNA stability. Systematic deletion analysis of the eight remaining uncharacterized HMG-box genes indicated that none were essential for viability, but that seven were involved in the sexual cycle. Two HMG-box genes display striking features. PaHMG5, an ortholog of SpSte11 from Schizosaccharomyces pombe, is a pivotal activator of mating-type genes in P. anserina, whereas PaHMG9 is a repressor of several phenomena specific to the stationary phase, most notably hyphal anastomoses. Transcriptional analyses of HMG-box genes in HMG-box deletion strains indicated that PaHMG5 is at the hub of a network of several HMG-box factors that regulate mating-type genes and mating-type target genes. Genetic analyses revealed that this network also controls fertility genes that are not regulated by mating-type transcription factors. This study points to the critical role of HMG-box members in sexual reproduction in fungi, as 11 out of 12 members were involved in the sexual cycle in P. anserina. PaHMG5 and SpSte11 are conserved transcriptional regulators of mating-type genes, although P. anserina and S. pombe diverged 550 million years ago. Two HMG-box genes, SOX9 and its upstream regulator SRY, also play an important role in sex determination in mammals. The P. anserina and S. pombe mating-type genes and their upstream regulatory factor form a module of HMG-box genes analogous to the SRY/SOX9 module, revealing a commonality of sex regulation in animals and fungi. PMID:23935511

Ait Benkhali, Jinane; Coppin, Evelyne; Brun, Sylvain; Peraza-Reyes, Leonardo; Martin, Tom; Dixelius, Christina; Lazar, Noureddine; van Tilbeurgh, Herman; Debuchy, Robert

2013-01-01

11

Search for ribosomal mutants in Podospora anserina: Genetic analysis of mutants resistant to paromomycin  

Microsoft Academic Search

It has recently been shown that paromomycin, an antibiotic of the aminoglycoside family, is also active on eukaryotic cytoplasmic ribosomes. In the fungus Podospora anserina, genetic analysis of ten mutants resistant to high doses of paromomycin shows that this resistance is caused by mutations in two different nuclear genes. These mutants display pleiotropic phenotypes (cold sensitivity, mycelium and spore appearance

M. Dequard; J. L. Couderc; P. Legrain; L. Belcour; M. Picard-Bennoun

1980-01-01

12

Ribosomal suppressors and antisuppressors in Podospora anserina: Altered susceptibility to paromomycin and relationships between genetic and phenotypic suppression  

Microsoft Academic Search

Informational suppressors and antisuppressors have been previously isolated in Podospora anserina, and their properties suggest that they could be ribosomal mutants involved in the control of translational fidelity. In this paper we present results concerning relationships between these mutants and paromomycin, an aminoglycoside antibiotic known to stimulate translational errors. The mutants were found to manifest an altered growth sensitivity to

E. Coppin-Raynal

1981-01-01

13

Isolation and characterization of plasma membranes from the fungus Podospora anserina.  

PubMed Central

This paper describes a method for separating and isolating plasma membranes from the septated fungus Podospora anserina. Plasma membranes were isolated from protoplasts (young cell plasma membranes) and mycelia (both young and aged cell plasma membranes). The procedure of fractionation consisted of a combination of differential and isopycnic centrifugations. Characterization of cellular membranes and enrichment of the fractions with plasmalemma were carried out by assays on enzymatic activities. A plasma membrane fraction was isolated in a buoyant density peak of 1.087 g/cm3, where three enzymatic activities bound to plasma membrane, adenylate cyclase, chitin synthase, and beta-glucan synthase at low affinity for UDP-Glc, peaked together. Good purity of this fraction was determined by the absence or the very low level of other enzymatic activities used as markers for intracellular membranes, i.e., succinate dehydrogenase, alpha-mannosidase, NADPH cytochrome c reductase, and beta-glucan synthase at high affinity for UDP-Glc activities.

Labarere, J; Bonneu, M

1982-01-01

14

Proteomic analysis of mitochondria from senescent Podospora anserina casts new light on ROS dependent aging mechanisms.  

PubMed

The mitochondrial free radical theory of aging (MFRTA) states that reactive oxygen species (ROS) generated at the respiratory electron transport chain are active in causing age-related damage of biomolecules like lipids, nucleic acids and proteins. Accumulation of this kind of damage results in functional impairments, aging and death of biological systems. Here we report data of an analysis to monitor the age-related quantitative protein composition of the mitochondria of the fungal aging model Podospora anserina. The impact of senescence on mitochondrial protein composition was analyzed by LC-MS. In an untargeted proteomic approach, we identified 795 proteins in samples from juvenile and senescent wild-type cultures and obtained quantitative information for 226 of these proteins by spectral counting. Despite the broad coverage of the proteome, no substantial changes in known age-related pathways could be observed. For a more detailed analysis, a targeted proteome analysis was applied focusing on 15 proteins from respiratory, ROS-scavenging and quality control pathways. Analyzing six distinct age-stages from juvenile to senescent P. anserina cultures revealed low, but statistically significant changes for the mitochondrial respiratory complexes. A P. anserina PaSod3 over-expression mutant with a phenotype of mitochondrial ROS over-production was used for biological evaluation of changes observed during aging. LC-MS analysis of the mutant revealed severe changes to the mitochondrial proteome - substantially larger than observed during senescence. Interestingly the amount of ATP synthase subunit g, involved in cristae formation is significantly decreased in the mutant implicating ROS-induced impairments in ATP synthase dimer and cristae formation. The difference between protein-profiles of aging wild type and ROS stressed mutant suggests that oxidative stress within the mitochondria is not the dominating mechanism for the aging process in P. anserina. Collectively, while our data do not exclude an effect of ROS on specific proteins and in signaling and control of pathways which are governing aging of P. anserina, it contradicts increasing ROS as a cause of a gross general and non-selective accumulation of damaged proteins during senescence. Instead, ROS may be effective by controlling specific regulators of mitochondrial function. PMID:24556281

Plohnke, Nicole; Hamann, Andrea; Poetsch, Ansgar; Osiewacz, Heinz D; Rögner, Matthias; Rexroth, Sascha

2014-08-01

15

Characterization of a glycoside hydrolase family 31 ?-glucosidase involved in starch utilization in Podospora anserina.  

PubMed

For Podospora anserina, several studies of cellulolytic enzymes have been established, but characteristics of amylolytic enzymes are not well understood. When P. anserina grew in starch as carbon source, it accumulated glucose, nigerose, and maltose in the culture supernatant. At the same time, the fungus secreted ?-glucosidase (PAG). PAG was purified from the culture supernatant, and was found to convert soluble starch to nigerose and maltose. The recombinant enzyme with C-terminal His-tag (rPAG) was produced with Pichia pastoris. Most rPAG produced under standard conditions lost its affinity for nickel-chelating resin, but the affinity was improved by the use of a buffered medium (pH 8.0) supplemented with casamino acid and a reduction of the cultivation time. rPAG suffered limited proteolysis at the same site as the original PAG. A site-directed mutagenesis study indicated that proteolysis had no effect on enzyme characteristics. A kinetic study indicated that the PAG possessed significant transglycosylation activity. PMID:24096679

Song, Kyung-Mo; Okuyama, Masayuki; Kobayashi, Kazuyuki; Mori, Haruhide; Kimura, Atsuo

2013-01-01

16

Wood Utilization Is Dependent on Catalase Activities in the Filamentous Fungus Podospora anserina  

PubMed Central

Catalases are enzymes that play critical roles in protecting cells against the toxic effects of hydrogen peroxide. They are implicated in various physiological and pathological conditions but some of their functions remain unclear. In order to decipher the role(s) of catalases during the life cycle of Podospora anserina, we analyzed the role of the four monofunctional catalases and one bifunctional catalase-peroxidase genes present in its genome. The five genes were deleted and the phenotypes of each single and all multiple mutants were investigated. Intriguingly, although the genes are differently expressed during the life cycle, catalase activity is dispensable during both vegetative growth and sexual reproduction in laboratory conditions. Catalases are also not essential for cellulose or fatty acid assimilation. In contrast, they are strictly required for efficient utilization of more complex biomass like wood shavings by allowing growth in the presence of lignin. The secreted CATB and cytosolic CAT2 are the major catalases implicated in peroxide resistance, while CAT2 is the major player during complex biomass assimilation. Our results suggest that P. anserina produces external H2O2 to assimilate complex biomass and that catalases are necessary to protect the cells during this process. In addition, the phenotypes of strains lacking only one catalase gene suggest that a decrease of catalase activity improves the capacity of the fungus to degrade complex biomass.

Bourdais, Anne; Bidard, Frederique; Zickler, Denise; Berteaux-Lecellier, Veronique; Silar, Philippe; Espagne, Eric

2012-01-01

17

PaCATB, a secreted catalase protecting Podospora anserina against exogenous oxidative stress  

PubMed Central

A differential mass spectrometry analysis of secreted proteins from juvenile and senescent Podospora anserina cultures revealed age-related differences in protein profiles. Among other proteins with decreased abundance in the secretome of senescent cultures a catalase, termed PaCATB, was identified. Genetic modulation of the abundance of PaCATB identified differential effects on the phenotype of the corresponding strains. Deletion of PaCatB resulted in decreased resistance, over-expression in increased resistance against hydrogen peroxide. While the lifespan of the genetically modified strains was found to be unaffected under standard growth conditions, increased exogenous hydrogen peroxide stress in the growth medium markedly reduced the lifespan of the PaCatB deletion strain but extended the lifespan of PaCatB over-expressors. Overall our data identify a component of the secretome of P. anserina as a new effective factor to cope with environmental stress, stress that under natural conditions is constantly applied on organisms and influences aging processes.

Zintel, Sandra; Bernhardt, Dominik; Rogowska-Wrzesinska, Adelina; Osiewacz, Heinz D.

2011-01-01

18

Structural and Biochemical Analyses of Glycoside Hydrolase Families 5 and 26 ?-(1,4)-Mannanases from Podospora anserina Reveal Differences upon Manno-oligosaccharide Catalysis*  

PubMed Central

The microbial deconstruction of the plant cell wall is a key biological process that is of increasing importance with the development of a sustainable biofuel industry. The glycoside hydrolase families GH5 (PaMan5A) and GH26 (PaMan26A) endo-?-1,4-mannanases from the coprophilic ascomycete Podospora anserina contribute to the enzymatic degradation of lignocellulosic biomass. In this study, P. anserina mannanases were further subjected to detailed comparative analysis of their substrate specificities, active site organization, and transglycosylation capacity. Although PaMan5A displays a classical mode of action, PaMan26A revealed an atypical hydrolysis pattern with the release of mannotetraose and mannose from mannopentaose resulting from a predominant binding mode involving the ?4 subsite. The crystal structures of PaMan5A and PaMan26A were solved at 1.4 and 2.85 ? resolution, respectively. Analysis of the PaMan26A structure supported strong interaction with substrate at the ?4 subsite mediated by two aromatic residues Trp-244 and Trp-245. The PaMan26A structure appended to its family 35 carbohydrate binding module revealed a short and proline-rich rigid linker that anchored together the catalytic and the binding modules.

Couturier, Marie; Roussel, Alain; Rosengren, Anna; Leone, Philippe; Stalbrand, Henrik; Berrin, Jean-Guy

2013-01-01

19

DNA sequence analysis of the apocytochrome b gene of Podospora anserina : a new family of intronic open reading frame  

Microsoft Academic Search

The 5,969 by (base pair) DNA sequence of the apocytochrome b mitochondrial (mt) gene of race A Podospora anserina was located in a 8.5 Kbp region. This gene contained a 2,499 by subgroup IB and a 1,306 by subgroup ID intron as well as a 990 bp subgroup IB intron which is present in race A but not race s.

Donald J. Cummings; François Michel; Kenneth L. McNally

1989-01-01

20

Purification and characterization of a new laccase from the filamentous fungus Podospora anserina.  

PubMed

A new laccase from the filamentous fungus Podospora anserina has been isolated and identified. The 73 kDa protein containing 4 coppers, truncated from its first 31 amino acids, was successfully overexpressed in Pichia pastoris and purified in one step with a yield of 48% and a specific activity of 644Umg(-1). The kinetic parameters, k(cat) and K(M), determined at 37 °C and optimal pH are 1372 s(-1) and 307 ?M for ABTS and, 1.29 s(-1) and 10.9 ?M, for syringaldazine (SGZ). Unlike other laccases, the new protein displays a better thermostability, with a half life>400 min at 37 °C, is less sensitive to chloride and more stable at pH 7. Even though, the new 566 amino-acid enzyme displays a large homology with Bilirubin oxidase (BOD) from Myrothecium verrucaria (58%) and exhibits the four histidine rich domains consensus sequences of BODs, the new enzyme is not able to oxidize neither conjugated nor unconjugated bilirubin. PMID:23220637

Durand, Fabien; Gounel, Sébastien; Mano, Nicolas

2013-03-01

21

Identification of a Hypothetical Protein from Podospora anserina as a Nitroalkane Oxidase  

SciTech Connect

The flavoprotein nitroalkane oxidase (NAO) from Fusarium oxysporum catalyzes the oxidation of primary and secondary nitroalkanes to their respective aldehydes and ketones. Structurally, the enzyme is a member of the acyl-CoA dehydrogenase superfamily. To date no enzymes other than that from F. oxysporum have been annotated as NAOs. To identify additional potential NAOs, the available database was searched for enzymes in which the active site residues Asp402, Arg409, and Ser276 were conserved. Of the several fungal enzymes identified in this fashion, PODANSg2158 from Podospora anserina was selected for expression and characterization. The recombinant enzyme is a flavoprotein with activity on nitroalkanes comparable to the F. oxysporum NAO, although the substrate specificity is somewhat different. Asp399, Arg406, and Ser273 in PODANSg2158 correspond to the active site triad in F. oxysporum NAO. The k{sub cat}/K{sub M}-pH profile with nitroethane shows a pK{sub a} of 5.9 that is assigned to Asp399 as the active site base. Mutation of Asp399 to asparagine decreases the k{sub cat}/K{sub M} value for nitroethane over 2 orders of magnitude. The R406K and S373A mutations decrease this kinetic parameter by 64- and 3-fold, respectively. The structure of PODANSg2158 has been determined at a resolution of 2.0 {angstrom}, confirming its identification as an NAO.

Tormos, Jose R.; Taylor, Alexander B.; Daubner, S. Colette; Hart, P. John; Fitzpatrick, Paul F. (Texas-HSC); (St. Mary)

2010-08-23

22

Enzymatic synthesis of model substrates recognized by glucuronoyl esterases from Podospora anserina and Myceliophthora thermophila.  

PubMed

Glucuronoyl esterases (GEs) are recently discovered enzymes that are suggested to cleave the ester bond between lignin alcohols and xylan-bound 4-O-methyl-D-glucuronic acid. Although their potential use for enhanced enzymatic biomass degradation and synthesis of valuable chemicals renders them attractive research targets for biotechnological applications, the difficulty to purify natural fractions of lignin-carbohydrate complexes hampers the characterization of fungal GEs. In this work, we report the synthesis of three aryl alkyl or alkenyl D-glucuronate esters using lipase B from Candida antarctica (CALB) and their use to determine the kinetic parameters of two GEs, StGE2 from the thermophilic fungus Myceliophthora thermophila (syn. Sporotrichum thermophile) and PaGE1 from the coprophilous fungus Podospora anserina. PaGE1 was functionally expressed in the methylotrophic yeast Pichia pastoris under the transcriptional control of the alcohol oxidase (AOX1) promoter and purified to its homogeneity (63 kDa). The three D-glucuronate esters contain an aromatic UV-absorbing phenol group that facilitates the quantification of their enzymatic hydrolysis by HPLC. Both enzymes were able to hydrolyze the synthetic esters with a pronounced preference towards the cinnamyl-D-glucuronate ester. The experimental results were corroborated by computational docking of the synthesized substrate analogues. We show that the nature of the alcohol portion of the hydrolyzed ester influences the catalytic efficiency of the two GEs. PMID:24531271

Katsimpouras, Constantinos; Bénarouche, Anaïs; Navarro, David; Karpusas, Michael; Dimarogona, Maria; Berrin, Jean-Guy; Christakopoulos, Paul; Topakas, Evangelos

2014-06-01

23

DNA-Binding Specificity of the IDI-4 Basic Leucine Zipper Factor of Podospora anserina Defined by Systematic Evolution of Ligands by Exponential Enrichment (SELEX)  

Microsoft Academic Search

Heterokaryon incompatibility is a cell destruction process that occurs when fungal cells of unlike genotype fuse. In Podospora anserina, autophagy is engaged during cell death by incompatibility and a number of genes are induced at the transcriptional level. These genes are termed idi (induced during incompatibility) genes. Among these is idi-4, a gene encoding a basic leucine zipper (bZIP) factor.

Karine Dementhon; Sven J. Saupe

2005-01-01

24

Incomplete penetrance and variable expressivity of a growth defect as a consequence of knocking out two K(+) transporters in the euascomycete fungus Podospora anserina.  

PubMed Central

We describe an example of incomplete penetrance and variable expressivity in the filamentous fungus Podospora anserina, two genetic properties classically associated with mutations in more complex organisms, such as green plants and animals. We show that the knockouts of two TRK-related K(+) transporters of this ascomycete present variability in their phenotype that cannot be attributed to fluctuations of the genetic background or the environment. Thalli of the knockout strains derived from independent monokaryotic ascospores or from a single monokaryotic ascospore and cultivated under standard growth conditions may or may not present impaired growth. When impaired, thalli exhibit a range of phenotypes. Environmental conditions control expressivity to a large extent and penetrance to a low extent. Restoration of functional potassium transport by heterologous expression of K(+) transporters from Neurospora crassa abolishes or strongly diminishes the growth impairment. These data show that incomplete penetrance and variable expressivity can be an intrinsic property of a single Mendelian loss-of-function mutation. They also show that such variability in the expression of a mutant phenotype can be promoted by a phenomenon not obviously related to the well-known chromatin structure modifications, i.e., potassium transport. They provide a framework to understand human channelopathies with similar properties.

Lalucque, Herve; Silar, Philippe

2004-01-01

25

Does autophagy mediate age-dependent effect of dietary restriction responses in the filamentous fungus Podospora anserina?  

PubMed

Autophagy is a well-conserved catabolic process, involving the degradation of a cell's own components through the lysosomal/vacuolar machinery. Autophagy is typically induced by nutrient starvation and has a role in nutrient recycling, cellular differentiation, degradation and programmed cell death. Another common response in eukaryotes is the extension of lifespan through dietary restriction (DR). We studied a link between DR and autophagy in the filamentous fungus Podospora anserina, a multicellular model organism for ageing studies and mitochondrial deterioration. While both carbon and nitrogen restriction extends lifespan in P. anserina, the size of the effect varied with the amount and type of restricted nutrient. Natural genetic variation for the DR response exists. Whereas a switch to carbon restriction up to halfway through the lifetime resulted in extreme lifespan extension for wild-type P. anserina, all autophagy-deficient strains had a shorter time window in which ageing could be delayed by DR. Under nitrogen limitation, only PaAtg1 and PaAtg8 mediate the effect of lifespan extension; the other autophagy-deficient mutants PaPspA and PaUth1 had a similar response as wild-type. Our results thus show that the ageing process impinges on the DR response and that this at least in part involves the genetic regulation of autophagy. PMID:24864315

van Diepeningen, Anne D; Engelmoer, Daniël J P; Sellem, Carole H; Huberts, Daphne H E W; Slakhorst, S Marijke; Sainsard-Chanet, Annie; Zwaan, Bas J; Hoekstra, Rolf F; Debets, Alfons J M

2014-07-01

26

Maintaining Two Mating Types: Structure of the Mating Type Locus and Its Role in Heterokaryosis in Podospora anserina.  

PubMed

Pseudo-homothallism is a reproductive strategy elected by some fungi producing heterokaryotic sexual spores containing genetically different but sexually compatible nuclei. This lifestyle appears as a compromise between true homothallism (self-fertility with predominant inbreeding) and complete heterothallism (with exclusive outcrossing). However, pseudohomothallic species face the problem of maintaining heterokaryotic mycelia to fully benefit from this lifestyle, as homokaryons are self-sterile. Here, we report on the structure of chromosome 1 in mat+ and mat- isolates of strain S of the pseudohomothallic fungus Podospora anserina. Chromosome 1 contains either one of the mat+ and mat- mating types of P. anserina, which is mostly found in nature as a mat+/mat- heterokaryotic mycelium harboring sexually compatible nuclei. We identified a "mat" region ?0.8 Mb long, devoid of meiotic recombination and containing the mating-type idiomorphs, which is a candidate to be involved in the maintenance of the heterokaryotic state, since the S mat+ and S mat- strains have different physiology that may enable hybrid-vigor-like phenomena in the heterokaryons. The mat region contains 229 coding sequences. A total of 687 polymorphisms were detected between the S mat+ and S mat- chromosomes. Importantly, the mat region is colinear between both chromosomes, which calls for an original mechanism of recombination inhibition. Microarray analyses revealed that 10% of the P. anserina genes have different transcriptional profiles in S mat+ and S mat-, in line with their different phenotypes. Finally, we show that the heterokaryotic state is faithfully maintained during mycelium growth of P. anserina, yet mat+/mat+ and mat-/mat- heterokaryons are as stable as mat+/mat- ones, evidencing a maintenance of heterokaryosis that does not rely on fitness-enhancing complementation between the S mat+ and S mat- strains. PMID:24558260

Grognet, Pierre; Bidard, Frédérique; Kuchly, Claire; Tong, Laetitia Chan Ho; Coppin, Evelyne; Benkhali, Jinane Ait; Couloux, Arnaud; Wincker, Patrick; Debuchy, Robert; Silar, Philippe

2014-05-01

27

Altering a gene involved in nuclear distribution increases the repeat-induced point mutation process in the fungus Podospora anserina.  

PubMed Central

Repeat-induced point mutation (RIP) is a homology-dependent gene-silencing mechanism that introduces C:G-to-T:A transitions in duplicated DNA segments. Cis-duplicated sequences can also be affected by another mechanism called premeiotic recombination (PR). Both are active over the sexual cycle of some filamentous fungi, e.g., Neurospora crassa and Podospora anserina. During the sexual cycle, several developmental steps require precise nuclear movement and positioning, but connections between RIP, PR, and nuclear distributions have not yet been established. Previous work has led to the isolation of ami1, the P. anserina ortholog of the Aspergillus nidulans apsA gene, which is required for nuclear positioning. We show here that ami1 is involved in nuclear distribution during the sexual cycle and that alteration of ami1 delays the fruiting-body development. We also demonstrate that ami1 alteration affects loss of transgene functions during the sexual cycle. Genetically linked multiple copies of transgenes are affected by RIP and PR much more frequently in an ami1 mutant cross than in a wild-type cross. Our results suggest that the developmental slowdown of the ami1 mutant during the period of RIP and PR increases time exposure to the duplication detection system and thus increases the frequency of RIP and PR.

Bouhouche, Khaled; Zickler, Denise; Debuchy, Robert; Arnaise, Sylvie

2004-01-01

28

DNA sequence, structure, and phylogenetic relationship of the small subunit rRNA coding region of mitochondrial DNA from Podospora anserina  

Microsoft Academic Search

Summary DNA sequence analysis and the localization of the 5? and 3? termini by S1 mapping have shown that the mitochondrial (mt) small subunit rRNA coding region fromPodospora anserina is 1980 bp in length. The analogous coding region for mt rRNA is 1962 bp in maize, 1686 bp inSaccharomyces cerevisiae, and 956 bp in mammals, whereas its counterpart inEscherichia coli

Donald J. Cummings; Joanne M. Domenico; James Nelson; Mitchell L. Sogin

1989-01-01

29

Identification of the het-r vegetative incompatibility gene of Podospora anserina as a member of the fast evolving HNWD gene family  

Microsoft Academic Search

In fungi, vegetative incompatibility is a conspecific non-self recognition mechanism that restricts formation of viable heterokaryons\\u000a when incompatible alleles of specific het loci interact. In Podospora anserina, three non-allelic incompatibility systems have been genetically defined involving interactions between het-c and het-d, het-c and het-e, het-r and het-v. het-d and het-e are paralogues belonging to the HNWD gene family that encode

Damien Chevanne; Eric Bastiaans; Alfons Debets; Sven J. Saupe; Corinne Clavé; Mathieu Paoletti

2009-01-01

30

Biological Roles of the Podospora anserina Mitochondrial Lon Protease and the Importance of Its N-Domain  

PubMed Central

Mitochondria have their own ATP-dependent proteases that maintain the functional state of the organelle. All multicellular eukaryotes, including filamentous fungi, possess the same set of mitochondrial proteases, unlike in unicellular yeasts, where ClpXP, one of the two matricial proteases, is absent. Despite the presence of ClpXP in the filamentous fungus Podospora anserina, deletion of the gene encoding the other matricial protease, PaLon1, leads to lethality at high and low temperatures, indicating that PaLON1 plays a main role in protein quality control. Under normal physiological conditions, the PaLon1 deletion is viable but decreases life span. PaLon1 deletion also leads to defects in two steps during development, ascospore germination and sexual reproduction, which suggests that PaLON1 ensures important regulatory functions during fungal development. Mitochondrial Lon proteases are composed of a central ATPase domain flanked by a large non-catalytic N-domain and a C-terminal protease domain. We found that three mutations in the N-domain of PaLON1 affected fungal life cycle, PaLON1 protein expression and mitochondrial proteolytic activity, which reveals the functional importance of the N-domain of the mitochondrial Lon protease. All PaLon1 mutations affected the C-terminal part of the N-domain. Considering that the C-terminal part is predicted to have an ? helical arrangement in which the number, length and position of the helices are conserved with the solved structure of its bacterial homologs, we propose that this all-helical structure participates in Lon substrate interaction.

Adam, Celine; Picard, Marguerite; Dequard-Chablat, Michelle; Sellem, Carole H.; Denmat, Sylvie Hermann-Le; Contamine, Veronique

2012-01-01

31

Genetic and Functional Investigation of Zn2Cys6 Transcription Factors RSE2 and RSE3 in Podospora anserina  

PubMed Central

In Podospora anserina, the two zinc cluster proteins RSE2 and RSE3 are essential for the expression of the gene encoding the alternative oxidase (aox) when the mitochondrial electron transport chain is impaired. In parallel, they activated the expression of gluconeogenic genes encoding phosphoenolpyruvate carboxykinase (pck) and fructose-1,6-biphosphatase (fbp). Orthologues of these transcription factors are present in a wide range of filamentous fungi, and no other role than the regulation of these three genes has been evidenced so far. In order to better understand the function and the organization of RSE2 and RSE3, we conducted a saturated genetic screen based on the constitutive expression of the aox gene. We identified 10 independent mutations in 9 positions in rse2 and 11 mutations in 5 positions in rse3. Deletions were generated at some of these positions and the effects analyzed. This analysis suggests the presence of central regulatory domains and a C-terminal activation domain in both proteins. Microarray analysis revealed 598 genes that were differentially expressed in the strains containing gain- or loss-of-function mutations in rse2 or rse3. It showed that in addition to aox, fbp, and pck, RSE2 and RSE3 regulate the expression of genes encoding the alternative NADH dehydrogenase, a Zn2Cys6 transcription factor, a flavohemoglobin, and various hydrolases. As a complement to expression data, a metabolome profiling approach revealed that both an rse2 gain-of-function mutation and growth on antimycin result in similar metabolic alterations in amino acids, fatty acids, and ?-ketoglutarate pools.

Bovier, Elodie; Sellem, Carole H.; Humbert, Adeline

2014-01-01

32

Genome-Wide Gene Expression Profiling of Fertilization Competent Mycelium in Opposite Mating Types in the Heterothallic Fungus Podospora anserina  

PubMed Central

Background Mating-type loci in yeasts and ascomycotan filamentous fungi (Pezizomycotina) encode master transcriptional factors that play a critical role in sexual development. Genome-wide analyses of mating-type-specification circuits and mating-type target genes are available in Saccharomyces cerevisiae and Schizosaccharomyces pombe; however, no such analyses have been performed in heterothallic (self-incompatible) Pezizomycotina. The heterothallic fungus Podospora anserina serves as a model for understanding the basic features of mating-type control. Its mat+ and mat? mating types are determined by dissimilar allelic sequences. The mat? sequence contains three genes, designated FMR1, SMR1 and SMR2, while the mat+ sequence contains one gene, FPR1. FMR1 and FPR1 are the major regulators of fertilization, and this study presents a genome-wide view of their target genes and analyzes their target gene regulation. Methodology/Principal Findings The transcriptomic profiles of the mat+ and mat? strains revealed 157 differentially transcribed genes, and transcriptomic analysis of fmr1? and fpr1? mutant strains was used to determine the regulatory actions exerted by FMR1 and FPR1 on these differentially transcribed genes. All possible combinations of transcription repression and/or activation by FMR1 and/or FPR1 were observed. Furthermore, 10 additional mating-type target genes were identified that were up- or down-regulated to the same level in mat+ and mat? strains. Of the 167 genes identified, 32 genes were selected for deletion, which resulted in the identification of two genes essential for the sexual cycle. Interspecies comparisons of mating-type target genes revealed significant numbers of orthologous pairs, although transcriptional profiles were not conserved between species. Conclusions/Significance This study represents the first comprehensive genome-wide analysis of mating-type direct and indirect target genes in a heterothallic filamentous fungus. Mating-type transcription factors have many more target genes than are found in yeasts and exert a much greater diversity of regulatory actions on target genes, most of which are not directly related to mating.

Coppin, Evelyne; Imbeaud, Sandrine; Grognet, Pierre; Delacroix, Herve; Debuchy, Robert

2011-01-01

33

HET-E and HET-D belong to a new subfamily of WD40 proteins involved in vegetative incompatibility specificity in the fungus Podospora anserina.  

PubMed Central

Vegetative incompatibility, which is very common in filamentous fungi, prevents a viable heterokaryotic cell from being formed by the fusion of filaments from two different wild-type strains. Such incompatibility is always the consequence of at least one genetic difference in specific genes (het genes). In Podospora anserina, alleles of the het-e and het-d loci control heterokaryon viability through genetic interactions with alleles of the unlinked het-c locus. The het-d2(Y) gene was isolated and shown to have strong similarity with the previously described het-e1(A) gene. Like the HET-E protein, the HET-D putative protein displayed a GTP-binding domain and seemed to require a minimal number of 11 WD40 repeats to be active in incompatibility. Apart from incompatibility specificity, no other function could be identified by disrupting the het-d gene. Sequence comparison of different het-e alleles suggested that het-e specificity is determined by the sequence of the WD40 repeat domain. In particular, the amino acids present on the upper face of the predicted beta-propeller structure defined by this domain may confer the incompatible interaction specificity.

Espagne, Eric; Balhadere, Pascale; Penin, Marie-Louise; Barreau, Christian; Turcq, Beatrice

2002-01-01

34

The Podospora rmp1 gene implicated in nucleus-mitochondria cross-talk encodes an essential protein whose subcellular location is developmentally regulated.  

PubMed Central

It has been previously reported that, at the time of death, the Podospora anserina AS1-4 mutant strains accumulate specific deleted forms of the mitochondrial genome and that their life spans depend on two natural alleles (variants) of the rmp1 gene: AS1-4 rmp1-2 strains exhibit life spans strikingly longer than those of AS1-4 rmp1-1. Here, we show that rmp1 is an essential gene. In silico analyses of eight rmp1 natural alleles present in Podospora isolates and of the putative homologs of this orphan gene in other filamentous fungi suggest that rmp1 evolves rapidly. The RMP1 protein is localized in the mitochondrial and/or the cytosolic compartment, depending on cell type and developmental stage. Strains producing RMP1 without its mitochondrial targeting peptide are viable but exhibit vegetative and sexual defects.

Contamine, Veronique; Zickler, Denise; Picard, Marguerite

2004-01-01

35

A genome-wide longitudinal transcriptome analysis of the aging model Podospora anserine.  

PubMed

Aging of biological systems is controlled by various processes which have a potential impact on gene expression. Here we report a genome-wide transcriptome analysis of the fungal aging model Podospora anserina. Total RNA of three individuals of defined age were pooled and analyzed by SuperSAGE (serial analysis of gene expression). A bioinformatics analysis identified different molecular pathways to be affected during aging. While the abundance of transcripts linked to ribosomes and to the proteasome quality control system were found to decrease during aging, those associated with autophagy increase, suggesting that autophagy may act as a compensatory quality control pathway. Transcript profiles associated with the energy metabolism including mitochondrial functions were identified to fluctuate during aging. Comparison of wild-type transcripts, which are continuously down-regulated during aging, with those down-regulated in the long-lived, copper-uptake mutant grisea, validated the relevance of age-related changes in cellular copper metabolism. Overall, we (i) present a unique age-related data set of a longitudinal study of the experimental aging model P. anserina which represents a reference resource for future investigations in a variety of organisms, (ii) suggest autophagy to be a key quality control pathway that becomes active once other pathways fail, and (iii) present testable predictions for subsequent experimental investigations. PMID:24376646

Philipp, Oliver; Hamann, Andrea; Servos, Jörg; Werner, Alexandra; Koch, Ina; Osiewacz, Heinz D

2013-01-01

36

Reactive Oxygen Species in Molecular Pathways Controlling Aging in the Filamentous Fungus Podospora anserina  

Microsoft Academic Search

\\u000a To generate ATP via different types of respiration, the impact of reactive oxygen species (ROS) as by-products generated at\\u000a the inner mitochondrial membrane is well analyzed and documented. Moreover, other pathways of ROS generation seem to be of\\u000a relevance, but they are currently less explored. It now seems that ROS not only play a key role in the age-related damaging

Heinz D. Osiewacz; Christian Q. Scheckhuber

37

Identification of six loci in which mutations partially restore peroxisome biogenesis and/or alleviate the metabolic defect of pex2 mutants in podospora.  

PubMed Central

Peroxins (PEX) are proteins required for peroxisome biogenesis. Mutations in PEX genes cause lethal diseases in humans, metabolic defects in yeasts, and developmental disfunctions in plants and filamentous fungi. Here we describe the first large-scale screening for suppressors of a pex mutation. In Podospora anserina, pex2 mutants exhibit a metabolic defect [inability to grow on medium containing oleic acid (OA medium) as sole carbon source] and a developmental defect (inability to differentiate asci in homozygous crosses). Sixty-three mutations able to restore growth of pex2 mutants on OA medium have been analyzed. They fall in six loci (suo1 to suo6) and act as dominant, allele-nonspecific suppressors. Most suo mutations have pleiotropic effects in a pex2(+) background: formation of unripe ascospores (all loci except suo5 and suo6), impaired growth on OA medium (all loci except suo4 and suo6), or sexual defects (suo4). Using immunofluorescence and GFP staining, we show that peroxisome biogenesis is partially restored along with a low level of ascus differentiation in pex2 mutant strains carrying either the suo5 or the suo6 mutations. The data are discussed with respect to beta-oxidation of fatty acids, peroxisome biogenesis, and cell differentiation.

Ruprich-Robert, Gwenael; Berteaux-Lecellier, Veronique; Zickler, Denise; Panvier-Adoutte, Arlette; Picard, Marguerite

2002-01-01

38

Species diversity of hypogeous ascomycetes in Israel.  

PubMed

We conducted a species diversity study of the hypogeous Ascomycetes of Israel. The hypogeous Ascomycetes in Israel include members of the families Pyronemataceae, Pezizaceae, and Tuberaceae, which are represented by seven species: Hydnocystis piligera, Terfezia arenaria, T. claveryi, T. oligosperma, Tirmania africana, Tuber asa, and T. nitidum; only T. asa is new to Israeli mycobiota. Synonymy, locations, collection data, general distribution, distribution in Israel, descriptions, a key to identification, illustrations, and taxonomic remarks are provided. PMID:23956647

Barseghyan, Gayane S; Wasser, Solomon P

2010-09-01

39

Ribosomal control of translational fidelity in Podospora anserina : A suppressor and an antisuppressor affecting the paromomycin-induced misreading in vitro  

Microsoft Academic Search

The hypersensitivity to paromomycin dis played by the su1-60 suppressor, which was thought to be a ribosomal ambiguity mutation, was used to isolate a new antisuppressor, AS71. This antisuppressor is not specific for ribosomal suppressors, since it is able to act on putative tRNA-type suppressors. Compared to the wild-type, the AS7-1 mutation produces an increased resistance to paromomycin. In addition,

E. Coppin-Raynal

1982-01-01

40

A mushroom lectin from ascomycete Cordyceps militaris  

Microsoft Academic Search

A mushroom lectin has been purified from ascomycete Cordyceps militaris, which is one of the most popular mushrooms in eastern Asia used as a nutraceutical and in traditional Chinese medicine. This lectin, designated CML, exhibited hemagglutination activity in mouse and rat erythrocytes, but not in human ABO erythrocytes. SDS-PAGE of CML revealed a single band with a molecular mass of

Eui Cha Jung; Ki Don Kim; Chan Hyung Bae; Ju Cheol Kim; Dae Kyong Kim; Ha Hyung Kim

2007-01-01

41

Phylogenetics of Saccharomycetales, the ascomycete yeasts  

Microsoft Academic Search

Ascomycete yeasts (phylum Ascomycota: subphylum Saccharomycotina: class Saccharomycetes: order Saccharomycetales) comprise a monophyletic lineage with a single order of about 1000 known species. These yeasts live as saprobes, often in association with plants, animals and their interfaces. A few species account for most human mycotic infections, and fewer than 10 species are plant pathogens. Yeasts are responsible for important industrial

Sung-Oui Suh; Meredith Blackwell; Cletus P. Kurtzman; M.-A. Lachance

2006-01-01

42

Hepatoprotective triterpenes from traditional Tibetan medicine Potentilla anserina.  

PubMed

A methanol extract from the tuberous roots of Potentilla anserina (Rosaceae) exhibited hepatoprotective effects against d-galactosamine (d-GalN)/lipopolysaccharide-induced liver injuries in mice. Six triterpene 28-O-monoglucopyranosyl esters, potentillanosides A-F, were isolated from the extract along with 32 known compounds, including 15 triterpenes. The structures of potentillanosides A-F were determined on the basis of spectroscopic properties and chemical evidence. Four ursane-type triterpene 28-O-monoglycosyl esters, potentillanoside A (IC50=46.7?M), 28-O-?-d-glucopyranosyl pomolic acid (IC50=9.5?M), rosamutin (IC50=35.5?M), and kaji-ichigoside F1 (IC50=14.1?M), inhibited d-GalN-induced cytotoxicity in primary cultured mouse hepatocytes. Among these four triterpenes, potentillanoside A, rosamutin, and kaji-ichigoside F1 exhibited in vivo hepatoprotective effects at doses of 50-100mg/kg, p.o. The mode of action was ascribable to the reduction in cytotoxicity caused by d-GalN. PMID:24697904

Morikawa, Toshio; Ninomiya, Kiyofumi; Imura, Katsuya; Yamaguchi, Takahiro; Akagi, Yoshinori; Yoshikawa, Masayuki; Hayakawa, Takao; Muraoka, Osamu

2014-06-01

43

Mitochondrial Intronic Open Reading Frames in Podospora: Mobility and Consecutive Exonic Sequence Variations  

PubMed Central

The mitochondrial genome of 23 wild-type strains belonging to three different species of the filamentous fungus Podospora was examined. Among the 15 optional sequences identified are two intronic reading frames, nad1-i4-orf1 and cox1-i7-orf2. We show that the presence of these sequences was strictly correlated with tightly clustered nucleotide substitutions in the adjacent exon. This correlation applies to the presence or absence of closely related open reading frames (ORFs), found at the same genetic locations, in all the Pyrenomycete genera examined. The recent gain of these optional ORFs in the evolution of the genus Podospora probably account for such sequence differences. In the homoplasmic progeny from heteroplasmons constructed between Podospora strains differing by the presence of these optional ORFs, nad1-i4-orf1 and cox1-i7-orf2 appeared highly invasive. Sequence comparisons in the nad1-i4 intron of various strains of the Pyrenomycete family led us to propose a scenario of its evolution that includes several events of loss and gain of intronic ORFs. These results strongly reinforce the idea that group I intronic ORFs are mobile elements and that their transfer, and comcomitant modification of the adjacent exon, could participate in the modular evolution of mitochondrial genomes.

Sellem, C. H.; d'Aubenton-Carafa, Y.; Rossignol, M.; Belcour, L.

1996-01-01

44

A mushroom lectin from ascomycete Cordyceps militaris.  

PubMed

A mushroom lectin has been purified from ascomycete Cordyceps militaris, which is one of the most popular mushrooms in eastern Asia used as a nutraceutical and in traditional Chinese medicine. This lectin, designated CML, exhibited hemagglutination activity in mouse and rat erythrocytes, but not in human ABO erythrocytes. SDS-PAGE of CML revealed a single band with a molecular mass of 31.0 kDa under both nonreducing and reducing conditions that was stained by silver nitrate, and a 31.4 kDa peak in a Superdex-200 HR gel-filtration column. The hemagglutination activity was inhibited by sialoglycoproteins, but not in by mono- or disaccharides, asialoglycoproteins, or de-O-acetylated glycoprotein. The activity was maximal at pH 6.0-9.1 and at temperatures below 50 degrees C. Circular dichroism spectrum analysis revealed that CML comprises 27% alpha-helix, 12% beta-sheets, 29% beta-turns, and 32% random coils. Its binding specificity and secondary structure are similar to those of a fungal lectin from Arthrobotrys oligospora. However, the N-terminal amino acid sequence of CML differs greatly from those of other lectins. CML exhibits mitogenic activity against mouse splenocytes. PMID:17306462

Jung, Eui Cha; Kim, Ki Don; Bae, Chan Hyung; Kim, Ju Cheol; Kim, Dae Kyong; Kim, Ha Hyung

2007-05-01

45

Phylogenetics of Saccharomycetales, the ascomycete yeasts.  

PubMed

Ascomycete yeasts (phylum Ascomycota: subphylum Saccharomycotina: class Saccharomycetes: order Saccharomycetales) comprise a monophyletic lineage with a single order of about 1000 known species. These yeasts live as saprobes, often in association with plants, animals and their interfaces. A few species account for most human mycotic infections, and fewer than 10 species are plant pathogens. Yeasts are responsible for important industrial and biotechnological processes, including baking, brewing and synthesis of recombinant proteins. Species such as Saccharomyces cerevisiae are model organisms in research, some of which led to a Nobel Prize. Yeasts usually reproduce asexually by budding, and their sexual states are not enclosed in a fruiting body. The group also is well defined by synapomorphies visible at the ultrastructural level. Yeast identification and classification changed dramatically with the availability of DNA sequencing. Species identification now benefits from a constantly updated sequence database and no longer relies on ambiguous growth tests. A phylogeny based on single gene analyses has shown the order to be remarkably divergent despite morphological similarities among members. The limits of many previously described genera are not supported by sequence comparisons, and multigene phylogenetic studies are under way to provide a stable circumscription of genera, families and orders. One recent multigene study has resolved species of the Saccharomycetaceae into genera that differ markedly from those defined by analysis of morphology and growth responses, and similar changes are likely to occur in other branches of the yeast tree as additional sequences become available. PMID:17486976

Suh, Sung-Oui; Blackwell, Meredith; Kurtzman, Cletus P; Lachance, Marc-André

2006-01-01

46

Two new ascomycetes from rainforest litter in Costa Rica  

Microsoft Academic Search

Two new ascomycetes, Boerlagiomyces cost- aricensis (Pleosporales) and Scopinella musciformis (Sordariales sensu lato), from litter samples collected in rainforests of Costa Rica, are described and illustrated. Boerlagiomyces costaricensis has globose, ostiolate ascomata covered by numerous setae-like hairs; cylindrical, fissitunicate asci without apical structures; and large, fusiform, muriform, hyaline to pale brown ascospores. Scopinella musciformis is characterized by ostiolate ascomata with

A. M. Stchigel; L. Umana; J. Guarro; M. Mata

2006-01-01

47

A complete inventory of fungal kinesins in representative filamentous ascomycetes  

Microsoft Academic Search

Complete inventories of kinesins from three pathogenic filamentous ascomycetes, Botryotinia fuckeliana, Cochliobolus heterostrophus, and Gibberella moniliformis, are described. These protein sequences were compared with those of the filamentous saprophyte, Neurospora crassa and the two yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Data mining and phylogenetic analysis of the motor domain yielded a constant set of 10 kinesins in the filamentous fungal

Conrad L. Schoch; James R. Aist; Olen C. Yoder; B. Gillian Turgeona

2003-01-01

48

Catalytic Properties and Classification of Cellobiose Dehydrogenases from Ascomycetes? †  

PubMed Central

Putative cellobiose dehydrogenase (CDH) genes are frequently discovered in various fungi by genome sequencing projects. The expression of CDH, an extracellular flavocytochrome, is well studied in white rot basidiomycetes and is attributed to extracellular lignocellulose degradation. CDH has also been reported for plant-pathogenic or saprotrophic ascomycetes, but the molecular and catalytic properties of these enzymes are currently less investigated. This study links various ascomycetous cdh genes with the molecular and catalytic characteristics of the mature proteins and suggests a differentiation of ascomycete class II CDHs into two subclasses, namely, class IIA and class IIB, in addition to the recently introduced class III of hypothetical ascomycete CDHs. This new classification is based on sequence and biochemical data obtained from sequenced fungal genomes and a screening of 40 ascomycetes. Thirteen strains showed CDH activity when they were grown on cellulose-based media, and Chaetomium atrobrunneum, Corynascus thermophilus, Dichomera saubinetii, Hypoxylon haematostroma, Neurospora crassa, and Stachybotrys bisbyi were selected for detailed studies. In these strains, one or two cdh-encoding genes were found that stem either from class IIA and contain a C-terminal carbohydrate-binding module or from class IIB without such a module. In several strains, both genes were found. Regarding substrate specificity, class IIB CDHs show a less pronounced substrate specificity for cellobiose than class IIA enzymes. A pH-dependent pattern of the intramolecular electron transfer was also observed, and the CDHs were classified into three groups featuring acidic, intermediate, or alkaline pH optima. The pH optimum, however, does not correlate with the CDH subclasses and is most likely a species-dependent adaptation to different habitats.

Harreither, Wolfgang; Sygmund, Christoph; Augustin, Manfred; Narciso, Melanie; Rabinovich, Mikhail L.; Gorton, Lo; Haltrich, Dietmar; Ludwig, Roland

2011-01-01

49

Characterization of a hydrophobin of the ascomycete Paecilomyces farinosus.  

PubMed

The entomopathogenic ascomycete Paecilomyces farinosus (alternative name Isaria farinosa) synthesized a hydrophobin, irrespective of being grown in submerged or surface culture. The protein was extracted using trifluoroacetic acid and purified using preparative HPLC and SDS-PAGE. Partial sequences were obtained using ESI-MS/MS. The peptides were used as a start to apply a 'template switching oligo' protocol to elucidate the complete open reading frame of P. farinosus hydrophobin 1 (pfah1). The deduced protein sequence comprised 107 amino acids (10.7 kDa) including a 16 amino acid long hydrophobic signal peptide, showed a calculated pI of 4.56, and was interrupted by one intron. Phylogenetic analyses revealed relationships to hydrophobins of the ascomycetes Magnaporthe grisea and Metarhizium anisopliae. Based on solubility, hydropathy pattern and phylogeny PfaH1 was assigned to the class Ia hydrophobins. PMID:21656798

Lunkenbein, Stefan; Takenberg, Meike; Nimtz, Manfred; Berger, Ralf G

2011-08-01

50

Larvicidal activity of metabolites from the endophytic Podospora sp. against the malaria vector Anopheles gambiae.  

PubMed

In a screening for natural products with mosquito larvicidal activities, the endophytic fungus Podospora sp. isolated from the plant Laggera alata (Asteraceae) was conspicuous. Two xanthones, sterigmatocystin (1) and secosterigmatocystin (2), and an anthraquinone derivative (3) 13-hydroxyversicolorin B were isolated after fermentation on M(2) medium. These compounds were characterised using spectroscopic and X-ray analysis and examined against third instar larvae of Anopheles gambiae. The results demonstrated that compound 1 was the most potent one with LC(50) and LC(90) values of 13.3 and 73.5 ppm, respectively. Over 95% mortality was observed at a concentration 100 ppm after 24 h. These results compared farvorably with the commercial larvicide pylarvex® that showed 100% mortality at the same concentration. Compound 3 was less potent and had an LC(50) of 294.5 ppm and over 95% mortality was achieved at a concentration of 1,000 ppm. Secosterigmatocystin (2) revealed relatively weak activity and therefore LC values were not determined. PMID:20922412

Matasyoh, Josphat C; Dittrich, Birger; Schueffler, Anja; Laatsch, Hartmut

2011-03-01

51

Two new ascomycetes from rainforest litter in Costa Rica.  

PubMed

Two new ascomycetes, Boerlagiomyces costaricensis (Pleosporales) and Scopinella musciformis (Sordariales sensu lato), from litter samples collected in rainforests of Costa Rica, are described and illustrated. Boerlagiomyces costaricensis has globose, ostiolate ascomata covered by numerous setae-like hairs; cylindrical, fissitunicate asci without apical structures; and large, fusiform, muriform, hyaline to pale brown ascospores. Scopinella musciformis is characterized by ostiolate ascomata with a few compact clusters of hypha-like hairs distributed on the peridial surface and a long neck; ovate to ellipsoidal unitunicate asci; and small quadrangular ascospores with diagonal germ slits. PMID:17256584

Stchigel, A M; Umaña, L; Guarro, J; Mata, M

2006-01-01

52

Apiosordaria antarctica and Thielavia antarctica, two new ascomycetes from Antarctica.  

PubMed

Two new species of ascomycetes, Apiosordaria antarctica, isolated from soil, and Thielavia antarctica, isolated from a sample of the lichen Usnea cf. aurantio-atra, both collected on King George Island (Antarctica), are described and illustrated. Apiosordaria antarctica is characterized by ostiolate ascomata with agglutinated hairs, eight-spored, uniseriate and cylindrical asci, and two-celled, irregularly navicular ascospores, with an upper cell ornamented with very small warts and with an apical germ pore. Thielavia antarctica is characterized by nonostiolate ascomata, with a thick peridium, eight-spored, cylindrical asci, uniseriate, oblate, ovoid ascospores, a slightly protruding apical germ pore, and a phialidic anamorph. PMID:21149023

Stchigel, Alberto M; Guarro, Josep; Mac Cormack, Walter

2003-01-01

53

Relative incidence of ascomycetous yeasts in arctic coastal environments.  

PubMed

Previous studies of fungi in polar environments have revealed a prevalence of basidiomycetous yeasts in soil and in subglacial environments of polythermal glaciers. Ascomycetous yeasts have rarely been reported from extremely cold natural environments, even though they are known contaminants of frozen foods. Using media with low water activity, we have isolated various yeast species from the subglacial ice of four glaciers from the coastal Arctic environment of Kongsfjorden, Spitzbergen, including Debaryomyces hansenii and Pichia guillermondii, with counts reaching 10(4) CFU L(-1). Together with the basidiomycetes Cryptococcus liquefaciens and Rhodotorula mucilaginosa, these yeasts represent the stable core of the subglacial yeast communities. Other glacial ascomycetous species isolated included Candida parapsilosis and a putative new species that resembles Candida pseudorugosa. The archiascomycete Protomyces inouyei has seldom been detected anywhere in the world but was here recovered from ice in a glacier cave. The glacier meltwater contained only D. hansenii, whereas the seawater contained D. hansenii, Debaryomyces maramus, Pichia guilliermondii, what appears to represent a novel species resembling Candida galli and Metschnikowia bicuspidata. Only P. guilliermondii was isolated from sea ice, while snow/ice in the fjord tidal zone included C. parapsilosis, D. hansenii, P. guilliermondii and Metschnikowia zobellii. All of these isolated strains were characterized as psychrotolerant and xero/halotolerant, with the exception of P. inouyei. PMID:21221569

Butinar, Lorena; Strmole, Tadeja; Gunde-Cimerman, Nina

2011-05-01

54

Conservation of PHO pathway in ascomycetes and the role of Pho84.  

PubMed

In budding yeast, Saccharomyces cerevisiae, the phosphate signalling and response pathway, known as PHO pathway, monitors phosphate cytoplasmic levels by controlling genes involved in scavenging, uptake and utilization of phosphate. Recent attempts to understand the phosphate starvation response in other ascomycetes have suggested the existence of both common and novel components of the budding yeast PHO pathway in these ascomycetes. In this review, we discuss the components of PHO pathway, their roles in maintaining phosphate homeostasis in yeast and their conservation across ascomycetes. The role of high-affinity transporter, Pho84, in sensing and signalling of phosphate has also been discussed. PMID:24845516

Tomar, Parul; Sinha, Himanshu

2014-06-01

55

A complete inventory of fungal kinesins in representative filamentous ascomycetes.  

PubMed

Complete inventories of kinesins from three pathogenic filamentous ascomycetes, Botryotinia fuckeliana, Cochliobolus heterostrophus, and Gibberella moniliformis, are described. These protein sequences were compared with those of the filamentous saprophyte, Neurospora crassa and the two yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Data mining and phylogenetic analysis of the motor domain yielded a constant set of 10 kinesins in the filamentous fungal species, compared with a smaller set in S. cerevisiae and S. pombe. The filamentous fungal kinesins fell into nine subfamilies when compared with well-characterized kinesins from other eukaryotes. A few putative kinesins (one in B. fuckeliana and two in C. heterostrophus) could not be defined as functional, due to unorthodox organization and lack of experimental data. The broad representation of filamentous fungal kinesins across most of the known subfamilies and the ease of gene manipulation make fungi ideal models for functional and evolutionary investigation of these proteins. PMID:12742059

Schoch, Conrad L; Aist, James R; Yoder, Olen C; Gillian Turgeon, B

2003-06-01

56

Eisosome Organization in the Filamentous AscomyceteAspergillus nidulans?†  

PubMed Central

Eisosomes are subcortical organelles implicated in endocytosis and have hitherto been described only in Saccharomyces cerevisiae. They comprise two homologue proteins, Pil1 and Lsp1, which colocalize with the transmembrane protein Sur7. These proteins are universally conserved in the ascomycetes. We identify in Aspergillus nidulans (and in all members of the subphylum Pezizomycotina) two homologues of Pil1/Lsp1, PilA and PilB, originating from a duplication independent from that extant in the subphylum Saccharomycotina. In the aspergilli there are several Sur7-like proteins in each species, including one strict Sur7 orthologue (SurG in A. nidulans). In A. nidulans conidiospores, but not in hyphae, the three proteins colocalize at the cell cortex and form tightly packed punctate structures that appear different from the clearly distinct eisosome patches observed in S. cerevisiae. These structures are assembled late during the maturation of conidia. In mycelia, punctate structures are present, but they are composed only of PilA, while PilB is diffused in the cytoplasm and SurG is located in vacuoles and endosomes. Deletion of each of the genes does not lead to any obvious growth phenotype, except for moderate resistance to itraconazole. We could not find any obvious association between mycelial (PilA) eisosome-like structures and endocytosis. PilA and SurG are necessary for conidial eisosome organization in ways that differ from those for their S. cerevisiae homologues. These data illustrate that conservation of eisosomal proteins within the ascomycetes is accompanied by a striking functional divergence.

Vangelatos, Ioannis; Roumelioti, Katerina; Gournas, Christos; Suarez, Teresa; Scazzocchio, Claudio; Sophianopoulou, Vicky

2010-01-01

57

Assessment of differences in ascomycete communities in the rhizosphere of field-grown wheat and potato.  

PubMed

To assess effects of plant crop species on rhizosphere ascomycete communities in the field, we compared a wheat monoculture and an alternating crop rotation of wheat and potato. Rhizosphere soil samples were taken at different time points during the growing season in four consecutive years (1999-2002). An ascomycete-specific primer pair (ITS5-ITS4A) was used to amplify internal transcribed spacer (ITS) sequences from total DNA extracts from rhizosphere soil. Amplified DNA was analyzed by denaturing gradient gel electrophoresis (DGGE). Individual bands from DGGE gels were sequenced and compared with known sequences from public databases. DGGE gels representing the ascomycete communities of the continuous wheat and the rotation site were compared and related to ascomycetes identified from the field. The effect of crop rotation exceeded that of the spatial heterogeneity in the field, which was evident after the first year. Significant differences between the ascomycete communities from the rhizospheres of wheat in monoculture and one year after a potato crop were found, indicating a long-term effect of potato. Sequencing of bands excised from the DGGE gels revealed the presence of ascomycetes that are common in agricultural soils. PMID:16329944

Viebahn, Mareike; Veenman, Christiaan; Wernars, Karel; van Loon, Leendert C; Smit, Eric; Bakker, Peter A H M

2005-07-01

58

A novel class of peptide pheromone precursors in ascomycetous fungi  

PubMed Central

Recently, sexual development in the heterothallic ascomycete Trichoderma reesei (anamorph of Hypocrea jecorina) has been achieved and thus initiated attempts to elucidate regulation and determinants of this process. While the ?-type pheromone of this fungus fits the consensus known from other fungi, the assumed a-type peptide pheromone precursor shows remarkably unusual characteristics: it comprises three copies of the motif (LI)GC(TS)VM thus constituting a CAAX domain at the C-terminus and two Kex2-protease sites. This structure shares characteristics of both a- and ?-type peptide pheromone precursors. Presence of hybrid-type peptide pheromone precursor 1 (hpp1) is essential for male fertility, thus indicating its functionality as a peptide pheromone precursor, while its phosphorylation site is not relevant for this process. However, sexual development in a female fertile background is not perturbed in the absence of hpp1, which rules out a higher order function in this process. Open reading frames encoding proteins with similar characteristics to HPP1 were also found in Fusarium spp., of which Fusarium solani still retains a putative a-factor-like protein, but so far in no other fungal genome available. We therefore propose the novel class of h-type (hybrid) peptide pheromone precursors with H. jecorina HPP1 as the first member of this class.

Schmoll, Monika; Seibel, Christian; Tisch, Doris; Dorrer, Marcel; Kubicek, Christian P

2010-01-01

59

Different growth and physiological responses to experimental warming of two dominant plant species Elymus nutans and Potentilla anserina in an alpine meadow of the eastern Tibetan Plateau  

Microsoft Academic Search

The effects of experimental warming on the growth and physiology of grass Elymus nutans and forb Potentilla anserina were studied by using open-top chambers (OTCs) in an alpine meadow of the eastern Tibetan Plateau. The warming treatment\\u000a increased mean air and soil surface temperatures by 1.53°C and 0.50°C, respectively, but it reduced soil relative water content\\u000a in the surface layer.

F. S. Shi; Y. Wu; N. Wu; P. Luo

2010-01-01

60

Origin and distribution of epipolythiodioxopiperazine (ETP) gene clusters in filamentous ascomycetes  

PubMed Central

Background Genes responsible for biosynthesis of fungal secondary metabolites are usually tightly clustered in the genome and co-regulated with metabolite production. Epipolythiodioxopiperazines (ETPs) are a class of secondary metabolite toxins produced by disparate ascomycete fungi and implicated in several animal and plant diseases. Gene clusters responsible for their production have previously been defined in only two fungi. Fungal genome sequence data have been surveyed for the presence of putative ETP clusters and cluster data have been generated from several fungal taxa where genome sequences are not available. Phylogenetic analysis of cluster genes has been used to investigate the assembly and heredity of these gene clusters. Results Putative ETP gene clusters are present in 14 ascomycete taxa, but absent in numerous other ascomycetes examined. These clusters are discontinuously distributed in ascomycete lineages. Gene content is not absolutely fixed, however, common genes are identified and phylogenies of six of these are separately inferred. In each phylogeny almost all cluster genes form monophyletic clades with non-cluster fungal paralogues being the nearest outgroups. This relatedness of cluster genes suggests that a progenitor ETP gene cluster assembled within an ancestral taxon. Within each of the cluster clades, the cluster genes group together in consistent subclades, however, these relationships do not always reflect the phylogeny of ascomycetes. Micro-synteny of several of the genes within the clusters provides further support for these subclades. Conclusion ETP gene clusters appear to have a single origin and have been inherited relatively intact rather than assembling independently in the different ascomycete lineages. This progenitor cluster has given rise to a small number of distinct phylogenetic classes of clusters that are represented in a discontinuous pattern throughout ascomycetes. The disjunct heredity of these clusters is discussed with consideration to multiple instances of independent cluster loss and lateral transfer of gene clusters between lineages.

Patron, Nicola J; Waller, Ross F; Cozijnsen, Anton J; Straney, David C; Gardiner, Donald M; Nierman, William C; Howlett, Barbara J

2007-01-01

61

Self/nonself recognition in Tuber melanosporum is not mediated by a heterokaryon incompatibility system.  

PubMed

Vegetative incompatibility is a widespread phenomenon in filamentous ascomycetes, which limits formation of viable heterokaryons. Whether this phenomenon plays a role in maintaining the homokaryotic state of the hyphae during the vegetative growth of Tuber spp. Gene expression, polymorphism analysis as well as targeted in vitro experiments allowed us to test whether a heterokaryon incompatibility (HI) system operates in Tuber melanosporum. HI is controlled by different genetic systems, often involving HET domain genes and their partners whose interaction can trigger a cell death reaction. Putative homologues to HI-related genes previously characterized in Neurospora crassa and Podospora anserina were identified in the T. melanosporum genome. However, only two HET domain genes were found. In many other ascomycetes HET domains have been found within different genes including some members of the NWD (NACHT and WD-repeat associated domains) gene family of P. anserina. More than 50 NWD homologues were found in T. melanosporum but none of these contain a HET domain. All these T. melanosporum paralogs showed a conserved gene organization similar to the microexon genes only recently characterized in Schistosoma mansoni. Expression data of the annotated HI-like genes along with low allelic polymorphism suggest that they have cellular functions unrelated to HI. Moreover, morphological analyses did not provide evidence for HI reactions between pairs of genetically different T. melanosporum strains. Thus, the maintenance of the genetic integrity during the vegetative growth of this species likely depends on mechanisms that act before hyphal fusion. PMID:22289772

Iotti, Mirco; Rubini, Andrea; Tisserant, Emilie; Kholer, Annegret; Paolocci, Francesco; Zambonelli, Alessandra

2012-02-01

62

An attempt to establish a model for the rhythmic phenomena affecting the growth or sporulation of certain fungi.  

PubMed

A simple two-variable mathematical model is proposed, able to acount for periodic variations relating to growth in Podospora anserina and fructification in Aspergillus niger. This basic model is open to generalization. PMID:520098

Hyver, C; Jerebzoff, S; Nguyen, V H

1979-01-01

63

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.  

PubMed

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events. PMID:21966247

Pöggeler, Stefanie

2011-04-01

64

Evolution of Multicopper Oxidase Genes in Coprophilous and Non-Coprophilous Members of the Order Sordariales  

PubMed Central

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

Poggeler, Stefanie

2011-01-01

65

Genomic Exploration of the Hemiascomycetous Yeasts: 19. Ascomycetes-specific genes  

Microsoft Academic Search

Comparisons of the 6213 predicted Saccharomyces cerevisiae open reading frame (ORF) products with sequences from organisms of other biological phyla differentiate genes commonly conserved in evolution from ‘maverick’ genes which have no homologue in phyla other than the Ascomycetes. We show that a majority of the ‘maverick’ genes have homologues among other yeast species and thus define a set of

Alain Malpertuy; Fredj Tekaia; Serge Casarégola; Michel Aigle; Francois Artiguenave; Gaëlle Blandin; Monique Bolotin-Fukuhara; Elisabeth Bon; Philippe Brottier; Jacky de Montigny; Pascal Durrens; Claude Gaillardin; Andrée Lépingle; Bertrand Llorente; Cécile Neuvéglise; Odile Ozier-Kalogeropoulos; Serge Potier; William Saurin; Claire Toffano-Nioche; Micheline Wésolowski-Louvel; Patrick Wincker; Jean Weissenbach; Jean-Luc Souciet; Bernard Dujon

2000-01-01

66

Catabolism of benzene compounds by ascomycetous and basidiomycetous yeasts and yeastlike fungi  

Microsoft Academic Search

A literature review is given on growth of yeasts on benzene compounds and on the catabolic pathways involved. Additionally, a yeast collection was screened for assimilation of phenol and 3-hydroxybenzoic acid. Fifteen ascomycetous and thirteen basidiomycetous yeast species were selected and were tested for growth on 84 benzene compounds. It appeared that 63 of these compounds supported growth of one

Wouter J. Middelhoven; Hesselink van Suchtelenweg

1993-01-01

67

Xylactam, a new nitrogen-containing compound from the fruiting bodies of ascomycete Xylaria euglossa.  

PubMed

A novel nitrogen-containing compound, named xylactam (1), was isolated from the fruiting bodies of ascomycete Xylaria euglossa together with two known compounds penochalasin B2 and neoechinulin A. Their structures were elucidated on the basis of spectral data. PMID:15981413

Wang, Xing-Na; Tan, Ren-Xiang; Liu, Ji-Kai

2005-04-01

68

New insights into the ligninolytic capability of a wood decay ascomycete.  

PubMed

Wood-grown cultures of Daldinia concentrica oxidized a permethylated beta-(14)C-labeled synthetic lignin to (14)CO(2) and also cleaved a permethylated alpha-(13)C-labeled synthetic lignin to give C(alpha)-C(beta) cleavage products that were detected by (13)C nuclear magnetic resonance spectrometry. Therefore, this ascomycete resembles white-rot basidiomycetes in attacking the recalcitrant nonphenolic structures that predominate in lignin. PMID:17766457

Shary, Semarjit; Ralph, Sally A; Hammel, Kenneth E

2007-10-01

69

Helvellisin, a novel alkaline protease from the wild ascomycete mushroom Helvella lacunosa  

Microsoft Academic Search

A 33.5-kDa serine protease designated as helvellisin was isolated from dried fruiting bodies of the wild ascomycete mushroom Helvella lacunosa. It was purified by using a procedure which entailed ion exchange chromatography on DEAE-cellulose, CM-Sepharose, Q-Sepharose, and FPLC-gel filtration on Superdex 75. The protease was characterized by unique N-terminal amino acid sequence, thermostability and pH stability. The protease exhibited a

Guoqing Zhang; Hexiang Wang; Xiaoqing Zhang; TziBun Ng

2010-01-01

70

Low pH dye decolorization with ascomycete Lamprospora wrightii laccase.  

PubMed

In a screening of saprotrophic, ectomycorrhizal and plant pathogen ascomycetes a frequent occurrence of laccase was observed. Lamprospora wrightii, the best producing organism, was chosen to elucidate the properties of a laccase from a moss-associated, saprotrophic ascomycete. The expression of laccase by this bryophilic fungus could be increased by the addition of tomato juice or copper sulfate to the medium. The obtained volumetric activity after optimization was 420 U/mL in either shaking flask or bioreactor-based cultivations. The purified laccase has a molecular mass of 68 kDa and an isoelectric point of 3.4. Although of ascomycete origin, its catalytic properties are similar to typical basidiomycte laccases, and an excellent activity and stability was observed at low pH, which makes it suitable for bioremediation in acidic environments. As an example, the decolorization reactions of azo-, anthraquinone-, trimethylmethane- and indigoid dyes at pH 3.0 and 5.0 were investigated. All ten selected dyes were decolorized, five of them very efficiently. Depending on the dye, the decolorization was found to be a combination of two reactions, degradation of the chromophore and formation of polymerized products, which contributed to the overall process in a dye-specific pattern. PMID:20652905

Mueangtoom, Kitti; Kittl, Roman; Mann, Oliver; Haltrich, Dietmar; Ludwig, Roland

2010-08-01

71

Mitochondrial RNase P RNAs in ascomycete fungi: Lineage-specific variations in RNA secondary structure  

PubMed Central

The RNA subunit of mitochondrial RNase P (mtP-RNA) is encoded by a mitochondrial gene (rnpB) in several ascomycete fungi and in the protists Reclinomonas americana and Nephroselmis olivacea. By searching for universally conserved structural elements, we have identified previously unknown rnpB genes in the mitochondrial DNAs (mtDNAs) of two fission yeasts, Schizosaccharomyces pombe and Schizosaccharomyces octosporus; in the budding yeast Pichia canadensis; and in the archiascomycete Taphrina deformans. The expression of mtP-RNAs of the predicted size was experimentally confirmed in the two fission yeasts, and their precise 5? and 3? ends were determined by sequencing of cDNAs generated from circularized mtP-RNAs. Comparative RNA secondary structure modeling shows that in contrast to mtP-RNAs of the two protists R. americana and N. olivacea, those of ascomycete fungi all have highly reduced secondary structures. In certain budding yeasts, such as Saccharomycopsis fibuligera, we find only the two most conserved pairings, P1 and P4. A P18 pairing is conserved in Saccharomyces cerevisiae and its close relatives, whereas nearly half of the minimum bacterial consensus structure is retained in the RNAs of fission yeasts, Aspergillus nidulans and Taphrina deformans. The evolutionary implications of the reduction of mtP-RNA structures in ascomycetes will be discussed.

SEIF, ELIAS R.; FORGET, LISE; MARTIN, NANCY C.; LANG, B. FRANZ

2003-01-01

72

The Potential for pathogenicity was present in the ancestor of the Ascomycete subphylum Pezizomycotina  

PubMed Central

Background Previous studies in Ascomycetes have shown that the function of gene families of which the size is considerably larger in extant pathogens than in non-pathogens could be related to pathogenicity traits. However, by only comparing gene inventories in extant species, no insights can be gained into the evolutionary process that gave rise to these larger family sizes in pathogens. Moreover, most studies which consider gene families in extant species only tend to explain observed differences in gene family sizes by gains rather than by losses, hereby largely underestimating the impact of gene loss during genome evolution. Results In our study we used a selection of recently published genomes of Ascomycetes to analyze how gene family gains, duplications and losses have affected the origin of pathogenic traits. By analyzing the evolutionary history of gene families we found that most gene families with an enlarged size in pathogens were present in an ancestor common to both pathogens and non-pathogens. The majority of these families were selectively maintained in pathogenic lineages, but disappeared in non-pathogens. Non-pathogen-specific losses largely outnumbered pathogen-specific losses. Conclusions We conclude that most of the proteins for pathogenicity were already present in the ancestor of the Ascomycete lineages we used in our study. Species that did not develop pathogenicity seemed to have reduced their genetic complexity compared to their ancestors. We further show that expansion of gained or already existing families in a species-specific way is important to fine-tune the specificities of the pathogenic host-fungus interaction.

2010-01-01

73

Agrobacterium -mediated gene transfer and enhanced green fluorescent protein visualization in the mycorrhizal ascomycete Tuber borchii : a first step towards truffle genetics  

Microsoft Academic Search

Mycorrhizal ascomycetes are ecologically and commercially important fungi that have proved impervious to genetic transformation so far. We report here on the successful transient transformation of Tuber borchii, an ectomycorrhizal ascomycete that colonizes a variety of trees and produces highly prized hypogeous fruitbodies known as “truffles”. A hypervirulent Agrobacterium tumefaciens strain bearing the binary plasmid pBGgHg was used for transformation.

Benedetto Grimaldi; Michiel A. de Raaf; Patrizia Filetici; Simone Ottonello; Paola Ballario

2005-01-01

74

Two new for science species of genus Cordyceps fr. (Ascomycetes) from Indian Himalaya.  

PubMed

Two new species for science, Cordyceps kurijimeaensis and C. nirtolii (Clavicipitaceae, Ascomycetes), collected from the forests of the Munsyari Region of the Himalayan hills (Uttarakhand State, India) are described and illustrated. C. kurijimeaensis has the same host, larvae of Hepialus armoricanus, as does Cordyceps (=Ophiocordyceps) sinensis, and C. nirtolii was found on Melanotus communis. Morphology and other diagnostic characteristics show a close relationship between C. kurijimeaensis and C. nirtolii. ITS sequences show a close phylogenetic relationship with members of Clavicipitaceae clade C, strongly supporting the classification of these as new species. PMID:23510219

Negi, Prem Singh; Singh, Ranjit; Koranga, Prithviraj Singh; Ahmed, Zakwan

2012-01-01

75

Sterol composition of mycelia of the plant pathogenic ascomycete Leptosphaeria maculans.  

PubMed

Analysis of sterols in mycelia of the ascomycete, Leptosphaeria maculans by gas chromatography-mass spectrometry revealed that ergosterol comprised 95% of the total sterols, with eight other sterols comprising the remaining 5%. Six of these latter sterols were putative precursors of ergosterol and their presence suggested a pathway for ergosterol biosynthesis in this fungus. Ergosterol biosynthesis in fungi is inhibited by the triazole antifungal agent flutriafol. When L. maculans was grown in the presence of flutriafol, ergosterol content decreased while two 14 alpha-methylated sterols, 24-methylene dihydrolanosterol and obtusifoliol, accumulated. PMID:12482449

Griffiths, K M; Bacic, A; Howlett, B J

2003-01-01

76

New species and new records of freshwater ascomycetes from Brazil and Costa Rica.  

PubMed

During independent surveys for freshwater ascomycetes in Brazil and Costa Rica, two new species, Torrentispora pilosa and Vertexicola ascoliberatus, and nine previously described species were recovered. Among the described species, Annulatascus biatriisporus, Anthostomella aquatica, Tamsiniella labiosa and Torrentispora crassiparietis are reported for the first time from the western hemisphere, Aniptodera chesapeakensis, Chaetosphaeria lignomollis and Jahnula seychellensis are new records for South America and Annulatascus velatisporus and Ophioceras venezuelensis are reported for the first time for Brazil. The description of the genus Torrentispora is emended to accommodate T. pilosa. The new species are described and illustrated and a brief description is provided for all new records. PMID:23080025

Barbosa, Flavia R; Gusmão, Luis F P; Raja, Huzefa A; Shearer, Carol A

2013-01-01

77

Freshwater ascomycetes: new and noteworthy species from aquatic habitats in Florida.  

PubMed

As part of a distributional study of freshwater ascomycetes in Florida, a number of new taxa were encountered. The new taxa include six Sordariomycetes, Aniptodera megaloascocarpa sp. nov., Flammispora pulchra sp. nov., Hanliniomyces hyaloapicalis gen. et sp. nov., Lockerbia striata sp. nov., Phomatospora triseptata sp. nov. and Physalospora limnetica sp. nov., and three Dothideomycetes, Caryospora obclavata sp. nov., Lepidopterella tangerina sp. nov. and Ophiobolus shoemakeri sp. nov. These taxa are described and illustrated. Six additional species are reported from Florida for the first time; among them, two species are new reports from freshwater habitats. PMID:18751554

Raja, Huzefa A; Shearer, Carol A

2008-01-01

78

Autochthonous ascomycetes in depollution of polychlorinated biphenyls contaminated soil and sediment.  

PubMed

We investigated the capacity of a consortium of ascomycetous strains, Doratomyces nanus, Doratomyces purpureofuscus, Doratomyces verrucisporus, Myceliophthora thermophila, Phoma eupyrena and Thermoascus crustaceus in the mycoremediation of historically contaminated soil and sediment by polychlorinated biphenyls (PCBs). Analyses of 15 PCB concentrations in three mesocosms containing soil from which the fungal strains had previously been isolated, revealed significant PCB depletions of 16.9% for the 6 indicator PCBs (i-PCBs) and 18.7% for the total 15 PCBs analyzed after 6months treatment. The degradation rate did not statistically vary whether the soil had been treated with non-inoculated straw or colonized straw or without straw and inoculated with the consortium of the six strains. Concerning the sediment, we evidenced significant depletions of 31.8% for the 6 i-PCBs and 33.3% for the 15 PCB congeners. The PCB depletions affected most of the 15 PCBs analyzed without preference for lower chlorinated congeners. Bioaugmented strains were evidenced in different mesocosms, but their reintroduction, after six months treatment, did not improve the rate of PCB degradation, suggesting that the biodegradation could affect the bioavailable PCB fraction. Our results demonstrate that the ascomycetous strains potentially adapted to PCBs may be propitious to the remediation of PCB contaminated sites. PMID:24880600

Sage, Lucile; Périgon, Sophie; Faure, Mathieu; Gaignaire, Carole; Abdelghafour, Mohamed; Mehu, Jacques; Geremia, Roberto A; Mouhamadou, Bello

2014-09-01

79

Conservation and evolution of cis-regulatory systems in ascomycete fungi  

SciTech Connect

Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in related species as well, we performed similar analyses on orthologs of coregulated S. cerevisiae genes in 13 other ascomycete species. We find that many species-specific gene groups are enriched for the same flanking regulatory sequences as those found in the orthologous gene groups from S. cerevisiae, indicating that those regulatory systems have been conserved in multiple ascomycete species. In addition to these clear cases of regulatory conservation, we find examples of cis-element evolution that suggest multiple modes of regulatory diversification, including alterations in transcription factor-binding specificity, incorporation of new gene targets into an existing regulatory system, and cooption of regulatory systems to control a different set of genes. We investigated one example in greater detail by measuring the in vitro activity of the S. cerevisiae transcription factor Rpn4p and its orthologs from Candida albicans and Neurospora crassa. Our results suggest that the DNA binding specificity of these proteins has coevolved with the sequences found upstream of the Rpn4p target genes and suggest that Rpn4p has a different function in N. crassa.

Gasch, Audrey P.; Moses, Alan M.; Chiang, Derek Y.; Fraser, Hunter B.; Berardini, Mark; Eisen, Michael B.

2004-03-15

80

The filamentous ascomycete Sordaria macrospora can survive in ambient air without carbonic anhydrases.  

PubMed

The rapid interconversion of carbon dioxide and bicarbonate (hydrogen carbonate) is catalysed by metalloenzymes termed carbonic anhydrases (CAs). CAs have been identified in all three domains of life and can be divided into five evolutionarily unrelated classes (?, ?, ?, ? and??) that do not share significant sequence similarities. The function of the mammalian, prokaryotic and plant ?-CAs has been intensively studied but the function of CAs in filamentous ascomycetes is mostly unknown. The filamentous ascomycete Sordaria macrospora codes for four CAs, three of the ?-class and one of the ?-class. Here, we present a functional analysis of CAS4, the S. macrospora ?-class CA. The CAS4 protein was post-translationally glycosylated and secreted. The knockout strain ?cas4 had a significantly reduced rate of ascospore germination. To determine the cas genes required for S.?macrospora growth under ambient air conditions, we constructed double and triple mutations of the four cas genes in all possible combinations and a quadruple mutant. Vegetative growth rate of the quadruple mutant lacking all cas genes was drastically reduced compared to the wild type and invaded the agar under normal air conditions. Likewise the fruiting bodies were embedded in the agar and completely devoid of mature ascospores. PMID:24720701

Lehneck, Ronny; Elleuche, Skander; Pöggeler, Stefanie

2014-06-01

81

Conservation and Evolution of Cis-Regulatory Systems in Ascomycete Fungi  

PubMed Central

Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in related species as well, we performed similar analyses on orthologs of coregulated S. cerevisiae genes in 13 other ascomycete species. We find that many species-specific gene groups are enriched for the same flanking regulatory sequences as those found in the orthologous gene groups from S. cerevisiae, indicating that those regulatory systems have been conserved in multiple ascomycete species. In addition to these clear cases of regulatory conservation, we find examples of cis-element evolution that suggest multiple modes of regulatory diversification, including alterations in transcription factor-binding specificity, incorporation of new gene targets into an existing regulatory system, and cooption of regulatory systems to control a different set of genes. We investigated one example in greater detail by measuring the in vitro activity of the S. cerevisiae transcription factor Rpn4p and its orthologs from Candida albicans and Neurospora crassa. Our results suggest that the DNA binding specificity of these proteins has coevolved with the sequences found upstream of the Rpn4p target genes and suggest that Rpn4p has a different function in N. crassa.

2004-01-01

82

A novel mode of chromosomal evolution peculiar to filamentous Ascomycete fungi  

PubMed Central

Background Gene loss, inversions, translocations, and other chromosomal rearrangements vary among species, resulting in different rates of structural genome evolution. Major chromosomal rearrangements are rare in most eukaryotes, giving large regions with the same genes in the same order and orientation across species. These regions of macrosynteny have been very useful for locating homologous genes in different species and to guide the assembly of genome sequences. Previous analyses in the fungi have indicated that macrosynteny is rare; instead, comparisons across species show no synteny or only microsyntenic regions encompassing usually five or fewer genes. To test the hypothesis that chromosomal evolution is different in the fungi compared to other eukaryotes, synteny was compared between species of the major fungal taxa. Results These analyses identified a novel form of evolution in which genes are conserved within homologous chromosomes, but with randomized orders and orientations. This mode of evolution is designated mesosynteny, to differentiate it from micro- and macrosynteny seen in other organisms. Mesosynteny is an alternative evolutionary pathway very different from macrosyntenic conservation. Surprisingly, mesosynteny was not found in all fungal groups. Instead, mesosynteny appears to be restricted to filamentous Ascomycetes and was most striking between species in the Dothideomycetes. Conclusions The existence of mesosynteny between relatively distantly related Ascomycetes could be explained by a high frequency of chromosomal inversions, but translocations must be extremely rare. The mechanism for this phenomenon is not known, but presumably involves generation of frequent inversions during meiosis.

2011-01-01

83

Explosively launched spores of ascomycete fungi have drag-minimizing shapes  

PubMed Central

The forcibly launched spores of ascomycete fungi must eject through several millimeters of nearly still air surrounding fruiting bodies to reach dispersive air flows. Because of their microscopic size, spores experience great fluid drag, and although this drag can aid transport by slowing sedimentation out of dispersive air flows, it also causes spores to decelerate rapidly after launch. We hypothesize that spores are shaped to maximize their range in the nearly still air surrounding fruiting bodies. To test this hypothesis we numerically calculate optimal spore shapes—shapes of minimum drag for prescribed volumes—and compare these shapes with real spore shapes taken from a phylogeny of >100 species. Our analysis shows that spores are constrained to remain within 1% of the minimum possible drag for their size. From the spore shapes we predict the speed of spore launch, and confirm this prediction through high-speed imaging of ejection in Neurospora tetrasperma. By reconstructing the evolutionary history of spore shapes within a single ascomycete family we measure the relative contributions of drag minimization and other shape determinants to spore shape evolution. Our study uses biomechanical optimization as an organizing principle for explaining shape in a mega-diverse group of species and provides a framework for future measurements of the forces of selection toward physical optima.

Roper, Marcus; Pepper, Rachel E.; Brenner, Michael P.; Pringle, Anne

2008-01-01

84

PCR primers that allow intergeneric differentiation of ascomycetes and their application to Verticillium spp.  

PubMed Central

A pair of conserved PCR primers, designated NMS1 and NMS2, that amplify a region in the mitochondrial small rRNA gene region were designed for fungi belonging to the class Ascomycetes. These primers were tested with members of eight fungal genera (Aspergillus, Fusarium, Magnaporthe, Mycospharella, Neurospora, Saccharomyces, Sclerotinia, Verticillium) and 10 Verticillium species (Verticillium albo-atrum, Verticillium chlamydosporium, Verticillium cinnebarium, Verticillium dahliae, Verticillium fungicola, Verticillium lecanii, Verticillium lateritium, Verticillium nigrescens, Verticillium psaliotae, and Verticillium tricorpus). The primers were also tested with 35 isolates of V. dahliae obtained from diverse geographic areas and diverse hosts. The results of a restriction fragment length polymorphism analysis of the region amplified by the primers differentiated the genera examined and the results of a DNA sequence analysis of the amplified region differentiated the Verticillium species. Two Fusarium species were also differentiated by the results of the restriction fragment length polymorphism analysis. On the basis of the nucleotide sequences of the amplified regions, we obtained a pair of PCR primers that could be used to differentiate V. dahliae from the other fungal isolates tested, including V. albo-atrum, a closely related plant-pathogenic species. The V. dahliae-specific PCR primer may aid in more rapid and specific detection of the pathogen directly in plant and/or soil samples. PCR primers NMS1 and NMS2 may be used as potential mitochondrial markers for studying fungal cytoplasmic inheritance of ascomycetes and for identifying DNA probes that are informative at or below the genus level. Images

Li, K N; Rouse, D I; German, T L

1994-01-01

85

Determination of absolute structures of cyclic peptides, PF1171A and PF1171C, from unidentified ascomycete OK-128.  

PubMed

Two cyclic peptides, PF1171A (1) and PF1171C (2), were isolated from okara that had been fermented with unidentified ascomycete OK-128. Their absolute configurations were determined by Marfey's method. These peptides showed paralytic activity against silkworms. PMID:20530885

Kai, Kenji; Yoshikawa, Hanae; Kuo, Yi-Hsuan; Akiyama, Kohki; Hayashi, Hideo

2010-01-01

86

Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences  

Microsoft Academic Search

Approximately 500 species of ascomycetous yeasts, including members of Candida and other anamorphic genera, were analyzed for extent of divergence in the variable D1\\/D2 domain of large subunit (26S) ribosomal DNA. Divergence in this domain is generally sufficient to resolve individual species, resulting in the prediction that 55 currently recognized taxa are synonyms of earlier described species. Phylogenetic relationships among

Cletus P. Kurtzman; Christie J. Robnett

1998-01-01

87

Kazachstania aquatica sp. nov. and Kazachstania solicola sp. nov., novel ascomycetous yeast species.  

PubMed

The unidentified strains AS 2.0706(T), preserved in the China General Microbiological Culture Collection Center (CGMCC), Academia Sinica, Beijing, China, and CBS 6904(T), preserved in the Centraalbureau voor Schimmelcultures (CBS), Utrecht, The Netherlands, were shown to represent two novel ascomycetous yeast species of the genus Kazachstania by 18S rDNA, internal transcribed spacer (ITS) region (including 5.8S rDNA) and 26S rDNA D1/D2 domain sequence analysis and electrophoretic karyotype comparison. The names Kazachstania aquatica sp. nov. and Kazachstania solicola sp. nov. are proposed for strains AS 2.0706(T) and CBS 6904(T), respectively. Phylogenetically, the two novel species are closely related to Kazachstania aerobia, Kazachstania servazzii and Kazachstania unispora. PMID:16166736

Wu, Zuo-Wei; Bai, Feng-Yan

2005-09-01

88

Freshwater ascomycetes: Alascospora evergladensis, a new genus and species from the Florida Everglades.  

PubMed

Alascospora evergladensis, a freshwater ascomycete collected from submerged dead petioles of Nymphaea odorata during a survey of aquatic fungi along a phosphorus gradient in the Florida Everglades, is described and illustrated as a new genus and species in the Pleosporales (Pleosporomycetidae, Dothideomycetes). The new fungus is unique among genera in the Pleosporales based on a combination of morphological characters that include light brown, translucent, membranous, ostiolate ascomata with dark, amorphous material irregularly deposited on the peridium, especially around the ostiole; globose, fissitunicate, thick-walled asci; septate pseudoparaphyses; and 1-septate ascospores that are hyaline when young, and surrounded by a hyaline gelatinous sheath that is wing-shaped in outline on each side of the ascospore. The sheath is distinctive in that it first expands in water and is translucent, then condenses and darkens around older ascospores, giving them a dark brown, verruculose appearance. PMID:20120226

Raja, Huzefa A; Violi, Helen A; Shearer, Carol A

2010-01-01

89

Isopimarane diterpene glycosides, apoptosis inducers, obtained from fruiting bodies of the ascomycete Xylaria polymorpha.  

PubMed

The methanol extract of fruiting bodies of the ascomycete Xylaria polymorpha afforded three isopimarane diterpene glycosides, namely, 16-alpha-D-mannopyranosyloxyisopimar-7-en-19-oic acid (1), 15-hydroxy-16-alpha-D-mannopyranosyloxyisopimar-7-en-19-oic acid (2), and 16-alpha-D-glucopyranosyloxyisopimar-7-en-19-oic acid (3). Their structures were determined by spectroscopic methods and by single-crystal X-ray analysis. They showed cytotoxicity against human cancer cell lines and exhibited IC50 values ranging from 71 to 607 microM. Further studies on the cytotoxicity of these compounds against HL60 cells demonstrated that they induced apoptosis along with typical DNA fragmentation. It was observed that 2 was less active than 1 and 3. PMID:19467682

Shiono, Yoshihito; Motoki, Sadayoshi; Koseki, Takuya; Murayama, Tetsuya; Tojima, Masato; Kimura, Ken-ichi

2009-05-01

90

PCR primers that allow intergeneric differentiation of ascomycetes and their application to Verticillium spp.  

PubMed

A pair of conserved PCR primers, designated NMS1 and NMS2, that amplify a region in the mitochondrial small rRNA gene region were designed for fungi belonging to the class Ascomycetes. These primers were tested with members of eight fungal genera (Aspergillus, Fusarium, Magnaporthe, Mycospharella, Neurospora, Saccharomyces, Sclerotinia, Verticillium) and 10 Verticillium species (Verticillium albo-atrum, Verticillium chlamydosporium, Verticillium cinnebarium, Verticillium dahliae, Verticillium fungicola, Verticillium lecanii, Verticillium lateritium, Verticillium nigrescens, Verticillium psaliotae, and Verticillium tricorpus). The primers were also tested with 35 isolates of V. dahliae obtained from diverse geographic areas and diverse hosts. The results of a restriction fragment length polymorphism analysis of the region amplified by the primers differentiated the genera examined and the results of a DNA sequence analysis of the amplified region differentiated the Verticillium species. Two Fusarium species were also differentiated by the results of the restriction fragment length polymorphism analysis. On the basis of the nucleotide sequences of the amplified regions, we obtained a pair of PCR primers that could be used to differentiate V. dahliae from the other fungal isolates tested, including V. albo-atrum, a closely related plant-pathogenic species. The V. dahliae-specific PCR primer may aid in more rapid and specific detection of the pathogen directly in plant and/or soil samples. PCR primers NMS1 and NMS2 may be used as potential mitochondrial markers for studying fungal cytoplasmic inheritance of ascomycetes and for identifying DNA probes that are informative at or below the genus level. PMID:7811072

Li, K N; Rouse, D I; German, T L

1994-12-01

91

The evolutionary history of Cytochrome P450 genes in four filamentous Ascomycetes  

PubMed Central

Background The Cytochrome P450 system is important in fungal evolution for adapting to novel ecological niches. To elucidate the evolutionary process of cytochrome P450 genes in fungi with different life styles, we studied the patterns of gene gains and losses in the genomes of four filamentous Ascomycetes, including two saprotrophs (Aspergillus nidulans (AN) and Neurospora crassa (NC)) and two plant pathogens (Fusarium graminearum (FG) and Magnaporthe grisea (MG)). Results A total of 376 P450 genes were assigned to 168 families according to standard nomenclature. On average, only 1 to 2 genes per family were in each genome. To resolve conflicting results between different clustering analyses and standard family designation, a higher order relationship was formulated. 376 genes were clustered into 115 clans. Subsequently a novel approach based on parsimony was developed to build the evolutionary models. Based on these analyses, a core of 30 distinct clans of P450s was defined. The core clans experienced contraction in all four fungal lineages while new clans expanded in all with exception of NC. MG experienced more genes and clans gains compared to the other fungi. Parsimonious analyses unanimously supported one species topology for the four fungi. Conclusion The four studied fungi exhibit unprecedented diversity in their P450omes in terms of coding sequence, intron-exon structures and genome locations, suggesting a complicated evolutionary history of P450s in filamentous Ascomycetes. Clan classification and a novel strategy were developed to study evolutionary history. Contraction of core clans and expansion of novel clans were identified. The exception was the NC lineage, which exhibited pure P450 gene loss.

Deng, Jixin; Carbone, Ignazio; Dean, Ralph A

2007-01-01

92

Freshwater ascomycetes: Wicklowia aquatica , a new genus and species in the Pleosporales from Florida and Costa Rica  

Microsoft Academic Search

During a latitudinal survey of freshwater ascomycetes, an unidentified fungus with bitunicate asci was found on submerged\\u000a wood and herbaceous material from Florida and Costa Rica. Based on morphological characteristics and 28S rDNA large subunit\\u000a (LSU) sequence data, this fungus is described as a new genus and species, Wicklowia aquatica, and placed in the Pleosporales (Pleosporomycetidae, Dothideomycetes). Phylogenetic analyses based

Huzefa A. Raja; Astrid Ferrer; Carol A. Shearer; Andrew N. Miller

2010-01-01

93

Vesicular transport in Histoplasma capsulatum: an effective mechanism for trans-cell wall transfer of proteins and lipids in ascomycetes  

PubMed Central

Vesicular secretion of macromolecules has recently been described in the basidiomycete Cryptococcus neoformans raising the question as to whether ascomycetes similarly utilize vesicles for transport. In the present study, we examine whether the clinically important ascomycete Histoplasma capsulatum produce vesicles and utilized these structures to secrete macromolecules. Transmission electron microscopy (TEM) show transcellular secretion of vesicles by yeast cells. Proteomic and lipidomic analyses of vesicles isolated from culture supernatants reveals a rich collection of macromolecules involved in diverse processes including metabolism, cell recycling, signaling, and virulence. The results demonstrate that H. capsulatum can utilize a trans-cell wall vesicular transport secretory mechanism to promote virulence. Additionally, TEM of supernatants collected from Candida albicans, Candida parapsilosis, Sporothrix schenckii, and Saccharomyces cerevisiae document that vesicles are similarly produced by additional ascomycetes. The vesicles from H. capsulatum react with immune serum from patients with histoplasmosis providing an association of the vesicular products with pathogenesis. The findings support the proposal that vesicular secretion is a general mechanism in fungi for the transport of macromolecules related to virulence and that this process could be a target for novel therapeutics.

Albuquerque, Priscila Costa; Nakayasu, Ernesto S.; Rodrigues, Marcio L.; Frases, Susana; Casadevall, Arturo; Zancope-Oliveira, Rosely M.; Almeida, Igor C.; Nosanchuk, Joshua D.

2008-01-01

94

Specific, non-nutritional association between an ascomycete fungus and Allomerus plant-ants  

PubMed Central

Ant–fungus associations are well known from attine ants, whose nutrition is based on a symbiosis with basidiomycete fungi. Otherwise, only a few non-nutritional ant–fungus associations have been recorded to date. Here we focus on one of these associations involving Allomerus plant-ants that build galleried structures on their myrmecophytic hosts in order to ambush prey. We show that this association is not opportunistic because the ants select from a monophyletic group of closely related fungal haplotypes of an ascomycete species from the order Chaetothyriales that consistently grows on and has been isolated from the galleries. Both the ants' behaviour and an analysis of the genetic population structure of the ants and the fungus argue for host specificity in this interaction. The ants' behaviour reveals a major investment in manipulating, growing and cleaning the fungus. A molecular analysis of the fungus demonstrates the widespread occurrence of one haplotype and many other haplotypes with a lower occurrence, as well as significant variation in the presence of these fungal haplotypes between areas and ant species. Altogether, these results suggest that such an interaction might represent an as-yet undescribed type of specific association between ants and fungus in which the ants cultivate fungal mycelia to strengthen their hunting galleries.

Ruiz-Gonzalez, Mario X.; Male, Pierre-Jean G.; Leroy, Celine; Dejean, Alain; Gryta, Herve; Jargeat, Patricia; Quilichini, Angelique; Orivel, Jerome

2011-01-01

95

Genomic evidence of repeat-induced point mutation (RIP) in filamentous ascomycetes.  

PubMed

The genomes of 49 filamentous ascomycetes (subphylum Pezizomycotina) were examined by two independent methods for evidence of multiple C?T transitions typical of RIP. At least one transposable element or other repeat family was identified in each genome, and members were assessed for transition and transversion mutations relative to a model of their intact progenitor. Occurrence of RIP was indicated where family members differed by excess of directional transitions over transversions. Transition mutations were quantified by an algorithm taking double mutations in CpG and CpC dinucleotides into account. A second method assessed dinucleotide frequency distribution anomalies in whole genomes, a procedure that allowed quantification of fractions of the non-coding genome that had been subject to extensive directional mutation. The results of both methods revealed that RIP-like activity varied greatly, both in extent of mutation and in dinucleotide context for C?T transitions. In the most extreme case, 75% of a Blastomyces dermatitidis genome had suffered conspicuous GC-depletion, all of it in the non-coding fraction. Many genomes carried both intact repeats as well as others that had suffered heavily from transitions. Only one species, Chaetomium globosum, showed no evidence of directional mutation. PMID:20854921

Clutterbuck, A John

2011-03-01

96

PfaH2: a novel hydrophobin from the ascomycete Paecilomyces farinosus.  

PubMed

The pfah2 gene coding for a novel hydrophobin PfaH2 from the ascomycete Paecilomyces farinosus was identified during sequencing of random clones from a cDNA library. The corresponding protein sequence of PfaH2 deduced from the cDNA comprised 134 amino acids (aa). A 16 aa signal sequence preceded the N-terminus of the mature protein. PfaH2 belonged to the class Ia hydrophobins. The protein was isolated using trifluoroacetic acid extraction and purified via SDS-PAGE and high-performance liquid chromatography. The surface activity of the recently described PfaH1 and of PfaH2 was compared by the determination of contact angles (CAs) on glass slides and Teflon tape, and the CA of distilled water droplets was measured on glass slides coated with hydrophobin PfaH1 or PfaH2. Surprisingly, both hydrophobins adsorbed to hydrophilic surfaces and changed their physicochemical properties to a similar quantitative extent, although little aa sequence homology was found. PMID:23600571

Zelena, Katerina; Takenberg, Meike; Lunkenbein, Stefan; Woche, Susanne K; Nimtz, Manfred; Berger, Ralf G

2013-01-01

97

Sequences of metanicins, 20-residue peptaibols from the ascomycetous fungus CBS 597.80.  

PubMed

Four linear 20-residue peptaibols, named metanicins (MTCs) A-D, were isolated from submerged cultures of the ascomycetous fungus CBS 597.80. Structure elucidation was performed by a combination of fast-atom-bombardment mass spectrometry (FAB-MS), electrospray ionization MS, Edman degradation of isolated fragments, and amino acid analysis by ion-exchange and gas chromatography, and enantioselective HPLC. The sequences of MTC A(B) are (amino acid exchange in B and C in parentheses): Ac-Aib-Ala-Aib-Ala-Aib-Ala-Gln-Aib-Val-Aib-Gly-Leu-Aib-Pro-Val-Aib-Aib(D-Iva)-Gln-Gln-Pheol and of MTC C(D) Ac-Aib-Ala-Aib-Ala-Aib-Ala-Gln-Aib-Val-Aib-Gly-Leu-Aib-Pro-Val-Aib-Aib(D-Iva)-Gln-Gln-Pheol (Ac, acetyl; Aib, ?-aminoisobutyric acid; Iva, isovaline; Pheol, L-phenylalaninol). The peptides are related, and some of the sequences are identical, to other 20-residue peptaibols isolated from Trichoderma species. MTCs show moderate activities against Micrococcus luteus, Enterococcus faecalis, and Staphylococcus aureus, and very low activities against Bacillus subtilis. The producer has originally been identified and deposited as Metarhizium anisopliae var. anisopliae CBS 597.80. Although this identification has been withdrawn by Centralbureau voor Schimmelcultures (CBS) in the meantime, the accession number will be retained - independently from any taxonomic revisions. PMID:23681727

Kimonyo, Anastase; Brückner, Hans

2013-05-01

98

Induction of apoptosis against cancer cell lines by four ascomycetes (endophytes) from Malaysian rainforest.  

PubMed

Endophytic fungi have been shown to be a promising source of biologically active natural products. In the present study, extracts of four endophytic fungi isolated from plants of the National Park, Pahang were evaluated for their cytotoxic activity and the nature of their active compounds determined. Those extracts exhibiting activity with IC(50) values less than 17 ?g/ml against HCT116, MCF-7 and K562 cell lines were shown to induce apoptosis in these cell lines. Molecular analysis, based on sequences of the rDNA internal transcribed spacers ITS1 and ITS4, revealed all four endophytic fungi to be ascomycetes: three sordariomycetes and a dothideomycete. Six known compounds, cytochalasin J, dechlorogriseofulvin, demethylharzianic-acid, griseofulvin, harzianic acid and 2-hexylidene-3-methyl-succinic acid were identified from a rapid dereplication technique for fungal metabolites using an in-house UV library. The results from the present study suggest the potential of endophytic fungi as cytotoxic agents, and there is an indication that the isolates contain bioactive compounds that mainly kill cancer cells by apoptosis. PMID:22397996

Hazalin, Nurul Aqmar Mohamad Nor; Ramasamy, Kalavathy; Lim, Siong Meng; Cole, Anthony L J; Majeed, Abu Bakar Abdul

2012-05-15

99

Conserved and essential transcription factors for cellulase gene expression in ascomycete fungi.  

PubMed

Rational engineering of filamentous fungi for improved cellulase production is hampered by our incomplete knowledge of transcriptional regulatory networks. We therefore used the model filamentous fungus Neurospora crassa to search for uncharacterized transcription factors associated with cellulose deconstruction. A screen of a N. crassa transcription factor deletion collection identified two uncharacterized zinc binuclear cluster transcription factors (clr-1 and clr-2) that were required for growth and enzymatic activity on cellulose, but were not required for growth or hemicellulase activity on xylan. Transcriptional profiling with next-generation sequencing methods refined our understanding of the N. crassa transcriptional response to cellulose and demonstrated that clr-1 and clr-2 were required for the bulk of that response, including induction of all major cellulase and some major hemicellulase genes. Functional CLR-1 was necessary for expression of clr-2 and efficient cellobiose utilization. Phylogenetic analyses showed that CLR-1 and CLR-2 are conserved in the genomes of most filamentous ascomycete fungi capable of degrading cellulose. In Aspergillus nidulans, a strain carrying a deletion of the clr-2 homolog (clrB) failed to induce cellulase gene expression and lacked cellulolytic activity on Avicel. Further manipulation of this control system in industrial production strains may significantly improve yields of cellulases for cellulosic biofuel production. PMID:22532664

Coradetti, Samuel T; Craig, James P; Xiong, Yi; Shock, Teresa; Tian, Chaoguang; Glass, N Louise

2012-05-01

100

Specific, non-nutritional association between an ascomycete fungus and Allomerus plant-ants.  

PubMed

Ant-fungus associations are well known from attine ants, whose nutrition is based on a symbiosis with basidiomycete fungi. Otherwise, only a few non-nutritional ant-fungus associations have been recorded to date. Here we focus on one of these associations involving Allomerus plant-ants that build galleried structures on their myrmecophytic hosts in order to ambush prey. We show that this association is not opportunistic because the ants select from a monophyletic group of closely related fungal haplotypes of an ascomycete species from the order Chaetothyriales that consistently grows on and has been isolated from the galleries. Both the ants' behaviour and an analysis of the genetic population structure of the ants and the fungus argue for host specificity in this interaction. The ants' behaviour reveals a major investment in manipulating, growing and cleaning the fungus. A molecular analysis of the fungus demonstrates the widespread occurrence of one haplotype and many other haplotypes with a lower occurrence, as well as significant variation in the presence of these fungal haplotypes between areas and ant species. Altogether, these results suggest that such an interaction might represent an as-yet undescribed type of specific association between ants and fungus in which the ants cultivate fungal mycelia to strengthen their hunting galleries. PMID:21084334

Ruiz-González, Mario X; Malé, Pierre-Jean G; Leroy, Céline; Dejean, Alain; Gryta, Hervé; Jargeat, Patricia; Quilichini, Angélique; Orivel, Jérôme

2011-06-23

101

Ascomycete communities in the rhizosphere of field-grown wheat are not affected by introductions of genetically modified Pseudomonas putida WCS358r.  

PubMed

A long-term field experiment (1999-2002) was conducted to monitor effects on the indigenous microflora of Pseudomonas putida WCS358r and two transgenic derivatives constitutively producing phenazine-1-carboxylic acid (PCA) or 2,4-diacetylphloroglucinol (DAPG). The strains were introduced as seed coating on wheat into the same field plots each year. Rhizosphere populations of ascomycetes were analysed using denaturing gradient gel electrophoresis (DGGE). To evaluate the significance of changes caused by the genetically modified microorganisms (GMMs), they were compared with effects caused by a crop rotation from wheat to potato. In the first year, only the combination of both GMMs caused a significant shift in the ascomycete community. After the repeated introductions this effect was no longer evident. However, cropping potato significantly affected the ascomycete community. This effect persisted into the next year when wheat was grown. Clone libraries were constructed from samples taken in 1999 and 2000, and sequence analysis indicated ascomycetes of common genera to be present. Most species occurred in low frequencies, distributed almost evenly in all treatments. However, in 1999 Microdochium occurred in relatively high frequencies, whereas in the following year no Microdochium species were detected. On the other hand, Fusarium-like organisms were low in 1999, and increased in 2000. Both the DGGE and the sequence analysis revealed that repeated introduction of P. putida WCS358r had no major effects on the ascomycete community in the wheat rhizosphere, but demonstrated a persistent difference between the rhizospheres of potato and wheat. PMID:16232292

Viebahn, Mareike; Doornbos, Rogier; Wernars, Karel; van Loon, Leendert C; Smit, Eric; Bakker, Peter A H M

2005-11-01

102

Comparative Xylose Metabolism among the Ascomycetes C. albicans, S. stipitis and S. cerevisiae  

PubMed Central

The ascomycetes Candida albicans, Saccharomyces cerevisiae and Scheffersomyces stipitis metabolize the pentose sugar xylose very differently. S. cerevisiae fails to grow on xylose, while C. albicans can grow, and S. stipitis can both grow and ferment xylose to ethanol. However, all three species contain highly similar genes that encode potential xylose reductases and xylitol dehydrogenases required to convert xylose to xylulose, and xylulose supports the growth of all three fungi. We have created C. albicans strains deleted for the xylose reductase gene GRE3, the xylitol dehydrogenase gene XYL2, as well as the gre3 xyl2 double mutant. As expected, all the mutant strains cannot grow on xylose, while the single gre3 mutant can grow on xylitol. The gre3 and xyl2 mutants are efficiently complemented by the XYL1 and XYL2 from S. stipitis. Intriguingly, the S. cerevisiae GRE3 gene can complement the Cagre3 mutant, while the ScSOR1 gene can complement the Caxyl2 mutant, showing that S. cerevisiae contains the enzymatic capacity for converting xylose to xylulose. In addition, the gre3 xyl2 double mutant of C. albicans is effectively rescued by the xylose isomerase (XI) gene of either Piromyces or Orpinomyces, suggesting that the XI provides an alternative to the missing oxido-reductase functions in the mutant required for the xylose-xylulose conversion. Overall this work suggests that C. albicans strains engineered to lack essential steps for xylose metabolism can provide a platform for the analysis of xylose metabolism enzymes from a variety of species, and confirms that S. cerevisiae has the genetic potential to convert xylose to xylulose, although non-engineered strains cannot proliferate on xylose as the sole carbon source.

Lepine, Guylaine; Askew, Chris; Raymond, Martine; Whiteway, Malcolm; Wu, Cunle

2013-01-01

103

Comparative xylose metabolism among the Ascomycetes C. albicans, S. stipitis and S. cerevisiae.  

PubMed

The ascomycetes Candida albicans, Saccharomyces cerevisiae and Scheffersomyces stipitis metabolize the pentose sugar xylose very differently. S. cerevisiae fails to grow on xylose, while C. albicans can grow, and S. stipitis can both grow and ferment xylose to ethanol. However, all three species contain highly similar genes that encode potential xylose reductases and xylitol dehydrogenases required to convert xylose to xylulose, and xylulose supports the growth of all three fungi. We have created C. albicans strains deleted for the xylose reductase gene GRE3, the xylitol dehydrogenase gene XYL2, as well as the gre3 xyl2 double mutant. As expected, all the mutant strains cannot grow on xylose, while the single gre3 mutant can grow on xylitol. The gre3 and xyl2 mutants are efficiently complemented by the XYL1 and XYL2 from S. stipitis. Intriguingly, the S. cerevisiae GRE3 gene can complement the Cagre3 mutant, while the ScSOR1 gene can complement the Caxyl2 mutant, showing that S. cerevisiae contains the enzymatic capacity for converting xylose to xylulose. In addition, the gre3 xyl2 double mutant of C. albicans is effectively rescued by the xylose isomerase (XI) gene of either Piromyces or Orpinomyces, suggesting that the XI provides an alternative to the missing oxido-reductase functions in the mutant required for the xylose-xylulose conversion. Overall this work suggests that C. albicans strains engineered to lack essential steps for xylose metabolism can provide a platform for the analysis of xylose metabolism enzymes from a variety of species, and confirms that S. cerevisiae has the genetic potential to convert xylose to xylulose, although non-engineered strains cannot proliferate on xylose as the sole carbon source. PMID:24236198

Harcus, Doreen; Dignard, Daniel; Lépine, Guylaine; Askew, Chris; Raymond, Martine; Whiteway, Malcolm; Wu, Cunle

2013-01-01

104

Mn(II) oxidation by an ascomycete fungus is linked to superoxide production during asexual reproduction  

PubMed Central

Manganese (Mn) oxides are among the most reactive minerals within the environment, where they control the bioavailability of carbon, nutrients, and numerous metals. Although the ability of microorganisms to oxidize Mn(II) to Mn(III/IV) oxides is scattered throughout the bacterial and fungal domains of life, the mechanism and physiological basis for Mn(II) oxidation remains an enigma. Here, we use a combination of compound-specific chemical assays, microspectroscopy, and electron microscopy to show that a common Ascomycete filamentous fungus, Stilbella aciculosa, oxidizes Mn(II) to Mn oxides by producing extracellular superoxide during cell differentiation. The reactive Mn oxide phase birnessite and the reactive oxygen species superoxide and hydrogen peroxide are colocalized at the base of asexual reproductive structures. Mn oxide formation is not observed in the presence of superoxide scavengers (e.g., Cu) and inhibitors of NADPH oxidases (e.g., diphenylene iodonium chloride), enzymes responsible for superoxide production and cell differentiation in fungi. Considering the recent identification of Mn(II) oxidation by NADH oxidase-based superoxide production by a common marine bacterium (Roseobacter sp.), these results introduce a surprising homology between some prokaryotic and eukaryotic organisms in the mechanisms responsible for Mn(II) oxidation, where oxidation appears to be a side reaction of extracellular superoxide production. Given the versatility of superoxide as a redox reactant and the widespread ability of fungi to produce superoxide, this microbial extracellular superoxide production may play a central role in the cycling and bioavailability of metals (e.g., Hg, Fe, Mn) and carbon in natural systems.

Hansel, Colleen M.; Zeiner, Carolyn A.; Santelli, Cara M.; Webb, Samuel M.

2012-01-01

105

Cryptosphaerolide: A Cytotoxic Mcl-1 Inhibitor from a Marine-Derived Ascomycete Related to the Genus Cryptosphaeria  

PubMed Central

Examination of the saline fermentation products from the marine-derived ascomycete fungal strain CNL-523 (Cryptosphaeria sp.), resulted in the isolation of cryptosphaerolide (1). The new compound is an ester-substituted sesquiterpenoid related to the eremophilane class. The structure of the new compound was assigned by spectroscopic and chemical methods. Cryptosphaerolide was found to be an inhibitor of the protein Mcl-1, a cancer drug target involved in apoptosis. It also showed significant cytotoxicity against an HCT-116 human colon carcinoma cell line indicating that the compound may be of value in exploring the Mcl-1 pathway as a target for cancer chemotherapy.

Oh, Hyuncheol; Jensen, Paul R.; Murphy, Brian T.; Fiorilla, Catherine; Sullivan, John F.; Ramsey, Timothy; Fenical, William

2010-01-01

106

Comparative Studies of Extracellular Fungal Laccases  

PubMed Central

Various basidiomycetes, ascomycetes, and deuteromycetes, grown in a sugar-rich liquid medium, were compared for laccase-producing ability and for the inducing effect of 2,5-xylidine on laccase production. Clear stimulation of the extracellular enzyme formation by xylidine was obtained in the cultures of Fomes annosus, Pholiota mutabilis, Pleurotus ostreatus, and Trametes versicolor, whereas Rhizoctonia praticola and Botrytis cinerea were not affected by the xylidine, and in the case of Podospora anserina a decrease in laccase activity was observed. The laccases were purified, and electrophoresis on polyacrylamide gels indicated a particular pattern for each laccase. The bands of the induced forms appeared only with basidiomycetes. The optimal pH of R. praticola laccase was in the neutral region, whereas the optima of all the other exolaccases were significantly lower (between pH 3.0 and 5.7). All laccases oxidized the methoxyphenolic acids under investigation, but there existed quantitative differences in oxidation efficiencies which depended on pH and on the nature (noninduced or induced) of the enzyme. The sensitivity of all enzymes to inhibitors did not differ considerably.

Bollag, Jean-Marc; Leonowicz, Andrzej

1984-01-01

107

Genes That Bias Mendelian Segregation  

PubMed Central

Mendel laws of inheritance can be cheated by Meiotic Drive Elements (MDs), complex nuclear genetic loci found in various eukaryotic genomes and distorting segregation in their favor. Here, we identify and characterize in the model fungus Podospora anserina Spok1 and Spok2, two MDs known as Spore Killers. We show that they are related genes with both spore-killing distorter and spore-protecting responder activities carried out by the same allele. These alleles act as autonomous elements, exert their effects independently of their location in the genome and can act as MDs in other fungi. Additionally, Spok1 acts as a resistance factor to Spok2 killing. Genetical data and cytological analysis of Spok1 and Spok2 localization during the killing process suggest a complex mode of action for Spok proteins. Spok1 and Spok2 belong to a multigene family prevalent in the genomes of many ascomycetes. As they have no obvious cellular role, Spok1 and Spok2 Spore Killer genes represent a novel kind of selfish genetic elements prevalent in fungal genome that proliferate through meiotic distortion.

Grognet, Pierre; Lalucque, Herve; Malagnac, Fabienne; Silar, Philippe

2014-01-01

108

Identification of heavy metal regulated genes from the root associated ascomycete Cadophora finlandica using a genomic microarray.  

PubMed

The ascomycete Cadophora finlandica, which can form mycorrhizas with ectomycorrhizal and ericoid hosts, is commonly found in heavy metal polluted soils. To understand the selective advantage of this organism at contaminated sites heavy metal regulated genes from C. finlandica were investigated. For gene identification a strategy based on a genomic microarray was chosen, which allows a rapid, genome-wide screening in genetically poorly characterized organisms. In a preliminary screen eleven plasmids covering eight distinct genomic regions and encoding a total of ten Cd-regulated genes were identified. Northern analyses with RNA from C. finlandica grown in the presence of either Cd, Pb or Zn revealed different transcription patterns in response to the heavy metals present in the growth medium. The Cd-regulated genes are predicted to encode several extracellular proteins with unknown functions, transporters, a centaurin-type regulator of intracellular membrane trafficking, a GNAT-family acetyltransferase and a B-type cyclin. PMID:19770041

Gorfer, Markus; Persak, Helene; Berger, Harald; Brynda, Sabine; Bandian, Dragana; Strauss, Joseph

2009-12-01

109

Production of the alkaloid swainsonine by a fungal endosymbiont of the Ascomycete order Chaetothyriales in the host Ipomoea carnea.  

PubMed

Some plant species within the Convolvulaceae (morning glory family) from South America, Africa, and Australia cause a neurologic disease in grazing livestock caused by swainsonine. These convolvulaceous species including Ipomoea carnea contain the indolizidine alkaloid swainsonine, an inhibitor of ?-mannosidase and mannosidase II, and polyhydroxy nortropane alkaloids, the calystegines which are glycosidase inhibitors. Swainsonine has been shown to be produced by a fungal endosymbiont in legumes of the Astragalus and Oxytropis genera, where it causes a similar neurologic disease in grazing livestock called locoism. Here we demonstrate that I. carnea plants are infected with a fungal endosymbiont that was cultured from its seeds and which produced swainsonine in pure culture but not the calystegines. The same fungal endosymbiont was detected by PCR and by culturing in I. carnea plants containing swainsonine. The fungal endosymbiont belongs to the Ascomycete order Chaetothyriales. Plants derived from fungicide-treated seeds lacked swainsonine, but calystegine concentrations were unaltered. PMID:23547913

Cook, Daniel; Beaulieu, Wesley T; Mott, Ivan W; Riet-Correa, Franklin; Gardner, Dale R; Grum, Daniel; Pfister, James A; Clay, Keith; Marcolongo-Pereira, Clairton

2013-04-24

110

A chloride tolerant laccase from the plant pathogen ascomycete Botrytis aclada expressed at high levels in Pichia pastoris.  

PubMed

Fungal laccases from basidiomycetous fungi are thoroughly investigated in respect of catalytic mechanism and industrial applications, but the number of reported and well characterized ascomycetous laccases is much smaller although they exhibit interesting catalytic properties. We report on a highly chloride tolerant laccase produced by the plant pathogen ascomycete Botrytis aclada, which was recombinantly expressed in Pichia pastoris with an extremely high yield and purified to homogeneity. In a fed-batch fermentation, 495 mg L(-1) of laccase was measured in the medium, which is the highest concentration obtained for a laccase by a yeast expression system. The recombinant B. aclada laccase has a typical molecular mass of 61,565 Da for the amino acid chain. The pI is approximately 2.4, a very low value for a laccase. Glycosyl residues attached to the recombinant protein make up for approximately 27% of the total protein mass. B. aclada laccase exhibits very low K(M) values and high substrate turnover numbers for phenolic and non-phenolic substrates at acidic and near neutral pH. The enzyme's stability increases in the presence of chloride ions and, even more important, its substrate turnover is only weakly inhibited by chloride ions (I(50)=1.4M), which is in sharp contrast to most other described laccases. This high chloride tolerance is mandatory for some applications such as implantable biofuel cells and laccase catalyzed reactions, which suffer from the presence of chloride ions. The high expression yield permits fast and easy production for further basic and applied research. PMID:22178779

Kittl, Roman; Mueangtoom, Kitti; Gonaus, Christoph; Khazaneh, Shima Tahvilda; Sygmund, Christoph; Haltrich, Dietmar; Ludwig, Roland

2012-01-20

111

A new pullulan and a branched (1-->3)-, (1-->6)-linked beta-glucan from the lichenised ascomycete Teloschistes flavicans.  

PubMed

The polysaccharides formed on hot alkaline extraction of the ascomycetous lichen Teloschistes flavicans were fractionated to give two glucans, which were characterised by methylation analysis and 1D and 2D NMR spectroscopy. One was a branched beta-glucan containing (1-->3) and (1-->6) linkages, a structure which is more typical of basidiomycetes rather than ascomycetes, which have linear glucans. The other was an alpha-glucan with alternating (1-->4) and (1-->6) linkages, found for the first time in Nature. This structure can be classified as a pullulan, which has been isolated from the fungi Aureobasidium pullulans, Tremella mesenterica, and Cyttaria harioti, but has different ratios of the component glycosidic linkages. The significance of the presence of the isolated alpha- and beta-glucans is discussed. PMID:12023070

Reis, Rodrigo A; Tischer, Cesar A; Gorin, Philip A J; Iacomini, Marcello

2002-04-23

112

Agrobacterium-mediated gene transfer and enhanced green fluorescent protein visualization in the mycorrhizal ascomycete Tuber borchii: a first step towards truffle genetics.  

PubMed

Mycorrhizal ascomycetes are ecologically and commercially important fungi that have proved impervious to genetic transformation so far. We report here on the successful transient transformation of Tuber borchii, an ectomycorrhizal ascomycete that colonizes a variety of trees and produces highly prized hypogeous fruitbodies known as "truffles". A hypervirulent Agrobacterium tumefaciens strain bearing the binary plasmid pBGgHg was used for transformation. The genes for hygromycin resistance and the enhanced green fluorescent protein (EGFP), both under the control of vector-borne promoters, were employed as selection markers. Patches of dark and fluorescent hyphae were observed upon fluorescence microscopic examination of hygromycin-resistant mycelia. The presence of EGFP was confirmed by both confocal microscopy and PCR analysis. The lack in the transformed mycelia of the DNA coding for kanamicin resistance (a trait encoded by a vector-borne gene located outside of the T-DNA region) indicates that Agrobacterium-mediated gene transfer correctly occurred in T. borchii. PMID:15868150

Grimaldi, Benedetto; de Raaf, Michiel A; Filetici, Patrizia; Ottonello, Simone; Ballario, Paola

2005-07-01

113

The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora  

Microsoft Academic Search

Members of the striatin family and their highly conserved interacting protein phocein\\/Mob3 are key components in the regulation\\u000a of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein\\/Mob3 orthologue SmMOB3 of\\u000a S. macrospora. We isolated the gene and showed that

Yasmine Bernhards; Stefanie Pöggeler

2011-01-01

114

Functional characterization of sucrose non-fermenting 1 protein kinase complex genes in the Ascomycete Fusarium graminearum.  

PubMed

Sucrose non-fermenting 1 (SNF1) protein kinase complex is a heterotrimer that functions in energy homeostasis in eukaryotes by regulating transcription of glucose-repressible genes. Our previous study revealed that SNF1 of the homothallic ascomycete fungus Fusarium graminearum plays important roles in vegetative growth, sexual development, and virulence. In this study, we further identified the components of the SNF1 complex in F. graminearum and characterized their functions. We found that the SNF1 complex in F. graminearum consists of one alpha subunit (FgSNF1), one beta subunit (FgGAL83), and one gamma subunit (FgSNF4). Deletion of Fggal83 and Fgsnf4 resulted in alleviated phenotype changes in vegetative growth and sexual development as compared to those of the Fgsnf1 deletion mutant. However, all of the single, double, and triple deletion mutants among Fgsnf1, Fggal83, and Fgsnf4 had similar levels of decreased virulence. In addition, there was no synergistic effect of the mutant (single, double, or triple deletions of SNF1 complex component genes) phenotypes except for sucrose utilization. In this study, we revealed that FgSNF1 is mainly required for SNF1 complex functions, and the other two SNF1 complex components have adjunctive roles with FgSNF1 in sexual development and vegetative growth but have a major role in virulence in F. graminearum. PMID:24057127

Yu, Jungheon; Son, Hokyoung; Park, Ae Ran; Lee, Seung-Ho; Choi, Gyung Ja; Kim, Jin-Cheol; Lee, Yin-Won

2014-02-01

115

Phylogenetic analysis identifies the 'megabacterium' of birds as a novel anamorphic ascomycetous yeast, Macrorhabdus ornithogaster gen. nov., sp. nov.  

PubMed

An organism commonly referred to as 'megabacterium' colonizes the gastric isthmus of many species of birds. It is weakly gram-positive and periodic acid-Schiff-positive and stains with silver stains. Previous studies have shown that it has a nucleus and a cell wall similar to those seen in fungi. Calcofluor white M2R staining suggests that the cell wall contains chitin, a eukaryote-specific substance, and rRNA in situ hybridization demonstrates that it is a eukaryote. To characterize this organism phylogenetically, DNA was extracted from purified cells. rDNA was readily amplified by PCR with pan-fungal DNA primer sets and primer sets derived from the newly determined sequence, but not with bacteria-specific primer sets. Specific primer sets amplified rDNA from isthmus scrapings from an infected bird, but not from a non-infected bird or other control DNA. The sequence was confirmed to derive from the purified organism by in situ rRNA hybridization using a specific probe. Phylogenetic analysis of sequences of the 18S rDNA and domain D1/D2 of 26S rDNA showed the organism to be a previously undescribed anamorphic ascomycetous yeast representing a new genus. The name Macrorhabdus ornithogaster gen. nov., sp. nov. is proposed for this organism. The type material is CBS 9251T (= NRRL Y-27487T). PMID:12892150

Tomaszewski, Elizabeth K; Logan, Kathleen S; Snowden, Karen F; Kurtzman, Cletus P; Phalen, David N

2003-07-01

116

High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples  

PubMed Central

The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS) region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties), causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

Yamamoto, Satoshi; Sato, Hirotoshi

2012-01-01

117

Removal of chlorophenolic derivatives by soil isolated ascomycete of Paraconiothyrium variabile and studying the role of its extracellular laccase.  

PubMed

The ability of Paraconiothyrium variabile, a laccase producing ascomycete recently isolated from soil, was studied to eliminate chlorophenol derivatives in submerged culture medium. Among the tested compounds, ?-chlorophenol (?-CP) and pentachlorophenol (PCP) were found to have minimum and maximum toxic effects, respectively, on the growth of the microorganism and at the same time high and low bioelimination percentages. The fungal strain was able to remove 86% of ?-CP (with initial concentration of 40 mg l(-1)) and 56% of 2,4-dichlorophenol (2,4-DCP; with same concentration as ?-CP) after 9 days of incubation while no elimination was observed in the presence of 2,4,6-trichlorophenol (2,4,6-TCP) and PCP. Monitoring of laccase production level in the fermentation broth together with pollutant removal confirmed the key role of this copper-containing oxidase in chlorophenol derivatives elimination. The type of laccase inducer (guaiacol) and its final concentration (250 ?M) and also initial pH of the fermentation broth (pH=5.5) in the elimination of ?-CP increased the final removal yield from 86% to 94.3%. PMID:22277342

Forootanfar, Hamid; Movahednia, Mohammad Mehdi; Yaghmaei, Soheila; Tabatabaei-Sameni, Minoosadat; Rastegar, Hossein; Sadighi, Armin; Faramarzi, Mohammad Ali

2012-03-30

118

Mutations to LmIFRD affect cell wall integrity, development and pathogenicity of the ascomycete Leptosphaeria maculans.  

PubMed

Maintaining cell wall integrity is essential for fungal growth and development. We describe two mutants with altered expression of a gene, LmIFRD, from the ascomycete Leptosphaeria maculans. Truncation of the LmIFRD transcript in a T-DNA insertional mutant led to slower germination, less sporulation and loss-of-pathogenicity towards Brassica napus, whereas silencing of the LmIFRD transcript led to increased germination, sporulation and earlier infection. The increased tolerance to cell wall lysing enzymes and cell wall-disrupting compounds of the T-DNA mutant contrasts with decreased tolerance of the silenced mutant and suggests altered cell wall integrity and accessibility to 1,3-linked glucan and chitin. Lectin binding experiments and monosaccharide analysis revealed altered polysaccharide content and structure within the cell wall of the LmIFRD mutants, notably increased 1,3-linked galactose and chitin within the cell wall of the T-DNA mutant. This is the first analysis of monosaccharide linkage composition of cell walls of spores and mycelia for any dothideomycete. PMID:19539773

Van de Wouw, Angela P; Pettolino, Filomena A; Howlett, Barbara J; Elliott, Candace E

2009-09-01

119

The cross-pathway control system regulates production of the secondary metabolite toxin, sirodesmin PL, in the ascomycete, Leptosphaeria maculans  

PubMed Central

Background Sirodesmin PL is a secondary metabolite toxin made by the ascomycetous plant pathogen, Leptosphaeria maculans. The sirodesmin biosynthetic genes are clustered in the genome. The key genes are a non-ribosomal peptide synthetase, sirP, and a pathway-specific transcription factor, sirZ. Little is known about regulation of sirodesmin production. Results Genes involved in regulation of sirodesmin PL in L. maculans have been identified. Two hundred random insertional T-DNA mutants were screened with an antibacterial assay for ones producing low levels of sirodesmin PL. Three such mutants were isolated and each transcribed sirZ at very low levels. One of the affected genes had high sequence similarity to Aspergillus fumigatus cpcA, which regulates the cross-pathway control system in response to amino acid availability. This gene was silenced in L. maculans and the resultant mutant characterised. When amino acid starvation was artificially-induced by addition of 3-aminotriazole for 5 h, transcript levels of sirP and sirZ did not change in the wild type. In contrast, levels of sirP and sirZ transcripts increased in the silenced cpcA mutant. After prolonged amino acid starvation the silenced cpcA mutant produced much higher amounts of sirodesmin PL than the wild type. Conclusions Production of sirodesmin PL in L. maculans is regulated by the cross pathway control gene, cpcA, either directly or indirectly via the pathway-specific transcription factor, sirZ.

2011-01-01

120

Large-Scale Introgression Shapes the Evolution of the Mating-Type Chromosomes of the Filamentous Ascomycete Neurospora tetrasperma  

PubMed Central

The significance of introgression as an evolutionary force shaping natural populations is well established, especially in animal and plant systems. However, the abundance and size of introgression tracts, and to what degree interspecific gene flow is the result of adaptive processes, are largely unknown. In this study, we present medium coverage genomic data from species of the filamentous ascomycete Neurospora, and we use comparative genomics to investigate the introgression landscape at the genomic level in this model genus. We revealed one large introgression tract in each of the three investigated phylogenetic lineages of Neurospora tetrasperma (sizes of 5.6 Mbp, 5.2 Mbp, and 4.1 Mbp, respectively). The tract is located on the chromosome containing the locus conferring sexual identity, the mating-type (mat) chromosome. The region of introgression is confined to the region of suppressed recombination and is found on one of the two mat chromosomes (mat a). We used Bayesian concordance analyses to exclude incomplete lineage sorting as the cause for the observed pattern, and multilocus genealogies from additional species of Neurospora show that the introgression likely originates from two closely related, freely recombining, heterothallic species (N. hispaniola and N. crassa/N. perkinsii). Finally, we investigated patterns of molecular evolution of the mat chromosome in Neurospora, and we show that introgression is correlated with reduced level of molecular degeneration, consistent with a shorter time of recombination suppression. The chromosome specific (mat) and allele specific (mat a) introgression reported herein comprise the largest introgression tracts reported to date from natural populations. Furthermore, our data contradicts theoretical predictions that introgression should be less likely on sex-determining chromosomes. Taken together, the data presented herein advance our general understanding of introgression as a force shaping eukaryotic genomes.

Menkis, Audrius; Whittle, Carrie A.; Andersson, Siv G. E.; Johannesson, Hanna

2012-01-01

121

Purifying selection and birth-and-death evolution in the class II hydrophobin gene families of the ascomycete Trichoderma/Hypocrea  

PubMed Central

Background Hydrophobins are proteins containing eight conserved cysteine residues that occur uniquely in mycelial fungi. Their main function is to confer hydrophobicity to fungal surfaces in contact with air or during attachment of hyphae to hydrophobic surfaces of hosts, symbiotic partners or themselves resulting in morphogenetic signals. Based on their hydropathy patterns and solubility characteristics, hydrophobins are divided into two classes (I and II), the latter being found only in ascomycetes. Results We have investigated the mechanisms driving the evolution of the class II hydrophobins in nine species of the mycoparasitic ascomycetous genus Trichoderma/Hypocrea, using three draft sequenced genomes (H. jecorina = T. reesei, H. atroviridis = T. atroviride; H. virens = T. virens) an additional 14,000 ESTs from six other Trichoderma spp. (T. asperellum, H. lixii = T. harzianum, T. aggressivum var. europeae, T. longibrachiatum, T. cf. viride). The former three contained six, ten and nine members, respectively. Ten is the highest number found in any ascomycete so far. All the hydrophobins we examined had the conserved four beta-strands/one helix structure, which is stabilized by four disulfide bonds. In addition, a small number of these hydrophobins (HFBs)contained an extended N-terminus rich in either proline and aspartate, or glycine-asparagine. Phylogenetic analysis reveals a mosaic of terminal clades containing duplicated genes and shows only three reasonably supported clades. Calculation of the ratio of differences in synonymous vs. non-synonymous nucleotide substitutions provides evidence for strong purifying selection (KS/Ka >> 1). A genome database search for class II HFBs from other ascomycetes retrieved a much smaller number of hydrophobins (2–4) from each species, and most were from Sordariomycetes. A combined phylogeny of these sequences with those of Trichoderma showed that the Trichoderma HFBs mostly formed their own clades, whereas those of other Sordariomycetes occurred in shared clades. Conclusion Our study shows that the genus Trichoderma/Hypocrea has a proliferated arsenal of class II hydrophobins which arose by birth-and-death evolution followed by purifying selection.

2008-01-01

122

Functional Characterization of MAT1-1-Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators?†  

PubMed Central

Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the ? domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.

Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Poggeler, S.

2010-01-01

123

Autophagy genes Smatg8 and Smatg4 are required for fruiting-body development, vegetative growth and ascospore germination in the filamentous ascomycete Sordaria macrospora  

PubMed Central

Autophagy is a tightly controlled degradation process involved in various developmental aspects of eukaryotes. However, its involvement in developmental processes of multicellular filamentous ascomycetes is largely unknown. Here, we analyzed the impact of the autophagic proteins SmATG8 and SmATG4 on the sexual and vegetative development of the filamentous ascomycete Sordaria macrospora. A Saccharomyces cerevisiae complementation assay demonstrated that the S. macrospora Smatg8 and Smatg4 genes can functionally replace the yeast homologs. By generating homokaryotic deletion mutants, we showed that the S. macrospora SmATG8 and SmATG4 orthologs were associated with autophagy-dependent processes. Smatg8 and Smatg4 deletions abolished fruiting-body formation and impaired vegetative growth and ascospore germination, but not hyphal fusion. We demonstrated that SmATG4 was capable of processing the SmATG8 precursor. SmATG8 was localized to autophagosomes, whereas SmATG4 was distributed throughout the cytoplasm of S. macrospora. Furthermore, we could show that Smatg8 and Smatg4 are not only required for nonselective macroautophagy, but for selective macropexophagy as well. Taken together, our results suggest that in S. macrospora, autophagy seems to be an essential and constitutively active process to sustain high energy levels for filamentous growth and multicellular development even under nonstarvation conditions.

Voigt, Oliver; Poggeler, Stefanie

2013-01-01

124

First structural insights into ?-L-arabinofuranosidases from the two GH62 glycoside hydrolase subfamilies.  

PubMed

?-L-arabinofuranosidases are glycoside hydrolases that specifically hydrolyze non-reducing residues from arabinose-containing polysaccharides. In the case of arabinoxylans, which are the main components of hemicellulose, they are part of microbial xylanolytic systems and are necessary for complete breakdown of arabinoxylans. Glycoside hydrolase family 62 (GH62) is currently a small family of ?-L-arabinofuranosidases that contains only bacterial and fungal members. Little is known about the GH62 mechanism of action, because only a few members have been biochemically characterized and no three-dimensional structure is available. Here, we present the first crystal structures of two fungal GH62 ?-L-arabinofuranosidases from the basidiomycete Ustilago maydis (UmAbf62A) and ascomycete Podospora anserina (PaAbf62A). Both enzymes are able to efficiently remove the ?-L-arabinosyl substituents from arabinoxylan. The overall three-dimensional structure of UmAbf62A and PaAbf62A reveals a five-bladed ?-propeller fold that confirms their predicted classification into clan GH-F together with GH43 ?-L-arabinofuranosidases. Crystallographic structures of the complexes with arabinose and cellotriose reveal the important role of subsites +1 and +2 for sugar binding. Intriguingly, we observed that PaAbf62A was inhibited by cello-oligosaccharides and displayed binding affinity to cellulose although no activity was observed on a range of cellulosic substrates. Bioinformatic analyses showed that UmAbf62A and PaAbf62A belong to two distinct subfamilies within the GH62 family. The results presented here provide a framework to better investigate the structure-function relationships within the GH62 family. PMID:24394409

Siguier, Béatrice; Haon, Mireille; Nahoum, Virginie; Marcellin, Marlène; Burlet-Schiltz, Odile; Coutinho, Pedro M; Henrissat, Bernard; Mourey, Lionel; O'Donohue, Michael J; Berrin, Jean-Guy; Tranier, Samuel; Dumon, Claire

2014-02-21

125

The High-Affinity Phosphodiesterase BcPde2 Has Impact on Growth, Differentiation and Virulence of the Phytopathogenic Ascomycete Botrytis cinerea  

PubMed Central

Components of the cAMP signaling pathway, such as the adenylate cyclase Bac and the protein kinase A (PKA) were shown to affect growth, morphogenesis and differentiation as well as virulence of the phytopathogenic fungus Botrytis cinerea. While loss of Bac caused drastically reduced intracellular cAMP levels, deletion of the PKA resulted in extremely increased cAMP concentrations. To regulate the intracellular level of the second messenger cAMP, a balance between its biosynthesis through adenylate cyclase activity and its hydrolysis by phosphodiesterases (PDEs) is crucial. Here, we report the functional characterization of the two PDEs in the ascomycete B. cinerea, BcPde1 and BcPde2. While deletion of bcpde2 resulted in severely affected vegetative growth, conidiation, germination and virulence, the bcpde1 deletion strain displayed a wild-type-like phenotype. However, the double bcpde1/2 deletion mutant exhibited an even stronger phenotype. Localization studies revealed that BcPde2 accumulates at the plasma membrane, but is also localized in the cytoplasm. BcPde1 was shown to be distributed in the cytoplasm as well, but also accumulates in so far unknown mobile vesicles. Overexpression of bcpde1 in the ?bcpde2 background rescued the deletion phenotype, and in addition an increased transcript level of bcpde1 in the ?bcpde2 strain was observed, indicating redundant functions of both PDEs and an interdependent gene expression.

Harren, Karin; Brandhoff, Beate; Knodler, Michael; Tudzynski, Bettina

2013-01-01

126

Mineralization of 14C-labelled synthetic lignin and extracellular enzyme activities of the wood-colonizing ascomycetes Xylaria hypoxylon and Xylaria polymorpha.  

PubMed

Two wood-dwelling ascomycetes, Xylaria hypoxylon and Xylaria polymorpha, were isolated from rotting beech wood. Lignin degradation was studied following the mineralization of a synthetic [formula: see text]-labelled lignin in solid and liquid media. Approximately 9% of the synthetic lignin was mineralized by X. polymorpha during the growth on beech wood meal, and the major fraction (65.5%) was polymerized into water- and dioxan-insoluble material. Both fungi produced laccase (up to 1,200 U l-1) in an agitated complex medium based on tomato juice; peroxidase activity (<80 U l-1) was only detected for X. polymorpha in soybean meal suspension. The enzymatic attack of X. polymorpha on beech wood resulted in the formation of three fractions of water-soluble lignocellulose fragments with molecular masses of 200, 30 (major fraction) and 3 kDa, as demonstrated by high-performance size exclusion chromatography. This fragment pattern differs considerably from that of the white-rot fungus Bjerkandera adusta, which preferentially released smaller lignocellulose fragments (0.8 kDa). The finding that X. polymorpha produced large lignocellulose fragments, along with the fact that high levels of hydrolytic enzymes (esterase 630 U l-1, xylanase 120 U l-1) were detected, indicates the cleavage of bonds between the lignin and hemicellulose moieties. PMID:16021487

Liers, C; Ullrich, R; Steffen, K T; Hatakka, A; Hofrichter, M

2006-01-01

127

Recognition of avirulence gene AvrLm1 from hemibiotrophic ascomycete Leptosphaeria maculans triggers salicylic acid and ethylene signaling in Brassica napus.  

PubMed

Interaction of a plant with a fungal pathogen is an encounter with hundreds of molecules. In contrast to this, a single molecule often decides between the disease and resistance. In the present article, we describe the defense responses triggered by AvrLm1, an avirulence gene from a hemibiotrophic ascomycete, Leptosphaeria maculans, responsible for an incompatible interaction with Brassica napus. Using multiple hormone quantification and expression analysis of defense-related genes, we investigated signaling events in Rlm1 plants infected with two sister isolates of L. maculans differentiated by the presence or absence of AvrLm1. Infection with the isolate carrying AvrLm1 increased the biosynthesis of salicylic acid (SA) and induced expression of the SA-associated genes ICS1, WRKY70, and PR-1, a feature characteristic of responses to biotrophic pathogens and resistance gene-mediated resistance. In addition to SA-signaling elements, we also observed the induction of ASC2a, HEL, and CHI genes associated with ethylene (ET) signaling. Pharmacological experiments confirmed the positive roles of SA and ET in mediating resistance to L. maculans. The unusual cooperation of SA and ET signaling might be a response to the hemibiotrophic nature of L. maculans. Our results also demonstrate the profound difference between the natural host B. napus and the model plant Arabidopsis in their response to L. maculans infection. PMID:22624662

Sašek, Vladimír; Nováková, Miroslava; Jind?ichová, Barbora; Bóka, Károly; Valentová, Olga; Burketová, Lenka

2012-09-01

128

Rapid Identification of Ascomycetous Yeasts from Clinical Specimens by a Molecular Method Based on Flow Cytometry and Comparison with Identifications from Phenotypic Assays†  

PubMed Central

This study was designed to compare the identification of ascomycetous yeasts recovered from clinical specimens by using phenotypic assays (PA) and a molecular flow cytometric (FC) method. Large-subunit rRNA domains 1 and 2 (D1/D2) gene sequence analysis was also performed and served as the reference for correct strain identification. A panel of 88 clinical isolates was tested that included representatives of nine commonly encountered species and six infrequently encountered species. The PA included germ tube production, fermentation of seven carbohydrates, morphology on corn meal agar, urease and phenoloxidase activities, and carbohydrate assimilation tests when needed. The FC method (Luminex) employed species-specific oligonucleotides attached to polystyrene beads, which were hybridized with D1/D2 amplicons from the unidentified isolates. The PA identified 81 of 88 strains correctly but misidentified 4 of Candida dubliniensis, 1 of C. bovina, 1 of C. palmioleophila, and 1 of C. bracarensis. The FC method correctly identified 79 of 88 strains and did not misidentify any isolate but did not identify nine isolates because oligonucleotide probes were not available in the current library. The FC assay takes approximately 5 h, whereas the PA takes from 2 h to 5 days for identification. In conclusion, PA did well with the commonly encountered species, was not accurate for uncommon species, and takes significantly longer than the FC method. These data strongly support the potential of FC technology for rapid and accurate identification of medically important yeasts. With the introduction of new antifungals, rapid, accurate identification of pathogenic yeasts is more important than ever for guiding antifungal chemotherapy.

Page, Brent T.; Shields, Christine E.; Merz, William G.; Kurtzman, Cletus P.

2006-01-01

129

Patterns of lignin degradation and oxidative enzyme secretion by different wood- and litter-colonizing basidiomycetes and ascomycetes grown on beech-wood.  

PubMed

The degradation of lignocellulose and the secretion of extracellular oxidoreductases were investigated in beech-wood (Fagus sylvatica) microcosms using 11 representative fungi of four different ecophysiological and taxonomic groups causing: (1) classic white rot of wood (e.g. Phlebia radiata), (2) 'nonspecific' wood rot (e.g. Agrocybe aegerita), (3) white rot of leaf litter (Stropharia rugosoannulata) or (4) soft rot of wood (e.g. Xylaria polymorpha). All strong white rotters produced manganese-oxidizing peroxidases as the key enzymes of ligninolysis (75-2200 mU g(-1)), whereas lignin peroxidase activity was not detectable in the wood extracts. Interestingly, activities of two recently discovered peroxidases - aromatic peroxygenase and a manganese-independent peroxidase of the DyP-type - were detected in the culture extracts of A. aegerita (up to 125 mU g(-1)) and Auricularia auricula-judae (up to 400 mU g(-1)), respectively. The activity of classic peroxidases correlated to some extent with the removal of wood components (e.g. Klason lignin) and the release of small water-soluble fragments (0.5-1.0 kDa) characterized by aromatic constituents. In contrast, laccase activity correlated with the formation of high-molecular mass fragments (30-200 kDa). The differences observed in the degradation patterns allow to distinguish the rot types caused by basidiomycetes and ascomycetes and may be suitable for following the effects of oxidative key enzymes (ligninolytic peroxidases vs. laccases, role of novel peroxidases) during wood decay. PMID:21631549

Liers, Christiane; Arnstadt, Tobias; Ullrich, René; Hofrichter, Martin

2011-10-01

130

Description of Taphrina antarctica f.a. sp. nov., a new anamorphic ascomycetous yeast species associated with Antarctic endolithic microbial communities and transfer of four Lalaria species in the genus Taphrina.  

PubMed

In the framework of a large-scale rock sampling in Continental Antarctica, a number of yeasts have been isolated. Two strains that are unable to grow above 20 °C and that have low ITS sequence similarities with available data in the public domain were found. The D1/D2 LSU molecular phylogeny placed them in an isolated position in the genus Taphrina, supporting their affiliation to a not yet described species. Because the new species is able to grow in its anamorphic state only, the species Taphrina antarctica f.a. (forma asexualis) sp. nov. has been proposed to accommodate both strains (type strain DBVPG 5268(T), DSM 27485(T) and CBS 13532(T)). Lalaria and Taphrina species are dimorphic ascomycetes, where the anamorphic yeast represents the saprotrophic state and the teleomorph is the parasitic counterpart on plants. This is the first record for this genus in Antarctica; since plants are absent on the continent, we hypothesize that the fungus may have focused on the saprotrophic part of its life cycle to overcome the absence of its natural host and adapt environmental constrains. Following the new International Code of Nomenclature for Algae, Fungi and Plants (Melbourne Code 2011) the reorganization of Taphrina-Lalaria species in the teleomorphic genus Taphrina is proposed. We emend the diagnosis of the genus Taphrina to accommodate asexual saprobic states of these fungi. Taphrina antarctica was registered in MycoBank under MB 808028. PMID:24893860

Selbmann, Laura; Turchetti, Benedetta; Yurkov, Andrey; Cecchini, Clarissa; Zucconi, Laura; Isola, Daniela; Buzzini, Pietro; Onofri, Silvano

2014-07-01

131

Real-time PCR-based monitoring of DNA pools in the tri-trophic interaction between Norway spruce, the rust Thekopsora areolata, and an opportunistic ascomycetous Phomopsis sp.  

PubMed

The difficulty in subculturing biotrophic fungi complicates etiological studies related to the associated plant diseases. By employing internal transcribed spacer rDNA-targeted quantitative real-time polymerase chain reaction, we now show that the heteroecious rust Thekopsora areolata, commonly associated in natural conditions to sapling shoots and cones of Norway spruce and leaves of wild bird cherry, frequently infects nursery-grown seedlings of the conifer. A spatial sampling scheme was used to investigate seedlings and saplings of Norway spruce showing phloem necrosis: the highest concentration of DNA of T. areolata was recorded in the area with necrotic phloem. The separate analysis of bark and wood tissues suggested that the initial spread of the rust to healthy tissues neighboring the infection site takes place in the bark. A Phomopsis species found to coexist with T. areolata in several seedlings showed very high DNA levels in the upper part of the lesion, and even in the visually healthy proximal tissues above the lesions, which indicates that the ascomycete, most probably a secondary invader following primary infection by T. areolata, has a latent stage during early host colonization. We hypothesize that this hemibiotrophic mode of infection contributes to the successful coexistence of Phomopsis with a biotrophic rust. PMID:18943238

Hietala, Ari M; Solheim, Halvor; Fossdal, Carl Gunnar

2008-01-01

132

Mitochondria-targeted plastoquinone derivatives as tools to interrupt execution of the aging program. 5. SkQ1 prolongs lifespan and prevents development of traits of senescence.  

PubMed

Very low (nano- and subnanomolar) concentrations of 10-(6'-plastoquinonyl) decyltriphenylphosphonium (SkQ1) were found to prolong lifespan of a fungus (Podospora anserina), a crustacean (Ceriodaphnia affinis), an insect (Drosophila melanogaster), and a mammal (mouse). In the latter case, median lifespan is doubled if animals live in a non-sterile vivarium. The lifespan increase is accompanied by rectangularization of the survival curves (an increase in survival is much larger at early than at late ages) and disappearance of typical traits of senescence or retardation of their development. Data summarized here and in the preceding papers of this series suggest that mitochondria-targeted antioxidant SkQ1 is competent in slowing down execution of an aging program responsible for development of age-related senescence. PMID:19120018

Anisimov, V N; Bakeeva, L E; Egormin, P A; Filenko, O F; Isakova, E F; Manskikh, V N; Mikhelson, V M; Panteleeva, A A; Pasyukova, E G; Pilipenko, D I; Piskunova, T S; Popovich, I G; Roshchina, N V; Rybina, O Yu; Saprunova, V B; Samoylova, T A; Semenchenko, A V; Skulachev, M V; Spivak, I M; Tsybul'ko, E A; Tyndyk, M L; Vyssokikh, M Yu; Yurova, M N; Zabezhinsky, M A; Skulachev, V P

2008-12-01

133

Coprophilous fungi: antibiotic discovery and functions in an underexplored arena of microbial defensive mutualism.  

PubMed

Microbial antibiotics can mediate mutualisms and interorganism communications. Herbivorous animal dung offers opportunities for discovery of new antibiotics from microbial communities that compete for a nutrient-rich, ephemeral resource. Distinct lineages form a specialized community of coprophilous (dung-colonizing) fungi. Bacteria, protists, invertebrates, the mammalian digestive system, and other fungi can pose challenges to their fitness in the dung environment. The well-characterized diversity of dung fungi offers accessible systems for dissecting the function of antibiotics and for exploring fungal genomes for new antibiotics. Their potential for antibiotic discovery is evidenced by a high frequency of antifungal antibiotics and bioactive secondary metabolites from limited prior efforts and from mapping biosynthetic pathways in the genomes of the coprophilous fungi Podospora anserina and Sordaria macrospora. PMID:23978412

Bills, Gerald F; Gloer, James B; An, Zhiqiang

2013-10-01

134

Glycolipid Intermembrane Transfer Is Accelerated by HET-C2, a Filamentous Fungus Gene Product Involved in the Cell--Cell Incompatibility Response†  

PubMed Central

Among filamentous fungi capable of mycelial growth, het genes play crucial roles by regulating heterokaryon formation between different individuals. When fusion occurs between fungal mycelia that differ genetically at their het loci, the resulting heterokaryotic cells are quickly destroyed. It is unclear how het gene products of Podospora anserina trigger heterokaryon incompatibility. One unexplored possibility is that glycosphingolipids play a role because the het-c2 gene encodes a protein that displays 32% sequence identity and an additional 30% similarity to the mammalian glycolipid transfer protein. Here, P. anserina protoplasts containing wild-type het-c2 genes were shown to have greater glycosphingolipid transfer activity than protoplasts with disrupted het-c2 genes, a condition previously linked to altered cell compatibility following hyphal fusion. The observed glycolipid transfer activity could not be accounted for by nonspecific lipid transfer protein activity. Direct assessment showed that purified, recombinant HET-C2 accelerates the intermembrane transfer of glycolipid in vitro, but that the HET-C2 activity is mitigated much less by negatively charged membranes than the mammalian glycolipid transfer protein. The findings are discussed within the context of HET-C2 being a member of an emerging family of ancestral sphingolipid transfer proteins that play important roles in cell proliferation and accelerated death.

Mattjus, Peter; Turcq, Beatrice; Pike, Helen M.; Molotkovsky, Julian G.; Brown, Rhoderick E.

2008-01-01

135

An Acetyltransferase Conferring Tolerance to Toxic Aromatic Amine Chemicals  

PubMed Central

Aromatic amines (AA) are a major class of environmental pollutants that have been shown to have genotoxic and cytotoxic potentials toward most living organisms. Fungi are able to tolerate a diverse range of chemical compounds including certain AA and have long been used as models to understand general biological processes. Deciphering the mechanisms underlying this tolerance may improve our understanding of the adaptation of organisms to stressful environments and pave the way for novel pharmaceutical and/or biotechnological applications. We have identified and characterized two arylamine N-acetyltransferase (NAT) enzymes (PaNAT1 and PaNAT2) from the model fungus Podospora anserina that acetylate a wide range of AA. Targeted gene disruption experiments revealed that PaNAT2 was required for the growth and survival of the fungus in the presence of toxic AA. Functional studies using the knock-out strains and chemically acetylated AA indicated that tolerance of P. anserina to toxic AA was due to the N-acetylation of these chemicals by PaNAT2. Moreover, we provide proof-of-concept remediation experiments where P. anserina, through its PaNAT2 enzyme, is able to detoxify the highly toxic pesticide residue 3,4-dichloroaniline in experimentally contaminated soil samples. Overall, our data show that a single xenobiotic-metabolizing enzyme can mediate tolerance to a major class of pollutants in a eukaryotic species. These findings expand the understanding of the role of xenobiotic-metabolizing enzyme and in particular of NATs in the adaptation of organisms to their chemical environment and provide a basis for new systems for the bioremediation of contaminated soils.

Martins, Marta; Rodrigues-Lima, Fernando; Dairou, Julien; Lamouri, Aazdine; Malagnac, Fabienne; Silar, Philippe; Dupret, Jean-Marie

2009-01-01

136

Programmed Ascospore Death in the Homothallic Ascomycete Coniochaeta tetraspora  

Microsoft Academic Search

Immature asci of Coniochaeta tetraspora originally contain eight uninucleate ascospores. Two ascospore pairs in each ascus survive and mature, and two die and degenerate. Arrangement of the two ascospore types in individual linear asci is what would be expected if death is controlled by a chromosomal gene segregating at the second meiotic division in about 50% of asci. Cultures originating

Namboori B. Raju; David D. Perkins

2000-01-01

137

Cytotoxic Dimeric Epipolythiodiketopiperazines from the Ascomycetous Fungus Preussia typharum.  

PubMed

Two new dimeric epipolythiodiketopiperazines, preussiadins A (1) and B (2), together with two known diastereomers, leptosins C (6) and A (7), were obtained from the mycelia of a Preussia typharum isolate. The structures of the new compounds were established by spectroscopic methods, and the absolute configurations of 1 and 2 were assigned by chemical transformations and comparisons of quantum chemical ECD and VCD calculations to experimental data. Compound 1 exhibited potent cytotoxic activity in the NCI-60 cell line panel with an average LC50 value of 251 nM. Further studies demonstrated that 1 circumvents P-glycoprotein-mediated drug resistance, yet had no significant antitumor activity in a xenograft UACC-62 melanoma model. PMID:24893224

Du, Lin; Robles, Andrew J; King, Jarrod B; Mooberry, Susan L; Cichewicz, Robert H

2014-06-27

138

Nuclear and Genome Dynamics in Multinucleate Ascomycete Fungi  

PubMed Central

Genetic variation between individuals is essential to evolution and adaptation. However, intra-organismic genetic variation also shapes the life histories of many organisms, including filamentous fungi. A single fungal syncytium can harbor thousands or millions of mobile and potentially genotypically different nuclei, each having the capacity to regenerate a new organism. Because the dispersal of asexual or sexual spores propagates individual nuclei in many of these species, selection acting at the level of nuclei creates the potential for competitive and cooperative genome dynamics. Recent work in Neurospora crassa and Sclerotinia sclerotiorum has illuminated how nuclear populations are coordinated for fungal growth and other behaviors and has revealed both molecular and physical mechanisms for preventing and policing inter-genomic conflict. Recent results from population-level genomic studies in a variety of filamentous fungi suggest that nuclear exchange between mycelia and recombination between heterospecific nuclei may be of more importance to fungal evolution, diversity and the emergence of newly virulent strains than has previously been recognized.

Roper, Marcus; Ellison, Chris; Taylor, John W.; Glass, N. Louise

2011-01-01

139

The NADPH Oxidase Complexes in Botrytis cinerea: Evidence for a Close Association with the ER and the Tetraspanin Pls1  

PubMed Central

NADPH oxidases (Nox) are major enzymatic systems that generate reactive-oxygen species (ROS) in multicellular eukaryotes. In several fungi they have been shown to be involved in sexual differentiation and pathogenicity. However, in contrast to the well characterized mammalian systems, basic information on the composition, recruitment, and localization of fungal Nox complexes and on the molecular mechanisms of their cellular effects are still lacking. Here we give a detailed analysis of components of the Nox complexes in the gray mold fungus Botrytis cinerea. It had previously been shown that the two catalytic transmembrane subunits BcNoxA and B are important for development of sclerotia and for full virulence, with BcNoxA being involved in spreading of lesions and BcNoxB in penetration; BcNoxR functions as a regulator of both subunits. Here we present evidence (using for the first time a functional GFP fusion able to complement the ?bcnoxA mutant) that BcNoxA localizes mainly to the ER and at the plasma membrane; BcNoxB shows a similar localization pattern, while the regulator BcNoxR is found in vesicles throughout the hyphae and at the hyphal tip. To identify possible interaction partners, which could be involved in the localization or recruitment of the Nox complexes, we functionally characterized the tetraspanin Pls1, a transmembrane protein, which had been suggested to be a NoxB-interacting partner in the saprophyte Podospora anserina. Knock-out experiments and GFP fusions substantiate a link between BcNoxB and BcPls1 because both deletion mutants have overlapping phenotypes (especially a defect in penetration), and the proteins show a similar localization pattern (ER). However, in contrast to the corresponding protein in P. anserina BcPls1 is important for female fertility, but not for ascospore germination.

Siegmund, Ulrike; Heller, Jens; van Kann, Jan A. L.; Tudzynski, Paul

2013-01-01

140

Vegetative incompatibility in the het-6 region of Neurospora crassa is mediated by two linked genes.  

PubMed Central

Non-self-recognition during asexual growth of Neurospora crassa involves restriction of heterokaryon formation via genetic differences at 11 het loci, including mating type. The het-6 locus maps to a 250-kbp region of LGIIL. We used restriction fragment length polymorphisms in progeny with crossovers in the het-6 region and a DNA transformation assay to identify two genes in a 25-kbp region that have vegetative incompatibility activity. The predicted product of one of these genes, which we designate het-6(OR), has three regions of amino acid sequence similarity to the predicted product of the het-e vegetative incompatibility gene in Podospora anserina and to the predicted product of tol, which mediates mating-type vegetative incompatibility in N. crassa. The predicted product of the alternative het-6 allele, HET-6(PA), shares only 68% amino acid identity with HET-6(OR). The second incompatibility gene, un-24(OR), encodes the large subunit of ribonucleotide reductase, which is essential for de novo synthesis of DNA. A region in the carboxyl-terminal portion of UN-24 is associated with incompatibility and is variable between un-24(OR) and the alternative allele un-24(PA). Linkage analysis indicates that the 25-kbp un-24-het-6 region is inherited as a block, suggesting that a nonallelic interaction may occur between un-24 and het-6 and possibly other loci within this region to mediate vegetative incompatibility in the het-6 region of N. crassa.

Smith, M L; Micali, O C; Hubbard, S P; Mir-Rashed, N; Jacobson, D J; Glass, N L

2000-01-01

141

Peroxisomes and sexual development in fungi.  

PubMed

Peroxisomes are versatile and dynamic organelles that are essential for the development of most eukaryotic organisms. In fungi, many developmental processes, such as sexual development, require the activity of peroxisomes. Sexual reproduction in fungi involves the formation of meiotic-derived sexual spores, often takes place inside multicellular fruiting bodies and requires precise coordination between the differentiation of multiple cell types and the progression of karyogamy and meiosis. Different peroxisomal functions contribute to the orchestration of this complex developmental process. Peroxisomes are required to sustain the formation of fruiting bodies and the maturation and germination of sexual spores. They facilitate the mobilization of reserve compounds via fatty acid ?-oxidation and the glyoxylate cycle, allowing the generation of energy and biosynthetic precursors. Additionally, peroxisomes are implicated in the progression of meiotic development. During meiotic development in Podospora anserina, there is a precise modulation of peroxisome assembly and dynamics. This modulation includes changes in peroxisome size, number and localization, and involves a differential activity of the protein-machinery that drives the import of proteins into peroxisomes. Furthermore, karyogamy, entry into meiosis and sorting of meiotic-derived nuclei into sexual spores all require the activity of peroxisomes. These processes rely on different peroxisomal functions and likely depend on different pathways for peroxisome assembly. Indeed, emerging studies support the existence of distinct import channels for peroxisomal proteins that contribute to different developmental stages. PMID:24046747

Peraza-Reyes, Leonardo; Berteaux-Lecellier, Véronique

2013-01-01

142

Lack of mitochondrial citrate synthase discloses a new meiotic checkpoint in a strict aerobe  

PubMed Central

Mitochondrial citrate synthase (mCS) is the initial enzyme of the tricarboxylic acid (TCA) cycle. Despite the key position of this protein in respiratory metabolism, very few studies have addressed the question of the effects of the absence of mCS in development. Here we report on the characterization of 15 point mutations and a complete deletion of the cit1 gene, which encodes mCS in the filamentous fungus Podospora anserina. This gene was identified genetically through a systematic search for suppressors of the metabolic defect of the peroxisomal pex2 mutants. The cit1 mutant strains exhibit no visible vegetative defects. However, they display an unexpected developmental phenotype: in homozygous crosses, cit1 mutations impair meiosis progression beyond the diffuse stage, a key stage of meiotic prophase. Enzyme assays, immunofluorescence and western blotting experiments show that the presence of the mCS protein is more important for completion of meiosis than its well-known enzyme activity. Combined with observations made in budding yeast, our data suggest that there is a general metabolic checkpoint at the diffuse stage in eukaryotes.

Ruprich-Robert, Gwenael; Zickler, Denise; Berteaux-Lecellier, Veronique; Velot, Christian; Picard, Marguerite

2002-01-01

143

MitoBreak: the mitochondrial DNA breakpoints database.  

PubMed

Mitochondrial DNA (mtDNA) rearrangements are key events in the development of many diseases. Investigations of mtDNA regions affected by rearrangements (i.e. breakpoints) can lead to important discoveries about rearrangement mechanisms and can offer important clues about the causes of mitochondrial diseases. Here, we present the mitochondrial DNA breakpoints database (MitoBreak; http://mitobreak.portugene.com), a free, web-accessible comprehensive list of breakpoints from three classes of somatic mtDNA rearrangements: circular deleted (deletions), circular partially duplicated (duplications) and linear mtDNAs. Currently, MitoBreak contains >1400 mtDNA rearrangements from seven species (Homo sapiens, Mus musculus, Rattus norvegicus, Macaca mulatta, Drosophila melanogaster, Caenorhabditis elegans and Podospora anserina) and their associated phenotypic information collected from nearly 400 publications. The database allows researchers to perform multiple types of data analyses through user-friendly interfaces with full or partial datasets. It also permits the download of curated data and the submission of new mtDNA rearrangements. For each reported case, MitoBreak also documents the precise breakpoint positions, junction sequences, disease or associated symptoms and links to the related publications, providing a useful resource to study the causes and consequences of mtDNA structural alterations. PMID:24170808

Damas, Joana; Carneiro, João; Amorim, António; Pereira, Filipe

2014-01-01

144

Peroxisomes and sexual development in fungi  

PubMed Central

Peroxisomes are versatile and dynamic organelles that are essential for the development of most eukaryotic organisms. In fungi, many developmental processes, such as sexual development, require the activity of peroxisomes. Sexual reproduction in fungi involves the formation of meiotic-derived sexual spores, often takes place inside multicellular fruiting bodies and requires precise coordination between the differentiation of multiple cell types and the progression of karyogamy and meiosis. Different peroxisomal functions contribute to the orchestration of this complex developmental process. Peroxisomes are required to sustain the formation of fruiting bodies and the maturation and germination of sexual spores. They facilitate the mobilization of reserve compounds via fatty acid ?-oxidation and the glyoxylate cycle, allowing the generation of energy and biosynthetic precursors. Additionally, peroxisomes are implicated in the progression of meiotic development. During meiotic development in Podospora anserina, there is a precise modulation of peroxisome assembly and dynamics. This modulation includes changes in peroxisome size, number and localization, and involves a differential activity of the protein-machinery that drives the import of proteins into peroxisomes. Furthermore, karyogamy, entry into meiosis and sorting of meiotic-derived nuclei into sexual spores all require the activity of peroxisomes. These processes rely on different peroxisomal functions and likely depend on different pathways for peroxisome assembly. Indeed, emerging studies support the existence of distinct import channels for peroxisomal proteins that contribute to different developmental stages.

Peraza-Reyes, Leonardo; Berteaux-Lecellier, Veronique

2013-01-01

145

Origins and Evolution of the HET-s Prion-Forming Protein: Searching for Other Amyloid-Forming Solenoids  

PubMed Central

The HET-s prion-forming domain from the filamentous fungus Podospora anserina is gaining considerable interest since it yielded the first well-defined atomic structure of a functional amyloid fibril. This structure has been identified as a left-handed beta solenoid with a triangular hydrophobic core. To delineate the origins of the HET-s prion-forming protein and to discover other amyloid-forming proteins, we searched for all homologs of the HET-s protein in a database of protein domains and fungal genomes, using a combined application of HMM, psi-blast and pGenThreader techniques, and performed a comparative evolutionary analysis of the N-terminal alpha-helical domain and the C-terminal prion-forming domain of HET-s. By assessing the tandem evolution of both domains, we observed that the prion-forming domain is restricted to Sordariomycetes, with a marginal additional sequence homolog in Arthroderma otae as a likely case of horizontal transfer. This suggests innovation and rapid evolution of the solenoid fold in the Sordariomycetes clade. In contrast, the N-terminal domain evolves at a slower rate (in Sordariomycetes) and spans many diverse clades of fungi. We performed a full three-dimensional protein threading analysis on all identified HET-s homologs against the HET-s solenoid fold, and present detailed structural annotations for identified structural homologs to the prion-forming domain. An analysis of the physicochemical characteristics in our set of structural models indicates that the HET-s solenoid shape can be readily adopted in these homologs, but that they are all less optimized for fibril formation than the P. anserina HET-s sequence itself, due chiefly to the presence of fewer asparagine ladders and salt bridges. Our combined structural and evolutionary analysis suggests that the HET-s shape has “limited scope” for amyloidosis across the wider protein universe, compared to the ‘generic’ left-handed beta helix. We discuss the implications of our findings on future identification of amyloid-forming proteins sharing the solenoid fold.

Gendoo, Deena M. A.; Harrison, Paul M.

2011-01-01

146

Identification and characterization of polymorphic minisatellites in the phytopathogenic ascomycete Leptosphaeria maculans.  

PubMed

Leptosphaeria maculans causes phoma stem canker, the most serious disease of oilseed rape world-wide. Sexual recombination is important in the pathogen life cycle and increases the risk of plant resistance genes being overcome rapidly. Thus, there is a need to develop easy-to-use molecular markers suitable for large-scale population genetic studies. The minisatellite MinLm1, showing six alleles in natural populations, has previously been used as a marker to survey populations. Here, we report the characterization of five new minisatellites (MinLm2-MinLm6), of which four were identified by a systematic search for tandemly repeated polymorphic regions in BAC-end sequencing data from L. maculans. Of 782 BAC-end sequences analysed, 43 possessed putative minisatellite-type repeats and four of these (MinLm3-MinLm6) displayed both consistent PCR amplification and size polymorphism in a collection of L. maculans isolates of diverse origins. Cloning and sequencing of each allele confirmed that polymorphism was due to variation in the repeat number of a core motif ranging from 11 bp (MinLm3) to 51 bp (MinLm4). The number of alleles found for each minisatellite ranged from three (MinLm4) to nine (MinLm2), with eight, five and six for MinLm3, MinLm5 and MinLm6, respectively. MinLm2-MinLm6 are all single locus markers specific to L. maculans and share some common features, such as conservation of core motifs and incomplete direct repeats in the flanking regions. To our knowledge, L. maculans is the first fungal species for which six polymorphic single locus minisatellite markers have been reported. PMID:15614492

Eckert, Maria; Gout, Lilian; Rouxel, Thierry; Blaise, Françoise; Jedryczka, Malgorzata; Fitt, Bruce; Balesdent, Marie-Hélène

2005-01-01

147

Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes  

Microsoft Academic Search

Fungal type I polyketides (PKs) are synthesized by PK synthases (PKSs) and include well known secondary metabolites such as the anticholesterol drug lovastatin and the potent natural carcinogen aflatoxin. Other type I PKs are known to be virulence factors for some plant pathogens and pigments such as melanin. In this study, a phylogenomic approach was used to investigate the origin

Scott Kroken; N. Louise Glass; John W. Taylor; O. C. Yoder; B. Gillian Turgeon

2003-01-01

148

Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes  

Microsoft Academic Search

Fungal type I polyketides (PKs) are synthesized by PK synthases (PKSs) and include well known secondary metabolites such as the anticholesterol drug lovastatin and the potent natural carcinogen aflatoxin. Other type I PKs are known to be virulence factors for some plant pathogens and pigments such as melanin. In this study, a phylogenomic approach was used to investigate the origin

Scott Kroken; N. Louise Glass; John W. Taylor; O. C. Yoder; B. Gillian Turgeon

2004-01-01

149

Candida leandrae sp. nov., an asexual ascomycetous yeast species isolated from tropical plants.  

PubMed

The novel yeast species Candida leandrae is described based on eight isolates from decaying fruits of Leandra reversa Cogn. (Melastomataceae) in an Atlantic rainforest site in Brazil, one from a Convolvulaceae flower in Costa Rica and one from a drosophilid in Hawai'i. The strains differed in their colony morphology, one being butyrous and smooth and the other being filamentous and rugose. Sequences of the D1/D2 domains of the large-subunit rRNA gene from both morphotypes were identical. C. leandrae belongs to the Kodamaea clade and is closely related to Candida restingae. The two species can be separated on the basis of growth at 37 degrees C and the assimilation of melezitose, negative in the novel species. The type culture of C. leandrae is strain UNESP 00-64R(T) (=CBS 9735(T)=NRRL Y-27757(T)). PMID:15545490

Ruivo, Carla C C; Lachance, Marc-André; Bacci, Maurício; Carreiro, Solange C; Rosa, Carlos A; Pagnocca, Fernando C

2004-11-01

150

Candida leandrae sp. nov., an asexual ascomycetous yeast species isolated from tropical plants  

Microsoft Academic Search

The novel yeast species Candida leandrae is described based on eight isolates from decaying fruits of Leandra reversa Cogn. (Melastomataceae) in an Atlantic rainforest site in Brazil, one from a Convolvulaceae flower in Costa Rica and one from a drosophilid in Hawai'i. The strains differed in their colony morphology, one being butyrous and smooth and the other being filamentous and

Carla C. C. Ruivo; Maurõ ´ cio; Solange C. Carreiro; Carlos A. Rosa; Fernando C. Pagnocca

2004-01-01

151

Candida gosingica sp. nov., an anamorphic ascomycetous yeast closely related to Scheffersomyces spartinae.  

PubMed

During surveys on yeast diversity in forest soils from Taiwan and Thailand, ten yeast strains isolated from different samples were found to have similar molecular and physiological characteristics. Sequence analysis of small subunit (SSU) rDNA, the D1/D2 domain of large subunit (LSU) rDNA and internal transcribed spacer (ITS)-5.8S rDNA demonstrated that these strains were closely related to Scheffersomyces spartinae. The novel strains could be differentiated from S. spartinae by a 0.9 ?% sequence divergence (5 substitutions, 0 gaps) in the D1/D2 domain of LSU rDNA, a 1.5 ?% divergence (8 substitutions, 0 gaps) in the ITS-5.8S rDNA and a 0.7 ?% divergence (12 substitutions, 2 gaps) in the SSU rDNA. The novel strains also showed specific patterns of electrophoretic karyotypes that differed from that of S. spartinae. Therefore, a novel yeast species, Candida gosingica sp. nov., is proposed to accommodate these strains. The type strain SJ7S11(T) (=BCRC 23194(T)=CBS 11433(T)) was assigned and deposited in the Bioresource Collection and Research Center (BCRC), Food Industry Development and Research Institute, Hsinchu, Taiwan, and Centraalbureau voor Schimmelcultures (CBS), Utrecht, The Netherlands. PMID:20382788

Chang, Chin-Feng; Yao, Cheng-Hsu; Young, Shuh-Sen; Limtong, Savitree; Kaewwichian, Rungluk; Srisuk, Nantana; Lee, Ching-Fu

2011-03-01

152

WetA is required for conidiogenesis and conidium maturation in the ascomycete fungus Fusarium graminearum.  

PubMed

Fusarium graminearum, a prominent fungal pathogen that infects major cereal crops, primarily utilizes asexual spores to spread disease. To understand the molecular mechanisms underlying conidiogenesis in F. graminearum, we functionally characterized the F. graminearum ortholog of Aspergillus nidulans wetA, which has been shown to be involved in conidiogenesis and conidium maturation. Deletion of F. graminearum wetA did not alter mycelial growth, sexual development, or virulence, but the wetA deletion mutants produced longer conidia with fewer septa, and the conidia were sensitive to acute stresses, such as oxidative stress and heat stress. Furthermore, the survival rate of aged conidia from the F. graminearum wetA deletion mutants was reduced. The wetA deletion resulted in vigorous generation of single-celled conidia through autophagy-dependent microcycle conidiation, indicating that WetA functions to maintain conidial dormancy by suppressing microcycle conidiation in F. graminearum. Transcriptome analyses demonstrated that most of the putative conidiation-related genes are expressed constitutively and that only a few genes are specifically involved in F. graminearum conidiogenesis. The conserved and distinct roles identified for WetA in F. graminearum provide new insights into the genetics of conidiation in filamentous fungi. PMID:24186953

Son, Hokyoung; Kim, Myung-Gu; Min, Kyunghun; Lim, Jae Yun; Choi, Gyung Ja; Kim, Jin-Cheol; Chae, Suhn-Kee; Lee, Yin-Won

2014-01-01

153

The artificial cultivation of medicinal Caterpillar Fungus, Ophiocordyceps sinensis (Ascomycetes): a review.  

PubMed

Caterpillar fungus, Ophiocordyceps sinensis (syn. Cordyceps sinensis), is highly valued in China as a dietary supplement or tonic food and natural remedy. The combination of the fungus and dead insect has been used as a traditional Chinese medicine for centuries, and evidence shows its efficacy on immunomodulatory potentials. The price of O. sinensis has continued to increase over the last few years due to growing worldwide demand, driving research to determine methods of artificial cultivation to make O. sinensis a more affordable material for commercial trade. This study highlights many aspects of artificial cultivation of O. sinensis, including separation of the anamorph, culture of the mycelium, cultivation of the fruiting bodies, bioecological characteristics of the host insect, and two patterns of artificial cultivation. In addition, this review discusses the current state, limitations, remedies, and future prospects, aiming to draw researchers' attention to the new frontier of research needs in this context. PMID:24266368

Yue, Kai; Ye, Meng; Lin, Xiao; Zhou, Zuji

2013-01-01

154

Functional Analyses of Two Acetyl Coenzyme A Synthetases in the Ascomycete Gibberella zeae ? †  

PubMed Central

Acetyl coenzyme A (acetyl-CoA) is a crucial metabolite for energy metabolism and biosynthetic pathways and is produced in various cellular compartments with spatial and temporal precision. Our previous study on ATP citrate lyase (ACL) in Gibberella zeae revealed that ACL-dependent acetyl-CoA production is important for histone acetylation, especially in sexual development, but is not involved in lipid synthesis. In this study, we deleted additional acetyl-CoA synthetic genes, the acetyl-CoA synthetases (ACS genes ACS1 and ACS2), to identify alternative acetyl-CoA production mechanisms for ACL. The ACS1 deletion resulted in a defect in sexual development that was mainly due to a reduction in 1-palmitoyl-2-oleoyl-3-linoleoyl-rac-glycerol production, which is required for perithecium development and maturation. Another ACS coding gene, ACS2, has accessorial functions for ACS1 and has compensatory functions for ACL as a nuclear acetyl-CoA producer. This study showed that acetate is readily generated during the entire life cycle of G. zeae and has a pivotal role in fungal metabolism. Because ACSs are components of the pyruvate-acetaldehyde-acetate pathway, this fermentation process might have crucial roles in various physiological processes for filamentous fungi.

Lee, Seunghoon; Son, Hokyoung; Lee, Jungkwan; Min, Kyunghun; Choi, Gyung Ja; Kim, Jin-Cheol; Lee, Yin-Won

2011-01-01

155

Intracellular targeting of ascomycetous catalase-peroxidases (KatG1s).  

PubMed

Bifunctional catalase-peroxidases (KatGs) are heme oxidoreductases widely spread among bacteria, archaea and among lower eukaryotes. In fungi, two KatG groups with different localization have evolved, intracellular (KatG1) and extracellular (KatG2) proteins. Here, the cloning, expression analysis and subcellular localization of two novel katG1 genes from the soil fungi Chaetomium globosum and Chaetomium cochliodes are reported. Whereas, the metalloenzyme from Ch. globosum is expressed constitutively, Ch. cochliodes KatG1 reveals a slight increase in expression after induction of oxidative stress by cadmium ions and hydrogen peroxide. The intronless open reading frames of both Sordariomycetes katG1 genes as well as of almost all fungal katG1s possess two peroxisomal targeting signals (PTS1 and PTS2). Peroxisomal localization of intracellular eukaryotic catalase-peroxidases was verified by organelle separation and immunofluorescence microscopy. Co-localization with the peroxisomal enzyme 3-ketoacyl-CoA-thiolase was demonstrated for KatGs from Magnaporthe grisea, Chaetomium globosum and Chaetomium cochliodes. The physiological role of fungal catalase-peroxidases is discussed. PMID:23589225

Zámocký, Marcel; Sekot, Gerhard; Bu?ková, Mária; Godo?íková, Jana; Schäffer, Christina; Farkašovský, Marián; Obinger, Christian; Polek, Bystrík

2013-06-01

156

Candida ecuadorensis sp. nov., an ascomycetous yeast species found in two separate regions of Ecuador.  

PubMed

In the course of an on-going study aimed at cataloguing the natural yeast biodiversity found in Ecuador, two strains (CLQCA 13-025 and CLQCA 20-004(T)) were isolated from samples of cow manure and rotten wood collected in two separate provinces of the country (Orellana and Bolívar). These strains were found to represent a novel yeast species based on the sequences of their D1/D2 domain of the large-subunit (LSU) rRNA gene and their physiological characteristics. Phylogenetic analysis based on LSU D1/D2 sequences revealed this novel species to belong to the Metschnikowia clade and to be most closely related to Candida suratensis, a species recently discovered in a mangrove forest in Thailand. The species name of Candida ecuadorensis sp. nov. is proposed to accommodate these strains, with strain CLQCA 20-004(T) (=CBS 12653(T) = NCYC 3782(T)) designated as the type strain. PMID:23104360

James, Stephen A; Carvajal Barriga, Enrique Javier; Barahona, Patricia Portero; Cross, Kathryn; Bond, Christopher J; Roberts, Ian N

2013-01-01

157

Keratitis due to the wood saprobic ascomycete, Auerswaldia lignicola (Family Botryosphaeriaceae), in a carpenter in India.  

PubMed

Keratitis due to Auerswaldia lignicola in a 32-year-old Indian male carpenter is described. At presentation, the patient reported persistent pain and tearing (left eye) in spite of topical antimicrobial therapy for more than 3 weeks. Clinically, mycotic keratitis was suspected, and direct microscopy of corneal scrapings stained by lactophenol cotton blue and Gram stains revealed broad septate hyphae. Intensive topical antifungal therapy was then given for 15 days. The keratitis continued to progress, necessitating therapeutic penetrating keratoplasty. Following the keratoplasty, there was rapid reduction in inflammation and gradual quietening of the eye. Brown-black fungal colonies resembling Lasiodiplodia theobromae were isolated from corneal scrape and corneal button (post-surgery) material on Sabouraud glucose-neopeptone agar; however, sporulation did not occur, so the morphological identification could not be confirmed. Sequence analysis of the 18S rRNA region of extracted fungal genomic DNA yielded an identification of A. lignicola Ariyawansa, J.K. Liu & K.D. Hyde; the sequence data have been deposited in GenBank (A. lignicola strain DK/V4, accession number KC866317.1). Medical management of keratitis due to such rarely reported fungal species may be difficult, necessitating surgical procedures. PMID:24158617

Ruban, Vasanthakumar Vasantha; Kaliamurthy, Jayaraman; Dineshkumar, Muniyandi; Jesudasan, Christadoss Arul Nelson; Geraldine, Pitchairaj; Thomas, Philip Aloysius

2013-12-01

158

WetA Is Required for Conidiogenesis and Conidium Maturation in the Ascomycete Fungus Fusarium graminearum  

PubMed Central

Fusarium graminearum, a prominent fungal pathogen that infects major cereal crops, primarily utilizes asexual spores to spread disease. To understand the molecular mechanisms underlying conidiogenesis in F. graminearum, we functionally characterized the F. graminearum ortholog of Aspergillus nidulans wetA, which has been shown to be involved in conidiogenesis and conidium maturation. Deletion of F. graminearum wetA did not alter mycelial growth, sexual development, or virulence, but the wetA deletion mutants produced longer conidia with fewer septa, and the conidia were sensitive to acute stresses, such as oxidative stress and heat stress. Furthermore, the survival rate of aged conidia from the F. graminearum wetA deletion mutants was reduced. The wetA deletion resulted in vigorous generation of single-celled conidia through autophagy-dependent microcycle conidiation, indicating that WetA functions to maintain conidial dormancy by suppressing microcycle conidiation in F. graminearum. Transcriptome analyses demonstrated that most of the putative conidiation-related genes are expressed constitutively and that only a few genes are specifically involved in F. graminearum conidiogenesis. The conserved and distinct roles identified for WetA in F. graminearum provide new insights into the genetics of conidiation in filamentous fungi.

Son, Hokyoung; Kim, Myung-Gu; Min, Kyunghun; Lim, Jae Yun; Choi, Gyung Ja; Kim, Jin-Cheol; Chae, Suhn-Kee

2014-01-01

159

The Ascomycete Verticillium longisporum Is a Hybrid and a Plant Pathogen with an Expanded Host Range  

Microsoft Academic Search

Hybridization plays a central role in plant evolution, but its overall importance in fungi is unknown. New plant pathogens are thought to arise by hybridization between formerly separated fungal species. Evolution of hybrid plant pathogens from non-pathogenic ancestors in the fungal-like protist Phytophthora has been demonstrated, but in fungi, the most important group of plant pathogens, there are few well-characterized

Patrik Inderbitzin; R. Michael Davis; Richard M. Bostock; Krishna V. Subbarao; Anastasia Litvintseva

2011-01-01

160

Three Types of Geranylgeranyl Diphosphate Synthases from the Medicinal Caterpillar Fungus, Cordyceps militaris (Ascomycetes).  

PubMed

Geranylgeranyl diphosphate synthase (GGPPS) is a key enzyme in the carotenoid biosynthetic pathway, catalyzing the synthesis of its C20 precursor. In the present study, three types of ggpps genes were cloned and analyzed from the Caterpillar Medicinal Fungus Cordyceps militaris, a valued carotenoid-producing species. The sequences were named as ggpps727, ggpps191, and ggpps595. The open reading frame codes for predicted polypeptides of 464, 550, and 431 aa. Three predicted GGPPSs had a high similarity to that from Beauveria bassiana ARSEF 2860 with identity of 73%, 71%, and 56%, respectively. Homology comparison of the deduced peptide sequences of the various GGPPSs revealed highly conserved domains. Both GGPPS727 and GGPPS191 from C. militaris contained all five domains highly conserved among prenyltransferases as well as two aspartate-rich DDXX(XX)D motifs in domains II and V, which have been proven essential for prenyltransferase activity. By constructing the phylogenetic tree of fungal GGPPSs, it was found that fungi-derived GGPPSs could be divided into three clusters, suggesting there were three types of GGPPSs in fungi. Each type may be responsible for a different metabolism. Three types of GGPPSs from C. militaris belonged to the different clusters separately. Expression analysis of three ggpps genes during the fruit body cultivation of C. militaris by real-time polymerase chain reaction (PCR) suggested the ggpps 191 gene may be involved in the synthesis of carotenoids and ggpps 727 may be responsible for primary metabolism. This is the first report of the GGPPS from C. militaris, a valued edible and medicinal fungus. PMID:24941033

Lian, Tiantian; Dong, Cai-Hong; Yang, Tao; Sun, Junde

2014-01-01

161

Isolation, structure and antibacterial activity of pleosporone from a pleosporalean ascomycete discovered by using antisense strategy.  

PubMed

Protein synthesis is one of the best antibacterial targets that have led to the development of a number of highly successful clinical drugs. Protein synthesis is catalyzed by ribosome, which is comprised of a number of ribosomal proteins that help the catalysis process. Ribosomal protein S4 (RPSD) is one of the proteins that is a part of the ribosomal machinery and is a potential new target for the discovery of antibacterial agents. Screening of microbial extracts using antisense-sensitized rpsD Staphylococcus aureus strain led to the isolation of pleosporone, a new compound, with modest antibacterial activities with MIC ranging from 1 to 64 microg/mL. This compound showed the highest sensitivity for Streptococcus pneumoniae and Haemophilus influenzae, and exhibited MIC's of 4 and 1 microg/mL, respectively. Pleosporone showed modest selectivity for the inhibition of RNA synthesis compared to DNA and protein synthesis, and showed activity against HeLa cells. Isolation, structure elucidation, and biological activity of pleosporone have been described. PMID:18442914

Zhang, Chaowei; Ondeyka, John G; Zink, Deborah L; Basilio, Angela; Vicente, Francisca; Collado, Javier; Platas, Gonzalo; Huber, Joann; Dorso, Karen; Motyl, Mary; Byrne, Kevin; Singh, Sheo B

2009-03-15

162

Lucidascocarpa pulchella, a new ascomycete genus and species from freshwater habitats in the American tropics.  

PubMed

A new fungus collected from submerged wood in Costa Rica and Ecuador has ascostromatic ascomata with fissitunicate asci and lacks pseudoparaphyses, characters that place it in the Dothideaceae (Dothideales). It is unusual in the order because it has white ascomata. Based on other morphological characters however this fungus could not be accommodated in any existing genus in the Dothideaceae and it is described herein as a new genus and species, Lucidascocarpa pulchella. These morphological features are characteristic of L. pulchella: ascomata glistening, white, each with a long, periphysate neck; a membranous peridium composed of 5-7 thin-walled, hyaline cells; pseudoparaphyses absent; asci fissitunicate, clavate, eight-spored; ascospores seven-septate, hyaline, multiguttulate, verruculose, surrounded by a large, regular, gelatinous sheath. PMID:18833757

Ferrer, Astrid; Raja, Huzefa A; Shearer, Carol A

2008-01-01

163

Identification and Isolation of Two Ascomycete Fungi from Spores of the Arbuscular Mycorrhizal Fungus Scutellospora castanea  

Microsoft Academic Search

Two filamentous fungi with different phenotypes were isolated from crushed healthy spores or perforated dead spores of the arbuscular mycorrhizal fungus (AMF) Scutellospora castanea. Based on comparative se- quence analysis of 5.8S ribosomal DNA and internal transcribed spacer fragments, one isolate, obtained from perforated dead spores only, was assigned to the genus Nectria, and the second, obtained from both healthy

Mohamed Hijri; Dirk Redecker; J. A. M.-C. Petetot; Kerstin Voigt; Johannes Wostemeyer; Ian R. Sanders

2002-01-01

164

The Ascomycete Verticillium longisporum Is a Hybrid and a Plant Pathogen with an Expanded Host Range  

PubMed Central

Hybridization plays a central role in plant evolution, but its overall importance in fungi is unknown. New plant pathogens are thought to arise by hybridization between formerly separated fungal species. Evolution of hybrid plant pathogens from non-pathogenic ancestors in the fungal-like protist Phytophthora has been demonstrated, but in fungi, the most important group of plant pathogens, there are few well-characterized examples of hybrids. We focused our attention on the hybrid and plant pathogen Verticillium longisporum, the causal agent of the Verticillium wilt disease in crucifer crops. In order to address questions related to the evolutionary origin of V. longisporum, we used phylogenetic analyses of seven nuclear loci and a dataset of 203 isolates of V. longisporum, V. dahliae and related species. We confirmed that V. longisporum was diploid, and originated three different times, involving four different lineages and three different parental species. All hybrids shared a common parent, species A1, that hybridized respectively with species D1, V. dahliae lineage D2 and V. dahliae lineage D3, to give rise to three different lineages of V. longisporum. Species A1 and species D1 constituted as yet unknown taxa. Verticillium longisporum likely originated recently, as each V. longisporum lineage was genetically homogenous, and comprised species A1 alleles that were identical across lineages.

Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

2011-01-01

165

Mating systems in representatives of Parmeliaceae, Ramalinaceae and Physciaceae (Lecanoromycetes, lichen-forming ascomycetes).  

PubMed

The progeny of meiosis of eight Parmeliaceae, two Ramalinaceae and seven Physciaceae were subjected to fingerprint analysis using RAPD-PCR applied to single spore isolates. The sample set included common and widespread rarely fertile species (Parmelia sulcata, Pseudevernia furfuracea, Physcia tenella), local to common, infrequently fertile species (Melanelixia glabra, Parmelina tiliacea, Xanthoparmelia conspersa, X. stenophylla, Anaptychia runcinata, Diploicia canescen, Physconia distorta), local to rare, infrequently or regularly fertile species with declining distributions (Parmelina carporrhizans, P. quercina, Ramalina fastigiata, R. fraxinea, Anaptychia ciliaris), and local to common, regularly fertile species (Physcia aipolia, P. stellaris). All species turned out to be heterothallic, polymorphisms among RAPD markers ranging from 10-87%. The significance of these findings for population genetics and conservation biology, and potential reasons for infrequent ascoma formation in some of the species are discussed. PMID:17512182

Honegger, Rosmarie; Zippler, Undine

2007-04-01

166

Allelic variation at a hypervariable compound microsatellite locus in the ascomycete Ascochyta rabiei  

Microsoft Academic Search

The genome of the fungal chickpea pathogen Ascochyta rabiei was screened for polymorphisms by microsatellite-primed PCR. While ethidium-bromide staining of electrophoretically separated\\u000a amplification products showed only limited polymorphism among 24 Tunisian A. rabiei isolates, Southern hybridization of purified PCR fragments to restriction digests of fungal DNA revealed polymorphic DNA\\u000a fingerprints. One particular probe that gave rise to a hypervariable single-locus

J. Geistlinger; K. Weising; W. J. Kaiser; G. Kahl

1997-01-01

167

Isolation and characterization of MAT genes in the symbiotic ascomycete Tuber melanosporum.  

PubMed

• The genome of Tuber melanosporum has recently been sequenced. Here, we used this information to identify genes involved in the reproductive processes of this edible fungus. The sequenced strain (Mel28) possesses only one of the two master genes required for mating, that is, the gene that codes for the high mobility group (HMG) transcription factor (MAT1-2-1), whereas it lacks the gene that codes for the protein containing the ?-box- domain (MAT1-1-1), suggesting that this fungus is heterothallic. • A PCR-based approach was initially employed to screen truffles for the presence of the MAT1-2-1 gene and amplify the conserved regions flanking the mating type (MAT) locus. The MAT1-1-1 gene was finally identified using primers designed from the conserved regions of strains that lack the MAT1-2-1 gene. • Mating type-specific primer pairs were developed to screen asci and gleba from truffles of different origins and to genotype single ascospores within the asci. These analyses provided definitive evidence that T. melanosporum is a heterothallic species with a MAT locus that is organized similarly to those of ancient fungal lineages. • A greater understanding of the reproductive mechanisms that exist in Tuber spp. allows for optimization of truffle plantation management strategies. PMID:20961294

Rubini, Andrea; Belfiori, Beatrice; Riccioni, Claudia; Tisserant, Emilie; Arcioni, Sergio; Martin, Francis; Paolocci, Francesco

2011-02-01

168

Nitrate reductase of the ascomycetous fungus, Leptosphaeria maculans : gene sequence and chromosomal location  

Microsoft Academic Search

The nitrate reductase (niaD) gene was isolated from the phytopathogenic loculoascomycete Leptosphaeria maculans by screening a genomic DNA library with the Aspergillus nidulans niaD gene. The L. maculans niaD gene is the first protein-encoding gene characterised from this fungus. It encodes a predicted protein of 893 amino acids and contains four putative introns at positions in the gene equivalent to

Robin S. B. Williams; Meryl A. Davis; Barbara J. Howlett

1994-01-01

169

Candida amazonensis sp. nov., an ascomycetous yeast isolated from rotting wood in the Amazonian forest.  

PubMed

Five strains of a novel yeast species were isolated from rotting wood samples collected in an Amazonian forest site in the state of Roraima, northern Brazil. The sequences of the D1/D2 domains of the large subunit of the rRNA gene showed that this species belongs to the Scheffersomyces clade and is related to Candida coipomoensis, Candida lignicola and Candida queiroziae. The novel species Candida amazonensis sp. nov. is proposed to accommodate these isolates. The type strain of C. amazonensis sp. nov. is UFMG-HMD-26.3(T) ( = CBS 12363(T) = NRRL Y-48762(T)). PMID:21856981

Cadete, Raquel M; Melo, Monaliza A; Lopes, Mariana R; Pereira, Gilmara M D; Zilli, Jerri E; Vital, Marcos J S; Gomes, Fátima C O; Lachance, Marc-André; Rosa, Carlos A

2012-06-01

170

Colonization of roots of cultivated Solanum lycopersicum by dark septate and other ascomycetous endophytes.  

PubMed

Tomato (Solanum lycopersicum L.) roots from four different crop sites in Colombia were surface sterilized and 51 fungal isolates were obtained and conserved for further analysis. Based on microscopical observations and growth characteristics, 20 fungal isolates corresponded to genus Fusarium, six presented asexual conidia different from Fusarium, eight were sterile mycelia, seven of which had dark septate hyphae and 17 did not continue to grow on plates after being recovered from conservation. Growth on different media, detailed morphological characterization and ITS region sequencing of the six sporulating and eight sterile isolates revealed that they belonged to different orders of Ascomycota and that the sterile dark septate endophytes did not correspond to the well known Phialocephala group. Interactions of nine isolates with tomato plantlets were assessed in vitro. No effect on shoot development was revealed, but three isolates caused brown spots in roots. Colonization patterns as analyzed by confocal microscopy differed among the isolates and ranged from epidermal to cortical penetration. Altogether 11 new isolates from root endophytic fungi were obtained, seven of which showed features of dark septate endophytes. Four known morphotypes were represented by five isolates, while six isolates belonged to five morphotypes of putative new unknown species. PMID:21307164

Andrade-Linares, Diana Rocio; Grosch, Rita; Franken, Philipp; Rexer, Karl-Heinz; Kost, Gerhard; Restrepo, Silvia; de Garcia, Maria Caridad Cepero; Maximova, Eugenia

2011-01-01

171

Fungicidal elements accumulated in Cryptothecia punctulata (Ascomycetes lichen) of an arecanut orchard in South India.  

PubMed

Different nutrient elements were analyzed in the lichen Cryptothecia punctulata collected from the arecanut trees which were exposed to several sprays of a fungicide Bordeaux mixture. The study revealed the accumulation of fungicidal elements such as Cu, Ca and S in higher concentration of 575.4, 10,000 and 21,000 microg g(-1), respectively. PMID:16161989

Nayaka, S; Singh, P K; Upreti, D K

2005-04-01

172

Occurrence of usnic acid in Usnea laevis Nylander (lichenized ascomycetes) from the Venezuelan Andes.  

PubMed

The presence of usnic acid in the lichen Usnea laevis Nyl. from the Venezuelan Andes was detected through chromotographic (TLC) and spectroscopic (IR, MS, 1H-NMR) methods. This compound was present in a concentration of 2.7% in the thallus. Usnic acid has a reported antibiotic activity and the lichen is utilized for medicinal purposes by Andean farmers. PMID:10473183

Marcano, V; Rodriguez-Alcocer, V; Morales Méndez, A

1999-09-01

173

Balticolid: A New 12-Membered Macrolide with Antiviral Activity from an Ascomycetous Fungus of Marine Origin  

PubMed Central

A new 12-membered macrolide, balticolid (1) was isolated from the EtOAc extract of the culture broth of fungal strain 222 belonging to the Ascomycota, which was found on driftwood collected from the coast of the Greifswalder Bodden, Baltic Sea, Germany. The structure of balticolid was determined to be (3R,11R), (4E,8E)-3-hydroxy-11-methyloxacyclododeca-4,8-diene-1,7-dione using extensive spectral data as well as the modified Mosher ester method. Balticolid (1) displayed anti-HSV-1 activity with an IC50 value of 0.45 ?M.

Shushni, Muftah A. M.; Singh, Rajinder; Mentel, Renate; Lindequist, Ulrike

2011-01-01

174

Bistability and hysteresis of the 'Secteur' differentiation are controlled by a two-gene locus in Nectria haematococca  

PubMed Central

Background Bistability and hysteresis are increasingly recognized as major properties of regulatory networks governing numerous biological phenomena, such as differentiation and cell cycle progression. The full scope of the underlying molecular mechanisms leading to bistability and hysteresis remains elusive. Nectria haemaotcocca, a saprophytic or pathogenic fungus with sexual reproduction, exhibits a bistable morphological modification characterized by a reduced growth rate and an intense pigmentation. Bistability is triggered by the presence or absence of ?, a cytoplasmic determinant. This determinant spreads in an infectious manner in the hyphae of the growing margin, insuring hysteresis of the differentiation. Results Seven mutants specifically affected in the generation of ? were selected through two different screening strategies. The s1 and s2 mutations completely abolish the generation of ? and of its morphological expression, the Secteur. The remaining five mutations promote its constitutive generation, which determines an intense pigmentation but not growth alteration. The seven mutations map at the same locus, Ses (for 'Secteur-specific'). The s2 mutant was obtained by an insertional mutagenesis strategy, which permitted the cloning of the Ses locus. Sequence and transcription analysis reveals that Ses is composed of two closely linked genes, SesA, mutated in the s1 and s2 mutant strains, and SesB, mutated in the s* mutant strains. SesB shares sequence similarity with animal and fungal putative proteins, with potential esterase/lipase/thioesterase activity, whereas SesA is similar to proteins of unknown function present only in the filamentous fungi Fusarium graminearum and Podospora anserina. Conclusions The cloning of Ses provides evidence that a system encoded by two linked genes directs a bistable and hysteretic switch in a eukaryote. Atypical regulatory relations between the two proteins may account for the hysteresis of Secteur differentiation.

Graziani, Stephane; Silar, Philippe; Daboussi, Marie-Josee

2004-01-01

175

Regulation of conidiation and adenylyl cyclase levels by the Galpha protein GNA-3 in Neurospora crassa.  

PubMed

We have identified a new gene encoding the G protein alpha subunit, gna-3, from the filamentous fungus Neurospora crassa. The predicted amino acid sequence of GNA-3 is most similar to the Galpha proteins MOD-D, MAGA, and CPG-2 from the saprophytic fungus Podospora anserina and the pathogenic fungi Magnaporthe grisea and Cryphonectria parasitica, respectively. Deletion of gna-3 leads to shorter aerial hyphae and premature, dense conidiation during growth on solid medium or in standing liquid cultures and to inappropriate conidiation in submerged culture. The conidiation and aerial hypha defects of the Deltagna-3 strain are similar to those of a previously characterized adenylyl cyclase mutant, cr-1. Supplementation with cyclic AMP (cAMP) restores wild-type morphology to Deltagna-3 strains in standing liquid cultures. Solid medium augmented with exogenous cAMP suppresses the premature conidiation defect, but aerial hypha formation is still reduced. Submerged-culture conidiation is refractory to cAMP but is suppressed by peptone. In addition, Deltagna-3 submerged cultures express the glucose-repressible gene, qa-2, to levels greatly exceeding those observed in the wild type under carbon-starved conditions. Deltagna-3 strains exhibit reduced fertility in homozygous crosses during the sexual cycle; exogenous cAMP has no effect on this phenotype. Intracellular steady-state cAMP levels of Deltagna-3 strains are decreased 90% relative to the wild type under a variety of growth conditions. Reduced intracellular cAMP levels in the Deltagna-3 strain correlate with lower adenylyl cyclase activity and protein levels. These results demonstrate that GNA-3 modulates conidiation and adenylyl cyclase levels in N. crassa. PMID:11003665

Kays, A M; Rowley, P S; Baasiri, R A; Borkovich, K A

2000-10-01

176

Contribution of Specific Residues of the ?-Solenoid Fold to HET-s Prion Function, Amyloid Structure and Stability.  

PubMed

The [Het-s] prion of the fungus Podospora anserina represents a good model system for studying the structure-function relationship in amyloid proteins because a high resolution solid-state NMR structure of the amyloid prion form of the HET-s prion forming domain (PFD) is available. The HET-s PFD adopts a specific ?-solenoid fold with two rungs of ?-strands delimiting a triangular hydrophobic core. A C-terminal loop folds back onto the rigid core region and forms a more dynamic semi-hydrophobic pocket extending the hydrophobic core. Herein, an alanine scanning mutagenesis of the HET-s PFD was conducted. Different structural elements identified in the prion fold such as the triangular hydrophobic core, the salt bridges, the asparagines ladders and the C-terminal loop were altered and the effect of these mutations on prion function, fibril structure and stability was assayed. Prion activity and structure were found to be very robust; only a few key mutations were able to corrupt structure and function. While some mutations strongly destabilize the fold, many substitutions in fact increase stability of the fold. This increase in structural stability did not influence prion formation propensity in vivo. However, if an Ala replacement did alter the structure of the core or did influence the shape of the denaturation curve, the corresponding variant showed a decreased prion efficacy. It is also the finding that in addition to the structural elements of the rigid core region, the aromatic residues in the C-terminal semi-hydrophobic pocket are critical for prion propagation. Mutations in the latter region either positively or negatively affected prion formation. We thus identify a region that modulates prion formation although it is not part of the rigid cross-? core, an observation that might be relevant to other amyloid models. PMID:24945274

Daskalov, Asen; Gantner, Matthias; Wälti, Marielle Aulikki; Schmidlin, Thierry; Chi, Celestine N; Wasmer, Christian; Schütz, Anne; Ceschin, Johanna; Clavé, Corinne; Cescau, Sandra; Meier, Beat; Riek, Roland; Saupe, Sven J

2014-06-01

177

Metabolic engineering of muconic acid production in Saccharomyces cerevisiae.  

PubMed

The dicarboxylic acid muconic acid has garnered significant interest due to its potential use as a platform chemical for the production of several valuable consumer bio-plastics including nylon-6,6 and polyurethane (via an adipic acid intermediate) and polyethylene terephthalate (PET) (via a terephthalic acid intermediate). Many process advantages (including lower pH levels) support the production of this molecule in yeast. Here, we present the first heterologous production of muconic acid in the yeast Saccharomyces cerevisiae. A three-step synthetic, composite pathway comprised of the enzymes dehydroshikimate dehydratase from Podospora anserina, protocatechuic acid decarboxylase from Enterobacter cloacae, and catechol 1,2-dioxygenase from Candida albicans was imported into yeast. Further genetic modifications guided by metabolic modeling and feedback inhibition mitigation were introduced to increase precursor availability. Specifically, the knockout of ARO3 and overexpression of a feedback-resistant mutant of aro4 reduced feedback inhibition in the shikimate pathway, and the zwf1 deletion and over-expression of TKL1 increased flux of necessary precursors into the pathway. Further balancing of the heterologous enzyme levels led to a final titer of nearly 141mg/L muconic acid in a shake-flask culture, a value nearly 24-fold higher than the initial strain. Moreover, this strain has the highest titer and second highest yield of any reported shikimate and aromatic amino acid-based molecule in yeast in a simple batch condition. This work collectively demonstrates that yeast has the potential to be a platform for the bioproduction of muconic acid and suggests an area that is ripe for future metabolic engineering efforts. PMID:23164574

Curran, Kathleen A; Leavitt, John M; Karim, Ashty S; Alper, Hal S

2013-01-01

178

Contribution of Specific Residues of the ?-Solenoid Fold to HET-s Prion Function, Amyloid Structure and Stability  

PubMed Central

The [Het-s] prion of the fungus Podospora anserina represents a good model system for studying the structure-function relationship in amyloid proteins because a high resolution solid-state NMR structure of the amyloid prion form of the HET-s prion forming domain (PFD) is available. The HET-s PFD adopts a specific ?-solenoid fold with two rungs of ?-strands delimiting a triangular hydrophobic core. A C-terminal loop folds back onto the rigid core region and forms a more dynamic semi-hydrophobic pocket extending the hydrophobic core. Herein, an alanine scanning mutagenesis of the HET-s PFD was conducted. Different structural elements identified in the prion fold such as the triangular hydrophobic core, the salt bridges, the asparagines ladders and the C-terminal loop were altered and the effect of these mutations on prion function, fibril structure and stability was assayed. Prion activity and structure were found to be very robust; only a few key mutations were able to corrupt structure and function. While some mutations strongly destabilize the fold, many substitutions in fact increase stability of the fold. This increase in structural stability did not influence prion formation propensity in vivo. However, if an Ala replacement did alter the structure of the core or did influence the shape of the denaturation curve, the corresponding variant showed a decreased prion efficacy. It is also the finding that in addition to the structural elements of the rigid core region, the aromatic residues in the C-terminal semi-hydrophobic pocket are critical for prion propagation. Mutations in the latter region either positively or negatively affected prion formation. We thus identify a region that modulates prion formation although it is not part of the rigid cross-? core, an observation that might be relevant to other amyloid models.

Schmidlin, Thierry; Chi, Celestine N.; Wasmer, Christian; Schutz, Anne; Ceschin, Johanna; Clave, Corinne; Cescau, Sandra; Meier, Beat; Riek, Roland; Saupe, Sven J.

2014-01-01

179

Characterization of a Broad-Specificity ?-Glucanase Acting on ?-(1,3)-, ?-(1,4)-, and ?-(1,6)-Glucans That Defines a New Glycoside Hydrolase Family  

PubMed Central

Here we report the cloning of the Pa_3_10940 gene from the coprophilic fungus Podospora anserina, which encodes a C-terminal family 1 carbohydrate binding module (CBM1) linked to a domain of unknown function. The function of the gene was investigated by expression of the full-length protein and a truncated derivative without the CBM1 domain in the yeast Pichia pastoris. Using a library of polysaccharides of different origins, we demonstrated that the full-length enzyme displays activity toward a broad range of ?-glucan polysaccharides, including laminarin, curdlan, pachyman, lichenan, pustulan, and cellulosic derivatives. Analysis of the products released from polysaccharides revealed that this ?-glucanase is an exo-acting enzyme on ?-(1,3)- and ?-(1,6)-linked glucan substrates and an endo-acting enzyme on ?-(1,4)-linked glucan substrates. Hydrolysis of short ?-(1,3), ?-(1,4), and ?-(1,3)/?-(1,4) gluco-oligosaccharides confirmed this striking feature and revealed that the enzyme performs in an exo-type mode on the nonreducing end of gluco-oligosaccharides. Excision of the CBM1 domain resulted in an inactive enzyme on all substrates tested. To our knowledge, this is the first report of an enzyme that displays bifunctional exo-?-(1,3)/(1,6) and endo-?-(1,4) activities toward beta-glucans and therefore cannot readily be assigned to existing Enzyme Commission groups. The amino acid sequence has high sequence identity to hypothetical proteins within the fungal taxa and thus defines a new family of glycoside hydrolases, the GH131 family.

Lafond, Mickael; Navarro, David; Haon, Mireille; Couturier, Marie

2012-01-01

180

A transcriptomic study of grapevine (Vitis vinifera cv. Cabernet-Sauvignon) interaction with the vascular ascomycete fungus Eutypa lata  

PubMed Central

Eutypa dieback is a vascular disease that may severely affect vineyards throughout the world. In the present work, microarrays were made in order (i) to improve our knowledge of grapevine (Vitis vinifera cv. Cabernet-Sauvignon) responses to Eutypa lata, the causal agent of Eutypa dieback; and (ii) to identify genes that may prevent symptom development. Qiagen/Operon grapevine microarrays comprising 14?500 probes were used to compare, under three experimental conditions (in vitro, in the greenhouse, and in the vineyard), foliar material of infected symptomatic plants (S+R+), infected asymptomatic plants (S–R+), and healthy plants (S–R–). These plants were characterized by symptom notation after natural (vineyard) or experimental (in vitro and greenhouse) infection, re-isolation of the fungus located in the lignified parts, and the formal identification of E. lata mycelium by PCR. Semi-quantitative real-time PCR experiments were run to confirm the expression of some genes of interest in response to E. lata. Their expression profiles were also studied in response to other grapevine pathogens (Erysiphe necator, Plasmopara viticola, and Botrytis cinerea). (i) Five functional categories of genes, that is those involved in metabolism, defence reactions, interaction with the environment, transport, and transcription, were up-regulated in S+R+ plants compared with S–R– plants. These genes, which cannot prevent infection and symptom development, are not specific since they were also up-regulated after infection by powdery mildew, downy mildew, and black rot. (ii) Most of the genes that may prevent symptom development are associated with the light phase of photosynthesis. This finding is discussed in the context of previous data on the mode of action of eutypin and the polypeptide fraction secreted by Eutypa.

Camps, Celine; Kappel, Christian; Lecomte, Pascal; Leon, Celine; Gomes, Eric; Coutos-Thevenot, Pierre; Delrot, Serge

2010-01-01

181

Taxonomy and phylogeny of the ascomycetous yeast genus Zygoascus, with proposal of Zygoascus meyerae sp. nov. and related anamorphic varieties.  

PubMed

Physiological characters, mating compatibility, PCR-RAPD fingerprints, mol% G + C content, DNA-DNA relatedness, and large-subunit and internal transcribed spacer rRNA gene sequences of strains assigned to the genus Zygoascus were re-examined. On the basis of those data, and after phylogenetic analyses, an emendation of Zygoascus hellenicus (type material is a cross of CBS 6736(T) x CBS 5839(T)) is proposed, comprising two novel anamorphic varieties, Candida steatolytica var. steatolytica (CBS 6736(T)) and C. steatolytica var. inositophila (CBS 5839(T)). A novel teleomorphic species, Zygoascus meyerae sp. nov. (type material is a cross of CBS 4099(T) x CBS 7521(T)) is described, together with two novel anamorphic varieties corresponding to it, Candida hellenica var. hellenica (CBS 4099(T)) and C. hellenica var. acidophila (CBS 7115(T)). PMID:15879282

Smith, Maudy Th; Robert, V; Poot, G A; Epping, Wendy; de Cock, A W A M

2005-05-01

182

On the reclassification of species assigned to Candida and other anamorphic ascomycetous yeast genera based on phylogenetic circumscription.  

PubMed

Multigene phylogenies have been instrumental in revising the classification of ascosporic (teleomorph) yeasts in a natural system based on lines of descent. Although many taxonomic changes have already been implemented for teleomorph taxa, this is not yet the case for the large genus Candida and smaller anascosporic (anamorph) genera. In view of the recently introduced requirement that a fungal species or higher taxon be assigned only a single valid name under the new International Code of Nomenclature for algae, fungi, and plants (Melbourne Code), the current species of Candida and other anamorph yeast genera must undergo revision to make genus membership consistent with phylogenetic affinities. A review of existing data and analyses shows that certain Candida species may be assigned to teleomorph genera with high confidence using multigene phylogenies. Candida species that form well-circumscribed phylogenetic clades without any teleomorph member justify the creation of new genera. However, a considerable number of Candida species sit at the end of isolated and often long branches, and hence cannot be assigned to larger species groups. They should be maintained in Candida sensu lato until studied by multigene analyses in datasets with comprehensive taxon sampling. The principle of name stability has to be honoured to the largest extent compatible with a natural classification of Candida species. PMID:24748333

Daniel, Heide-Marie; Lachance, Marc-André; Kurtzman, Cletus P

2014-07-01

183

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.  

PubMed

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen. PMID:11570517

Attard, A; Gourgues, M; Gout, L; Schmit, J; Roux, J; Narcy, J P; Balesdent, M H; Rouxel, T

2001-08-01

184

Some Foliicolous Ascomycetes on Ferns in Australia and New Zealand. The Genera Rhagadolobium P. Henn. & Lind. and Lauterobachiella Theiss. & Syd  

Microsoft Academic Search

In New Zealand Rhagadolobium hemiteliae P. Henn. is recorded on Cyathea smithii Hook. f. and R. bakerianum Sacc. on Cyathea dealbata (Forst.f.) Swartz. In Australia and New Zealand Lauterbachiella dicksoniafoliae n.sp. is recorded on Dicksonia lanata Col. D. squarrosa (Forst.f.) Swartz and on D. antarctica Labill. L. filicina (Berk. & Br.) n.comb. is recorded on Cyathea rebecca (F.v.M.) Domin. in

Joan M. Dingley

1972-01-01

185

Protein kinase A subunits of the ascomycete pathogen Mycosphaerella graminicola regulate asexual fructification, filamentation, melanization and osmosensing.  

PubMed

SUMMARY As in many fungi, asexual reproduction of Mycosphaerella graminicola in planta is a complex process that requires proper differentiation of the infectious hyphae in the substomatal cavities of foliar tissue before pycnidia with conidia can be formed. In this study, we have investigated the role of the cAMP signalling pathway in development and pathogenicity of this pathogen by disruption of the genes encoding the catalytic (designated MgTpk2) and regulatory subunit (designated MgBcy1) of protein kinase A. The MgTpk2 and MgBcy1 mutants showed altered phenotypes in vitro when grown under different growth conditions. On potato dextrose agar (PDA), MgBcy1 mutants showed altered osmosensitivity and reduced melanization, whereas the MgTpk2 mutants showed accelerated melanization when compared with the M. graminicola IPO323 wild-type strain and ectopic transformants. MgTpk2 mutants also secreted a dark-brown pigment into yeast glucose broth medium. In germination and microconidiation assays, both mutants showed a germination pattern similar to that of the controls on water agar, whereas on PDA filamentous growth of MgTpk2 mutants was impaired. Pathogenicity assays showed that the MgTpk2 and MgBcy1 mutants were less virulent as they caused only limited chlorotic and necrotic symptoms at the tips of the inoculated leaves. Further analyses of the infection process showed that MgTpk2 and MgBcy1 mutants were able to germinate, penetrate and colonize mesophyll tissue, but were unable to produce the asexual fructifications, which was particularly due to inappropriate differentiation during the late stage of this morphogenesis-related process. PMID:20507470

Mehrabi, Rahim; Kema, Gert H J

2006-11-01

186

Antioxidant and antiradical properties of methanolic extracts from algerian wild edible desert truffles (terfezia and tirmania, ascomycetes).  

PubMed

Wild edible truffles (namely, Terfezia leonis, Tirmania pinoyi, and T. nivea) were commercially obtained from Southern Algeria and methanolic extracts were prepared from these truffles. Their antioxidant and antiradical properties were studied by using five analytical methods: scavenging capacity on 1,1-diphenyl-2-picrylhydrazyl (DPPH·), 2,2'-azinobis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS·+), superoxide anion (O2·-) radicals, ferric reducing antioxidant power (FRAP), and ferricyanide/Prussian blue assay. Chemical constituents contributing to these activities were also investigated. T. leonis had the highest total phenolics, total carotenoids, and anthocyanin contents. At 2.6 mg/mL, scavenging effects on the DPPH· radical were 92.47%, 53.06%, and 41.34% for T. leonis, T. pinoyi, and T. nivea, respectively. T. leonis showed the most potent radical scavenging activities on DPPH·, ABTS·+, and O2·- radicals, with EC50 values of 1.08, 1.35, and 7.27 mg/mL, respectively. On the other hand, T. leonis exhibited the highest reductive capabilities. On the basis of the EC50 values, T. leonis had good antioxidant and antiradical properties. These results showed that methanolic extracts from these three truffles species had effective antioxidant and antiradical properties. Therefore, wild edible desert truffles could serve as an easily accessible item of food rich in natural antioxidants, as a possible food supplement, or even as a pharmaceutical agent. PMID:24266372

Gouzi, Hicham; Leboukh, Mourad; Bouchouka, Elmouloud

2013-01-01

187

GzSNF1 Is Required for Normal Sexual and Asexual Development in the Ascomycete Gibberella zeae? †  

PubMed Central

The sucrose nonfermenting 1 (SNF1) protein kinase of yeast plays a central role in the transcription of glucose-repressible genes in response to glucose starvation. In this study, we deleted an ortholog of SNF1 from Gibberella zeae to characterize its functions by using a gene replacement strategy. The mycelial growth of deletion mutants (?GzSNF1) was reduced by 21 to 74% on diverse carbon sources. The virulence of ?GzSNF1 mutants on barley decreased, and the expression of genes encoding cell-wall-degrading enzymes was reduced. The most distinct phenotypic changes were in sexual and asexual development. ?GzSNF1 mutants produced 30% fewer perithecia, which matured more slowly, and asci that contained one to eight abnormally shaped ascospores. Mutants in which only the GzSNF1 catalytic domain was deleted had the same phenotype changes as the ?GzSNF1 strains, but the phenotype was less extreme in the mutants with the regulatory domain deleted. In outcrosses between the ?GzSNF1 mutants, each perithecium contained ?70% of the abnormal ascospores, and ?50% of the asci showed unexpected segregation patterns in a single locus tested. The asexual spores of the ?GzSNF1 mutants were shorter and had fewer septa than those of the wild-type strain. The germination and nucleation of both ascospores and conidia were delayed in ?GzSNF1 mutants in comparison with those of the wild-type strain. GzSNF1 expression and localization depended on the developmental stage of the fungus. These results suggest that GzSNF1 is critical for normal sexual and asexual development in addition to virulence and the utilization of alternative carbon sources.

Lee, Seung-Ho; Lee, Jungkwan; Lee, Seunghoon; Park, Eun-Hee; Kim, Ki-Woo; Kim, Myoung-Dong; Yun, Sung-Hwan; Lee, Yin-Won

2009-01-01

188

Cultivation of medicinal caterpillar fungus, Cordyceps militaris (Ascomycetes), and production of cordycepin using the spent medium from levan fermentation.  

PubMed

A process of tandem cultivation for the production of green and invaluable bioproducts (levan and Cordycepes militaris) useful for medical applications has been successfully developed. The process involves first cultivating Bacillus subtilis strain natto in sucrose medium to produce levan, followed by the subsequent cultivation of C. militaris in liquid- and solid-state cultures using the spent medium from levan fermentation as substrates. The factors affecting the cell growth and production of metabolites of C. militaris were investigated, and the various metabolites produced in the culture filtrate, mycelia, and fruiting body were analyzed. In addition, cordycepin was prepared from the solid waste medium of C. militaris. This is an excellent example in the development of cost effective biorefineries that maximize useful product formation from the available biomass. The preparation of cordycepin from solid waste medium of C. militaris using a method with high extraction efficiency and minimum solvent usage is also environmentally friendly. PMID:23796221

Wu, Fang-Chen; Chen, Yi-Lin; Chang, Shu-Ming; Shih, Ing-Lung

2013-01-01

189

Antibacterial activity of wild Xylaria sp. strain R005 (Ascomycetes) against multidrug-resistant Staphylococcus aureus and Pseudomonas aeruginosa.  

PubMed

There is a growing need for new and effective antibiotic agents due to the recent emergence of life-threatening, multidrug-resistant bacterial infections such as methicillin-resistant Staphylococcus aureus and Pseudomonas aeruginosa. In the present study, the antimicrobial potential of mushroom was investigated against multidrug-resistant bacterial strains. The mushroom was identified as Xylaria sp. strain R005 based on the morphological characteristics and confirmed by 18S ribosomal RNA sequence comparisons. The crude ethyl acetate extracts of culture filtrate and fruiting bodies of Xylaria sp. showed significant antibacterial activity against multidrug-resistant S. aureus strains (1-10) and P. aeruginosa strains (1-8). The minimum inhibitory concentration of the ethyl acetate extracts of culture filtrate and fruiting bodies ranged from 225 µg/mL to 625 µg/mL, and 120 µg/mL to 625 µg/mL, respectively, against clinical strains of S. aurues and P. aeruginosa. The synergistic action of extracts of Xylaria sp. with vancomycin and ciprofloxacin was observed against S. aureus strain 6 and P. aeruginosa strain 3, respectively. The fractional inhibitory concentration indices (FICIs) of culture filtrate extract with vancomycin and ciprofloxacin were 0.5 and 0.18, respectively. The FICI of fruiting body extract with vancomycin and ciprofloxacin were 0.5 and 0.375, respectively. These results clearly indicate that the metabolites of culture filtrate and fruiting bodies of Xylaria sp. are the potential source for production of new antimicrobial compounds. PMID:22339707

Ramesh, Veluchamy; Arivudainambi, U; Thalavaipandian, Annamalai; Karunakaran, Chandran; Rajendran, Ayyappan

2012-01-01

190

The Mechanism of Toxicity in HET-S/HET-s Prion Incompatibility  

PubMed Central

The HET-s protein from the filamentous fungus Podospora anserina is a prion involved in a cell death reaction termed heterokaryon incompatibility. This reaction is observed at the point of contact between two genetically distinct strains when one harbors a HET-s prion (in the form of amyloid aggregates) and the other expresses a soluble HET-S protein (96% identical to HET-s). How the HET-s prion interaction with HET-S brings about cell death remains unknown; however, it was recently shown that this interaction leads to a relocalization of HET-S from the cytoplasm to the cell periphery and that this change is associated with cell death. Here, we present detailed insights into this mechanism in which a non-toxic HET-s prion converts a soluble HET-S protein into an integral membrane protein that destabilizes membranes. We observed liposomal membrane defects of approximately 10 up to 60 nm in size in transmission electron microscopy images of freeze-fractured proteoliposomes that were formed in mixtures of HET-S and HET-s amyloids. In liposome leakage assays, HET-S has an innate ability to associate with and disrupt lipid membranes and that this activity is greatly enhanced when HET-S is exposed to HET-s amyloids. Solid-state nuclear magnetic resonance (NMR) analyses revealed that HET-s induces the prion-forming domain of HET-S to adopt the ?-solenoid fold (previously observed in HET-s) and this change disrupts the globular HeLo domain. These data indicate that upon interaction with a HET-s prion, the HET-S HeLo domain partially unfolds, thereby exposing a previously buried ?34-residue N-terminal transmembrane segment. The liberation of this segment targets HET-S to the membrane where it further oligomerizes, leading to a loss of membrane integrity. HET-S thus appears to display features that are reminiscent of pore-forming toxins.

Seuring, Carolin; Greenwald, Jason; Wasmer, Christian; Wepf, Roger; Saupe, Sven J.; Meier, Beat H.; Riek, Roland

2012-01-01

191

Genomics reveals traces of fungal phenylpropanoid-flavonoid metabolic pathway in the f ilamentous fungus Aspergillus oryzae.  

PubMed

Fungal secondary metabolites constitute a wide variety of compounds which either play a vital role in agricultural, pharmaceutical and industrial contexts, or have devastating effects on agriculture, animal and human affairs by virtue of their toxigenicity. Owing to their beneficial and deleterious characteristics, these complex compounds and the genes responsible for their synthesis have been the subjects of extensive investigation by microbiologists and pharmacologists. A majority of the fungal secondary metabolic genes are classified as type I polyketide synthases (PKS) which are often clustered with other secondary metabolism related genes. In this review we discuss on the significance of our recent discovery of chalcone synthase (CHS) genes belonging to the type III PKS superfamily in an industrially important fungus, Aspergillus oryzae. CHS genes are known to play a vital role in the biosynthesis of flavonoids in plants. A comparative genome analyses revealed the unique character of A. oryzae with four CHS-like genes (csyA, csyB, csyC and csyD) amongst other Aspergilli (Aspergillus nidulans and Aspergillus fumigatus) which contained none of the CHS-like genes. Some other fungi such as Neurospora crassa, Fusarium graminearum, Magnaporthe grisea, Podospora anserina and Phanerochaete chrysosporium also contained putative type III PKSs, with a phylogenic distinction from bacteria and plants. The enzymatically active nature of these newly discovered homologues is expected owing to the conservation in the catalytic residues across the different species of plants and fungi, and also by the fact that a majority of these genes (csyA, csyB and csyD) were expressed in A. oryzae. While this finding brings filamentous fungi closer to plants and bacteria which until recently were the only ones considered to possess the type III PKSs, the presence of putative genes encoding other principal enzymes involved in the phenylpropanoid and flavonoid biosynthesis (viz., phenylalanine ammonia-lyase, cinnamic acid hydroxylase and p-coumarate CoA ligase) in the A. oryzae genome undoubtedly prove the extent of its metabolic diversity. Since many of these genes have not been identified earlier, knowledge on their corresponding products or activities remain undeciphered. In future, it is anticipated that these enzymes may be reasonable targets for metabolic engineering in fungi to produce agriculturally and nutritionally important metabolites. PMID:16410762

Juvvadi, Praveen Rao; Seshime, Yasuyo; Kitamoto, Katsuhiko

2005-12-01

192

The Wood Rot Ascomycete Xylaria polymorpha Produces a Novel GH78 Glycoside Hydrolase That Exhibits ?-l-Rhamnosidase and Feruloyl Esterase Activities and Releases Hydroxycinnamic Acids from Lignocelluloses  

PubMed Central

Soft rot (type II) fungi belonging to the family Xylariaceae are known to substantially degrade hardwood by means of their poorly understood lignocellulolytic system, which comprises various hydrolases, including feruloyl esterases and laccase. In the present study, several members of the Xylariaceae were found to exhibit high feruloyl esterase activity during growth on lignocellulosic materials such as wheat straw (up to 1,675 mU g?1) or beech wood (up to 80 mU g?1). Following the ester-cleaving activity toward methyl ferulate, a hydrolase of Xylaria polymorpha was produced in solid-state culture on wheat straw and purified by different steps of anion-exchange and size-exclusion chromatography to apparent homogeneity (specific activity, 2.2 U mg?1). The peptide sequence of the purified protein deduced from the gene sequence and verified by de novo peptide sequencing shows high similarity to putative ?-l-rhamnosidase sequences belonging to the glycoside hydrolase family 78 (GH78; classified under EC 3.2.1.40). The purified enzyme (98 kDa by SDS-PAGE, 103 kDa by size-exclusion chromatography; pI 3.7) converted diverse glycosides (e.g., ?-l-rhamnopyranoside and ?-l-arabinofuranoside) but also natural and synthetic esters (e.g., chlorogenic acid, hydroxycinnamic acid glycoside esters, veratric acid esters, or p-nitrophenyl acetate) and released free hydroxycinnamic acids (ferulic and coumaric acid) from arabinoxylan and milled wheat straw. These catalytic properties strongly suggest that X. polymorpha GH78 is a multifunctional enzyme. It is the first fungal enzyme that combines glycosyl hydrolase with esterase activities and may help this soft rot fungus to degrade lignocelluloses.

Nghi, Do Huu; Bittner, Britta; Kellner, Harald; Jehmlich, Nico; Ullrich, Rene; Pecyna, Marek J.; Nousiainen, Paula; Sipila, Jussi; Huong, Le Mai; Hofrichter, Martin

2012-01-01

193

Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene.  

PubMed Central

Clinically important species of Candida and related organisms were compared for extent of nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA (rDNA) gene. This rDNA region is sufficiently variable to allow reliable separation of all known clinically significant yeast species. Of the 204 described species examined, 21 appeared to be synonyms of previously described organisms. Phylogenetic relationships among the species are presented.

Kurtzman, C P; Robnett, C J

1997-01-01

194

Mitochondrial Carnitine-Dependent Acetyl Coenzyme A Transport Is Required for Normal Sexual and Asexual Development of the Ascomycete Gibberella zeae  

PubMed Central

Fungi have evolved efficient metabolic mechanisms for the exact temporal (developmental stages) and spatial (organelles) production of acetyl coenzyme A (acetyl-CoA). We previously demonstrated mechanistic roles of several acetyl-CoA synthetic enzymes, namely, ATP citrate lyase and acetyl-CoA synthetases (ACSs), in the plant-pathogenic fungus Gibberella zeae. In this study, we characterized two carnitine acetyltransferases (CATs; CAT1 and CAT2) to obtain a better understanding of the metabolic processes occurring in G. zeae. We found that CAT1 functioned as an alternative source of acetyl-CoA required for lipid accumulation in an ACS1 deletion mutant. Moreover, deletion of CAT1 and/or CAT2 resulted in various defects, including changes to vegetative growth, asexual/sexual development, trichothecene production, and virulence. Although CAT1 is associated primarily with peroxisomal CAT function, mislocalization experiments showed that the role of CAT1 in acetyl-CoA transport between the mitochondria and cytosol is important for sexual and asexual development in G. zeae. Taking these data together, we concluded that G. zeae CATs are responsible for facilitating the exchange of acetyl-CoA across intracellular membranes, particularly between the mitochondria and the cytosol, during various developmental stages.

Son, Hokyoung; Min, Kyunghun; Lee, Jungkwan; Choi, Gyung Ja; Kim, Jin-Cheol

2012-01-01

195

Isolation and Purification of a Polysaccharide from the Caterpillar Medicinal Mushroom Cordyceps militaris (Ascomycetes) Fruit Bodies and Its Immunomodulation of RAW 264.7 Macrophages.  

PubMed

A novel polysaccharide (CP2-S) was purified from Cordyceps militaris fruit bodies by hot water extraction, ethanol precipitation, DEAE-Sepharose Fast Flow and Sephacryl S-400 high-resolution chromatography. The polysaccharide had a molecular weight of 5.938 × 106 g/mol and was mainly composed of glucose. CP2-S had carbohydrate content estimated to be 100% using the phenol-sulfuric acid method. Immunostimulating experiments in vitro indicated that CP2-S could stimulate nitric oxide production, phagocytosis, respiratory burst activity, and secretion of interleukin-1? and interleukin-2 of macrophages, suggesting that this water-soluble polysaccharide from the fruit body of C. militaris is a natural immunostimulating polysaccharide with potential for further application. PMID:24941166

Zhu, Lina; Tang, Qingjiu; Zhou, Shuai; Liu, Yanfang; Zhang, Zhong; Gao, Xinhua; Wang, Shiping; Wang, Zhaolong

2014-01-01

196

The wood rot ascomycete Xylaria polymorpha produces a novel GH78 glycoside hydrolase that exhibits ?-L-rhamnosidase and feruloyl esterase activities and releases hydroxycinnamic acids from lignocelluloses.  

PubMed

Soft rot (type II) fungi belonging to the family Xylariaceae are known to substantially degrade hardwood by means of their poorly understood lignocellulolytic system, which comprises various hydrolases, including feruloyl esterases and laccase. In the present study, several members of the Xylariaceae were found to exhibit high feruloyl esterase activity during growth on lignocellulosic materials such as wheat straw (up to 1,675 mU g(-1)) or beech wood (up to 80 mU g(-1)). Following the ester-cleaving activity toward methyl ferulate, a hydrolase of Xylaria polymorpha was produced in solid-state culture on wheat straw and purified by different steps of anion-exchange and size-exclusion chromatography to apparent homogeneity (specific activity, 2.2 U mg(-1)). The peptide sequence of the purified protein deduced from the gene sequence and verified by de novo peptide sequencing shows high similarity to putative ?-L-rhamnosidase sequences belonging to the glycoside hydrolase family 78 (GH78; classified under EC 3.2.1.40). The purified enzyme (98 kDa by SDS-PAGE, 103 kDa by size-exclusion chromatography; pI 3.7) converted diverse glycosides (e.g., ?-L-rhamnopyranoside and ?-L-arabinofuranoside) but also natural and synthetic esters (e.g., chlorogenic acid, hydroxycinnamic acid glycoside esters, veratric acid esters, or p-nitrophenyl acetate) and released free hydroxycinnamic acids (ferulic and coumaric acid) from arabinoxylan and milled wheat straw. These catalytic properties strongly suggest that X. polymorpha GH78 is a multifunctional enzyme. It is the first fungal enzyme that combines glycosyl hydrolase with esterase activities and may help this soft rot fungus to degrade lignocelluloses. PMID:22544251

Nghi, Do Huu; Bittner, Britta; Kellner, Harald; Jehmlich, Nico; Ullrich, René; Pecyna, Marek J; Nousiainen, Paula; Sipilä, Jussi; Huong, Le Mai; Hofrichter, Martin; Liers, Christiane

2012-07-01

197

Aging as Evolution-Facilitating Program and a Biochemical Approach to Switch It Off  

NASA Astrophysics Data System (ADS)

A concept is presented considering aging of living organisms as a final step of their ontogenetic program. It is assumed that such an aging program was invented by biological evolution to facilitate the evolutionary process. Indications are summarized suggesting that controlled production of toxic forms of oxygen (so called reactive oxygen species) by respiring intracellular organelles (mitochondria) is an obligatory component of the aging program. First results of a research project devoted to an attempt to interrupt aging program by antioxidants specifically addressed to mitochondria have been described. Within the framework of the project, antioxidants of a new type (SkQ) were synthesized. SkQs are composed of (i) plastoquinone (an antioxidant moiety), (ii) a penetrating cation, and (iii) a decane or pentane linker. Using planar bilayer phospholipid membranes, we selected SkQ derivatives of the highest penetrability, namely plastoquinonyl decyl triphenylphosphonium (SkQ1), plastoquinonyl decyl rhodamine 19 (SkQR1), and methylplastoquinonyl decyl triphenylphosphonium (SkQ3). Anti- and prooxidant properties of these substances and also of ubiquinonyl-decyl-triphenylphosphonium (MitoQ) were tested in isolated mitochondria. Micromolar concentrations of cationic quinones are found to be very strong prooxidants, but in the lower (sub-micromolar) concentrations they display antioxidant activity which decreases in the series SkQ1 = SkQR1 > SkQ3 > MitoQ. Thus, the window between the anti- and prooxidant effects is the smallest for MitoQ and the largest for SkQ1 and SkQR1. SkQ1 is rapidly reduced by complex III of the mitochondrial respiratory chain, i.e. it is a rechargeable antioxidant. Extremely low concentrations of SkQ1 and SkQR1 completely arrest the H2O2-induced apoptosis in human fibroblasts and HeLa cells (for SkQ1, C 1/2 = 8 · 10-9M). Higher concentrations of SkQ1 are required to block necrosis initiated by reactive oxygen species (ROS). In mice, SkQ1 decelerates the development of three types of accelerated aging (progeria) and also of normal aging, and this effect is especially demonstrative at early stages of aging. The same pattern is shown in invertebrates (Drosophila and Daphnia), and fungus (Podospora anserina). In mammals, the effect of SkQs on aging is accompanied by inhibition of development of such age-related diseases as osteoporosis, involution of thymus, cataract, retinopathy, etc. SkQ1 manifests a strong therapeutic action on some already pronounced retinopathies, in particular, congenital retinal dysplasia. With drops containing 250 nM SkQ1, vision is recovered in 66 of 96 animals (dogs, cats and horses) who became blind because of retinopathy. SkQ1-containing drops instilled into eyes prevent the loss of sight in rabbits suffering from experimental uveitis and restore vision to animals that had already become blind due to this pathology. A favorable effect is also achieved in experimental glaucoma in rabbits. Moreover, the pretreatment of rats with 0.2 nM SkQ1 significantly decreases the H2O2-induced arrhythmia of the isolated heart. SkQ1 strongly reduces the damaged area in myocardial infarction or stroke and prevents the death of animals from kidney infarction. In p53-/- mice, SkQ1 decreases the ROS level in the spleen cells and inhibits appearance of lymphomas which are the main cause of death of such animals. As a result, the lifespan increases. SkQs look like promising drugs to treat aging and age-related diseases.

Skulachev, Vladimir P.

198

An attempt to prevent senescence: a mitochondrial approach.  

PubMed

Antioxidants specifically addressed to mitochondria have been studied to determine if they can decelerate senescence of organisms. For this purpose, a project has been established with participation of several research groups from Russia and some other countries. This paper summarizes the first results of the project. A new type of compounds (SkQs) comprising plastoquinone (an antioxidant moiety), a penetrating cation, and a decane or pentane linker has been synthesized. Using planar bilayer phospholipid membrane (BLM), we selected SkQ derivatives with the highest permeability, namely plastoquinonyl-decyl-triphenylphosphonium (SkQ1), plastoquinonyl-decyl-rhodamine 19 (SkQR1), and methylplastoquinonyldecyltriphenylphosphonium (SkQ3). Anti- and prooxidant properties of these substances and also of ubiquinonyl-decyl-triphenylphosphonium (MitoQ) were tested in aqueous solution, detergent micelles, liposomes, BLM, isolated mitochondria, and cell cultures. In mitochondria, micromolar cationic quinone derivatives were found to be prooxidants, but at lower (sub-micromolar) concentrations they displayed antioxidant activity that decreases in the series SkQ1=SkQR1>SkQ3>MitoQ. SkQ1 was reduced by mitochondrial respiratory chain, i.e. it is a rechargeable antioxidant. Nanomolar SkQ1 specifically prevented oxidation of mitochondrial cardiolipin. In cell cultures, SkQR1, a fluorescent SkQ derivative, stained only one type of organelles, namely mitochondria. Extremely low concentrations of SkQ1 or SkQR1 arrested H(2)O(2)-induced apoptosis in human fibroblasts and HeLa cells. Higher concentrations of SkQ are required to block necrosis initiated by reactive oxygen species (ROS). In the fungus Podospora anserina, the crustacean Ceriodaphnia affinis, Drosophila, and mice, SkQ1 prolonged lifespan, being especially effective at early and middle stages of aging. In mammals, the effect of SkQs on aging was accompanied by inhibition of development of such age-related diseases and traits as cataract, retinopathy, glaucoma, balding, canities, osteoporosis, involution of the thymus, hypothermia, torpor, peroxidation of lipids and proteins, etc. SkQ1 manifested a strong therapeutic action on some already pronounced retinopathies, in particular, congenital retinal dysplasia. With drops containing 250 nM SkQ1, vision was restored to 67 of 89 animals (dogs, cats, and horses) that became blind because of a retinopathy. Instillation of SkQ1-containing drops prevented the loss of sight in rabbits with experimental uveitis and restored vision to animals that had already become blind. A favorable effect of the same drops was also achieved in experimental glaucoma in rabbits. Moreover, the SkQ1 pretreatment of rats significantly decreased the H(2)O(2) or ischemia-induced arrhythmia of the isolated heart. SkQs strongly reduced the damaged area in myocardial infarction or stroke and prevented the death of animals from kidney ischemia. In p53(-/-) mice, 5 nmol/kgxday SkQ1 decreased the ROS level in the spleen and inhibited appearance of lymphomas to the same degree as million-fold higher concentration of conventional antioxidant NAC. Thus, SkQs look promising as potential tools for treatment of senescence and age-related diseases. PMID:19159610

Skulachev, Vladimir P; Anisimov, Vladimir N; Antonenko, Yuri N; Bakeeva, Lora E; Chernyak, Boris V; Erichev, Valery P; Filenko, Oleg F; Kalinina, Natalya I; Kapelko, Valery I; Kolosova, Natalya G; Kopnin, Boris P; Korshunova, Galina A; Lichinitser, Mikhail R; Obukhova, Lidia A; Pasyukova, Elena G; Pisarenko, Oleg I; Roginsky, Vitaly A; Ruuge, Enno K; Senin, Ivan I; Severina, Inna I; Skulachev, Maxim V; Spivak, Irina M; Tashlitsky, Vadim N; Tkachuk, Vsevolod A; Vyssokikh, Mikhail Yu; Yaguzhinsky, Lev S; Zorov, Dmitry B

2009-05-01

199

Independent Terrestrial Origins of the Halosphaeriales (Marine Ascomycota)  

Microsoft Academic Search

A phylogenetic study of marine ascomycetes was initiated to test and refine evolutionary hypotheses of marine-terrestrial transitions among ascomycetes. Taxon sampling focused on the Halosphaeriales, the largest order of marine ascomycetes. Approximately 1050 base pairs (bp) of the gene that codes for the nuclear small subunit (SSU) and 600 bp of the gene that codes for the nuclear large subunit

Joseph W. Spatafora; Brigitte Volkmann-Kohlmeyer; Jan Kohlmeyer

1998-01-01

200

Optimization of solid state culture conditions for the production of adenosine, cordycepin, and D-mannitol in fruiting bodies of medicinal caterpillar fungus Cordyceps militaris (L.:Fr.) Link (Ascomycetes).  

PubMed

In general, Cordyceps sinensis is much more popular than C. militaris, though both species contain quite similar bioactive ingredients and exhibit medicinal activities. Many bioactive ingredients have been isolated from C. militaris, such as adenosine, cordycepin, D-mannitol, and exopolysaccharides. C. militaris is claimed to have extensive pharmacological properties, such as: anti-inflammatory; anti-fatigue; anti-bacterial; anti-diabetic; improve lung, liver, and kidney functions; to be beneficial for treating cancer as well as male and female sexual dysfunctions. C. militaris is fast gaining momentum for its so-called health benefits, and it is often used as a substitute for C. sinensis. In view of the growing popularity of C. militaris, nowadays C. militaris cultivation for stroma is also done. There is a great diversity of compounds from different strains of Cordyceps and different artificially cultivated products. This study is to determine the optimum culture parameters integrated with substrate of choice to bring the indoor-cultivated C. militaris to a higher and more consistent level of quality. To achieve the above objective, the resultant products after growth were analyzed for adenosine, cordycepin, and D-mannitol using the high-performance liquid chromatography method. The optimum culture condition to produce a high level of adenosine is by using millet as solid substrate. It must be cultivated in the dark for the first 7 days and harvested on day 40. The optimum culture condition to produce a high level of cordycepin is by using soybean as solid substrate. It must be cultivated in the dark for the first 14 days and harvested on day 50. While a high level of D-mannitol is achieved with millet as the solid substrate. It must be kept in the dark for the first 7 days and harvested on day 50. The adenosine level decreased and cordycepin increased from day 40 of culture to day 50 generally. PMID:22506578

Lim, LekTeng; Lee, ChiaYen; Chang, EngThuan

2012-01-01

201

Transcription of sterol Delta(5,6)-desaturase and sterol 14alpha-demethylase is induced in the plant pathogenic ascomycete, Leptosphaeria maculans, during treatment with a triazole fungicide.  

PubMed

Two genes whose derived amino acid sequences closely resemble the ergosterol biosynthetic enzymes, sterol Delta(5,6)-desaturase (erg3) and sterol 14alpha-demethylase (erg11), were cloned from the plant pathogenic fungus Leptosphaeria maculans. Transcript levels of both these genes increased following exposure of L. maculans to the triazole fungicide, flutriafol, which specifically inhibits the ergosterol biosynthetic pathway. This induction may be due to a decrease in ergosterol content or to abnormal levels of the ergosterol precursor, 24-methylene dihydrolanosterol. PMID:12445649

Griffiths, Katherine M; Howlett, Barbara J

2002-11-19

202

Distribution of sterigmatocystin in filamentous fungi  

Microsoft Academic Search

During the last 50y, the carcinogenic mycotoxin sterigmatocystin (ST) has been reported in several phylogenetically and phenotypically different genera: Aschersonia, Aspergillus, Bipolaris, Botryotrichum, Chaetomium, Emericella, Eurotium, Farrowia, Fusarium, Humicola, Moelleriella, Monocillium and Podospora. We have reexamined all available strains of the original producers, in addition to ex type and further strains of each species reported to produce ST and the

Christian Rank; Kristian F. Nielsen; Thomas O. Larsen; Janos Varga; Rob A. Samson; Jens C. Frisvad

2011-01-01

203

Phylogeny of the Gyalectales and Ostropales (Ascomycota, Fungi): among and within order relationships based on nuclear ribosomal RNA small and large subunits  

Microsoft Academic Search

Despite various morphological and anatomical similarities, the two orders Gyalectales (lichenized ascomycetes) and Ostropales (lichenized and non-lichenized ascomycetes) have been considered to be distantly related to each other and their position within the Ascomycota was unsettled. To estimate relationships within these groups and their respective phylogenenetic placement within the Ascomycota, we analyzed DNA sequences from the nuclear small and large

Frank Kauff; François Lutzoni

2002-01-01

204

Ribosomal DNA and Resolution of Branching Order among the Ascomycota: How Many Nucleotides Are Enough?  

Microsoft Academic Search

Molecular phylogenies for the fungi in the Ascomycota rely heavily on 18S rRNA gene sequences but this gene alone does not answer all questions about relationships. Particularly problematical are the relationships among the first ascomycetes to diverge, the Archiascomycetes, and the branching order among the basal filamentous ascomycetes, the Euascomycetes. Would more data resolve branching order? We used the jackknife

Mary L. Berbee; David A. Carmean; Katarina Winka

2000-01-01

205

Purification and characterization of mycoferritin from Aspergillus parasiticus (255)  

Microsoft Academic Search

As intracellular iron storage molecules, only hydroxymate type siderophores have been reported in ascomycetes and basidiomycetes. This is the first report documenting the presence of mycoferritin in ascomycetes. The fungus, Aspergillus parasiticus (255), is capable of producing mycoferritin only upon induction with iron in yeast extract sucrose (YES) medium. The same has been purified from Aspergillus sps by application of

J. Shashidhar; R. B. Sashidhar; Vijay Deshpande

2005-01-01

206

How to Identify and Control Cyclaneusma Needle Cast of Pines,  

National Technical Information Service (NTIS)

Cyclaneusma needle cast is caused by Cyclaneusma minus (=Naemacyclus minor) (Ascomycetes:Rhytisma-taceaae). In North America, this disease occurs from Virginia to Missouri northward through New England and southern Canada western Nebraska and Manitoba, pl...

W. Merrill K. Robbins

1987-01-01

207

Cellulase-Producing Microorganism.  

National Technical Information Service (NTIS)

A process and a microorganism for synthesizing cellulase enzymes are described. The microorganism is a mutant strain of an Ascomycete fungus capable of synthesizing cellulases. The synthesis of cellulases by the mutant is nonrepressed by glycerol, repress...

B. J. Gallo

1978-01-01

208

Phylogeny of Discomycetes and early radiations of the apothecial Ascomycotina inferred from SSU rDNA sequence data.  

PubMed

We used nucleotide sequences of the small subunit ribosomal genes (SSU rDNA) to examine evolutionary relationships of apothecial ascomycetes (division Ascomycota; class Discomycetes sensu), commonly known as the cup fungi. The apothecial ascomycetes include both lichen-forming and free-living fungi. We sequenced the SSU rDNA from representatives of 10 fungal genera from four orders: Pezizales (Ascobolus lineolatus, Morchella elata agg., Peziza badia); Leotiales (Leotia lubrica, Sclerotinia sclerotiorum); Caliciales (Calicium tricolor, Mycocalicium albonigrum, Sphaerophorus globosus); and Lecanorales (Lecanora dispersa, Porpidia crustulata). Of these, C. tricolor, S. globosus, L. dispersa, and P. crustulata are lichen-forming fungi. Based on parsimony analyses of approximately 1750 aligned nucleotides of their SSU rDNA, we determined a most parsimonious tree (MPT). This hypothesis suggests that the apothecial ascomycetes are a paraphyletic assemblage, basal to other groups of filamentous ascomycetes including representatives of the perithecial fungi and cleistothecial fungi. The most parsimonious tree produced using this dataset supported the monophyly of the orders Pezizales, Leotiales, and Lecanorales. However, there was no support for monophyly of the representative Caliciales; S. globosus had affinities with members of the Lecanorales. This phylogenetic hypothesis recognizes Pezizales as basal and supports Nannfeldt's hypothesis (1932) of a primitive apothecial ascomata with subsequent evolution of perithecial and cleistothecial forms. This MPT provides a foundation for understanding evolution of the ascomycetous fungi. PMID:7614369

Gargas, A; Taylor, J W

1995-03-01

209

The genome and development-dependent transcriptomes of Pyronema confluens: a window into fungal evolution.  

PubMed

Fungi are a large group of eukaryotes found in nearly all ecosystems. More than 250 fungal genomes have already been sequenced, greatly improving our understanding of fungal evolution, physiology, and development. However, for the Pezizomycetes, an early-diverging lineage of filamentous ascomycetes, there is so far only one genome available, namely that of the black truffle, Tuber melanosporum, a mycorrhizal species with unusual subterranean fruiting bodies. To help close the sequence gap among basal filamentous ascomycetes, and to allow conclusions about the evolution of fungal development, we sequenced the genome and assayed transcriptomes during development of Pyronema confluens, a saprobic Pezizomycete with a typical apothecium as fruiting body. With a size of 50 Mb and ~13,400 protein-coding genes, the genome is more characteristic of higher filamentous ascomycetes than the large, repeat-rich truffle genome; however, some typical features are different in the P. confluens lineage, e.g. the genomic environment of the mating type genes that is conserved in higher filamentous ascomycetes, but only partly conserved in P. confluens. On the other hand, P. confluens has a full complement of fungal photoreceptors, and expression studies indicate that light perception might be similar to distantly related ascomycetes and, thus, represent a basic feature of filamentous ascomycetes. Analysis of spliced RNA-seq sequence reads allowed the detection of natural antisense transcripts for 281 genes. The P. confluens genome contains an unusually high number of predicted orphan genes, many of which are upregulated during sexual development, consistent with the idea of rapid evolution of sex-associated genes. Comparative transcriptomics identified the transcription factor gene pro44 that is upregulated during development in P. confluens and the Sordariomycete Sordaria macrospora. The P. confluens pro44 gene (PCON_06721) was used to complement the S. macrospora pro44 deletion mutant, showing functional conservation of this developmental regulator. PMID:24068976

Traeger, Stefanie; Altegoer, Florian; Freitag, Michael; Gabaldon, Toni; Kempken, Frank; Kumar, Abhishek; Marcet-Houben, Marina; Pöggeler, Stefanie; Stajich, Jason E; Nowrousian, Minou

2013-01-01

210

Molecular data and ploidal levels indicate several putative allopolyploidization events in the genus Potentilla (Rosaceae)  

PubMed Central

Several naturally occurring hybrids in Potentilla (Rosaceae) have been reported, but no molecular evidence has so far been available to test these hypotheses of hybridization. We have compared a nuclear and a chloroplast gene tree to identify topological incongruences that may indicate hybridization events in the genus. Furthermore, the monophyly and phylogenetic position of the proposed segregated genera Argentina, Ivesia and Horkelia have been tested. The systematic signal from the two morphological characters, style- and anther shape, has also been investigated by ancestral state reconstruction, to elucidate how well these characters concur with the results of the molecular phylogenies. Six major clades, Anserina, Alba, Fragarioides, Reptans, ivesioid and Argentea, have been identified within genus Potentilla. Horkelia, Ivesia and Horkeliella (the ivesioid clade), form a monophyletic group nested within Potentilla. Furthermore, the origin of the proposed segregated genus Argentina (the Anserina clade) is uncertain but not in conflict with a new generic status of the group. We also found style morphology to be an informative character that reflects the phylogenetic relationships within Potentilla. Five well-supported incongruences were found between the nuclear and the chloroplast phylogenies, and three of these involved polyploid taxa. However, further investigations, using low copy molecular markers, are required to infer the phylogeny of these species and to test the hypothesis of hybrid origin.

Topel, Mats; Lundberg, Magnus; Eriksson, Torsten; Eriksen, Bente

2011-01-01

211

Fungal microflora biodiversity as a function of pollution in Oued Sebou (Morocco).  

PubMed

An inventory of the fungal microflora present in sediments collected at 11 sites along Oued Sebou has been established. The influence of some climatic parameters (temperature, rainfall) and of pollution on the composition of the fungal communities has been questioned. Emericella nidulans, Eurotium amstelodami, Neosartotya fisheri var. glabrum (Ascomycetes), Dreschslera biseptata (Dematiaceae), Penicillium citrinum (Mucedinaceae) and Phoma sp. (Sphaeropsidale) can be considered as strains sensitive to pollution. Penicillium janthelinum, Trichoderma koningii (Mucedinaceae) and Candida albicans (Yeast) were found only at the most polluted sites; Talaromyces flavus (Ascomycete) Rhodotorula rubra, Saccharomyces cerevisiae (Yeasts) and Fusarium oxysporum (Tuberculariales) were more often found at heavily polluted sites than at lightly polluted ones. PMID:9253167

Sage, L; Bennasser, L; Steiman, R; Seigle-Murandi, F

1997-08-01

212

[Diversity and specific composition of microscopic fungi on synthetic polymeric materials].  

PubMed

We summarized experimental data on species diversity of fungi decomposing synthetic polymeric materials. Most of the fungi were anamorphs of the phylum Ascomycota, class Ascomycetes (231 species and 85 genera). Teleomorphs of ascomycetes were represented by 18 species and 7 genera. We revealed a smaller number of fungi belonging to the phylum Zygomycota, class Zygomycetes (31 species and 15 genera), or the phylum Basidiomycota, class Basidiomycetes (5 species and 5 genera). The specific composition of fungi was assessed on polymeric materials of various classes. PMID:18669268

Kurakov, A B; Gevorkian, S A; Goginian, V B; Ozeskaia, S M

2008-01-01

213

Investigations into the taxonomy of the mushroom pathogen Verticillium fungicola and its relatives based on sequence analysis of nitrate reductase and ITS regions  

Microsoft Academic Search

The full sequence of the nitrate reductase gene was obtained from a type isolate of Verticillium fungicola var. fungicola and used for phylogenetic analysis against other ascomycete fungi. Sequencing obtained 2749 bp of coding region, 668 bp of\\u000a 5? flanking sequence and 731 bp of 3? flanking sequence. In silico analysis indicated that the coding region contains a single intron

R. C. Amey; A. Athey-Pollard; P. R. Mills; G. D. Foster; A. Bailey

2007-01-01

214

Whole-genome analysis of two-component signal transduction genes in fungal pathogens.  

PubMed

Two-component phosphorelay systems are minimally comprised of a histidine kinase (HK) component, which autophosphorylates in response to an environmental stimulus, and a response regulator (RR) component, which transmits the signal, resulting in an output such as activation of transcription, or of a mitogen-activated protein kinase cascade. The genomes of the yeasts Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Candida albicans encode one, three, and three HKs, respectively. In contrast, the genome sequences of the filamentous ascomycetes Neurospora crassa, Cochliobolus heterostrophus (Bipolaris maydis), Gibberella moniliformis (Fusarium verticillioides), and Botryotinia fuckeliana (Botrytis cinerea) encode an extensive family of two-component signaling proteins. The putative HKs fall into 11 classes. Most of these classes are represented in each filamentous ascomycete species examined. A few of these classes are significantly more prevalent in the fungal pathogens than in the saprobe N. crassa, suggesting that these groups contain paralogs required for virulence. Despite the larger numbers of HKs in filamentous ascomycetes than in yeasts, all of the ascomycetes contain virtually the same downstream histidine phosphotransfer proteins and RR proteins, suggesting extensive cross talk or redundancy among HKs. PMID:14665450

Catlett, Natalie L; Yoder, Olen C; Turgeon, B Gillian

2003-12-01

215

RFLP Markers Show Genetic Recombination in Botryotinia fuckeliana (Botrytis cinerea) and Transposable Elements Reveal Two Sympatric Species  

Microsoft Academic Search

Molecular markers revealed that Botryotinia jiickeliana (the teleomorph of Botrytis cinerea), a haploid, filamentous, heterothallic ascomycete, contained a large amount of intrapopulation genetic variation. The markers were used to determine the mode of reproduction and the population structure of this fungus. We did not detect any differentiation between isolates from different organs, collection dates, varieties of grape, or locations in

Tatiana Giraud; Dominique Fortini; Caroline Levis; Pierre Leroux; Yves Brygoo

216

Technological Advancement Conidial germination in the filamentous fungus Fusarium graminearum  

Microsoft Academic Search

The ascomycetous fungus Fusarium graminearum is an important plant pathogen causing Fusarium head blight disease of wheat and barley. To understand early developmental stages of this organism, we followed the germination of macroconidia microscopically to understand the timing of key events. These events, recorded after suspension of spores in liquid germination medium, included spore swelling at 2 h, germination tube

Kye-Yong Seong; Xinhua Zhao; Jin-Rong Xu; Ulrich Guldener; H. Corby Kistler

217

Conidial germination in the filamentous fungus Fusarium graminearum  

Microsoft Academic Search

The ascomycetous fungus Fusarium graminearum is an important plant pathogen causing Fusarium head blight disease of wheat and barley. To understand early developmental stages of this organism, we followed the germination of macroconidia microscopically to understand the timing of key events. These events, recorded after suspension of spores in liquid germination medium, included spore swelling at 2h, germination tube emergence

Kye-Yong Seong; Xinhua Zhao; Jin-Rong Xu; Ulrich Güldener; H. Corby Kistler

2008-01-01

218

Die Bildung eines rotbraunen Pigmentes durch Mikroorganismen bei Anwesenheit von Tryptophan in der Nährlösung  

Microsoft Academic Search

Summary SeveralPhycomycetes andAscomycetes form a reddish-brown pigment if their nutrient medium contains tryptophan. The pigment can be extracted from the medium withn-butanol, cyclohexanol, and a mixture of phenol and chloroform 1:1 (w\\/v).

H. Thöni

1966-01-01

219

Über die antagonistische Beeinflussung von Wachstum und atmung bei einigen höheren Pilzen  

Microsoft Academic Search

6 Hymenomyceten (Merulius lacrymans, Polyporus sulfureus, Daedalea quercina, Pholiota mutabilis, Panus conchatus und Lepiota cepaestipes) und I Ascomycet (Xylaria polymorpha) wurden auf Biomalzlösung kultiviert; im Zeitpunkt des maximalen Hemmstoffgehaltes der Nährlösung (je nach Art nach 12 Tagen bis 5 Wochen) wurde deren Wirkung auf Wachstum und Atmung von 5 anderen Hymenomyceten (Coniophora cerebella, Polystictus versicolor, Fomes fomentarius, Trametes radiciperda und

Georg Nesemann

1953-01-01

220

A haemagglutinin from the medicinal fungus Cordyceps militaris.  

PubMed

There are only a few reports on agglutinins from ascomycete and medicinal fungi. An HA (haemagglutinin), with an N-terminal amino acid sequence different from those of known lectins, was isolated in the present study from dried fruiting bodies of the medicinal ascomycete fungus Cordyceps militaris. The purification protocol consisted of affinity chromatography, ion-exchange chromatography and gel filtration. The haemagglutinating activity of the HA could not be inhibited by simple sugars or heparin, and was stable over the pH range 2-13 and up to 60 degrees C. Chemical modification of tryptophan and tyrosine residues had no effect. The HA exhibited some antiproliferative activity towards hepatoma (HepG2) cells and inhibited HIV-1 reverse transcriptase (IC50=10 microM). However, it did not exhibit antifungal activity, mitogenic activity towards splenocytes, nitric oxide-inducing activity towards macrophages or RNase activity. The results of the present study add to the meagre information pertaining to agglutinins from ascomycete and medicinal mushrooms. It is revealed in this study that C. militaris HA differs from other ascomycete mushroom HAs in a variety of biochemical characteristics. PMID:19093913

Wong, Jack H; Wang, Hexiang; Ng, Tzi B

2009-10-01

221

Molecular mapping of Stb1 , a potentially durable gene for resistance to septoria tritici blotch in wheat  

Microsoft Academic Search

Septoria tritici blotch (STB), caused by the ascomycete Mycosphaerella graminicola (anamorph Septoria tritici), was the most destructive disease of wheat in Indiana and adjacent states before deployment of the resistance gene Stb1 during the early 1970s. Since then, Stb1 has provided durable protection against STB in widely grown wheat cultivars. However, its chromosomal location and allelic relationships to most other

T. B. Adhikari; X. Yang; J. R. Cavaletto; X. Hu; G. Buechley; H. W. Ohm; G. Shaner; S. B. Goodwin

2004-01-01

222

The AMT1 Arginine Methyltransferase Gene Is Important for Plant Infection and Normal Hyphal Growth in Fusarium graminearum  

Microsoft Academic Search

Arginine methylation of non-histone proteins by protein arginine methyltransferase (PRMT) has been shown to be important for various biological processes from yeast to human. Although PRMT genes are well conserved in fungi, none of them have been functionally characterized in plant pathogenic ascomycetes. In this study, we identified and characterized all of the four predicted PRMT genes in Fusarium graminearum,

Guanghui Wang; Chenfang Wang; Rui Hou; Xiaoying Zhou; Guotian Li; Shijie Zhang; Jin-Rong Xu

2012-01-01

223

Major chromosomal length polymorphisms are evident after meiosis in the phytopathogenic fungus Leptosphaeria maculans  

Microsoft Academic Search

Chromosomal DNA of Australian field-isolates of the phytopathogenic ascomycete Leptosphaeria maculans was resolved by pulsed-field gel electrophoresis. All isolates examined had highly variable karyotypes. Ascospores (sexual spores) derived from single pseudothecia (sexual fruiting bodies) isolated from Brassica napus (oilseed rape) stubble were analyzed. In two tetrads four distinct karyotypes were observed, with only one chromosomal DNA band in common to

Kim M. Plummer; Barbara J. Howlett

1993-01-01

224

Production, isolation and characterization of a sterol esterase from Ophiostoma piceae  

Microsoft Academic Search

We studied extracellular sterol esterase production by the ascomycete Ophiostoma piceae in liquid culture. Esterase activity was found in low levels in glucose medium but it was strongly induced by olive oil. An esterase was purified from the 0.5% olive oil-supplemented cultures using ultrafiltration followed by a single chromatographic step on a hydrophobic interaction column. The enzyme was a glycoprotein

Olga Calero-Rueda; Francisco J Plou; Antonio Ballesteros; Angel T Mart??nez; Mar??a Jesús Mart??nez

2002-01-01

225

Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†  

PubMed Central

We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region.

Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

2000-01-01

226

A genetic linkage map of Venturia inaequalis, the causal agent of apple scab  

Microsoft Academic Search

BACKGROUND: Venturia inaequalis is an economically-important disease of apple causing annual epidemics of scab worldwide. The pathogen is a heterothallic ascomycete with an annual cycle of sexual reproduction on infected apple leaf litter, followed by several cycles of asexual reproduction during the apple growing season. Current disease control is achieved mainly through scheduled applications of fungicides. Genetic linkage maps are

Xiangming Xu; Tony Roberts; Dez Barbara; Nick G Harvey; Liqiang Gao; Daniel J Sargent

2009-01-01

227

Eucalyptus microfungi known from culture. 2. Alysidiella, Fusculina and Phlogicylindrium genera nova, with notes on some other poorly known taxa  

Microsoft Academic Search

Although numerous microfungi have been described from Eucalyptus in recent years, this plant genus remains a rich substrate colonized by numerous undescribed species. In the present study several species and genera of ascomycetes were collected from symptomatic leaves or from leaf litter of this host in Australia, South Africa and Europe. New genera include those encompassing Alysidiella parasitica and Phlogicylindrium

B. A. Summerbell; Johannes Z. Groenewald; Angus J. Carnegie; Richard C. Summerbell; Pedro W. Crous

2006-01-01

228

Control of Saccharomyces cerevisiae Filamentous Growth by Cyclin-Dependent Kinase Cdc28  

Microsoft Academic Search

The ascomycete Saccharomyces cerevisiae exhibits alternative vegetative growth states referred to as the yeast form and the filamentous form, and it switches between the two morphologies depending on specific environ- mental signals. To identify molecules involved in control of morphologic differentiation, this study character- ized mutant S. cerevisiae strains that exhibit filamentous growth in the absence of the normal external

NICHOLAS P. EDGINGTON; MELISSA J. BLACKETER; TRACIE A. BIERWAGEN; ALAN M. MYERS

1999-01-01

229

Evolution of the fungal self-fertile reproductive life style from self-sterile ancestors  

Microsoft Academic Search

In most fungal ascomycetes, mating is con- trolled by a single locus (MAT). Fungi requiring a partner to mate are heterothallic (self-sterile); those not requiring a partner are homothallic (self-fertile). Structural analyses of MATsequences from homothallic and heterothallic Cochliobo- lus species support the hypothesis that heterothallism is ancestral. Homothallic species carry both MAT genes in a single nucleus, usually closely

SUNG-HWAN YUN; MARY L. BERBEE; O. C. Y ODER; B. GILLIAN TURGEON

1999-01-01

230

Structural and functional analysis of mitochondrial plasmids in Claviceps purpurea  

Microsoft Academic Search

Several strains of Claviceps purpurea, a phytopathogenic Ascomycete, contain mitochondrial (mt) plasmids in high molar excess relative to mtDNA. Comparative analysis of plasmids of four strains of different geographic origin revealed that all the plasmids are structurally related (size; linearity; restriction map; probably 5'-linked terminal protein; terminal inverted repeats, TIRs); two of them are even identical, indicating a possible mobility

Andrea Düvell; Heike Hessberg-Stutzke; Birgitt Oeser; Petra Rogmann-Backwinkel; Paul Tudzynski

1988-01-01

231

Predicting Dye Biodegradation from Redox Potentials  

Microsoft Academic Search

Two biological approaches for decolorization of azo sulfonated dyes have been compared: reductive decolorization with the ascomycete yeast Issatchenkia occidentalis and enzymatic oxidative decolorization with Trametes villosa laccase alone or in the presence of the mediator 1-hydroxybenzotriazole. The redox potential difference between the biological cofactor involved in the reductive activity of growing cells and the azo dye is a reliable

Andrea Zille; Patricia Ramalho; Tzanko Tzanov; Roy Millward; Veronika Aires; Maria Helena Cardoso; Maria Teresa Ramalho; G. M. Gubitz; Artur Cavaco-Paulo

2004-01-01

232

Yeast genome evolution—the origin of the species  

Microsoft Academic Search

With almost 20 genomes sequenced from unicellular ascomycetes (Saccharomycotina), and the prospect of many more in the pipeline, we review the patterns and processes of yeast genome evolution. A central core of about 4000 genes is shared by all the sequenced yeast genomes. Gains of genes by horizontal gene transfer seem to be very rare. Gene losses are more frequent,

Devin R. Scannell; Geraldine Butler; Kenneth H. Wolfe

2007-01-01

233

The Genome of Nectria haematococca: Contribution of Supernumerary Chromosomes to Gene Expansion  

Microsoft Academic Search

The ascomycetous fungus Nectria haematococca, (asexual name Fusarium solani), is a member of a group of >50 species known as the “Fusarium solani species complex”. Members of this complex have diverse biological properties including the ability to cause disease on >100 genera of plants and opportunistic infections in humans. The current research analyzed the most extensively studied member of this

Jeffrey J. Coleman; Steve D. Rounsley; Marianela Rodriguez-Carres; Alan Kuo; Catherine C. Wasmann; Jane Grimwood; Jeremy Schmutz; Masatoki Taga; Gerard J. White; Shiguo Zhou; David C. Schwartz; Michael Freitag; Li-jun Ma; Etienne G. J. Danchin; Bernard Henrissat; Pedro M. Coutinho; David R. Nelson; Dave Straney; Carolyn A. Napoli; Bridget M. Barker; Michael Gribskov; Martijn Rep; Scott Kroken; István Molnár; Christopher Rensing; John C. Kennell; Jorge Zamora; Mark L. Farman; Eric U. Selker; Asaf Salamov; Harris Shapiro; Jasmyn Pangilinan; Erika Lindquist; Casey Lamers; Igor V. Grigoriev; David M. Geiser; Sarah F. Covert; Esteban Temporini; Hans D. VanEtten

2009-01-01

234

Mutations in nirA gene of Aspergillus nidulans and nitrogen metabolism  

Microsoft Academic Search

IN both prokaryotes and eukaryotes many structural genes are subject to more than one form of control. The ways in which these various forms of regulation interact with each other are therefore of considerable importance for an understanding of the control of gene expression. In the ascomycete fungus Aspergillus nidulans, the structural genes for nitrate reductase and nitrite reductase, the

Keith N. Rand; Herbert N. Arst

1978-01-01

235

Congruent evidence from ?-tubulin and ?-tubulin gene phylogenies for a zygomycete origin of microsporidia  

Microsoft Academic Search

The origin of microsporidia and the evolutionary relationships among the major lineages of fungi have been examined by molecular phylogeny using ?-tubulin and ?-tubulin. Chytrids, basidiomycetes, ascomycetes, and microsporidia were all recovered with high support, and the zygomycetes were consistently paraphyletic. The microsporidia were found to branch within zygomycetes, and showed relationships with members of the Entomophthorales and Zoopagales. This

Patrick J. Keeling

2003-01-01

236

Bioactive biomolecules of mushrooms: Food function and medicinal effect of mushroom fungi  

Microsoft Academic Search

Out of the several thousand species of mushrooms (Basidiomycetes and Ascomycetes) on earth, 1500 species are found in Japan. Many of these species are valuable as gene pool sources which can be utilized by biotechnology to develop new foods and new medicines. Many edible mushrooms are now being studied for their nutritional and flavor properties. To utilize the full potential

Takashi Mizuno

1995-01-01

237

Phylogenetic significance of morphological characters in the tropical Hypotrachyna clade of parmelioid lichens (Parmeliaceae, Ascomycota)  

Microsoft Academic Search

Lichen-forming ascomycetes exhibit often complex morphologies of the vegetative thallus that are usually not found in non-lichenized fungi. This includes the thallus organization and appendical structures associated with the main thallus, such as cilia and rhizines. Such morphological characters are widely employed in the taxonomy of parmelioid lichens, especially at generic level. Within parmelioid lichens, several monophyletic groups can be

Pradeep K. Divakar; Ana Crespo; Oscar Blanco; H. Thorsten Lumbsch

2006-01-01

238

Evolutionary History of Vegetative Reproduction in Porpidia s.l. (Lichen-Forming Ascomycota)  

Microsoft Academic Search

The evolutionary history of gains and losses of vegetative reproductive propagules (soredia) in Porpidia s.l., a group of lichen-forming ascomycetes, was clarified using Bayesian Markov chain Monte Carlo (MCMC) approaches to monophyly tests and a combined MCMC and maximum likelihood approach to ancestral character state reconstructions. The MCMC framework provided confidence estimates for the reconstructions of relationships and ancestral character

Jutta Buschbom; Daniel Barker

2006-01-01

239

Phylogenetic classification of peltigeralean fungi (Peltigerales, Ascomycota) based on ribosomal RNA small and large subunits  

Microsoft Academic Search

To provide a comprehensive molecular phylogeny for peltigeralean fungi and to establish a classification based on monophyly, phylogenetic analyses were carried out on sequences from the nuclear ribosomal large (LSU) and small (SSU) subunits obtained from 113 individuals that represent virtually all main lineages of ascomycetes. Analyses were also conducted on a subset of 77 individuals in which the ingroup

JOLANTA MIADLIKOWSKA; F. Lutzoni

2004-01-01

240

Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF1? genes  

Microsoft Academic Search

True fungi (Eumycota) are heterotrophic eukaryotic microorganisms encompassing ascomycetes, basidiomycetes, chytridiomycetes and zygomycetes. The natural systematics of the latter group, Zygomycota, are very poorly understood due to the lack of distinguishing morphological characters. We have determined sequences for the nuclear-encoded genes actin (act) from 82 zygomycetes representing all 54 currently recognized genera from the two zygomycetous orders Mucorales and Mortierellales.

Kerstin Voigt; Johannes Wöstemeyer

2001-01-01

241

Rate of iodine volatilization and accumulation by filamentous fungi through laboratory cultures  

Microsoft Academic Search

Five strains of basidiomycetes (Lentinula edodes, Coprinus phlyctidosporus, Hebeloma vinosophyllum, Pleurotus ostreatus and Agaricus bisporus), one strain of ascomycete (Hormoconis resinae) and six strains of imperfect fungi (Penicillium chrysogenum, Penicillium roquefortii, Cladosporium cladosporioides, Alternaria alternata, Aspergillus niger and Aspergillus oryzae) were cultured in a liquid medium containing a radioactive iodine tracer (125I), and were tested for their abilities to volatilize

Tadaaki Ban-nai; Yasuyuki Muramatsu; Seigo Amachi

2006-01-01

242

Polyphasic Analysis of Intraspecific Diversity in Epicoccum nigrum Warrants Reclassification into Separate Species  

Microsoft Academic Search

BackgroundEpicoccum nigrum Link (syn. E. purpurascens Ehrenb. ex Schlecht) is a saprophytic ascomycete distributed worldwide which colonizes a myriad of substrates. This fungus has been known as a biological control agent for plant pathogens and produces a variety of secondary metabolites with important biological activities as well as biotechnological application. E. nigrum produces darkly pigmented muriform conidia on short conidiophores

Léia Cecilia de Lima Fávaro; Fernando Lucas de Melo; Carlos Ivan Aguilar-Vildoso; Welington Luiz Araújo

2011-01-01

243

Bioactive Chemical Constituents of a Sterile Endophytic Fungus from Meliotus dentatus  

Microsoft Academic Search

Chemical and biological investigations of the endophytic fungus of an unidentified Ascomycete, isolated from Meliotus dentatus led to the isolation of six known polyketide metabolites ( 1-6) and two steroids (7 and 8). Compounds 1-3, and 5 were tested for antibacterial, antialgal and antifungal activities. Compounds 2, 3, and 5 showed good activity against the alga Chlorella fusca, while compounds

Hidayat Hussain; Karsten Krohn; Siegfried Draeger; Kathrin Meier; Barbara Schulz

244

Comparative genomic analyses of the human fungal pathogens Coccidioides and their relatives  

Microsoft Academic Search

While most Ascomycetes tend to associate principally with plants, the dimorphic fungi Coccidioides immitis and Coccidioides posadasii are primary pathogens of immunocompetent mammals, including humans. Infection results from environmental exposure to Coccidiodies, which is believed to grow as a soil saprophyte in arid deserts. To investigate hypotheses about the life history and evolution of Coccidioides, the genomes of several Onygenales,

Thomas J. Sharpton; Jason E. Stajich; Steven D. Rounsley; Malcolm J. Gardner; Jennifer R. Wortman; Vinita S. Jordar; Rama Maiti; Chinnappa D. Kodira; Daniel E. Neafsey; Qiandong Zeng; Chiung-Yu Hung; Cody McMahan; Anna Muszewska; Marcin Grynberg; M. Alejandra Mandel; Ellen M. Kellner; Bridget M. Barker; John N. Galgiani; Marc J. Orbach; Theo N. Kirkland

2009-01-01

245

Deletion and Complementation of the Mating Type (MAT) Locus of the Wheat Head Blight Pathogen Gibberella zeae  

Microsoft Academic Search

Gibberella zeae, a self-fertile, haploid filamentous ascomycete, causes serious epidemics of wheat (Triticum aestivum) head blight worldwide and contaminates grain with trichothecene mycotoxins. Anecdotal evidence dating back to the late 19th century indicates that G. zeae ascospores (sexual spores) are a more important inoculum source than are macroconidia (asexual spores), although the fungus can produce both during wheat head blight

A. E. Desjardins; D. W. Brown; S.-H. Yun; R. H. Proctor; T. Lee; R. D. Plattner; S.-W. Lu; B. G. Turgeon

2004-01-01

246

Mapping of loci from Solanum lycopersicoides conferring resistance or susceptibility to Botrytis cinerea in tomato  

Microsoft Academic Search

Cultivated tomato (Solanum lycopersicum, syn. Lycopersicon esculentum) is susceptible to the necrotrophic ascomycete and causal agent of gray mold, Botrytis cinerea. Resistance to this fungal pathogen is elevated in wild relatives of tomato, including Solanum lycopersicoides. An introgression line population (IL) containing chromosomal segments of S. lycopersicoides within the background of tomato cv. VF36 was used to screen the genome

Joel Davis; Daozhan Yu; Wendy Evans; Tufan Gokirmak; Roger T. Chetelat; Henrik U. Stotz

2009-01-01

247

Fatty acid composition of lipids present in selected lichenized fungi: A chemotyping study  

Microsoft Academic Search

The total-lipid composition of 21 lichens of the ascomycetous genera Cladonia (11) and Cladina (1) of the family Cladoniacea, Cladia (1), Parmotrema (3), Ramalina (2), Leptogium (1), Cetraria (1), and the basidiomycetous genus Dictyonema (1) was determined. Analyses of those of Dictyonema glabratum were carried out with a total extract and those obtained after successive extractions with various solvents. Each

Guilherme L. Sassaki; Leonardo M. Cruz; Philip A. J. Gorin; Marcello Iacomini

2001-01-01

248

Expression of a chitinase transgene in rose (Rosa hybrida L.) reduces development of blackspot disease (Diplocarpon rosae Wolf)  

Microsoft Academic Search

Blackspot, caused by the Ascomycete fungus Diplocarpon rosae, is the most widespread and pernicious disease of cultivated roses. While some species of rose possess resistance to D. rosae, none of the modern-day rose cultivars are fully resistant to the pathogen. In the current study, Biolistic gene delivery was used to introduce a rice gene, encoding a basic (Class I), chitinase

Robert Marchant; Michael R. Davey; John A. Lucas; Chris J. Lamb; Richard A. Dixon; J. Brian Power

1998-01-01

249

From an electrophoretic mobility shift assay to isolated transcription factors: a fast genomic-proteomic approach  

Microsoft Academic Search

BACKGROUND: Hypocrea jecorina (anamorph Trichoderma reesei) is a filamentous ascomycete of industrial importance due to its hydrolases (e.g., xylanases and cellulases). The regulation of gene expression can influence the composition of the hydrolase cocktail, and thus, transcription factors are a major target of current research. Here, we design an approach for identifying a repressor of a xylanase-encoding gene. RESULTS: We

Astrid R Mach-Aigner; Karin Grosstessner-Hain; Marcio J Poças-Fonseca; Karl Mechtler; Robert L Mach

2010-01-01

250

Cytotoxic alpha-pyrones from Xylaria hypoxylon.  

PubMed

Two new alpha-pyrone derivatives, xylarone (1) and 8,9-dehydroxylarone (2) possessing cytotoxic activities, were isolated from the culture fluid of submerged cultures of the ascomycete Xylaria hypoxylon, strain A27-94. Their structures were elucidated by spectroscopic methods. PMID:17542480

Schüffler, Anja; Sterner, Olov; Anke, Heidrun

2007-01-01

251

Studies on the solubilization of German coal by fungi  

Microsoft Academic Search

Summary The capability of seven basidiomycetes (Trametes versicolor, Poria placenta, Pleurotus florida, P. ostreatus, P. sajor-caju, P. eryngii, Stropharia sp.), one ascomycete (Chaetomium globosum) and five hyphomycetes and moulds (Humicola grisea, Trichoderma viride, Aspergillus terreus, Paecilomyces varioti, Papulaspora immersa) to solubilize medium and high volatile bituminous coals (types A and B) as well as four types of lignite B from

J. Reiss

1992-01-01

252

Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.  

PubMed

Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary and secondary metabolites. This and the earlier mini-review (Johnson Appl Microb Biotechnol 97:503-517, 2013) were motivated during the preparation and publication of the landmark three-volume set of "The yeasts: a taxonomic study, 5th edition" (Kurtzman et al. 2011a, b). PMID:23893324

Johnson, Eric A

2013-09-01

253

An analysis of sexual size dimorphism in goose.  

PubMed

Abstract 1. Sexual size dimorphism (SSD) is a common phenomenon in animals. Rensch's rule states that larger species generally exhibit a higher male to female body size ratio than smaller ones. 2. Domesticated animals offer excellent opportunities for testing predictions of the functional explanations of Rensch's rule and this was tested in a meta-analysis of SSD in 38 breeds of domestic geese compared among themselves and with their wild relatives (subfamily Anserinae, 35 species). 3. Domestic geese and wild Anser species taken together supported Rench's rule but the wild species did not. 4. The non-targeted sex selection hypothesis seems to provide the best intuitive explanation for the lack of SSD in geese. PMID:24571324

Parés-Casanova, P M

2014-04-01

254

Genomic perspectives on the evolution of fungal entomopathogenicity in Beauveria bassiana.  

PubMed

The ascomycete fungus Beauveria bassiana is a pathogen of hundreds of insect species and is commercially produced as an environmentally friendly mycoinsecticide. We sequenced the genome of B. bassiana and a phylogenomic analysis confirmed that ascomycete entomopathogenicity is polyphyletic, but also revealed convergent evolution to insect pathogenicity. We also found many species-specific virulence genes and gene family expansions and contractions that correlate with host ranges and pathogenic strategies. These include B. bassiana having many more bacterial-like toxins (suggesting an unsuspected potential for oral toxicity) and effector-type proteins. The genome also revealed that B. bassiana resembles the closely related Cordyceps militaris in being heterothallic, although its sexual stage is rarely observed. A high throughput RNA-seq transcriptomic analysis revealed that B. bassiana could sense and adapt to different environmental niches by activating well-defined gene sets. The information from this study will facilitate further development of B. bassiana as a cost-effective mycoinsecticide. PMID:22761991

Xiao, Guohua; Ying, Sheng-Hua; Zheng, Peng; Wang, Zheng-Liang; Zhang, Siwei; Xie, Xue-Qin; Shang, Yanfang; St Leger, Raymond J; Zhao, Guo-Ping; Wang, Chengshu; Feng, Ming-Guang

2012-01-01

255

Dolabra nepheliae on rambutan and lychee represents a novel lineage of phytopathogenic Eurotiomycetes.  

PubMed

Rambutan (Nephelium lappaceum) and lychee (Litchi chinensis) are tropical trees in the Sapindaceae that produce delicious edible fruits and are increasingly cultivated in tropical regions. These trees are afflicted with a stem canker disease associated with the ascomycete Dolabra nepheliae. Previously known from Asia and Australia, this fungus was recently reported from Hawaii and Puerto Rico. The sexual and asexual states of Dolabra nepheliae are redescribed and illustrated. In addition, the ITS and large subunit of the nuclear ribosomal DNA plus fragments from the genes RPB2, TEF1, and the mitochondrial small ribosomal subunit were sequenced for three isolates of D. nepheliae and compared with other sequences of ascomycetes. It was determined that D. nepheliae represents a new lineage within the Eurotiomycetes allied with Phaeomoniella chlamydospora, the causal agent of Petri grapevine decline. PMID:20802819

Rossman, Amy Y; Schoch, Conrad L; Farr, David F; Nishijima, Kate; Keith, Lisa; Goenaga, Ricardo

2010-07-01

256

Transport assays in filamentous fungi: kinetic characterization of the UapC purine transporter of Aspergillus nidulans.  

PubMed

Transport assays allow the direct kinetic analysis of a specific transporter by measuring apparent Km and Vmax values, and permit the characterization of substrate specificity profiles through competition assays. In this protocol we describe a rapid and easy method for performing uptake assays in the model filamentous ascomycete Aspergillus nidulans. Our method makes use of A. nidulans germinating conidiospores at a defined morphological stage in which most transporters show maximal expression, avoiding technical difficulties associated with the use of mycelia. In combination with the ease of construction of genetic null mutants in A. nidulans, our method allows the rigorous characterization of any transporter in genetic backgrounds that are devoid of other transporters of similar specificity. Here, we use this method to characterize the kinetic parameters and the specificity profile of UapC, a uric acid-xanthine transporter present in all ascomycetes and member of the ubiquitous Nucleobase-Ascorbate Transporter family, in specific genetic backgrounds lacking other relevant transporters. PMID:24355588

Krypotou, Emilia; Diallinas, George

2014-02-01

257

Nucleotide Composition of Nucleic Acids of Fungi II. Deoxyribonucleic Acids  

PubMed Central

Storck, Roger (The University of Texas, Austin). Nucleotide composition of nucleic acids from fungi. II. Deoxyribonucleic acids. J. Bacteriol. 91:227–230. 1966.—The nucleotide composition of the deoxyribonucleic acids (DNA) present in extracts of 30 species of fungi was determined. The results were analyzed, together with those in the literature. It was found that the content, in moles per cent of guanine plus cytosine (GC content), varied from 38 to 63% in a distribution composed of 9 species of zygomycetes, 14 of ascomycetes, and 9 each of deuteromycetes and basidiomycetes. The GC content ranges were: 38 to 48% for the zygomycetes, 38 to 54% for the ascomycetes, 47 to 62% for the deuteromycetes, and 44 to 63% for the basidiomycetes. The GC content ranged from 38 to 40% for four Mucor species. The base composition of fungal DNA appears, therefore, to have a taxonomic and phylogenetic significance.

Storck, Roger

1966-01-01

258

The fungal glutathione S-transferase system. Evidence of new classes in the wood-degrading basidiomycete Phanerochaete chrysosporium.  

PubMed

The recent release of several basidiomycete genome sequences allows an improvement of the classification of fungal glutathione S-transferases (GSTs). GSTs are well-known detoxification enzymes which can catalyze the conjugation of glutathione to non-polar compounds that contain an electrophilic carbon, nitrogen, or sulfur atom. Following this mechanism, they are able to metabolize drugs, pesticides, and many other xenobiotics and peroxides. A genomic and phylogenetic analysis of GST classes in various sequenced fungi--zygomycetes, ascomycetes, and basidiomycetes--revealed some particularities in GST distribution, in comparison with previous analyses with ascomycetes only. By focusing essentially on the wood-degrading basidiomycete Phanerochaete chrysosporium, this analysis highlighted a new fungal GST class named GTE, which is related to bacterial etherases, and two new subclasses of the omega class GSTs. Moreover, our phylogenetic analysis suggests a relationship between the saprophytic behavior of some fungi and the number and distribution of some GST isoforms within specific classes. PMID:19662500

Morel, Mélanie; Ngadin, Andrew A; Droux, Michel; Jacquot, Jean-Pierre; Gelhaye, Eric

2009-12-01

259

Dolabra nepheliae on rambutan and lychee represents a novel lineage of phytopathogenic Eurotiomycetes  

PubMed Central

Rambutan (Nephelium lappaceum) and lychee (Litchi chinensis) are tropical trees in the Sapindaceae that produce delicious edible fruits and are increasingly cultivated in tropical regions. These trees are afflicted with a stem canker disease associated with the ascomycete Dolabra nepheliae. Previously known from Asia and Australia, this fungus was recently reported from Hawaii and Puerto Rico. The sexual and asexual states of Dolabra nepheliae are redescribed and illustrated. In addition, the ITS and large subunit of the nuclear ribosomal DNA plus fragments from the genes RPB2, TEF1, and the mitochondrial small ribosomal subunit were sequenced for three isolates of D. nepheliae and compared with other sequences of ascomycetes. It was determined that D. nepheliae represents a new lineage within the Eurotiomycetes allied with Phaeomoniella chlamydospora, the causal agent of Petri grapevine decline.

Schoch, Conrad L.; Farr, David F.; Nishijima, Kate; Keith, Lisa; Goenaga, Ricardo

2010-01-01

260

Rapid Identification of Candida Species and Other Clinically Important Yeast Species by Flow Cytometry†  

PubMed Central

Two rapid diagnostic assays, utilizing two different Luminex flow cytometry methods, were developed for identification of clinically important ascomycetous yeast species. Direct hybridization and allele-specific primer extension methods were both successful in establishing a DNA-based assay that can rapidly and accurately identify Candida albicans, Candida krusei, Candida parapsilosis, Candida glabrata, and Candida tropicalis as well as other clinical species. The direct hybridization assay was designed to identify a total of 19 ascomycetous yeast species, and the allele-specific primer extension assay was designed to identify a total of 34 species. Probes were validated against 438 strains representing 303 species. From culture to identification, the allele-specific primer extension method takes 8 h and the direct hybridization method takes less than 5 h to complete. These assays represent comprehensive, rapid tests that are well suited for the clinical laboratory.

Page, Brent T.; Kurtzman, Cletus P.

2005-01-01

261

Antagonistic activity of Malassezia Spp. towards other clinically significant yeast genera.  

PubMed

Antagonistic activity of Malassezia yeast towards clinically significant yeast species was studied. Ten Malassezia strains exhibited this activity. M. furfur strain exhibited maximum activity and the least sensitivity to "foreign" metabolites. M. globosa proved to be the most sensitive and the least active. M. furfur metabolites exhibited pronounced activity towards 6 Basidiomycetes strains. This effect was significantly higher in comparison with antagonistic activity towards 13 Ascomycetes species. Studies of a complex of M. furfur antagonistic metabolites showed that it has at least two components: thermolabile proteins with molecular weights of 33 and 35 kDa and a thermostable one, proteinase-resistant. In contrast to metabolites of many other yeast species, this substance is more effective against related Basidiomycetes microorganisms (Cryptococcus albicans), while antagonistic proteins are active mainly towards Ascomycetes, such as Candida albicans. It was found that mycocin-like activity of Malassezia is encoded by chromosomes, but not plasmids. PMID:20396701

Arzumanian, V G; Sergeev, A Yu; Shelemekh, O V; Ojovan, I M; Serdiuk, O A

2009-09-01

262

Production of extracellular ribonuclease by yeasts and yeastlike fungi, and its repression by orthophosphate in species of Cryptococcus and Tremella.  

PubMed Central

A strain of Cryptococcus laurentii and a haploid isolate of Tremella foliacea were shown to produce orthophosphate-repressible ribonuclease in liquid culture. Addition of as little as 1 mM K2HPO4, pH 7.0, completely repressed enzyme production by both fungi. The orthophosphate-repressible enzyme was not produced by other species of the two genera tested. These results, together with other findings, suggest a close phylogenetic relationship between Cryptococcus laurentii and Tremella foliacea. The ability of other yeasts and yeastlike fungi to hydrolyze ribonucleic acid in a solid test medium was assessed. Based on the limited number of organisms available for study, extracellular ribonuclease activity was found in species having close affinity to the Basidiomycetes and in yeasts classified in the ascomycetous genera, Endomycopsis, Hansenula, and Kluyveromyces. Other ascomycetous yeasts did not exhibit extracellular ribonuclease.

Burt, W R; Cazin, J

1976-01-01

263

Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador.  

PubMed

Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes. PMID:18534836

Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A

2008-07-01

264

Assimilation of Unusual Carbon Compounds  

NASA Astrophysics Data System (ADS)

Yeast taxa traditionally are distinguished by growth tests on several sugars and organic acids. During the last decades it became apparent that many yeast species assimilate a much greater variety of naturally occurring carbon compounds as sole source of carbon and energy. These abilities are indicative of a greater role of yeasts in the carbon cycle than previously assumed. Especially in acidic soils and other habitats, yeasts may play a role in the degradation of carbon compounds. Such compounds include purines like uric acid and adenine, aliphatic amines, diamines and hydroxyamines, phenolics and other benzene compounds and polysaccharides. Assimilation of purines and amines is a feature of many ascomycetes and basidiomycetes. However, benzene compounds are degraded by only a few ascomycetous yeasts (e.g. the Stephanoascus/ Blastobotrys clade and black yeastlike fungi) but by many basidiomycetes, e.g. Filobasidiales, Trichosporonales, red yeasts producing ballistoconidia and related species, but not by Tremellales. Assimilation of polysaccharides is wide-spread among basidiomycetes

Middelhoven, Wouter J.

265

Isolation and Characterization of a Novel Facultative Anaerobic Filamentous Fungus from Japanese Rice Field Soil  

PubMed Central

A novel filamentous fungus strain designated RB-1 was isolated into pure culture from Japanese rice field soil through an anaerobic role tube technique. The strain is a mitosporic fungus that grows in both aerobic and strict anaerobic conditions using various mono-, di-, tri-, and polysaccharides with acetate and ethanol productions. The amount of acetate produced was higher than that of ethanol in both aerobic and anaerobic cultures. The characteristic verrucose or punctuate conidia of RB-1 closely resembled those of some strains of the genus Thermomyces, a thermophilic or mesophilic anamorphic ascomycete. However, based on phylogenetic analysis with the small subunit (SSU) and large subunit (LSU) rDNA sequences, RB-1 was characterized as a member of the class Lecanoromycetes of the phylum Ascomycota. Currently, RB-1 is designated as an anamorphic ascomycete and is phylogenetically considered an incertae sedis within the class Lecanoromycetes.

Tonouchi, Akio

2009-01-01

266

Comparative Functional Genomics of the Fission Yeasts  

Microsoft Academic Search

The fission yeast clade---comprising Schizosaccharomyces pombe, S. octosporus, S. cryophilus, and S. japonicus---occupies the basal branch of Ascomycete fungi and is an important model of eukaryote biology. A comparative annotation of these genomes identified a near extinction of transposons and the associated innovation of transposon-free centromeres. Expression analysis established that meiotic genes are subject to antisense transcription during vegetative growth,

Nicholas Rhind; Zehua Chen; Moran Yassour; Dawn A. Thompson; Brian J. Haas; Naomi Habib; Ilan Wapinski; Sushmita Roy; Michael F. Lin; David I. Heiman; Sarah K. Young; Kanji Furuya; Yabin Guo; Alison Pidoux; Huei Mei Chen; Barbara Robbertse; Jonathan M. Goldberg; Keita Aoki; Elizabeth H. Bayne; Aaron M. Berlin; Christopher A. Desjardins; Edward Dobbs; Livio Dukaj; Lin Fan; Michael G. FitzGerald; Courtney French; Sharvari Gujja; Klavs Hansen; Dan Keifenheim; Joshua Z. Levin; Rebecca A. Mosher; Carolin A. Müller; Jenna Pfiffner; Margaret Priest; Carsten Russ; Agata Smialowska; Peter Swoboda; Sean M. Sykes; Matthew Vaughn; Sonya Vengrova; Ryan Yoder; Qiandong Zeng; Robin Allshire; David Baulcombe; Bruce W. Birren; William Brown; Karl Ekwall; Manolis Kellis; Janet Leatherwood; Henry Levin; Hanah Margalit; Rob Martienssen; Conrad A. Nieduszynski; Joseph W. Spatafora; Nir Friedman; Jacob Z. Dalgaard; Peter Baumann; Hironori Niki; Aviv Regev; Chad Nusbaum

2011-01-01

267

ENDOPHYTES OF SERAPIAS PARVIFLORA PARL. AND SPIRANTHES SPIRALIS (L.) CHEVALL. (ORCHIDACEAE): DESCRIPTION OF ENDOPHYTES OF S. PARVIFLORA, AND IN VITRO SYMBIOSIS DEVELOPMENT IN S. PARVIFLORA AND SPIRANTHES SPIRALIS  

Microsoft Academic Search

AB S T R A C T. Endophytes were isolated from Serapias parviflora (Orchidaceae) roots. They are described and partially classified under microscope, after growth on PDA. Two fungi had symbiotic characters: A-Sepa-1, an ascomycete, and B-Sepa-1, a basidiomycete. At the same time, many plants of S. parviflora and Spiranthes spiralis were asymbiotically obtained by sterilisation of seeds and sowing

PIER LUIGI PACETTI; SABINE RIESS

268

A Botrytis cinerea Putative 3-keto Reductase Gene ( ERG27 ) that is Homologous to the Mammalian 17?-Hydroxysteroid Dehydrogenase type 7 gene (17?-HSD7)  

Microsoft Academic Search

Botrytis cinerea (anamorph of Botryotinia fuckeliana) is a filamentous ascomycete that causes grey mould on grapevine. We had previously described two distinct populations, named HydR1 and non-HydR1, that comprise two distinct genetic entities based on genetic polymorphism, natural resistance towards the fungicide hydroxyanilide fenhexamid, and vegetative incompatibility between them. Here, we used PCR to isolate the 3-keto reductase gene ERG27

Catherine Albertini; Pierre Leroux

2004-01-01

269

A simple method for a mini-preparation of fungal DNA  

Microsoft Academic Search

A simple method was established to prepare DNA from fungal mycelia cultured on an agar plate. The fungi tested successfully\\u000a with this method contained Zygomycetes, Ascomycetes, Basidiomycetes, and Oomycetes. This method did not require any time-consuming\\u000a steps to crush or digest mycelia or fractionation in a phenol–chloroform mixture. The DNA was easily extracted by immersing\\u000a and dispersing the mycelial plugs

Ken-ichiro Saitoh; Kana Togashi; Tsutomu Arie; Tohru Teraoka

2006-01-01

270

Technological Advancement Development of a Fusarium graminearum AVymetrix GeneChip for proWling fungal gene expression in vitro and in planta  

Microsoft Academic Search

Recently the genome sequences of several Wlamentous fungi have become available, providing the opportunity for large-scale func- tional analysis including genome-wide expression analysis. We report the design and validation of the Wrst AVymetrix GeneChip micro- array based on the entire genome of a Wlamentous fungus, the ascomycetous plant pathogen Fusarium graminearum. To maximize the likelihood of representing all putative genes

Ulrich Güldener; Kye-Yong Seong; Jayanand Boddu; Seungho Cho; Frances Trail; Jin-Rong Xu; Gerhard Adam; Hans-Werner Mewes

271

Fusarium graminearum Gene Deletion Mutants Map1 and tri5 Reveal Similarities and Differences in the Pathogenicity Requirements to Cause Disease on Arabidopsis and Wheat Floral Tissue  

Microsoft Academic Search

The Ascomycete pathogen Fusarium graminearum can infect all cereal species and lower grain yield, quality and safety. The fungus can also cause disease on Arabidopsis thaliana. In this study, the disease-causing ability of two F. graminearum mutants was analysed to further explore the parallels between the wheat (Triticum aestivum) and Arabidopsis floral pathosystems. Wild-type F graminearum (strain PH-1) and two

Alayne Cuzick; Martin Urban; Kim Hammond-Kosack

2008-01-01

272

Dolabra nepheliae on rambutan and lychee represents a novel lineage of phytopathogenic Eurotiomycetes  

Microsoft Academic Search

Rambutan (Nephelium lappaceum) and lychee (Litchi chinensis) are tropical trees in the Sapindaceae that produce delicious edible fruits and are increasingly cultivated in tropical regions.\\u000a These trees are afflicted with a stem canker disease associated with the ascomycete Dolabra nepheliae. Previously known from Asia and Australia, this fungus was recently reported from Hawaii and Puerto Rico. The sexual and\\u000a asexual

Amy Y. RossmanConrad; Conrad L. Schoch; David F. Farr; Kate Nishijima; Lisa Keith; Ricardo Goenaga

2010-01-01

273

Wood-decay fungi in hazel wood: species richness correlated to stand age and dead wood features  

Microsoft Academic Search

The correlation between species richness of wood-decay fungi, stand age and dead wood features was investigated in eight hazel stands in south-east Sweden. Sampling of fruit-bodies was performed on fallen decomposing hazel stems and a total of 140 species were found, 60 ascomycetes (pyrenomycetes) and 80 basidiomycetes (Aphyllophorales). Total species richness correlated negatively with the age of stands, contrary to

Bjorn Norden; Heidi Paltto

2001-01-01

274

The Sfp-Type 4?-Phosphopantetheinyl Transferase Ppt1 of Fusarium fujikuroi Controls Development, Secondary Metabolism and Pathogenicity  

Microsoft Academic Search

The heterothallic ascomycete Fusarium fujikuroi is a notorious rice pathogen causing super-elongation of plants due to the production of terpene-derived gibberellic acids (GAs) that function as natural plant hormones. Additionally, F. fujikuroi is able to produce a variety of polyketide- and non-ribosomal peptide-derived metabolites such as bikaverins, fusarubins and fusarins as well as metabolites from yet unidentified biosynthetic pathways, e.g.

Philipp Wiemann; Sabine Albermann; Eva-Maria Niehaus; Lena Studt; Katharina W. von Bargen; Nelson L. Brock; Hans-Ulrich Humpf; Jeroen S. Dickschat; Bettina Tudzynski

2012-01-01

275

Comparison of transcription of multiple genes during mycelia transition to yeast cells of Paracoccidioides brasiliensis reveals insights to fungal differentiation and pathogenesis  

Microsoft Academic Search

The ascomycete Paracoccidioides brasiliensis is a human pathogen with a broad distribution in Latin America. The infection process of P. brasiliensis is initiated by aerially dispersed mycelia propagules, which differentiate into the yeast parasitic phase in human lungs.\\u000a Therefore, the transition to yeast is an initial and fundamental step in the infective process. In order to identify and characterize\\u000a genes

Juliana Alves Parente; Clayton Luiz Borges; Alexandre Melo Bailão; Maria Sueli S. Felipe; Maristela Pereira; Célia Maria de Almeida Soares

2008-01-01

276

Slippery Scar: A New Mushroom Disease in Auricularia polytricha  

PubMed Central

A new disease, the slippery scar, was investigated in cultivated bags of Auricularia polytricha. This fungus was isolated from the infected mycelia of cultivated bags. Based on morphological observation, rDNA-internal transcribed spacer and 18S sequence analysis, this pathogen was identified as the Ascomycete Scytalidium lignicola. According to Koch's Postulation, the pathogenicity of S. lignicola to the mycelia of A. polytricha was confirmed. The parasitism of this fungus on mushroom mycelia in China has not been reported before.

Sun, Jie

2012-01-01

277

Structures of Cvnh Family Lectins  

Microsoft Academic Search

Members of the CVNH family are found in a restricted range of eukaryotic organisms as diverse as filamentous ascomycetes and\\u000a seedless plants. All CVNH proteins so far exhibit a fold that matches the unique fold of the cyanobacterial protein. The CVNH\\u000a domain is a versatile protein module, and, with some exceptions, comprises 101–150 aa with two sequential repeats of 50

Angela M. Gronenborn

278

A glimpse of lignicolous marine fungi occurring in coastal water bodies of Tamil Nadu (India).  

PubMed

In the present investigation, a total of 51 marine fungi were obtained from wood samples collected from four locations of Tamil Nadu (Tuthukudi, Chennai, Kanyakumari and Pichavaram), India. Out of these 51, 28 were ascomycetes, one was basidiomycete and 22 were mitosporic fungi. Maximum fungal diversity was encountered from Tuthukudi, followed by Chennai, Kanyakumari, and the minimum from Pichavaram. Periconia prolifica was the only species common to all the four locations. PMID:18511000

Nambiar, Gayatri R; Raveendran, Kalathil; Changxing, Zhao; Jaleel, Cheruth Abdul

2008-06-01

279

A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia  

PubMed Central

We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries.

Gabriel, Frederic; D'Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valerie; Noel, Thierry; Accoceberry, Isabelle

2013-01-01

280

11 Carbonic Anhydrases in Fungi and Fungal-Like Organisms – Functional Distribution and Evolution of a Gene Family  

Microsoft Academic Search

\\u000a The gene family of carbonic anhydrases consists of enzymes that are capable to rapidly accelerate the spontaneous and reversible\\u000a interconversion from carbon dioxide to bicarbonate. To date, fungal carbonic anhydrases have been identified in the genomes\\u000a of some ‘basal fungi’, ascomycetes, basidiomycetes and also within the so-called group of non-fungal organisms studied by\\u000a mycologists. Based on the primary structure of

Skander Elleuche

281

Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera  

Microsoft Academic Search

The phylogeny of the genera Periconiella, Ramichloridium, Rhinocladiella and Veronaea was explored by means of partial sequences of the 28S (LSU) rRNA gene and the ITS region (ITS1, 5.8S rDNA and ITS2). Based on the LSU sequence data, ramichloridium-like species segregate into eight distinct clusters. These include the Capnodiales (Mycosphaerellaceae and Teratosphaeriaceae), the Chaetothyriales (Herpotrichiellaceae), the Pleosporales, and five ascomycete

M. Arzanlou; J. Z. Groenewald; W. Gams; U. Braun; P. W. Crous

2007-01-01

282

The influence of clear-cutting on ectomycorrhizal fungus diversity in a lodgepole pine ( Pinus contorta ) stand, Yellowstone National Park, Wyoming, and Gallatin National Forest, Montana  

Microsoft Academic Search

Effects of clear-cutting on the ectomycorrhizal (EM) fungus community in a Pinus contorta Dougl. ex Loud. forest near Yellowstone National Park, Wyoming, U.S.A., were assessed using molecular techniques. Samples were taken by soil core in both undisturbed and clear-cut sites by randomized block design. Species overlap was compared between clear-cut and undisturbed sites and ascomycete-basidiomycete ratio was determined, using PCR-RFLP

Kristin B. Byrd; V. Thomas Parker; Detlev R. Vogler; Ken W. Cullings

2000-01-01

283

Transformation of Sordaria macrospora to hygromycin B resistance: characterization of transformants by electrophoretic karyotyping and tetrad analysis  

Microsoft Academic Search

The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium

Markus Walz; Ulrich Kiick

1995-01-01

284

Purification of exo-1,3-beta-glucanase, a new extracellular glucanolytic enzyme from Talaromyces emersonii  

Microsoft Academic Search

The moderately thermophilic aerobic ascomycete Talaromyces emersonii secretes, under selected growth conditions, several ?-glucan hydrolases including an exo-1,3-?-glucanase. This enzyme was\\u000a purified to apparent homogeneity in order to characterise its biochemical properties and investigate hydrolysis of different\\u000a ?-glucans, including laminaran, a 1,3-?-glucan from brown algae. The native enzyme is monomeric with a molecular mass of ~40 kDa\\u000a and a pI value

Elaine O’Connell; Charles Piggott; Maria Tuohy

2011-01-01

285

The ?-glucuronidase Agu1 from Schizophyllum commune is a member of a novel glycoside hydrolase family (GH115)  

Microsoft Academic Search

Schizophyllum commune produces an ?-glucuronidase that is active on polymeric xylan, while the ascomycete ?-glucuronidases are only active on xylan\\u000a oligomers. In this study, we have identified the gene (agu1) encoding this enzyme and confirmed the functionality by overexpression of the gene in S. commune and degradation of aldopentauronic acids, (MeGlcA)3-Xyl4, in the cultivation medium of the transformants. Expression analysis

Sun-Li Chong; Evy Battaglia; Pedro M. Coutinho; Bernard Henrissat; Maija Tenkanen; Ronald P. de Vries

2011-01-01

286

?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora  

PubMed Central

Carbon dioxide (CO2) is among the most important gases for all organisms. Its reversible interconversion to bicarbonate (HCO3?) reaches equilibrium spontaneously, but slowly, and can be accelerated by a ubiquitous group of enzymes called carbonic anhydrases (CAs). These enzymes are grouped by their distinct structural features into ?-, ?-, ?-, ?- and ?-classes. While physiological functions of mammalian, prokaryotic, plant and algal CAs have been extensively studied over the past years, the role of ?-CAs in yeasts and the human pathogen Cryptococcus neoformans has been elucidated only recently, and the function of CAs in multicellular filamentous ascomycetes is mostly unknown. To assess the role of CAs in the development of filamentous ascomycetes, the function of three genes, cas1, cas2 and cas3 (carbonic anhydrase of Sordaria) encoding ?-class carbonic anhydrases was characterized in the filamentous ascomycetous fungus Sordaria macrospora. Fluorescence microscopy was used to determine the localization of GFP- and DsRED-tagged CAs. While CAS1 and CAS3 are cytoplasmic enzymes, CAS2 is localized to the mitochondria. To assess the function of the three isoenzymes, we generated knock-out strains for all three cas genes (?cas1, ?cas2, and ?cas3) as well as all combinations of double mutants. No effect on vegetative growth, fruiting-body and ascospore development was seen in the single mutant strains lacking cas1 or cas3, while single mutant ?cas2 was affected in vegetative growth, fruiting-body development and ascospore germination, and the double mutant strain ?cas1/2 was completely sterile. Defects caused by the lack of cas2 could be partially complemented by elevated CO2 levels or overexpression of cas1, cas3, or a non-mitochondrial cas2 variant. The results suggest that CAs are required for sexual reproduction in filamentous ascomycetes and that the multiplicity of isoforms results in redundancy of specific and non-specific functions.

Elleuche, Skander; Poggeler, Stefanie

2009-01-01

287

Distribution of mating types and genetic diversity induced by sexual recombination in Setosphaeria turcica in northern China  

Microsoft Academic Search

Mature ascocarps and ascospores in the heterothallic ascomycete fungus, Setosphaeria turcica, were successfully produced in Sach’s medium with barley culm as the mating stimulator after four weeks’ coincubation of\\u000a two opposite mating type isolates at 25°C in darkness. A single isolate could not produce ascospores or ascocarps. The ascocarps\\u000a were produced on the exposed surface and embedded parts of barley

Yongshan Fan; Jifang Ma; Xiumei Gui; Xinlong An; Shuqin Sun; Jingao Dong

2007-01-01

288

The distribution of ascus types and photobiontal selection in Lecanoromycetes (Ascomycota) against the background of a revised SSU nrDNA phylogeny  

Microsoft Academic Search

Within the last decade, molecular methods have revealed the relationships in many groups of lichenized Ascomycetes. However,\\u000a the published phylogenies were often contradictory with respect to higher taxonomic levels. To achieve a more convincing overall\\u000a picture of phylogenetic relationships of and within the Lecanoromycetes, we set up an alignment of all publicly available\\u000a SSU nrDNA sequences of the Pezizomycotina, discarded

Derek Peršoh; Andreas Beck; Gerhard Rambold

2004-01-01

289

Using a multigene phylogenetic analysis to assess generic delineation and character evolution in Verrucariaceae ( Verrucariales, Ascomycota)  

Microsoft Academic Search

Verrucariaceae are a family of mostly crustose lichenized ascomycetes colonizing various habitats ranging from marine and fresh water to arid environments. Phylogenetic relationships among members of the Verrucariaceae are mostly unknown and the current morphology-based classification has never been confronted to molecular data. A multilocus phylogeny (nuLSU, nuSSU and RPB1) was reconstructed for 83 taxa representing all main genera of

Cécile Gueidan; Claude Roux; François Lutzoni

2007-01-01

290

Early diverging Ascomycota: phylogenetic divergence and related evolutionary enigmas  

Microsoft Academic Search

The early diverging Ascomycota lineage, detected primarily from nSSU rDNA sequence-based phylogenetic analyses, includes enigmatic key taxa important to an understanding of the phylogeny and evolution of higher fungi. At the moment six representative genera of early diverging ascomycetes (i.e. Taphrina, Protomyces, Saitoella, Schizosaccharo- myces, Pneumocystis and Neolecta) have been assigned to ''Archiascomycetes'' sensu Nishida and Sugiyama (1994) or the

Junta Sugiyama; Kentaro Hosaka; Sung-Oui Suh

2006-01-01

291

Ascus types are phylogenetically misleading in Trapeliaceae and Agyriaceae ( Ostropomycetidae, Ascomycota)  

Microsoft Academic Search

The phylogeny of Agyriaceae was investigated using MP and Bayesian approaches based on a combined dataset of nuLSU rDNA, mtSSU rDNA, and RPB1 sequences of 78 ascomycetes. The type genus of the family is shown to be a strongly supported sister to Coccotremataceae+Pertusariaceae, whereas the remaining species currently classified in Agyriaceae have a well-supported sister-group relationship with Baeomycetales. Monophyly of

H. Thorsten Lumbsch; Imke Schmitt; Armin Mangold; Mats Wedin

2007-01-01

292

Primary structure of the trpC gene from Aspergillus nidulans  

Microsoft Academic Search

We have determined the structure and complete nucleotide sequence of the trifunctional trpC gene from the Ascomycetous fungus Aspergillus nidulans. Results from RNA gel blot analyses showed that this gene encodes two size classes of polyribosomal, poly (A)+RNAs with approximate lengths of 2,400 and 2,600 nucleotides. S1 nuclease protection studies demonstrated that the distribution into the two size classes is

Edward J. Mullaney; John E. Hamer; Kellee A. Roberti; M. Melanie Yelton; William E. Timberlake

1985-01-01

293

Medicinal mushrooms: Towards a new horizon  

PubMed Central

The arising awareness about functional food has created a boom in this new millennium. Mushrooms are widely consumed by the people due to their nutritive and medicinal properties. Belonging to taxonomic category of basidiomycetes or ascomycetes, these mushrooms possess antioxidant and antimicrobial properties. They are also one of the richest source of anticancer and immunomodulating agents. Thus these novel myochemicals from these mushrooms are the wave of future.

Ganeshpurkar, A.; Rai, G.; Jain, A. P.

2010-01-01

294

Heterologous gene expression in the basidiomycete fungus Coprinus cinereus  

Microsoft Academic Search

Direct selection for TRP+ transformants of a trp-2 mutant of Coprinus cinereus showed that the gene mutation could be complemented by the heterologous gene from two other basidiomycete species, Schizophyllum commune (trp1) and Phanerochaete chrysosporium (trpC) but not by an ascomycete gene from Aspergillus nidulans (trpC). Cotransformation was used to confirm that the Aspergillus nidulans gene could be integrated but

Lorna A. Casselton; Alicia Fuente Herce

1989-01-01

295

Cloning and analysis of the mating type genes from Cochliobolus heterostrophus  

Microsoft Academic Search

Cochliobolus heterostrophus, a heterothallic Ascomycete, has a single mating type locus with two alternate forms called MAT-1 and MAT-2. MAT-1 was cloned by complementing a MAT-2 strain using a cosmid library from a MAT-1 strain and screening for a homothallic transformant. The cosmid recovered from this transformant was able to re-transform a MAT-2 strain to homothallism and MAT identity was

B. Gillian Turgeon; Holger Bohlmann; Lynda M. Ciuffetti; Solveig K. Christiansen; Ge Yang; Willi Schfifer; O. C. Yoder

1993-01-01

296

Tagged Mutations at the Tox1 Locus of Cochliobolus heterostrophus by Restriction Enzyme-Mediated Integration  

Microsoft Academic Search

We have used the restriction enzyme-mediated integration insertional mutagenesis procedure to tag the Tox1 locus in the filamentous Ascomycete Cochliobolus heterostrophus. Mutations at other, unselected, loci were also identified and a high proportion (30-50%) of them were tagged. This procedure may be of general utility for simultaneously mutating and tagging genes in fungi and in other eukaryotes. The Tox1 locus

Shunwen Lu; Linda Lyngholm; Ge Yang; Charlotte Bronson; O. C. Yoder; B. Gillian Turgeon

1994-01-01

297

Fungal biodiversity in aquatic habitats  

Microsoft Academic Search

Fungal biodiversity in freshwater, brackish and marine habitats was estimated based on reports in the literature. The taxonomic\\u000a groups treated were those with species commonly found on submerged substrates in aquatic habitats: Ascomycetes (exclusive of yeasts), Basidiomycetes, Chytridiomycetes, and the non-fungal Saprolegniales in the Class Oomycetes. Based on presence\\/absence data for a large number and variety of aquatic habitats, about

Carol A. Shearer; Enrique Descals; Brigitte Kohlmeyer; Jan Kohlmeyer; Ludmila Marvanová; David Padgett; David Porter; Huzefa A. Raja; John P. Schmit; Holly A. Thorton; Hermann Voglymayr

2007-01-01

298

Phylogeny of Discomycetes and Early Radiations of the Apothecial Ascomycotina Inferred from SSU rDNA Sequence Data  

Microsoft Academic Search

Gargas, A., and Taylor, J. W. 1995. Phylogeny of discomycetes and early radiations of the apothecial Ascomycotina inferred from SSU rDNA sequence data. Experimental Mycology 19, 7-15. We used nucleotide sequences of the small subunit ribosomal genes (SSU rDNA) to examine evolutionary relationships of apothecial ascomycetes (division Ascomycota; class Discomycetes sensu ), commonly known as the cup fungi. The apothecial

Andrea Gargas; John W. Taylor

1995-01-01

299

Molecular identification of mycorrhizal fungi in Dactylorhiza sambucina (Orchidaceae)  

Microsoft Academic Search

We amplified and sequenced internal transcribed spacer (ITS) region of the nuclear ribosomal repeat from fungi in roots of\\u000a Dactylorhiza sambucina (Orchidaceae) and used the extended database to identify the mycorrhizal fungi. We molecularly identified three ITS recovered\\u000a from D. sambucina roots, one belonging to Rhizoctonia group, and two to ascomycetes, for the first time in Orchidoidae. In many cases,

Giuseppe Pellegrino; Francesca Bellusci

2009-01-01

300

Diversity of fungi in hair roots of Ericaceae varies along a vegetation gradient.  

PubMed

Ericaceous dwarf shrubs including Calluna vulgaris and Vaccinium spp. occur both in open heathland communities and in forest ecosystems as understory vegetation. Ericaceous shrubs were once thought to form ericoid mycorrhizal associations with a relatively narrow range of ascomycetous fungi closely related to, and including, Rhizoscyphus ericae. However, perceptions have recently changed since the realization that a broader range of ascomycete fungi, and in some cases basidiomycete fungi, can also form associations with the roots of ericaceous plants. We used a combination of molecular approaches, including denaturing gradient gel electrophoresis, terminal restriction fragment length polymorphism, cloning and sequencing, to investigate the diversity of fungi associated with C. vulgaris roots collected across a heathland/native Scots pine forest vegetation gradient. We also determined differences in fungal community composition between roots of co-occurring C. vulgaris and Vaccinium myrtillus in the forest understory. Collectively, the data show that a large diversity of potentially ericoid mycorrhizal fungal taxa associate with roots of C. vulgaris and V. myrtillus, and that ascomycetes were about 2.5 times more frequent than basidiomycetes. The assemblages of fungi associated with C. vulgaris and V. myrtillus were different. In addition, the community of fungi associated with C. vulgaris hair roots was different for samples collected from the forest, open heathland and a transition zone between the two. This separation was partly, but not entirely, due to the occurrence of typical ectomycorrhizal basidiomycetes associated with the hair roots of C. vulgaris in the forest understory. These data demonstrate that forest understory ericaceous shrubs associate with a diverse range of ascomycete and basidiomycete taxa, including typical ectomycorrhizal basidiomycetes. PMID:17908212

Bougoure, Damian S; Parkin, Pamela I; Cairney, John W G; Alexander, Ian J; Anderson, Ian C

2007-11-01

301

ENZYME SYSTEMS FROM THE THERMOPHILIC FUNGUS TALAROMYCES EMERSONII FOR SUGAR BEET BIOCONVERSION  

Microsoft Academic Search

The thermostable enzyme systems produced by the thermophilic ascomycete fungus Talaromyces emersonii cultivated on various carbon sources were investigated for the production of high value products from sugar beet. A broad range of enzymatic activities relevant to cellulose, hemicellulose, and pectin hydrolysis were identified in T. emersonii culture filtrates. In hydrolysis experiments conducted at 71ºC, the enzyme cocktails generated sugar-rich

Sara Fernandes; Patrick G Murray; Maria G. Tuohya

302

Evolution and Ecophysiology of the Industrial Producer Hypocrea jecorina (Anamorph Trichoderma reesei) and a New Sympatric Agamospecies Related to It  

Microsoft Academic Search

BackgroundTrichoderma reesei, a mitosporic green mould, was recognized during the WW II based on a single isolate from the Solomon Islands and since then used in industry for production of cellulases. It is believed to be an anamorph (asexual stage) of the common pantropical ascomycete Hypocrea jecorina.Methodology\\/Principal FindingsWe combined molecular evolutionary analysis and multiple methods of phenotype profiling in order

Irina S. Druzhinina; Monika Komon-Zelazowska; Lea Atanasova; Verena Seidl; Christian P. Kubicek; Alfredo Herrera-Estrella

2010-01-01

303

Capnodiaceae  

PubMed Central

In this paper we revisit the Capnodiaceae with notes on selected genera. Type specimens of the ascomycetous genera Aithaloderma, Anopeltis, Callebaea, Capnodaria, Echinothecium, Phragmocapnias and Scorias were re–examined, described and illustrated. Leptoxyphium is anamorphic Capnodiaceae and Polychaeton is a legitimate and earlier name for Capnodium, but in order to maintain nomenclatural stability we propose that the teleomorphic name should be conisdered for the approved lists of names currently in preparation for fungi. Notes are provided on the ascomycetous genus Scoriadopsis. However, we were unable to locate the type of this genus during the time frame of this study. The ascomycetous genera Aithaloderma, Ceramoclasteropsis, Hyaloscolecostroma and Trichomerium are excluded from Capnodiaceae on the basis of having ascostromata and trans-septate hyaline ascospores and should be accommodated in Chaetothyriaceae. Callebaea is excluded as the ascomata are thyriothecia and the genus is placed in Micropeltidaceae. Echinothecium is excluded as synonym of Sphaerellothecium and is transferred to Mycosphaerellaceae. The type specimen of Capnophaeum is lost and this should be considered as a doubtful genus. The coelomycetous Microxiphium is polyphyletic, while the status of Fumiglobus, Polychaetella and Tripospermum is unclear. Fourteen new collections of sooty moulds made in Thailand were isolated and sequenced. The nuclear large and small rDNA was partially sequenced and compared in a phylogeny used to build a more complete understanding of the relationships of genera in Capnodiaceae. Four new species are described and illustrated, while Phragmocapnias and Scorias are epitypified with fresh collections.

Chomnunti, Putarak; Schoch, Conrad L.; Aguirre-Hudson, Begona; Ko-Ko, Thida W.; Hongsanan, Sinang; Jones, E.B. Gareth; Kodsueb, Rampai; Phookamsak, Rungtiwa; Chukeatirote, Ekachai; Bahkali, Ali H.; Hyde, Kevin D

2012-01-01

304

Soil-inhabiting fungal community composition as qualitative indicator of C metabolism processes  

NASA Astrophysics Data System (ADS)

Although fungi represent the greater part of soil microbial biomass, they play an important role in macro-aggregate formation and their carbon (C) assimilation efficiency is markedly higher than that of bacteria (Bailey et al., 2002), they have not yet been widely used as soil biological indicators. The reason is mainly due to the difficulties in application of molecular analysis tools due to limited availability of reference sequence of fungal strains in DNA database and to the low concentration of fungal DNA in soil and in isolating, enumerating and identifying groups of fungi differing for their functioning in soil and for biological characteristics. The presence of Ascomycetes and Basidiomycetes as the two main groups of soil-inhabiting fungi were investigated in four different cropping systems. The soil DNA of soil samples coming from twenty sites (five sites for each system), collected in two cropping systems in northern (soil organic matter - SOM content varying from 0.8 to 1.4 %) and two in southern Italy (SOM from 1.4 to 2.3%), was amplified using Ascomycete-specific primer ITS1F - ITS4A (Larena et al., 1999) and Basidiomycete-specific primer ITS1F -ITS4B (Gardes and Bruns, 1993). On the basis of soil DNA amplified with specific primers, Ascomycetes were much more represented than Basidiomycetes in the cultivated top soil. Basidiomycetes are usually reported to account for more than half of the fungal biomass in undisturbed soils. However the low ratio of Basidiomycete DNA to soil fungal DNA observed in this study could be a feature of soil fungal communities in arable soil affected by desertification problems as those of some Italian cropping systems mainly in Mediterranean area. This phenomenon could be due to soil tillage, which is well known to deeply reduce fungal biomass and to continuous incorporation into the soil of herbaceous crop residues. In fact, Ascomycetes decompose holocellulose in preference to lignin (Oslko & Takeda, 2002) and their growth may depend on readily available energy sources, such as soluble carbohydrates (Hudson, 1968). The high ratio of Ascomycetes in the top layer where crop residues of the recurrent had represented the main substrate for saprophytic fungi could explain these results. On the contrary, Basidiomycetes are the most important synthesizing biomass organisms in forest soils as well as the most effective organisms in lignin decomposition with an important role in humic substances processes (Hurst et al., 1963; Cook and Rayner, 1986). Preliminary results of this study suggest that the composition of soil-inhabiting fungal communities, which are the organisms most involved in C metabolism processes, could represents an useful indicator in programs aimed to increase the quality of organic matter in arable soils. Bailey V., Smith L., Bolton Jr K. 2002. Fungal-to-bacteria ratio investigated for enhanced C sequestration. Soil Biol. Biochem. 34, 997-1007. Cook R., Rayner A.D.M. 1984. Ecology of Saprotrophic Fungi. Longman, London, New York, 415 pp. Gardes M., Bruns T.D. 1993. ITS primers with enhanced specificity for Basidiomycetes: application to the identification of mycorrhizae and rusts. Molec. Ecol. 2, 113-118. Hudson H.J. 1968. The ecology of fungi on plant remains above the soil. New Phytol. 67, 837-874. Hurst H.M., A. Burges, P. Latter. 1963. Some aspects of the biochemistry of humic acid decomposition by fungi. Phytochem. 1, 227-231. Larena I., Salazar O., González V, Julián M.C., Rubio V. 1999. Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for Ascomycetes. J. Biotech. 75, 187-194. Osolko T., Fukasawa Y., Takeda H. 2003. Roles of diverse fungi in Larch neerle-litter decomposition. Mycologia 95, 820-826.

Manici, L.; Ciavatta, C.; Caputo, F.

2009-04-01

305

Yeasts in malting, with special emphasis on Wickerhamomyces anomalus (synonym Pichia anomala).  

PubMed

Malted barley is a major raw material of beer, as well as distilled spirits and several food products. The production of malt (malting) exploits the biochemical reactions of a natural process, grain germination. In addition to germinating grain, the malting process includes another metabolically active component: a diverse microbial community that includes various types of bacteria and fungi. Therefore, malting can be considered as a complex ecosystem involving two metabolically active groups. Yeasts and yeast-like fungi are an important part of this ecosystem, but previously the significance of yeasts in malting has been largely underestimated. Characterization and identification of yeasts in industrial processes revealed 25 ascomycetous yeasts belonging to 10 genera, and 18 basidiomycetous yeasts belonging to 7 genera. In addition, two ascomycetous yeast-like fungi belonging to the genera Aureobasidium and Exophiala were commonly detected. Yeasts and yeast-like fungi produced extracellular hydrolytic enzymes with a potentially positive contribution to the malt enzyme spectrum. Several ascomycetous yeast strains showed strong antagonistic activity against field and storage moulds, Wickerhamomyces anomalus (synonym Pichia anomala) being the most effective species. Malting studies revealed that W. anomalus VTT C-04565 effectively restricted Fusarium growth and hydrophobin production during malting and prevented beer gushing. In order to broaden the antimicrobial spectrum and to improve malt brewhouse performance, W. anomalus could be combined with other starter cultures such as Lactobacillus plantarum. Well-characterized microbial mixtures consisting of barley and malt-derived microbes open up several possibilities to improve malt properties and to ensure the safety of the malting process. PMID:20872177

Laitila, Arja; Sarlin, Tuija; Raulio, Mari; Wilhelmson, Annika; Kotaviita, Erja; Huttunen, Timo; Juvonen, Riikka

2011-01-01

306

Yeasts in an industrial malting ecosystem.  

PubMed

The malting ecosystem consists of two components: the germinating cereal grains and the complex microbial community. Yeasts and yeast-like fungi are an important part of this ecosystem, but the composition and the effects of this microbial group have been largely unknown. In this study we surveyed the development of yeasts and yeast-like fungi in four industrial scale malting processes. A total of 136 malting process samples were collected and examined for the presence of yeasts growing at 15, 25 and 37 degrees C. More than 700 colonies were isolated and characterized. The isolates were discriminated by PCR-fingerprinting with microsatellite primer (M13). Yeasts representing different fingerprint types were identified by sequence analysis of the D1/D2 domain of the 26S rRNA gene. Furthermore, identified yeasts were screened for the production of alpha-amylase, beta-glucanase, cellulase and xylanase. A numerous and diverse yeast community consisting of both ascomycetous (25) and basidiomycetous (18) species was detected in the various stages of the malting process. The most frequently isolated ascomycetous yeasts belonged to the genera Candida, Clavispora, Galactomyces, Hanseniaspora, Issatchenkia, Pichia, Saccharomyces and Williopsis and the basidiomycetous yeasts to Bulleromyces, Filobasidium, Cryptococcus, Rhodotorula, Sporobolomyces and Trichosporon. In addition, two ascomycetous yeast-like fungi (black yeasts) belonging to the genera Aureobasidium and Exophiala were commonly detected. Yeasts and yeast-like fungi produced extracellular hydrolytic enzymes with a potentially positive contribution to the malt enzyme spectrum. Knowledge of the microbial diversity provides a basis for microflora management and understanding of the role of microbes in the cereal germination process. PMID:16758169

Laitila, A; Wilhelmson, A; Kotaviita, E; Olkku, J; Home, S; Juvonen, R

2006-11-01

307

Yeast Diversity Associated with Invasive Dendroctonus valens Killing Pinus tabuliformis in China Using Culturing and Molecular Methods.  

PubMed

Bark beetle-associated yeasts are much less studied than filamentous fungi, yet they are also considered to play important roles in beetle nutrition, detoxification, and chemical communication. The red turpentine beetle, Dendroctonus valens, an invasive bark beetle introduced from North America, became one of the most destructive pests in China, having killed more than 10 million Pinus tabuliformis as well as other pine species. No investigation of yeasts associated with this bark beetle in its invaded ranges has been conducted so far. The aim of this study was to assess the diversity of yeast communities in different microhabitats and during different developmental stages of Den. valens in China using culturing and denaturing gradient gel electrophoresis (DGGE) approaches and to compare the yeast flora between China and the USA. The yeast identity was confirmed by sequencing the D1/D2 domain of LSU ribosomal DNA (rDNA). In total, 21 species (13 ascomycetes and eight basidiomycetes) were detected by culturing method, and 12 species (11 ascomycetes and one basidiomycetes) were detected by molecular methods from China. The most frequent five species in China were Candida piceae (Ogataea clade), Cyberlindnera americana, Candida oregonensis (Metschnikowia clade), Candida nitratophila (Ogataea clade) and an undescribed Saccharomycopsis sp., detected by both methods. Seven species were exclusively detected by DGGE. Ca. oregonensis (Metschnikowia clade) was the most frequently detected species by DGGE method. Eight species (all were ascomycetes) from the USA were isolated; seven of those were also found in China. We found significant differences in yeast total abundance as well as community composition between different developmental stages and significant differences between the surface and the gut. The frass yeast community was more similar to that of Den. valens surface or larvae than to the community of the gut or adults. Possible functions of the yeast associates are discussed. PMID:24691849

Lou, Qiao-Zhe; Lu, Min; Sun, Jiang-Hua

2014-08-01

308

The cell end marker Tea4 regulates morphogenesis and pathogenicity in the basidiomycete fungus Ustilago maydis.  

PubMed

Positional cues localized to distinct cell domains are critical for the generation of cell polarity and cell morphogenesis. These cues lead to assembly of protein complexes that organize the cytoskeleton resulting in delivery of vesicles to sites of polarized growth. Tea4, an SH3 domain protein, was first identified in fission yeast, and is a critical determinant of the axis of polarized growth, a role conserved among ascomycete fungi. Ustilago maydis is a badiomycete fungus that exhibits a yeast-like form that is nonpathogenic and a filamentous form that is pathogenic on maize and teozintle. We are interested in understanding how positional cues contribute to generation and maintenance of these two forms, and their role in pathogenicity. We identified a homologue of fission yeast tea4 in a genetic screen for mutants with altered colony and cell morphology and present here analysis of Tea4 for the first time in a basidiomycete fungus. We demonstrate that Tea4 is an important positional marker for polarized growth and septum location in both forms. We uncover roles for Tea4 in maintenance of cell and neck width, cell separation, and cell wall deposition in the yeast-like form, and in growth rate, formation of retraction septa, growth reversal, and inhibition of budding in the filamentous form. We show that Tea4::GFP localizes to sites of polarized or potential polarized growth in both forms, as observed in ascomycete fungi. We demonstrate an essential role of Tea4 in pathogencity in the absence of cell fusion. Basidiomycete and ascomycete Tea4 homologues share SH3 and Glc7 domains. Tea4 in basidiomycetes has additional domains, which has led us to hypothesize that Tea4 has novel functions in this group of fungi. PMID:24613993

Valinluck, Michael; Woraratanadharm, Tad; Lu, Ching-Yu; Quintanilla, Rene H; Banuett, Flora

2014-05-01

309

Module evolution and substrate specificity of fungal nonribosomal peptide synthetases involved in siderophore biosynthesis  

PubMed Central

Background Most filamentous ascomycete fungi produce high affinity iron chelators called siderophores, biosynthesized nonribosomally by multimodular adenylating enzymes called nonribosomal peptide synthetases (NRPSs). While genes encoding the majority of NRPSs are intermittently distributed across the fungal kingdom, those encoding ferrichrome synthetase NRPSs, responsible for biosynthesis of ferrichrome siderophores, are conserved, which offers an opportunity to trace their evolution and the genesis of their multimodular domain architecture. Furthermore, since the chemistry of many ferrichromes is known, the biochemical and structural 'rules' guiding NRPS substrate choice can be addressed using protein structural modeling and evolutionary approaches. Results A search of forty-nine complete fungal genome sequences revealed that, with the exception of Schizosaccharomyces pombe, none of the yeast, chytrid, or zygomycete genomes contained a candidate ferrichrome synthetase. In contrast, all filamentous ascomycetes queried contained at least one, while presence and numbers in basidiomycetes varied. Genes encoding ferrichrome synthetases were monophyletic when analyzed with other NRPSs. Phylogenetic analyses provided support for an ancestral duplication event resulting in two main lineages. They also supported the proposed hypothesis that ferrichrome synthetases derive from an ancestral hexamodular gene, likely created by tandem duplication of complete NRPS modules. Recurrent losses of individual domains or complete modules from this ancestral gene best explain the diversity of extant domain architectures observed. Key residues and regions in the adenylation domain pocket involved in substrate choice and for binding the amino and carboxy termini of the substrate were identified. Conclusion Iron-chelating ferrichrome synthetases appear restricted to fission yeast, filamentous ascomycetes, and basidiomycetes and fall into two main lineages. Phylogenetic analyses suggest that loss of domains or modules led to evolution of iterative biosynthetic mechanisms that allow flexibility in biosynthesis of the ferrichrome product. The 10 amino acid NRPS code, proposed earlier, failed when we tried to infer substrate preference. Instead, our analyses point to several regions of the binding pocket important in substrate choice and suggest that two positions of the code are involved in substrate anchoring, not substrate choice.

2008-01-01

310

Identification of the tick-borne relapsing fever spirochete Borrelia hermsii by using a species-specific monoclonal antibody.  

PubMed Central

Borrelia hermsii causes a relapsing fever in humans and is one of several species of tick-borne spirochetes known to occur in the western United States. Spirochetes observed in the peripheral blood of patients acutely ill have been presumptively identified in the past by the geographic location of exposure and the probable species of tick vector. We describe a monoclonal antibody (H9826) that bound to the flagellar protein of B. hermsii but not to those of any of the other species tested, which included B. parkeri, B. turicatae, B. coriaceae, B. anserina, B. burgdorferi, and Leptospira interrogans serovar ballum. This antibody bound efficiently to B. hermsii in an indirect immunofluorescence assay and was used to rapidly detect and identify this spirochete in the peripheral blood of experimentally infected mice and in the central ganglia of Ornithodoros hermsi ticks. H9826 can rapidly confirm the identification of B. hermsii to increase our understanding concerning the geographic distribution, vector specificity, and epidemiological significance of this zoonotic human pathogen. Images

Schwan, T G; Gage, K L; Karstens, R H; Schrumpf, M E; Hayes, S F; Barbour, A G

1992-01-01

311

Identification and function of a polyketide synthase gene responsible for 1,8-dihydroxynaphthalene-melanin pigment biosynthesis in Ascochyta rabiei  

Microsoft Academic Search

Ascochyta rabiei produces and accumulates one of the well-known fungal polyketides, 1,8-dihydroxynaphthalene-melanin pigment (DHN-melanin),\\u000a in asexual and sexual fruiting bodies. Degenerate PCR primers were used to isolate an ArPKS1 of A. rabiei encoding a polypeptide with high similarity to polyketide synthase (PKS) involved in biosynthesis of DHN-melanin in other\\u000a ascomycetous fungi. Site-directed mutagenesis of ArPKS1 in A. rabiei generated melanin-deficient

Hajime O. Akamatsu; Martin I. Chilvers; Jane E. Stewart; Tobin L. Peever

2010-01-01

312

Uranium Biosorption by the Lichen Trapelia involuta at a Uranium Mine  

Microsoft Academic Search

Metal localisation was investigated in the lichenised ascomycete Trapelia involuta growing on a range of uraniferous minerals including metazeunerite [Cu(UO2)2(AsO4)2·8H2O], metatorbernite [Cu(UO2)2(PO4)2·8H2O], autunite [Ca(UO2)2(PO4)2·10H2O] and uranium-enriched iron oxide and hydroxide minerals at the abandoned South Terras mine site, Cornwall, UK. Apothecia from samples collected from waste dumps at the mine have an unusually dark colour that decolorized with NaOCl, an

O. William Purvis; Elizabeth H. Bailey; Judith McLean; Takeshi Kasama; Ben J. Williamson

2004-01-01

313

Cytotoxic activities of endophytic fungi isolated from the endangered, Chinese endemic species Dysosma pleiantha.  

PubMed

Eleven strains of endophytic fungi which habitat in an endangered, Chinese endemic medicinal plant, Dysosma pleiantha (Hance) Woodson, were isolated and tested for their cytotoxic activity using the brine shrimp lethality bioassay. Six isolates were found to exhibit some cytotoxic activity. Extracts of F1273, F1276, and F1280, which were identified as Trichoderma citrinoviride, Chaetomium globosum and Ascomycete sp., in particular, showed most potent activity with LC50 values of 4.86, 7.71, and 14.88 microg/ml, respectively. These results indicate that endophytic fungi of Dysosma pleiantha could be a promising source for antitumour agents. PMID:19791503

Lu, Yin; Chen, Shaoyuan; Wang, Ben

2009-01-01

314

Fungal diversity on fallen leaves of Ficus in northern Thailand* §  

PubMed Central

Fallen leaves of Ficus altissima, F. virens, F. benjamina, F. fistulosa and F. semicordata, were collected in Chiang Mai Province in northern Thailand and examined for fungi. Eighty taxa were identified, comprising 56 anamorphic taxa, 23 ascomycetes and 1 basidiomycete. Common fungal species occurring on five host species with high frequency of occurrence were Beltraniella nilgirica, Lasiodiplodia theobromae, Ophioceras leptosporum, Periconia byssoides and Septonema harknessi. Colletotrichum and Stachybotrys were also common genera. The leaves of different Ficus species supported diverse fungal taxa, and the fungal assemblages on the different hosts showed varying overlap. The fungal diversity of saprobes at the host species level is discussed.

Wang, Hong-kai; Hyde, Kevin D.; Soytong, Kasem; Lin, Fu-cheng

2008-01-01

315

Identification of potentially safe promising fungal cell factories for the production of polyketide natural food colorants using chemotaxonomic rationale  

PubMed Central

Background Colorants derived from natural sources look set to overtake synthetic colorants in market value as manufacturers continue to meet the rising demand for clean label ingredients – particularly in food applications. Many ascomycetous fungi naturally synthesize and secrete pigments and thus provide readily available additional and/or alternative sources of natural colorants that are independent of agro-climatic conditions. With an appropriately selected fungus; using in particular chemotaxonomy as a guide, the fungal natural colorants could be produced in high yields by using the optimized cultivation technology. This approach could secure efficient production of pigments avoiding use of genetic manipulation. Results Polyketide pigment producing ascomycetous fungi were evaluated for their potential as production organisms based on a priori knowledge on species-specific pigment and potential mycotoxin production and BioSafety level (BSL) classification. Based on taxonomic knowledge, we pre-selected ascomycetous fungi belonging to Penicillium subgenus Biverticillium that produced yellow, orange or red pigments while deselecting Penicillium marneffei; a well known human pathogen in addition to other mycotoxigenic fungi belonging to the same group. We identified 10 strains belonging to 4 species; viz. P. purpurogenum, P. aculeatum, P. funiculosum, and P. pinophilum as potential pigment producers that produced Monascus-like pigments but no known mycotoxins. The selection/deselection protocol was illustrated in the pigment extracts of P. aculeatum IBT 14259 and P. crateriforme IBT 5015 analysed by HPLC-DAD-MS. In addition, extracellular pigment producing ability of some of the potential pigment producers was evaluated in liquid media with a solid support and N-glutarylmonascorubramine was discovered in the partially purified pigment extract of P. purpurogenum IBT 11181 and IBT 3645. Conclusion The present work brought out that the use of chemotaxonomic tools and a priori knowledge of fungal extrolites is a rational approach towards selection of fungal polyketide pigment producers considering the enormous chemical diversity and biodiversity of ascomycetous fungi. This rationale could be very handy for the selection of potentially safe fungal cell factories not only for polyketide pigments but also for the other industrially important polyketides; the molecular and genetic basis for the biosynthesis of which has not yet been examined in detail. In addition, 4 out of the 10 chemotaxonomically selected promising Penicillium strains were shown to produce extracellular pigments in the liquid media using a solid support indicating future cell factory possibilities for polyketide natural food colorants.

Mapari, Sameer AS; Meyer, Anne S; Thrane, Ulf; Frisvad, Jens C

2009-01-01

316

Fungal Mating Pheromones: Choreographing the Dating Game  

PubMed Central

Pheromones are ubiquitous from bacteria to mammals - a testament to their importance in regulating inter-cellular communication. In fungal species, they play a critical role in choreographing interactions between mating partners during the program of sexual reproduction. Here, we describe how fungal pheromones are synthesized, their interactions with G protein-coupled receptors, and the signals propagated by this interaction, using Saccharomyces cerevisiae as a reference point. Divergence from this model system is compared amongst the ascomycetes and basidiomycetes, which reveals the wealth of information that has been gleaned from studying pheromone-driven processes across a wide spectrum of the fungal kingdom.

Jones, Stephen K.; Bennett, Richard J.

2011-01-01

317

Parallels in Amphibian and Bat Declines from Pathogenic Fungi  

PubMed Central

Pathogenic fungi have substantial effects on global biodiversity, and 2 emerging pathogenic species—the chytridiomycete Batrachochytrium dendrobatidis, which causes chytridiomycosis in amphibians, and the ascomycete Geomyces destructans, which causes white-nose syndrome in hibernating bats—are implicated in the widespread decline of their vertebrate hosts. We synthesized current knowledge for chytridiomycosis and white-nose syndrome regarding disease emergence, environmental reservoirs, life history characteristics of the host, and host–pathogen interactions. We found striking similarities between these aspects of chytridiomycosis and white-nose syndrome, and the research that we review and propose should help guide management of future emerging fungal diseases.

Eskew, Evan A.

2013-01-01

318

Purification and characterization of mycoferritin from Fusarium verticillioides MRC 826  

Microsoft Academic Search

The fungus Fusarium verticillioides MRC 826 (ascomycetes species), a toxigenic isolate is capable of synthesizing mycoferritin only upon induction with iron\\u000a in yeast extract sucrose medium. The molecular mass, yield, iron and carbohydrate contents of the purified mycoferritin were\\u000a 460 kDa, 0.010 mg\\/g of wet mycelia, 1.0 and 40.2%, respectively. Native gel electrophoresis of the mycoferritin revealed two\\u000a bands possibly representing isoforms

Vakdevi Validandi; Karuna Rupula; Sashidhar Rao Beedu; Vijay Deshpande

2009-01-01

319

Isolation and characterization of endophytic huperzine A-producing fungi from Huperzia serrata.  

PubMed

Huperzia serrata is a producer of huperzine A (HupA), a cholinesterase inhibitor (ChEI). Over 120 endophytic fungi were recovered from this plant and screened for Hup-A and nine were found. These nine represented seven different fungal genera with the most significant producer being Shiraia sp. A total of 127 endophytic fungi isolates obtained from the root, stem, and leaf segments of H. serrata were grouped into 19 genera based on their morphological traits and sequence analysis of the internal transcribed spacers (ITS1-5.8S-ITS2), indicating endophytic fungi in H. serrata are diverse and abundant. Aspergillus, Podospora, Penicillium, Colletotrichum, and Acremonium were the frequent genera, whereas the remaining genera were infrequent groups. Overall, 39 endophytic fungi isolates showed acetylcholinesterase (AChE) inhibition in vitro. Nine endophytic fungi isolates from seven distinct genera were capable of producing HupA verified by thin-layer chromatography and reverse-phase high-performance liquid chromatography (RP-HPLC). Among the HupA-producing fungi, the yield of HupA produced by the Shiraia sp. Slf14 was 327.8 ?g/l in potato dextrose broth, and the fungal HupA was further validated by mass spectrometry (ESI-MS). The present study demonstrated that H. serrata was a fascinating fungal reservoir for producing HupA and other ChEIs. PMID:21107640

Wang, Ya; Zeng, Qing Gui; Zhang, Zhi Bin; Yan, Ri Ming; Wang, Ling Yun; Zhu, Du

2011-09-01

320

De Novo Biosynthesis of Vanillin in Fission Yeast (Schizosaccharomyces pombe) and Baker's Yeast (Saccharomyces cerevisiae) ?  

PubMed Central

Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin ?-d-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity.

Hansen, Esben H.; M?ller, Birger Lindberg; Kock, Gertrud R.; Bunner, Camilla M.; Kristensen, Charlotte; Jensen, Ole R.; Okkels, Finn T.; Olsen, Carl E.; Motawia, Mohammed S.; Hansen, J?rgen

2009-01-01

321

Distribution of sterigmatocystin in filamentous fungi.  

PubMed

During the last 50y, the carcinogenic mycotoxin sterigmatocystin (ST) has been reported in several phylogenetically and phenotypically different genera: Aschersonia, Aspergillus, Bipolaris, Botryotrichum, Chaetomium, Emericella, Eurotium, Farrowia, Fusarium, Humicola, Moelleriella, Monocillium and Podospora. We have reexamined all available strains of the original producers, in addition to ex type and further strains of each species reported to produce ST and the biosynthetically derived aflatoxins. We also screened strains of all available species in Penicillium and Aspergillus for ST and aflatoxin. Six new ST producing fungi were discovered: Aspergillus asperescens, Aspergillus aureolatus, Aspergillus eburneocremeus, Aspergillus protuberus, Aspergillus tardus, and Penicillium inflatum and one new aflatoxin producer: Aspergillus togoensis (=Stilbothamnium togoense). ST was confirmed in 23 Emericella, four Aspergillus, five Chaetomium, one Botryotrichum and one Humicola species grown on a selection of secondary metabolite inducing media, and using multiple detection methods: HPLC-UV/Vis DAD, - HRMS and - MS/MS. The immediate precursor for aflatoxin, O-methylsterigmatocystin was found in Chaetomium cellulolyticum, Chaetomium longicolleum, Chaetomium malaysiense and Chaetomium virescens, but aflatoxin was not detected from any Chaetomium species. In all 55 species, representing more than 11 clades throughout the Pezizomycotina, can be reliably claimed to be ST producers and 13 of these can also produce aflatoxins. It is not known yet whether the ST/aflatoxin pathway has been developed independently 11 times, or is the result of partial horizontal gene transfer. PMID:21530923

Rank, Christian; Nielsen, Kristian F; Larsen, Thomas O; Varga, Janos; Samson, Rob A; Frisvad, Jens C

2011-01-01

322

Two Origins for the Gene Encoding ?-Isopropylmalate Synthase in Fungi  

PubMed Central

Background The biosynthesis of leucine is a biochemical pathway common to prokaryotes, plants and fungi, but absent from humans and animals. The pathway is a proposed target for antimicrobial therapy. Methodology/Principal Findings Here we identified the leuA gene encoding ?-isopropylmalate synthase in the zygomycete fungus Phycomyces blakesleeanus using a genetic mapping approach with crosses between wild type and leucine auxotrophic strains. To confirm the function of the gene, Phycomyces leuA was used to complement the auxotrophic phenotype exhibited by mutation of the leu3+ gene of the ascomycete fungus Schizosaccharomyces pombe. Phylogenetic analysis revealed that the leuA gene in Phycomyces, other zygomycetes, and the chytrids is more closely related to homologs in plants and photosynthetic bacteria than ascomycetes or basidiomycetes, and suggests that the Dikarya have acquired the gene more recently. Conclusions/Significance The identification of leuA in Phycomyces adds to the growing body of evidence that some primary metabolic pathways or parts of them have arisen multiple times during the evolution of fungi, probably through horizontal gene transfer events.

Larson, Erica M.; Idnurm, Alexander

2010-01-01

323

Comparative genomic analyses of the human fungal pathogens Coccidioides and their relatives  

PubMed Central

While most Ascomycetes tend to associate principally with plants, the dimorphic fungi Coccidioides immitis and Coccidioides posadasii are primary pathogens of immunocompetent mammals, including humans. Infection results from environmental exposure to Coccidiodies, which is believed to grow as a soil saprophyte in arid deserts. To investigate hypotheses about the life history and evolution of Coccidioides, the genomes of several Onygenales, including C. immitis and C. posadasii; a close, nonpathogenic relative, Uncinocarpus reesii; and a more diverged pathogenic fungus, Histoplasma capsulatum, were sequenced and compared with those of 13 more distantly related Ascomycetes. This analysis identified increases and decreases in gene family size associated with a host/substrate shift from plants to animals in the Onygenales. In addition, comparison among Onygenales genomes revealed evolutionary changes in Coccidioides that may underlie its infectious phenotype, the identification of which may facilitate improved treatment and prevention of coccidioidomycosis. Overall, the results suggest that Coccidioides species are not soil saprophytes, but that they have evolved to remain associated with their dead animal hosts in soil, and that Coccidioides metabolism genes, membrane-related proteins, and putatively antigenic compounds have evolved in response to interaction with an animal host.

Sharpton, Thomas J.; Stajich, Jason E.; Rounsley, Steven D.; Gardner, Malcolm J.; Wortman, Jennifer R.; Jordar, Vinita S.; Maiti, Rama; Kodira, Chinnappa D.; Neafsey, Daniel E.; Zeng, Qiandong; Hung, Chiung-Yu; McMahan, Cody; Muszewska, Anna; Grynberg, Marcin; Mandel, M. Alejandra; Kellner, Ellen M.; Barker, Bridget M.; Galgiani, John N.; Orbach, Marc J.; Kirkland, Theo N.; Cole, Garry T.; Henn, Matthew R.; Birren, Bruce W.; Taylor, John W.

2009-01-01

324

Distribution and evolution of glycoside hydrolase family 45 cellulases in nematodes and fungi  

PubMed Central

Background Horizontal gene transfer (HGT) has been suggested as the mechanism by which various plant parasitic nematode species have obtained genes important in parasitism. In particular, cellulase genes have been acquired by plant parasitic nematodes that allow them to digest plant cell walls. Unlike the typical glycoside hydrolase (GH) family 5 cellulase genes which are found in several nematode species from the order Tylenchida, members of the GH45 cellulase have only been identified in a cluster including the families Parasitaphelenchidae (with the pinewood nematode Bursaphelenchus xylophilus) and Aphelenchoididae, and their origins remain unknown. Results In order to investigate the distribution and evolution of GH45 cellulase genes in nematodes and fungi we performed a wide ranging screen for novel putative GH45 sequences. This revealed that the sequences are widespread mainly in Ascomycetous fungi and have so far been found in a single major nematode lineage. Close relationships between the sequences from nematodes and fungi were found through our phylogenetic analyses. An intron position is shared by sequences from Bursaphelenchus nematodes and several Ascomycetous fungal species. Conclusions The close phylogenetic relationships and conserved gene structure between the sequences from nematodes and fungi strongly supports the hypothesis that nematode GH45 cellulase genes were acquired via HGT from fungi. The rapid duplication and turnover of these genes within Bursaphelenchus genomes demonstrate that useful sequences acquired via HGT can become established in the genomes of recipient organisms and may open novel niches for these organisms to exploit.

2014-01-01

325

Mycorrhizal interactions of orchids colonizing Estonian mine tailings hills.  

PubMed

Northeastern Estonia is home to extensive oil shale mines. Associated with these are desolate and environmentally damaging hills of ash and semicoke tailings. Interestingly, some of the first plants to colonize these hills are rare orchids. Here, we assess the identities of the mycorrhizal fungi associated with these orchids, in particular Epipactis atrorubens, Orchis militaris, and Dactylorhiza baltica, and compare them with mycorrhizal fungi from orchids from pristine habitat. Epipactis atrorubens associated with the widest breadth of fungi, including unnamed members of the basidiomycete family Tulasnellaceae and the potentially ectomycorrhizal ascomycetes Trichophaea woolhopeia and Geopora cooperi. Orchis militaris also associated with unnamed members of the Tulasnellaceae. Dactylorhiza baltica associated with Ceratobasidium albasitensis. In Epipactis and Orchis, the same fungi associated with plants in the pristine habitat as with those on ash hills. The tulasnelloid and ceratobasidioid fungi mycorrhizal with these orchids appear closely related to common orchid mycorrhizal fungi, while one of the ascomycetes mycorrhizal with E. atrorubens is closely related to a mycorrhizal fungus with E. microphylla. Our results suggest that these orchids and their fungi are not limited to pristine habitats and that environmentally polluted sites may present novel habitats that may be exploited for endangered plant conservation. PMID:21632341

Shefferson, Richard P; Kull, Tiiu; Tali, Kadri

2008-02-01

326

The reassignment of three 'lost' Taphrina species (Taphrina bullata, Taphrina insititiae and Taphrina rhizophora) supported by the divergence of nuclear and mitochondrial DNA.  

PubMed

The ascomycetous genus Taphrina Fries originally contained more than 90 phytopathogenic microscopic dimorphic ascomycetes causing specific infections in different vascular plants. Although species have mainly been identified historically according to their host and morphological and physiological traits, they can be studied and preserved in the form of yeasts arising from germinating ascospores. Due to low DNA sequence divergence and the lack of available strains, the number of accepted Taphrina species has currently been reduced to 28. The aim of this study is the description of three previously accepted species. Taphrina bullata (type strain CCY 58-4-1 = CBS 12783), Taphrina insititiae (type strain CCY 58-5-1 = CBS 12782) and Taphrina rhizophora (type strain CCY 58-6-1 = CBS 12781), which have been omitted from a recent key. The host range, the divergence of the 26S rRNA gene sequence, internal transcribed spacers (ITS) and the mitochondrial small ribosomal subunit (rns) sequence strongly support their reassignment as species. PMID:23710051

Petrydesová, Jana; Bacigálová, Kamila; Sulo, Pavol

2013-08-01

327

Identification of the CRE-1 Cellulolytic Regulon in Neurospora crassa  

PubMed Central

Background In filamentous ascomycete fungi, the utilization of alternate carbon sources is influenced by the zinc finger transcription factor CreA/CRE-1, which encodes a carbon catabolite repressor protein homologous to Mig1 from Saccharomyces cerevisiae. In Neurospora crassa, deletion of cre-1 results in increased secretion of amylase and ?-galactosidase. Methodology/Principal Findings Here we show that a strain carrying a deletion of cre-1 has increased cellulolytic activity and increased expression of cellulolytic genes during growth on crystalline cellulose (Avicel). Constitutive expression of cre-1 complements the phenotype of a N. crassa ?cre-1 strain grown on Avicel, and also results in stronger repression of cellulolytic protein secretion and enzyme activity. We determined the CRE-1 regulon by investigating the secretome and transcriptome of a ?cre-1 strain as compared to wild type when grown on Avicel versus minimal medium. Chromatin immunoprecipitation-PCR of putative target genes showed that CRE-1 binds to only some adjacent 5?-SYGGRG-3? motifs, consistent with previous findings in other fungi, and suggests that unidentified additional regulatory factors affect CRE-1 binding to promoter regions. Characterization of 30 mutants containing deletions in genes whose expression level increased in a ?cre-1 strain under cellulolytic conditions identified novel genes that affect cellulase activity and protein secretion. Conclusions/Significance Our data provide comprehensive information on the CRE-1 regulon in N. crassa and contribute to deciphering the global role of carbon catabolite repression in filamentous ascomycete fungi during plant cell wall deconstruction.

Sun, Jianping; Glass, N. Louise

2011-01-01

328

Functional Analysis of the Degradation of Cellulosic Substrates by a Chaetomium globosum Endophytic Isolate  

PubMed Central

Most photosynthetically fixed carbon is contained in cell wall polymers present in plant biomasses, the largest organic carbon source in the biosphere. The degradation of these polymers for biotechnological purposes requires the combined action of several enzymes. To identify new activities, we examined which enzymes are activated by an endophytic strain of Chaetomium globosum to degrade cellulose-containing substrates. After biochemical analyses of the secretome of the fungus grown on cellulose or woody substrates, we took advantage of the available genomic data to identify potentially involved genes. After in silico identification of putative genes encoding either proteins able to bind to cellulose or glycohydrolases (GHs) of family 7, we investigated their transcript levels by reverse transcription-quantitative PCR (RT-qPCR). Our data suggest that eight genes compose the core of the cellulose-degrading system of C. globosum. Notably, the related enzymes belong structurally to the well-described GH families 5, 6, 7, 16, and 45, which are known to be the core of the cellulose degradation systems of several ascomycetes. The high expression levels of cellobiose dehydrogenase and two GH 61 enzymes suggest the involvement of this oxidoreductive synergic system in C. globosum. Transcript analysis along with relevant coding sequence (CDS) isolation and expression of recombinant proteins proved to be a key strategy for the determination of the features of two endoglucanases used by C. globosum for the first attack of crystalline cellulose. Finally, the possible involvement of transcriptional regulators described for other ascomycetes is discussed.

Longoni, Paolo; Rodolfi, Marinella; Pantaleoni, Laura; Doria, Enrico; Concia, Lorenzo; Cella, Rino

2012-01-01

329

The conserved global regulator VeA is necessary for symptom production and mycotoxin synthesis in maize seedlings by Fusarium verticillioides.  

PubMed

The veA or velvet gene is necessary for biosynthesis of mycotoxins and other secondary metabolites in Aspergillus species. In addition, veA has also been demonstrated to be necessary for normal seed colonization in Aspergillus flavus and Aspergillus parasiticus. The present study shows that veA homologues are broadly distributed in fungi, particularly in Ascomycetes. The Fusarium verticillioides veA orthologue, FvVE1, is also required for the synthesis of several secondary metabolites, including fumonisin and fusarins. This study also shows that maize plants grown from seeds inoculated with FvVE1 deletion mutants did not show disease symptoms, while plants grown from seeds inoculated with the F. verticillioides wildtype and complementation strains clearly showed disease symptoms under the same experimental conditions. In this latter case, the presence of lesions coincided with accumulation of fumonisins in the plant tissues, and only these plant tissues had elevated levels of sphingoid bases and their 1-phosphate derivatives, indicating inhibition of ceramide synthase and disruption of sphingolipid metabolism. The results strongly suggest that FvVE1 is necessary for pathogenicity by F. verticillioides against maize seedlings. The conservation of veA homologues among ascomycetes suggests that veA could play a pivotal role in regulating secondary metabolism and associated pathogenicity in other fungi. PMID:22247572

Myung, K; Zitomer, N C; Duvall, M; Glenn, A E; Riley, R T; Calvo, A M

2012-02-01

330

Neurospora crassa ve-1 affects asexual conidiation.  

PubMed

The velvet factor of the homothallic fungus Aspergillus nidulans promotes sexual fruiting body formation. The encoding veA gene is conserved among fungi, including the ascomycete Neurospora crassa. There, the orthologous ve-1 gene encodes a deduced protein with high similarity to A. nidulans VeA. Cross-complementation experiments suggest that both the promoter and the coding sequence of N. crassa ve-1 are functional to complement the phenotype of an A. nidulans deletion mutant. Moreover, ve-1 expression in the heterologous host A. nidulans results in development of reproductive structures in a light-dependent manner, promoting sexual development in the darkness while stimulating asexual sporulation under illumination. Deletion of the N. crassa ve-1 locus by homologous gene replacement causes formation of shortened aerial hyphae accompanied by a significant increase in asexual conidiation, which is not light-dependent. Our data suggest that the conserved velvet proteins of A. nidulans and N. crassa exhibit both similar and different functions to influence development of these two ascomycetes. PMID:17631397

Bayram, Ozgür; Krappmann, Sven; Seiler, Stephan; Vogt, Nico; Braus, Gerhard H

2008-02-01

331

Functional analysis of the degradation of cellulosic substrates by a Chaetomium globosum endophytic isolate.  

PubMed

Most photosynthetically fixed carbon is contained in cell wall polymers present in plant biomasses, the largest organic carbon source in the biosphere. The degradation of these polymers for biotechnological purposes requires the combined action of several enzymes. To identify new activities, we examined which enzymes are activated by an endophytic strain of Chaetomium globosum to degrade cellulose-containing substrates. After biochemical analyses of the secretome of the fungus grown on cellulose or woody substrates, we took advantage of the available genomic data to identify potentially involved genes. After in silico identification of putative genes encoding either proteins able to bind to cellulose or glycohydrolases (GHs) of family 7, we investigated their transcript levels by reverse transcription-quantitative PCR (RT-qPCR). Our data suggest that eight genes compose the core of the cellulose-degrading system of C. globosum. Notably, the related enzymes belong structurally to the well-described GH families 5, 6, 7, 16, and 45, which are known to be the core of the cellulose degradation systems of several ascomycetes. The high expression levels of cellobiose dehydrogenase and two GH 61 enzymes suggest the involvement of this oxidoreductive synergic system in C. globosum. Transcript analysis along with relevant coding sequence (CDS) isolation and expression of recombinant proteins proved to be a key strategy for the determination of the features of two endoglucanases used by C. globosum for the first attack of crystalline cellulose. Finally, the possible involvement of transcriptional regulators described for other ascomycetes is discussed. PMID:22389369

Longoni, Paolo; Rodolfi, Marinella; Pantaleoni, Laura; Doria, Enrico; Concia, Lorenzo; Picco, Anna Maria; Cella, Rino

2012-05-01

332

Characterization of the arom gene in Rhizoctonia solani, and transcription patterns under stable and induced hypovirulence conditions.  

PubMed

The quinate pathway is induced by quinate in the wild-type virulent Rhizoctonia solani isolate Rhs 1AP but is constitutive in the hypovirulent, M2 dsRNA-containing isolate Rhs 1A1. Constitutive expression of the quinate pathway results in downregulation of the shikimate pathway, which includes the pentafunctional arom gene in Rhs 1A1. The arom gene has 5,323 bp including five introns as opposed to a single intron found in arom in ascomycetes. A 199-bp upstream sequence has a GC box, no TATAA box, but two GTATTAGA repeats. The largest arom transcript is 5,108 nucleotides long, excluding the poly(A) tail. It contains an open reading frame of 4,857 bases, coding for a putative 1,618-residue pentafunctional AROM protein. A Kozak sequence (GCGCCATGG) is present between +127 and +135. The 5'-end of the arom mRNA includes two nucleotides (UA) that are not found in the genomic sequence, and are probably added post-transcriptionally. Size and sequence heterogeneity were observed at both 5'- and 3'-end of the mRNA. Northern blot and suppression subtractive hybridization analyses showed that presence of a low amount of quinate, inducer of the quinate pathway, resulted in increased levels of arom mRNA, consistent with the compensation effect observed in ascomycetes. PMID:16479402

Lakshman, Dilip K; Liu, Chunyu; Mishra, Prashant K; Tavantzis, Stellos

2006-03-01

333

Evolutionary relationships among beta-tubulin gene sequences of basidiomycetous fungi.  

PubMed

36 fungal beta-tubulin sequences were analysed to study the evolution of this gene and the phylogeny of basidiomycetes. The analysis comprises a representative selection of all major lineages of basidiomycetous fungi and some selected ascomycetes for comparison. Intron positions vary between the different lineages, but seem to be conserved in the Hymenomycetes and Ustilaginomycetes. The most conserved regions seem to be highly susceptible for introns. Splicing and branching sites of the introns are more variable in basidiomycetes than reported from other fungal groups so far. Basidiomycete monophyly was confirmed with our data in respect to the ascomycetes studied. By analysing amino acid sequences, the Hymenomycetes and the Ustilaginomycetes were resolved as monophyletic groups. The phylogeny within these two groups is similar to that obtained with other genes. Based on beta-tubulin data Naohidea sebacea, Chionosphaera apobasidialis, Jaculispora submersa, Platygloea pustulata, Platygloea disciformis and Melampsora lini, representing the Urediniomycetes, are not resolved in most analyses. The early radiation of major basidiomycetous lineages seems to be reflected in the highly conserved beta-tubulin gene. PMID:15587059

Begerow, Dominik; John, Beate; Oberwinkler, Franz

2004-11-01

334

Identification and characterization of a novel multicopper oxidase from Acidomyces acidophilus with ferroxidase activity.  

PubMed

A new multicopper oxidase gene AaMco1 was identified in Acidomyces acidophilus, a pigmented extremophile ascomycete originally isolated from acidic water. Sequence analysis revealed that it encodes a 682 amino acid protein with an apparent molecular mass of 85 kDa as determined by denaturing SDS-PAGE. Interestingly, AaMco1 has a predicted N-terminal transmembrane helix and no signal peptide. To obtain an active and soluble protein, AaMco1 was truncated at its N-terminal to remove the transmembrane helix, but even in this form the protein was found in the insoluble fraction. AaMco1 and its truncated form were then denatured, purified and renatured before characterization. Structural analysis and protein characterization by enzymatic assays indicate that AaMco1 has ferroxidase activity. AaMco1 is also able to oxidize the DMPPDA compound and could be part of a new phylogenetic cluster, the ascomycete MCOs family, described for the first time here. PMID:24582726

Boonen, France; Vandamme, Anne-Michèle; Etoundi, Emilie; Pigneur, Lise-Marie; Housen, Isabelle

2014-07-01

335

Nucleotide Composition of Nucleic Acids of Fungi I. Ribonucleic Acids  

PubMed Central

Storck, Roger (The University of Texas, Austin). Nucleotide composition of nucleic acids from fungi. I. Ribonucleic acids. J. Bacteriol. 90:1260–1264. 1965.—The nucleotide composition of the ribonucleic acids (RNA) present in extracts of 26 species of fungi was determined. The results were analyzed, together with those in the literature. It was found that the content in moles per cent of guanine plus cytosine (GC content) varied from 44.1 to 60.5 in a distribution composed of 8 species of zygomycetes, 10 of ascomycetes, 11 of deuteromycetes, and 8 of basidiomycetes. The GC-content range and average were, respectively, 44.1 to 49.3 and 46.4 for the zygomycetes, 47.4 to 54.4 and 50.2 for the ascomycetes, 48.2 to 54.5 and 51.6 for the deuteromycetes, and 50.4 to 60.5 and 52.4 for the basidiomycetes. The GC content averaged 45.6 and ranged from 44.1 to 46.3 for four Mucor species. In addition, GC contents significantly lower than 50 were also encountered in some species of Hemiascomycetidae, suggesting that AT type RNA is not uncommon in fungi. It was proposed that the base composition of fungal RNA might have a taxonomic and phylogenetic significance.

Storck, Roger

1965-01-01

336

Five new species of yeasts from fresh water and marine habitats in the Florida Everglades.  

PubMed

Yeast populations in the Shark River Slough of the Florida Everglades, USA, were examined during a 3-year period (2002-2005) at six locations ranging from fresh water marshes to marine mangroves. Seventy-four described species (33 ascomycetes and 41 basidiomycetes) and an approximately equal number of undescribed species were isolated during the course of the investigation. Serious human pathogens, such as Candida tropicalis, were not observed, which indicates that their presence in coastal waters is due to sources of pollution. Some of the observed species were widespread throughout the fresh water and marine habitats, whereas others appeared to be habitat restricted. Species occurrence ranged from prevalent to rare. Five representative unknown species were selected for formal description. The five species comprise two ascomycetes: Candida sharkiensis sp. nov. (CBS 11368(T)) and Candida rhizophoriensis sp. nov. (CBS 11402(T)) (Saccharomycetales, Metschnikowiaceae), and three basidiomycetes: Rhodotorula cladiensis sp. nov. (CBS 10878(T)) in the Sakaguchia clade (Cystobasidiomycetes), Rhodotorula evergladiensis sp. nov. (CBS 10880(T)) in the Rhodosporidium toruloides clade (Microbotryomycetes, Sporidiobolales) and Cryptococcus mangaliensis sp. nov. (CBS 10870(T)) in the Bulleromyces clade (Agaricomycotina, Tremellales). PMID:20967499

Fell, Jack W; Statzell-Tallman, Adele; Scorzetti, Gloria; Gutiérrez, Marcelo H

2011-03-01

337

Molecular cloning and characterization of the glucoamylase gene of Aspergillus awamori.  

PubMed Central

The filamentous ascomycete Aspergillus awamori secretes large amounts of glucoamylase upon growth in medium containing starch, glucose, or a variety of hexose sugars and sugar polymers. We examined the mechanism of this carbon source-dependent regulation of glucoamylase accumulation and found a several hundredfold increase in glucoamylase mRNA in cells grown on an inducing substrate, starch, relative to cells grown on a noninducing substrate, xylose. We postulate that induction of glucoamylase synthesis is regulated transcriptionally. Comparing total mRNA from cells grown on starch and xylose, we were able to identify an inducible 2.3-kilobase mRNA-encoding glucoamylase. The glucoamylase mRNA was purified and used to identify a molecularly cloned 3.4-kilobase EcoRI fragment containing the A. awamori glucoamylase gene. Comparison of the nucleotide sequence of the 3.4-kilobase EcoRI fragment with that of the glucoamylase I mRNA (as determined from molecularly cloned cDNA) revealed the existence of four intervening sequences within the glucoamylase gene. The 5' end of the glucoamylase mRNA was mapped to several locations within a region -52 to -73 nucleotides from the translational start. Sequence and structural features of the glucoamylase gene of the filamentous ascomycete A. awamori were examined and compared with those reported in genes of other eucaryotes. Images

Nunberg, J H; Meade, J H; Cole, G; Lawyer, F C; McCabe, P; Schweickart, V; Tal, R; Wittman, V P; Flatgaard, J E; Innis, M A

1984-01-01

338

Scheffersomyces cryptocercus: a new xylose-fermenting yeast associated with the gut of wood roaches and new combinations in the Sugiyamaella yeast clade.  

PubMed

The gut of wood-feeding insects is a microhabitat for a specialized community of microbes, including bacteria and several groups of eukaryotes such as nematodes, parabasalids and fungi. The characterization of gut yeast communities from a variety of insects has shown that certain yeasts often are associated with the insects. The gut of wood-feeding insects is rich in ascomycete yeasts and in particular xylose-fermenting (X-F) and assimilating yeasts have been consistently present in the gut of lignicolous insects. The objective of this study was the characterization of the yeast flora from the gut of the wood roach Cryptocercus sp. (Blattodea: Cryptocercidae). Five wood roaches were collected along the Appalachian Trail near the border between Tennessee and North Carolina, USA. We isolated 18 yeast strains from the wood roaches identified as Sugiyamaella paludigena and Sugiyamaella lignohabitans, xylose-assimilating yeasts, and Scheffersomyces cryptocercus (NRRL Y-48824(T) = CBS 12658) a new species of X-F yeast. The presence of X-F and certain non X-F yeasts in the gut of the subsocial wood roach Cryptocercus sp. extends the previous findings of associations between certain ascomycete yeasts and lignicolous insects. New combinations were made for 13 asexual members of the Sugiyamaella clade. PMID:23233509

Urbina, Hector; Frank, Robert; Blackwell, Meredith

2013-01-01

339

Mycological and ecotoxicological characterisation of landfill leachate before and after traditional treatments.  

PubMed

Pollution caused by landfill leachates is one of the main problems of urbanised areas, on account of their chemical composition, which turn in an ineffective treatment. A characterisation of leachates, which takes into account chemical, ecotoxicological and mycological aspects, is basilar for the evaluation of environmental impact of leachate and the development of suitable treatment techniques. In this study, the toxicity of a raw leachate and an effluent coming from traditional wastewater treatment plant was assessed by means of 4 ecotoxicological assays. Both the samples exceed the legal threshold value according to all the tested organisms, indicating the ineffectiveness of activated sludge treatment in the reduction of toxicity. The autochthonous mycoflora of the two samples was evaluated by filtration. The fungal load was 73CFU for leachate and 102CFU for the effluent. Ascomycetes were the dominant fraction (81% and 61%, for leachate and effluent respectively), followed by basidiomycetes (19% and 39%, respectively). Most of them were potential emerging pathogens. A decolourisation screening with autochthonous fungi was set up towards both samples in the presence or absence of glucose. Eleven fungi (basidiomycetes and ascomycetes) achieved up to 38% decolourisation yields, showing to be promising fungi for the bioremediation of leachates. Further experiment will be aimed to the study of decolourisation mechanism and toxicity reduction. PMID:24793330

Tigini, Valeria; Prigione, Valeria; Varese, Giovanna Cristina

2014-07-15

340

The fatty acid synthase of the basidiomycete Omphalotus olearius is a single polypeptide.  

PubMed

Fatty acids are essential components of almost all biological membranes. Additionally, they are important in energy storage, as second messengers during signal transduction, and in post-translational protein modification. De novo synthesis of fatty acids is essential for almost all organisms, and entails the iterative elongation of the growing fatty acid chain through a set of reactions conserved in all kingdoms. During our work on the biosynthesis of secondary metabolites, a 450-kDa protein was detected by SDS-PAGE of enriched fractions from mycelial lysates from the basidiomycete Omphalotus olearius. Protein sequencing of this protein band revealed the presence of peptides with homology to both alpha and beta subunits of the ascomycete fatty acid synthase (FAS) family. The FAS encoding gene of O. olearius was sequenced. The positions of its predicted 21 introns were verified. The gene encodes a 3931 amino acids single protein, with an equivalent of the ascomycetous beta subunit at the N-terminus and the a subunit at the C-terminus. This is the first report on an FAS protein from a homobasidiomycete and also the first fungal FAS which is comprised of a single polypeptide. PMID:19526720

Antelo, Luis; Schlipp, Angela; Hof, Carolin; Eisfeld, Katrin; Berg, Holger; Hornbogen, Till; Zocher, Rainer; Anke, Heidrun

2009-01-01

341

Current state and perspectives of truffle genetics and sustainable biotechnology.  

PubMed

Mycorrhizal fungi belonging to the genus Tuber produce, after the establishment of a productive interaction with a plant host, hypogeous fruitbodies of great economic value known as ''truffles''. This review summarizes the state of art on life cycle, genetic, and biotechnological investigations of Tuber spp. The ascocarp formation in truffles is a consequence of the activation of the sexual phase of the biological cycle. The formation of a dikaryotic secondary mycelium and the karyogamy in the ascal cell (followed by meiosis with ascospores formation) have been hypothesized by several authors but some doubts yet arise from the Tuber cycle by considering that a series of abnormalities have been pointed out in respect to other Ascomycetes. It is unclear if binucleated hyphal cells are derived from the fusion of mononucleated cells belonging to mycelia from different mating types or from one only. According to the karyotypes of Tuber melanosporum, Tuber magnatum, and Tuber borchii, the numbers of hyphal chromosomes suggest a chromosome number of eight (2n); these values are in the range of those of several Ascomycetes and observed for Tuber aestivum (2n=10). The importance and growth in interest during the last years in the fungi protoplasts isolation and transformation techniques can be related to current developments in Tuber genetics and biotechnology. T. borchii could be transformed through liposome-mediated delivery of genetic material as mycelial protoplasts isolation and fusion with liposomes has already been established. On the other hand, Agrobacterium-mediated transformation has been successfully established for T. borchii. PMID:16802150

Poma, Anna; Limongi, Tania; Pacioni, Giovanni

2006-09-01

342

The conserved global regulator VeA is necessary for symptom production and mycotoxin synthesis in maize seedlings by Fusarium verticillioides  

PubMed Central

The veA or velvet gene is necessary for biosynthesis of mycotoxins and other secondary metabolites in Aspergillus species. In addition, veA has also been demonstrated to be necessary for normal seed colonization in Aspergillus flavus and Aspergillus parasiticus. The present study shows that veA homologues are broadly distributed in fungi, particularly in Ascomycetes. The Fusarium verticillioides veA orthologue, FvVE1, is also required for the synthesis of several secondary metabolites, including fumonisin and fusarins. This study also shows that maize plants grown from seeds inoculated with FvVE1 deletion mutants did not show disease symptoms, while plants grown from seeds inoculated with the F. verticillioides wildtype and complementation strains clearly showed disease symptoms under the same experimental conditions. In this latter case, the presence of lesions coincided with accumulation of fumonisins in the plant tissues, and only these plant tissues had elevated levels of sphingoid bases and their 1-phosphate derivatives, indicating inhibition of ceramide synthase and disruption of sphingolipid metabolism. The results strongly suggest that FvVE1 is necessary for pathogenicity by F. verticillioides against maize seedlings. The conservation of veA homologues among ascomycetes suggests that veA could play a pivotal role in regulating secondary metabolism and associated pathogenicity in other fungi.

Myung, K.; Zitomer, N. C.; Duvall, M.; Glenn, A. E.; Riley, R. T.; Calvo, A. M.

2011-01-01

343

Genome-wide inventory of metal homeostasis-related gene products including a functional phytochelatin synthase in the hypogeous mycorrhizal fungus Tuber melanosporum.  

PubMed

Ectomycorrhizal fungi are thought to enhance mineral nutrition of their host plants and to confer increased tolerance toward toxic metals. However, a global view of metal homeostasis-related genes and pathways in these organisms is still lacking. Building upon the genome sequence of Tuber melanosporum and on transcriptome analyses, we set out to systematically identify metal homeostasis-related genes in this plant-symbiotic ascomycete. Candidate gene products (101) were subdivided into three major functional classes: (i) metal transport (58); (ii) oxidative stress defence (32); (iii) metal detoxification (11). The latter class includes a small-size metallothionein (TmelMT) that was functionally validated in yeast, and phytochelatin synthase (TmelPCS), the first enzyme of this kind to be described in filamentous ascomycetes. Recombinant TmelPCS was shown to support GSH-dependent, metal-activated phytochelatin synthesis in vitro and to afford increased Cd/Cu tolerance to metal hypersensitive yeast strains. Metal transporters, especially those related to Cu and Zn trafficking, displayed the highest expression levels in mycorrhizae, suggesting extensive translocation of both metals to root cells as well as to fungal metalloenzymes (e.g., laccase) that are strongly upregulated in symbiotic hyphae. PMID:21094264

Bolchi, Angelo; Ruotolo, Roberta; Marchini, Gessica; Vurro, Emanuela; di Toppi, Luigi Sanità; Kohler, Annegret; Tisserant, Emilie; Martin, Francis; Ottonello, Simone

2011-06-01

344

Community composition of root-associated fungi in a Quercus-dominated temperate forest: "codominance" of mycorrhizal and root-endophytic fungi  

PubMed Central

In terrestrial ecosystems, plant roots are colonized by various clades of mycorrhizal and endophytic fungi. Focused on the root systems of an oak-dominated temperate forest in Japan, we used 454 pyrosequencing to explore how phylogenetically diverse fungi constitute an ecological community of multiple ecotypes. In total, 345 operational taxonomic units (OTUs) of fungi were found from 159 terminal-root samples from 12 plant species occurring in the forest. Due to the dominance of an oak species (Quercus serrata), diverse ectomycorrhizal clades such as Russula, Lactarius, Cortinarius, Tomentella, Amanita, Boletus, and Cenococcum were observed. Unexpectedly, the root-associated fungal community was dominated by root-endophytic ascomycetes in Helotiales, Chaetothyriales, and Rhytismatales. Overall, 55.3% of root samples were colonized by both the commonly observed ascomycetes and ectomycorrhizal fungi; 75.0% of the root samples of the dominant Q. serrata were so cocolonized. Overall, this study revealed that root-associated fungal communities of oak-dominated temperate forests were dominated not only by ectomycorrhizal fungi but also by diverse root endophytes and that potential ecological interactions between the two ecotypes may be important to understand the complex assembly processes of belowground fungal communities.

Toju, Hirokazu; Yamamoto, Satoshi; Sato, Hirotoshi; Tanabe, Akifumi S; Gilbert, Gregory S; Kadowaki, Kohmei

2013-01-01

345

High-throughput screening for cellobiose dehydrogenases by Prussian Blue in situ formation.  

PubMed

Extracellular fungal flavocytochrome cellobiose dehydrogenase (CDH) is a promising enzyme for both bioelectronics and lignocellulose bioconversion. A selective high-throughput screening assay for CDH in the presence of various fungal oxidoreductases was developed. It is based on Prussian Blue (PB) in situ formation in the presence of cellobiose (<0.25 mM), ferric acetate, and ferricyanide. CDH induces PB formation via both reduction of ferricyanide to ferrocyanide reacting with an excess of Fe³? (pathway 1) and reduction of ferric ions to Fe²? reacting with the excess of ferricyanide (pathway 2). Basidiomycetous and ascomycetous CDH formed PB optimally at pH 3.5 and 4.5, respectively. In contrast to the holoenzyme CDH, its FAD-containing dehydrogenase domain lacking the cytochrome domain formed PB only via pathway 1 and was less active than the parent enzyme. The assay can be applied on active growing cultures on agar plates or on fungal culture supernatants in 96-well plates under aerobic conditions. Neither other carbohydrate oxidoreductases (pyranose dehydrogenase, FAD-dependent glucose dehydrogenase, glucose oxidase) nor laccase interfered with CDH activity in this assay. Applicability of the developed assay for the selection of new ascomycetous CDH producers as well as possibility of the controlled synthesis of new PB nanocomposites by CDH are discussed. PMID:22294389

Vasilchenko, Liliya G; Ludwig, Roland; Yershevich, Olga P; Haltrich, Dietmar; Rabinovich, Mikhail L

2012-07-01

346

Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species.  

PubMed

Relationships among ascomycetous yeast genera (subphylum Saccharomycotina, phylum Ascomycota) have been uncertain. In the present study, type species of 70 currently recognized genera are compared from divergence in the nearly entire nuclear gene sequences for large subunit rRNA, small subunit (SSU) rRNA, translation elongation factor-1?, and RNA polymerase II, subunits 1 (RPB1) and 2 (RPB2). The analysis substantiates earlier proposals that all known ascomycetous yeast genera now assigned to the Saccharomycotina represent a single clade. Maximum likelihood analysis resolved the taxa into eight large multigenus clades and four-one- and two-genus clades. Maximum parsimony and neighbor-joining analyses gave similar results. Genera of the family Saccharomycetaceae remain as one large clade as previously demonstrated, to which the genus Cyniclomyces is now assigned. Pichia, Saturnispora, Kregervanrija, Dekkera, Ogataea and Ambrosiozyma are members of a single large clade, which is separate from the clade that includes Barnettozyma, Cyberlindnera, Phaffomyces, Starmera and Wickerhamomyces. Other clades include Kodamaea, Metschnikowia, Debaryomyces, Cephaloascus and related genera, which are separate from the clade that includes Zygoascus, Trichomonascus, Yarrowia and others. This study once again demonstrates that there is limited congruence between a system of classification based on phenotype and a system determined from DNA sequences. PMID:22978764

Kurtzman, Cletus P; Robnett, Christie J

2013-02-01

347

Rhizosphere communities of genetically modified zeaxanthin-accumulating potato plants and their parent cultivar differ less than those of different potato cultivars.  

PubMed

The effects of genetically modified (GM), zeaxanthin-accumulating potato plants on microbial communities in the rhizosphere were compared to the effects of different potato cultivars. Two GM lines and their parental cultivar, as well as four other potato cultivars, were grown in randomized field plots at two sites and in different years. Rhizosphere samples were taken at three developmental stages during plant growth and analyzed using denaturing gradient gel electrophoresis (DGGE) fingerprints of Bacteria, Actinobacteria, Alpha- and Betaproteobacteria, Bacillus, Streptomycetaceae, Pseudomonas, gacA, Fungi, and Ascomycetes. In the bacterial DGGE gels analyzed, significant differences between the parental cultivar and the two GM lines were detected mainly for Actinobacteria but also for Betaproteobacteria and Streptomycetaceae, yet these differences occurred only at one site and in one year. Significant differences occurred more frequently for Fungi, especially Ascomycetes, than for bacteria. When all seven plant genotypes were compared, DGGE analysis revealed that different cultivars had a greater effect on both bacterial and fungal communities than genetic modification. The effects of genetic modification were detected mostly at the senescence developmental stage of the plants. The site was the overriding factor affecting microbial community structure compared to the plant genotype. In general, the fingerprints of the two GM lines were more similar to that of the parental cultivar, and the differences observed did not exceed natural cultivar-dependent variability. PMID:19376893

Weinert, Nicole; Meincke, Remo; Gottwald, Christine; Heuer, Holger; Gomes, Newton C M; Schloter, Michael; Berg, Gabriele; Smalla, Kornelia

2009-06-01

348

The tempo and modes of evolution of reproductive isolation in fungi  

PubMed Central

Reproductive isolation is an essential ingredient of speciation, and much has been learned in recent years about the evolution of reproductive isolation and the genetics of reproductive barriers in animals and plants. Fungi have been neglected on these aspects, despite being tractable model eukaryotes. Here, we used a model fitting approach to look at the importance of different barriers to gene flow to explain the decrease of reproductive compatibility with genetic distance in fungi. We found support for the occurrence of reinforcement in the presyngamy compatibility among basidiomycetes. In contrast, no evidence for reinforcement was detected in ascomycetes, concurring with the idea that host/habitat adaptation in this group can pleiotropically cause reproductive isolation. We found no evidence of a snowballing accumulation of postsyngamic reproductive incompatibilities in either ascomycetes or the complex of anther smut fungi. Together with previous studies, our results suggest that ecologically based barriers to gene flow and karyotypic differences may have an important role in hybrid inviability and sterility in fungi. Interestingly, hybrid sterility appeared to evolve faster than hybrid inviability in fungi.

Giraud, T; Gourbiere, S

2012-01-01

349

Nematocera (Ceratopogonidae, Psychodidae, Simuliidae and Culicidae) and control methods.  

PubMed

The biology, veterinary importance and control of certain Nematocera are described and discussed. Culicoides spp. (family Ceratopogonidae) transmit the arboviruses of bluetongue (BT), African horse sickness (AHS), bovine ephemeral fever (BEF) and Akabane. Some other arboviruses have been isolated from these species, while fowl pox has been transmitted experimentally by Culicoides. These insects are vectors of the parasitic protozoans Leucocytozoon caulleryi and Haemoproteus nettionis, and the parasitic nematodes Onchocerca gutturosa, O. gibsoni and O. cervicalis. They also cause recurrent summer hypersensitivity in horses, ponies, donkeys, cattle and sheep. Farm animals can die as a result of mass attack by Simulium spp., which are also vectors of Leucocytozoon simondi, L. smithi and the filariae O. gutturosa, O. linealis and O. ochengi. Venezuelan equine encephalomyelitis (VEE) and Rift Valley fever (RVF) have been isolated from simuliids, and vesicular stomatitis virus New Jersey strain has been replicated in Simulium vittatum. Simuliids are well known as vectors of O. volvulus, the cause of human onchocercosis (river blindness). The family Psychodidae includes the genera Phlebotomus and Lutzomyia (subfamily Phlebotominae), vectors of Leishmania spp. in humans, dogs and other mammals. Vesicular stomatitis virus Indiana strain has been regularly isolated from phlebotomine sandflies. Mass attack by mosquitoes can also prove fatal to farm animals. Mosquitoes are vectors of the viruses of Akabane, BEF, RVF, Japanese encephalitis, VEE, western equine encephalomyelitis, eastern equine encephalomyelitis and west Nile meningoencephalitis, secondary vectors of AHS and suspected vectors of Israel turkey meningoencephalitis. The viruses of hog cholera, fowl pox and reticuloendotheliosis, the rickettsiae Eperythrozoon ovis and E. suis, and the bacterium Borrelia anserina are mechanically transmitted by mosquitoes. These insects also induce allergic dermatitis in horses. They transmit several filarial worms of both animals and humans, and are of great medical importance as vectors of major human diseases, including malaria, yellow fever, dengue fever and many more diseases caused by arboviruses. PMID:7711309

Braverman, Y

1994-12-01

350

De novo biosynthesis of vanillin in fission yeast (Schizosaccharomyces pombe) and baker's yeast (Saccharomyces cerevisiae).  

PubMed

Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin beta-D-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity. PMID:19286778

Hansen, Esben H; Møller, Birger Lindberg; Kock, Gertrud R; Bünner, Camilla M; Kristensen, Charlotte; Jensen, Ole R; Okkels, Finn T; Olsen, Carl E; Motawia, Mohammed S; Hansen, Jørgen

2009-05-01

351

Trichosporon species isolated from guano samples obtained from bat-inhabited caves in Japan.  

PubMed

Yeasts from caves have rarely been examined. We examined yeasts collected from bat guano samples from 20 bat-inhabited limestone and volcanic caves located in 11 prefectures in Japan. Of approximately 700 yeast-like colonies, nine Trichosporon species were recovered from 15 caves. Two of these were known species, and the remaining seven are potentially novel species, based on molecular phylogenetic analyses. In addition to Trichosporon species, identifiable strains of eight ascomycetous yeasts and one basidiomycetous yeast were recovered at frequencies of 5 to 35%. Our findings suggest that Trichosporon spp. are the major yeast species in bat guano in Japan and that bat guano is a potentially rich source of previously undescribed yeast species. PMID:16269819

Sugita, Takashi; Kikuchi, Ken; Makimura, Koichi; Urata, Kensaku; Someya, Takashi; Kamei, Katsuhiko; Niimi, Masakazu; Uehara, Yoshimasa

2005-11-01

352

Comparative Functional Genomics of the Fission Yeasts  

PubMed Central

The fission yeast clade, comprising Schizosaccharomyces pombe, S. octosporus, S. cryophilus and S. japonicus, occupies the basal branch of Ascomycete fungi and is an important model of eukaryote biology. A comparative annotation of these genomes identified a near extinction of transposons and the associated innovation of transposon-free centromeres. Expression analysis established that meiotic genes are subject to antisense transcription during vegetative growth, suggesting a mechanism for their tight regulation. In addition, trans-acting regulators control new genes within the context of expanded functional modules for meiosis and stress response. Differences in gene content and regulation also explain why, unlike the Saccharomycotina, fission yeasts cannot use ethanol as a primary carbon source. These analyses elucidate the genome structure and gene regulation of fission yeast and provide tools for investigation across the Schizosaccharomyces clade.

Rhind, Nicholas; Chen, Zehua; Yassour, Moran; Thompson, Dawn A; Haas, Brian J; Habib, Naomi; Wapinski, Ilan; Roy, Sushmita; Lin, Michael F.; Heiman, David I; Young, Sarah K; Furuya, Kanji; Guo, Yabin; Pidoux, Alison; Chen, Huei Mei; Robbertse, Barbara; Goldberg, Jonathan M.; Aoki, Keita; Bayne, Elizabeth H.; Berlin, Aaron M; Desjardins, Christopher A.; Dobbs, Edward; Dukaj, Livio; Fan, Lin; FitzGerald, Michael G; French, Courtney; Gujja, Sharvari; Hansen, Klavs; Keifenheim, Dan; Levin, Joshua Z.; Mosher, Rebecca A.; Muller, Carolin A.; Pfiffner, Jenna; Priest, Margaret; Russ, Carsten; Smialowska, Agata; Swoboda, Peter; Sykes, Sean M; Vaughn, Matthew; Vengrova, Sonya; Yoder, Ryan; Zeng, Qiandong; Allshire, Robin; Baulcombe, David; Birren, Bruce W.; Brown, William; Ekwall, Karl; Kellis, Manolis; Leatherwood, Janet; Levin, Henry; Margalit, Hanah; Martienssen, Rob; Nieduszynski, Conrad A.; Spatafora, Joseph W.; Friedman, Nir; Dalgaard, Jacob Z.; Baumann, Peter; Niki, Hironori; Regev, Aviv; Nusbaum, Chad

2011-01-01

353

Coniosporium perforans and C. apollinis, two new rock-inhabiting fungi isolated from marble in the Sanctuary of Delos (Cyclades, Greece).  

PubMed

Coniosporium perforans and C. apollinis, originating from marble in the Mediterranean basin, are described as new species of rock inhabiting microcolonial fungi. The morphologically similar species Monodictys castaneae (Wallr.) S. Hughes, Phaeosclera dematioides Sigler et al., and a Coniosporium-like strain are compared using 18S rDNA phylogeny and Restriction Length Fragment Polymorphism analysis of Internal Transcribed Spacer regions. Sarcinomyces crustaceus Lindner is additionally compared on the basis of 18S rDNA sequencing data. Phylogenetic analysis suggests that Phaeosclera dematioides is related to the ascomycetous order Dothideales and Monodictys castaneae to the Pleosporales, whereas the three Coniosporium species studied are a sister group to the Herpotrichiellaceae (Chaetothyriales). A similar affinity was suggested previously for the recently described meristematic rock-fungus Sarcinomyces petricola Wollenzien & de Hoog. Sarcinomyces crustaceus appears unrelated to this group, and hence the present new taxa cannot be described in this genus. PMID:9442275

Sterflinger, K; De Baere, R; de Hoog, G S; De Wachter, R; Krumbein, W E; Haase, G

1997-11-01

354

RFLP markers show genetic recombination in Botryotinia fuckeliana (Botrytis cinerea) and transposable elements reveal two sympatric species.  

PubMed

Molecular markers revealed that Botryotinia fuckeliana (the teleomorph of Botrytis cinerea), a haploid, filamentous, heterothallic ascomycete, contained a large amount of intrapopulation genetic variation. The markers were used to determine the mode of reproduction and the population structure of this fungus. We did not detect any differentiation between isolates from different organs, collection dates, varieties of grape, or locations in the Champagne region of France, but two unexpected sympatric populations were identified. One group of isolates (transposa) contained the transposable elements Boty and Flipper; the other (vacuma) did not. These groups differed from one another for all the other markers. RFLP markers showed that there was genetic recombination in both groups of isolates. We conclude that there are two sympatric populations of B. fuckeliana in Champagne. One species (transposa) seems to be local and well adapted, while the other one (vacuma) is presumably a heterogeneous migrant population. PMID:9364775

Giraud, T; Fortini, D; Levis, C; Leroux, P; Brygoo, Y

1997-11-01

355

Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum.  

PubMed

Two mating-type genes, designated MAT1-1-1 and MAT1-2-1, were cloned and sequenced from the presumed asexual ascomycete Cladosporium fulvum (syn. Passalora fulva). The encoded products are highly homologous to mating-type proteins from members of the Mycosphaerellaceae, such as Mycosphaerella graminicola and Cercospora beticola. In addition, the two MAT idiomorphs of C. fulvum showed regions of homology and each contained one additional putative ORF without significant similarity to known sequences. The distribution of the two mating-type genes in a world-wide collection of 86 C. fulvum strains showed a departure from a 1:1 ratio (chi(2)=4.81, df=1). AFLP analysis revealed a high level of genotypic diversity, while strains of the fungus were identified with similar virulence spectra but distinct AFLP patterns and opposite mating-types. These features could suggest the occurrence of recombination in C. fulvum. PMID:17178244

Stergiopoulos, Ioannis; Groenewald, Marizeth; Staats, Martijn; Lindhout, Pim; Crous, Pedro W; De Wit, Pierre J G M

2007-05-01

356

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis.  

PubMed

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (HyR) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. HyR transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcriptional start points are the same in U. maydis and A. niger. PMID:2112106

Smith, T L; Gaskell, J; Berka, R M; Yang, M; Henner, D J; Cullen, D

1990-04-16

357

Candida bromeliacearum sp. nov. and Candida ubatubensis sp. nov., two yeast species isolated from the water tanks of Canistropsis seidelii (Bromeliaceae).  

PubMed

Strains belonging to two novel yeast species, Candida bromeliacearum and Candida ubatubensis, were isolated from the bromeliad tank of Canistropsis seidelii (Bromeliaceae) in a sandy coastal plain (restinga) ecosystem site in an Atlantic rainforest of south-eastern Brazil. These species were genetically distinct from all other currently accepted ascomycetous yeasts, based on sequence divergence in the D1/D2 domains of the large-subunit rDNA and in the small-subunit rDNA. The species occupy basal positions in the Metschnikowiaceae clade. The type strains are Candida bromeliacearum UNESP 00-103(T) (=CBS 10002(T)=NRRL Y-27811(T)) and Candida ubatubensis UNESP 01-247R(T) (=CBS 10003(T)=NRRL Y-27812(T)). PMID:16166735

Ruivo, Carla C C; Lachance, Marc-André; Rosa, Carlos A; Bacci, Maurício; Pagnocca, Fernando C

2005-09-01

358

Catabolism of 4-hydroxybenzoate in Candida parapsilosis proceeds through initial oxidative decarboxylation by a FAD-dependent 4-hydroxybenzoate 1-hydroxylase.  

PubMed

The first two steps in the catabolism of 4-hydroxybenzoate by the ascomycetous yeast Candida parapsilosis CBS604 were investigated. In contrast to the well-known bacterial pathways and to what was previously assumed, metabolism of 4-hydroxybenzoate in C. parapsilosis proceeds through initial oxidative decarboxylation to give 1,4-dihydroxybenzene. This reaction is catalyzed by a NAD(P)H and FAD-dependent 4-hydroxybenzoate 1-hydroxylase. Further metabolism of 1,4-dihydroxybenzene to the ring-fission substrate 1,2,4-trihydroxybenzene is catalyzed by a NADPH-specific FAD-dependent aromatic hydroxylase acting on phenolic compounds. 19F-NMR experiments with cell extracts and 2-fluoro-4-hydroxybenzoate as the model compound confirm this metabolic pathway and exclude the alternative pathway proceeding through initial 3-hydroxylation followed by oxidative decarboxylation in the second step. PMID:7926672

van Berkel, W J; Eppink, M H; Middelhoven, W J; Vervoort, J; Rietjens, I M

1994-08-15

359

Genealogical concordance phylogenetic species recognition in the Fusarium oxysporum species complex.  

PubMed

Fusarium oxysporum is an important plant and human pathogenic ascomycetous group, with near ubiquity in agricultural and non-cultivated ecosystems. Phylogenetic evidence suggests that F. oxysporum is a complex of multiple morphologically cryptic species. Species boundaries and limits of genetic exchange within this complex are poorly defined, largely due to the absence of a sexual state and the paucity of morphological characters. This study determined species boundaries within the F. oxysporum species complex using Genealogical Concordance Phylogenetic Species Recognition (GCPSR) with eight protein coding loci. GCPSR criteria were used firstly to identify independent evolutionary lineages (IEL), which were subsequently collapsed into phylogenetic species. Seventeen IELs were initially identified resulting in the recognition of two phylogenetic species. Further evidence supporting this delineation is discussed. PMID:24742832

Laurence, Matthew H; Summerell, Brett A; Burgess, Lester W; Liew, Edward C Y

2014-04-01

360

Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides?immitis  

PubMed Central

Simple cladogenetic theory suggests that gene genealogies can be used to detect mixis in a population and delineate reproductively isolated groups within sexual taxa. We have taken this approach in a study of Coccidioides immitis, an ascomycete fungus responsible for a recent epidemic of coccidioidomycosis (Valley fever) in California. To test whether this fungus represents a single sexual species throughout its entire geographic range, we have compared genealogies from fragments of five nuclear genes. The five genealogies show multiple incompatibilities indicative of sex, but also share a branch that partitions the isolates into two reproductively isolated taxa, one centered in California and the other outside California. We conclude that coccidioidomycosis can be caused by two distinct noninterbreeding taxa. This result should aid the future study of the disease and illustrates the utility of the genealogical approach in population genetics.

Koufopanou, Vassiliki; Burt, Austin; Taylor, John W.

1997-01-01

361

Experimental infection of white-leghorn cockerels with Macrorhabdos ornithogaster (Megabacterium).  

PubMed

Macrorhabdos ornithogaster is a newly described anamorphic ascomycetous yeast that has been reported to cause a chronic, debilitating disease in many species of birds, including poultry. Study of this organism is complicated by the limited ability to grow M. ornithogaster in vitro. In this study, we showed that the chicken can be used to amplify this organism and as a model to study its pathogenicity. An infection rate of 100% was achieved in day-old chicks orally inoculated with 10(5) M. ornithogaster derived from the budgerigar (Melopsittacus undulatus). The organism was also determined to increase in number by greater than 10-fold 14 days after oral inoculation in these chicks. Chickens infected with M. ornithogaster demonstrated no sign of illness but had decreased feed conversion efficiency and consistent and characteristic histopathologic lesions in the proventriculus and isthmus of the stomach, suggesting that M. ornithogaster may represent a potential threat to the poultry industry. PMID:12887185

Phalen, David N; Moore, Robert P

2003-01-01

362

Control and possible applications of a novel carrot-spoilage basidiomycete, Fibulorhizoctonia psychrophila  

PubMed Central

A novel cold-tolerant fungus, Fibulorhizoctonia psychrophila, was isolated from a refrigerated carrot storage facility and identified as an anamorph of Athelia, often classified in Rhizoctonia s.l. Growth of this fungus was observed between 0 and 20°C with an optimum at 9–12°C, while incubation of mycelium grown at 15–32°C resulted in absence of growth even after the fungus was transferred back to 15°C. Growth was inhibited in the presence of the antifungals sorbic acid or natamycin, in particular when the fungus was incubated at 18°C. F. psychrophila produces polysaccharide degrading enzymes that, when compared to enzymes from the ascomycete fungus Aspergillus niger, retain a larger proportion of their activity at lower temperatures. This indicates that F. psychrophila could be used as a source for novel industrial enzymes that are active at 4–15°C.

de Lange, Elvira S.; Wosten, Han A. B.; Stalpers, Joost A.

2008-01-01

363

Comparative genomics of Taphrina fungi causing varying degrees of tumorous deformity in plants.  

PubMed

Taphrina fungi are biotrophic plant pathogens that cause plant deformity diseases. We sequenced the genomes of four Taphrina species-Taphrina wiesneri, T. deformans, T. flavorubra, and T. populina-which parasitize Prunus, Cerasus, and Populus hosts with varying severity of disease symptoms. High levels of gene synteny within Taphrina species were observed, and our comparative analysis further revealed that these fungi may utilize multiple strategies in coping with the host environment that are also found in some specialized dimorphic species. These include species-specific aneuploidy and clusters of highly diverged secreted proteins located at subtelomeres. We also identified species differences in plant hormone biosynthesis pathways, which may contribute to varying degree of disease symptoms. The genomes provide a rich resource for investigation into Taphrina biology and evolutionary studies across the basal ascomycetes clade. PMID:24682155

Tsai, Isheng J; Tanaka, Eiji; Masuya, Hayato; Tanaka, Ryusei; Hirooka, Yuuri; Endoh, Rikiya; Sahashi, Norio; Kikuchi, Taisei

2014-04-01

364

Genome sequence of Wickerhamomyces anomalus DSM 6766 reveals genetic basis of biotechnologically important antimicrobial activities.  

PubMed

The ascomycetous yeast Wickerhamomyces anomalus (formerly Pichia anomala and Hansenula anomala) exhibits antimicrobial activities and flavoring features that are responsible for its frequent association with food, beverage and feed products. However, limited information on the genetic background of this yeast and its multiple capabilities are currently available. Here, we present the draft genome sequence of the neotype strain W. anomalus DSM 6766. On the basis of pyrosequencing, a de novo assembly of this strain resulted in a draft genome sequence with a total size of 25.47 Mbp. An automatic annotation using RAPYD generated 11 512 protein-coding sequences. This annotation provided the basis to analyse metabolic capabilities, phylogenetic relationships, as well as biotechnologically important features and yielded novel candidate genes of W. anomalus DSM 6766 coding for proteins participating in antimicrobial activities. PMID:22292503

Schneider, Jessica; Rupp, Oliver; Trost, Eva; Jaenicke, Sebastian; Passoth, Volkmar; Goesmann, Alexander; Tauch, Andreas; Brinkrolf, Karina

2012-05-01

365

Diversity and evolution of ABC proteins in basidiomycetes.  

PubMed

ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization. PMID:23928421

Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

2013-01-01

366

Paleomycology of the Princeton Chert II. Dark-septate fungi in the aquatic angiosperm Eorhiza arnoldii indicate a diverse assemblage of root-colonizing fungi during the Eocene.  

PubMed

Tissues of the extinct aquatic or emergent angiosperm, Eorhiza arnoldii incertae sedis, were extensively colonized by microfungi, and in this study we report the presence of several types of sterile mycelia. In addition to inter- and intracellular proliferation of regular septate hyphae, the tissues contain monilioid hyphae with intercalary branching. These filamentous mycelia are spatially associated with two distinct morphotypes of intracellular microsclerotia. These quiescent structures are morphologically similar to loose and cerebriform microsclerotia found within the living tissues of some plants, which have been attributed to an informal assemblage of dematiaceous ascomycetes, the dark-septate endophytes. While there are significant challenges to interpreting the ecology of fossilized fungi, these specimens provide evidence for asymptomatic endophytic colonization of the rooting structures of a 48.7 million year old aquatic angiosperm. PMID:23709575

Klymiuk, Ashley A; Taylor, Thomas N; Taylor, Edith L; Krings, Michael

2013-01-01

367

Candida sergipensis, a new asexual yeast species isolated from frozen pulps of tropical fruits.  

PubMed

Sixteen strains of the new yeast species Candida sergipensis have been isolated from frozen pulps of the tropical fruits umbú ( Spondias tuberosa Avr. Cam.) and mangaba ( Hancornia speciosa Gom.). Candida sergipensis was one of the prevalent species in the yeast community of these substrates. The new asexual ascomycetous yeast is phylogenetically related to Candida spandovensis and Candida sorbophila, species belonging to the Wickerhamiella clade, as evidenced by the sequences of the D1/D2 domains of their large subunit ribosomal DNAs. The species C. sergipensis and C. spandovensis can be separated on the basis of growth on 50% glucose agar, xylose and succinate, negative for the first species and positive for the second. The type culture is strain UFMG-R188 (CBS 9567). PMID:15103235

Trindade, Rita C; Resende, Maria A; Pimenta, Raphael S; Lachance, Marc-André; Rosa, Carlos A

2004-07-01

368

Psychrotrophic yeast Yarrowia lipolytica NCYC 789 mediates the synthesis of antimicrobial silver nanoparticles via cell-associated melanin  

PubMed Central

A psychrotrophic marine strain of the ascomycetous yeast Yarrowia lipolytica (NCYC 789) synthesized silver nanoparticles (AgNPs) in a cell-associated manner. These nanostructures were characterized by UV-Visible spectroscopy and scanning electron microscope-energy dispersive spectrometer (SEM-EDS) analysis. The brown pigment (melanin) involved in metal-interactions was obtained from the cells. This extracted pigment also mediated the synthesis of silver nanoparticles that were characterized by a variety of analytical techniques. The melanin-derived nanoparticles displayed antibiofilm activity. This paper thus reports the synthesis of AgNPs by the biotechnologically important yeast Y. lipolytica; proposes a possible mechanism involved in the synthetic process and describes the use of the bio-inspired nanoparticles as antibiofilm agents.

2013-01-01

369

The Cryphonectria parasitica plasmid pUG1 contains a large ORF with motifs characteristic of family B DNA polymerases.  

PubMed Central

The isolation and characterization of the circular mitochondrial plasmid pUG1 from the ascomycete Cryphonectria parasitica is described. The entire sequence (4182 bp) was obtained and high similarities to DNA-dependent DNA polymerases were revealed. Strikingly common features with the DNA polymerases encoded by the Neurospora intermedia plasmids Fiji and LaBelle, such as matches to the conserved motifs A and B and the presence of TTD instead of DTD in motif C, were found, suggesting the existence of a distinct group of members of the B DNA family polymerases. These strong similarities between the plasmids might suggest a common origin of the C.parasitica and the Neurospora plasmids.

Gobbi, E; Carpanelli, A; Firrao, G; Locci, R

1997-01-01

370

Structures of Cvnh Family Lectins  

NASA Astrophysics Data System (ADS)

Members of the CVNH family are found in a restricted range of eukaryotic organisms as diverse as filamentous ascomycetes and seedless plants. All CVNH proteins so far exhibit a fold that matches the unique fold of the cyanobacterial protein. The CVNH domain is a versatile protein module, and, with some exceptions, comprises 101-150 aa with two sequential repeats of 50 amino acids. We determined high resolution structures of CVNHs from Tuber borchii, Ceratopteris richardii, Neurospora crassa, and Gibberella zeae, representing different phylogenetic groups. All proteins exhibit the same fold and the overall structures resemble that of the founding member of the family, CVN, albeit with noteworthy differences in loop conformation and detailed local structure.

Gronenborn, Angela M.

371

Effector diversification within compartments of the Leptosphaeria maculans genome affected by Repeat-Induced Point mutations  

PubMed Central

Fungi are of primary ecological, biotechnological and economic importance. Many fundamental biological processes that are shared by animals and fungi are studied in fungi due to their experimental tractability. Many fungi are pathogens or mutualists and are model systems to analyse effector genes and their mechanisms of diversification. In this study, we report the genome sequence of the phytopathogenic ascomycete Leptosphaeria maculans and characterize its repertoire of protein effectors. The L. maculans genome has an unusual bipartite structure with alternating distinct guanine and cytosine-equilibrated and adenine and thymine (AT)-rich blocks of homogenous nucleotide composition. The AT-rich blocks comprise one-third of the genome and contain effector genes and families of transposable elements, both of which are affected by repeat-induced point mutation, a fungal-specific genome defence mechanism. This genomic environment for effectors promotes rapid sequence diversification and underpins the evolutionary potential of the fungus to adapt rapidly to novel host-derived constraints.

Rouxel, Thierry; Grandaubert, Jonathan; Hane, James K.; Hoede, Claire; van de Wouw, Angela P.; Couloux, Arnaud; Dominguez, Victoria; Anthouard, Veronique; Bally, Pascal; Bourras, Salim; Cozijnsen, Anton J.; Ciuffetti, Lynda M.; Degrave, Alexandre; Dilmaghani, Azita; Duret, Laurent; Fudal, Isabelle; Goodwin, Stephen B.; Gout, Lilian; Glaser, Nicolas; Linglin, Juliette; Kema, Gert H. J.; Lapalu, Nicolas; Lawrence, Christopher B.; May, Kim; Meyer, Michel; Ollivier, Benedicte; Poulain, Julie; Schoch, Conrad L.; Simon, Adeline; Spatafora, Joseph W.; Stachowiak, Anna; Turgeon, B. Gillian; Tyler, Brett M.; Vincent, Delphine; Weissenbach, Jean; Amselem, Joelle; Quesneville, Hadi; Oliver, Richard P.; Wincker, Patrick; Balesdent, Marie-Helene; Howlett, Barbara J.

2011-01-01

372

Fusarium graminearum and Its Interactions with Cereal Heads: Studies in the Proteomics Era.  

PubMed

The ascomycete fungal pathogen Fusarium graminearum (teleomorph stage: Gibberella zeae) is the causal agent of Fusarium head blight in wheat and barley. This disease leads to significant losses of crop yield, and especially quality through the contamination by diverse fungal mycotoxins, which constitute a significant threat to the health of humans and animals. In recent years, high-throughput proteomics, aiming at identifying a broad spectrum of proteins with a potential role in the pathogenicity and host resistance, has become a very useful tool in plant-fungus interaction research. In this review, we describe the progress in proteomics applications toward a better understanding of F. graminearum pathogenesis, virulence, and host defense mechanisms. The contribution of proteomics to the development of crop protection strategies against this pathogen is also discussed briefly. PMID:23450732

Yang, Fen; Jacobsen, Susanne; Jørgensen, Hans J L; Collinge, David B; Svensson, Birte; Finnie, Christine

2013-01-01

373

Recent advances in genes involved in secondary metabolite synthesis, hyphal development, energy metabolism and pathogenicity in Fusarium graminearum (teleomorph Gibberella zeae).  

PubMed

The ascomycete fungus, Fusarium graminearum (teleomorph Gibberella zeae), is the most common causal agent of Fusarium head blight (FHB), a devastating disease for cereal crops worldwide. F. graminearum produces ascospores (sexual spores) and conidia (asexual spores), which can serve as disease inocula of FHB. Meanwhile, Fusarium-infected grains are often contaminated with mycotoxins such as trichothecenes (TRIs), fumonisins, and zearalenones, among which TRIs are related to the pathogenicity of F. graminearum, and these toxins are hazardous to humans and livestock. In recent years, with the complete genome sequencing of F. graminearum, an increasing number of functional genes involved in the production of secondary metabolites, hyphal differentiation, sexual and asexual reproduction, virulence and pathogenicity have been identified from F. graminearum. In this review, the secondary metabolite synthesis, hyphal development and pathogenicity related genes in F. graminearum were thoroughly summarized, and the genes associated with secondary metabolites, sexual reproduction, energy metabolism, and pathogenicity were highlighted. PMID:24389085

Geng, Zongyi; Zhu, Wei; Su, Hao; Zhao, Yong; Zhang, Ke-Qin; Yang, Jinkui

2014-01-01

374

Phialosimplex, a new anamorphic genus associated with infections in dogs and having phylogenetic affinity to the Trichocomaceae.  

PubMed

Anamorphic members of the ascomycete family Trichocomaceae including Aspergillus, Penicillium, Paecilomyces, Geosmithia and Sagenomella have been reported from infections in canines. Six clinical isolates (five associated with infections in canines and one from a human source) demonstrated simple phialides producing conidia in long chains and were investigated for their potential relationship to Sagenomella chlamydospora, a known agent of canine disseminated mycosis. Phylogenetic analyses of internal transcribed spacer (ITS) and small subunit (SSU) region sequences revealed that all of the canine-associated isolates were distinct from Sagenomella species. The new anamorphic genus and species Phialosimplex caninus is described to accommodate the clinical isolates. Sagenomella chlamydospora and Sagenomella sclerotialis are transferred to the new genus as Phialosimplex chlamydosporus comb. nov. and Phialosimplex sclerotialis comb. nov. PMID:20141373

Sigler, Lynne; Sutton, Deanna A; Gibas, Connie Fe C; Summerbell, Richard C; Noel, Rhonda K; Iwen, Peter C

2010-03-01

375

The benomyl test as a fundamental diagnostic method for medical mycology.  

PubMed Central

The fungicide benomyl has long been known to differentially affect major taxonomic groups of fungi. In the present study 163 species or aggregates of closely similar species of medically important fungi and actinomycetes, as well as species commonly isolated as clinical contaminants, were tested to determine their reactions to three concentrations of benomyl. Fungi of basidiomycetous, endomycetous, and microascaceous affinities were highly resistant, including all common yeasts and Geotrichum, Pseudallescheria, Scedosporium, and Scopulariopsis species. Also resistant were fungi of pleosporalean affinities with poroconidial anamorphs, such as Alternaria, Bipolaris, Curvularia, and Exserohilum species. Most other fungi of ascomycetous affinity were moderately to strongly susceptible. Such fungi included dermatophytes; Coccidioides, Blastomyces, and Histoplasma species; Sporothrix schenckii; medically important aspergilli; and "black yeasts." Benomyl testing aided in the provisional identification of nonsporulating mycelia, including common basidiomycetous isolates obtained as contaminants as well as nonsporulating Aspergillus fumigatus from pulmonary sources.

Summerbell, R C

1993-01-01

376

Total synthesis of (+)-chloriolide.  

PubMed

(+)-Chloriolide, a metabolite of the ascomycete Chloridium virescens var. chlamydosporum, was synthesized in 16 linear steps from cellulose as a source of a levoglucosenone that contributed the (Z)-alkene and the R stereocenter. The attachment of a spacer derived from l-lactate gave an ?-hydroxyacetal which was added to the phosphorus ylide Ph3PCCO. The resulting ester ylide was treated with hydrochloric acid to liberate the hemiacetal shown. Addition of sodium hydroxide regenerated the corresponding ylide, which underwent a spontaneous intramolecular Wittig olefination to afford (+)-chloriolide in 65% yield without the necessity of high-dilution conditions. This is the third synthesis of (+)-chloriolide and the first one ever of a macrolide by a ring-closing Wittig olefination of a stabilized phosphorus ylide bearing an ?-hemiacetal. Our synthetic sample exhibited moderate cytotoxicity against cancer cells but no antimicrobial activity against Staphylococcus aureus. PMID:24708255

Ostermeier, Michael; Schobert, Rainer

2014-05-01

377

Host-specific differentiation among populations of Venturia inaequalis causing scab on apple, pyracantha and loquat.  

PubMed

Patterns of multilocus DNA sequence variation within and between closely related taxa can provide insights into the history of divergence. Here, we report on DNA polymorphism and divergence at six nuclear loci in globally distributed samples of the ascomycete Venturia inaequalis, responsible for scab on apple, loquat, and pyracantha. Isolates from different hosts were differentiated but did not form diagnosable distinct phylogenetic species. Parameters of an Isolation-with-Migration model estimated from the data suggested that the large amount of variation shared among groups more likely resulted from recent splitting than from extensive genetic exchanges. Inferred levels of gene flow among groups were low and more concentrated toward recent times, and we identified two potentially recent one-off shifters from apple and pyracantha to loquat. These findings support a scenario of recent divergence in allopatry followed by introgression through secondary contact, with groups from loquat and pyracantha being the most recently differentiated. PMID:20060485

Gladieux, P; Caffier, V; Devaux, M; Le Cam, B

2010-06-01

378

Microorganisms in the gut of beetles: evidence from molecular cloning.  

PubMed

We have regularly cultured yeasts from the gut of certain beetles in our ongoing research. In this study cloned PCR products amplified from the gut contents of certain mushroom-feeding and wood-ingesting beetles in four families (Erotylidae, Tenebrionidae, Ciidae, and Passalidae) were sequenced and compared with culture results. Cultural techniques detected some yeasts present in the gut of the beetles, including a Pichia stipitis-like yeast associated with wood-ingesting passalid beetles. Clone sequences similar to several ascomycete yeasts and Malassezia restricta, a fastidious basidiomycetous yeast requiring special growth media, however, were not detected by culturing. Unexpectedly, phylogenetic analysis of additional clone sequences discovered from passalid beetles showed similarity to members of the Parabasalia, protists known from other wood-ingesting insects, termites, and wood roaches. Examination of all gut regions of living passalids, however, failed to reveal parabasalids, and it is possible that they were parasites in the gut tissue present in low numbers. PMID:14726245

Zhang, Ning; Suh, Sung-Oui; Blackwell, Meredith

2003-11-01

379

Bioactive fungal polysaccharides as potential functional ingredients in food and nutraceuticals.  

PubMed

Fungal bioactive polysaccharides deriving mainly from the Basidiomycetes family (and some from the Ascomycetes) and medicinal mushrooms have been well known and widely used in far Asia as part of traditional diet and medicine, and in the last decades have been the core of intense research for the understanding and the utilization of their medicinal properties in naturally produced pharmaceuticals. In fact, some of these biopolymers (mainly ?-glucans or heteropolysaccharides) have already made their way to the market as antitumor, immunostimulating or prophylactic drugs. The fact that many of these biopolymers are produced by edible mushrooms makes them also very good candidates for the formulation of novel functional foods and nutraceuticals without any serious safety concerns, in order to make use of their immunomodulating, anticancer, antimicrobial, hypocholesterolemic, hypoglycemic and health-promoting properties. This article summarizes the most important properties and applications of bioactive fungal polysaccharides and discusses the latest developments on the utilization of these biopolymers in human nutrition. PMID:24518400

Giavasis, Ioannis

2014-04-01

380

Ultrastructural study of galacturonic acid distribution in some pathogenic fungi using gold-complexed Aplysia depilans gonad lectin.  

PubMed

Aplysia gonad lectin, isolated from the mollusc Aplysia depilans, was successfully conjugated to colloidal gold and used for ultrastructural detection of galacturonic acids in some pathogenic fungi. These sugar residues were found to occur in the fibrillar sheath surrounding hyphal cells of Ascocalyx abietina and in intravacuolar dense inclusions of this fungus spores. In hyphae and spores of Ophiostoma ulmi, galacturonic acids were detected mainly in the outermost wall layers. In contrast, these saccharides appeared associated with the innermost wall layers and especially the plasma membrane of Verticillium albo-atrum cells. Galacturonic acids were found to be absent in cells of Fusarium oxysporum f.sp. radicis-lycopersici and Candida albicans. These cytochemical data indicate therefore that a heterogeneity in wall composition exists between ascomycete fungi. The significance of the presence of galacturonic acids in the cell walls of certain fungi is still open to question. PMID:2659155

Benhamou, N

1989-03-01

381

Comparative Genomics of Taphrina Fungi Causing Varying Degrees of Tumorous Deformity in Plants  

PubMed Central

Taphrina fungi are biotrophic plant pathogens that cause plant deformity diseases. We sequenced the genomes of four Taphrina species—Taphrina wiesneri, T. deformans, T. flavorubra, and T. populina—which parasitize Prunus, Cerasus, and Populus hosts with varying severity of disease symptoms. High levels of gene synteny within Taphrina species were observed, and our comparative analysis further revealed that these fungi may utilize multiple strategies in coping with the host environment that are also found in some specialized dimorphic species. These include species-specific aneuploidy and clusters of highly diverged secreted proteins located at subtelomeres. We also identified species differences in plant hormone biosynthesis pathways, which may contribute to varying degree of disease symptoms. The genomes provide a rich resource for investigation into Taphrina biology and evolutionary studies across the basal ascomycetes clade.

Tsai, Isheng J.; Tanaka, Eiji; Masuya, Hayato; Tanaka, Ryusei; Hirooka, Yuuri; Endoh, Rikiya; Sahashi, Norio; Kikuchi, Taisei

2014-01-01

382

An improved high-throughput Nile red fluorescence assay for estimating intracellular lipids in a variety of yeast species  

PubMed Central

A rapid and inexpensive method for estimating lipid content of yeasts is needed for screening large numbers of yeasts samples. Nile red is a fluorescent lipophilic dye used for detection and quantification of intracellular lipid droplets in various biological system including algae, yeasts and filamentous fungi. However, a published assay for yeast is affected by variable diffusion across the cell membrane, and variation in the time required to reach maximal fluorescence emission. In this study, parameters that may influence the emission were varied to determine optimal assay conditions. An improved assay with a high-throughput capability was developed that includes the addition of dimethyl sulfoxide (DMSO) solvent to improve cell permeability, elimination of the washing step, the reduction of Nile red concentration, kinetic readings rather than single time-point reading, and utilization of a black 96-well microplate. The improved method was validated by comparison to gravimetric determination of lipid content of a broad variety of ascomycete and basidiomycete yeast species.

Sitepu, I.R.; Ignatia, L.; Franz, A. K.; Wong, D. M.; Faulina, S.A.; Tsui, M.; Kanti, A.; Boundy-Mills, K.

2012-01-01

383

On the trail of a cereal killer: recent advances in Fusarium graminearum pathogenomics and host resistance.  

PubMed

The ascomycete fungal pathogen Fusarium graminearum (sexual stage: Gibberella zeae) causes the devastating head blight or scab disease on wheat and barley, and cob or ear rot disease on maize. Fusarium graminearum infection causes significant crop and quality losses. In addition to roles as virulence factors during pathogenesis, trichothecene mycotoxins (e.g. deoxynivalenol) produced by this pathogen constitute a significant threat to human and animal health if consumed in respective food or feed products. In the last few years, significant progress has been made towards a better understanding of the processes involved in F. graminearum pathogenesis, toxin biosynthesis and host resistance mechanisms through the use of high-throughput genomic and phenomic technologies. In this article, we briefly review these new advances and also discuss how future research can contribute to the development of sustainable plant protection strategies against this important plant pathogen. PMID:22098555

Kazan, Kemal; Gardiner, Donald M; Manners, John M

2012-05-01

384

Cre-loxP-based system for removal and reuse of selection markers in Ashbya gossypii targeted engineering.  

PubMed

The filamentous ascomycete Ashbya gossypii is amenable to genetic manipulation and is an excellent model system for studying eukaryotic cell biology. However, the number of selection markers in current use for both targeted gene integration and disruption in this fungus are very limited. Therefore, the Cre-loxP recombination system was adapted for use in A. gossypii and its effectiveness in recycling marker genes was demonstrated by constructing both single and double deleted Agura3 and Agade1 auxotrophic strains free of exogenous markers. In spite of its wide use, this is the first report in which the Cre-loxP system was applied to A. gossypii, opening new perspectives for targeted engineering of this fungus with several promising biotechnological applications. PMID:24792968

Aguiar, Tatiana Q; Dinis, Cláudia; Domingues, Lucília

2014-07-01

385

Dioxatricyclic and oxabicyclic polyketides from Trichocladium opacum.  

PubMed

Five new polyketides, trichocladinols D-H (1-5) with dioxatricyclic (1-3) and oxabicyclic (4 and 5) skeletons, and the known massarilactone C (6) were isolated from the solid-substrate fermentation cultures of the ascomycete fungus Trichocladium opacum. The structures of 1-5 were determined mainly by NMR experiments, and 1, 3, and 4 were confirmed by X-ray crystallography. The absolute configurations of 1 and 3 were assigned by X-ray crystallography using Cu K? radiation, whereas that of C-5 in 2 and 4 was deduced via the circular dichroism (CD) data. Compounds 2-4 showed weak cytotoxicity against the human tumor cell lines A549, HCT116, and SW480. PMID:24354429

Chen, Shenxi; Ren, Fengxia; Niu, Shubin; Liu, Xingzhong; Che, Yongsheng

2014-01-24

386

Pyrrole and indole alkaloids from an endophytic Fusarium incarnatum (HKI00504) isolated from the mangrove plant Aegiceras corniculatum.  

PubMed

Two new pyrrole alkaloids, N-[4-(2-formyl-5-hydroxymethyl-pyrrol-1-yl)-butyl]-acetamide (1) and N-[5-(2-formyl-5-hydroxymethyl-pyrrol-1-yl)-pentyl]-acetamide (2), and a new indole derivative (3aR,8aR)-3a-acetoxyl-1,2,3,3a,8,8a-hexahydropyrrolo-[2,3-b]indol (3) were isolated, together with ( - )-3a-hydroxyfuroindoline, (3aR,8aS)-1-acetyl-1,3,3a,8,8a-hexahydropyrrolo-[2,3-b]indol-3a-ol, and N-acetyltryptamine A, from an endophytic ascomycetous fungus, Fusarium incarnatum (HKI00504), which was isolated from the mangrove plant Aegiceras corniculatum. The structures of compounds 1-3 were determined on the basis of extensive spectroscopic data analyses. PMID:18696331

Li, Li-Ya; Ding, Yi; Groth, Ingrid; Menzel, Klaus-Dieter; Peschel, Gundela; Voigt, Kerstin; Deng, Zi-Wei; Sattler, Isabel; Lin, Wen-Han

2008-01-01

387

Pyrrole and indole alkaloids from an endophytic Fusarium incarnatum (HKI00504) isolated from the mangrove plant Aegiceras corniculatum  

Microsoft Academic Search

Two new pyrrole alkaloids, N-[4-(2-formyl-5-hydroxymethyl-pyrrol-1-yl)-butyl]-acetamide (1) and N-[5-(2-formyl-5-hydroxymethyl-pyrrol-1-yl)-pentyl]-acetamide (2), and a new indole derivative (3aR,8aR)-3a-acetoxyl-1,2,3,3a,8,8a-hexahydropyrrolo-[2,3-b]indol (3) were isolated, together with ( ? )-3a-hydroxyfuroindoline, (3aR,8aS)-1-acetyl-1,3,3a,8,8a-hexahydropyrrolo-[2,3-b]indol-3a-ol, and N-acetyltryptamine A, from an endophytic ascomycetous fungus, Fusarium incarnatum (HKI00504), which was isolated from the mangrove plant Aegiceras corniculatum. The structures of compounds 1–3 were determined on the basis of extensive spectroscopic data analyses.

Li-Ya Li; Yi Ding; Ingrid Groth; Klaus-Dieter Menzel; Gundela Peschel; Kerstin Voigt; Zi-Wei Deng; Isabel Sattler; Wen-Han Lin

2008-01-01

388

Msi1-Like (MSIL) Proteins in Fungi  

PubMed Central

Msi1-like (MSIL) proteins, which are eukaryote-specific and contain a series of WD40 repeats, have pleiotropic roles in chromatin assembly, DNA damage repair, and regulation of nutrient/stress-sensing signaling pathways. In the fungal kingdom, the functions of MSIL proteins have been studied most intensively in the budding yeast model Saccharomyces cerevisiae, an ascomycete. Yet their functions are largely unknown in other fungi. Recently, an MSIL protein, Msl1, was discovered and functionally characterized in the pathogenic yeast Cryptococcus neoformans, a basidiomycete. Interestingly, MSIL proteins appear to have redundant and unique roles in both fungi, suggesting that MSIL proteins may have evolutionarily divergent roles in different parts of the fungal kingdom. In this review, we will describe the current findings regarding the role of MSIL proteins in fungi and discuss future directions for research on this topic.

Yang, Dong-Hoon; Maeng, Shinae

2013-01-01

389

Mate and fuse: how yeast cells do it  

PubMed Central

Many cells are able to orient themselves in a non-uniform environment by responding to localized cues. This leads to a polarized cellular response, where the cell can either grow or move towards the cue source. Fungal haploid cells secrete pheromones to signal mating, and respond by growing a mating projection towards a potential mate. Upon contact of the two partner cells, these fuse to form a diploid zygote. In this review, we present our current knowledge on the processes of mating signalling, pheromone-dependent polarized growth and cell fusion in Saccharomyces cerevisiae and Schizosaccharomyces pombe, two highly divergent ascomycete yeast models. While the global architecture of the mating response is very similar between these two species, they differ significantly both in their mating physiologies and in the molecular connections between pheromone perception and downstream responses. The use of both yeast models helps enlighten both conserved solutions and species-specific adaptations to a general biological problem.

Merlini, Laura; Dudin, Omaya; Martin, Sophie G.

2013-01-01

390

High diversity and complex evolution of fungal cytochrome P450 reductase: cytochrome P450 systems.  

PubMed

Cytochrome P450 reductase (CPR) is the redox partner of P450 monooxygenases, involved in primary and secondary metabolism of eukaryotes. Two novel CPR genes, sharing 34% amino acid identity, were found in the filamentous ascomycete Cochliobolus lunatus. Fungal genomes were searched for putative CPR enzymes. Phylogenetic analysis suggests that multiple independent CPR duplication events occurred in fungi, whereas P450-CPR fusion occurred before the diversification of Dikarya and Zygomycota. Additionally, losses of methionine synthase reductase were found in certain fungal taxa; a truncated form of this enzyme was conserved in Pezizomycotina. In fungi, high numbers of cytochrome P450 enzymes, multiple CPRs, and P450-CPR fusion proteins were associated with filamentous growth. Evolution of multiple CPR-like oxidoreductases in filamentous fungi might have been driven by the complexity of biochemical functions necessitated by their growth form, as opposed to yeast. PMID:18024101

Lah, Ljerka; Krasevec, Nada; Trontelj, Peter; Komel, Radovan

2008-04-01

391

[Diversity of facultatively anaerobic microscopic mycelial fungi in soils].  

PubMed

The numbers of microscopic fungi isolated from soil samples after anaerobic incubation varied from tens to several hundreds of CFU per one gram of soil; a total of 30 species was found. This group is composed primarily of mitotic fungi of the ascomycete affinity belonging to the orders Hypocreales (Fusarium solani, F. oxysporum, Fusarium sp., Clonostachys grammicospora, C. rosea. Acremonium sp., Gliocladium penicilloides, Trichoderma aureoviride, T. harzianum, T. polysporum, T. viride. T. koningii, Lecanicillum lecanii, and Tolypocladium inflatum) and Eurotiales (Aspergillus terreus, A. niger, and Paecilomyces lilacimus), as well as to the phylum Zygomycota, to the order Mucorales (Actinomucor elegans, Absidia glauca, Mucor circinelloides, M. hiemalis, M. racemosus, Mucor sp., Rhizopus oryzae, Zygorrhynchus moelleri, Z. heterogamus, and Umbelopsis isabellina) and the order Mortierellales (Mortierella sp.). As much as 10-30% of the total amount of fungal mycelium remains viable for a long time (one month) under anaerobic conditions. PMID:18365728

Kurakov, A V; Lavrent'ev, R B; Nechita?lo, T Iu; Golyshin, P N; Zviagintsev, D G

2008-01-01

392

Mycosphaerella is polyphyletic  

PubMed Central

Mycosphaerella, one of the largest genera of ascomycetes, encompasses several thousand species and has anamorphs residing in more than 30 form genera. Although previous phylogenetic studies based on the ITS rDNA locus supported the monophyly of the genus, DNA sequence data derived from the LSU gene distinguish several clades and families in what has hitherto been considered to represent the Mycosphaerellaceae. Several important leaf spotting and extremotolerant species need to be disposed to the genus Teratosphaeria, for which a new family, the Teratosphaeriaceae, is introduced. Other distinct clades represent the Schizothyriaceae, Davidiellaceae, Capnodiaceae, and the Mycosphaerellaceae. Within the two major clades, namely Teratosphaeriaceae and Mycosphaerellaceae, most anamorph genera are polyphyletic, and new anamorph concepts need to be derived to cope with dual nomenclature within the Mycosphaerella complex.

Crous, P.W.; Braun, U.; Groenewald, J.Z.

2007-01-01

393

Integration of the first and second generation bioethanol processes and the importance of by-products.  

PubMed

Lignocellulosic ethanol has obstacles in the investment costs and uncertainties in the process. One solution is to integrate it with the running dry mills of ethanol from grains. However, the economy of these mills, which dominate the world market, are dependent on their by-products DDGS (Distiller's Dried Grains and Solubles), sold as animal feed. The quality of DDGS therefore must not be negatively influenced by the integration. This puts restraints on the choice of pretreatment of lignocelluloses and utilizing the pentose sugars by food-grade microorganisms. The proposed solution is to use food related filamentous Zygomycetes and Ascomycetes fungi, and to produce fungal biomass as a high-grade animal feed from the residues after the distillation (stillage). This also has the potential to improve the first generation process by increasing the amount of the thin stillage directly sent back into the process, and by decreasing the evaporator based problems. PMID:24582951

Lennartsson, Patrik R; Erlandsson, Per; Taherzadeh, Mohammad J

2014-08-01

394

Isolating Fungal Pathogens from a Dynamic Disease Outbreak in a Native Plant Population to Establish Plant-Pathogen Bioassays for the Ecological Model Plant Nicotiana attenuata  

PubMed Central

The wild tobacco species Nicotiana attenuata has been intensively used as a model plant to study its interaction with insect herbivores and pollinators in nature, however very little is known about its native pathogen community. We describe a fungal disease outbreak in a native N. attenuata population comprising 873 plants growing in an area of about 1500 m2. The population was divided into 14 subpopulations and disease symptom development in the subpopulations was monitored for 16 days, revealing a waxing and waning of visible disease symptoms with some diseased plants recovering fully. Native fungal N. attenuata pathogens were isolated from diseased plants, characterized genetically, chemotaxonomically and morphologically, revealing several isolates of the ascomycete genera Fusarium and Alternaria, that differed in the type and strength of the disease symptoms they caused in bioassays on either detached leaves or intact soil-grown plants. These isolates and the bioassays will empower the study of N. attenuata-pathogen interactions in a realistic ecological context.

Schuck, Stefan; Baldwin, Ian T.

2014-01-01

395

Aspergillus Niger Genomics: Past, Present and into the Future  

SciTech Connect

Aspergillus niger is a filamentous ascomycete fungus that is ubiquitous in the environment and has been implicated in opportunistic infections of humans. In addition to its role as an opportunistic human pathogen, A. niger is economically important as a fermentation organism used for the production of citric acid. Industrial citric acid production by A. niger represents one of the most efficient, highest yield bioprocesses in use currently by industry. The genome size of A. niger is estimated to be between 35.5 and 38.5 megabases (Mb) divided among eight chromosomes/linkage groups that vary in size from 3.5 - 6.6 Mb. Currently, there are three independent A. niger genome projects, an indication of the economic importance of this organism. The rich amount of data resulting from these multiple A. niger genome sequences will be used for basic and applied research programs applicable to fermentation process development, morphology and pathogenicity.

Baker, Scott E.

2006-09-01

396

Searching for gold beyond mitosis  

PubMed Central

The genetically tractable filamentous ascomycete fungus Aspergillus nidulans has been successfully exploited to gain major insight into the eukaryotic cell cycle. More recently, its amenability to in vivo multidimensional microscopy has fueled a potentially gilded second age of A. nidulans cell biology studies. This review specifically deals with studies on intracellular membrane traffic in A. nidulans. The cellular logistics are subordinated to the needs imposed by the polarized mode of growth of the multinucleated hyphal tip cells, whereas membrane traffic is adapted to the large intracellular distances. Recent work illustrates the usefulness of this fungus for morphological and biochemical studies on endosome and Golgi maturation, and on the role of microtubule-dependent motors in the long-distance movement of endosomes. The fungus is ideally suited for genetic studies on the secretory pathway, as mutations impairing secretion reduce apical extension rates, resulting in phenotypes detectable by visual inspection of colonies.

Penalva, Miguel A.; Galindo, Antonio; Abenza, Juan F.; Pinar, Mario; Calcagno-Pizarelli, Ana M.; Arst, Herbert N.; Pantazopoulou, Areti

2012-01-01

397

Tuber borchii mycelial protoplasts isolation, characterization and functional delivery of liposome content, a new step towards truffles biotechnology.  

PubMed

The filametous ascomycete Tuber borchii is a plant-symbiotic ectomycorrhizal microrganism with an high value due to the production of hypogeous fruitbodies (truffles). The present work was undertaken to develop a procedure for the release of T. borchii viable protoplasts from Tuber mycelium, isolate ATTC 96540; several factors which affect the isolation, morphology and viability were examined and developed in order to improve applications of T. borchii protoplasts in morphological, biochemical and genetic investigations (protoplast fusion or transformation). Functional delivery of liposome content into T. borchii protoplasts has also been examined with a cytotoxic ribosome inactivator as saporin. T. borchii protoplasts incubation/fusion with saporin containing liposomes were made to demonstrate the absence of cell wall of 16 days cultured protoplasts. PMID:16260098

Poma, Anna; Colafarina, Sabrina; Limongi, Tania; Pacioni, Giovanni

2005-12-15

398

Specific adaptation of Ustilaginoidea virens in occupying host florets revealed by comparative and functional genomics.  

PubMed

Ustilaginoidea virens (Cooke) Takah is an ascomycetous fungus that causes rice false smut, a devastating emerging disease worldwide. Here we report a 39.4 Mb draft genome sequence of U. virens that encodes 8,426 predicted genes. The genome has ~25% repetitive sequences that have been affected by repeat-induced point mutations. Evolutionarily, U. virens is close to the entomopathogenic Metarhizium spp., suggesting potential host jumping across kingdoms. U. virens possesses reduced gene inventories for polysaccharide degradation, nutrient uptake and secondary metabolism, which may result from adaptations to the specific floret infection and biotrophic lifestyles. Consistent with their potential roles in pathogenicity, genes for secreted proteins and secondary metabolism and the pathogen-host interaction database genes are highly enriched in the transcriptome during early infection. We further show that 18 candidate effectors can suppress plant hypersensitive responses. Together, our analyses offer new insights into molecular mechanisms of evolution, biotrophy and pathogenesis of U. virens. PMID:24846013

Zhang, Yong; Zhang, Kang; Fang, Anfei; Han, Yanqing; Yang, Jun; Xue, Minfeng; Bao, Jiandong; Hu, Dongwei; Zhou, Bo; Sun, Xianyun; Li, Shaojie; Wen, Ming; Yao, Nan; Ma, Li-Jun; Liu, Yongfeng; Zhang, Min; Huang, Fu; Luo, Chaoxi; Zhou, Ligang; Li, Jianqiang; Chen, Zhiyi; Miao, Jiankun; Wang, Shu; Lai, Jinsheng; Xu, Jin-Rong; Hsiang, Tom; Peng, You-Liang; Sun, Wenxian

2014-01-01

399

Secondary metabolites from higher fungi in China and their biological activity.  

PubMed

As a part of our search for naturally occurring bioactive metabolites from higher fungi, we investigated the chemical constituents of basidiomycetes and ascomycetes fungi (Albatrellus confluens, Albatrellus dispansus, Boletus edulis, Boletopsis grisea, Bondarzewia berkeleyi, Cortinarius tenuipes, Cortinarius vibratilis, Daldinia concentrica, Engleromyces goetzii, Hydnum repandum, Hebeloma versipelle, Hygrophorus eburnesus, Lactarius deliciosus, Lactarius hatsudake, Lactarius hirtipes, Lactarius mitissimus, Lactarius rufus, Paxillus panuoides, Pulveroboletus ravenelii, Russula cyanoxantha, Russula foetens, Russula lepida, Russula nigricans, Sarcodon laevigatum, Sarcodon scabrosus, Shiraia bambusicola, Thelephora aurantiotincta, Thelephora ganbajun, Tricholomopsis rutilans, Tylopilus virens, Tuber indicum, Xylaria euglossa, etc.), and isolated a number of novel terpenoids, phenolics, and nitrogen-containing compounds. The isolation, structural elucidation, and biologically activity of the new compounds are discussed. PMID:22504394

Liu, J K

2007-10-01

400

Evaluation of Paecilomyces variotii potential in bioethanol production from lignocellulose through consolidated bioprocessing.  

PubMed

The ascomycete Paecillomyces variotii was evaluated for the first time as a candidate species for the production of bioethanol from lignocellulose through consolidated bioprocessing (CBP) approaches. The examined strain (ATHUM 8891) revealed all the necessary phenotypic characteristics required for 2nd generation biofuel production. The fungus is able to efficiently ferment glucose and xylose to ethanol, with yields close to the theoretical maximum. Nitrogen supplementation greatly affected ethanol production with nitrate-nitrogen presenting the best results. Notably, ethanol yield on xylose fermentation was higher than that of glucose, while in co-fermentation of glucose-xylose mixtures no distinguished diauxic behavior was observed. Furthermore, the fungus seems to possess the necessary enzyme factory for the degradation of lignocellulosic biomass, as it was able to grow and produce ethanol on common agro-industrial derivatives. Overall, the results of our study indicate that P. variotii is a new and possibly powerful candidate for CBP applications. PMID:24759646

Zerva, Anastasia; Savvides, Alexander L; Katsifas, Efstathios A; Karagouni, Amalia D; Hatzinikolaou, Dimitris G

2014-06-01

401

Potential of Ophiostoma piceae sterol esterase for biotechnologically relevant hydrolysis reactions.  

PubMed

The ascomycete Ophiostoma piceae produces a sterol esterase (OPE) with high affinity toward p-nitrophenol, glycerol, and sterol esters. Recently, this enzyme has been heterologously expressed in the methylotrophic yeast Pichia pastoris under the AOX1 methanol-inducible promoter (PAOX1) using sorbitol as co-susbtrate, and the hydrolytic activity of the recombinant protein (OPE*) turned out to be improved from a kinetic point of view. In this study, we analyze the effects of sorbitol during the expression of OPE*, at first added as an additional carbon source, and methanol as inducer. The O. piceae enzyme was successfully used for PVAc hydrolysis, suggesting its potential applicability in recycled paper production to decrease stickies problems. PMID:23138020

Barba Cedillo, Víctor; Prieto, Alicia; Martínez, María Jesús

2013-01-01

402

Viral repression of fungal pheromone precursor gene expression.  

PubMed

Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a G alpha(i) subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete. PMID:9447992

Zhang, L; Baasiri, R A; Van Alfen, N K

1998-02-01

403

The information highways of a biotechnological workhorse - signal transduction in Hypocrea jecorina  

PubMed Central

Background The ascomycete Hypocrea jecorina (anamorph Trichoderma reesei) is one of the most prolific producers of biomass-degrading enzymes and frequently termed an industrial workhorse. To compete for nutrients in its habitat despite its shortcoming in certain degradative enzymes, efficient perception and interpretation of environmental signals is indispensable. A better understanding of these signals as well as their transmission machinery can provide sources for improvement of biotechnological processes. Results The genome of H. jecorina was analysed for the presence and composition of common signal transduction pathways including heterotrimeric G-protein cascades, cAMP signaling, mitogen activated protein kinases, two component phosphorelay systems, proteins involved in circadian rhythmicity and light response, calcium signaling and the superfamily of Ras small GTPases. The results of this survey are discussed in the context of current knowledge in order to assess putative functions as well as potential impact of alterations of the respective pathways. Conclusion Important findings include an additional, bacterial type phospholipase C protein and an additional 6-4 photolyase. Moreover the presence of 4 RGS-(Regulator of G-protein Signaling) proteins and 3 GprK-type G-protein coupled receptors comprising an RGS-domain suggest a more complex posttranslational regulation of G-protein signaling than in other ascomycetes. Also the finding, that H. jecorina, unlike yeast possesses class I phosducins which are involved in phototransduction in mammals warrants further investigation. An alteration in the regulation of circadian rhythmicity may be deduced from the extension of both the class I and II of casein kinases, homologues of which are implicated in phosphorylation of FRQ in Neurospora crassa. On the other hand, a shortage in the number of the pathogenicity related PTH11-type G-protein coupled receptors (GPCRs) as well as a lack of microbial opsins was detected. Considering its efficient enzyme system for breakdown of cellulosic materials, it came as a surprise that H. jecorina does not possess a carbon sensing GPCR.

Schmoll, Monika

2008-01-01

404

Mating Type Locus of Chinese Black Truffles Reveals Heterothallism and the Presence of Cryptic Species within the T. indicum Species Complex  

PubMed Central

Tuber spp. are filamentous ascomycetes which establish symbiosis with the roots of trees and shrub species. By virtue of this symbiosis they produce hypogeous ascocarps, known as truffles. Filamentous ascomycetes can reproduce by homothallism or heterothallism depending on the structure and organization of their mating type locus. The first mating type locus in a truffle species has been recently characterized in Tuber melanosporum and it has been shown that this fungus, endemic in Europe, is heterothallic. The availability of sequence information for T. melanosporum mating type genes is seminal to cloning their orthologs from other Tuber species and assessing their reproductive mode. Here we report on the organization of the mating type region in T. indicum, the black truffle species present in Asia, which is the closest relative to T. melanosporum and is characterized by an high level of morphological and genetic variability. The present study shows that T. indicum is also heterothallic. Examination of Asiatic black truffles belonging to different genetic classes, sorted according to the sequence polymorphism of the internal transcribed spacer rDNA region, has revealed sequence variations and rearrangements in both coding and non-coding regions of the mating type locus, to suggest the existence of cryptic species within the T. indicum complex. The presence of transposable elements within or linked to the mating type region suggests a role of these elements in generating the genotypic diversity present among T. indicum strains. Overall, comparative analyses of the mating type locus have thus allowed us to tackle taxonomical and phylogenetic issues within black truffles and make inferences about the evolution of T. melanosporum-T. indicum lineage. Our results are not only of fundamental but also of applied relevance as T. indicum produces edible fruit bodies that are imported also into Europe and thus may represent a biological threat for T. melanosporum.

Belfiori, Beatrice; Riccioni, Claudia; Paolocci, Francesco; Rubini, Andrea

2013-01-01

405

Leaf and Root-Associated Fungal Assemblages Do Not Follow Similar Elevational Diversity Patterns  

PubMed Central

The diversity of fungi along environmental gradients has been little explored in contrast to plants and animals. Consequently, environmental factors influencing the composition of fungal assemblages are poorly understood. The aim of this study was to determine whether the diversity and composition of leaf and root-associated fungal assemblages vary with elevation and to investigate potential explanatory variables. High-throughput sequencing of the Internal Transcribed Spacer 1 region was used to explore fungal assemblages along three elevation gradients, located in French mountainous regions. Beech forest was selected as a study system to minimise the host effect. The variation in species richness and specific composition was investigated for ascomycetes and basidiomycetes assemblages with a particular focus on root-associated ectomycorrhizal fungi. The richness of fungal communities associated with leaves or roots did not significantly relate to any of the tested environmental drivers, i.e. elevation, mean temperature, precipitation or edaphic variables such as soil pH or the ratio carbon?nitrogen. Nevertheless, the ascomycete species richness peaked at mid-temperature, illustrating a mid-domain effect model. We found that leaf and root-associated fungal assemblages did not follow similar patterns of composition with elevation. While the composition of the leaf-associated fungal assemblage correlated primarily with the mean annual temperature, the composition of root-associated fungal assemblage was explained equally by soil pH and by temperature. The ectomycorrhizal composition was also related to these variables. Our results therefore suggest that above and below-ground fungal assemblages are not controlled by the same main environmental variables. This may be due to the larger amplitude of climatic variables in the tree foliage compared to the soil environment.

Coince, Aurore; Cordier, Tristan; Lengelle, Juliette; Defossez, Emmanuel; Vacher, Corinne; Robin, Cecile

2014-01-01

406

Transcriptome analysis of the honey bee fungal pathogen, Ascosphaera apis: implications for host pathogenesis  

PubMed Central

Background We present a comprehensive transcriptome analysis of the fungus Ascosphaera apis, an economically important pathogen of the Western honey bee (Apis mellifera) that causes chalkbrood disease. Our goals were to further annotate the A. apis reference genome and to identify genes that are candidates for being differentially expressed during host infection versus axenic culture. Results We compared A. apis transcriptome sequence from mycelia grown on liquid or solid media with that dissected from host-infected tissue. 454 pyrosequencing provided 252?Mb of filtered sequence reads from both culture types that were assembled into 10,087 contigs. Transcript contigs, protein sequences from multiple fungal species, and ab initio gene predictions were included as evidence sources in the Maker gene prediction pipeline, resulting in 6,992 consensus gene models. A phylogeny based on 12 of these protein-coding loci further supported the taxonomic placement of Ascosphaera as sister to the core Onygenales. Several common protein domains were less abundant in A. apis compared with related ascomycete genomes, particularly cytochrome p450 and protein kinase domains. A novel gene family was identified that has expanded in some ascomycete lineages, but not others. We manually annotated genes with homologs in other fungal genomes that have known relevance to fungal virulence and life history. Functional categories of interest included genes involved in mating-type specification, intracellular signal transduction, and stress response. Computational and manual annotations have been made publicly available on the Bee Pests and Pathogens website. Conclusions This comprehensive transcriptome analysis substantially enhances our understanding of the A. apis genome and its expression during infection of honey bee larvae. It also provides resources for future molecular studies of chalkbrood disease and ultimately improved disease management.

2012-01-01

407

Viral Repression of Fungal Pheromone Precursor Gene Expression  

PubMed Central

Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a G?i subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete.

Zhang, Lei; Baasiri, Rudeina A.; Van Alfen, Neal K.

1998-01-01

408

Phylogenetic Characterization and In Situ Detection of a Cytophaga-Flexibacter-Bacteroides Phylogroup Bacterium in Tuber borchii Vittad. Ectomycorrhizal Mycelium  

PubMed Central

Mycorrhizal ascomycetous fungi are obligate ectosymbionts that colonize the roots of gymnosperms and angiosperms. In this paper we describe a straightforward approach in which a combination of morphological and molecular methods was used to survey the presence of potentially endo- and epiphytic bacteria associated with the ascomycetous ectomycorrhizal fungus Tuber borchii Vittad. Universal eubacterial primers specific for the 5? and 3? ends of the 16S rRNA gene (16S rDNA) were used for PCR amplification, direct sequencing, and phylogenetic analyses. The 16S rDNA was amplified directly from four pure cultures of T. borchii Vittad. mycelium. A nearly full-length sequence of the gene coding for the prokaryotic small-subunit rRNA was obtained from each T. borchii mycelium studied. The 16S rDNA sequences were almost identical (98 to 99% similarity), and phylogenetic analysis placed them in a single unique rRNA branch belonging to the Cytophaga-Flexibacter-Bacteroides (CFB) phylogroup which had not been described previously. In situ detection of the CFB bacterium in the hyphal tissue of the fungus T. borchii was carried out by using 16S rRNA-targeted oligonucleotide probes for the eubacterial domain and the Cytophaga-Flexibacter phylum, as well as a probe specifically designed for the detection of this mycelium-associated bacterium. Fluorescent in situ hybridization showed that all three of the probes used bound to the mycelium tissue. This study provides the first direct visual evidence of a not-yet-cultured CFB bacterium associated with a mycorrhizal fungus of the genus Tuber.

Barbieri, Elena; Potenza, Lucia; Rossi, Ismaela; Sisti, Davide; Giomaro, Giovanna; Rossetti, Simona; Beimfohr, Claudia; Stocchi, Vilberto

2000-01-01

409

Evolutionary origins of the eukaryotic shikimate pathway: gene fusions, horizontal gene transfer, and endosymbiotic replacements.  

PubMed

Currently the shikimate pathway is reported as a metabolic feature of prokaryotes, ascomycete fungi, apicomplexans, and plants. The plant shikimate pathway enzymes have similarities to prokaryote homologues and are largely active in chloroplasts, suggesting ancestry from the plastid progenitor genome. Toxoplasma gondii, which also possesses an alga-derived plastid organelle, encodes a shikimate pathway with similarities to ascomycete genes, including a five-enzyme pentafunctional arom. These data suggests that the shikimate pathway and the pentafunctional arom either had an ancient origin in the eukaryotes or was conveyed by eukaryote-to-eukaryote horizontal gene transfer (HGT). We expand sampling and analyses of the shikimate pathway genes to include the oomycetes, ciliates, diatoms, basidiomycetes, zygomycetes, and the green and red algae. Sequencing of cDNA from Tetrahymena thermophila confirmed the presence of a pentafused arom, as in fungi and T. gondii. Phylogenies and taxon distribution suggest that the arom gene fusion event may be an ancient eukaryotic innovation. Conversely, the Plantae lineage (represented here by both Viridaeplantae and the red algae) acquired different prokaryotic genes for all seven steps of the shikimate pathway. Two of the phylogenies suggest a derivation of the Plantae genes from the cyanobacterial plastid progenitor genome, but if the full Plantae pathway was originally of cyanobacterial origin, then the five other shikimate pathway genes were obtained from a minimum of two other eubacterial genomes. Thus, the phylogenies demonstrate both separate HGTs and shared derived HGTs within the Plantae clade either by primary HGT transfer or secondarily via the plastid progenitor genome. The shared derived characters support the holophyly of the Plantae lineage and a single ancestral primary plastid endosymbiosis. Our analyses also pinpoints a minimum of 50 gene/domain loss events, demonstrating that loss and replacement events have been an important process in eukaryote genome evolution. PMID:16963634

Richards, Thomas A; Dacks, Joel B; Campbell, Samantha A; Blanchard, Jeffrey L; Foster, Peter G; McLeod, Rima; Roberts, Craig W

2006-09-01

410

Fungi Unearthed: Transcripts Encoding Lignocellulolytic and Chitinolytic Enzymes in Forest Soil  

PubMed Central

Background Fungi are the main organisms responsible for the degradation of biopolymers such as lignin, cellulose, hemicellulose, and chitin in forest ecosystems. Soil surveys largely target fungal diversity, paying less attention to fungal activity. Methodology/Principal Findings Here we have focused on the organic horizon of a hardwood forest dominated by sugar maple that spreads widely across Eastern North America. The sampling site included three plots receiving normal atmospheric nitrogen deposition and three that received an extra 3 g nitrogen m?2 y?1 in form of sodium nitrate pellets since 1994, which led to increased accumulation of organic matter in the soil. Our aim was to assess, in samples taken from all six plots, transcript-level expression of fungal genes encoding lignocellulolytic and chitinolytic enzymes. For this we collected RNA from the forest soil, reverse-transcribed it, and amplified cDNAs of interest, using both published primer pairs as well as 23 newly developed ones. We thus detected transcript-level expression of 234 genes putatively encoding 26 different groups of fungal enzymes, notably major ligninolytic and diverse aromatic-oxidizing enzymes, various cellulose- and hemicellulose-degrading glycoside hydrolases and carbohydrate esterases, enzymes involved in chitin breakdown, N-acetylglucosamine metabolism, and cell wall degradation. Among the genes identified, 125 are homologous to known ascomycete genes and 105 to basidiomycete genes. Transcripts corresponding to all 26 enzyme groups were detected in both control and nitrogen-supplemented plots. Conclusions/Significance Many of these enzyme groups are known to be important in soil turnover processes, but the contribution of some is probably underestimated. Our data highlight the importance of ascomycetes, as well as basidiomycetes, in important biogeochemical cycles. In the nitrogen-supplemented plots, we have detected no transcript-level gap likely to explain the observed increased carbon storage, which is more likely due to community changes and perhaps transcriptional and/or post-transcriptional down-regulation of relevant genes.

Kellner, Harald; Vandenbol, Micheline

2010-01-01

411

[Current aspects of fungal spores allergy].  

PubMed

In industrialized countries the prevalence of allergic inhalant diseases is some 15-20%. More than 10% of these individuals are sensitized to fungal allergens. Many fungal spores are less than 10 microns in size, which permits penetration into the smaller airways of the lung. Bronchial provocation tests have demonstrated that fungal spores and spore extracts can cause both an early and a late phase reaction in sensitive subjects. Over 80 genera of fungi have been associated with symptoms of respiratory tract allergy. Ascomycetes, basidiomycetes and zygomycetes are the major fungal groups that contain genera known to induce and elicit allergic reactions. These groups contribute most of the spores found in air. Although ascomycetes include the greatest number of any fungal group, only a few species, such as Aspergillus fumigatus, Alternaria alternata and Cladosporium herbarum, have been investigated in a scientific manner. In recent years spores of basidiomycetes have been tested for allergenicity and some species have been determined to be allergenic, such as Calvatia cyathiformis, Ganoderma applanatum, Pleurotus ostreatus, or Psilocybe cubensis. Compared to pollen-related allergies, diagnosis of fungal allergy is often difficult. Provocative challenge with specific fungal antigens can provide a definitive diagnosis. To date, only three controlled immunotherapy trials with standardized extracts of A. alternata and C. herbarum have shown clinical efficacy. In spite of these studies, immunotherapy with fungal antigens requires further investigations. Thus, the indication for immunotherapy with fungal extracts must be judged by an experienced allergist. Apart from pharmacological management, avoiding or minimizing exposure is the front-line measure. PMID:8016603

Helbling, A; Reese, G; Horner, W E; Lehrer, S B

1994-05-28

412

Colorimetric characterization for comparative analysis of fungal pigments and natural food colorants.  

PubMed

Exogenous pigments produced by ascomycetous filamentous fungi belonging to the genera Penicillium, Epicoccum, and Monascus, preselected based on chemotaxonomic knowledge, have been extracted and characterized by quantitative colorimetry. The color characteristics of the fungal extracts were compared to water soluble natural colorants derived from sources currently in use. The tested fungal extracts also included some commercially available Monascus colorants. The a values for the fungal extracts were found to be both positive and negative, the b values were found to be positive, while the hue angles of the fungal color extracts ranged from 40 to 110 indicating the color distribution of fungal extracts over the red-orange-yellow region of the CIELAB color space. The fungal extracts exhibited additional color hues in the red spectrum and similar hues in the yellow spectrum as compared to the reference natural colorants. They were also found to be similar or brighter in terms of chroma to some of the reference natural colorants. Principal component analysis was performed to group and distinguish different colors based on the a and b values. The fungal color extracts could be grouped in accordance with the similarity or difference in the color to those of the existing natural colorants. The diversity of colors was not only found among different fungal genera and/or species but also within the same species on changing the media. There was a marked change in the color composition of the extracts resulting in relatively different hues. Our results, thus, indicate that there exists pigment-producing genera of ascomycetous fungi other than Monascus that produce color shades in the red and the yellow spectra in addition or similar to reference colorants. These color shades could add to the color palette of the natural colorants currently in use. In addition, the multivariate approach in distinguishing and classifying the colorants was shown to be a very useful tool in colorimetric comparison of colorants. PMID:16968059

Mapari, Sameer A S; Meyer, Anne S; Thrane, Ulf

2006-09-20

413

Bacterial, archaeal and eukaryal community structures throughout soil horizons of harvested and naturally disturbed forest stands.  

PubMed

Disturbances caused by timber harvesting have critical long-term effects on the forest soil microbiota and alter fundamental ecosystem services provided by these communities. This study assessed the effects of organic matter removal and soil compaction on microbial community structures in different soil horizons 13 years after timber harvesting at the long-term soil productivity site at Skulow Lake, British Columbia. A harvested stand was compared with an unmanaged forest stand. Ribosomal intergenic spacer profiles of bacteria, archaea and eukarya indicated significantly different community structures in the upper three soil horizons of the two stands, with differences decreasing with depth. Large-scale sequencing of the ribosomal intergenic spacers coupled to small-subunit ribosomal RNA genes allowed taxonomic identification of major microbial phylotypes affected by harvesting or varying among soil horizons. Actinobacteria and Gemmatimonadetes were the predominant phylotypes in the bacterial profiles, with the relative abundance of these groups highest in the unmanaged stand, particularly in the deeper soil horizons. Predominant eukaryal phylotypes were mainly assigned to known mycorrhizal and saprotrophic species of Basidiomycetes and Ascomycetes. Harvesting affected Basidiomycetes to a minor degree but had stronger effects on some Ascomycetes. Archaeal profiles had low diversity with only a few predominant crenarchaeal phylotypes whose abundance appeared to increase with depth. Detection of these effects 13 years after harvesting may indicate a long-term change in processes mediated by the microbial community with important consequences for forest productivity. These effects warrant more comprehensive investigation of the effects of harvesting on the structure of forest soil microbial communities and the functional consequences. PMID:19659501

Hartmann, Martin; Lee, Sangwon; Hallam, Steven J; Mohn, William W

2009-12-01

414

Species delimitation in taxonomically difficult lichen-forming fungi: an example from morphologically and chemically diverse Xanthoparmelia (Parmeliaceae) in North America.  

PubMed

Mounting evidence suggests many morphology-based species circumscriptions in lichenized ascomycetes misrepresent fungal diversity. The lichenized ascomycete genus Xanthoparmelia includes over 800 described species displaying a considerable range of morphological and chemical variation. Species circumscriptions in this genus have traditionally been based on thallus morphology, medullary chemistry, and the presence or absence of sexual or asexual reproductive structures. Notwithstanding concerted effort on the part of taxonomists to arrive at a natural classification, modern taxonomic concepts for the most part remain unclear. Here we assess the evolution of characters traditionally regarded as taxonomically important by reconstructing a phylogenetic hypothesis based on sequence data from four nuclear ribosomal markers as well as fragments from two protein-coding nuclear loci. A total of 414 individuals were tested, representing 19 currently accepted species. Most sampled species, as currently circumscribed, were recovered as polyphyletic, suggesting that major diagnostic characters have evolved in a homoplasious manner. The vagrant growth form, distinct medullary chemistries, and production of vegetative diaspores appear to have evolved independently multiple times. Application of a population assignment test resulted in the recognition of 21 species-level genetic clusters, each of which was supported by a comparison of genetic distances as well as a Bayesian species delimitation method calculating probabilities associated with speciation events. Inferred clusters are largely incongruent with traditionally circumscribed species due to the prevalence of cryptic diversity and, in some cases, high levels of intraspecific morphological and chemical variation. These results call for a major taxonomic revision of Xanthoparmelia species in western North America. PMID:21627994