Science.gov

Sample records for aseptic sternal pseudoarthrosis

  1. Sternal Talon, a novel repair for sternal dehiscence

    PubMed Central

    Keita, Luther; Veerasingam, Dave

    2015-01-01

    Sternal dehiscence is a recognised complication after median sternotomy, occurring in 0.5-5% of cases with or without infection. A 72-year-old man presenting with collapse and ventricular tachycardia was investigated for a possible acute cardiac event 2 years after coronary artery bypass grafting for ischemic heart disease. Work-up chest X-ray showed displacement of all sternal wires, and computed tomography (CT) performed to investigate further showed sternal dehiscence with right ventricle wall herniation through the defect and sternal wire breakdown. A decision was made after discussion with the patient to repair the defect using 3 Sternal Talon devices and 2 sternal wires. The patient made an uncomplicated recovery, and the outpatient clinic review after discharge home showed satisfactory and stable sternal union. We report a case of non-infected sternal dehiscence managed successfully with the Sternal Talon without long-term complications. PMID:26336499

  2. Sternal exploration or closure

    MedlinePlus

    ... M, Austin K, Coulen C, Boyle D. Implementing evidence-based practice findings to decrease postoperative sternal wound infections following open heart surgery. Journal of Cardiovascular Nursing. October 2005; 20(5): ...

  3. Sternal mycobacterial infections

    PubMed Central

    Yuan, Shi-Min

    2016-01-01

    Sternal mycobacterial infections are rare. Due to the rarity, its clinical characteristics, diagnoses, and regular management strategies are still scanty. A total of 76 articles on this topic were obtained by a comprehensive literature collection. The clinical features, diagnosis, management strategies and prognosis were carefully analyzed. There were totally 159 patients including 152 (95%) cases of tuberculosis (TB) and seven (5%) cases of non-TB sternal infections. Sternal mycobacterial infections can be categorized into three types: Primary, secondary, and postoperative, according to the pathogenesis; and categorized into isolated, peristernal, and multifocal, according to the extent of the lesions. Microbiological investigation is more sensitive than medical imaging and Mantoux tuberculin skin test in the diagnosis of sternal infections. Most patients show good responses to the standard four-drug regimen and a surgical intervention was necessary in 28.3% patients. The prognoses of the patients are good with a very low mortality. A delayed diagnosis of sternal mycobacterial infections may bring about recurrent sternal infections and sustained incurability. An early diagnosis and prompt antibiotic regimens may significantly improve the patients' outcomes. PMID:27168857

  4. Primary Sternal Osteomyelitis Caused by Actinomyces israelii

    PubMed Central

    Lee, Jun Ho; Jeon, Seok Chol; Jang, Hyo-Jun; Kim, Hyuck; Kim, Young Hak; Chung, Won-Sang

    2015-01-01

    Primary sternal osteomyelitis is a rare disease. Common infectious organisms causing primary sternal osteomyelitis include Staphylococcus aureus and Pseudomonas aeruginosa. Actinomyces species are common saprophytes of the oral cavity, but there have been few reports in the literature of primary sternal osteomyelitis caused by Actinomyces species. We describe a case of primary sternal osteomyelitis caused by Actinomyces israelii without pulmonary involvement. PMID:25705607

  5. A comparative study of two types of sternal pins used for sternal closure: poly-L-lactide sternal pins versus uncalcined hydroxyapatite poly-L-lactide sternal pins.

    PubMed

    Fu, Xian-ming; Oshima, Hideki; Araki, Yoshimori; Narita, Yuji; Mutsuga, Masato; Okada, Noritaka; Tsunekawa, Tomohiro; Usui, Akihiko

    2013-12-01

    Bioabsorbable poly-L-lactide (PLLA) sternal pins are applied to reinforce sternal closure during cardiac surgery. However, these pins lack osteoconductivity. A new bioabsorbable sternal pin with osteoconductivity, made of uncalcined hydroxyapatite and poly-L-lactide (u-HA-PLLA) has been developed. This study was conducted to compare the two types of sternal pins in terms of sternal stability and healing after median sternotomy. Between October 2006 and January 2012, 105 patients underwent aortic surgery for aortic aneurysms or dissection via median sternotomy and sternal closure with sternal pins. Among these patients, 75 were followed for 12 months using serial computed tomography (CT). PLLA sternal pins were used in 30 patients (group A) and u-HA-PLLA sternal pins were used in 45 patients (group B). The incidence rates of transverse sternal dehiscence, anteroposterior displacement and complete sternal fusion were evaluated using CT. The cross-sectional cortical bone density area (CBDA) of the sternum around the sternal pins was examined to evaluate the osteoconductivity of the sternal pins. There were no significant differences between groups A and B in the sternal dehiscence rate (6.7 vs 4.4 %), sternal displacement rate (6.7 vs 2.2 %) or 12-month sternal fusion rate (63.3 vs 73.3 %). The CBDA around the sternal pins significantly increased between discharge and 12 months after surgery in group B (P < 0.001) but not in group A. These results show that u-HA-PLLA sternal pins exhibit certain osteoconductivity; however, both PLLA and u-HA-PLLA sternal pins provide comparable clinical outcomes regarding sternal stability and healing. PMID:23996506

  6. Syphilitic aseptic meningitis

    MedlinePlus

    Syphilitic aseptic meningitis is a complication of untreated syphilis. It involves inflammation of the tissues covering the ... Syphilis is a sexually transmitted disease caused by the spirochete bacteria Treponema pallidum . Syphilis has three main ...

  7. MDCT evaluation of sternal variations: Pictorial essay

    PubMed Central

    Duraikannu, Chary; Noronha, Olma V; Sundarrajan, Pushparajan

    2016-01-01

    Sternal variations and anomalies have been identified in the past during autopsy or cadaveric studies. Recently, an increasing number of minor sternal variations have been reported with the advent of multidetector computed tomography (CT). Although there are many sternal variations that occur with varying appearance and prevalence, most of them are not recognized or are underreported during routine imaging of thorax. Identification of sternal variations is important to differentiate from pathological conditions and to prevent fatal complications prior to sternal interventions like marrow aspiration or acupuncture. This article aims to describe the minor and asymptomatic sternal variations by multidetector CT and their clinical significance. PMID:27413263

  8. Failure analysis of explanted sternal wires.

    PubMed

    Shih, Chun-Ming; Su, Yea-Yang; Lin, Shing-Jong; Shih, Chun-Che

    2005-05-01

    To classify and understand the mechanisms of surface damages and fracture mechanisms of sternal wires, explanted stainless steel sternal wires were collected from patients with sternal dehiscence following open-heart surgery. Surface alterations and fractured ends of sternal wires were examined and analyzed. Eighty fractured wires extracted from 25 patients from January 1999 to December 2003, with mean implantation interval of 55+/-149 days (range 5-729 days) after cardiac surgery, were studied by various techniques. The extracted wires were cleaned and the fibrotic tissues were removed. Irregularities and fractured ends were assayed by a scanning electron microscopy. After stereomicroscopy and documentation, the explants were cleaned with 1% sodium hypochlorite to remove the blood and tissues and was followed by cleaned with deionized water and alcohol. The explants were examined by stereomicroscopy, and irregularities on surface and fracture surfaces of sternal wires were assayed by scanning electron microscopy, energy dispersive X-ray analysis (EDAX) and X-ray mapping. The explants with surrounding fibrotic tissue were stained and examined with stereomicroscopy and transmission electronic microscopy. Corrosion pits were found on the surface of explanted sternal wires. EDAX and X-ray mapping examinations revealed diminution of nickel concentration in the severely corroded pits on sternal wires. A feature of transgranular cracking was observed for stress corrosion cracking and striation character for typical corrosion fatigue was also identified. TEM examination of tissue showed the metallic particles in phagolysosomes of macrophages inside the surrounding sternal tissue. The synergic effect of hostile environment and the stress could be the precursors of failures for sternal wires. PMID:15576179

  9. Considering syphilis in aseptic meningitis.

    PubMed

    Tayal, Sarup; Chadwick, David; Chawla, Girish

    2009-12-01

    Clinicians need to consider syphilis in the differential diagnosis of macular or papular rashes with neurological conditions, particularly aseptic meningitis, as early diagnosis and treatment lead to a better prognosis. PMID:20095316

  10. Aseptic technique in microgravity.

    PubMed

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  11. Multidimensional Sternal Fixation to Overcome a “Floating” Sternum

    PubMed Central

    Rothstein, William; Spata, Tyler

    2014-01-01

    This case report describes the repair of a complete sternal dehiscence of the lower right sternum using sternal wires, manubrial plates, and a Talon closure device for rigid, multidimensional sternal fixation. Sternal dehiscence is a rare but significant cause of morbidity for patients undergoing median sternotomy. The risk factors for this complication are well described and although sternal wires have traditionally been used for primary closure, rigid fixation with sternal plates is a viable alternative to avoid dehiscence in this high-risk cohort. PMID:25379318

  12. Aseptic technique for cell culture.

    PubMed

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  13. Sternal plate fixation for sternal wound reconstruction: initial experience (Retrospective study)

    PubMed Central

    2011-01-01

    Background Median sternotomy infection and bony nonunion are two commonly described complications which occur in 0.4 - 5.1% of cardiac procedures. Although relatively infrequent, these complications can lead to significant morbidity and mortality. The aim of this retrospective study is to evaluate the initial experience of a transverse plate fixation system following wound complications associated with sternal dehiscence with or without infection following cardiac surgery. Methods A retrospective chart review of 40 consecutive patients who required sternal wound reconstruction post sternotomy was performed. Soft tissue debridement with removal of all compromised tissue was performed. Sternal debridement was carried using ronguers to healthy bleeding bone. All patients underwent sternal fixation using three rib plates combined with a single manubrial plate (Titanium Sternal Fixation System®, Synthes). Incisions were closed in a layered fashion with the pectoral muscles being advanced to the midline. Data were expressed as mean ± SD, Median (range) or number (%). Statistical analyses were made by using Excel 2003 for Windows (Microsoft, Redmond, WA, USA). Results There were 40 consecutive patients, 31 males and 9 females. Twenty two patients (55%) were diagnosed with sternal dehiscence alone and 18 patients (45%) with associated wound discharge. Thirty eight patients went on to heal their wounds. Two patients developed recurrent wound infection and required VAC therapy. Both were immunocompromised. Median post-op ICU stay was one day with the median hospital stay of 18 days after plating. Conclusion Sternal plating appears to be an effective option for the treatment of sternal wound dehiscence associated with sternal instability. Long-term follow-up and further larger studies are needed to address the indications, benefits and complications of sternal plating. PMID:21529357

  14. The biology of aseptic osteolysis.

    PubMed

    Holt, G; Murnaghan, C; Reilly, J; Meek, R M D

    2007-07-01

    Total hip arthroplasty is one of the most commonly performed and successful elective orthopaedic procedures. However, numerous failure mechanisms limit the long-term success including aseptic osteolysis, aseptic loosening, infection, and implant instability. Aseptic osteolysis and subsequent implant failure occur because of a chronic inflammatory response to implant-derived wear particles. To reduce particulate debris and their consequences, implants have had numerous design modifications including high-molecular-weight polyethylene sockets and noncemented implants that rely on bone ingrowth for fixation. Surgical techniques have improved cementation with the use of medullary plugs, cement guns, lavage of the canal, pressurization, centralization of the stem, and reduction in cement porosity. Despite these advances, aseptic osteolysis continues to limit implant longevity. Numerous proinflammatory cytokines, such as interleukin-1, interleukin-6, tumor necrosis factor-alpha, and prostaglandin E2, have proosteoclastogenic effects in response to implant-derived wear particles. However, none of these cytokines represents a final common pathway for the process of particle-induced osteoclast differentiation and maturation. Recent work has identified the fundamental role of the RANKL-RANK-NF-kappaB pathway not only in osteoclastogenesis but also in the development and function the immune system. Thus, the immune system and skeletal homeostasis may be linked in the process of osteoclastogenesis and osteolysis. PMID:17620815

  15. Management of aseptic tibial nonunion.

    PubMed

    Hak, David J

    2011-09-01

    Tibial nonunion remains a significant clinical challenge despite advances in surgical management. New techniques to help manage tibial nonunion include extracorporeal shock wave therapy and percutaneous application of bone marrow aspirate. Management strategies vary based on the type of nonunion: aseptic or infected, and atrophic or hypertrophic. Extracorporeal shock wave therapy has been shown to be as effective as surgical management in patients with stable hypertrophic nonunion. New fixation options include locked plates and intramedullary compression nails. Novel methods of external fixation have been developed for bone graft harvest from the intramedullary canal. Several biologic adjuncts also are available, including bone marrow aspirates, stem cells, and bone morphogenetic protein. PMID:21885702

  16. [Overview of primary sternal closure techniques].

    PubMed

    Nešpor, D; Fila, P; Černý, J; Němec, P

    2015-02-01

    The aim of the overview study is to describe the currently used methods of primary median sternotomy closure in adult cardiac surgery. In the review of published literature, we draw on the data and focus on the methodology, indications, advantages, limitations, biomechanical and clinical results of the different methods in relation to the incidence of deep sternal wound complications after median sternotomy in adult cardiac surgery.Key words: sternum sternotomy adult cardiac surgery surgical procedures. PMID:25659253

  17. Basics of sterile compounding: aseptic processing.

    PubMed

    Akers, Michael J

    2015-01-01

    This article discusses factors that affect the assurance of sterility of an aseptic process operation and balances what is required/practiced in the pharmaceutical industry via the U.S. Food and Drug Administration and European aseptic processing guidelines and what is required/practiced in compounding pharmacies via the United States Pharmacopeia (USP) General Chapter <797>. PMID:25902628

  18. [SAPHO syndrome and aseptic osteitis].

    PubMed

    Cotten, A; Boutry, N; Demondion, X; Chastanet, P; Flipo, R M

    1997-01-01

    Palmoplantar pustulosis and severe acne are sometimes associated with aseptic skeletal lesions, but such skeletal conditions can be observed without skin lesions. The acronym SAPHO (Synovitis, Acne, Palmoplantar pustulosis, Hyperostosis, Osteitis) has been suggested for this cluster of manifestations. The most frequent site of the disease is the upper anterior chest wall, characterized by predominantly osteosclerotic lesions, hyperostosis, and arthritis of the adjacent joints. Osteosclerosis of the vertebral bodies, hyperostosis, and erosions of the vertebral plates can be encountered. Unilateral sacroiliitis of frequently observed. Long bone involvement consists of osteosclerosis or osteolysis with periosteal new bone formation. Peripheral arthritis is rarely associated with joint destruction. The pathogenesis of this syndrome remains unknown, but a link with seronegative spondylarthropathies is probable. Awareness of the SAPHO syndrome should facilitate proper diagnosis and treatment. PMID:9810077

  19. Simultaneous surgery of the aortic valve and sternal osteomyelitis.

    PubMed

    Urbanski, Paul P; Lindemann, Yvonne; Babin-Ebell, Jörg; Fröhner, Steffen; Diegeler, Anno

    2009-09-01

    A 64-year-old man was referred for aortic valve replacement due to severe stenosis. He also suffered chronic sternal osteomyelitis with skin fistula subsequent to radiation therapy. Both pathologies were approached simultaneously by sternal resection, omental plasty, and valve replacement, which led to favorable primary and mid-term result. PMID:19699936

  20. Sternal fractures: retrospective analysis of 100 cases.

    PubMed

    Athanassiadi, Kalliopi; Gerazounis, Michalis; Moustardas, Marios; Metaxas, Efstathios

    2002-10-01

    Isolated sternal fractures are seen with increasing frequency in road accidents, especially since the introduction of seatbelt legislation. The medical records of all our patients who were treated with a diagnosis of sternal fracture (SF) over the past two decades were retrospectively reviewed to determine the incidence, morbidity, and mortality of this entity. Between 1984 and 1998, 100 consecutive patients were admitted to the Department of Surge Surgery, General Hospital of Nikea-Piraeus, Greece, for SF. There were 72 men and 28 women ranging in age between 17 and 84 years. Sixty-seven patients sustained an isolated SF and the remaining 33 had a SF in combination with multiple injuries such as flail chest (n = 19), head injury (n = 18), limb fractures (n = 10), spinal fractures (n = 4), hear contusion (n = 1), hemo-pneumothorax (n = 9), pneumothorax (n = 6), hemomediastinum (n = 5), and pericarditis (n = 2), among others. All patients with a radiological diagnosis were admitted for cardiac monitoring for at least 24 hours. Electrocardiogram (ECG), determinations of cardiac enzyme levels such as lactic dehydrogenase, creatine kinase, and creatine kinase-MB, and evaluation by a cardiologist were routinely performed. An echocardiogram was performed as indicated by the cardiologist. Seven patients underwent operation, two for abdominal bleeding, two for chest wall and sternal stabilization, two for open pneumothorax, and one for massive hemothorax. Eight of our patients needed ventilatory support. Four of them died from respiratory insufficiency, myocardial infarction, and heart and lung contusion. Although an isolated SF carries a good prognosis, careful evaluation and clinical observation are essential. PMID:12181604

  1. Treatment of Sternal Wound Infection Using a Free Myocutaneous Flap.

    PubMed

    Chiang, I-han; Chen, Shyi-Gen; Wang, Chih-Hsin

    2015-11-01

    Deep sternal wound infections are potentially life-threatening complications after cardiac operations because they can spread into the mediastinum and cause postoperative morbidity and mortality. We present a 65-year-old man with a history of coronary artery bypass grafting. A large sternal defect was left after debridement. After brief vacuum-assisted closure (VAC), a free myocutaneous flap of the anterolateral thigh (ALT) was used to fill the dead space. At the 9-month follow-up, the wound had healed completely without tissue loss or complications, and the patient returned to normal life. This was a successful treatment of a deep sternal wound with free flap coverage. PMID:26522542

  2. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  3. A deep sternal wound infection caused by Ureaplasma urealyticum.

    PubMed

    Lucke, Katja; Kuster, Stefan P; Bertea, Mihai; Ruef, Christian; Bloemberg, Guido V

    2010-10-01

    Ureaplasma species are usually associated with infection of the urogenital tract. An unusual case of a sternal wound infection caused by Ureaplasma urealyticum in a 41-year-old male after aortic valve replacement is described. PMID:20616189

  4. Closing the cleft over a throbbing heart: neonatal sternal cleft

    PubMed Central

    J, Ashok Raja; G, Mathevan; K, Mathiarasan; P, Ramasubramaniam

    2014-01-01

    Sternal cleft is a rare anomaly comprising 0.5% of chest wall malformations. We present a case of a neonate with a ‘V’-shaped upper partial sternal cleft at birth. A hyperpigmented cutaneous nevi was present over the cleft. Primary approximation and closure of the defect was performed at 1 week of life. We discuss the presentation and management, and review the literature. PMID:25100810

  5. Trimethoprim-sulfamethoxazole-induced aseptic meningitis.

    PubMed Central

    Wambulwa, Charles; Bwayo, Salome; Laiyemo, Adeyinka O.; Lombardo, Fredric

    2005-01-01

    We present a 46-year-old African-American man with AIDS who was admitted on two different occasions within three weeks for signs and symptoms of meningitis after using trimethoprim/sulfamethoxazole (TMP/SMX). TMP/SMX is primarily used for the treatment of pneumocystis carinii pneumonia prophylaxis in AIDS patients. Drug-induced aseptic meningitis (DIAM) is commonly seen with nonsteroidal anti-inflammatory drugs (NSAIDS), antibiotics (with TMP/SMX being the most frequently implicated), intravenous immunoglobulins and OKT3 antibodies. However, the implication of TMP/SMX inducing aseptic meningitis has been underreported to FDA/MEDWATCH program. This might be due to the fact that it has also been used to treat bacterial meningitis from organisms like Listeria monocytogenes, which is a common pathogen in the elderly and in infants. We reviewed the literature in an attempt to characterize the pattern and predictors of TMP/SMX-induced aseptic meningitis. PMID:16396068

  6. Percutaneous Transpedicular Interbody Fusion Technique in Percutaneous Pedicle Screw Stabilization for Pseudoarthrosis Following Pyogenic Spondylitis.

    PubMed

    Ikuta, Ko; Masuda, Keigo; Yonekura, Yutaka; Kitamura, Takahiro; Senba, Hideyuki; Shidahara, Satoshi

    2016-04-01

    This report introduces a percutaneous transpedicular interbody fusion (PTPIF) technique in posterior stabilization using percutaneous pedicle screws (PPSs). An 81-year-old man presented with pseudoarthrosis following pyogenic spondylitis 15 months before. Although no relapse of infection was found, he complained of obstinate low back pain and mild neurological symptoms. Radiological evaluations showed a pseudoarthrosis following pyogenic spondylitis at T11-12. Posterior stabilization using PPSs from Th9 to L2 and concomitant PTPIF using autologous iliac bone graft at T11-12 were performed. Low back pain and neurological symptoms were immediately improved after surgery. A solid interbody fusion at T11-12 was completed 9 months after surgery. The patient had no restriction of daily activity and could play golf at one year after surgery. PTPIF might be a useful option for perform segmental fusion in posterior stabilization using PPSs. PMID:27114777

  7. Percutaneous Transpedicular Interbody Fusion Technique in Percutaneous Pedicle Screw Stabilization for Pseudoarthrosis Following Pyogenic Spondylitis

    PubMed Central

    Masuda, Keigo; Yonekura, Yutaka; Kitamura, Takahiro; Senba, Hideyuki; Shidahara, Satoshi

    2016-01-01

    This report introduces a percutaneous transpedicular interbody fusion (PTPIF) technique in posterior stabilization using percutaneous pedicle screws (PPSs). An 81-year-old man presented with pseudoarthrosis following pyogenic spondylitis 15 months before. Although no relapse of infection was found, he complained of obstinate low back pain and mild neurological symptoms. Radiological evaluations showed a pseudoarthrosis following pyogenic spondylitis at T11–12. Posterior stabilization using PPSs from Th9 to L2 and concomitant PTPIF using autologous iliac bone graft at T11–12 were performed. Low back pain and neurological symptoms were immediately improved after surgery. A solid interbody fusion at T11–12 was completed 9 months after surgery. The patient had no restriction of daily activity and could play golf at one year after surgery. PTPIF might be a useful option for perform segmental fusion in posterior stabilization using PPSs. PMID:27114777

  8. Septic and aseptic arthritis: a continuum?

    PubMed

    Taylor-Robinson, D; Keat, A

    1999-03-01

    This chapter considers the likelihood that a wide spectrum of infection-provoked arthritis exists, ranging from overt sepsis to apparently aseptic chronic arthritis in which very small numbers of causal bacteria can be detected only by using highly sensitive techniques. It asks whether joints are, as conventionally held, normally devoid of micro-organisms and how to judge the significance of bacteria detected within apparently sterile joints. Through a consideration of known septic, probably infective and apparently aseptic forms of arthritis, a set of criteria for attributing causality to putative arthritogenic micro-organisms is proposed. PMID:10952856

  9. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 3 2014-01-01 2014-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  10. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 3 2011-01-01 2011-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  11. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  12. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 3 2012-01-01 2012-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  13. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 3 2013-01-01 2013-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  14. Quantitative risk modeling in aseptic manufacture.

    PubMed

    Tidswell, Edward C; McGarvey, Bernard

    2006-01-01

    Expedient risk assessment of aseptic manufacturing processes offers unique opportunities for improved and sustained assurance of product quality. Contemporary risk assessments applied to aseptic manufacturing processes, however, are commonly handicapped by assumptions and subjectivity, leading to inexactitude. Quantitative risk modeling augmented with Monte Carlo simulations represents a novel, innovative, and more efficient means of risk assessment. This technique relies upon fewer assumptions and removes subjectivity to more swiftly generate an improved, more realistic, quantitative estimate of risk. The fundamental steps and requirements for an assessment of the risk of bioburden ingress into aseptically manufactured products are described. A case study exemplifies how quantitative risk modeling and Monte Carlo simulations achieve a more rapid and improved determination of the risk of bioburden ingress during the aseptic filling of a parenteral product. Although application of quantitative risk modeling is described here purely for the purpose of process improvement, the technique has far wider relevance in the assisted disposition of batches, cleanroom management, and the utilization of real-time data from rapid microbial monitoring technologies. PMID:17089696

  15. Resuture using Shirodkar tape for sternal dehiscence after extended thymectomy via median sternotomy.

    PubMed

    Sakuraba, Motoki; Miyamoto, Hideaki; Oh, Shiaki; Takahashi, Nobumasa; Miyasaka, Yoshikazu; Suzuki, Kenji

    2009-06-01

    Sternal dehiscence is one complication after median sternotomy. We followed a patient with sternal dehiscence for 6 months after extended thymectomy via median sternotomy. His diagnosis was myasthenia gravis without thymoma and with complicating diabetes mellitus. Sixteen days after the operation chest radiography revealed that one of six sternal wires was cut, although sternal dehiscence was not apparent. Six months after the operation, chest radiography revealed that five of six wires were cut. The patient experienced sternal dehiscence, could not cough, and felt pain at the median wound site. We implemented a resuture technique of the sternum using Shirodkar tape for postoperative sternal dehiscence. After the second operation, sternal dehiscence was not apparent. He was able to cough and had no respiratory deficiency. One year after the second operation, chest computed tomography revealed no sternal dehiscence. Shirodkar tape is extremely useful and is low in price. PMID:19533280

  16. Complete sternal cleft - A rare congenital malformation and its repair in a 3-month-old boy: A case report.

    PubMed

    Kothari, Paras; Gupta, Abhaya; Patil, Prashant S; Kekre, Geeta; Kamble, Ravi; Dikshit, Kiran Vishesh

    2016-01-01

    Complete midline sternal cleft is a rare congenital anomaly resulting from failed midline ventral fusion of the sternal bars. Very few cases of complete sternal cleft have been described in literature. We present a case of complete sternal cleft in a 3-month-old child. The patient underwent primary closure of the defect using stainless steel wires. PMID:27046980

  17. A bioresorbable osteosynthesis device can induce an earlier sternal fusion after median sternotomy

    PubMed Central

    Tsunekawa, Tomohiro; Usui, Akihiko; Oshima, Hideki; Mizutani, Shinnichi; Araki, Yoshimori; Okada, Noritaka; Ueda, Yuichi

    2012-01-01

    OBJECTIVES We examined the impact of the bioresorbable osteosynthesis sternal pin (Super Fixsorb 30) on sternal healing after median sternotomy. METHODS Sixty-three patients who underwent aortic surgery through median sternotomy between January 2006 and March 2009 were analysed. Sternal pins were utilized in 36 patients in addition to the standard closure of the sternum with Ethibond sutures (Group A), and 27 patients received no pins with the standard Ethibond sternal closure (Group B). The occurrence of transverse sternal dehiscence, anterior–posterior displacement and complete fusion of the sternum were evaluated by a computed tomography scan. The cross-sectional cortical bone density area (CBDA) of the sternum was examined to evaluate the osteoconductivity of the sternal pin over a 12-month period. RESULTS There was no sternal displacement (0%) observed in Group A at discharge. Meanwhile, five displacements (18.5%) were observed in Group B (P = 0.007). The complete sternal fusion rates at 12 months postoperatively were 100% in Group A, and 21.6% in Group B (P < 0.001). A significant increase in the CBDA was observed in Group A (P < 0.001; between CBDA at discharge and 12 months postoperatively). CONCLUSIONS The Super Fixsorb 30 sternal pin reduced an anterior–posterior sternal displacement and facilitated an earlier sternal fusion. The pin may have the potential to promote osteogenesis. PMID:22623628

  18. Sternal Resection and Reconstruction for Malignant Phylloides Tumor.

    PubMed

    Selvakumar, Veda Padma Priya; Poonia, Dharmaram; Agrawal, Juhi; Goel, Ashish; Mehta, Sandeep; Kumar, Kapil

    2015-08-01

    Malignant phylloides tumor is a locally aggressive breast neoplasm constituting less than 1 % of all breast cancers. It has a tendency for local recurrence and management is multidisciplinary. We hereby report a case of total sternal resection and reconstruction using Biopore HDPE prosthesis for Malignant Phylloides tumor. PMID:26702245

  19. Technical Modifications to Prevent Massive Hemothorax Following Sternal Plating.

    PubMed

    Cece, John A; Rose, Michael R; Schneider, Lisa F

    2015-09-01

    We report two cases of life-threatening massive hemothorax after titanium plate fixation. We propose a modification of this technique using smaller plates that span the sternal bone but do not encroach upon the cartilage of the ribcage. PMID:26205095

  20. First in Man: Sternal Reconstruction with Autologous Stem Cells.

    PubMed

    Khalpey, Zain; Marsh, Katherine M; Ferng, Alice; Riaz, Irbaz Bin; Hemphill, Courtney; Johnson, Kitsie; Oliva, Isabel; Friedman, Mark

    2015-01-01

    Sternal nonunion is associated with high morbidity and treated using rigid plate and screw fixation. This is the first reported example of successful sternal reconstruction using adipose-derived stromal vascular fraction (SVF) stem cells in addition to traditional techniques. Mesenchymal stem cells, one component of the SVF, play an important role in bone healing and were therefore used to promote remedial processes in a patient with sternal nonunion. A 3D printed model of the patient's sternum was used for preoperative planning of the plating. Intraoperatively, SVF was isolated using ultrasonic cavitation and previously planned sternal plating was completed. A total of 300 million cells were delivered via both local injection and intravenously before chest closure. The patient's pain dramatically decreased, commensurate with healed areas of nonunion by 3 months and maintained at 6 months postoperatively, supported by three-dimensional computed tomography imaging. Utilizing autologous stem cells from the SVF in conjunction with existing plating techniques may provide an optimal platform to stabilize the sternum and promote bone healing, although additional study is recommended. PMID:25914951

  1. Right Ventricular Epicardial Fibrosis in Mice With Sternal Segment Dislocation.

    PubMed

    Adissu, H A; Medhanie, G A; Morikawa, L; White, J K; Newbigging, S; McKerlie, C

    2015-09-01

    We report coincident sternal segment dislocation and focally extensive right ventricular epicardial fibrosis observed during routine histopathology evaluation of C57BL/6N mice as part of a high throughput phenotyping screen conducted between 4 and 16 weeks of age. This retrospective case series study was conducted to determine whether cardiac fibrosis was a pathological consequence of sternal segment dislocation. We identified sternal segment dislocation in 51 of the total 1103 mice (4.6%) analyzed at 16 weeks of age. Males were more frequently affected. In all cases but 2, the dislocation occurred at the fourth intersternebral joint. In 42 of the 51 cases (82.4%), the dislocation was encased by regenerative cartilaginous callus that protruded internally into the thoracic cavity (intrathoracic callus) and/or externally to the outer aspect of the sternum (extrathoracic callus). Displacement of dislocated ends of the sternum into the thoracic cavity was present in 19 of 51 cases (36.5%). Coincident minimal or mild right ventricular epicardial and subepicardial fibrosis was observed in 22 of the 51 cases (43%) but was not observed in any of the mice in the absence of sternal segment dislocation. Our data suggest that right ventricular fibrosis was likely caused by direct injury of the right ventricle by the dislocated ends of the sternum and/or by intrathoracic callus that develops post dislocation. Potential pathogenesis for the sternal and cardiac lesions and their implication for the interpretation of phenotypes in mouse models of cardiopulmonary and skeletal disease are discussed. PMID:25281652

  2. [A case of recurrent aseptic meningitis induced by ergot agents].

    PubMed

    Ogawa, Tomoko; Tagawa, Asako; Hashimoto, Ritsuo; Kato, Hiroyuki

    2015-01-01

    We describe the case of a 29-year-old woman with recurrent aseptic meningitis that was caused by ergot agents. She miscarried at age 27, and the uterus constrictor methylergometrine was prescribed. Three days later, she developed aseptic meningitis and was hospitalized. Two years later, she again developed aseptic meningitis the day after she took ergotamine tartrate. In both events, her symptoms improved rapidly when the medication was stopped. The drug-induced lymphocyte stimulation test for methylergometrine yielded a value of 180%. Drug-induced meningitis is a rare form of recurrent aseptic meningitis. Many studies have reported cases of meningitis caused by non-steroidal anti-inflammatory drugs, but many other drugs can induce aseptic meningitis. To the best of our knowledge, this is the first case of aseptic meningitis induced by ergot agents. PMID:26103816

  3. Failure of aseptic revision total knee arthroplasties

    PubMed Central

    Leta, Tesfaye H; Lygre, Stein Håkon L; Skredderstuen, Arne; Hallan, Geir; Furnes, Ove

    2015-01-01

    Background and purpose In Norway, the proportion of revision knee arthroplasties increased from 6.9% in 1994 to 8.5% in 2011. However, there is limited information on the epidemiology and causes of subsequent failure of revision knee arthroplasty. We therefore studied survival rate and determined the modes of failure of aseptic revision total knee arthroplasties. Method This study was based on 1,016 aseptic revision total knee arthroplasties reported to the Norwegian Arthroplasty Register between 1994 and 2011. Revisions done for infections were not included. Kaplan-Meier and Cox regression analyses were used to assess the survival rate and the relative risk of re-revision with all causes of re-revision as endpoint. Results 145 knees failed after revision total knee arthroplasty. Deep infection was the most frequent cause of re-revision (28%), followed by instability (26%), loose tibial component (17%), and pain (10%). The cumulative survival rate for revision total knee arthroplasties was 85% at 5 years, 78% at 10 years, and 71% at 15 years. Revision total knee arthroplasties with exchange of the femoral or tibial component exclusively had a higher risk of re-revision (RR = 1.7) than those with exchange of the whole prosthesis. The risk of re-revision was higher for men (RR = 2.0) and for patients aged less than 60 years (RR = 1.6). Interpretation In terms of implant survival, revision of the whole implant was better than revision of 1 component only. Young age and male sex were risk factors for re-revision. Deep infection was the most frequent cause of failure of revision of aseptic total knee arthroplasties. PMID:25267502

  4. Delayed aortic rupture resulting from postoperative superficial sternal wound infection

    PubMed Central

    Kim, Su Wan; Chang, Jee Won

    2016-01-01

    While deep sternal wound infection (DSWI) after cardiac surgery is a significant contributor to patient morbidity and mortality, superficial sternal wound infection (SSWI) mostly has a benign course. We report a mortality case of aortic rupture resulting from SSWI after cardiac surgery. A 50-year-old male underwent an aortic valve replacement (AVR). Three months after the valve operation, he presented with severe dyspnea, which had never before been observed, and chest computed tomography revealed an ascending aortic rupture with large hematoma compressing the main pulmonary artery. We performed an emergent operation for aortic rupture that possibly originated from the SSWI. Postoperatively, the patient died of hypovolemic shock due to recurrent aortic rupture despite efforts to resuscitate him. PMID:27499988

  5. [Strategies for the treatment of postoperative sternal infections].

    PubMed

    Akil, A; Schnorr, P; Wiebe, K

    2016-02-01

    Postoperative sternal infections are associated with significant morbidity and mortality. An incidence of up to 8 % has to be expected. Typically, a highly inflammatory acute infection with a marked soft tissue component is observed. However, the infection may also be present as a less symptomatic reaction and localised chronic osteomyelitis with fistula formation. The treatment strategy for a deep sternal wound infection consists of several steps. A radical debridement of the wound requires the opening of all abscesses, the resection of non-vital bone and the removal of all infected allomaterial. This is followed by a period of VAC therapy (Vacuum-Assisted Closure Therapy) for infection treatment and conditioning of the wound. Secondary closure of the wound may be planned only after the infection is completely controlled. The sternum is stabilised by osteosynthesis. Sternal defects are covered. In most cases adequate soft tissue coverage is achieved by mobilisation of both pectoral muscles together with the precostal soft tissues. Following resection of the sternum, the reconstruction of the thoracic wall requires the implantation of material for stabilisation as well as soft tissue coverage. For complicated or large defects various muscle flaps and the omentum majus have been advocated. The latissimus dorsi muscle with skin is the muscle flap most frequently used. PMID:26492536

  6. Radiographic comparison of a fractured clavicle exhibiting a pseudo-arthrosis.

    PubMed

    Rhode, Matthew P; Goodhue, William W; Stephan, Carl N

    2012-07-01

    Bone remodeling is a natural process that is potentially problematic for radiographic comparisons because it can occur after antemortem (AM) imaging, thus interfering with the comparability of AM and postmortem (PM) radiographs from the same individual. While the effects of age-related remodeling have been studied, limited attention has been given to trauma-related remodeling with respect to radiographic comparisons. This report adds to the latter topic by presenting a case of AM clavicle fracture that developed into a pseudo-arthrosis over a 12-month period prior to the individual's death. Even though remodeling was discernable along the fracture margins, adjacent skeletal features on the PM radiograph remained unaltered and constituted compelling evidence for the identification. This case illustrates the potential of using both normal and pathological anatomy concurrently to maximize the surety of findings from radiographic comparisons. PMID:22409353

  7. Sternal Osteomyelitis Caused by Gordonia bronchialis after Open-Heart Surgery

    PubMed Central

    Chang, Jeong-Hyun; Ji, Misuk; Hong, Hyo-Lim; Choi, Sang-Ho; Kim, Yang-Soo; Chung, Cheol-Hyun; Kim, Mi-Na

    2014-01-01

    We report the case of a deep sternal wound infection with sternal osteomyelitis caused by Gordonia bronchialis after open-heart surgery. The isolate was identified as a G. bronchialis by 16S rRNA and hsp65 gene sequencing, having initially been misidentified as a Rhodococcus by a commercial phenotypic identification system. PMID:25024874

  8. Sex estimation from sternal measurements using multidetector computed tomography.

    PubMed

    Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur

    2014-12-01

    We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation.Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30-60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation. PMID:25501090

  9. Management of Large Sternal Wound Infections With the Superior Epigastric Artery Perforator Flap.

    PubMed

    Eburdery, H; Grolleau, J L; Berthier, C; Bertheuil, N; Chaput, B

    2016-01-01

    The management of sternal wound infections often requires pedicled flaps. In recent years, the emergence of perforator flaps has changed our management of wounds involving tissue loss. For sternal wounds, the superior epigastric artery perforator (SEAP) flap can be used with the propeller procedure with minimal donor site morbidity. In our practice, this flap has replaced the traditional latissimus dorsi and pectoralis major flaps in the treatment of many sternal wounds. We report our experience with 4 patients with large sternal wound infection after cardiothoracic operations. The SEAP flap appears a safe alternative for low-morbidity coverage of sternal infections. Moreover, muscle flaps remain available in case the SEAP flap fails. PMID:26694288

  10. Sternal Closure With Tie Bands: A Word of Caution.

    PubMed

    Samuels, Louis

    2016-08-01

    The median sternotomy for cardiac operations can be reapproximated in a variety of ways. Traditionally, sternal wires have been used in several configurations to afford satisfactory closure. Alternative techniques include cables, plates, and clip-like devices. A relatively recent addition to the menu of options is the plastic tie band. Although a few studies have suggested its efficacy, this favorable experience has not been universal. The purpose of this report is to describe a failure in closure and the reaction of the soft tissue around it. PMID:27449444

  11. Complete sternal cleft — A rare congenital malformation and its repair in a 3-month-old boy: A case report

    PubMed Central

    Kothari, Paras; Gupta, Abhaya; Patil, Prashant S.; Kekre, Geeta; Kamble, Ravi; Dikshit, Kiran Vishesh

    2016-01-01

    Complete midline sternal cleft is a rare congenital anomaly resulting from failed midline ventral fusion of the sternal bars. Very few cases of complete sternal cleft have been described in literature. We present a case of complete sternal cleft in a 3-month-old child. The patient underwent primary closure of the defect using stainless steel wires. PMID:27046980

  12. Congenital Pseudoarthrosis of Medial Malleolus in A Young Soccer Player - Diagnosis in Clinical setting of Ankle Sprain

    PubMed Central

    Cerulli, Giuliano; Fabiano, Fantasia; Gabriele, Potalivo; Giacomo, Placella; Enrico, Sebastiani

    2014-01-01

    Introduction: We report a case of a young female soccer player affected by congenital medial bilateral malleolus pseudoarthrosis and os subfibulare. Congenital pseudoarthrosis is the failure of the bones to fuse prior or at birth. The etiology is still unknown, although frequency is high in subjects affected by neurofibromatosis or correlated syndromes, so it has been suggested that these congenital disorders may be the cause of congenital pseudoarthrosis. Case Report: Our patient, a 16-year-old female, high level soccer player, was referred to us following a right ankle sprain during a match. She reported no medical history of tibia-tarsus joint injuries or disease. Pain, swelling and functional impairment were noted immediately after the accident. Standard radiographs in the emergency department revealed a displaced fracture of the medial malleolus and the presence of os subfibularis. The patient was transferred to our Traumatology and Orthopaedic Department to undergo malleolus ostheosynthesis. Before surgery swelling, functional impairment and intense pain at the medial malleolus level were confirmed. However, there was no radiological opening of ankle, instability or pronation pain; furthermore the flexion-extension was preserved with slight pain. Twenty-four hours later a considerable remission of symptoms was evident with increased range of motion and reduction in the swelling and post-traumatic edema. A radiograph on the left ankle to compare with that of the right ankle was necessary to overcome the discrepancy between the radiological diagnosis and the clinical examination. The radiographic results of both medial malleoli were comparable although on the left the os subfibularis was absent. Since the diagnosis of fracture by the association between the radiographs and the symptomatology was doubtful, a bilateral CT was performed. The scan revealed a medial bilateral malleolus pseudoarthrosis and an accessory right subfibularis nucleus. The patient was

  13. Revision after early aseptic failures in primary total knee arthroplasty.

    PubMed

    Piedade, Sérgio Rocha; Pinaroli, Alban; Servien, Elvire; Neyret, Philippe

    2009-03-01

    The purpose of this study was to evaluate cases of early aseptic failures presented during the first 5-year follow-up in a group of 981 primary total knee arthroplasty (primary TKA). Predisposing factors as well causes of failures and postoperative complications in different groups of aseptic failures were re-assessed and compared to a control group. A retrospective and cohort study compared one group of 944 primary TKA without surgical revision (890 patients) (Group A) with 22 primary TKA (22 patients) (Group B) that had revision TKA secondary to aseptic failure during the first five years follow-up. The cases of isolated patellar button replacement (n = 8) and infection (n = 7) were not considered in this study. All patients underwent a systematic assessment that included clinical and radiographic examinations, and IKS scores. Aseptic failure was more prevalent at the first 2-year follow-up (63%). TKA loosening (n = 11) and undiagnosed pain (n = 7) were considered the most frequent modes of failures, and laxity (n = 1) was a very rare early cause of failure. The aseptic failure group was characterized as average 5 years younger with a greater number of previous knee surgeries, lower IKS scores improvement, and more postoperative pain compared to control group, despite the fact that the aseptic failure group showed a prevalence of cases during the first 2-year follow-up. Inside this group, the undiagnosed pain group had lower improvement of IKS scores, a remarkable prevalence in prior surgical procedure (71%) and a minor mean interval between primary and revision TKA (11.6 months). PMID:19082578

  14. Occult sternal metastasis identified by laminography in patients with chest pain.

    PubMed

    LaBan, M M; Newman, J M

    1984-04-01

    Six patients with occult sternal metastasis presenting with chest pain, and four with sternal deformity associated with "arthritis" had undergone routine roentgenographic examinations, reported as "normal." Subsequent laminography of the sternum demonstrated lytic lesions confirmed by needle biopsy. Adenocarcinoma of the lung and breast were identified in two each of four patients; myeloma and kidney neoplasms were the primary source of malignancy in the remaining two patients. In widespread malignancy, metastasis to the skeletal chest wall is a well-recognized occurrence. Infrequently, it can be an isolated manifestation of an occult or recurrent malignancy, initially overlooked when routine roentgenograms are read as normal. Although sternal x-rays remain the most important means of diagnosis, in suspected cases of sternal metastasis laminography alone may initially reveal lytic lesions. PMID:6712441

  15. Fixation of sternal fracture using absorbable plating system, three years follow-up

    PubMed Central

    Katballe, Niels; Pilegaard, Hans

    2015-01-01

    Sternal fractures occur due to severe chest wall trauma in a small number of patients. They are often conservatively treated. The surgical intervention, although controversial, is indicated in case of deformity, severe pain, and ventilatory complications. We report the first case where absorbable plate has been used to fix a traumatic fracture in a 42-year-old female. After 3 years, the patient is still free of symptoms and CT scanning reveals intact sternal bone structure. PMID:26101659

  16. Trends in postcoronary artery bypass graft sternal wound dehiscence in a provincial population

    PubMed Central

    Doherty, Christopher; Nickerson, Duncan; Southern, Danielle A; Kieser, Teresa; Appoo, Jehangir; Dawes, Jeffery; De Souza, Michael A; Harrop, Alan R; Rabi, Doreen

    2014-01-01

    BACKGROUND: It appears that the medical profile of patients undergoing coronary artery bypass graft (CABG) surgery has changed. The impact of this demographic shift on CABG outcomes, such as sternal wound dehiscence, is unclear. OBJECTIVES: To quantify the incidence and trends of sternal wound dehiscence, quantify the demographic shift of those undergoing CABG and identify patient factors predictive of disease. METHODS: A prospective analysis was performed on a historical cohort of consecutive patients who underwent CABG (without valve replacement) in Alberta between April 1, 2002 and November 30, 2009. The incidence and trends of sternal wound dehiscence were determined. In addition, the trend of the mean Charlson index score and European System for Cardiac Operative Risk Evaluation (EuroSCORE) (capturing patient comorbidities) was analyzed. Univariable analysis and multivariable models were performed to determine factors predictive of wound dehiscence. RESULTS: A total of 5815 patients underwent CABG during the study period. The incidence proportion of sternal wound dehiscence in Alberta was 1.86% and the incidence rate was 1.98 cases per 100 person-years. Although both the EuroSCORE and Charlson scores significantly increased over the study period, the incidence of sternal wound dehiscence did not change significantly. Factors predictive of sternal wound dehiscence were diabetes (OR 2.97 [95% CI 1.73 to 5.10]), obesity (OR 1.55 [95% CI 1.05 to 2.27]) and female sex (OR 1.90 [95% CI 1.26 to 2.87]). CONCLUSIONS: The incidence proportion of sternal wound dehiscence in Alberta was comparable with the incidence previously published in the literature. While patients undergoing CABG had worsening medical profiles, the incidence of sternal wound dehiscence did not appear to be increasing significantly. PMID:25332650

  17. A new cable-tie-based sternal closure device: infectious considerations†

    PubMed Central

    Melly, Ludovic; Gahl, Brigitta; Meinke, Ruth; Rueter, Florian; Matt, Peter; Reuthebuch, Oliver; Eckstein, Friedrich S.; Grapow, Martin T.R.

    2013-01-01

    OBJECTIVES To determine the difference in sternal infection and other infectious events between conventional wire and cable-tie-based closure techniques post-sternotomy in a collective of patients after cardiac surgery. METHODS The sternal ZipFix™ (ZF) system consists of a biocompatible poly-ether-ether-ketone (PEEK) cable-tie that surrounds the sternum through the intercostal space and provides a large implant-to-bone contact. Between 1 February 2011 and 31 January 2012, 680 cardiac operations were performed via sternotomy at our institution. After the exclusion of operations for active endocarditis and early mortality within 7 days, 95 patients were exclusively closed with ZF and could be compared with 498 who were closed with conventional wires (CWs) during the same period. A multivariable logistic regression analysis, including body mass index, renal impairment and emergency as suspected confounders and inverse propensity weights was performed on the infection rate. RESULTS Total infection rate was 6.1%, with a total of 36 diagnosed sternal infections (5 in ZF and 31 in CW). Comparing ZF with CW with regard to sternal infection, there is no statistically significant difference related to the device (odds ratio: 0.067, confidence interval: 0.04–9.16, P = 0.72). The propensity modelling provided excellent overlap and the mean propensity was almost the same in both groups. Thus, we have observed no difference in receiving either ZF or CW. No sternal instability was observed with the ZF device, unlike 4/31 patients in the CW group. The overall operation time is reduced by 11 min in the ZF group with identical perfusion and clamping times. CONCLUSIONS Our study underlines a neutral effect of the sternal ZipFix™ system in patients regarding sternal infection. Postoperative complications are similar in both sternal closure methods. The cable-tie-based system is fast, easy to use, reliable and safe. PMID:23624983

  18. Staged Delayed Sternal Closure Using a Binder Clip After Pediatric Cardiac Surgery.

    PubMed

    Fuchigami, Tai; Nishioka, Masahiko; Akashige, Toru; Higa, Shotaro; Nagata, Nobuhiro

    2016-07-01

    After pediatric cardiac surgery, patients who undergo delayed sternal closure may become hemodynamically unstable. We performed a staged sternal closure technique using a binder clip in 31 consecutive patients to minimize cardiopulmonary instability. Only one patient (3.2%) died of mediastinitis. Thus, our technique may be safe and minimize cardiopulmonary instability. doi: 10.1111/jocs.12767 (J Card Surg 2016;31:464-466). PMID:27277820

  19. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    SciTech Connect

    Doenmez, Halil Mavili, Ertugrul Ikizceli, Tuerkan; Durak, Ahmet Candan; Kurtsoy, Ali

    2009-07-15

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  20. rhBMP-2 protects against reoperation for pseudoarthrosis and/or instrumentation failure: A matched case-control study of 448 patients.

    PubMed

    Macki, Mohamed; Syeda, Sbaa; Kerezoudis, Panagiotis; Bydon, Ali; Witham, Timothy F; Sciubba, Daniel M; Wolinsky, Jean-Paul; Bydon, Mohamad; Gokaslan, Ziya

    2016-10-01

    The objective of this independent study is to determine the impact of recombinant human bone morphogenetic protein 2 (rhBMP-2) on reoperation for pseudarthrosis and/or instrumentation failure. A nested case-control study of first-time posterolateral, instrumented fusion of the lumbar spine for degenerative spinal disease was undertaken. Cases of reoperation for pseudoarthrosis and/or instrumentation failure were assigned to controls, who did not experience the primary outcome measure at the time of reoperation. Cases and controls were matched on number of interspaces fused and inclusion of interbody. Predictors of reoperation for pseudoarthrosis and/or instrumentation failure were assessed with a conditional logistical regression controlling for rhBMP-2, age, obesity, and smoking. Of the 448 patients, 155 cases of reoperation for pseudoarthrosis and/or instrumentation were matched with 293 controls. Twenty-six percent of first-time surgeries included rhBMP-2, which was statistically more commonly used in the control cohort (33.11%) versus the case cohort (12.90%) (Unadjusted odds ratio [ORunadj]=0.28) (95% confidence interval [CI]: 0.16-0.49). Following a multivariate analysis controlling for age, obesity, and smoking, the rhBMP-2 recipients incurred a 73% lower odds of reoperation for pseudoarthrosis and/or instrumentation failure (95% CI, 0.15-0.48). Neither sarcomatous nor osseous neoplasm was detected in the study population. Mean follow up did not differ between the cases (81.57±standard deviation [SD] 4.98months) versus controls (74.75±2.49month) (ORunadj=1.01) (95% CI: 1.00-1.01). rhBMP-2 in lumbar fusion constructs protects against reoperation for pseudoarthrosis and/or instrumentation failure. However, the decision to include fusion supplements should be weighted between surgical determinants and clinical outcomes. PMID:27396376

  1. Deep sternal wound infection after cardiac surgery: Evidences and controversies

    PubMed Central

    Cotogni, Paolo; Barbero, Cristina; Rinaldi, Mauro

    2015-01-01

    Despite many advances in prevention and perioperative care, deep sternal wound infection (DSWI) remains a pressing concern in cardiac surgery, with a still relevant incidence and with a considerable impact on in-hospital mortality and also on mid- and long-term survival. The permanent high impact of this complication is partially related to the increasing proportion of patients at high-risk for infection, as well as to the many patient and surgical risk factors involved in the pathogenesis of DSWI. The prophylactic antibiotic therapy is one of the most important tools in the prevention of DSWI. However, the choice of antibiotic, the dose, the duration, the adequate levels in serum and tissue, and the timing of antimicrobial prophylaxis are still controversial. The treatment of DSWI ranges from surgical revision with primary closure to surgical revision with open dressings or closed irrigation, from reconstruction with soft tissue flaps to negative pressure wound therapy (NPWT). However, to date, there have been no accepted recommendations regarding the best management of DSWI. Emerging evidence in the literature has validated the efficacy and safety of NPWT either as a single-line therapy, or as a “bridge” prior to final surgical closure. In conclusion, the careful control of patient and surgical risk factors - when possible, the proper antimicrobial prophylaxis, and the choice of validated techniques of treatment could contribute to keep DSWIs at a minimal rate. PMID:26557476

  2. Deep sternal wound infection after cardiac surgery: Evidences and controversies.

    PubMed

    Cotogni, Paolo; Barbero, Cristina; Rinaldi, Mauro

    2015-11-01

    Despite many advances in prevention and perioperative care, deep sternal wound infection (DSWI) remains a pressing concern in cardiac surgery, with a still relevant incidence and with a considerable impact on in-hospital mortality and also on mid- and long-term survival. The permanent high impact of this complication is partially related to the increasing proportion of patients at high-risk for infection, as well as to the many patient and surgical risk factors involved in the pathogenesis of DSWI. The prophylactic antibiotic therapy is one of the most important tools in the prevention of DSWI. However, the choice of antibiotic, the dose, the duration, the adequate levels in serum and tissue, and the timing of antimicrobial prophylaxis are still controversial. The treatment of DSWI ranges from surgical revision with primary closure to surgical revision with open dressings or closed irrigation, from reconstruction with soft tissue flaps to negative pressure wound therapy (NPWT). However, to date, there have been no accepted recommendations regarding the best management of DSWI. Emerging evidence in the literature has validated the efficacy and safety of NPWT either as a single-line therapy, or as a "bridge" prior to final surgical closure. In conclusion, the careful control of patient and surgical risk factors - when possible, the proper antimicrobial prophylaxis, and the choice of validated techniques of treatment could contribute to keep DSWIs at a minimal rate. PMID:26557476

  3. Delayed primary closure of deep sternal wound infections.

    PubMed Central

    Zacharias, A; Habib, R H

    1996-01-01

    Deep infections of the sternum and mediastinum, with prevalence of osteomyelitis and tissue necrosis, were documented in 38 of 8,056 patients (0.47%) who underwent open-heart surgery (1975 through 1994) in our service. The incidences of insulin-dependent diabetes, obesity, and emergency surgery in these patients were relatively high at 39%, 47%, and 18%, respectively. Treatment with antibiotics, débridement, open packing, and delayed closure was administered to 33 patients (87%), with 100% healing. There were no deaths in this group. Flap reconstruction was indicated in 5 gravely ill patients (13%) in whom excessively large wound defects did not allow reapproximation. There were 2 deaths in this group, and 4 reoperations were necessary in the surviving patients because of sequelae arising from flap reconstruction. The overall mortality was 5.3% and the median period of hospitalization was 29 days. The length of stay decreased substantially over the period of this study (median = 21 days, year > or = 1987). Accordingly, we believe that treatment of deep sternal infections with delayed primary closure is safe and effective. Also, given the increased potential for complications and long-term sequelae, we believe that flap reconstruction should be used selectively and should be limited to patients with large defects, uncontrolled mediastinal bleeding, or both. PMID:8885104

  4. Ibuprofen-induced aseptic meningoencephalitis confirmed by drug challenge.

    PubMed

    Moreno-Ancillo, A; Gil-Adrados, A C; Jurado-Palomo, J

    2011-01-01

    Drug-induced aseptic meningitis (DIAM) is a diagnostic challenge. The major causative agents are nonsteroidal anti-inflammatory drugs (particularly ibuprofen), antibiotics, intravenous immunoglobulin, and OKT3 monoclonal antibodies. DIAM is more frequently observed in patients with autoimmune diseases. A 36-year-old woman was attended in our department 3 months after being diagnosed with aseptic meningoencephalitis. She had had 2 episodes in 9 months. Neurological symptoms were associated with ibuprofen. A challenge with acetylsalicylic acid was negative, whereas a drug challenge with ibuprofen was positive. Thirty minutes after ingesting 50 mg of ibuprofen, she experienced general malaise and progressively developed chills, fever (39.5 degrees C), headache, and nuchal rigidity. Lumbar puncture showed normal glucose and high protein levels. Neutrophilic pleocytosis was observed at the first admission; lymphocytosis was predominant in the second and third episodes. DIAM is a rare and severe hypersensitivity reaction. Drug challenge enabled us to make an accurate diagnosis. PMID:21995183

  5. An alternative approach to prescribing sternal precautions after median sternotomy, "Keep Your Move in the Tube".

    PubMed

    Adams, Jenny; Lotshaw, Ana; Exum, Emelia; Campbell, Mark; Spranger, Cathy B; Beveridge, Jim; Baker, Shawn; McCray, Stephanie; Bilbrey, Tim; Shock, Tiffany; Lawrence, Anne; Hamman, Baron L; Schussler, Jeffrey M

    2016-01-01

    Traditional sternal precautions, given to sternotomy patients as part of their discharge education, are intended to help prevent sternal wound complications. They vary widely but generally include arbitrary load and time restrictions (lifting no more than a specified weight for up to 12 weeks) and may prohibit common shoulder joint and shoulder girdle movements. Having observed the negative effects of restrictive sternal precautions for many years, our research team performed a series of studies that measured the forces exerted during various common activities and their relationship to the sternum. The results, though informative, led us to realize that the goal of identifying "the" appropriate load restriction to prescribe for sternotomy patients was futile. The alternative approach that we introduce applies standard kinesiological principles and teaches patients how to perform load-bearing movements in a way that avoids excessive stress to the sternum. PMID:26722187

  6. Feedback to the field: an assessment of sternal intraosseous (IO) infusion.

    PubMed

    Harcke, H Theodore; Crawley, Geoffrey; Mazuchowski, Edward

    2011-01-01

    Intraosseous vascular infusion (IO) is a recognized alternative to peripheral intravenous infusion when access is inadequate. The sternum and proximal tibia are the preferred sites. A review of 98 cases at autopsy revealed successful sternal IO placement in 78 cases (80%). Assuming a worst case scenario for placement (pin mark and no tip in bone [17 cases] and tip present and not in the sternum [3 cases]), attempts were unsuccessful in 20 cases (20%). We draw no specific conclusions regarding sternal IO use, but hope that personnel placing these devices and those providing medical training can use the information. PMID:21455906

  7. Coronary artery bypass surgery in diabetic patients – risk factors for sternal wound infections

    PubMed Central

    Lenz, Kristina; Brandt, Michael; Fraund-Cremer, Sandra; Cremer, Jochen

    2016-01-01

    The incidence of sternal wound infections (SWI) after coronary artery bypass surgery (CABG) as reported worldwide is low. However, it is associated with significant increase of postoperative mortality and treatment costs. The major risk factors discussed are diabetes mellitus and bilateral IMA harvesting of the internal mammary artery. This study analyses data of 590 patients receiving CABG concerning the risk factors for SWI. Sternal wound infections occur significantly more often in diabetic patients, one crucial and significant additional risk factor is obesity. PMID:27547690

  8. Combined use of Ilizarov external fixation and Papineau technique for septic pseudoarthrosis of the distal tibia in a patient with diabetes mellitus

    PubMed Central

    Koutsostathis, Stefanos D.; Lepetsos, Panagiotis; Polyzois, Vasilios D.; Pneumaticos, Spyros G.; Macheras, George A.

    2014-01-01

    The surgical treatment of open pilon fractures has a high complication rate especially in diabetic patients. In this article, we present a case of an infected tibial non-union after an open reduction and internal fixation in a diabetic patient, treated with Ilizarov external fixation combined with Papineau technique. Combined use of external fixation and Papineau technique can provide an alternative option for the treatment of septic pseudoarthrosis of the distal tibia. PMID:24563728

  9. Combined use of Ilizarov external fixation and Papineau technique for septic pseudoarthrosis of the distal tibia in a patient with diabetes mellitus.

    PubMed

    Koutsostathis, Stefanos D; Lepetsos, Panagiotis; Polyzois, Vasilios D; Pneumaticos, Spyros G; Macheras, George A

    2014-01-01

    The surgical treatment of open pilon fractures has a high complication rate especially in diabetic patients. In this article, we present a case of an infected tibial non-union after an open reduction and internal fixation in a diabetic patient, treated with Ilizarov external fixation combined with Papineau technique. Combined use of external fixation and Papineau technique can provide an alternative option for the treatment of septic pseudoarthrosis of the distal tibia. PMID:24563728

  10. Implementing evidence-based practice findings to decrease postoperative sternal wound infections following open heart surgery.

    PubMed

    Haycock, Camille; Laser, Craig; Keuth, Jennifer; Montefour, Kerry; Wilson, Melissa; Austin, Kerry; Coulen, Charmaine; Boyle, Deborah

    2005-01-01

    Sternal wound infections following open heart surgery are an infrequent occurrence but can have significant impact on patient morbidity, length of stay, and cost of care. The objective of this project initiative was to decrease the incidence of sternal wound infections by examining and changing current practice in the preoperative and postoperative management of patients undergoing open heart surgery. Following a literature review of interdisciplinary best practices, process teams were formed to evaluate our own patient cohort with documented infection. Five key areas were addressed: (1) preoperative skin preparation, (2) antibiotic prophylaxis, (3) blood glucose control, (4) wound care management, and (5) hand hygiene. A retrospective chart review of patients with documented sternal wound infections status post-mediastinal open heart surgery revealed that the average postoperative glucose was 201 mg/dL. An inquiry of practice variations determined the absence of a common provider and causative organism. A change model guided project initiatives and sustainability of new behaviors and practice. Each element of the project initiative had defined outcome measures. Staff nurses participated in peer education and outcome data collection. Following the implementation of evidence based practice changes, a linear decrease in sternal wound infections was documented. Nurses play a critical role in identifying, orchestrating, and evaluating change efforts in clinical practice. Outcomes are enhanced when nurses collaborate with all stakeholders in the practice improvement initiative. PMID:16141774

  11. Trail Following Activity in Extracts of Sternal Glands from Anacanthotermes turkestanicus (Isoptera: Hodotermitidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Turkestan termite Anacanthotermes turkestanicus (Isoptera: Hodotermitidae) is a harvester termite found in the Central Asian region. The workers forage before sunrise or late in the evenings. This termite, like most other termites, has a sternal gland under the 4th sternite that produces a phero...

  12. Mesenchymal Stem/Stromal Cells from Discarded Neonatal Sternal Tissue: In Vitro Characterization and Angiogenic Properties

    PubMed Central

    Wang, Shuyun; Mundada, Lakshmi; Colomb, Eric; Ohye, Richard G.; Si, Ming-Sing

    2016-01-01

    Autologous and nonautologous bone marrow mesenchymal stem/stromal cells (MSCs) are being evaluated as proangiogenic agents for ischemic and vascular disease in adults but not in children. A significant number of newborns and infants with critical congenital heart disease who undergo cardiac surgery already have or are at risk of developing conditions related to inadequate tissue perfusion. During neonatal cardiac surgery, a small amount of sternal tissue is usually discarded. Here we demonstrate that MSCs can be isolated from human neonatal sternal tissue using a nonenzymatic explant culture method. Neonatal sternal bone MSCs (sbMSCs) were clonogenic, had a surface marker expression profile that was characteristic of bone marrow MSCs, were multipotent, and expressed pluripotency-related genes at low levels. Neonatal sbMSCs also demonstrated in vitro proangiogenic properties. Sternal bone MSCs cooperated with human umbilical vein endothelial cells (HUVECs) to form 3D networks and tubes in vitro. Conditioned media from sbMSCs cultured in hypoxia also promoted HUVEC survival and migration. Given the neonatal source, ease of isolation, and proangiogenic properties, sbMSCs may have relevance to therapeutic applications. PMID:26770206

  13. [Aseptic osteonecrosis of alcoholic origin: a case report].

    PubMed

    Jissendi Tchofo, P; Brasseur, P

    2001-06-01

    Alcohol-induced aseptic osteonecrosis is not infrequent but multifocal osseous destruction is very rare. Alcoholic patients often present lipidic metabolism perturbation with fat embolism and are susceptible to develop diffuse intravascular coagulation in terminal microcirculation of femoral and humeral heads. The authors report one case of multifocal alcohol-induced osteonecrosis in a 74 year-woman. She presented with bilateral osteonecrosis of the humeral heads and total osteolysis of the neck and the head of the hips. Hepatic cirrhosis and chronic pancreatitis were additional risk factors inducing intra-osseous thrombosis. PMID:11488085

  14. [Aseptic bone flap osteonecrosis following cranioplasty after decompressive cranietomy].

    PubMed

    Smoll, Nicolas R; Stienen, Martin N; Schaller, Karl; Gautschi, Oliver P

    2013-06-19

    This case report discusses a case of aseptic osteonecrosis in a cranioplasty bone flap after decompressive craniectomy, which is a known, but rare complication after autologous cranioplasty. We suggest that the pathophysiology of cranial bone flap necrosis may have a similar pathophysiology to free flap necrosis/failure. The key suggested problem causing the osteonecrosis is vessel thrombosis within the smaller vessels of the bone flap due to the prothrombotic effects of the factors released during drilling of the bone flap. Suspicious local findings like wound dehiscence or fluid leakage should lead to a head computed tomography in order to discuss a prophylactic artificial second cranioplasty if necessary. PMID:23773942

  15. The pathobiology and pathology of aseptic implant failure.

    PubMed

    Athanasou, N A

    2016-05-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles.Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162-168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  16. Performance analysis of exam gloves used for aseptic rodent surgery.

    PubMed

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-05-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  17. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-01-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  18. The pathobiology and pathology of aseptic implant failure

    PubMed Central

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  19. Surgical Fixation of Sternal Fractures: Preoperative Planning and a Safe Surgical Technique Using Locked Titanium Plates and Depth Limited Drilling

    PubMed Central

    Schulz-Drost, Stefan; Oppel, Pascal; Grupp, Sina; Schmitt, Sonja; Carbon, Roman Th.; Mauerer, Andreas; Hennig, Friedrich F.; Buder, Thomas

    2015-01-01

    Different ways to stabilize a sternal fracture are described in literature. Respecting different mechanisms of trauma such as the direct impact to the anterior chest wall or the flexion-compression injury of the trunk, there is a need to retain each sternal fragment in the correct position while neutralizing shearing forces to the sternum. Anterior sternal plating provides the best stability and is therefore increasingly used in most cases. However, many surgeons are reluctant to perform sternal osteosynthesis due to possible complications such as difficulties in preoperative planning, severe injuries to mediastinal organs, or failure of the performed method. This manuscript describes one possible safe way to stabilize different types of sternal fractures in a step by step guidance for anterior sternal plating using low profile locking titanium plates. Before surgical treatment, a detailed survey of the patient and a three dimensional reconstructed computed tomography is taken out to get detailed information of the fracture’s morphology. The surgical approach is usually a midline incision. Its position can be described by measuring the distance from upper sternal edge to the fracture and its length can be approximated by the summation of 60 mm for the basis incision, the thickness of presternal soft tissue and the greatest distance between the fragments in case of multiple fractures. Performing subperiosteal dissection along the sternum while reducing the fracture, using depth limited drilling, and fixing the plates prevents injuries to mediastinal organs and vessels. Transverse fractures and oblique fractures at the corpus sterni are plated longitudinally, whereas oblique fractures of manubrium, sternocostal separation and any longitudinally fracture needs to be stabilized by a transverse plate from rib to sternum to rib. Usually the high convenience of a patient is seen during follow up as well as a precise reconstruction of the sternal morphology. PMID

  20. Staphylococcus aureus and repeat bacteremia in febrile patients as early signs of sternal wound infection after cardiac surgery

    PubMed Central

    2014-01-01

    Background Sternal wound infection is a devastating complication of cardiothoracic surgery that carries high postoperative morbidity and mortality rates. We explored whether our current program of extensive bacteriological examination including repeat blood cultures may contribute to the early diagnosis of sternal wound infection. Methods We retrospectively analyzed 112 patients who were subjected to our bacteriological examination protocol including within 90 days after cardiothoracic surgery. Univariate and multivariate analyses were made in order to identify risk factors for sternal infection. Results The median patient age was 75 years, and 65 patients were male. In 35 cases (31.2%) the blood cultures showed the presence of bacterial infection with the following frequencies: Staphylococcus aureus, 18 cases; Coagulase-negative Staphylococcus, 7 cases; other organisms, 10 cases. Eleven patients presented repeat bacteremia on at least 2 different occasions. Twenty patients (17.8%) presented sternal wound infections. There was no difference in operative mortality between the patients with and without sternal wound infection. Univariate and multivariate analyses demonstrated that bilateral mammary artery use (OR, 13.68, 95% CI, 1.09-167.36, p = 0.043), positive blood culture for Staphylococcus aureus (OR, 19.51, 95% CI, 4.46-104.33, p < 0.0001), repeat bacteremia (OR, 17.98, 95% CI, 2.51-161.77, p = 0.004) were risk factors that were associated for sternal wound infection. Conclusion Repeat blood cultures in febrile patients appear to be useful for the early detection of Staphylococcus aureus and repeat bacteremia, and these were associated with sternal wound infection. Bilateral internal mammary artery use was another risk factor of sternal wound infection in febrile patients. These factors may identify patients suitable for expeditious radiological examination and aggressive treatments. PMID:24885820

  1. Doxycycline inhibits bone resorption by human interface membrane cells from aseptically loose hip replacements.

    PubMed

    Ong, S M; Taylor, G J S

    2003-04-01

    Matrix metalloproteinases (MMPs) may have a role in the process of aseptic loosening. Doxycycline has been shown to inhibit MMPs. Our aim was to investigate the potential pharmacological effect of doxycycline on aseptic loosening. We used radiolabelled mouse calvariae cultured with human interface membrane cells from aseptically loosened hips. Bone resorption was confirmed in this model. The effect of doxycycline was assessed by culturing dead radiolabelled bone discs with cells from the interface membrane with doxycycline. The control group consisted of the same culture system without doxycycline. Supernatant 45calcium and the total 45calcium remaining in the bone discs at the completion of the culture were used to measure osteolysis. We found that doxycycline can inhibit osteolysis at the interface membrane of aseptically loosened hips. This may have therapeutic implications for the treatment of patients with aseptic loosening of total joint replacements. PMID:12729128

  2. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  3. A pituitary abscess masquerading as recurrent hypernatremia and aseptic meningitis.

    PubMed

    Gonzales, Michael; Marik, Paul Ellis; Khardori, Romesh K; O'Brian, John T

    2012-01-01

    Pituitary abscess is a rare condition. In the setting of multiple surgical interventions, the risk of its development increases. A 49-year-old man presented with episodes of altered mental status. He had two surgeries for a recurrent suprasellar arachnoid cyst. The second surgery was complicated by a persistent cerebrospinal fluid (CSF) leak that required two repairs following which he developed panhypopituitarism and central diabetes insipidus. Twelve months after his last surgery he was diagnosed with aseptic meningitis. This was followed by recurrent hospitalisations for severe hypernatremia blamed on poor medication compliance. He was subsequently hospitalised for the evaluation of a febrile illness. Brain MRI showed ventriculitis and enhancement of the sella. Exploratory surgery revealed a purulent collection in the sella and a mucosal graft which had been used to repair the CSF leak. After drainage of pus and replacement of the graft he recovered completely but requiring life-long hormonal replacement. PMID:22751424

  4. A pituitary abscess masquerading as recurrent hypernatremia and aseptic meningitis

    PubMed Central

    Gonzales, Michael; Marik, Paul Ellis; Khardori, Romesh K; O'Brian, John T

    2012-01-01

    Pituitary abscess is a rare condition. In the setting of multiple surgical interventions, the risk of its development increases. A 49-year-old man presented with episodes of altered mental status. He had two surgeries for a recurrent suprasellar arachnoid cyst. The second surgery was complicated by a persistent cerebrospinal fluid (CSF) leak that required two repairs following which he developed panhypopituitarism and central diabetes insipidus. Twelve months after his last surgery he was diagnosed with aseptic meningitis. This was followed by recurrent hospitalisations for severe hypernatremia blamed on poor medication compliance. He was subsequently hospitalised for the evaluation of a febrile illness. Brain MRI showed ventriculitis and enhancement of the sella. Exploratory surgery revealed a purulent collection in the sella and a mucosal graft which had been used to repair the CSF leak. After drainage of pus and replacement of the graft he recovered completely but requiring life-long hormonal replacement. PMID:22751424

  5. Aseptic laboratory techniques: volume transfers with serological pipettes and micropipettors.

    PubMed

    Sanders, Erin R

    2012-01-01

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: ·Work within the sterile field created by the Bunsen burner flame. ·Use serological pipettes without compromising instrument sterility. ·Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. ·Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. ·Identify different applications for plastic versus glass serological pipettes. ·State accuracy limitations for micropipettors.

  6. A novel surgical technique for transverse sternal bone defects using flexible intramedullary nailing.

    PubMed

    Böcker, W; Euler, E; Schieker, M; Kettler, M; Mutschler, W

    2006-12-01

    Transverse sternal bone defects as a result of surgery or trauma remain an important clinical condition with serious sequelae. Patients sometimes complain of local pain during movement and breathing. Usually, defects are filled with prosthetic materials which remain permanently IN SITU. Small defects can be treated with autogenous bone grafts, whereas large defects are difficult to stabilize with common osteosynthetic techniques. Here, we report a new surgical technique using flexible intramedullary nailing ("Elastic Stable Intramedullary Nailing"--ESIN or "Embrochage Centro-Medullaire Elastique Stable"--ECMES) to stabilize a sternal defect after surgical removal of an osteochondral lesion. The defect was bridged by two elastic titanium nails and an autogenous corticocancellous bone graft. This new surgical technique showed a good clinical and functional outcome. PMID:17151979

  7. Delayed sternal closure after vacuum-assisted closure therapy for tracheo-innominate artery fistula repair.

    PubMed

    Suzuki, Ryo; Mikamo, Akihito; Kurazumi, Hiroshi; Hamano, Kimikazu

    2011-08-01

    We report a case of successful innominate artery resection with delayed sternal closure after vacuum-assisted closure (VAC) therapy for a tracheo-innominate artery fistula (TIF). A 42-year-old woman with cerebral palsy underwent tracheostomy for respiratory assistance. On postoperative day 14, she was transferred to our hospital after an episode of massive hemoptysis. TIF was diagnosed based on the findings of multidetector computed tomography. Thus, we resected the innominate artery and started VAC therapy to control the postoperative local infection. The patient recovered uneventfully, without any infectious sequelae. Our strategy, which includes VAC therapy, for TIF repair may eliminate postoperative infective problems that could induce sequential bleeding and sternal compromise. To our knowledge, this is the first report of using VAC therapy for TIF. PMID:21628318

  8. Gallium-67 scanning in the diagnosis of postoperative sternal osteomyelitis: concise communication

    SciTech Connect

    Salit, I.E.; Detsky, A.S.; Simor, A.E.; Weisel, R.D.; Feiglin, D.

    1983-11-01

    Sternal osteomyelitis is an uncommon but serious complication of the median sternotomy incision. Definite diagnosis is clinically difficult and radionuclide scanning is of uncertain value in the early postoperative period. A prospective blind study of gallium scanning was conducted in the early period after caridac surgery and clinically diagnosed cases that also had scans were reviewed. Clinical status and scan interpretation were each independently assessed by three raters. Thirty-eight scans included six true positives, five true negatives (no sternotomy) and 27 post-sternotomy, clinically uninfected patients. Using categories of high, medium and low for scan interpretation, the radiologic assessors agreed 90% of the time. Normal postoperative Ga-67 uptake could usually be differentialted from uptake by an infected sternum. The test had a sensitivity of 83% and specificity of 96%. This study of observer variation and validity indicates that Ga-67 scanning may be useful in confirming the diagnosis of poststernotomy sternal osteomyelitis.

  9. Sternal Cleft associated with Patent Ductus Arteriosus, Atrial Septal Defect, and Subglottic Hemangioma: A rarity.

    PubMed

    Sadeghian, Naser; Mirshemirani, Alireza; Sadeghian, Irandokht

    2014-01-01

    We present a 2-day-old female neonate with cleft of the upper sternum, patent ductus arteriosus (PDA), atrial septal defect (ASD), and subglottic hemangioma. Dimensional and Doppler echocardiography, abdominal ultrasonography, and imaging were performed. She underwent a surgical repair of sternal cleft in neonatal life. After 8 months, she developed respiratory distress, apnea due to subglottic hemangioma. She underwent urgent tracheostomy. Subglottic hemangioma was treated with the KTP532 laser. PMID:24834387

  10. Successful placement of an adult sternal intraosseous line through burned skin.

    PubMed

    Frascone, Ralph; Kaye, Koren; Dries, David; Solem, Lynn

    2003-01-01

    Obtaining vascular access can be difficult in the critical adult patient. This can be especially true in a severely burned patient, where the usual insertion site may be involved in the burn injury. We present a case in which a sternal intraosseous line was placed through a full-thickness injury, in a patient in full arrest, who subsequently underwent a successful cardiac resuscitation. PMID:14501399

  11. Morphology of the sternal gland in workers of Coptotermes gestroi (Isoptera, Rhinotermitidae).

    PubMed

    Costa-Leonardo, A M

    2006-01-01

    The sternal gland is considered the only source of trail pheromones in termites. The morphology of the sternal gland was investigated in workers of Coptotermes gestroi using transmission and scanning electron microscopy. The results showed a small bilobed gland at the anterior part of the fifth abdominal sternite. The cuticular surface of the sternal gland showed a V-shaped structure with two peg sensilla in elevated socket and various campaniform sensilla. Pores and cuticular scale-like protuberances also occur in the glandular area. The ultrastructure showed a gland composed of class 1 cells and two different types of class 3 cells distinguished by location, different size and electron-density of secretory vesicles. Small class 3 cells (type 1) of the anterior lobe are inserted among class 1 cells and have weakly electron-dense vesicles associated with mitochondria, glycogen and smooth endoplasmic reticulum. The class 3 cells (type 2) of posterior lobe showed many round electron-lucent vesicles of secretion, abundant free ribosomes and a well-developed Golgi apparatus. Each class 3 cell is connected to the cuticle by a cuticular duct constituted by the receiving canal and the conducting canal. The secretion of class 1 cells is stored in an inner subcuticular reservoir that is delimited by the microvilli of these cells. This inner reservoir is large and crossed by the campaniform sensilla and ducts of two types of class 3 cells that open outside of the insect body. An exterior reservoir also is present between the fourth and fifth sternite. The complex structure of the sternal gland suggests multicomponents for the trail pheromone in the worker of C. gestroi. PMID:16458523

  12. Intracardiac Abscess with Cutaneous Fistula Secondary to Ventricular Septal Defect Repair Simulating Sternal Wound Infection

    PubMed Central

    Keshavamurthy, Suresh; Sepulveda, Edgardo; Miranda, Cyndee Cruz; Okamoto, Toshihiro; Pettersson, Gosta Bengt

    2014-01-01

    Cutaneous fistula as a clinical presentation of intracardiac abscess of the right side is such an unusual occurrence that it has not until now been reported in the English-language medical literature. We present a rare case of right-sided infective endocarditis caused by Achromobacter xylosoxidans in which recurrent infection presented as sternal wound discharge. The infection was found to have an intracardiac origin and was successfully managed by radical débridement on cardiopulmonary bypass. PMID:24955054

  13. Evolution and functional significance of derived sternal ossification patterns in ornithothoracine birds.

    PubMed

    O'Connor, J K; Zheng, X-T; Sullivan, C; Chuong, C-M; Wang, X-L; Li, A; Wang, Y; Zhang, X-M; Zhou, Z-H

    2015-08-01

    The midline pattern of sternal ossification characteristic of the Cretaceous enantiornithine birds is unique among the Ornithodira, the group containing birds, nonavian dinosaurs and pterosaurs. This has been suggested to indicate that Enantiornithes is not the sister group of Ornithuromorpha, the clade that includes living birds and their close relatives, which would imply rampant convergence in many nonsternal features between enantiornithines and ornithuromorphs. However, detailed comparisons reveal greater similarity between neornithine (i.e. crown group bird) and enantiornithine modes of sternal ossification than previously recognized. Furthermore, a new subadult enantiornithine specimen demonstrates that sternal ossification followed a more typically ornithodiran pattern in basal members of the clade. This new specimen, referable to the Pengornithidae, indicates that the unique ossification pattern observed in other juvenile enantiornithines is derived within Enantiornithes. A similar but clearly distinct pattern appears to have evolved in parallel in the ornithuromorph lineage. The atypical mode of sternal ossification in some derived enantiornithines should be regarded as an autapomorphic condition rather than an indication that enantiornithines are not close relatives of ornithuromorphs. Based on what is known about molecular mechanisms for morphogenesis and the possible selective advantages, the parallel shifts to midline ossification that took place in derived enantiornithines and living neognathous birds appear to have been related to the development of a large ventral keel, which is only present in ornithuromorphs and enantiornithines. Midline ossification can serve to medially reinforce the sternum at a relatively early ontogenetic stage, which would have been especially beneficial during the protracted development of the superprecocial Cretaceous enantiornithines. PMID:26079847

  14. Platelet-rich plasma inside the sternotomy wound reduces the incidence of sternal wound infections.

    PubMed

    Serraino, Giuseppe F; Dominijanni, Andrea; Jiritano, Federica; Rossi, Michele; Cuda, Aldo; Caroleo, Santo; Brescia, Adalgisa; Renzulli, Attilio

    2015-06-01

    Despite the large choice of wide-spectrum antibiotic therapy, deep sternal wound infection (DSWI) following cardiac surgery is a life-threatening complication worldwide. This study evaluated that the use of platelet-rich plasma (PRP) applied inside the sternotomy wound would reduce the effect of sternal wound infections, both superficial and deep. Between January 2007 and January 2012, 1093 consecutive patients underwent cardiac surgery through median sternotomy. Patients were divided into two groups. Group B, the study group, included those who received the PRP applied inside the sternotomy wound before closure. Group A, the control group, included patients who received a median sternotomy but without the application of PRP. Antibiotic prophylaxis remained unchanged across the study and between the two groups. Occurrence of DSWI was significantly higher in group A than in group B [10 of 671 (1·5%) versus 1 of 422 (0·20%), P = 0·043]. Also, superficial sternal wound infections (SSWIs) were significantly higher in group A than in group B [19 of 671 (2·8%) versus 2 of 422 (0·5%), P = 0·006]. The use of PRP can significantly reduce the occurrence of DSWI and SSWI in cardiac surgery. PMID:23692143

  15. Free vascular fibular transfer in congenital pseudoarthrosis of the tibia: results of the EPOS multicenter study. European Paediatric Orthopaedic Society (EPOS).

    PubMed

    Romanus, B; Bollini, G; Dungl, P; Fixsen, J; Grill, F; Hefti, F; Ippolito, E; Tudisco, C; Wientroub, S

    2000-04-01

    This paper presents a review of the literature, describes the principal author's (B.R.) personal experience and provides the results of the European Paediatric Orthopaedic Society (EPOS) multicenter study. The objective is to evaluate the present status and future role of free vascular fibular transfer in treating congenital pseudoarthrosis of the tibia. Variables such as the selection of cases, age at operation, technical surgical details and postoperative results will be considered. The data on the EPOS study were incomplete at the time of writing, but the considerable amount of information already amassed is a valuable contribution to this updated report. PMID:10868357

  16. Comparison of Aseptic Compounding Errors Before and After Modified Laboratory and Introductory Pharmacy Practice Experiences

    PubMed Central

    Owora, Arthur H.; Kirkpatrick, Alice E.

    2015-01-01

    Objective. To determine whether aseptic compounding errors were reduced at the end of the third professional year after modifying pharmacy practice laboratories and implementing an institutional introductory pharmacy practice experience (IPPE). Design. An aseptic compounding laboratory, previously occurring during the third-year spring semester, was added to the second-year spring semester. An 80-hour institutional IPPE was also added in the summer between the second and third years. Instructors recorded aseptic compounding errors using a grading checklist for second-year and third-year student assessments. Third-year student aseptic compounding errors were assessed prior to the curricular changes and for 2 subsequent years for students on the Oklahoma City and Tulsa campuses of the University of Oklahoma. Assessment. Both third-year cohorts committed fewer aseptic technique errors than they did during their second years, and the probability was significantly lower for students on the Oklahoma City campus. The probability of committing major aseptic technique errors was significantly lower for 2 consecutive third-year cohorts after the curricular changes. Conclusion. The addition of second-year aseptic compounding laboratory experiences and third-year institutional IPPE content reduced instructor-assessed errors at the end of the third year. PMID:26889070

  17. Cross-sectional area of the abdomen predicts complication incidence in patients undergoing sternal reconstruction

    PubMed Central

    Kozlow, Jeffrey H.; Lisiecki, Jeffrey; Terjimanian, Michael N.; Rinkinen, Jacob; Brownley, Robert Cameron; Agarwal, Shailesh; Wang, Stewart C.; Levi, Benjamin

    2015-01-01

    Background Sternal reconstruction with vascularized flaps is central to the management of sternal wound infections and mediastinitis but carries a high risk of complications. There is a need to identify reliable predictors of complication risk to help inform patients and clinicians in preparation for surgery. Unfortunately, body mass index and serum albumin may not be reliable predictors of complication rates. Analytic morphomics provides a robust quantitative method to measure patients’ obesity as it pertains to their risk of complications in undergoing sternal reconstruction. Methods We identified 34 patients with preoperative computed tomography scans of the abdomen from a cohort of sternal reconstructions performed between 1997 and 2010. Using semiautomated analytic morphomics, we identified the patients’ skin and fascia layers between the ninth and 12th thoracic spine levels; from these landmarks, we calculated morphomic measurements of the patients’ abdomens, including their total body cross sectional area and the cross sectional area of their subcutaneous fat. We obtained the incidence of complications from chart review and correlated the incidence of complications (including seroma, hematoma, recurrent wounds, mediastinitis, tracheostomy, and death) with patients’ morphomic measurements. Results Sixty-two percent of patients (n = 21) suffered complications after their operation. Those who suffered from complications, relative to those who did not have complications, had increased visceral fat area (12,547.2 mm2 versus 6569.9 mm2, P = 0.0080), subcutaneous fat area (16,520.2 mm2 versus 8020.1 mm2, P = 0.0036), total body area (91,028.6 mm2 versus 67,506.5 mm2, P = 0.0022), fascia area (69,238.4 mm2 versus 56,730.9 mm2, P = 0.0118), total body circumference (1101.8 mm versus 950.2 mm, P = 0.0017), and fascia circumference (967.5 mm versus 868.1 mm, P = 0.0077). We also demonstrated a significant positive correlation between the previously mentioned

  18. A retrospective study of deep sternal wound infections: clinical and microbiological characteristics, treatment, and risk factors for complications.

    PubMed

    Chan, Monica; Yusuf, Erlangga; Giulieri, Stefano; Perrottet, Nancy; Von Segesser, Ludwig; Borens, Olivier; Trampuz, Andrej

    2016-03-01

    Deep sternal wound infection (DSWI) is a feared complication following cardiac surgery. This study describes clinical, microbiological, and treatment outcomes of DSWI and determines risk factors for complications. Of 55 patients with DSWI, 66% were male and mean age was 68.2years. Initial sternotomy was for coronary artery bypass graft in 49% of patients. Sternal debridement at mean 25.4±18.3days showed monomicrobial (94%), mainly Gram-positive infection. Secondary sternal wound infection (SSWI) occurred in 31% of patients, was mostly polymicrobial (71%), and was predominantly due to Gram-negative bacilli. Risk factors for SSWI were at least 1 revision surgery (odds ratio [OR] 4.8 [95% confidence interval {CI} 1.0-22.4], P=0.047), sternal closure by muscle flap (OR 4.6 [1.3-16.8], P=0.02), delayed sternal closure (mean 27 versus 14days, P=0.03), and use of vacuum-assisted closure device (100% versus 58%, P=0.008). Hospital stay was significantly longer in patients with SSWI (69days versus 48days, P=0.04). PMID:26707065

  19. A new cable-tie based sternal closure system: description of the device, technique of implantation and first clinical evaluation

    PubMed Central

    2012-01-01

    Background Wire closure still remains the preferred technique despite reasonable disadvantages. Associated complications, such as infection and sternal instability, cause time- and cost-consuming therapies. We present a new tool for sternal closure with its first clinical experience and results. Methods The sternal ZipFixTM System is based on the cable-tie principle. It primarily consists of biocompatible Poly-Ether-Ether-Ketone implants and is predominantly used peristernally through the intercostal space. The system provides a large implant-to-bone contact for better force distribution and for avoiding bone cut through. Results 50 patients were closed with the ZipFixTM system. No sternal instability was observed at 30 days. Two patients developed a mediastinitis that necessitated the removal of the device; however, the ZipFixTM were intact and the sternum remained stable. Conclusions In our initial evaluation, the short-term results have shown that the sternal ZipFixTM can be used safely and effectively. It is fast, easy to use and serves as a potential alternative for traditional wire closure. PMID:22731778

  20. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... for the Agency's current good manufacturing practice regulations for PET drugs. DATES: Although you... answers written specifically to help manufacturers comply with the Agency's current good manufacturing... media fill is the performance of an aseptic manufacturing procedure using a sterile...

  1. An alternative approach to prescribing sternal precautions after median sternotomy, “Keep Your Move in the Tube”

    PubMed Central

    Lotshaw, Ana; Exum, Emelia; Campbell, Mark; Spranger, Cathy B.; Beveridge, Jim; Baker, Shawn; McCray, Stephanie; Bilbrey, Tim; Shock, Tiffany; Lawrence, Anne; Hamman, Baron L.; Schussler, Jeffrey M.

    2016-01-01

    Traditional sternal precautions, given to sternotomy patients as part of their discharge education, are intended to help prevent sternal wound complications. They vary widely but generally include arbitrary load and time restrictions (lifting no more than a specified weight for up to 12 weeks) and may prohibit common shoulder joint and shoulder girdle movements. Having observed the negative effects of restrictive sternal precautions for many years, our research team performed a series of studies that measured the forces exerted during various common activities and their relationship to the sternum. The results, though informative, led us to realize that the goal of identifying “the” appropriate load restriction to prescribe for sternotomy patients was futile. The alternative approach that we introduce applies standard kinesiological principles and teaches patients how to perform load-bearing movements in a way that avoids excessive stress to the sternum. PMID:26722187

  2. Total hip arthroplasty for failed aseptic Austin Moore prosthesis

    PubMed Central

    Bhosale, Pradeep; Suryawanshi, Ashish; Mittal, Amber

    2012-01-01

    Background: Though Austin Moore (AM) replacement prosthesis has fairly good short term results for intracapsular femoral neck fractures in the elderly, it still is a compromised option and has a high failure rate in the long run. The objective of the present retrospective study is to analyze the functional outcome, assess survivorship of revision total hip arthroplasty (THA) at mid to long term followup, and evaluate intraoperative difficulties faced during conversion of failed aseptic AM prosthesis to cemented THA. Materials and Methods: Eighty-nine cemented THA surgeries for failed AM prosthesis were performed between 1986 and 2005. AM failures were classified into seven groups on the basis of mode of failure. Infected failures were excluded from the study. There were 35 men and 54 women in the study group. The mean age was 68 years (range 57–91 years). Mean followup was 8 years (range 5–13 years). Results: Average Harris Hip Score improved from 65 preoperatively (range 42–73) to 87 (range 76–90) at 1 year postoperatively and to 86 (range 75–89) at the last followup. The overall complication rate was 4.5%. Conclusion: Conversion THA is an excellent treatment strategy for symptomatic failed AM hemiarthroplasty in terms of pain relief and restoration of function and mobility as near as possible to the preinjury level. Also, hemiarthroplasty should not be used in physically active patients, even in elderly individuals. Careful patient selection for hemiarthroplasty versus THA is vital and may decrease the incidence of complications and ameliorate the outcomes in the treatment of intracapsular femoral neck fractures. PMID:22719116

  3. Gentamicin-impregnated collagen sponge for preventing sternal wound infection after cardiac surgery

    PubMed Central

    Targońska, Sylwia; Stążka, Janusz; Kozioł-Montewka, Maria

    2014-01-01

    The frequency of sternal wound infection (SWI) after cardiac surgery ranges from 0.5% to 8% and is associated with significant morbidity, mortality, and treatment cost. Perioperative antibiotic prophylaxis is not sufficient to fully prevent the contamination of the surgical access site. One of the most effective methods for the prevention of wound infection seems to be the use of gentamicin-impregnated collagen sponge, which is successfully used in abdominal and orthopedic surgery. Surgically implantable topical antibiotics can reduce wound infection in cardiac patients as well, but the efficacy of SWI prevention in cardiac surgery still raises many questions. PMID:26336388

  4. Sternal and costochondral infections with gentamicin and methicillin resistant Staphylococcus aureus following thoracic surgery.

    PubMed

    Cafferkey, M T; Luke, D A; Keane, C T

    1983-01-01

    Six patients in a thoracic unit developed sternal osteomyelitis and costochondritis following median sternotomy. Five of the patients were operated on in another hospital. Gentamicin and methicillin resistant Staphylococcus aureus was isolated in pure culture in each case. The S. aureus isolate from 2 patients was of the same phage type suggesting cross-infection. Antibiotic prophylaxis administered in the perioperative period was ineffective. One patient, treated with amikacin (to which all of the strains were sensitive in vitro) and cefuroxime, died from overwhelming infection in spite of débridement and resuturing of the wound. The remaining 5 patients were cured with vancomycin therapy usually coupled with surgical intervention. PMID:6557667

  5. Ant repellent effect of the sternal gland secretion ofPolistes dominulus (Christ) andP. sulcifer (Zimmermann). (Hymenoptera: Vespidae).

    PubMed

    Dani, F R; Cannoni, S; Turillazzi, S; David Morgan, E

    1996-01-01

    The long-chain carboxylic acids identified in the sternal gland secretion ofPolistes dominulus andP. sulcifer females were tested individually on three species of ants,Crematogaster scutellaris, Formica cunicularia, andLasius sp., in order to verify if they have a repellent effect. The unsaturated acids (palmitoleic, linoleic, and oleic) act as repellents of all three ant species, while the saturated acids (lauric, myristic, palmitic, and stearic) have no effect. The mixture reproducing the secretion of the sternal glands ofP. dominulus maintained its repellency for at least four days. PMID:24226981

  6. PET-CT imaging in patients with chronic sternal wound infections prior to reconstructive surgery: A case series.

    PubMed

    Read, Charlotte; Branford, Olivier A; Verjee, Liaquat S; Wood, Simon H

    2015-08-01

    Late presenting and recurrent sternal wound infections post-sternotomy are difficult to treat, with the clinical picture not necessarily reflecting the underlying problem. As a result of our experience, we suggest that these chronic cases should be managed using a different algorithm to acute sternal wound infection. Positron emission tomography combined with computerized tomography (PET-CT) imaging may be potentially useful in enabling accurate localization of disease sites, which guides adequate debridement prior to definitive reconstruction. It may also allow for disease surveillance and monitoring of the response to antimicrobial treatment. We present three cases which support the need for pre-operative imaging using PET-CT. PMID:25986418

  7. Sternal Gland Scent-Marking Signals Sex, Age, Rank, and Group Identity in Captive Mandrills.

    PubMed

    Vaglio, Stefano; Minicozzi, Pamela; Romoli, Riccardo; Boscaro, Francesca; Pieraccini, Giuseppe; Moneti, Gloriano; Moggi-Cecchi, Jacopo

    2016-02-01

    Mandrills are one of the few Old World primates to show scent-marking. We combined ethological and chemical approaches to improve our understanding of this behavior in 3 zoo-managed groups. We observed the olfactory behavior performed by adults and adolescents (N = 39) for 775h. We investigated the volatile components of sternal scent-marks using gas chromatography-mass spectrometry and compared volatile profiles with traits of the signaler. Males marked more than females and within each sex the frequency of scent-marking was related to age and dominance status, but alpha males scent-marked most frequently and particularly in specific areas at the enclosure boundaries. We identified a total of 77 volatile components of sternal gland secretion, including compounds functioning as male sex pheromones in other mammals, in scent-marks spontaneously released on filter paper by 27 male and 18 female mandrills. We confirmed our previous findings that chemical profiles contain information including sex, male age and rank, and we also found that odor may encode information about group membership in mandrills. Our results support the hypotheses that scent-marking signals the status of the dominant male as well as playing territorial functions but also suggest that it is part of sociosexual communication. PMID:26708734

  8. Occult Infection in Aseptic Joint Loosening and the Diagnostic Role of Implant Sonication

    PubMed Central

    Kempthorne, J. T.; Ailabouni, R.; Raniga, S.; Hammer, D.; Hooper, G.

    2015-01-01

    Our aim was to determine the incidence of occult infection and to examine the role of ultrasound sonication of the implants in cases of presumed aseptic loosening in a prospective trial. Joint swabs, aspirates, and deep tissue samples were obtained from around the prosthesis for routine microbiology. Each prosthesis was sonicated and the sonicate examined with Gram staining and extended cultures. There were 106 joints in the study of which 54 were revised for aseptic loosening and 52 were assigned to the control revision group. There were 9 positive cultures with 8/54 positive cultures in the aseptic loosening group and 1/52 in the control revision group (p = 0.017, associated OR 47.7). We found concordant results between sonication fluid culture and conventional samples in 5/9 cultures. Preoperative inflammatory markers were not prognostic for infection. Coagulase-negative Staphylococcus was the most commonly cultured organism (7/9). Previously unrecognised infection was present in 15% of patients undergoing revision for aseptic loosening. Ultrasound sonication of the removed prosthesis was less sensitive than conventional sampling techniques. We recommend routine intraoperative sampling for patients having revision for aseptic loosening, but we do not support the routine use of ultrasound sonication for its detection. PMID:26583149

  9. The Lateral Position Improved Airway Patency in Anesthetized Patient With Burn-Induced Cervico-Mento-Sternal Scar Contracture

    PubMed Central

    Arai, Young-Chang P.; Kawanishi, Jun; Sakakima, Yoshikazu; Ohmoto, Koichi; Ito, Akihiro; Maruyama, Yuki; Ikemoto, Tatsunori

    2016-01-01

    A 78-year-old woman with burn-induced cervico-mento-sternal scar contracture was scheduled for laparoscopic cholecystectomy. During inhalational induction of sevoflurane, her airway patency deteriorated. The right lateral position and assist ventilation using a breathing bag dramatically improved her airway patency. PMID:27252906

  10. Stature estimation based on measurements of the sternal medullary cavity using multidetector computed tomography images of Japanese cadavers.

    PubMed

    Torimitsu, Suguru; Makino, Yohsuke; Saitoh, Hisako; Sakuma, Ayaka; Ishii, Namiko; Hayakawa, Mutsumi; Yajima, Daisuke; Inokuchi, Go; Motomura, Ayumi; Chiba, Fumiko; Iwase, Hirotaro

    2014-09-01

    Stature estimation using a skeleton is important for the medicolegal investigation of unidentified human remains. The aims of this study were to identify a correlation between stature and measurements of the sternal medullary cavity using multidetector computed tomography (MDCT) and derive regression equations for stature estimation in the Japanese population. Measurements were conducted on 215 Japanese subjects (107 males, 108 females) who underwent postmortem computed tomography with subsequent forensic autopsy between May 2012 and January 2014. For assessment, MDCT cross-sections through the mid-point of the first costal facets were chosen. The length of a rising diagonal stroke from the bottom left to the top right of the sternal medullary cavity (RS) and the length of a falling diagonal stroke from top left to bottom right of the sternal medullary cavity (FS) were measured. Statistical analyses indicated that both RS and FS were positively correlated with stature regardless of sex. The correlations were stronger for males than for females. The correlation coefficients for RS were higher than those for FS, and standard errors of estimation calculated by regression analysis using RS were lower than those using FS regardless of sex. Measurement of the sternal medullary cavity using MDCT images may be a potentially useful tool for stature estimation, particularly in cases where better predictors such as long bones are not available. PMID:25082372

  11. Prophylactic sternal plating with pectoralis advancement flaps after sternotomy in patients with a history of chest irradiation.

    PubMed

    Neaman, Keith C; Blount, Andrew L; Kim, John A; Renucci, John D; Hooker, Robert L

    2011-03-01

    Deep sternal infections secondary to bony instability and malunion, can result in mediastinitis. Previous authors have described the use of prophylactic rigid plate fixation in high-risk patients. The purpose of our study is to review the use of prophylactic sternal platting with pectoralis advancement flaps in high-risk patients with a history of chest irradiation. Fourteen patients (July 2003-September 2008) with a history of chest irradiation who underwent a median sternotomy followed by prophylactic rigid plate fixation of the sternum were reviewed. Breast cancer was the most common etiology of chest irradiation (n=11, 78%). The average EuroSCORE was 24.06% with 72% of patients having a preoperative New York Heart Association (NYHA) class≥III. There were no episodes of sternal non-union, mediastinitis or death. Follow-up was 100% with a 0% 30-day and a 7.1% one-year mortality rate (non-cardiac). A comparison between mean preoperative left ventricular ejection fraction (LVEF) (49.6%) and postoperative LVEF (59.7%) was statistically significant (P<0.0001). All living patients currently maintain a NYHA class I/II. Prophylactic rigid plate fixation and pectoralis flap coverage decreases the risk of developing sternal dehiscence and postoperative wound complications and should therefore be considered in high-risk patients with a history of chest irradiation. PMID:21138917

  12. Gordonia bronchialis sternal wound infection in 3 patients following open heart surgery: intraoperative transmission from a healthcare worker.

    PubMed

    Wright, Shaneka N; Gerry, Joanna S; Busowski, Mary T; Klochko, Alena Y; McNulty, Steven G; Brown, Scott A; Sieger, Barry E; Ken Michaels, P; Wallace, Mark R

    2012-12-01

    We describe an investigation of 3 postoperative Gordonia bronchialis sternal infections. A nurse anesthetist was identified as the source of the outbreak, her scrubs likely becoming contaminated by her home washing machine. The outbreak ended after disposal of the implicated washing machine. Domestic laundering of surgical scrubs may need reevaluation. PMID:23143362

  13. District nurses' and aseptic technique: where did it all go wrong?

    PubMed

    Unsworth, John

    2011-01-01

    Concerns have been raised about whether it is possible to perform aseptic procedures within a community setting. Hallett (2000) has described how community nurses often have a fatalistic view about whether such procedures can really be performed at home. At the same time there has been an increase in the number of patients being cared for at home who need interventions which must adhere to the principles of asepsis. While it has been acknowledged for some time that community nurses must be resourceful and adapt the procedure, the view that community nurses cannot really perform aseptic procedures is a fairly new phenomenon. This article explores the reasons why concerns about the performance of aseptic procedures in the community may have arisen and what steps can be taken to address these concerns to ensure that care at home is both safe and effective. PMID:21278647

  14. Novel technique for avoidance of pressure competition between a negative pressure wound therapy device and chest drains in the management of deep sternal wound infections.

    PubMed

    Davis, James S; Kourliouros, Antonios; Deshpande, Ranjit; Cavale, Naveen

    2015-02-01

    In recent years, the use of negative pressure wound therapy (NPWT) devices has changed the way sternal wound infections are being managed. It is not uncommon for deep sternal wound infections to occur together with mediastinal or even pleural collections requiring underwater seal drainage. In these patients in whom there is a communication between the pleural and mediastinal cavities, the concomitant use of an NPWT device negates the pressure gradient within the pleural and mediastinal drains, allowing suppurative fluid to stagnate. We present a novel technique to address this limitation of NPWT devices in patients with sternal wound infections that communicate with a pleural collection. PMID:25415315

  15. Prevention of sternal wound complications after sternotomy: results of a large prospective randomized multicentre trial†

    PubMed Central

    Gorlitzer, Michael; Wagner, Florian; Pfeiffer, Steffen; Folkmann, Sandra; Meinhart, Johann; Fischlein, Theodor; Reichenspurner, Hermann; Grabenwoeger, Martin

    2013-01-01

    OBJECTIVES A prospective randomized multicentre trial was performed to analyse the efficacy of a vest (Posthorax support vest®) to prevent sternal wound infection after cardiac surgery, and to identify risk factors. METHODS From September 2007 to March 2010, 2539 patients undergoing cardiac surgery via median sternotomy were prospectively randomized into those who received a Posthorax® vest and those who did not. Patients were instructed to wear the vest postoperatively for 24 h a day for at least 6 weeks; the duration of follow-up was 90 days. Patients who did not use the vest within a period of 72 h postoperatively were regarded as study dropouts. Statistical calculations were based on an intention-to-treat (ITT) analysis. Further evaluations comprised all subgroups of patients. RESULTS Complete data were available for 2539 patients (age 67 ± 11years, 45% female). Of these, 1351 were randomized to receive a vest, while 1188 received no vest. No significant differences were observed between groups regarding age, gender, diabetes, body mass index, chronic obstructive pulmonary disease (COPD), renal failure, the logistic EuroSCORE and the indication for surgery. The frequency of deep wound complications (dWC: mediastinitis and sternal dehiscence) was significantly lower in vest (n = 14; 1.04%) vs non-vest (n = 27; 2.27%) patients (ITT, P < 0.01), but superficial complications did not differ between groups. Subanalysis of vest patients revealed that only 933 (Group A) wore the vest according to the protocol, while 202 (Group BR) refused to wear the vest (non-compliance) and 216 (Group BN) did not use the vest for other reasons. All dWC occurred in Groups BR (n = 7) and BN (n = 7), although these groups had the same preoperative risk profile as Group A. Postoperatively, Group BN had a prolonged intubation time, a longer stay in the intensive care unit, greater use of intra-aortic balloon pump, higher frequency of COPD and a larger percentage of patients who

  16. Negative-pressure wound therapy and laparoscopic omentoplasty for deep sternal wound infections after median sternotomy.

    PubMed

    De Brabandere, Kristof; Jacobs-Tulleneers-Thevissen, Daniel; Czapla, Jens; La Meir, Mark; Delvaux, Georges; Wellens, Francis

    2012-01-01

    Deep sternal wound infection remains one of the most serious complications in patients who undergo median sternotomy for coronary artery bypass surgery.We describe our experience in treating 6 consecutive patients with our treatment protocol that combines aggressive débridement, broad-spectrum antibiotics, negative-pressure wound therapy, omentoplasty with laparoscopically harvested omentum, and the use of bilateral pectoral muscle advancement flaps.The number of débridements needed in order to attain clinically clean wounds and negative cultures varied between 1 and 10, with a median of 5. The length of stay after omentoplasty and bilateral pectoral muscle advancement flap placement varied between 11 and 22 days. One of the 6 patients developed a small wound dehiscence that was treated conservatively. No bleeding related to vacuum-assisted closure therapy was identified. Three patients had pneumonia. Two of the 3 patients had an episode of acute renal failure. The 30-day mortality rate was zero, although 1 patient died in the hospital 43 days after the reconstructive surgery, of multiple-organ failure due to pneumonia that was induced by end-stage pulmonary fibrosis. No patient died between hospital discharge and the most recent follow-up date (4-12 mo). Late local follow-up results, both functional and aesthetic, were good.We conclude that negative-pressure wound therapy-in combination with omentoplasty using laparoscopically harvested omentum and with the use of bilateral pectoral advancement flaps-is a valuable technique in the treatment of deep sternal wound infection because it produces good functional and aesthetic results. PMID:22719146

  17. Negative-Pressure Wound Therapy and Laparoscopic Omentoplasty for Deep Sternal Wound Infections after Median Sternotomy

    PubMed Central

    De Brabandere, Kristof; Jacobs-Tulleneers-Thevissen, Daniel; Czapla, Jens; La Meir, Mark; Delvaux, Georges; Wellens, Francis

    2012-01-01

    Deep sternal wound infection remains one of the most serious complications in patients who undergo median sternotomy for coronary artery bypass surgery. We describe our experience in treating 6 consecutive patients with our treatment protocol that combines aggressive débridement, broad-spectrum antibiotics, negative-pressure wound therapy, omentoplasty with laparoscopically harvested omentum, and the use of bilateral pectoral muscle advancement flaps. The number of débridements needed in order to attain clinically clean wounds and negative cultures varied between 1 and 10, with a median of 5. The length of stay after omentoplasty and bilateral pectoral muscle advancement flap placement varied between 11 and 22 days. One of the 6 patients developed a small wound dehiscence that was treated conservatively. No bleeding related to vacuum-assisted closure therapy was identified. Three patients had pneumonia. Two of the 3 patients had an episode of acute renal failure. The 30-day mortality rate was zero, although 1 patient died in the hospital 43 days after the reconstructive surgery, of multiple-organ failure due to pneumonia that was induced by end-stage pulmonary fibrosis. No patient died between hospital discharge and the most recent follow-up date (4–12 mo). Late local follow-up results, both functional and aesthetic, were good. We conclude that negative-pressure wound therapy—in combination with omentoplasty using laparoscopically harvested omentum and with the use of bilateral pectoral advancement flaps—is a valuable technique in the treatment of deep sternal wound infection because it produces good functional and aesthetic results. PMID:22719146

  18. Feasibility of raw glycerol conversion into single cell oil by zygomycetes under non-aseptic conditions.

    PubMed

    Moustogianni, Anna; Bellou, Stamatia; Triantaphyllidou, Irene-Eva; Aggelis, George

    2015-04-01

    The use of plant oils as feedstock for the biodiesel manufacture has many drawbacks, thus, the interest has turned to single cell oil (SCO) as an alternative. However, the production of SCO is still too expensive, mainly due to the low oil productivity and the high cost of medium sterilization required. In this work raw glycerol was converted into SCO by oleaginous Zygomycetes under non-aseptic conditions on selective (i.e., containing essential oils and/or antibiotics) nitrogen limited media. The obtained data showed that although bacterial populations inhibited the fungal growth, lipid accumulation remained unaffected by the presence of bacteria in the growth medium compared to control experiments (conducted under aseptic conditions). Therefore, a two-stage process was developed in which growth was performed under aseptic conditions (1st stage) followed by lipid accumulation performed under non-aseptic conditions (2nd stage) in the presence of thyme essential oil as an antibacterial agent. Large amounts of lipids were accumulated inside the mycelia, yielding around 13% wt/wt of oil per glycerol consumed. PMID:25335774

  19. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-11

    ... the Agency's current good manufacturing practice regulations for PET drugs. DATES: Submit either... good manufacturing practices for PET drugs (21 CFR part 212) regarding media fills. A draft guidance of..., such as bacterial endotoxins. The media fill is the performance of an aseptic manufacturing...

  20. Continuous flow microwave-assisted processing and aseptic packaging of purple-fleshed sweetpotato purees

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pumpable purees from purple-flesh sweetpotatoes (PFSP) were subjected to microwave heating using a 915 MHz continuous flow system, followed by aseptic packaging in flexible containers to obtain a shelf-stable product. Initial test runs were conducted using a 5 kW microwave unit to measure dielectr...

  1. 99mTc-MDP bone SPECT for the evaluation of sternal ischaemia following internal mammary artery dissection.

    PubMed

    Lorberboym, M; Medalion, B; Bder, O; Lockman, J; Cohen, N; Schachner, A; Cohen, A J

    2002-01-01

    Coronary artery bypass grafting (CABG) is one of the most frequently performed operations in the United States. The use of internal mammary artery (IMA) grafting has been identified as increasing the risk of sternal wound infections and mediastinitis. The purpose of our study was to prospectively evaluate the effect of different techniques of left internal mammary artery (LIMA) harvesting on sternal vascularity. Thirty-three patients undergoing primary coronary artery bypass grafting were studied. The patients were divided into groups that received a skeletonized IMA (group I, n=11), a pedicled IMA (group II, n=12), or a semiskeletonized IMA (group III, n=10) graft. Each patient underwent a preoperative 99mTc-methylene diphosphonate bone scan using single photon emission computed tomography (SPECT). The ratio of the mean counts/pixel for each side of the sternum was obtained. Post-operatively, all patients had a repeat bone SPECT. Ratios of unilateral sternal uptakes were compared to the preoperative study. A univariable analysis of post-operative to pre-operative ratios revealed statistically significant reduction in vascularity to the left side of the sternum post-operatively in group II compared with groups I and III (0.68 0.12 vs 0.99 0.24 and 0.93 0.09; P<0.01). There was no difference between groups I and III (P=1). Multivariable analysis revealed only the type of harvesting to be associated with post-operative reduction in left to right sternal activity ratio (P<0.02). Pairwise comparisons revealed that differences are due to pedicled type of harvesting (group II vs group I, P=0.03; II vs III, P=0.001; and I vs III, P=0.115). A pedicled IMA graft causes acute post-operative sternal ischaemia. This does not occur when the IMA is skeletonized or semiskeletonized. Hence, it may be prudent to minimize dissection during mobilization of the IMA to decrease the likelihood of post-operative sternal complications. PMID:11748437

  2. Prevention of sternal dehiscence with the Sternum External Fixation (Stern-E-Fix) corset – a randomized trial in 750 patients

    PubMed Central

    2012-01-01

    Background The main objective of this study will be to determine the effects of a new advanced sternum external fixation (Stern-E-Fix) corset on prevention of sternal instability and mediastinitis in high-risk patients. Methods This prospective, randomized study (January 2009 – June 2011) comprised 750 male patients undergoing standard median sternotomy for cardiac procedures (78% CABG). Patients were divided in two randomized groups (A, n = 380: received a Stern-E-Fix corset postoperatively for 6 weeks and B, n = 370: control group received a standard elastic thorax bandage). In both groups, risk factors for sternal dehiscence and preoperative preparations were similar. Results Wound infections occurred in n = 13 (3.42%) pts. in group A vs. n = 35 (9.46%) in group B. In group A, only 1 patient presented with sternal dehiscence vs. 22 pts. in group B. In all 22 patients, sternal rewiring followed by antibiotic therapy was needed. Mediastinitis related mortality was none in A versus two in B. Treatment failure in group B was more than five times higher than in A (p = 0.01); the mean length of stay in hospital was 12.5 ± 7.4 days (A) versus 18 ± 15.1 days (B) (p=0.002). Re-operation for sternal infection was 4 times higher in group B. Mean ventilation time was relatively longer in B (2.5 vs. 1.28 days) (p = 0.01). The mean follow-up period was 8 weeks (range 6 – 12 weeks). Conclusions We demonstrated that using an external supportive sternal corset (Stern-E-Fix) yields a significantly better and effective prevention against development of sternal dehiscence and secondary sternal infection in high-risk poststernotomy patients. PMID:22958313

  3. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  4. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    PubMed

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products. PMID:9143820

  5. Gentamicin-Impregnated Collagen Sponge: Effectiveness in Preventing Sternal Wound Infection in High-Risk Cardiac Surgery

    PubMed Central

    Rapetto, Filippo; Bruno, Vito D.; Guida, Gustavo; Marsico, Roberto; Chivasso, Pierpaolo; Zebele, Carlo

    2016-01-01

    Sternal wound infections represent one of the most frequent complications after cardiac surgery and are associated with high postoperative mortality. Several preventive methods have been introduced, and recently, gentamicin-impregnated collagen sponges (GICSs) have shown a promising effect in reducing the incidence of this type of complications. Gentamicin is an aminoglycoside antibiotic that has been widely used to treat infections caused by multiresistant bacteria; despite its effectiveness, its systemic use carries a risk of toxicity. GICSs appear to overcome this side effect, topically delivering high antibiotic concentrations to the wound and thus reducing the toxic-related events. Although several retrospective analyses and randomized controlled trials have studied the use of GICSs in cardiac surgery, conclusions regarding their efficacy in preventing sternal wound infection are inconsistent. We have reviewed the current literature focusing on high-risk patients. PMID:27279734

  6. Sternal Precautions: Is It Time for Change? Precautions versus Restrictions – A Review of Literature and Recommendations for Revision

    PubMed Central

    LaPier, Tanya Kinney; Shaw, Donald K.

    2011-01-01

    The processes that occur with normal sternal healing and potential complications related to median sternotomy are of particular interest to physical therapists. The premise of patients following sternal precautions (SP) or specific activity restrictions is the belief that avoiding certain movements will reduce risk of sternal complications. However, current research has identified that many patients remain functionally impaired long after cardiothoracic surgery. It is possible that some SP may contribute to such functional impairments. Currently, SP have several limitations including that they: (1) have no universally accepted definition, (2) are often based on anecdotal/expert opinion or at best supported by indirect evidence, (3) are mostly applied uniformly for all patients without regard to individual differences, and (4) may be overly restrictive and therefore impede ideal recovery. The purpose of this article is to present an overview of current research and commentary on median sternotomy procedures and activity restrictions. We propose that the optimal degree and duration of SP should be based on an individual patient's characteristics (eg, risk factors, comorbidities, previous activity level) that would enable physical activity to be targeted to particular limitations rather than restricting specific functional tasks and physical activity. Such patient-specific SP focusing on function may be more likely to facilitate recovery after median sternotomy and less likely to impede it. PMID:21448343

  7. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  8. Irradiated or aseptically prepared frozen dairy desserts: acceptability to bone marrow transplant recipients.

    PubMed

    Dong, F M; Hashisaka, A E; Rasco, B A; Einstein, M A; Mar, D R; Aker, S N

    1992-06-01

    Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovery immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be "market-tested" by the targeted patient population before inclusion in the menu. PMID:1607569

  9. Aseptic Endocarditis in Behçet's Disease Presenting as Tricuspid Valve Stenosis

    PubMed Central

    Lee, Hyun Sang; Choi, Won Suk; Kim, Kyun Hee; Kang, Jung Kyu; Kim, Na Young; Park, Sun Hee; Park, Youngwhi; Nam, Eon Jeong; Yang, Dong Heon; Cho, Yongkeun; Lee, Jong-Myung; Chae, Shung-Chull

    2011-01-01

    Aseptic endocarditis is an uncommon complication of Behçet's disease (BD). We describe a rare case of a 39-year-old female who had BD with aseptic endocarditis of the tricuspid valve (TV) presenting as tricuspid stenosis. She was diagnosed with BD four years ago. The mucocutaneous lesions were well-controlled with colchicine and short courses of corticosteroids. She remained free of signs and symptoms of BD for one year without any medication. Three months before admission, she gradually developed dyspnea on exertion and peripheral edema. Echocardiography revealed dilated right atrium and markedly thickened TV with severe stenosis. TV replacement was performed. Pathologic examination of the valve showed fibrinoid necrotic material and inflammatory cell infiltration. Blood cultures and cultures of the excised valve were negative for microorganisms. PMID:21860642

  10. [Aseptic osteonecrosis of the femoral head in cancer patients with neuropathies caused by vincristine and vinblastine].

    PubMed

    Meneghello, A; Presacco, D; Di Maggio, C

    1989-06-01

    Aseptic osteonecrosis has been described in many and dissimilar pathologic conditions--most frequently as the aftermath of fractures or dislocations; in falciform anemia, obesity, alcoholism; in diseases requiring constant and heavy corticosteroid therapy, and also following renal transplantation. Many of these pathologies, especially alcoholism, diabetes, uremia, and collagen vascular diseases, have a common denominator: peripheral neuropathy, which is believed to be a pathogenetic factor supporting osteonecrosis. The authors analyze 3 cases of aseptic osteonecrosis of the femoral head in cancer patients treated with vincristine and/or vinblastine. Since in these subjects severe and persistent neuropathy preceded the onset of osteonecrosis, a possible relationship is postulated between the vincristine/vinblastine treatment and the onset of femoral head osteonecrosis, through the pathogenetic mechanism of peripheral neuropathy. PMID:2756179

  11. An update review on risk factors and scales for prediction of deep sternal wound infections.

    PubMed

    Buja, Alessandra; Zampieron, Alessandra; Cavalet, Sara; Chiffi, Daniele; Sandonà, Paolo; Vinelli, Angela; Baldovin, Tatjana; Baldo, Vincenzo

    2012-08-01

    Surgical site infections are the most common nosocomial infections in surgical patients. The preventable and the unmodifiable risk factors for deep sternal wound infections (DSWI) have been amply assessed in the literature. The aim of this review was to describe the results of the numerous published studies to describe all the DSWI risk factors and the scales devised to predict SWI, with a view to providing an update on this issue. A comprehensive search of the Medline and Embase databases was performed (considering studies from January 1995 to April 2011); and a manual search was also conducted using references cited in original publications and relevant review articles. There are several risk factors associated with DSWI, which could be classified in four categories as demographic (e.g. sex and age), behavioural (e.g. smoking and obesity), baseline clinical conditions (e.g. diabetes, hypertension and COPD) and surgical operative risk factors (e.g. duration of operation and emergency operation). Six scales for predicting the risk of DSWI are described in the literature: they vary not only in accuracy but also in ease of application and they are applied at different times (some only preoperatively and others also postoperatively). This study provides a broad update on our knowledge of the risk factors for DSWI and the scales for prediction with a view to improving the management of infections at cardiosurgery units. PMID:22151350

  12. Detection of Leptospira DNA in Patients with Aseptic Meningitis by PCR

    PubMed Central

    Romero, Eliete C.; Billerbeck, Ana E. C.; Lando, Valéria S.; Camargo, Eide D.; Souza, Candida C.; Yasuda, Paulo H.

    1998-01-01

    Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively. PMID:9574730

  13. Molecular Epidemiology of Human Enterovirus Associated with Aseptic Meningitis in Shandong Province, China, 2006–2012

    PubMed Central

    Liu, Guifang; Xu, Aiqiang; Lin, Xiaojuan; Song, Lizhi; Ji, Feng; Wang, Suting; Cui, Ning; Song, Yanyan

    2014-01-01

    Background Human enteroviruses (HEVs) are common causes of acute meningitis. However, there is limited information about HEV associated with aseptic meningitis in mainland China because it has not been classified as a notifiable disease. Objectives To characterize the HEVs associated with sporadic aseptic meningitis in China and to analyze their genetic features. Study Design Cerebrospinal fluid, throat swab and feces specimens were collected from patients with aseptic meningitis in 5 sentinel hospitals in Shandong Province, China between 2006 and 2012. Virological investigation (viral isolation and molecular identification) and phylogenetic analysis were performed. Results A total of 437 hospitalized patients were reported, and enteroviruses were detected in the specimens from 84 patients (19.2%) and were identified into 17 serotypes. The nine main serotypes were echovirus (E) 30 (27.4%), EV71 (13.1%), coxsackievirus (CV) B1 (9.5%), CVB3 (7.1%), CVB5 (7.1%), E6 (7.1%), E9 (7.1%), CVA9 (6.0%), and CVA10 (3.6%). Monthly distribution of isolated enteroviruses revealed a major peak in summer-fall season and a small second peak in winter constituted totally by EV71. Sequence analysis on VP1 coding region suggested Shandong strains had great genetic divergence with isolates from other countries. Conclusions Multiple serotypes were responsible for enterovirus meningitis in mainland China. Aseptic meningitis caused by EV71 and coxsackie A viruses–the predominant pathogens for the hand, foot, and mouth disease–is currently an important concern in mainland China. PMID:24587020

  14. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-01-01

    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  15. Varicella Zoster Aseptic Meningitis: Report of an Atypical Case and Literature Review

    PubMed Central

    Ibrahim, Walid; Elzouki, Abdel-Naser; Husain, Ahmed; Osman, Lubna

    2015-01-01

    Patient: Female, 15 Final Diagnosis: Varicella Zoster aseptic meningitis Symptoms: — Medication: — Clinical Procedure: Lumber punctur Specialty: Infectious Diseases Objective: Unusual clinical course Background: Neurologic complications can occur with varicella zoster virus (VZV) infection, usually after vesicular exanthem. A review of the literature revealed 3 cases of viral meningitis associated with 6th nerve palsy but without significantly increased intracranial pressure. Case Report: We report a case of a previously healthy 15-year-old girl with aseptic meningitis as a result of reactivated-VZV infection with symptoms of increased intracranial pressure and reversible 6th cranial nerve palsy but without exanthema. Diagnosis was made by detection of VZV-DNA in cerebrospinal fluid using polymerase chain reaction and documented high intracranial pressure. Full recovery was achieved after a course of acyclovir and acetazolamide. Conclusions: This case demonstrates that VZV may be considered in cases of aseptic meningitis in immunocompetent individuals, even without exanthema, and it may increase the intracranial pressure, leading to symptoms, and causing reversible neurological deficit. PMID:26342350

  16. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis

    PubMed Central

    Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  17. Aseptic versus Sterile Acellular Dermal Matrices in Breast Reconstruction: An Updated Review

    PubMed Central

    Mendenhall, Shaun D.; Neumeister, Michael W.; Cederna, Paul S.; Momoh, Adeyiza O.

    2016-01-01

    Background: As the use of acellular dermal matrices in breast reconstruction has become more commonplace and efforts are made to improve on postoperative outcomes, the method of acellular dermal matrix (ADM) processing (aseptic versus sterile) has become a subject of interest. This article provides an updated overview of the critical aspects of ADM processing in addition to application of ADMs in single- and two-stage breast reconstruction, a review of the morbidity associated with ADM use, and alternatives. Methods: A literature review was performed in PubMed identifying recent systematic reviews, meta-analyses, and head-to-head comparisons on aseptically processed ADM and sterile-processed ADM in implant-based breast reconstruction. Results: Recent meta-analyses have shown a 2- to 3-fold increase in infections and tissue expander/implant explantation rates and a 3- to 4-fold increase in seroma formation compared with non-ADM reconstruction techniques. Comparisons of aseptic and sterile ADMs in multiple studies have shown no significant difference in infection rates and equivocal findings for other specific complications such as seroma formation. Conclusions: Current evidence on the impact of processing techniques that improve ADM sterility on postoperative morbidity in implant breast reconstruction is unclear. Deficiencies of the available data highlight the need for well-designed, multicenter, randomized controlled studies that will aid in optimizing outcomes in implant-based breast reconstruction. PMID:27536502

  18. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis.

    PubMed

    Jha, Pinky; Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  19. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.

    PubMed

    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2015-01-01

    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  20. The BCL2 -938C>A Promoter Polymorphism Is Associated with Risk for and Time to Aseptic Loosening of Total Hip Arthroplasty

    PubMed Central

    Fuest, Lena; Kurscheid, Gina; Gehrke, Thorsten; Klenke, Stefanie; Jäger, Marcus; Kauther, Max D.; Bachmann, Hagen S.

    2016-01-01

    Aseptic loosening is a major cause of revision surgery of total hip arthroplasty (THA). Only few host factors affecting aseptic loosening have been identified until now, although they are urgently needed to identify and possibly treat those patients at higher risk for aseptic loosening. To determine whether the functional single nucleotide polymorphism (SNP) c.-938C>A (rs2279115), located in the promoter region of the BCL2 gene has an impact on aseptic loosening of THA we genotyped and analyzed 234 patients suffering from aseptic loosening and 231 patients after primary THA. The polymorphism is associated with risk for aseptic loosening with the CC genotype at highest risk for aseptic loosening, Odds Ratio CC vs. AA 1.93, 95%CI 1.15–3.25, p = 0.013. In contrast, low risk AA genotype carriers that still developed aseptic loosening showed a significantly shorter time to aseptic loosening than patients carrying the C allele (p = 0.004). These results indicate that the BCL2 -938C>A polymorphism influences the occurrence and course of aseptic loosening and suggests this polymorphism as an interesting candidate for prospective studies and analyses in THA registers. PMID:26881923

  1. Another cause of chest pain: Staphylococcus aureus sternal osteomyelitis in an otherwise healthy adult

    PubMed Central

    Vacek, Thomas P; Rehman, Shahnaz; Yu, Shipeng; Moza, Ankush; Assaly, Ragheb

    2014-01-01

    Chest pain requires a detailed differential diagnosis with good history-taking skills to differentiate between cardiogenic and noncardiogenic causes. Moreover, when other symptoms such as fever and elevated white blood cell count are involved, it may be necessary to consider causes that include infectious sources. A 53-year-old female with no significant past medical history returned to the hospital with recurrent complaints of chest pain that was constant, substernal, reproducible, and exacerbated with inspiration and expiration. The chest pain was thought to be noncardiogenic, as electrocardiography did not demonstrate changes, and cardiac enzymes were found to be negative for signs of ischemia. The patient’s blood cultures were analyzed from a previous admission and were shown to be positive for Staphylococcus aureus. The patient was started empirically on vancomycin, which was later switched to ceftriaxone as the bacteria were more sensitive to this antibiotic. A transthoracic echocardiogram did not demonstrate any vegetation or signs of endocarditis. There was a small right pleural effusion discovered on X-ray. Therefore, computed tomography as well as magnetic resonance imaging of the chest were performed, and showed osteomyelitis of the chest. The patient was continued on intravenous ceftriaxone for a total of 6 weeks. Tests for HIV, hepatitis A, B, and C were all found to be negative. The patient had no history of childhood illness, recurrent infections, or previous trauma to the chest, and had had no recent respiratory infections, pneumonia, or any underlying lung condition. Hence, her condition was thought to be a case of primary sternal osteomyelitis without known cause. PMID:25246811

  2. Charts versus Discharge ICD-10 Coding for Sternal Wound Infection Following Coronary Artery Bypass Grafting

    PubMed Central

    Southern, Danielle A.; Doherty, Christopher; De Souza, Michael A.; Quan, Hude; Harrop, A. Robertson; Nickerson, Duncan; Rabi, Doreen

    2015-01-01

    Background Sternal wound infection (SWI) in patients undergoing coronary artery bypass grafting (CABG) can carry a significant risk of morbidity and mortality. The objective of this work is to describe the methods used to identify cases of SWI in an administrative database and to demonstrate the effectiveness of using an International Classification of Diseases, Tenth Revision (ICD-10) coding algorithm for this purpose. Methods ICD-10 codes were used to identify cases of SWI within one year of CABG between April 2002 and November 2009. We randomly chose 200 charts for detailed chart review (100 from each of the groups coded as having SWI and not having SWI) to determine the utility of the ICD-10 coding algorithm. Results There were 2,820 patients undergoing CABG. Of these, 264 (9.4 percent) were coded as having SWI. Thirty-eight cases of SWI were identified by chart review. The ICD-10 coding algorithm of T81.3 or T81.4 was able to identify incident SWI with a positive predictive value of 35 percent and a negative predictive value of 97 percent. The agreement between the ICD-10 coding algorithm and presence of SWI remained fair, with an overall kappa coefficient of 0.32 (95 percent confidence interval, 0.22–0.43). The effectiveness of identifying deep SWI cases is also presented. Conclusions This article describes an effective algorithm for identifying a cohort of patients with SWI following open sternotomy in large databases using ICD-10 coding. In addition, alternative search strategies are presented to suit researchers' needs. PMID:26396556

  3. Missed low-grade infection in suspected aseptic loosening has no consequences for the survival of total hip arthroplasty

    PubMed Central

    Boot, Willemijn; Moojen, Dirk Jan F; Visser, Els; Lehr, A Mechteld; De Windt, Tommy S; Van Hellemondt, Gijs; Geurts, Jan; Tulp, Niek J A; Schreurs, B Wim; Burger, Bart J; Dhert, Wouter J A; Gawlitta, Debby; Vogely, H Charles

    2015-01-01

    Background and purpose — Aseptic loosening and infection are 2 of the most common causes of revision of hip implants. Antibiotic prophylaxis reduces not only the rate of revision due to infection but also the rate of revision due to aseptic loosening. This suggests under-diagnosis of infections in patients with presumed aseptic loosening and indicates that current diagnostic tools are suboptimal. In a previous multicenter study on 176 patients undergoing revision of a total hip arthroplasty due to presumed aseptic loosening, optimized diagnostics revealed that 4–13% of the patients had a low-grade infection. These infections were not treated as such, and in the current follow-up study the effect on mid- to long-term implant survival was investigated. Patients and methods — Patients were sent a 2-part questionnaire. Part A requested information about possible re-revisions of their total hip arthroplasty. Part B consisted of 3 patient-related outcome measure questionnaires (EQ5D, Oxford hip score, and visual analog scale for pain). Additional information was retrieved from the medical records. The group of patients found to have a low-grade infection was compared to those with aseptic loosening. Results — 173 of 176 patients from the original study were included. In the follow-up time between the revision surgery and the current study (mean 7.5 years), 31 patients had died. No statistically significant difference in the number of re-revisions was found between the infection group (2 out of 21) and the aseptic loosening group (13 out of 152); nor was there any significant difference in the time to re-revision. Quality of life, function, and pain were similar between the groups, but only 99 (57%) of the patients returned part B. Interpretation — Under-diagnosis of low-grade infection in conjunction with presumed aseptic revision of total hip arthroplasty may not affect implant survival. PMID:26364842

  4. Sternal Cleft and Pectus Excavatum: A Combined Approach for the Correction of a Complex Anterior Chest Wall Malformation in a Teenager.

    PubMed

    Tocchioni, Francesca; Ghionzoli, Marco; Lo Piccolo, Roberto; Deaconu, Diana E; Facchini, Flavio; Milanez De Campos, Jose R; Messineo, Antonio

    2015-06-01

    Congenital sternal cleft is a rare chest wall malformation. Because of the flexibility of the chest in infants, surgical repair should be performed by primary closure in the neonatal period. In adolescents and adults, different techniques have been suggested to overcome the lack of sternal bone tissue. We describe a very rare case of an 18-year-old woman with a complete bifid sternum associated with pectus excavatum for whom a satisfactory cosmetic and functional result was obtained by adequate surgical planning, which entailed a combination of two standardized surgical techniques. PMID:26046903

  5. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    USGS Publications Warehouse

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  6. An echovirus 18-associated outbreak of aseptic meningitis in Taiwan: epidemiology and diagnostic and genetic aspects.

    PubMed

    Tsai, Huey-Pin; Huang, Sheng-Wen; Wu, Feng-Ling; Kuo, Pin-Hwa; Wang, Shih-Min; Liu, Ching-Chuan; Su, Ih-Jen; Wang, Jen-Ren

    2011-09-01

    In 2006, an outbreak of aseptic meningitis was noted in Taiwan. From January to October 2006, a total of 3283 specimens collected from patients with viral infection, including 173 cerebrospinal fluid (CSF) samples, were examined for virus isolation and identification. Overall, 339 enterovirus (EV)-positive cases were identified by virus culture: echovirus 18 (E18) formed the majority (27.4 %, 93 cases), followed by coxsackievirus B2 (13.8 %, 47 cases) and coxsackievirus A2 (10.8 %, 37 cases). The manifestations of the 93 E18 cases were aseptic meningitis (44.1 %), viral exanthema (23.6 %), acute tonsillitis (15.1 %), acute pharyngitis (14.0 %), acute gastritis (11.8 %), herpangina (7.5 %) and bronchopneumonia (5.3 %). Of 107 E18 isolates identified, 100, 62.5 and 19 % were obtained following culture in RD, MRC-5 and A549 cells, respectively. E18 was identified most frequently from throat swabs (67.2 %) and less frequently from stool samples (15.9 %) and CSF (16.8 %). The detection rate of E18 was 78.2 % from CSF, 50 % from stool samples and 22.9 % from throat swabs. Phylogenetic relationships among the E18 strains were examined. Analysis of the partial VP1 gene showed 3.7-23.8 % variation in sequence compared with sequences from GenBank and, notably, the amino acid change V152S was detected in a protruding loop within the VP1 protein. These results indicate that a genetic variant of E18 was circulating and caused an outbreak of aseptic meningitis in Taiwan in 2006. PMID:21546563

  7. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    PubMed

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones. PMID:26502645

  8. Solvent effect in the polyethylene recovery from multilayer postconsumer aseptic packaging.

    PubMed

    Cervantes-Reyes, Alejandro; Núñez-Pineda, Alejandra; Barrera-Díaz, Carlos; Varela-Guerrero, Víctor; Martínez-Barrera, Gonzalo; Cuevas-Yañez, Erick

    2015-04-01

    Polyethylene films were separated and recovered from polyethylene-aluminum composites derived from recycling multilayer postconsumer aseptic packaging. A brief study about the separation process by dissolving PE-aluminum (PE-Al) composites into a series of organic solvents with a combination of time and temperature is presented. Through this procedure, 56% polyethylene is recovered from this kind of composites in optimized conditions. DSC and TGA studies were performed to determine the thermal stability of recovered polyethylene films and to establish a comparison with a PE reference commercial product, demonstrating that recovered polyethylene films kept their thermal properties. PMID:25681948

  9. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    PubMed Central

    Wolf, Marc E.; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G.; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient. PMID:26889150

  10. Cutaneous aseptic neutrophilic abscesses and Yersinia enterocolitica infection in a case subsequently diagnosed as Crohn's disease.

    PubMed

    Safa, G; Loppin, M; Tisseau, L; Lamoril, J

    2008-01-01

    We report the case of a man who presented cutaneous aseptic abscesses, a rare form of neutrophilic disease, associated with Yersinia enterocolitica infection and who was later diagnosed as having Crohn's disease (CD). Genetic analysis showed that the patient had a mutation in the caspase activation recruitment domain 15/nucleotide oligomerization domain 2 gene (R702W heterozygote). This case is in keeping with recent evidence in the literature which suggests that CD is a disease linked to abnormal immune responses to enteric bacteria in genetically susceptible individuals. Further understanding of the innate immune system should provide new insights into the pathogenesis of these inflammatory diseases. PMID:18799880

  11. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI.

    PubMed

    Wolf, Marc E; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient. PMID:26889150

  12. Nuss procedure for surgical stabilization of flail chest with horizontal sternal body fracture and multiple bilateral rib fractures

    PubMed Central

    Lee, Sung Kwang

    2016-01-01

    Flail chest is a life-threatening situation that paradoxical movement of the thoracic cage was caused by multiply fractured ribs in two different planes, or a sternal fracture, or a combination of the two. The methods to achieve stability of the chest wall are controversy between surgical fixation and mechanical ventilation. We report a case of a 33-year-old man who fell from a high place with fail chest due to multiple rib fractures bilaterally and horizontal sternal fracture. The conventional surgical stabilization using metal plates by access to the front of the sternum could not provide stability of the flail segment because the fracture surface was obliquely upward and there were multiple bilateral rib fractures adjacent the sternum. The Nuss procedure was performed for supporting the flail segment from the back. Flail chest was resolved immediately after the surgery. The patient was weaned from the mechanical ventilation on third postoperative day successfully and was ultimately discharged without any complications. PMID:27293864

  13. The fine structural organization of sternal glands of pseudergates and workers in termites (Isoptera): a comparative survey.

    PubMed

    Quennedey, André; Sillam-Dussès, David; Robert, Alain; Bordereau, Christian

    2008-05-01

    Thirty-nine species belonging to different families of termites are studied to give a comprehensive view of the evolution of the sternal glands. Several modifications occurring at cuticular and cytological levels are described in neuter castes. The outer epicuticle is always pierced by epicuticular pores. In advanced termites the epicuticular filaments greatly increase in number and length creating a thick layer. The pore canals gradually enlarge while the cuticle changes into a lattice structure lining an extracellular space in which the secretion is stored. Two classes of cells are present in basal termites (Mastotermitidae, Hodotermitidae, Termopsidae and Kalotermitidae) but their glandular structures greatly differ between families. A more complex organization with three classes of cells is found in the Serritermitidae and Rhinotermitidae. A regressive evolution occurs in the Termitidae where only two classes of cells are present. A dual nervous control (campaniform sensilla and neurosecretory fibers) is found in lower termites, except for the Hodotermitidae which have mechanosensory bristles. In the other families, neurosecretory fibers are lacking. A comparison with phylogenetic data is given. A more versatile role of sternal glands in neuter castes is hypothesized. PMID:18207459

  14. Combined exposure to big endothelin-1 and mechanical loading in bovine sternal cores promotes osteogenesis.

    PubMed

    Meyer, Luisa A; Johnson, Michael G; Cullen, Diane M; Vivanco, Juan F; Blank, Robert D; Ploeg, Heidi-Lynn; Smith, Everett L

    2016-04-01

    Increased bone formation resulting from mechanical loading is well documented; however, the interactions of the mechanotransduction pathways are less well understood. Endothelin-1, a ubiquitous autocrine/paracrine signaling molecule promotes osteogenesis in metastatic disease. In the present study, it was hypothesized that exposure to big endothelin-1 (big ET1) and/or mechanical loading would promote osteogenesis in ex vivo trabecular bone cores. In a 2×2 factorial trial of daily mechanical loading (-2000με, 120cycles daily, "jump" waveform) and big ET1 (25ng/mL), 48 bovine sternal trabecular bone cores were maintained in bioreactor chambers for 23days. The bone cores' response to the treatment stimuli was assessed with percent change in core apparent elastic modulus (ΔEapp), static and dynamic histomorphometry, and prostaglandin E2 (PGE2) secretion. Two-way ANOVA with a post hoc Fisher's LSD test found no significant treatment effects on ΔEapp (p=0.25 and 0.51 for load and big ET1, respectively). The ΔEapp in the "no load + big ET1" (CE, 13±12.2%, p=0.56), "load + no big ET1" (LC, 17±3.9%, p=0.14) and "load + big ET1" (LE, 19±4.2%, p=0.13) treatment groups were not statistically different than the control group (CC, 3.3%±8.6%). Mineralizing surface (MS/BS), mineral apposition (MAR) and bone formation rates (BFR/BS) were significantly greater in LE than CC (p=0.037, 0.0040 and 0.019, respectively). While the histological bone formation markers in LC trended to be greater than CC (p=0.055, 0.11 and 0.074, respectively) there was no difference between CE and CC (p=0.61, 0.50 and 0.72, respectively). Cores in LE and LC had more than 50% greater MS/BS (p=0.037, p=0.055 respectively) and MAR (p=0.0040, p=0.11 respectively) than CC. The BFR/BS was more than two times greater in LE (p=0.019) and LC (p=0.074) than CC. The PGE2 levels were elevated at 8days post-osteotomy in all groups and the treatment groups remained elevated compared to the CC group on days 15

  15. Intravenous Immunoglobulin with Enhanced Polyspecificity Improves Survival in Experimental Sepsis and Aseptic Systemic Inflammatory Response Syndromes

    PubMed Central

    Djoumerska-Alexieva, Iglika; Roumenina, Lubka; Pashov, Anastas; Dimitrov, Jordan; Hadzhieva, Maya; Lindig, Sandro; Voynova, Elisaveta; Dimitrova, Petya; Ivanovska, Nina; Bockmeyer, Clemens; Stefanova, Zvetanka; Fitting, Catherine; Bläss, Markus; Claus, Ralf; von Gunten, Stephan; Kaveri, Srini; Cavaillon, Jean-Marc; Bauer, Michael; Vassilev, Tchavdar

    2015-01-01

    Sepsis is a major cause for death worldwide. Numerous interventional trials with agents neutralizing single proinflammatory mediators have failed to improve survival in sepsis and aseptic systemic inflammatory response syndromes. This failure could be explained by the widespread gene expression dysregulation known as “genomic storm” in these patients. A multifunctional polyspecific therapeutic agent might be needed to thwart the effects of this storm. Licensed pooled intravenous immunoglobulin preparations seemed to be a promising candidate, but they have also failed in their present form to prevent sepsis-related death. We report here the protective effect of a single dose of intravenous immunoglobulin preparations with additionally enhanced polyspecificity in three models of sepsis and aseptic systemic inflammation. The modification of the pooled immunoglobulin G molecules by exposure to ferrous ions resulted in their newly acquired ability to bind some proinflammatory molecules, complement components and endogenous “danger” signals. The improved survival in endotoxemia was associated with serum levels of proinflammatory cytokines, diminished complement consumption and normalization of the coagulation time. We suggest that intravenous immunoglobulin preparations with additionally enhanced polyspecificity have a clinical potential in sepsis and related systemic inflammatory syndromes. PMID:26701312

  16. Suitability of different construction materials for use in aseptic processing environments decontaminated with gaseous hydrogen peroxide.

    PubMed

    Unger, Beatriz; Rauschnabel, Uta; Düthorn, Berthold; Kottke, Volker; Hertel, Christian; Rauschnabel, Johannes

    2007-01-01

    The purpose of this study is to examine the behavior of different materials towards the microbial inactivation kinetic of gaseous hydrogen peroxide. Samples of 49 materials potentially used in aseptic processing environments were inoculated with 106 spores of Geobacillus stearothermophilus ATCC #12980 and exposed to defined periods using a reproducible hydrogen peroxide bio-decontamination cycle. The inactivation characteristic of each material was investigated by means of repeated D-value calculations. The results demonstrate that different materials show highly variable performance regarding the inactivation pattern of spores on each particular surface. Not only the chemical composition of the material but also differences in manufacturing processes and surface treatments were found to have an effect on the resistance of the test organisms. From the data obtained it is concluded that some correlation exists between the calculated D-values and roughness as well as wettability of the materials. Best- and worst-case materials were identified, and the dependence of specific decontamination characteristics on material properties was investigated. It is suggested to integrate studies regarding the inactivation characteristics of incorporated materials into the construction process of new aseptic processing systems bio-decontaminated with hydrogen peroxide. PMID:17933208

  17. Use of gentamicin sulfate-impregnated sponges as adjuvant therapy for the treatment of chronic foreign body associated sternal osteomyelitis in a dog

    PubMed Central

    Wainberg, Shannon H.; Brisson, Brigitte A.; Hayes, Galina M.; Mackenzie, Shawn

    2015-01-01

    A 2-year-old Labrador retriever dog was referred for evaluation of parasternal chronic draining sinus tracts associated with sternal osteomyelitis secondary to the presence of a residual wooden foreign body. The use of gentamicin-impregnated collagen sponges as adjunctive therapy to osteomyelitis treatment is reported herein. PMID:26538672

  18. A specific groove design for individualized healing in a canine partial sternal defect model by a polycaprolactone/hydroxyapatite scaffold coated with bone marrow stromal cells.

    PubMed

    Xuan, Yiwen; Tang, Hua; Wu, Bin; Ding, Xinyu; Lu, Zhongyuan; Li, Wei; Xu, Zhifei

    2014-10-01

    The reconstruction of sternal defects remains clinically challenging for thoracic surgeons. Here we aimed to explore the individualized reconstruction of partial sternal defects with new biodegradable material in a large animal model. We used the fused deposition modeling (FDM) technique to manufacture polycaprolactone/hydroxyapatite (PCL/HA) tissue scaffolds with individualized grooves to repair the sternal defect. The defects were surgically created in a sternocostal joint of eighteen Beagle dogs. The animals were separated into three groups (n = 6): Blank group, PCL/HA group, and PCL/HA/BMSCs group. Radiographic examination, histological, and histomorphometric analyses were performed to evaluate the result. In the blank group, the defect site couldn't maintain its original integrity due to no bone union. In the PCL/HA group and PCL/HA/BMSCs group, it was observed that the scaffolds retained their shapes without significant degradation at 12 weeks. Both groups could observe new bone-union by radiographic and histological examination. And PCL/HA/BMSCs would be more mineralized tissue area at implant sites (p < 0.05). These results reveal that using the FDM technique to manufacture the PCL/HA scaffolds with specific grooves could repair the sternal defect satisfactorily. Furthermore the scaffolds with BMSCs-seeded could enhance the amount of bone ingrowth and seemed to be more promising. PMID:24142768

  19. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    PubMed

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  20. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from Diplodocidae and their morphological, functional and evolutionary implications

    PubMed Central

    Tschopp, Emanuel; Mateus, Octávio

    2013-01-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles – which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  1. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from diplodocidae and their morphological, functional and evolutionary implications.

    PubMed

    Tschopp, Emanuel; Mateus, Octávio

    2013-03-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles - which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  2. Innovative food processing technology using ohmic heating and aseptic packaging for meat.

    PubMed

    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko

    2014-02-01

    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage. PMID:24200557

  3. A Cryosampler Payload for Aseptic Air Sample Collection at Stratospheric Altitudes Using Balloons.

    NASA Astrophysics Data System (ADS)

    Sreenivasan, S.; Dutt, C. B. S.; Bhargava, P.; Shivaji, S.; Manchanda, R. K.

    A balloon borne Astrobiology program is being conducted from the National Balloon Facility of the Tata Institute of Fundamental Research at Hyderabad India in which a liquid Neon cooled cryo pump collects air samples under sterile conditions in the altitude regime 19 - 41 Km Pursuant to the encouraging results obtained from an earlier experiment conducted on January 2001 a new payload was configured and the balloon flight was conducted on April 20 2005 after implementing much more rigorous and enhanced sterilization protocol to completely rule out contamination from ground Air samples were collected in the altitude region 20 - 41 Km and are under analysis in the National laboratories in India for detecting the presence of living microbial cells In this paper we discuss the design and fabrication of the air sample collection probes the stringent sterilization protocol evolved for ensuring that the probes are aseptic before the commencement of the experiment and the sample retrival methods for analysis in the laboratory

  4. The value of suction drainage fluid culture during aseptic and septic orthopedic surgery: a prospective study of 901 patients.

    PubMed

    Bernard, L; Pron, B; Vuagnat, A; Gleizes, V; Signoret, F; Denormandie, P; Si-Ali, A; Perrone, C; Feron, J M; Gaillard, J L

    2002-01-01

    There are no guidelines on the value of suction drainage fluid culture (SDC), and it is difficult to determine whether the organisms cultured from suction drainage fluid samples are pathogenic or simply contaminants. We performed 2989 cultures of suction drainage fluid samples obtained, during a 1-year period, from 901 patients who underwent aseptic or septic orthopedic surgery (946 operations). The culture results were analyzed to evaluate their ability to detect postoperative infection after aseptic operations or to detect either a persistent or new episode of sepsis in patients known to have infection. For aseptic operations, the sensitivity of SDC was 25%, the specificity was 99%, the positive predictive value was 25%, and the negative predictive value was 99%. For septic operations, the sensitivity of SDC was 81%, the specificity was 96%, the positive predictive value was 87%, and the negative predictive value was 94%. We conclude that, for aseptic orthopedic surgery, SDC is not useful in detecting postoperative infection. However, for septic orthopedic surgery, it is of clinical importance. PMID:11731944

  5. Overcoming issues associated with the scale-up of a continuous flow microwave system for aseptic processing of vegetable purees

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Continuous flow microwave heating is a promising alternative to conventional heating for aseptic processing of low-acid vegetable purees. However, non-uniform temperature distribution and control of processing parameters are the major hurdles in the implementation of continuous flow microwave heatin...

  6. Impact of donor arm cleaning with different aseptic solutions for prevention of contamination in blood bags.

    PubMed

    Patel, Tanvi G; Shukla, Rinku V; Gupte, Snehalata C

    2013-03-01

    Transfusion associated sepsis cases are encountered occasionally and bacterial transmission remains the major cause. The goal of our study was to compare the efficacy of disinfectants in phlebotomy site preparation. After selection of donor the antecubital fossa area of the arm was disinfected with different types of disinfectants namely sprit (70% isopropyl alcohol), povidone iodine (0.5% w/v available iodine in distilled water), savlon (1.5% v/v chlorhexidine gluconate solution and 3.0% cetrimide solution) and combination of sprit and povidone iodine. Swabs were collected from 20 donors using a sterile forceps, after cleaning with different antiseptic solutions. Swab was streaked on blood agar plate aseptically and the plate was incubated at 37°C for 24 h. Colonies were counted and a single colony was re-cultured by growing on nutrient and Mac-Conkey agar. The biochemical characteristics were determined by performing Gram staining, Motility, Catalase and Oxidase tests. The mean values of colonies were significantly higher with savlon compared to other three solutions. The difference was statistically significant by "t" test (t values 1.7-3.0; P < 0.05). Staphylococcus epidermidis, Staphylococcus sp., Streptococcus sp., Micrococcus sp., Bacillus megaterium and Bacillus cereus were the organisms identified. After completion of bleeding, samples from the bag were aseptically inoculated in aerobic and anaerobic culture bottles to be tested on BacT/Alert system. The bag containing donor's blood did not show any contamination when three cleanings were carried out using sprit, povidone iodine and spirit respectively. PMID:24426327

  7. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    PubMed

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. PMID:26441162

  8. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Smith, Alistair

    2015-01-01

    Abstract There is growing interest in the development of methods capable of non‐invasive characterization of stem cells prior to their use in cell‐based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm−1 after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up‐regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non‐invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for

  9. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.

    1992-01-01

    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  10. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  11. Prospective study on the chemokine CXCL13 in neuroborreliosis and other aseptic neuroinfections.

    PubMed

    Pícha, D; Moravcová, L; Smíšková, D

    2016-09-15

    The study evaluates the clinical significance of CXCL13 (leukocyte chemoattractant synthesized in CSF ) in Lyme neuroborreliosis (LNB) and other aseptic CNS infections. 244 patients with symptoms of neuroinfection and/or LNB were divided into groups: A - patients with LNB-positive antibodies in serum and CSF (96) or CSF only (14); B - patients with aseptic non-borrelial neuroinfections (82); C - negative controls (52). Group A was divided into A1-A4 according to pleocytosis in CSF and AIIgG positivity. The highest CSF CXCL13 concentrations (max. 81,287.60pg/ml; median 1766.90pg/ml) were in A1 (positive AI, pleocytosis) and A3 (negative AIIgG, pleocytosis; max. 7201,60pg/ml, median 56.22pg/ml). A2 (positive AI without pleocytosis) and A4 (negative AI without pleocytosis) had low CXCL13 levels - A2 max. 650.50pg/ml (median<7.80pg/ml); A4 max. 118.56pg/ml (median<7.8pg/ml). In B the median was 28.10pg/ml (max. 595.87pg/ml). In C the CXCL13 concentrations were the lowest (max. 83.83pg/ml; median<7.80pg/ml). The lowest cut-off was 29pg/ml (sensitivity 90.0%, specificity 72.2%), the highest one 400pg/ml (sensitivity 59.6%, specificity 94.0%). The group differences of serum CXCL13 were insignificant. The highest concentrations were at the beginning of the disease. In LNB CXCL13 correlates better with the CSF pleocytosis than AI positivity. PMID:27538636

  12. Tissue Engineered Strategies for Pseudoarthrosis

    PubMed Central

    Longo, Umile Giuseppe; Trovato, Ugo; Loppini, Mattia; Rizzello, Giacomo; Khan, Wasim Sardar; Maffulli, Nicola; Denaro, Vincenzo

    2012-01-01

    Numerous classification systems of non-union have been proposed based on: presence or absence of infection, radiographic features, clinical findings, biologic activity, location and shape. The management of pseudarthrosis is strongly related to the type of non-union (infected versus uninfected, atrophic versus hypertrophic). Surgical management of pseudarthrosis is generally effective with a success rate ranging from 75 to 100%. Nevertheless, in a relatively high number of instances several combined treatments are required for the fracture healing. The current gold standard to stimulate the bone regeneration is represented by the revision surgery with the application of autologous bone grafts. However, several approaches have been described to promote and enhance the bone tissue regeneration, including extracorporeal shock wave therapy (ESWT), ultrasound, electromagnetic, bone morphogenic proteins (BMPs) and platelet-rich-plasma (PRP). The aim of the present study was to perform a systematic review of the literature evaluating the current therapies to promote and enhance the bone tissue healing. The systematic review was performed according to PRISMA guidelines with a PRISMA checklist and algorithm. Limitations of the present systematic review are mainly related to the scanty quality of the studies available in the literature. Although the therapies previously described for the management of patients with non-unions seems to be effective, the limitations of the included studies, especially the extensive clinical heterogeneity, make not possible to provide clear recommendations regarding the application of these approaches. The problems remain the need to better understand the most effective treatment options, subject to surgical stabilization as a first step. PMID:23248729

  13. Delayed Sternal Closure After Continuous Flow Left Ventricle Assist Device Implantation: Analysis of Risk Factors and Impact on Outcomes and Costs.

    PubMed

    Quader, Mohammed; LaPar, Damien J; Wolfe, Luke; Ailawadi, Gorav; Rich, Jeffrey; Speir, Alan; Fonner, Clifford; Kasirajan, Vigneshwar

    2016-01-01

    Patient and institutional factors predictive of delayed sternal closure (DSC) practice and its impact on clinical and cost outcomes when compared with primary sternal closure (PSC) following continuous-flow left ventricular assist device (CF-LVAD) implantation were examined. Statewide Society of Thoracic Surgeons and hospital cost data on CF-LVADs implanted were analyzed. Between January 2007 and December 2013, 558 CF-LVADs were implanted (PSC = 464, 83.2%; DSC = 94, 16.8%). Among the six institutions implanting CF-LVADs, DSC practice ranged from 3.1% to 37.8%. Compared with PSC, the DSC group had higher body mass index (BMI), renal failure, anemia, IIb/IIIa inhibitor use, emergency surgery, and extracorporeal membrane oxygenation (ECMO) support. Delayed sternal closure patients had significantly longer bypass time (139 ± 63 min vs. 107.6 ± 42 min) and higher use of intraoperative blood products (82% vs. 69%) and right ventricular assist device (RVAD) support (4.3% vs. 0.2%). Postoperative morbidities and mortality (23.4% vs. 6.5%; p ≤ 0.0001) were higher in the DSC group compared with PSC. Mean hospital costs for DSC were higher than PSC ($249,144 ± 123,273 vs. $155,915 ± 95,032; p ≤ 0.0001). Multivariate predictors of DSC include institution with higher DSC practice, preoperative ECMO support, use of IIb/IIIa inhibitors, tricuspid valve surgery, and intraoperative red blood cell transfusion. Delayed sternal closure was an independent risk factor for postoperative mortality, odds ratio 3.0 (1.2-7.2). PMID:27164037

  14. The protective effect of topical rifamycin treatment against sternal wound infection in diabetic patients undergoing on-pump coronary artery bypass graft surgery

    PubMed Central

    Aygun, Fatih; Kuzgun, Ahmet; Ulucan, Seref; Keser, Ahmet; Akpek, Mahmut; Kaya, Mehmet G

    2014-01-01

    Summary Objectives The aim of this study was to investigate the protective effect of topical rifamycin SV treatment against sternal wound infection (SWI) in diabetic patients undergoing on-pump coronary artery bypass graft (CABG) surgery. Methods One hundred and fifty-nine diabetic patients who were scheduled to undergo isolated on-pump CABG surgery were included. Eight were excluded for various reasons. Of the 151 patients, 51 were on insulin therapy and 100 were on oral anti-diabetics. The risk of mediastinitis was assessed using the American College of Cardiology/American Heart Association 2004 guideline update for CABG surgery. According to the risk scores, patients were divided into two comparable groups: the rifamycin group (n = 78) received topical rifamycin treatment after on-pump CABG surgery, and the control group (n = 73) received no topical treatment. Results Deep sternal wound infection (mediastinitis) was not observed in either group (0/78 vs 0/73, p = 1.0). No superficial sternal wound infection was observed in the rifamycin group, however, it did occur in one patient in the control group (0/78 vs 1/73, p = 0.303). Wound culture was performed and coagulase-negative staphylococci were observed. The infection regressed on initiation of antibiotic therapy against isolated bacteria and the patient was discharged after a full recovery. Conclusion Although the difference in rate of superficial sternal wound infection (SSWI) in the rifamycin and control groups was not statistically significant, locally applied rifamycin SV during closure of the sternum in the CABG operation may have had a protective affect against SWI. PMID:24687038

  15. Hands-up positioning during asymmetric sternal retraction for internal mammary artery harvest: a possible method to reduce brachial plexus injury.

    PubMed

    Jellish, W S; Blakeman, B; Warf, P; Slogoff, S

    1997-02-01

    This study compares the hands-up (HU) with the arms at side (AAS) position to determine whether one is beneficial in reducing brachial plexus stress during asymmetric sternal retraction. Eighty patients undergoing cardiac surgery were assigned to either Group 1 (AAS) or Group 2 (HU). Perioperative neurologic evaluations of the brachial plexus were performed and somatosensory evoked potentials (SSEPs) were collected during internal mammary artery harvest using asymmetric sternal retraction. Demographic data, SSEP changes, and postoperative brachial plexus symptoms were compared between groups. SSEP amplitude decreased in 95% of all patients during retractor placement with substantial decreases (> 50%) observed on the left side in 50% of the AAS and 35% of the HU patients. Amplitude recovery was normally seen in both groups after asymmetric retractor removal. Similar changes were noted, to a lesser degree, on the right side. During asymmetric sternal retraction, HU positioning offered minimal benefit in reducing brachial plexus stress as measured by SSEP. Three of the seven AAS patients who reported brachial plexus symptoms had an ulnar nerve distribution of injury. However, none of the four patients with plexus symptoms in the HU group had ulnar nerve problems, suggesting that the higher incidence of postoperative symptoms observed with AAS positioning may occur from ulnar nerve compression. PMID:9024012

  16. Controlled Human Malaria Infection of Tanzanians by Intradermal Injection of Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites

    PubMed Central

    Shekalaghe, Seif; Rutaihwa, Mastidia; Billingsley, Peter F.; Chemba, Mwajuma; Daubenberger, Claudia A.; James, Eric R.; Mpina, Maximillian; Ali Juma, Omar; Schindler, Tobias; Huber, Eric; Gunasekera, Anusha; Manoj, Anita; Simon, Beatus; Saverino, Elizabeth; Church, L. W. Preston; Hermsen, Cornelus C.; Sauerwein, Robert W.; Plowe, Christopher; Venkatesan, Meera; Sasi, Philip; Lweno, Omar; Mutani, Paul; Hamad, Ali; Mohammed, Ali; Urassa, Alwisa; Mzee, Tutu; Padilla, Debbie; Ruben, Adam; Lee Sim, B. Kim; Tanner, Marcel; Abdulla, Salim; Hoffman, Stephen L.

    2014-01-01

    Controlled human malaria infection (CHMI) by mosquito bite has been used to assess anti-malaria interventions in > 1,500 volunteers since development of methods for infecting mosquitoes by feeding on Plasmodium falciparum (Pf) gametocyte cultures. Such CHMIs have never been used in Africa. Aseptic, purified, cryopreserved Pf sporozoites, PfSPZ Challenge, were used to infect Dutch volunteers by intradermal injection. We conducted a double-blind, placebo-controlled trial to assess safety and infectivity of PfSPZ Challenge in adult male Tanzanians. Volunteers were injected intradermally with 10,000 (N = 12) or 25,000 (N = 12) PfSPZ or normal saline (N = 6). PfSPZ Challenge was well tolerated and safe. Eleven of 12 and 10 of 11 subjects, who received 10,000 and 25,000 PfSPZ respectively, developed parasitemia. In 10,000 versus 25,000 PfSPZ groups geometric mean days from injection to Pf positivity by thick blood film was 15.4 versus 13.5 (P = 0.023). Alpha-thalassemia heterozygosity had no apparent effect on infectivity. PfSPZ Challenge was safe, well tolerated, and infectious. PMID:25070995

  17. Bilateral non-traumatic aseptic osteonecrosis in the femoral head. An experimental study of incidence

    SciTech Connect

    Hauzeur, J.P.; Pasteels, J.L.; Orloff, S.

    1987-10-01

    Thirty-five patients who were seen with non-traumatic aseptic osteonecrosis of the femoral head were included in a study of the contralateral hip to evaluate the incidence of bilateral disease. We used not only conventional radiography and scintigraphy but also measurement of intramedullary pressure and core biopsy. Pain was caused by 14.3 per cent of the contralateral hips, a lesion was demonstrated on plain radiographs in 51.4 per cent, and increased isotopic uptake was seen in 31.4 per cent. Histological study of specimens obtained by osteomedullary biopsy (after special procedure) showed bilateral necrosis in 88.5 per cent of the patients. After a mean follow-up of thirty-four months, only one of nine hips that were painless and had negative radiographic and isotopic findings, but had positive findings on biopsy, became painful and radiographically positive. The intramedullary pressure in the intertrochanteric area was recorded in each hip, and no correlation was found with the radiographic stage or with pain.

  18. Aseptic necrosis at multiple localisations in a lupus patient with lymphoma.

    PubMed

    Bazso, A; Bazso, T; Szodoray, P; Poor, G; Kiss, E

    2014-04-01

    Avascular or aseptic necrosis is a well-defined entity leading to the degradation of cellular elements of the bone. The pathogenesis of osteonecrosis (ON) is still unknown. There are two main types of ON: traumatic or non-traumatic. Several clinical entities could associate with ON, systemic diseases, environmental factors, pregnancy, systemic autoimmune or rheumatic diseases, thrombophilia, corticosteroid therapy, cytotoxic dugs, infections, metabolic and hematologic diseases, etc. Corticosteroids (CS) are still the most frequently used therapeutic options in the early phase and during flares of these diseases. Inflammatory cytokines and antibodies have been described to participate in the pathogenesis of ON. The infiltrative disorders of the bone marrow could also contribute to the development of ON. Hereby, we describe a female patient with NHL followed by SLE in whom ON has developed at least in two localisations. Lupus flare, long-term CS therapy, lymphoma relapse or the presence of antiphospholipid antibodies were excluded. Although the bi-localised ON could be contributed to immunologic factors or trauma, the exact aetiology in this case could not be elucidated. PMID:24297095

  19. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    PubMed

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products. PMID:20549988

  20. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae)

    NASA Astrophysics Data System (ADS)

    Vujisić, Ljubodrag V.; Vučković, Ivan M.; Makarov, Slobodan E.; Ilić, Bojan S.; Antić, Dragan Ž.; Jadranin, Milka B.; Todorović, Nina M.; Mrkić, Ivan V.; Vajs, Vlatka E.; Lučić, Luka R.; Ćurčić, Božidar P. M.; Mitić, Bojan M.

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6 O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises.

  1. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae).

    PubMed

    Vujisić, Ljubodrag V; Vučković, Ivan M; Makarov, Slobodan E; Ilić, Bojan S; Antić, Dragan Z; Jadranin, Milka B; Todorović, Nina M; Mrkić, Ivan V; Vajs, Vlatka E; Lučić, Luka R; Curčić, Božidar P M; Mitić, Bojan M

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises. PMID:23907296

  2. Cardiomyogenic differentiation of human sternal bone marrow mesenchymal stem cells using a combination of basic fibroblast growth factor and hydrocortisone.

    PubMed

    Hafez, Pezhman; Jose, Shinsmon; Chowdhury, Shiplu R; Ng, Min Hwei; Ruszymah, B H I; Abdul Rahman Mohd, Ramzisham

    2016-01-01

    The alarming rate of increase in myocardial infarction and marginal success in efforts to regenerate the damaged myocardium through conventional treatments creates an exceptional avenue for cell-based therapy. Adult bone marrow mesenchymal stem cells (MSCs) can be differentiated into cardiomyocytes, by treatment with 5-azacytidine, thus, have been anticipated as a therapeutic tool for myocardial infarction treatment. In this study, we investigated the ability of basic fibroblastic growth factor (bFGF) and hydrocortisone as a combined treatment to stimulate the differentiation of MSCs into cardiomyocytes. MSCs were isolated from sternal marrow of patients undergoing heart surgery (CABG). The isolated cells were initially monitored for the growth pattern, followed by characterization using ISCT recommendations. Cells were then differentiated using a combination of bFGF and hydrocortisone and evaluated for the expression of characteristic cardiac markers such as CTnI, CTnC, and Cnx43 at protein level using immunocytochemistry and flow cytometry, and CTnC and CTnT at mRNA level. The expression levels and pattern of the cardiac markers upon analysis with ICC and qRT-PCR were similar to that of 5-azacytidine induced cells and cultured primary human cardiomyocytes. However, flow cytometric evaluation revealed that induction with bFGF and hydrocortisone drives MSC differentiation to cardiomyocytes with a marginally higher efficiency. These results indicate that combination treatment of bFGF and hydrocortisone can be used as an alternative induction method for cardiomyogenic differentiation of MSCs for future clinical applications. PMID:26289249

  3. Ultrastructure of posterior sternal glands of Macrotermes annandalei (Silvestri): new members of the sexual glandular set found in termites (Insecta).

    PubMed

    Quennedey, André; Peppuy, Alexis; Courrent, Annie; Robert, Alain; Everaerts, Claude; Bordereau, Christian

    2004-12-01

    In female alates of Macrotermes annandalei, two types of abdominal glands are involved in the secretion of sex pheromone. Tergal glands are found at the anterior margin of tergites 6-10 and posterior sternal glands (PSGs) are located at the anterior margin of sternites 6-7. The cytological features of both types of glands are quite similar. The fine structural organization of PSGs is studied more precisely and described for the first time. The glandular cuticle is pitted with narrow apertures corresponding to the openings of numerous subcuticular pouches. Several Class 3 glandular units open in each pouch. One canal cell and one secretory cell make an individual glandular unit. The canal cell is enlarged apically and is connected with the other canal cells to form a common pouch. Based on the structural features found in these glands, we propose a common secretory process for PSGs and tergal glands. During the physiological maturation of alates inside the nest, secretory vesicles amass in the cytoplasm of secretory cells, while large intercellular spaces collapse the cuticular pouches. At the time of dispersal flight, pouches are filled with the content of secretory vesicles while intercellular spaces are sharply reduced. After calling behavior, no secretion remains in the glands and pouches collapse again, while secretory cells are drastically reduced in size. The structure and the secretory processes of PSGs and tergal glands are compared to those of abdominal sexual glands known in termites. PMID:15487007

  4. Age Estimation in Living Adults using 3D Volume Rendered CT Images of the Sternal Plastron and Lower Chest.

    PubMed

    Oldrini, Guillaume; Harter, Valentin; Witte, Yannick; Martrille, Laurent; Blum, Alain

    2016-01-01

    Age estimation is commonly of interest in a judicial context. In adults, it is less documented than in children. The aim of this study was to evaluate age estimation in adults using CT images of the sternal plastron with volume rendering technique (VRT). The evaluation criteria are derived from known methods used for age estimation and are applicable in living or dead subjects. The VRT images of 456 patients were analyzed. Two radiologists performed age estimation independently from an anterior view of the plastron. Interobserver agreement and correlation coefficients between each reader's classification and real age were calculated. The interobserver agreement was 0.86, and the correlation coefficients between readers classifications and real age classes were 0.60 and 0.65. Spearman correlation coefficients were, respectively, 0.89, 0.67, and 0.71. Analysis of the plastron using VRT allows age estimation in vivo quickly and with results similar than methods such as Iscan, Suchey-Brooks, and radiographs used to estimate the age of death. PMID:27092960

  5. Osteometric sex discrimination from the sternal extremity of the fourth rib in a recent forensic sample from Southwestern Spain.

    PubMed

    Macaluso, P James; Rico, Antonio; Santos, María; Lucena, Joaquín

    2012-11-30

    The discrimination of sex is central to the process of establishing a personal identification from human skeletal remains. Previous study has demonstrated that osteometric analysis of the sternal extremity of the fourth rib provides a reasonably accurate method for assessing this biological attribute in diverse human groups. As metric standards are generally population-specific, the purpose of the current research was to evaluate the degree of sexual dimorphism present in the fourth rib among contemporary Spaniards, a group thus far not investigated, and generate discriminant function equations which can be used to estimate the sex of unidentified remains in this population. Superior-inferior height and anterior-posterior breadth dimensions of the fourth rib were collected for a sample consisting of 60 males and 57 females derived from postmortem examinations performed at the Institute of Legal Medicine, Seville, Spain. The results demonstrated that both rib dimensions were highly sexually dimorphic (p<0.0001) in this Spanish sample. Univariate discriminant function analyses yielded correct sex classification rates of 76.9% and 83.8% for breadth and height dimensions, respectively. Multivariate analysis incorporating both rib measurements improved the allocation accuracy to 86.3%, with an associated sex bias of only 0.7%. Therefore, the derived discriminant function equations, particularly those that incorporate rib height, can be effectively used in cases involving fragmentary remains in which more dimorphic elements such as the pelvis are not preserved, as well as complete skeletons to complement other metric and morphological sex assessment methods. PMID:23068090

  6. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive. PMID:21225195

  7. Transmission of seasonal outbreak of childhood enteroviral aseptic meningitis and hand-foot-mouth disease.

    PubMed

    Park, Sue K; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu; Cheong, Hae-Kwan

    2010-05-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD. PMID:20436701

  8. Tissue Engineering Chamber Promotes Adipose Tissue Regeneration in Adipose Tissue Engineering Models Through Induced Aseptic Inflammation

    PubMed Central

    Peng, Zhangsong; Dong, Ziqing; Chang, Qiang; Zhan, Weiqing; Zeng, Zhaowei; Zhang, Shengchang

    2014-01-01

    Tissue engineering chamber (TEC) makes it possible to generate significant amounts of mature, vascularized, stable, and transferable adipose tissue. However, little is known about the role of the chamber in tissue engineering. Therefore, to investigate the role of inflammatory response and the change in mechanotransduction started by TEC after implantation, we placed a unique TEC model on the surface of the groin fat pads in rats to study the expression of cytokines and tissue development in the TEC. The number of infiltrating cells was counted, and vascular endothelial growth factor (VEGF) and monocyte chemotactic protein-1 (MCP-1) expression levels in the chamber at multiple time points postimplantation were analyzed by enzyme-linked immunosorbent assay. Tissue samples were collected at various time points and labeled for specific cell populations. The result showed that new adipose tissue formed in the chamber at day 60. Also, the expression of MCP-1 and VEGF in the chamber decreased slightly from an early stage as well as the number of the infiltrating cells. A large number of CD34+/perilipin− perivascular cells could be detected at day 30. Also, the CD34+/perilipin+ adipose precursor cell numbers increased sharply by day 45 and then decreased by day 60. CD34−/perilipin+ mature adipocytes were hard to detect in the chamber content at day 30, but their number increased and then peaked at day 60. Ki67-positive cells could be found near blood vessels and their number decreased sharply over time. Masson's trichrome showed that collagen was the dominant component of the chamber content at early stage and was replaced by newly formed small adipocytes over time. Our findings suggested that the TEC implantation could promote the proliferation of adipose precursor cells derived from local adipose tissue, increase angiogenesis, and finally lead to spontaneous adipogenesis by inducing aseptic inflammation and changing local mechanotransduction. PMID:24559078

  9. Usefulness of inflammatory biomarkers in discriminating between bacterial and aseptic meningitis in hospitalized children from a population with low vaccination coverage

    PubMed Central

    Wysocki, Jacek; Avonts, Dirk; Januszkiewicz-Lewandowska, Danuta; Michalak, Michal

    2016-01-01

    Introduction Neisseria meningitidis and Streptococcus pneumoniae are the most frequent pathogens responsible for meningitis beyond the neonatal period. Aseptic meningitis is a disabling condition, but bacterial meningitis if left untreated is 100% fatal. The aim of the study was to analyze the usefulness of biochemical and hematological parameters in distinguishing between bacterial and non-bacterial meningitis in children with meningitis from a population with low rates of vaccination against S. pneumoniae and N. meningitidis. Material and methods This study is a retrospective chart review of children hospitalized with meningitis. In patients with aseptic and bacterial meningitis the following parameters were compared: C-reactive protein, D-dimers, fibrinogen, glucose level, and leukocyte level, and in cerebrospinal fluid, protein, glucose, and leukocyte concentrations were analyzed. Number of points in the Bacterial Meningitis Score (BMS) was calculated. The predictive value of each parameter to distinguish between bacterial and aseptic meningitis was evaluated. Results In total, 129 patients were included in the study: 65 diagnosed with bacterial meningitis and 64 with aseptic meningitis. Bacterial and aseptic meningitis were statistically significantly different based on each analyzed parameter (p < 0.000001). Among children with aseptic meningitis 42 (66%) scored 0 points in the BMS, while all the children with bacterial meningitis had at least one point. Conclusions In children with meningitis inflammatory biomarkers differ statistically significantly depending on the etiology – bacterial or aseptic. Serum concentration of C-reactive protein higher than 80 mg/dl is a useful marker of bacterial etiology of meningitis. A high Bacterial Meningitis Score is indicative for bacterial meningitis. PMID:27186188

  10. Use of Incisional Negative Pressure Wound Therapy on Closed Median Sternal Incisions after Cardiothoracic Surgery: Clinical Evidence and Consensus Recommendations

    PubMed Central

    Dohmen, Pascal M.; Markou, Thanasie; Ingemansson, Richard; Rotering, Heinrich; Hartman, Jean M.; van Valen, Richard; Brunott, Maaike; Segers, Patrique

    2014-01-01

    to provide recommendations on the optimal use of negative pressure wound therapy on closed median sternal incisions after cardiothoracic surgery. PMID:25280449

  11. Aseptic Raman spectroscopy can detect changes associated with the culture of human dental pulp stromal cells in osteoinductive culture

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Tomlinson, Matthew J.; Smith, Alistair

    2015-01-01

    There is an unmet need for the non-invasive characterisation of stem cells to facilitate the translation of cell-based therapies. Raman spectroscopy has proven utility in stem cell characterisation but as yet no method has been reported capable of taking repeated Raman measurements of living cells aseptically over time. The aim of this study was to determine if Raman spectroscopy could be used to monitor changes in a well characterised cell population (human dental pulp stromal cells (DPSCs)) by taking repeated Raman measurements from the same cell populations in osteoinductive culture over time and under aseptic conditions. DPSCs were isolated from extracted premolar teeth from 3 consenting donors. Following in vitro expansion, DPSCs were maintained for 28 days in osteo-inductive medium. Raman spectra were acquired from the cells at days 0, 3, 7, 10, 14 and 28. Principal component analysis (PCA) was carried out to assess if there was any temporal spectral variation. At day 28, osteoinduction was confirmed using alizarin red staining and qRT-PCR for alkaline phosphatase and osteocalcin. Alizarin red staining was positive in all samples at day 28 and significant increases in alkaline phosphatase (p < 0.001) and osteocalcin (p < 0.05) gene expression were also observed compared with day 0. PCA of the Raman data demonstrated trends in PC1 from days 0–10, influenced by protein associated features and PC2 from days 10–28, influenced by DNA/RNA associated features. We conclude that spectroscopy can be used to monitor changes in Raman signature with time associated with the osteoinduction of DPSCs using repeated measurements via an aseptic methodology. PMID:26374253

  12. Review of the role of dynamic 18F-NaF PET in diagnosing and distinguishing between septic and aseptic loosening in hip prosthesis.

    PubMed

    Adesanya, Olu; Sprowson, Andrew; Masters, James; Hutchinson, Charles

    2015-01-01

    Joint replacements may fail due to infection, dislocation, peri-prosthetic fracture and loosening. Between 0.4 and 4% of joint replacements are known to be complicated by infection and aseptic loosening 2-18%. Differentiating between infection and aseptic loosening has an important bearing on the ongoing strategy for antimicrobial therapy and surgical intervention, but distinguishing one from the other can be difficult and will often require a battery of clinical and biochemical tests including the use of varying radiological modalities to accurately identify whether problematic joints are infected or aseptically loose. Prompt diagnosis is important due to the development of a biofilm on the surface of the infected prosthesis, which makes treatment difficult. There is no consensus among experts on the ideal imaging technique nor the methodology for image interpretation, but there is an increasing trend to apply hybrid imaging in the investigation of painful joint prosthesis and recent attempts have been made using PET-CT to identify aseptic loosening and infection with (18)F-fluorodeoxyglucose (FDG) and sodium fluoride (18)F-Na. The aim of this paper is to evaluate the role of (18)F-NaF sodium fluoride ((18)F-NaF) positron emission tomography (PET) in distinguishing between septic and aseptic failure in hip and knee replacements, in addition to evaluating the feasibility of using multi-sequential (18)F-NaF PET-CT for the assessment of painful lower limb prostheses. PMID:25592441

  13. The Protective Effect of Bafilomycin A1 Against Cobalt Nanoparticle-Induced Cytotoxicity and Aseptic Inflammation in Macrophages In Vitro.

    PubMed

    Wang, Songhua; Liu, Fan; Zeng, Zhaoxun; Yang, Huilin; Jiang, Haitao

    2016-01-01

    Co ions released due to corrosion of Co nanoparticles (CoNPs) in the lysosomes of macrophages may be a factor in the particle-induced cytotoxicity and aseptic inflammation accompanying metal-on-metal (MOM) hip prosthesis failure. Here, we show that CoNPs are easily dissolved under a low pH, simulating the acidic lysosomal environment. We then used bafilomycin A1 to change the pH inside the lysosome to inhibit intracellular corrosion of CoNPs and then investigated its protective effects against CoNP-induced cytotoxicity and aseptic inflammation on murine macrophage RAW264.7 cells. XTT {2,3-bis (2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide} assays revealed that bafilomycin A1 can significantly decrease CoNP-induced cytotoxicity in RAW264.7 cells. Enzyme-linked immunosorbent assays showed that bafilomycin A1 can significantly decrease the subtoxic concentration of CoNP-induced levels of pro-inflammatory cytokines (tumor necrosis factor-α, interleukin-1β, and interleukin-6), but has no effect on anti-inflammatory cytokines (transforming growth factor-β and interleukin-10) in RAW264.7 cells. We studied the protective mechanism of bafilomycin A1 against CoNP-induced effects in RAW264.7 cells by measuring glutathione/oxidized glutathione (GSH/GSSG), superoxide dismutase, catalase, and glutathione peroxidase levels and employed scanning electron microscopy, transmission electron microscopy, and energy dispersive spectrometer assays to observe the ultrastructural cellular changes. The changes associated with apoptosis were assessed by examining the pAKT and cleaved caspase-3 levels using Western blotting. These data strongly suggested that bafilomycin A1 can potentially suppress CoNP-induced cytotoxicity and aseptic inflammation by inhibiting intracellular corrosion of CoNPs and that the reduction in Co ions released from CoNPs may play an important role in downregulating oxidative stress in RAW264.7 cells. PMID:26054709

  14. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling

    PubMed Central

    Bhadane, Bhushan S.; Patil, Ravindra H.

    2016-01-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  15. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    PubMed

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  16. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  17. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination.

    PubMed

    Atwater, J E; Michalek, W F; Wheeler, R R; Dahl, R; Lunsford, T D; Garmon, F C; Sauer, R L

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus. PMID:11587573

  18. Sternal exploration or closure

    MedlinePlus

    ... infections following open heart surgery. Journal of Cardiovascular Nursing. October 2005; 20(5):299-305. PMID: 16141774 http://www.ncbi.nlm.nih.gov/pubmed/16141774 . Kulaylat MN, Dayton MT. Surgical complications. In: Townsend CM Jr, Beauchamp RD, Evers ...

  19. Plasmodium falciparum Malaria Challenge by the Bite of Aseptic Anopheles stephensi Mosquitoes: Results of a Randomized Infectivity Trial

    PubMed Central

    Lyke, Kirsten E.; Laurens, Matthew; Adams, Matthew; Billingsley, Peter F.; Richman, Adam; Loyevsky, Mark; Chakravarty, Sumana; Plowe, Christopher V.; Sim, B. Kim Lee; Edelman, Robert; Hoffman, Stephen L.

    2010-01-01

    Background Experimental infection of malaria-naïve volunteers by the bite of Plasmodium falciparum-infected mosquitoes is a preferred means to test the protective effect of malaria vaccines and drugs. The standard model relies on the bite of five infected mosquitoes to induce malaria. We examined the efficacy of malaria transmission using mosquitoes raised aseptically in compliance with current Good Manufacturing Practices (cGMPs). Methods and Findings Eighteen adults aged 18–40 years were randomized to receive 1, 3 or 5 bites of Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of P. falciparum. Seventeen participants developed malaria; fourteen occurring on Day 11. The mean prepatent period was 10.9 days (9–12 days). The geometric mean parasitemia was 15.7 parasites/µL (range: 4–70) by microscopy. Polymerase chain reaction (PCR) detected parasites 3.1 (range: 0–4) days prior to microscopy. The geometric mean sporozoite load was 16,753 sporozoites per infected mosquito (range: 1,000–57,500). A 1-bite participant withdrew from the study on Day 13 post-challenge and was PCR and smear negative. Conclusions The use of aseptic, cGMP-compliant P. falciparum-infected mosquitoes is safe, is associated with a precise prepatent period compared to the standard model and appears more efficient than the standard approach, as it led to infection in 100% (6/6) of volunteers exposed to three mosquito bites and 83% (5/6) of volunteers exposed to one mosquito bite. Trial Registration ClinicalTrials.gov NCT00744133 PMID:21042404

  20. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  1. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    SciTech Connect

    Haydary, J.; Susa, D.; Dudáš, J.

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  2. Topical versus Systemic Vancomycin for Deep Sternal Wound Infection Caused by Methicillin-Resistant Staphylococcus aureus in a Rodent Experimental Model

    PubMed Central

    Ozcan, Ali V.; Demir, Melek; Onem, Gokhan; Goksin, Ibrahim; Baltalarli, Ahmet; Topkara, Veli K.; Kaleli, Ilknur

    2006-01-01

    In 37 Wistar albino rats, we investigated the effects of topical vancomycin on deep sternal wound infection caused by methicillin-resistant Staphylococcus aureus. Partial median sternotomy was performed under sterile conditions. Group I (n=6) was the sham, and group II (n=7) was the control. Group III (n=8) received topical vancomycin, group IV (n=8) received systemic vancomycin, and group V (n=8) received topical and systemic vancomycin (combined). Rats in groups II through V were inoculated with 0.5 mL × 108 CFU/mL methicillin-resistant S. aureus in the mediastinum and sternum. No medication was given to groups I and II. Twenty-four hours after surgery, 40 mg/kg/day vancomycin was given topically in group III; systemically in group IV; and topically and systemically in group V. After 7 days, smear samples from the mediastinum and tissue cultures from the sternum were obtained. We found 5.00 ± 0 CFU/mL microorganisms in the mediastinum in group II, 1.90 ± 1.70 in group III, 3.33 ± 0.48 in group IV, and 1.70 ± 1.08 in group V. The quantity of microorganisms per gram of tissue in the sternum was 7.36 ± 0.23 in group II, 6.01 ± 0.33 in group III, 5.81 ± 0.81 in group IV, and 3.99 ± 2.47 in group V. The quantity of microorganisms was less in the 3 treatment groups than in the control group (P <0.05). We conclude that topical plus systemic vancomycin treatment might be more effective in patients with deep sternal wound infections caused by methicillin-resistant S. aureus. PMID:16878608

  3. Aseptic Meningitis Associated with ECHO Virus Type 9 Infection—With Special Reference to Variability by Sex and Incidence of Paralytic Sequelae

    PubMed Central

    Portnoy, Bernard; Hanes, Bernard; Pierce, Nathaniel F.; Leedom, John M.; Kunzman, E. Eugene; Wehrle, Paul F.

    1965-01-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable. A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  4. ASEPTIC MENINGITIS ASSOCIATED WITH ECHO VIRUS TYPE 9 INFECTION. WITH SPECIAL REFERENCE TO VARIABILITY BY SEX AND INCIDENCE OF PARALYTIC SEQUELAE.

    PubMed

    PORTNOY, B; HANES, B; PIERCE, N F; LEEDOM, J M; KUNZMAN, E E; WEHRLE, P F

    1965-04-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable.A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  5. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    PubMed

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. PMID:23428565

  6. Design, development and qualification of a microbiological challenge facility to assess the effectiveness of BFS aseptic processing.

    PubMed

    Leo, F; Poisson, P; Sinclair, C S; Tallentire, A

    2005-01-01

    A programme of work has been initiated to further the understanding of the impact of the environment surrounding a Blow/Fill/Seal (BFS) machine upon the microbiological quality of processed product. A dedicated facility (Challenge Room) has been constructed and qualified to provide for the production and containment of dispersions of micro organisms in air of a room housing an operating BFS machine of a given style and configuration. The facility achieves homogeneous distribution of generated dispersions throughout the Challenge Room air, including that within and close to the critical area in which aseptic BFS operations occur. Generated microbial dispersions can be maintained in the room over extended time periods (up to 600 min) at a desired concentration within the range 10(1) to 10(7) cfu m(-3). They can also be produced employing different cell types, including bacterial endospores, Gram-positive and Gram-negative vegetative cells and yeast cells. Effective containment of dispersions is achieved while 'cards of product' (vials in sets) are conveyed from the Challenge Room to an adjacent Packing and Storage Area. Decontamination of the room and the housed BFS machine is accomplished through exposure to chlorine dioxide gas at a concentration of 1.0 mg dm(-3) for 120 min at room temperature (approximately 23 degrees C). PMID:15796134

  7. The development of invertase activity in slices of the root of Beta vulgaris L. washed under aseptic conditions

    PubMed Central

    Bacon, J. S. D.; MacDonald, I. R.; Knight, A. H.

    1965-01-01

    1. When disks of root tissue from sugar or red beet (Beta vulgaris L.) are washed in running aerated tap water the sucrose contained in them disappears and glucose and fructose are formed. 2. Invertase activity in the disks has been measured by a polarimetric method. Freshly cut tissue has a very low activity, but a considerable increase occurs during the first 3–4 days of washing, the final activity being sufficient to hydrolyse the sucrose contained in the disk within a few hours. 3. Disks of red beet have been cut and shaken in water under aseptic conditions. Sucrose breakdown and invertase development still took place. Microbial contamination is therefore not responsible. 4. Trisaccharides that appear in sugar-beet disks during the washing process have been isolated and identified; their formation also suggests that a higher-plant invertase is acting. 5. The significance of these results is discussed in relation to protein synthesis in washed storage-tissue slices, and the occurrence of high invertase activity in growing plant cells. PMID:14342226

  8. Surgical treatment of an aseptic fistulized acromioclavicular joint cyst: a case report and review of the literature

    PubMed Central

    Murena, Luigi; D’angelo, Fabio; Falvo, Daniele A

    2009-01-01

    An acromioclavicular joint cyst is an uncommonly reported condition, which seems to result from a massive rotator cuff tear and degenerative osteoarthritis of the acromioclavicular joint. We present the case of an 81-year-old man affected by an acromioclavicular joint cyst, associated to a massive rotator cuff tear, proximal migration of the humeral head and osteoarthritis of the gleno-humeral joint. The mass was 7 × 2.5 cm in size and the overlying skin presented a fistula that drained clear synovial-like fluid. Plain X-ray examination of the left shoulder showed proximal migration of the humeral head migration and osteoarthritis of the gleno-humeral joint, and further MRI evaluation confirmed the clinical diagnosis of a complete rotator cuff tear and observed a large subcutaneous cyst in communication with the degenerative acromioclavicular joint. The patient underwent surgical excision of the cyst and lateral resection of the clavicle to prevent disease recurrence. To the best of our knowledge, this is the first reported case of an acromioclavicular joint cyst complicated by an aseptic fistula resulting from multiple aspirations. PMID:19918423

  9. Aseptic non-touch technique and catheter-related bloodstream infection in children receiving parenteral nutrition at home

    PubMed Central

    Evans, Victoria; Hughes, Anna; Hill, Susan

    2015-01-01

    Objectives Parenteral nutrition (PN) at home is an acceptable form of delivering long-term PN for children with intestinal failure. Catheter-related bloodstream infection (CRBSI) is one of the serious complications of long-term PN and can lead to increasing morbidity and mortality. Using aseptic non-touch technique (ANTT) was proven to decrease the incidence of CRBSI in hospital patients. In this study we aimed to review the incidence of CRBSI in children receiving PN at home in our institution using the ANTT and a simplified training programme for parents and carers. Methods We retrospectively collected clinical and microbiological data on all children with intestinal failure (IF) who were on treatment with PN at home under our specialist IF rehabilitation service between November 2012 and November 2013. Results Thirty-five children were included, 16 of whom did not have any infection recorded during the study period. The overall CRBSI rate was 1.3 infections per 1000 line-days, with Staphylococcus being the commonest organism. Twenty-one children did not require catheter change and the overall catheter changes were 1.8 per 1000 line-days. Conclusion In this article, we report a low incidence of CRBSI in a single institution by using the principle of ANTT for accessing central venous catheters combined with a simplified, nurse-led, two-week standardised training programme for parents of children going home on PN. PMID:26279849

  10. Comparison of the roles of IL-1, IL-6, and TNFα in cell culture and murine models of aseptic loosening1

    PubMed Central

    Taki, Naoya; Tatro, Joscelyn M.; Lowe, Robert; Goldberg, Victor M.; Greenfield, Edward M.

    2007-01-01

    Pro-inflammatory cytokines, such as IL-1, IL-6, and TNF, are considered to be major mediators of osteolysis and ultimately aseptic loosening. This study demonstrated that synergistic interactions among these cytokines are required for the in vitro stimulation of osteoclast differentiation by titanium particles. In contrast, genetic knock out of these cytokines or their receptors does not protect murine calvaria from osteolysis induced by titanium particles. Thus, the extent of osteolysis was not substantially altered in single knock out mice lacking either the IL-1 receptor or IL-6. Osteolysis also was not substantially altered in double knock out mice lacking both the IL-1 receptor and IL-6 or in double knock out mice lacking both TNF receptor-1 and TNF receptor-2. The differences between the in vivo and the cell culture results make it difficult to conclude whether the pro-inflammatory cytokines contribute to aseptic loosening. One alternative is that in vivo experiments are more physiological and that therefore the current results do not support a role for the pro-inflammatory cytokines in aseptic loosening. We however favor the alternative that, in this case, the cell culture experiments can be more informative. We favor this alternative because the role of the pro-inflammatory cytokines may be obscured in vivo by compensation by other cytokines or by the low signal to noise ratio found in measurements of particle-induced osteolysis. PMID:17236833

  11. The role of Card9 overexpression in peripheral blood mononuclear cells from patients with aseptic acute pancreatitis.

    PubMed

    Yang, Zhi-wen; Weng, Cheng-zhao; Wang, Jing; Xu, Ping

    2016-03-01

    Activated mononuclear cells are an early event in the course of severe acute pancreatitis (SAP). To date, the molecular mechanism triggering peripheral blood mononuclear cells (PBMCs) is poorly understood. The aim of this paper was to determine the potential role of Card9 in SAP. We collected data from 72 subjects between January 2013 and June 2014. Subsequently, PBMCs were isolated on day 1, 3 and 5 of pancreatitis. Immunofluorescence staining, quantitative real-time PCR, Western blotting, immunoprecipitation and ELISA were used to determine the role of Card9 in SAP. Microbial culture showed that SAP patients at the early period did not develop any bacteria and fungi infection. Card9 expression in SAP patients was higher than that in mild acute pancreatitis and volunteer healthy controls, up to the peak on day 1. The monocyte-derived cytokines interleukin (IL)-17, IL-1β, IL-6 and tumour necrosis factor-α mediated by the induction of Card9 markedly increased in SAP patients compared with the control group. Furthermore, the inducible formation of Card9-Bcl10 complex was found in PBMCs, which may be involved in nuclear factor kappa B (NF-κB) and p38 activation in SAP. Receiver operating characteristic curve indicated that Card9 levels had a high sensitivity of 87.5% and specificity of 67.7%, showing the close correlation with SAP patients. Card9 overexpression was firstly found in aseptic SAP, which may be played an important role in NF-κB and p38 activation in PBMCs. It also provided the new insights into therapeutic interventions by targeting monocytes activation in SAP patients. PMID:26893103

  12. 18F-FDG microPET imaging differentiates between septic and aseptic wound healing after orthopedic implant placement

    PubMed Central

    Odekerken, Jim C E; Brans, Boudewijn T; Welting, Tim J M; Walenkamp, Geert H I M

    2014-01-01

    Background and purpose 18F-FDG PET is a widely used tool for molecular imaging of oncological, cardiovascular, and neurological disorders. We evaluated 18F-FDG microPET as an implant osteomyelitis imaging tool using a Staphylococcus aureus-induced peroperative implant infection in rabbits. Methods Intramedullary titanium nails were implanted in contaminated and uncontaminated (control) proximal right tibiae of rabbits. Tibiae were quantitatively assessed with microPET for 18F-FDG uptake before and sequentially at 1, 3, and 6 weeks after surgery. Tracer uptake was assessed in soft tissue and bone in both treatment groups with an additional comparison between the operated and unoperated limb. MicroPET analysis was combined with radiographic assessment and complementary histology of the tibiae. Results At the first postoperative week, the 18F-FDG uptake in the contaminated implant group was significantly higher than the preoperative measurement, without a significant difference between the contaminated and uncontaminated tibiae. From the third postoperative week onward, 18F-FDG uptake allowed discrimination between osteomyelitis and postoperative aseptic bone healing, as well as quantification of the infection at distinct locations around the implant. Interpretation 18F-FDG-based microPET imaging allows differentiation between deep infection and undisturbed wound healing after implantation of a titanium intramedullary nail in this rabbit model. Furthermore, our results indicate that 18F-FDG PET may provide a tool in human clinical diagnostics and for the evaluation of antimicrobial strategies in animal models of orthopedic implant infection. PMID:24673540

  13. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    PubMed

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression. PMID:22318091

  14. Une observation d'un goitre sur dysgénésie thyroïdienne pré-sternale

    PubMed Central

    Fanantenana, Herinirina Nicolas; Hasina, Rajaonarison Ny Ony Narindra Lova; Hery, Rafanomezantsoa; Claude, Rakotoarisoa Andriamihaja Jean; Ahmad, Ahmad

    2015-01-01

    L'hétérotopie thyroïdienne est une localisation anormale de tissus thyroïdiens normaux coexistant avec un organe normal et de localisation normale. Elle se distingue de l'ectopie thyroïdienne et d'une métastase du cancer de la thyroïde. Nous rapportons un cas d'hétérotopie thyroïdienne pré-sternale chez une femme de 65 ans afin de discuter le mécanisme de la migration de la thyroïde, le problème diagnostique et thérapeutique posé par cette topographie exceptionnelle. L'origine thyroïdienne de la masse est confirmée par l'histologie. Dans les lieux isolés, la chirurgie d'exérèse reste le seul moyen pour avoir le diagnostic et pour traiter les patients. PMID:26327954

  15. [A portable sternal compressor for cardiac massage on a patient carried by a litter--Part 3: Applicability of the device tested by a recording manikin].

    PubMed

    Yoshitake, Atsushi; Nishi, Masaaki; Maeda, Asako; Okamoto, Taisuke; Morioka, Tohru; Terasaki, Hidenori

    2002-10-01

    Effects of a portable sternal compressor developed by us was examined by 43 medical students (28 males and 15 females) and 9 anesthesia residents using a recording manikin. Compression over a depth of 3.5 to 5.0 cm was classified as adequate. First, the examinee held the device affixed in front of the chest with a belt hanged over the shoulder and pulled the other handle back and forth at a rate of 100 per minute. The male students could perform adequate compression in 92% of the total number of compression in the first one minute, while female students could in 65%. Though the anesthesia residents accomplished 99% of success rate in the first one minute, the rate fell to nearly 80% in the next minute and about 50% thereafter due to fatigue. When one handle was sustained on the floor with its fold-in stand and held between the knees of the examinee sitting on a chair, adequate compression was performed with the success rate of over 80% for 5 minutes. We conclude this device will be useful for cardiac massage on a patient either transported on a litter or lying on a soft bed. PMID:12428330

  16. On the absence of sternal elements in Anchiornis (Paraves) and Sapeornis (Aves) and the complex early evolution of the avian sternum

    PubMed Central

    Zheng, Xiaoting; O’Connor, Jingmai; Wang, Xiaoli; Wang, Min; Zhang, Xiaomei; Zhou, Zhonghe

    2014-01-01

    Anchiornis (Deinonychosauria: Troodontidae), the earliest known feathered dinosaur, and Sapeornis (Aves: Pygostylia), one of the basalmost Cretaceous birds, are both known from hundreds of specimens, although remarkably not one specimen preserves any sternal ossifications. We use histological analysis to confirm the absence of this element in adult specimens. Furthermore, the excellent preservation of soft-tissue structures in some specimens suggests that no chondrified sternum was present. Archaeopteryx, the oldest and most basal known bird, is known from only 10 specimens and the presence of a sternum is controversial; a chondrified sternum is widely considered to have been present. However, data from Anchiornis and Sapeornis suggest that a sternum may also have been completely absent in this important taxon, suggesting that the absence of a sternum could represent the plesiomorphic avian condition. Our discovery reveals an unexpected level of complexity in the early evolution of the avian sternum; the large amount of observable homoplasy is probably a direct result of the high degree of inherent developmental plasticity of the sternum compared with observations in other skeletal elements. PMID:25201982

  17. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    PubMed

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  18. The inhibitory effect of strontium-doped calcium polyphosphate particles on cytokines from macrophages and osteoblasts leading to aseptic loosening in vitro.

    PubMed

    Huang, Chengcheng; Li, Li; Yu, Xixun; Gu, Zhipeng; Zhang, Xu

    2014-04-01

    Aseptic loosening is a common cause of joint implant failure in humans. In order to enhance implant stability, we need to develop a new material that not only promotes the wear resistance of components of an artificial joint, but also possesses the pharmaceutical efficacy of protecting patients against aseptic loosening. Strontium-doped calcium polyphosphate (SCPP) has been found to have this potential ability. The goal of this study is to respectively quantify the levels of TNF-α (for macrophages), receptor activator of NF-kB ligand (RANKL) and osteoprotegerin (OPG) (for osteoblasts) when osteoblasts and macrophages are challenged with various particles (including SCPP). In this study, the osteoblasts ROS 17/2.8 and macrophages RAW 264.7 were challenged with various wear particles (8% SCPP, the molar percentage of Sr in SCPP is 8%, UHMWPE, hydroxyapatite (HA) and CPP). The secretion of TNF-α (from RAW 264.7), OPG and RANKL protein (from ROS 17/2.8) was analyzed by ELISA. The OPG and RANKL mRNA from ROS 17/2.8 was detected by RT-PCR. The data of ELISA indicated that the amount of TNF-α challenged with 8% SCPP particles was more than three-fold lower than that of all other test groups. The ratio of OPG/RANKL in the 8% SCPP group was significantly increased compared to that of all other test groups. The results of OPG and RANKL mRNA expression showed the same tendency as the ELISA results. In general, this study showed that 8% SCPP particles can inhibit the expression of TNF-α and RANKL, promote the expression of OPG so that SCPP can inhibit bone resorption and promote bone formation, and then inhibit aseptic loosening. Thus SCPP could be a promising material for the construction of artificial joints. PMID:24518283

  19. Optimizing and developing a continuous separation system for the wet process separation of aluminum and polyethylene in aseptic composite packaging waste.

    PubMed

    Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi

    2015-01-01

    The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved. PMID:25458854

  20. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66)

    PubMed Central

    1971-01-01

    Report of Decompression Sickness Panel, Medical Research Council (1971). Brit. J. industr. Med., 28, 1-21. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66). This paper describes investigations into the health of compressed air workers during and after the construction of a road tunnel under the River Tyne. Altogether 641 men were exposed to the compressed air environment over a period of approximately 31 months. The maximum working pressure was 42 psig (289·6 kN/m2), and the overall decompression sickness rate for work at pressures of 18 psig (124·1 kN/m2) and above was 2%. Radiological examination of the chest was carried out on 183 men to detect lung cysts but only one was found. Thus lung cysts were not shown to be a common factor in the causation of decompression sickness but the possibility of small sub-radiological collections of trapped air being involved was not excluded. Radiological examinations of the shoulders, hips and knee joints were carried out on 171 men. There was evidence of aseptic necrosis in one or more bones of 44 men (26%). Fifteen of the men with definite lesions of aseptic necrosis of bone and 7 of the men with suspected lesions had never worked in compressed air before this contract. The remaining 14 men with definite lesions and the 8 with suspected lesions had worked elsewhere in compressed air prior to this contract, but a definite lesion in one of these men and a suspected lesion in another can almost certainly be attributed to their work in compressed air on this contract. Images PMID:5543625

  1. Somatosensory evoked potential monitoring of the brachial plexus to predict nerve injury during internal mammary artery harvest: intraoperative comparisons of the Rultract and Pittman sternal retractors.

    PubMed

    Jellish, W S; Martucci, J; Blakeman, B; Hudson, E

    1994-08-01

    Brachial plexus injury after coronary artery bypass grafting (CABG) continues to be a common problem postoperatively. With the use of somatosensory evoked potential monitoring (SSEP), neurologic integrity of the brachial plexus during internal mammary artery (IMA) harvest was assessed and the Rultract and Pittman sternal retractors were compared to determine what effect they had on SSEP characteristics. Results showed that the Rultract and Pittman retractors caused large decreases in SSEP amplitudes after insertion, (1.25 +/- 0.14 versus 0.72 +/- 0.09, P < 0.05; and 1.64 +/- 0.27 versus 0.91 +/- 0.14, P < 0.05) respectively. This decrease was noted in 85% of Rultract and 68.75% of Pittman patients, respectively. Amplitudes increased after retractor removal but never returned to baseline values. Cooley retractor placement in the patients not undergoing IMA harvest (control) produced only mild decreases in amplitude. Waveform latency increased in all groups after retractor placement, but these increases were thought to be clinically insignificant. Postoperatively, three patients in each of the IMA retractor groups had brachial plexus symptoms (18%), whereas only one patient in the control group had symptoms. Somatosensory evoked potential monitoring seems to be a sensitive intraoperative monitor for assessing brachial plexus injury during CABG. The nerve plexus seems to be most at risk for pathologic injury during retraction of the sternum for IMA harvest. Though the Rultract retractor caused greater changes in SSEP characteristics than the Pittman, no clinical outcome differences between the two could be ascertained. Using SSEP monitoring may reduce brachial plexus injury during IMA harvest by allowing early detection of nerve compromise and therapeutic interventions to alleviate the insult while under general anesthesia. PMID:7948794

  2. The importance of toxoplasma gondii infection in diseases presenting with headaches. Headaches and aseptic meningitis may be manifestations of the Jarisch-Herxheimer reaction.

    PubMed

    Prandota, Joseph

    2009-01-01

    Worldwide, approximately 2 billion people are chronically infected with T. gondii with largely unknown consequences. This review presents clinical symptoms, differential diagnosis, triggering factors, treatment, and pathomechanisms responsible for idiopathic intracranial hypertension, pseudotumor cerebri, and aseptic meningitis. Literature cited in this work illustrates that immune state and other biologic mediator imbalances due to various endogenous and exogenous triggering factors may markedly affect latent central nervous system T. gondii infection/inflammation intensity, and cause reactivation of cerebral toxoplasmosis (CT). Irregularities in pro- and anti-inflammatory processes may markedly disturb the host and/or T. gondii defense mechanisms important for immune control of the parasite thereby manifesting as a wide range of neurologic symptoms and signs observed in some patients with migraine, epilepsy, celiac disease, Henoch-Schönlein purpura, and other brain disorders. This is consistent with reactivation of CT in mice after treatment with dexamethasone associated with depression of type T(H)1 immune response, and development of CT after administration of etanercept or other bioproducts. It seems that various types of headaches, epilepsy, aseptic meningitis, systemic adverse reactions to drugs or other substances represent the Jarisch-Herxheimer reaction due to apoptosis of T. gondii tachyzoites. Also development of some brain tumors, such as ependymoma and glioma may be associated with a chronic course of CT. Thus, all these patients should be tested for T. gondii infection. PMID:19916846

  3. Presence of corrosion products and hypersensitivity-associated reactions in periprosthetic tissue after aseptic loosening of total hip replacements with metal bearing surfaces.

    PubMed

    Huber, Monika; Reinisch, Georg; Trettenhahn, Günter; Zweymüller, Karl; Lintner, Felix

    2009-01-01

    Aseptic loosening of articular implants is frequently associated with tissue reactions to wear particles. Some patients, who had received metal-on-metal articulations, present early symptoms including persistent pain and implant failure. These symptoms raise the suspicion about the development of an immunological response. Furthermore, the generation of rare corrosion products in association with metallic implants has been observed. Corrosion products are known to enhance third-body wear and contribute to the loss of the implant. The purpose of this study was to investigate periprosthetic tissue containing solid corrosion products after aseptic loosening of second-generation metal-on-metal total hip replacements made of low-carbon cobalt-chromium-molybdenum alloy for the presence of immunologically determined tissue changes. Periprosthetic tissue of 11 cases containing uncommon solid deposits was investigated by light microscopy. In order to confirm the presence of corrosion products, additional methods including scanning electron microscopy (SEM) investigation, energy dispersive X-ray (EDX) and Fourier transform infrared microspectroscopy (FTIR) analysis were used. All investigated cases revealed solid chromium orthophosphate corrosion products as well as metallic wear particles to a various extent. Moreover, various intense tissue reactions characteristic of immune response were observed in all cases. The simultaneous presence of corrosion products and hypersensitivity-associated tissue reaction indicates that a relationship between corrosion development and implant-related hypersensitivity may exist. PMID:18725188

  4. Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB.

    PubMed

    Luo, Guotian; Li, Ziqing; Wang, Yu; Wang, Haixing; Zhang, Ziji; Chen, Weishen; Zhang, Yangchun; Xiao, Yinbo; Li, Chaohong; Guo, Ying; Sheng, Puyi

    2016-04-01

    Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol's protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. PMID:26878849

  5. High-Dose Continuous Oxacillin Infusion Results in Achievement of Pharmacokinetics Targets in Critically Ill Patients with Deep Sternal Wound Infections following Cardiac Surgery

    PubMed Central

    Verdier, Marie-Clémence; Launey, Yoann; Malherbe, Alexandre; Dermu, Marine; Piau, Caroline; Flécher, Erwan; Tribut, Olivier; Mallédant, Yannick; Seguin, Philippe

    2014-01-01

    Knowledge regarding antimicrobial therapy strategies in deep sternal wound infections (DSWI) following cardiac surgery is limited. Therefore, we aimed to determine the steady-state plasma and mediastinal concentrations of oxacillin administered by continuous infusion in critically ill patients with DSWI and to compare these concentrations with the susceptibility of staphylococci recovered. A continuous infusion of oxacillin (150 to 200 mg/kg of body weight/24 h) was administered after a loading dose (50 mg/kg). Plasma and mediastinal concentrations of total and unbound oxacillin were determined 4 h after the loading dose (H4) and then at day 1 (H24) and day 2 (H48). Twelve patients were included. Nine patients exhibited bacteremia, 5 were in septic shock, 8 were positive for Staphylococcus aureus, and 4 were positive for coagulase-negative staphylococci. The median MIC (first to third interquartile range) was 0.25 (0.24 to 0.41) mg/liter. Median plasma concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 64.4 (41.4 to 78.5) and 20.4 (12.4 to 30.4) mg/liter, 56.9 (31.4 to 80.6) and 21.7 (6.5 to 27.3) mg/liter, and 57.5 (32.2 to 85.1) and 20 (14.3 to 35.7) mg/liter. The median mediastinal concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 2.3 (0.7 to 25.9) and 0.9 (<0.5 to 15) mg/liter, 29.1 (19.7 to 38.2) and 12.6 (5.9 to 19.8) mg/liter, and 31.6 (14.9 to 42.9) and 17.1 (6.7 to 26.7) mg/liter. High-dose oxacillin delivered by continuous infusion is a valuable strategy to achieve our pharmacokinetic target (4× MIC) at the site of action at H24. But concerns remain in cases of higher MICs, emphasizing the need for clinicians to obtain the MICs for the bacteria and to monitor oxacillin concentrations, especially the unbound forms, at the target site. PMID:24982092

  6. Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are sternal outgrowths and not limbs.

    PubMed

    Wolff, Carsten; Scholtz, Gerhard

    2006-01-01

    The question of arthropod head segmentation has become one of the central issues in Evolutionary Developmental Biology. The number of theories pertaining to head segments progressively enlarges, old concepts have been revitalized, and nearly every conceivable composition of the arthropod head has at some point received discussion. One contentious issue involves a characteristic mouthpart in crustaceans--the lower lips or the so-called paragnaths. The paragnaths build the posterior border of the mouth region antagonistic to the upper lip--the labrum. We show here the development of the appendage-like structures in the mandibular region of the amphipod crustacean Orchestia cavimana at a high level of cellular resolution. The embryos are examined during development of the mouthparts using in vivo labeling. An invariant cell division pattern of the mandibular segment was detected by 4D-microscopy and a preliminary model for pattern of the first cleavages in the mandibular region created. With this indispensable precondition single ectodermal cells of the grid-like pattern were labeled with DiI--a lipophilic fluorescent dye--to trace cell lineages and determine the clonal composition of the developing mouthparts, especially the mandibular segment. From our data it is evident that the paragnaths are sternal outgrowths of the mandible segment. The assumption of the limb nature of paragnaths and the presence of an additional head segment between the mandibular and the second antennal segments are clearly refuted by our data. Our results show the power of cell lineage and clonal analyses for inferences on the nature, origin and thus homology of morphological structures. With this kind of investigation morphological and gene expression data can be complemented. We discuss notable similarities of paragnath anlagen to those of the hypopharynx complex in myriapods and hexapods. The fact that both structures grow out as two lateral buds in the same region of the mandibular

  7. High-dose continuous oxacillin infusion results in achievement of pharmacokinetics targets in critically ill patients with deep sternal wound infections following cardiac surgery.

    PubMed

    Nesseler, Nicolas; Verdier, Marie-Clémence; Launey, Yoann; Malherbe, Alexandre; Dermu, Marine; Piau, Caroline; Flécher, Erwan; Tribut, Olivier; Mallédant, Yannick; Seguin, Philippe

    2014-09-01

    Knowledge regarding antimicrobial therapy strategies in deep sternal wound infections (DSWI) following cardiac surgery is limited. Therefore, we aimed to determine the steady-state plasma and mediastinal concentrations of oxacillin administered by continuous infusion in critically ill patients with DSWI and to compare these concentrations with the susceptibility of staphylococci recovered. A continuous infusion of oxacillin (150 to 200 mg/kg of body weight/24 h) was administered after a loading dose (50 mg/kg). Plasma and mediastinal concentrations of total and unbound oxacillin were determined 4 h after the loading dose (H4) and then at day 1 (H24) and day 2 (H48). Twelve patients were included. Nine patients exhibited bacteremia, 5 were in septic shock, 8 were positive for Staphylococcus aureus, and 4 were positive for coagulase-negative staphylococci. The median MIC (first to third interquartile range) was 0.25 (0.24 to 0.41) mg/liter. Median plasma concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 64.4 (41.4 to 78.5) and 20.4 (12.4 to 30.4) mg/liter, 56.9 (31.4 to 80.6) and 21.7 (6.5 to 27.3) mg/liter, and 57.5 (32.2 to 85.1) and 20 (14.3 to 35.7) mg/liter. The median mediastinal concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 2.3 (0.7 to 25.9) and 0.9 (<0.5 to 15) mg/liter, 29.1 (19.7 to 38.2) and 12.6 (5.9 to 19.8) mg/liter, and 31.6 (14.9 to 42.9) and 17.1 (6.7 to 26.7) mg/liter. High-dose oxacillin delivered by continuous infusion is a valuable strategy to achieve our pharmacokinetic target (4× MIC) at the site of action at H24. But concerns remain in cases of higher MICs, emphasizing the need for clinicians to obtain the MICs for the bacteria and to monitor oxacillin concentrations, especially the unbound forms, at the target site. PMID:24982092

  8. Antibiotic cement was associated with half the risk of re-revision in 1,154 aseptic revision total knee arthroplasties

    PubMed Central

    Bini, Stefano A; Chan, Priscilla H; Inacio, Maria C S; Paxton, Elizabeth W; Khatod, Monti

    2016-01-01

    Background and purpose Aseptic revisions comprise 80% of revision total knee arthroplasties (TKAs). We determined the incidence of re-revision TKA, the reasons for re-revision, and risk factors associated with these procedures. Patients and methods We conducted a retrospective cohort study of 1,154 patients who underwent aseptic revision TKA between 2002 and 2013 and were followed prospectively by a total joint replacement registry in the USA. Revision was defined as any operation in which an implanted component was replaced. Patient-, surgeon-, and procedure-related risk factors were evaluated. Survival analyses were conducted. Results There were 114 re-revisions (10%) with a median time to reoperation of 3.6 years (interquartile range (IQR): 2.6–5.2). The infection rate was 2.9% (34/1,154) and accounted for 30% of re-revisions (34 of 114). In adjusted models, use of antibiotic-loaded cement was associated with a 50% lower risk of all-cause re-revision surgery (hazard ratio (HR) = 0.5, 95% CI: 0.3–0.9), age with a 20% lower risk for every 10-year increase (HR = 0.8, CI: 0.7–1.0), body mass index (BMI) with a 20% lower risk for every 5-unit increase (HR = 0.8, CI: 0.7–1.0), and a surgeon’s greater cumulative experience (≥ 20 cases vs. < 20 cases) with a 3 times higher risk of re-revision (HR = 2.8, CI: 1.5–5). Interpretation Revised TKAs were at high risk of subsequent failure. The use of antibiotic-loaded cement, higher age, and higher BMI were associated with lower risk of further revision whereas a higher degree of surgeon experience was associated with higher risk. PMID:26472086

  9. Long-term Treatment of Teicoplanin for Methicillin-resistant Staphylococcus aureus Sternal Osteomyelitis with Renal Impairment: A Case of High Teicoplanin Trough Levels Maintained by Therapeutic Drug Monitoring.

    PubMed

    Shiohira, Hideo; Nakamatsu, Masashi; Kise, Yuya; Higa, Futoshi; Tateyama, Masao; Hokama, Nobuo; Kuniyoshi, Yukio; Ueda, Shinichiro; Nakamura, Katsunori; Fujita, Jiro

    2016-01-01

    Teicoplanin, a glycopeptide antibiotic for methicillin-resistant Staphylococcus aureus, is recommended for therapeutic drug monitoring during treatment. Maintaining a high trough range of teicoplanin is also recommended for severe infectious disease. However, the optimal dose and interval of treatment for severe renal impairment is unknown. We report a 79-year-old man who received long-term teicoplanin treatment for methicillin-resistant Staphylococcus aureus bacteremia due to postoperative sternal osteomyelitis with renal impairment. Plasma teicoplanin trough levels were maintained at a high range (20-30 μg/mL). Although the patient required long-term teicoplanin treatment, a further decline in renal function was not observed, and blood culture remained negative after the start of treatment. Teicoplanin treatment that is maintained at a high trough level by therapeutic drug monitoring might be beneficial for severe methicillin-resistant Staphylococcus aureus infection accompanied by renal impairment. PMID:27592834

  10. Marked MMP-2 transcriptional up-regulation in mononuclear leukocytes invading the subarachnoidal space in aseptic suppurative steroid-responsive meningitis-arteritis in dogs.

    PubMed

    Schwartz, M; Puff, C; Stein, V M; Baumgärtner, W; Tipold, A

    2010-02-15

    Canine Steroid-Responsive Meningitis-Arteritis (SRMA) is a suitable animal model for studies on the development of neutrophilic pleocytosis in aseptic meningitis. Samples of dogs in the acute phase of SRMA (n=16) were examined for gene expression of matrix metalloproteinases (MMP)-2 and -9 and tissue inhibitors of metalloproteinases (TIMP)-1 and -2. Results were compared to those of dogs under glucocorticosteroid treatment for SRMA (n=16) and dogs with other inflammatory and neoplastic diseases of the central nervous system (CNS) (n=19). Samples included mononuclear (PBMCs) and polymorphonuclear cells (PBPMNs) of peripheral blood and cerebrospinal fluid white blood cells (CSF WBCs). In the acute phase of SRMA CSF WBCs showed mRNA expression for MMP-2 and -9 and TIMP-1 and -2, highlighting a contribution of these cells to the overall content of MMPs and TIMPs in CSF. MMP-2 mRNA levels in CSF WBCs were significantly up-regulated in comparison to PBMC expression levels, suggesting that MMP-2 is relevant for PBMC invasion into the subarachnoidal space and that the expression is influenced by migratory activity through the blood-CSF-barrier. PMID:19733404

  11. A retrospective epidemiological study of clinical signs and familial predisposition associated with aseptic meningitis in the Norwegian population of Nova Scotia duck tolling retrievers born 1994–2003

    PubMed Central

    Anfinsen, Kristin P.; Berendt, Mette; Liste, Flora J.H.; Haagensen, Therese R.; Indrebo, Astrid; Lingaas, Frode; Stigen, Oyvind; Alban, Lis

    2008-01-01

    Aseptic meningitis (AM) is a disease that causes grave clinical signs such as intensive neck pain, fever, and lethargy. The severity of this disease is reflected in the fact that affected animals require long-term, and in chronic cases, lifelong therapy with corticosteroids. A number of dogs must be euthanized because of therapeutic failure. In recent years, the Norwegian population of Nova Scotia duck tolling retrievers has experienced an increase in individuals with AM. The aim of the present study was to investigate the prevalence of AM and to pursue the suspicion of hereditary factors influencing an accumulation of AM cases in the breed. Using the Norwegian Kennel Club registery, a random sample (362 dogs) stratified by year of birth was drawn from the total population born from 1994 to 2003 (1525 individuals). The owners were contacted and questioned about clinical signs of AM in their dogs. Subsequently, the practising veterinarians and the breeders of positive responders were contacted in order to confirm a clinical diagnosis of AM and to identify possible affected family members. Pedigrees of AM positive individuals and affected relatives were investigated. The study estimated a prevalence of AM of 2.5%. For all affected dogs, it was possible to trace the pedigree of both parents of affected dogs back to a specific founder dog. The genealogical investigation strongly indicates that genetic factors are involved in the etiology of the disease. PMID:18783024

  12. Elucidation of Echovirus 30's Origin and Transmission during the 2012 Aseptic Meningitis Outbreak in Guangdong, China, through Continuing Environmental Surveillance

    PubMed Central

    Lu, Jing; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen

    2015-01-01

    An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804

  13. Elucidation of echovirus 30's origin and transmission during the 2012 aseptic meningitis outbreak in Guangdong, China, through continuing environmental surveillance.

    PubMed

    Lu, Jing; Zheng, Huanying; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen

    2015-04-01

    An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804

  14. Ibandronate and cementless total hip arthroplasty: densitometric measurement of periprosthetic bone mass and new therapeutic approach to the prevention of aseptic loosening

    PubMed Central

    Muratore, Maurizio; Quarta, Eugenio; Quarta, Laura; Calcagnile, Fabio; Grimaldi, Antonella; Orgiani, M. Antonio; Marsilio, Antonio; Rollo, Giuseppe

    2012-01-01

    Summary Studies of the mechanisms of periprosthetic bone loss have led to the development of pharmacologic strategies intended to enhance bone mass recovery after surgery and consequently prevent aseptic loosening and prolong the implant survival. Bisphosphonates, potent anti-resorptive drugs widely used in the treatment of osteoporosis and other disorders of bone metabolism, were shown to be particularly effective in reducing periprosthetic bone resorption in the first year after hip and knee arthroplasty, both cemented and cementless. Based on these results, we investigated the inhibitory effects of ibandronate on periprosthetic bone loss in a 2-year study of postmenopausal women that underwent cementless total hip arthroplasty. In the first 6 months both groups (A, treated with ibandronate 3 mg i.v. within five days after surgery and then with oral ibandronate 150 mg/month, plus calcium and vitamin D supplementation; and B, treated with calcium and vitamin D supplementation only) experienced bone loss, though to a lesser extent in group A. After 12 months, group A showed a remarkable BMD recovery, that was statistically significant versus baseline values (about +1, 74% of global BMD) and most evident in region R1 (+3, 81%) and R2 (+4, 12%); in group B, on the contrary, BMD values were unchanged compared with those at 6 months post-surgery. Quality of life scores also showed a greater improvement in group A, both at 6 and 12 months after surgery, likely because of the pain-reducing effects of ibandronate treatment. PMID:22783337

  15. Sensory Characteristics and Consumer Acceptance of Frozen Cooked Rice by a Rapid Freezing Process Compared to Homemade and Aseptic Packaged Cooked Rice

    PubMed Central

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong

    2013-01-01

    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars–IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p<0.05) in IM and SD cultivars. The differences in sensory characteristics between the FCR and ACR were larger than the equivalent differences between the FCR and HCR. Overall consumer acceptance ratings for FCR in overall aspect, appearance, aroma, and texture were not significantly different compared to those for HCR (p>0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  16. Sensory characteristics and consumer acceptance of frozen cooked rice by a rapid freezing process compared to homemade and aseptic packaged cooked rice.

    PubMed

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong

    2013-03-01

    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars-IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p<0.05) in IM and SD cultivars. The differences in sensory characteristics between the FCR and ACR were larger than the equivalent differences between the FCR and HCR. Overall consumer acceptance ratings for FCR in overall aspect, appearance, aroma, and texture were not significantly different compared to those for HCR (p>0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  17. [Treatment of pseudoarthrosis of the carpal scaphoid with fibrin glue].

    PubMed

    Carozzi, S

    1983-08-01

    The author think that "Fibrin Seal Glue" and mechanical syntesis is an opimal method for osteosintesis of the Carpal scaphoid. He speaks about 5 patients treated with optimal results in 50 days mean. PMID:6395974

  18. Does incineration turn infectious waste aseptic?

    PubMed

    Kanemitsu, K; Inden, K; Kunishima, H; Ueno, K; Hatta, M; Gunji, Y; Watanabe, I; Kaku, M

    2005-08-01

    Incineration of infectious waste is considered to be biologically safe. We performed basic experiments to confirm that bacillus spores are killed by incineration in a muffle furnace. Biological samples containing 10(6) spores of Bacillus stearothermophilus were placed in stainless steel Petri dishes and then into hot furnaces. The furnace temperature and duration of incineration were 300 degrees C for 15 min, 300 degrees C for 30 min, 500 degrees C for 15 min, 500 degrees C for 30 min and 1100 degrees C for 3 min. We confirmed that all spores of B. stearothermophilus were killed at each of these settings. The effect of incineration seems to be equivalent to that of sterilization, based on the satisfactory sterilization assurance level of 10(-6). PMID:15963601

  19. [Treatment of long tubular bone pseudoarthrosis with revascularized cortical layer of radius].

    PubMed

    Milanov, N O; Trofimov, E I; Umerenkov, A G

    1997-01-01

    The method of osteogenesis without resection of the false joint was employed in the treatment of long tubular bone pseudarthrosis. The authors used a free revascularized radial flap, including the corticoperiosteal layer of the radius as a source of osteogenesis. A thin corticoperiosteal graft was taken from the distal third of the radius with or without a skin flap, if necessary. The graft was placed into the slotted bed of the false joint and fixed by two screws. Final fixation was made by using an Ilizarov apparatus or a metal plate. The authors used this procedure in the treatment of 12 patients with long tubular bone pseudarthrosis who had undergone at two operations on the false joint or fracture. Eight patients suffered from chronic osteomyelitis. Eleven patients completely recovered at postoperative month 12. Radiographic and scintigraphic investigations showed signs of bed-graft adhesion at month 3 after surgery and those of false joint ossification at month 6 postoperatively. PMID:9376741

  20. Hyperbaric oxygen therapy for primary sternal osteomyelitis: a case report

    PubMed Central

    2013-01-01

    Introduction Primary osteomyelitis of the sternum is a rare condition, which accounts for 0.3% of all cases of osteomyelitis reported in the literature. The diagnosis requires a high degree of suspicion and confirmation by percutaneous biopsy. The treatment consists of resection of the periosteum and affected bone. Despite reports of successful conservative treatment using antibiotics alone, early surgical intervention plus bacterial control is the definitive treatment; it reduces morbidity, and is the most cost-effective approach for the patient. We report a case of primary osteomyelitis surgically treated with debridement and antibiotics, followed by hyperbaric oxygen therapy. Case presentation A 39-year-old Brazilian man without a significant medical history presented with primary osteomyelitis. After a normal chest radiograph and normal laboratory test results, he was treated with 2 weeks of nonsteroidal anti-inflammatory drugs. One month later a presumptive diagnosis of Tietze syndrome was made and he was prescribed prednisolone (60mg/day) for 3 weeks. The following month he presented to our service with swelling, redness, and warmth in the area between his left third and fourth ribs. Subsequent magnetic resonance imaging revealed a large collection of liquid (8.8×6.8×20.2cm) in his chest wall, between the body and the manubrium of the sternum. An area of soft, friable tissue with a large amount of pus was found in his sternum during surgical debridement. Subsequent treatment consisted of antibiotic therapy using metronidazole and cefotaxime plus hyperbaric oxygen therapy. On postoperative day 10 the incision was sutured. The patient was discharged on postoperative day 15 on a regimen of oral ciprofloxacin, and completed hyperbaric oxygen therapy as an out-patient. Conclusions The satisfying outcome of this patient reflects the quick action to promote surgical debridement and use of antibiotics, which are both recommended treatments. The closure of the wound in 10 days after debridement suggests that the hyperbaric oxygen therapy might have indirectly, but not conclusively, aided in the premature closure of the wound, avoiding a longer healing by second intention or muscle flap rotation closure. PMID:23806012

  1. An aseptic meningitis picture from incipient brain abscess.

    PubMed

    Singer, J I

    1992-08-01

    A preadolescent with headache and stiff neck presented for emergency department care. The presumptive diagnosis of viral meningitis was entertained on the basis of clinical examination and cerebrospinal fluid analysis. Events subsequent to his release from the department formed the stimulus for this report. It is apparent that patients with complicated sinusitis may present with a constellation of findings consistent with viral meningitis. PMID:1513739

  2. Pituitary abscess: an unusual presentation of "aseptic meningitis".

    PubMed

    Schwartz, I D; Zalles, M C; Foster, J L; Burry, V F

    1995-01-01

    Granulomatous inflammation of the pituitary and pituitary abscesses are rare entities. These conditions are found even more rarely in the pediatric aged population. We report a case of a radiographic and clinical, sterile pituitary abscess with non-caseating granulomatous inflammation in a girl who presented with hypopituitarism, meningeal irritation, and symptoms of pituitary apoplexy. PMID:7584709

  3. Gravity, chromosomes, and organized development in aseptically cultured plant cells

    NASA Technical Reports Server (NTRS)

    Krikorian, Abraham D.

    1993-01-01

    The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.

  4. Aseptic polyurethane carotid patch rejection: complication, allergy or miraculous healing?

    PubMed

    Tshomba, Y; De Dominicis, D; Marone, E M; Mascia, D; Sanvito, F; Chiesa, R

    2011-12-01

    Carotid endarterectomy plays an important role in the prevention of ischemic stroke; patching could reduce the risk of intra- and postoperative complications and late restenosis among primary closure. Materials actually available for the patch tailoring are synthetic or biological: which is the best is still debated. We present the case of a polyurethane (PU) carotid patch rejection three years after its implant, with no evident arterial discontinuity and no sign of infection. Histopathological analysis on hematoxylin-eosin stained sections of the regenerated arterial wall tissue removed revealed plasma cell infiltration and clusters of foreign body giant cells. PU patch rejection has been seldom described in literature. This is an unusual late complication that should be considered at long-term follow-up evaluation of these patients. PMID:21750481

  5. A Rare Case of Crowned Dens Syndrome Mimicking Aseptic Meningitis

    PubMed Central

    Takahashi, Teruyuki; Minakata, Yugo; Tamura, Masato; Takasu, Toshiaki; Murakami, Marohito

    2013-01-01

    Background Crowned dens syndrome (CDS), related to microcrystalline deposition in the periodontoid process, is the main cause of acute or chronic cervical pain. Microcrystal-line deposition most often consists of calcium pyrophosphate dehydrate crystals and/or hydroxyapatite crystals. Case Presentation This report describes the case of an 89-year-old woman who presented with sudden onset, high fever, severe occipital headache, and neck stiffness. A laboratory examination revealed a markedly elevated white blood cell count (11,100/µl) and C-reactive protein level (23.8 mg/dl). These clinical findings suggested severe infection such as meningitis with sepsis. However, the results of blood culture, serum endotoxin, and procalcitonin were all negative, and cerebrospinal fluid studies revealed only a slight abnormality. The patient was first diagnosed with meningitis and treated with antiviral and antibiotic agents as well as non-steroidal anti-inflammatory drugs, but they only had limited effects. A cervical plain computed tomography (CT) scan and its three-dimensional (3D) reconstruction detected a remarkable crown-like calcification surrounding the odontoid process. On the basis of the CT findings, the patient was diagnosed as a severe case of CDS and was immediately treated with corticosteroids. The patient's condition drastically improved within a week after one course of corticosteroid therapy. Conclusion Some atypical symptoms of CDS are misleading and may be misdiagnosed as meningitis, as happened in our case. A CT scan, especially a 3D-CT scan, is necessary and useful for a definitive diagnosis of CDS. CDS should be considered as a differential diagnosis of a possible etiology for fever, headache, and cervical pain of unknown origin. PMID:23569451

  6. Percutaneous Pedicle Screw Fixation with Polymethylmethacrylate Augmentation for the Treatment of Thoracolumbar Intravertebral Pseudoarthrosis Associated with Kummell's Osteonecrosis.

    PubMed

    Kim, Hyeun-Sung; Heo, Dong-Hwa

    2016-01-01

    Purpose. The purpose of our study is to evaluate the therapeutic efficacy of short-segment percutaneous pedicle screw fixation with polymethylmethacrylate (PMMA) augmentation for the treatment of osteoporotic thoracolumbar compression fracture with osteonecrosis. Methods. Osteoporotic thoracolumbar compression fractures with avascular necrosis were treated by short-segment PPF with PMMA augmentation. Eighteen were followed up for more than 2 years. The kyphotic angle, compression ratio, visual analog scale (VAS) score for back pain, and the Oswestry Disability Index (ODI) were analyzed. In addition, radiologic and clinical parameters of PPF group were compared with percutaneous vertebroplasty (PVP) group. Results. Vertebral height and kyphotic angle of the compressed vertebral bodies were significantly corrected after the operation (P < 0.05). Further, restored vertebral height was maintained during the 2 or more years of postoperative follow-up. Compared to the PVP group the postoperative compression ratio and kyphotic angle were significantly lower in the PPF group (P < 0.05). The postoperative ODI and VAS of the PVP group were significantly higher than the PPF (P < 0.05). Conclusions. According to our results, short-segment PPF with PMMA augmentation may be an effective minimally invasive treatment for osteoporosis in cases of osteoporotic vertebral compression fractures with Kummell's osteonecrosis. PMID:27595101

  7. Percutaneous Pedicle Screw Fixation with Polymethylmethacrylate Augmentation for the Treatment of Thoracolumbar Intravertebral Pseudoarthrosis Associated with Kummell's Osteonecrosis

    PubMed Central

    2016-01-01

    Purpose. The purpose of our study is to evaluate the therapeutic efficacy of short-segment percutaneous pedicle screw fixation with polymethylmethacrylate (PMMA) augmentation for the treatment of osteoporotic thoracolumbar compression fracture with osteonecrosis. Methods. Osteoporotic thoracolumbar compression fractures with avascular necrosis were treated by short-segment PPF with PMMA augmentation. Eighteen were followed up for more than 2 years. The kyphotic angle, compression ratio, visual analog scale (VAS) score for back pain, and the Oswestry Disability Index (ODI) were analyzed. In addition, radiologic and clinical parameters of PPF group were compared with percutaneous vertebroplasty (PVP) group. Results. Vertebral height and kyphotic angle of the compressed vertebral bodies were significantly corrected after the operation (P < 0.05). Further, restored vertebral height was maintained during the 2 or more years of postoperative follow-up. Compared to the PVP group the postoperative compression ratio and kyphotic angle were significantly lower in the PPF group (P < 0.05). The postoperative ODI and VAS of the PVP group were significantly higher than the PPF (P < 0.05). Conclusions. According to our results, short-segment PPF with PMMA augmentation may be an effective minimally invasive treatment for osteoporosis in cases of osteoporotic vertebral compression fractures with Kummell's osteonecrosis. PMID:27595101

  8. Single sternal metastasis due to malignant melanoma with unexpected long-term survival: a case report

    PubMed Central

    Gogakos, Apostolos S; Paliouras, Dimitrios; Asteriou, Christos; Rallis, Thomas; Lazopoulos, Achilleas; Chatzinikolaou, Fotios; Zissimopoulos, Athanassios; Tsavlis, Drosos; Tsirgogianni, Katerina; Zarogoulidis, Konstantinos; Porpodis, Konstantinos; Tsakiridis, Kosmas; Pitsiou, Georgia; Kioumis, Ioannis; Karapantzos, Ilias; Karapantzou, Chrysanthi; Sachpekidis, Nikos; Zarogoulidis, Paul; Barbetakis, Nikolaos

    2016-01-01

    Metastases from melanoma have a very poor prognosis for the patient. Single metastatic lesions in the sternum due to melanoma are extremely rare. A rare case of a presternal mass in a 56-year-old patient who had undergone excision for malignant melanoma is presented. Review of the patient’s history and surgical resection of a single metastatic soft tissue lesion offer the best chance of long-term survival. PMID:26848270

  9. Sternal wound infection after cardiac surgery: incidence and risk factors according to clinical presentation.

    PubMed

    Lemaignen, A; Birgand, G; Ghodhbane, W; Alkhoder, S; Lolom, I; Belorgey, S; Lescure, F-X; Armand-Lefevre, L; Raffoul, R; Dilly, M-P; Nataf, P; Lucet, J C

    2015-07-01

    The incidence of surgical site infection (SSI) after cardiac surgery depends on the definition used. A distinction is generally made between mediastinitis, as defined by the US Centers for Disease Control and Prevention (CDC), and superficial SSI. Our objective was to decipher these entities in terms of presentation and risk factors. We performed a 7-year single centre analysis of prospective surveillance of patients with cardiac surgery via median sternotomy. SSI was defined as the need for reoperation due to infection. Among 7170 patients, 292 (4.1%) developed SSI, including 145 CDC-defined mediastinitis (CDC-positive SSI, 2.0%) and 147 superficial SSI without associated bloodstream infection (CDC-negative SSI, 2.1%). Median time to reoperation for CDC-negative SSI was 18 days (interquartile range, 14-26) and 16 (interquartile range, 11-24) for CDC-positive SSI (p 0.02). Microorganisms associated with CDC-negative SSI were mainly skin commensals (62/147, 41%) or originated in the digestive tract (62/147, 42%); only six were due to Staphylococcus aureus (4%), while CDC-positive SSI were mostly due to S. aureus (52/145, 36%) and germs from the digestive tract (52/145, 36%). Risk factors for SSI were older age, obesity, chronic obstructive bronchopneumonia, diabetes mellitus, critical preoperative state, postoperative vasopressive support, transfusion or prolonged ventilation and coronary artery bypass grafting, especially if using both internal thoracic arteries in female patients. The number of internal thoracic arteries used and factors affecting wound healing were primarily associated with CDC-negative SSI, whereas comorbidities and perioperative complications were mainly associated with CDC-positive SSI. These 2 entities differed in time to revision surgery, bacteriology and risk factors, suggesting a differing pathophysiology. PMID:25882356

  10. A case of syphilitic aortic aneurysm with sternal erosion and impending rupture.

    PubMed

    Mohamed Sarjun Basha, Khadhar; Raman, Karthik; Ahmed, Sheriff Ejaz; Latchumanadoss, Kalidoss; Rajan, Sethuratnam

    2016-02-01

    Syphilitic aortic aneurysm is a rare occurrence in the current antibiotic era. Cardiovascular syphilis has nearly disappeared in developed countries, although it remains a factor in differential diagnosis in developing nations. We report a case of syphilitic aortic aneurysm eroding through the sternum in a 52-year-old man who underwent successful surgical repair. PMID:25344618