Science.gov

Sample records for aseptic sternal pseudoarthrosis

  1. Sternal Talon, a novel repair for sternal dehiscence

    PubMed Central

    Keita, Luther; Veerasingam, Dave

    2015-01-01

    Sternal dehiscence is a recognised complication after median sternotomy, occurring in 0.5-5% of cases with or without infection. A 72-year-old man presenting with collapse and ventricular tachycardia was investigated for a possible acute cardiac event 2 years after coronary artery bypass grafting for ischemic heart disease. Work-up chest X-ray showed displacement of all sternal wires, and computed tomography (CT) performed to investigate further showed sternal dehiscence with right ventricle wall herniation through the defect and sternal wire breakdown. A decision was made after discussion with the patient to repair the defect using 3 Sternal Talon devices and 2 sternal wires. The patient made an uncomplicated recovery, and the outpatient clinic review after discharge home showed satisfactory and stable sternal union. We report a case of non-infected sternal dehiscence managed successfully with the Sternal Talon without long-term complications. PMID:26336499

  2. Sternal exploration or closure

    MedlinePlus

    ... M, Austin K, Coulen C, Boyle D. Implementing evidence-based practice findings to decrease postoperative sternal wound infections following open heart surgery. Journal of Cardiovascular Nursing. October 2005; 20(5): ...

  3. Sternal mycobacterial infections

    PubMed Central

    Yuan, Shi-Min

    2016-01-01

    Sternal mycobacterial infections are rare. Due to the rarity, its clinical characteristics, diagnoses, and regular management strategies are still scanty. A total of 76 articles on this topic were obtained by a comprehensive literature collection. The clinical features, diagnosis, management strategies and prognosis were carefully analyzed. There were totally 159 patients including 152 (95%) cases of tuberculosis (TB) and seven (5%) cases of non-TB sternal infections. Sternal mycobacterial infections can be categorized into three types: Primary, secondary, and postoperative, according to the pathogenesis; and categorized into isolated, peristernal, and multifocal, according to the extent of the lesions. Microbiological investigation is more sensitive than medical imaging and Mantoux tuberculin skin test in the diagnosis of sternal infections. Most patients show good responses to the standard four-drug regimen and a surgical intervention was necessary in 28.3% patients. The prognoses of the patients are good with a very low mortality. A delayed diagnosis of sternal mycobacterial infections may bring about recurrent sternal infections and sustained incurability. An early diagnosis and prompt antibiotic regimens may significantly improve the patients' outcomes. PMID:27168857

  4. Primary Sternal Osteomyelitis Caused by Actinomyces israelii

    PubMed Central

    Lee, Jun Ho; Jeon, Seok Chol; Jang, Hyo-Jun; Kim, Hyuck; Kim, Young Hak; Chung, Won-Sang

    2015-01-01

    Primary sternal osteomyelitis is a rare disease. Common infectious organisms causing primary sternal osteomyelitis include Staphylococcus aureus and Pseudomonas aeruginosa. Actinomyces species are common saprophytes of the oral cavity, but there have been few reports in the literature of primary sternal osteomyelitis caused by Actinomyces species. We describe a case of primary sternal osteomyelitis caused by Actinomyces israelii without pulmonary involvement. PMID:25705607

  5. A comparative study of two types of sternal pins used for sternal closure: poly-L-lactide sternal pins versus uncalcined hydroxyapatite poly-L-lactide sternal pins.

    PubMed

    Fu, Xian-ming; Oshima, Hideki; Araki, Yoshimori; Narita, Yuji; Mutsuga, Masato; Okada, Noritaka; Tsunekawa, Tomohiro; Usui, Akihiko

    2013-12-01

    Bioabsorbable poly-L-lactide (PLLA) sternal pins are applied to reinforce sternal closure during cardiac surgery. However, these pins lack osteoconductivity. A new bioabsorbable sternal pin with osteoconductivity, made of uncalcined hydroxyapatite and poly-L-lactide (u-HA-PLLA) has been developed. This study was conducted to compare the two types of sternal pins in terms of sternal stability and healing after median sternotomy. Between October 2006 and January 2012, 105 patients underwent aortic surgery for aortic aneurysms or dissection via median sternotomy and sternal closure with sternal pins. Among these patients, 75 were followed for 12 months using serial computed tomography (CT). PLLA sternal pins were used in 30 patients (group A) and u-HA-PLLA sternal pins were used in 45 patients (group B). The incidence rates of transverse sternal dehiscence, anteroposterior displacement and complete sternal fusion were evaluated using CT. The cross-sectional cortical bone density area (CBDA) of the sternum around the sternal pins was examined to evaluate the osteoconductivity of the sternal pins. There were no significant differences between groups A and B in the sternal dehiscence rate (6.7 vs 4.4 %), sternal displacement rate (6.7 vs 2.2 %) or 12-month sternal fusion rate (63.3 vs 73.3 %). The CBDA around the sternal pins significantly increased between discharge and 12 months after surgery in group B (P < 0.001) but not in group A. These results show that u-HA-PLLA sternal pins exhibit certain osteoconductivity; however, both PLLA and u-HA-PLLA sternal pins provide comparable clinical outcomes regarding sternal stability and healing. PMID:23996506

  6. Syphilitic aseptic meningitis

    MedlinePlus

    Syphilitic aseptic meningitis is a complication of untreated syphilis. It involves inflammation of the tissues covering the ... Syphilis is a sexually transmitted disease caused by the spirochete bacteria Treponema pallidum . Syphilis has three main ...

  7. MDCT evaluation of sternal variations: Pictorial essay

    PubMed Central

    Duraikannu, Chary; Noronha, Olma V; Sundarrajan, Pushparajan

    2016-01-01

    Sternal variations and anomalies have been identified in the past during autopsy or cadaveric studies. Recently, an increasing number of minor sternal variations have been reported with the advent of multidetector computed tomography (CT). Although there are many sternal variations that occur with varying appearance and prevalence, most of them are not recognized or are underreported during routine imaging of thorax. Identification of sternal variations is important to differentiate from pathological conditions and to prevent fatal complications prior to sternal interventions like marrow aspiration or acupuncture. This article aims to describe the minor and asymptomatic sternal variations by multidetector CT and their clinical significance. PMID:27413263

  8. Failure analysis of explanted sternal wires.

    PubMed

    Shih, Chun-Ming; Su, Yea-Yang; Lin, Shing-Jong; Shih, Chun-Che

    2005-05-01

    To classify and understand the mechanisms of surface damages and fracture mechanisms of sternal wires, explanted stainless steel sternal wires were collected from patients with sternal dehiscence following open-heart surgery. Surface alterations and fractured ends of sternal wires were examined and analyzed. Eighty fractured wires extracted from 25 patients from January 1999 to December 2003, with mean implantation interval of 55+/-149 days (range 5-729 days) after cardiac surgery, were studied by various techniques. The extracted wires were cleaned and the fibrotic tissues were removed. Irregularities and fractured ends were assayed by a scanning electron microscopy. After stereomicroscopy and documentation, the explants were cleaned with 1% sodium hypochlorite to remove the blood and tissues and was followed by cleaned with deionized water and alcohol. The explants were examined by stereomicroscopy, and irregularities on surface and fracture surfaces of sternal wires were assayed by scanning electron microscopy, energy dispersive X-ray analysis (EDAX) and X-ray mapping. The explants with surrounding fibrotic tissue were stained and examined with stereomicroscopy and transmission electronic microscopy. Corrosion pits were found on the surface of explanted sternal wires. EDAX and X-ray mapping examinations revealed diminution of nickel concentration in the severely corroded pits on sternal wires. A feature of transgranular cracking was observed for stress corrosion cracking and striation character for typical corrosion fatigue was also identified. TEM examination of tissue showed the metallic particles in phagolysosomes of macrophages inside the surrounding sternal tissue. The synergic effect of hostile environment and the stress could be the precursors of failures for sternal wires. PMID:15576179

  9. Considering syphilis in aseptic meningitis.

    PubMed

    Tayal, Sarup; Chadwick, David; Chawla, Girish

    2009-12-01

    Clinicians need to consider syphilis in the differential diagnosis of macular or papular rashes with neurological conditions, particularly aseptic meningitis, as early diagnosis and treatment lead to a better prognosis. PMID:20095316

  10. Aseptic technique in microgravity.

    PubMed

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  11. Multidimensional Sternal Fixation to Overcome a “Floating” Sternum

    PubMed Central

    Rothstein, William; Spata, Tyler

    2014-01-01

    This case report describes the repair of a complete sternal dehiscence of the lower right sternum using sternal wires, manubrial plates, and a Talon closure device for rigid, multidimensional sternal fixation. Sternal dehiscence is a rare but significant cause of morbidity for patients undergoing median sternotomy. The risk factors for this complication are well described and although sternal wires have traditionally been used for primary closure, rigid fixation with sternal plates is a viable alternative to avoid dehiscence in this high-risk cohort. PMID:25379318

  12. Aseptic technique for cell culture.

    PubMed

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  13. Sternal plate fixation for sternal wound reconstruction: initial experience (Retrospective study)

    PubMed Central

    2011-01-01

    Background Median sternotomy infection and bony nonunion are two commonly described complications which occur in 0.4 - 5.1% of cardiac procedures. Although relatively infrequent, these complications can lead to significant morbidity and mortality. The aim of this retrospective study is to evaluate the initial experience of a transverse plate fixation system following wound complications associated with sternal dehiscence with or without infection following cardiac surgery. Methods A retrospective chart review of 40 consecutive patients who required sternal wound reconstruction post sternotomy was performed. Soft tissue debridement with removal of all compromised tissue was performed. Sternal debridement was carried using ronguers to healthy bleeding bone. All patients underwent sternal fixation using three rib plates combined with a single manubrial plate (Titanium Sternal Fixation System®, Synthes). Incisions were closed in a layered fashion with the pectoral muscles being advanced to the midline. Data were expressed as mean ± SD, Median (range) or number (%). Statistical analyses were made by using Excel 2003 for Windows (Microsoft, Redmond, WA, USA). Results There were 40 consecutive patients, 31 males and 9 females. Twenty two patients (55%) were diagnosed with sternal dehiscence alone and 18 patients (45%) with associated wound discharge. Thirty eight patients went on to heal their wounds. Two patients developed recurrent wound infection and required VAC therapy. Both were immunocompromised. Median post-op ICU stay was one day with the median hospital stay of 18 days after plating. Conclusion Sternal plating appears to be an effective option for the treatment of sternal wound dehiscence associated with sternal instability. Long-term follow-up and further larger studies are needed to address the indications, benefits and complications of sternal plating. PMID:21529357

  14. The biology of aseptic osteolysis.

    PubMed

    Holt, G; Murnaghan, C; Reilly, J; Meek, R M D

    2007-07-01

    Total hip arthroplasty is one of the most commonly performed and successful elective orthopaedic procedures. However, numerous failure mechanisms limit the long-term success including aseptic osteolysis, aseptic loosening, infection, and implant instability. Aseptic osteolysis and subsequent implant failure occur because of a chronic inflammatory response to implant-derived wear particles. To reduce particulate debris and their consequences, implants have had numerous design modifications including high-molecular-weight polyethylene sockets and noncemented implants that rely on bone ingrowth for fixation. Surgical techniques have improved cementation with the use of medullary plugs, cement guns, lavage of the canal, pressurization, centralization of the stem, and reduction in cement porosity. Despite these advances, aseptic osteolysis continues to limit implant longevity. Numerous proinflammatory cytokines, such as interleukin-1, interleukin-6, tumor necrosis factor-alpha, and prostaglandin E2, have proosteoclastogenic effects in response to implant-derived wear particles. However, none of these cytokines represents a final common pathway for the process of particle-induced osteoclast differentiation and maturation. Recent work has identified the fundamental role of the RANKL-RANK-NF-kappaB pathway not only in osteoclastogenesis but also in the development and function the immune system. Thus, the immune system and skeletal homeostasis may be linked in the process of osteoclastogenesis and osteolysis. PMID:17620815

  15. Management of aseptic tibial nonunion.

    PubMed

    Hak, David J

    2011-09-01

    Tibial nonunion remains a significant clinical challenge despite advances in surgical management. New techniques to help manage tibial nonunion include extracorporeal shock wave therapy and percutaneous application of bone marrow aspirate. Management strategies vary based on the type of nonunion: aseptic or infected, and atrophic or hypertrophic. Extracorporeal shock wave therapy has been shown to be as effective as surgical management in patients with stable hypertrophic nonunion. New fixation options include locked plates and intramedullary compression nails. Novel methods of external fixation have been developed for bone graft harvest from the intramedullary canal. Several biologic adjuncts also are available, including bone marrow aspirates, stem cells, and bone morphogenetic protein. PMID:21885702

  16. [Overview of primary sternal closure techniques].

    PubMed

    Nešpor, D; Fila, P; Černý, J; Němec, P

    2015-02-01

    The aim of the overview study is to describe the currently used methods of primary median sternotomy closure in adult cardiac surgery. In the review of published literature, we draw on the data and focus on the methodology, indications, advantages, limitations, biomechanical and clinical results of the different methods in relation to the incidence of deep sternal wound complications after median sternotomy in adult cardiac surgery.Key words: sternum sternotomy adult cardiac surgery surgical procedures. PMID:25659253

  17. Basics of sterile compounding: aseptic processing.

    PubMed

    Akers, Michael J

    2015-01-01

    This article discusses factors that affect the assurance of sterility of an aseptic process operation and balances what is required/practiced in the pharmaceutical industry via the U.S. Food and Drug Administration and European aseptic processing guidelines and what is required/practiced in compounding pharmacies via the United States Pharmacopeia (USP) General Chapter <797>. PMID:25902628

  18. [SAPHO syndrome and aseptic osteitis].

    PubMed

    Cotten, A; Boutry, N; Demondion, X; Chastanet, P; Flipo, R M

    1997-01-01

    Palmoplantar pustulosis and severe acne are sometimes associated with aseptic skeletal lesions, but such skeletal conditions can be observed without skin lesions. The acronym SAPHO (Synovitis, Acne, Palmoplantar pustulosis, Hyperostosis, Osteitis) has been suggested for this cluster of manifestations. The most frequent site of the disease is the upper anterior chest wall, characterized by predominantly osteosclerotic lesions, hyperostosis, and arthritis of the adjacent joints. Osteosclerosis of the vertebral bodies, hyperostosis, and erosions of the vertebral plates can be encountered. Unilateral sacroiliitis of frequently observed. Long bone involvement consists of osteosclerosis or osteolysis with periosteal new bone formation. Peripheral arthritis is rarely associated with joint destruction. The pathogenesis of this syndrome remains unknown, but a link with seronegative spondylarthropathies is probable. Awareness of the SAPHO syndrome should facilitate proper diagnosis and treatment. PMID:9810077

  19. Simultaneous surgery of the aortic valve and sternal osteomyelitis.

    PubMed

    Urbanski, Paul P; Lindemann, Yvonne; Babin-Ebell, Jörg; Fröhner, Steffen; Diegeler, Anno

    2009-09-01

    A 64-year-old man was referred for aortic valve replacement due to severe stenosis. He also suffered chronic sternal osteomyelitis with skin fistula subsequent to radiation therapy. Both pathologies were approached simultaneously by sternal resection, omental plasty, and valve replacement, which led to favorable primary and mid-term result. PMID:19699936

  20. Sternal fractures: retrospective analysis of 100 cases.

    PubMed

    Athanassiadi, Kalliopi; Gerazounis, Michalis; Moustardas, Marios; Metaxas, Efstathios

    2002-10-01

    Isolated sternal fractures are seen with increasing frequency in road accidents, especially since the introduction of seatbelt legislation. The medical records of all our patients who were treated with a diagnosis of sternal fracture (SF) over the past two decades were retrospectively reviewed to determine the incidence, morbidity, and mortality of this entity. Between 1984 and 1998, 100 consecutive patients were admitted to the Department of Surge Surgery, General Hospital of Nikea-Piraeus, Greece, for SF. There were 72 men and 28 women ranging in age between 17 and 84 years. Sixty-seven patients sustained an isolated SF and the remaining 33 had a SF in combination with multiple injuries such as flail chest (n = 19), head injury (n = 18), limb fractures (n = 10), spinal fractures (n = 4), hear contusion (n = 1), hemo-pneumothorax (n = 9), pneumothorax (n = 6), hemomediastinum (n = 5), and pericarditis (n = 2), among others. All patients with a radiological diagnosis were admitted for cardiac monitoring for at least 24 hours. Electrocardiogram (ECG), determinations of cardiac enzyme levels such as lactic dehydrogenase, creatine kinase, and creatine kinase-MB, and evaluation by a cardiologist were routinely performed. An echocardiogram was performed as indicated by the cardiologist. Seven patients underwent operation, two for abdominal bleeding, two for chest wall and sternal stabilization, two for open pneumothorax, and one for massive hemothorax. Eight of our patients needed ventilatory support. Four of them died from respiratory insufficiency, myocardial infarction, and heart and lung contusion. Although an isolated SF carries a good prognosis, careful evaluation and clinical observation are essential. PMID:12181604

  1. Treatment of Sternal Wound Infection Using a Free Myocutaneous Flap.

    PubMed

    Chiang, I-han; Chen, Shyi-Gen; Wang, Chih-Hsin

    2015-11-01

    Deep sternal wound infections are potentially life-threatening complications after cardiac operations because they can spread into the mediastinum and cause postoperative morbidity and mortality. We present a 65-year-old man with a history of coronary artery bypass grafting. A large sternal defect was left after debridement. After brief vacuum-assisted closure (VAC), a free myocutaneous flap of the anterolateral thigh (ALT) was used to fill the dead space. At the 9-month follow-up, the wound had healed completely without tissue loss or complications, and the patient returned to normal life. This was a successful treatment of a deep sternal wound with free flap coverage. PMID:26522542

  2. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  3. A deep sternal wound infection caused by Ureaplasma urealyticum.

    PubMed

    Lucke, Katja; Kuster, Stefan P; Bertea, Mihai; Ruef, Christian; Bloemberg, Guido V

    2010-10-01

    Ureaplasma species are usually associated with infection of the urogenital tract. An unusual case of a sternal wound infection caused by Ureaplasma urealyticum in a 41-year-old male after aortic valve replacement is described. PMID:20616189

  4. Closing the cleft over a throbbing heart: neonatal sternal cleft

    PubMed Central

    J, Ashok Raja; G, Mathevan; K, Mathiarasan; P, Ramasubramaniam

    2014-01-01

    Sternal cleft is a rare anomaly comprising 0.5% of chest wall malformations. We present a case of a neonate with a ‘V’-shaped upper partial sternal cleft at birth. A hyperpigmented cutaneous nevi was present over the cleft. Primary approximation and closure of the defect was performed at 1 week of life. We discuss the presentation and management, and review the literature. PMID:25100810

  5. Trimethoprim-sulfamethoxazole-induced aseptic meningitis.

    PubMed Central

    Wambulwa, Charles; Bwayo, Salome; Laiyemo, Adeyinka O.; Lombardo, Fredric

    2005-01-01

    We present a 46-year-old African-American man with AIDS who was admitted on two different occasions within three weeks for signs and symptoms of meningitis after using trimethoprim/sulfamethoxazole (TMP/SMX). TMP/SMX is primarily used for the treatment of pneumocystis carinii pneumonia prophylaxis in AIDS patients. Drug-induced aseptic meningitis (DIAM) is commonly seen with nonsteroidal anti-inflammatory drugs (NSAIDS), antibiotics (with TMP/SMX being the most frequently implicated), intravenous immunoglobulins and OKT3 antibodies. However, the implication of TMP/SMX inducing aseptic meningitis has been underreported to FDA/MEDWATCH program. This might be due to the fact that it has also been used to treat bacterial meningitis from organisms like Listeria monocytogenes, which is a common pathogen in the elderly and in infants. We reviewed the literature in an attempt to characterize the pattern and predictors of TMP/SMX-induced aseptic meningitis. PMID:16396068

  6. Percutaneous Transpedicular Interbody Fusion Technique in Percutaneous Pedicle Screw Stabilization for Pseudoarthrosis Following Pyogenic Spondylitis

    PubMed Central

    Masuda, Keigo; Yonekura, Yutaka; Kitamura, Takahiro; Senba, Hideyuki; Shidahara, Satoshi

    2016-01-01

    This report introduces a percutaneous transpedicular interbody fusion (PTPIF) technique in posterior stabilization using percutaneous pedicle screws (PPSs). An 81-year-old man presented with pseudoarthrosis following pyogenic spondylitis 15 months before. Although no relapse of infection was found, he complained of obstinate low back pain and mild neurological symptoms. Radiological evaluations showed a pseudoarthrosis following pyogenic spondylitis at T11–12. Posterior stabilization using PPSs from Th9 to L2 and concomitant PTPIF using autologous iliac bone graft at T11–12 were performed. Low back pain and neurological symptoms were immediately improved after surgery. A solid interbody fusion at T11–12 was completed 9 months after surgery. The patient had no restriction of daily activity and could play golf at one year after surgery. PTPIF might be a useful option for perform segmental fusion in posterior stabilization using PPSs. PMID:27114777

  7. Percutaneous Transpedicular Interbody Fusion Technique in Percutaneous Pedicle Screw Stabilization for Pseudoarthrosis Following Pyogenic Spondylitis.

    PubMed

    Ikuta, Ko; Masuda, Keigo; Yonekura, Yutaka; Kitamura, Takahiro; Senba, Hideyuki; Shidahara, Satoshi

    2016-04-01

    This report introduces a percutaneous transpedicular interbody fusion (PTPIF) technique in posterior stabilization using percutaneous pedicle screws (PPSs). An 81-year-old man presented with pseudoarthrosis following pyogenic spondylitis 15 months before. Although no relapse of infection was found, he complained of obstinate low back pain and mild neurological symptoms. Radiological evaluations showed a pseudoarthrosis following pyogenic spondylitis at T11-12. Posterior stabilization using PPSs from Th9 to L2 and concomitant PTPIF using autologous iliac bone graft at T11-12 were performed. Low back pain and neurological symptoms were immediately improved after surgery. A solid interbody fusion at T11-12 was completed 9 months after surgery. The patient had no restriction of daily activity and could play golf at one year after surgery. PTPIF might be a useful option for perform segmental fusion in posterior stabilization using PPSs. PMID:27114777

  8. Septic and aseptic arthritis: a continuum?

    PubMed

    Taylor-Robinson, D; Keat, A

    1999-03-01

    This chapter considers the likelihood that a wide spectrum of infection-provoked arthritis exists, ranging from overt sepsis to apparently aseptic chronic arthritis in which very small numbers of causal bacteria can be detected only by using highly sensitive techniques. It asks whether joints are, as conventionally held, normally devoid of micro-organisms and how to judge the significance of bacteria detected within apparently sterile joints. Through a consideration of known septic, probably infective and apparently aseptic forms of arthritis, a set of criteria for attributing causality to putative arthritogenic micro-organisms is proposed. PMID:10952856

  9. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 3 2014-01-01 2014-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  10. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 3 2011-01-01 2011-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  11. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  12. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 3 2012-01-01 2012-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  13. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 3 2013-01-01 2013-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  14. Quantitative risk modeling in aseptic manufacture.

    PubMed

    Tidswell, Edward C; McGarvey, Bernard

    2006-01-01

    Expedient risk assessment of aseptic manufacturing processes offers unique opportunities for improved and sustained assurance of product quality. Contemporary risk assessments applied to aseptic manufacturing processes, however, are commonly handicapped by assumptions and subjectivity, leading to inexactitude. Quantitative risk modeling augmented with Monte Carlo simulations represents a novel, innovative, and more efficient means of risk assessment. This technique relies upon fewer assumptions and removes subjectivity to more swiftly generate an improved, more realistic, quantitative estimate of risk. The fundamental steps and requirements for an assessment of the risk of bioburden ingress into aseptically manufactured products are described. A case study exemplifies how quantitative risk modeling and Monte Carlo simulations achieve a more rapid and improved determination of the risk of bioburden ingress during the aseptic filling of a parenteral product. Although application of quantitative risk modeling is described here purely for the purpose of process improvement, the technique has far wider relevance in the assisted disposition of batches, cleanroom management, and the utilization of real-time data from rapid microbial monitoring technologies. PMID:17089696

  15. Resuture using Shirodkar tape for sternal dehiscence after extended thymectomy via median sternotomy.

    PubMed

    Sakuraba, Motoki; Miyamoto, Hideaki; Oh, Shiaki; Takahashi, Nobumasa; Miyasaka, Yoshikazu; Suzuki, Kenji

    2009-06-01

    Sternal dehiscence is one complication after median sternotomy. We followed a patient with sternal dehiscence for 6 months after extended thymectomy via median sternotomy. His diagnosis was myasthenia gravis without thymoma and with complicating diabetes mellitus. Sixteen days after the operation chest radiography revealed that one of six sternal wires was cut, although sternal dehiscence was not apparent. Six months after the operation, chest radiography revealed that five of six wires were cut. The patient experienced sternal dehiscence, could not cough, and felt pain at the median wound site. We implemented a resuture technique of the sternum using Shirodkar tape for postoperative sternal dehiscence. After the second operation, sternal dehiscence was not apparent. He was able to cough and had no respiratory deficiency. One year after the second operation, chest computed tomography revealed no sternal dehiscence. Shirodkar tape is extremely useful and is low in price. PMID:19533280

  16. Complete sternal cleft - A rare congenital malformation and its repair in a 3-month-old boy: A case report.

    PubMed

    Kothari, Paras; Gupta, Abhaya; Patil, Prashant S; Kekre, Geeta; Kamble, Ravi; Dikshit, Kiran Vishesh

    2016-01-01

    Complete midline sternal cleft is a rare congenital anomaly resulting from failed midline ventral fusion of the sternal bars. Very few cases of complete sternal cleft have been described in literature. We present a case of complete sternal cleft in a 3-month-old child. The patient underwent primary closure of the defect using stainless steel wires. PMID:27046980

  17. A bioresorbable osteosynthesis device can induce an earlier sternal fusion after median sternotomy

    PubMed Central

    Tsunekawa, Tomohiro; Usui, Akihiko; Oshima, Hideki; Mizutani, Shinnichi; Araki, Yoshimori; Okada, Noritaka; Ueda, Yuichi

    2012-01-01

    OBJECTIVES We examined the impact of the bioresorbable osteosynthesis sternal pin (Super Fixsorb 30) on sternal healing after median sternotomy. METHODS Sixty-three patients who underwent aortic surgery through median sternotomy between January 2006 and March 2009 were analysed. Sternal pins were utilized in 36 patients in addition to the standard closure of the sternum with Ethibond sutures (Group A), and 27 patients received no pins with the standard Ethibond sternal closure (Group B). The occurrence of transverse sternal dehiscence, anterior–posterior displacement and complete fusion of the sternum were evaluated by a computed tomography scan. The cross-sectional cortical bone density area (CBDA) of the sternum was examined to evaluate the osteoconductivity of the sternal pin over a 12-month period. RESULTS There was no sternal displacement (0%) observed in Group A at discharge. Meanwhile, five displacements (18.5%) were observed in Group B (P = 0.007). The complete sternal fusion rates at 12 months postoperatively were 100% in Group A, and 21.6% in Group B (P < 0.001). A significant increase in the CBDA was observed in Group A (P < 0.001; between CBDA at discharge and 12 months postoperatively). CONCLUSIONS The Super Fixsorb 30 sternal pin reduced an anterior–posterior sternal displacement and facilitated an earlier sternal fusion. The pin may have the potential to promote osteogenesis. PMID:22623628

  18. Technical Modifications to Prevent Massive Hemothorax Following Sternal Plating.

    PubMed

    Cece, John A; Rose, Michael R; Schneider, Lisa F

    2015-09-01

    We report two cases of life-threatening massive hemothorax after titanium plate fixation. We propose a modification of this technique using smaller plates that span the sternal bone but do not encroach upon the cartilage of the ribcage. PMID:26205095

  19. Sternal Resection and Reconstruction for Malignant Phylloides Tumor.

    PubMed

    Selvakumar, Veda Padma Priya; Poonia, Dharmaram; Agrawal, Juhi; Goel, Ashish; Mehta, Sandeep; Kumar, Kapil

    2015-08-01

    Malignant phylloides tumor is a locally aggressive breast neoplasm constituting less than 1 % of all breast cancers. It has a tendency for local recurrence and management is multidisciplinary. We hereby report a case of total sternal resection and reconstruction using Biopore HDPE prosthesis for Malignant Phylloides tumor. PMID:26702245

  20. First in Man: Sternal Reconstruction with Autologous Stem Cells.

    PubMed

    Khalpey, Zain; Marsh, Katherine M; Ferng, Alice; Riaz, Irbaz Bin; Hemphill, Courtney; Johnson, Kitsie; Oliva, Isabel; Friedman, Mark

    2015-01-01

    Sternal nonunion is associated with high morbidity and treated using rigid plate and screw fixation. This is the first reported example of successful sternal reconstruction using adipose-derived stromal vascular fraction (SVF) stem cells in addition to traditional techniques. Mesenchymal stem cells, one component of the SVF, play an important role in bone healing and were therefore used to promote remedial processes in a patient with sternal nonunion. A 3D printed model of the patient's sternum was used for preoperative planning of the plating. Intraoperatively, SVF was isolated using ultrasonic cavitation and previously planned sternal plating was completed. A total of 300 million cells were delivered via both local injection and intravenously before chest closure. The patient's pain dramatically decreased, commensurate with healed areas of nonunion by 3 months and maintained at 6 months postoperatively, supported by three-dimensional computed tomography imaging. Utilizing autologous stem cells from the SVF in conjunction with existing plating techniques may provide an optimal platform to stabilize the sternum and promote bone healing, although additional study is recommended. PMID:25914951

  1. Right Ventricular Epicardial Fibrosis in Mice With Sternal Segment Dislocation.

    PubMed

    Adissu, H A; Medhanie, G A; Morikawa, L; White, J K; Newbigging, S; McKerlie, C

    2015-09-01

    We report coincident sternal segment dislocation and focally extensive right ventricular epicardial fibrosis observed during routine histopathology evaluation of C57BL/6N mice as part of a high throughput phenotyping screen conducted between 4 and 16 weeks of age. This retrospective case series study was conducted to determine whether cardiac fibrosis was a pathological consequence of sternal segment dislocation. We identified sternal segment dislocation in 51 of the total 1103 mice (4.6%) analyzed at 16 weeks of age. Males were more frequently affected. In all cases but 2, the dislocation occurred at the fourth intersternebral joint. In 42 of the 51 cases (82.4%), the dislocation was encased by regenerative cartilaginous callus that protruded internally into the thoracic cavity (intrathoracic callus) and/or externally to the outer aspect of the sternum (extrathoracic callus). Displacement of dislocated ends of the sternum into the thoracic cavity was present in 19 of 51 cases (36.5%). Coincident minimal or mild right ventricular epicardial and subepicardial fibrosis was observed in 22 of the 51 cases (43%) but was not observed in any of the mice in the absence of sternal segment dislocation. Our data suggest that right ventricular fibrosis was likely caused by direct injury of the right ventricle by the dislocated ends of the sternum and/or by intrathoracic callus that develops post dislocation. Potential pathogenesis for the sternal and cardiac lesions and their implication for the interpretation of phenotypes in mouse models of cardiopulmonary and skeletal disease are discussed. PMID:25281652

  2. [A case of recurrent aseptic meningitis induced by ergot agents].

    PubMed

    Ogawa, Tomoko; Tagawa, Asako; Hashimoto, Ritsuo; Kato, Hiroyuki

    2015-01-01

    We describe the case of a 29-year-old woman with recurrent aseptic meningitis that was caused by ergot agents. She miscarried at age 27, and the uterus constrictor methylergometrine was prescribed. Three days later, she developed aseptic meningitis and was hospitalized. Two years later, she again developed aseptic meningitis the day after she took ergotamine tartrate. In both events, her symptoms improved rapidly when the medication was stopped. The drug-induced lymphocyte stimulation test for methylergometrine yielded a value of 180%. Drug-induced meningitis is a rare form of recurrent aseptic meningitis. Many studies have reported cases of meningitis caused by non-steroidal anti-inflammatory drugs, but many other drugs can induce aseptic meningitis. To the best of our knowledge, this is the first case of aseptic meningitis induced by ergot agents. PMID:26103816

  3. Failure of aseptic revision total knee arthroplasties

    PubMed Central

    Leta, Tesfaye H; Lygre, Stein Håkon L; Skredderstuen, Arne; Hallan, Geir; Furnes, Ove

    2015-01-01

    Background and purpose In Norway, the proportion of revision knee arthroplasties increased from 6.9% in 1994 to 8.5% in 2011. However, there is limited information on the epidemiology and causes of subsequent failure of revision knee arthroplasty. We therefore studied survival rate and determined the modes of failure of aseptic revision total knee arthroplasties. Method This study was based on 1,016 aseptic revision total knee arthroplasties reported to the Norwegian Arthroplasty Register between 1994 and 2011. Revisions done for infections were not included. Kaplan-Meier and Cox regression analyses were used to assess the survival rate and the relative risk of re-revision with all causes of re-revision as endpoint. Results 145 knees failed after revision total knee arthroplasty. Deep infection was the most frequent cause of re-revision (28%), followed by instability (26%), loose tibial component (17%), and pain (10%). The cumulative survival rate for revision total knee arthroplasties was 85% at 5 years, 78% at 10 years, and 71% at 15 years. Revision total knee arthroplasties with exchange of the femoral or tibial component exclusively had a higher risk of re-revision (RR = 1.7) than those with exchange of the whole prosthesis. The risk of re-revision was higher for men (RR = 2.0) and for patients aged less than 60 years (RR = 1.6). Interpretation In terms of implant survival, revision of the whole implant was better than revision of 1 component only. Young age and male sex were risk factors for re-revision. Deep infection was the most frequent cause of failure of revision of aseptic total knee arthroplasties. PMID:25267502

  4. Delayed aortic rupture resulting from postoperative superficial sternal wound infection

    PubMed Central

    Kim, Su Wan; Chang, Jee Won

    2016-01-01

    While deep sternal wound infection (DSWI) after cardiac surgery is a significant contributor to patient morbidity and mortality, superficial sternal wound infection (SSWI) mostly has a benign course. We report a mortality case of aortic rupture resulting from SSWI after cardiac surgery. A 50-year-old male underwent an aortic valve replacement (AVR). Three months after the valve operation, he presented with severe dyspnea, which had never before been observed, and chest computed tomography revealed an ascending aortic rupture with large hematoma compressing the main pulmonary artery. We performed an emergent operation for aortic rupture that possibly originated from the SSWI. Postoperatively, the patient died of hypovolemic shock due to recurrent aortic rupture despite efforts to resuscitate him. PMID:27499988

  5. [Strategies for the treatment of postoperative sternal infections].

    PubMed

    Akil, A; Schnorr, P; Wiebe, K

    2016-02-01

    Postoperative sternal infections are associated with significant morbidity and mortality. An incidence of up to 8 % has to be expected. Typically, a highly inflammatory acute infection with a marked soft tissue component is observed. However, the infection may also be present as a less symptomatic reaction and localised chronic osteomyelitis with fistula formation. The treatment strategy for a deep sternal wound infection consists of several steps. A radical debridement of the wound requires the opening of all abscesses, the resection of non-vital bone and the removal of all infected allomaterial. This is followed by a period of VAC therapy (Vacuum-Assisted Closure Therapy) for infection treatment and conditioning of the wound. Secondary closure of the wound may be planned only after the infection is completely controlled. The sternum is stabilised by osteosynthesis. Sternal defects are covered. In most cases adequate soft tissue coverage is achieved by mobilisation of both pectoral muscles together with the precostal soft tissues. Following resection of the sternum, the reconstruction of the thoracic wall requires the implantation of material for stabilisation as well as soft tissue coverage. For complicated or large defects various muscle flaps and the omentum majus have been advocated. The latissimus dorsi muscle with skin is the muscle flap most frequently used. PMID:26492536

  6. Radiographic comparison of a fractured clavicle exhibiting a pseudo-arthrosis.

    PubMed

    Rhode, Matthew P; Goodhue, William W; Stephan, Carl N

    2012-07-01

    Bone remodeling is a natural process that is potentially problematic for radiographic comparisons because it can occur after antemortem (AM) imaging, thus interfering with the comparability of AM and postmortem (PM) radiographs from the same individual. While the effects of age-related remodeling have been studied, limited attention has been given to trauma-related remodeling with respect to radiographic comparisons. This report adds to the latter topic by presenting a case of AM clavicle fracture that developed into a pseudo-arthrosis over a 12-month period prior to the individual's death. Even though remodeling was discernable along the fracture margins, adjacent skeletal features on the PM radiograph remained unaltered and constituted compelling evidence for the identification. This case illustrates the potential of using both normal and pathological anatomy concurrently to maximize the surety of findings from radiographic comparisons. PMID:22409353

  7. Sternal Osteomyelitis Caused by Gordonia bronchialis after Open-Heart Surgery

    PubMed Central

    Chang, Jeong-Hyun; Ji, Misuk; Hong, Hyo-Lim; Choi, Sang-Ho; Kim, Yang-Soo; Chung, Cheol-Hyun; Kim, Mi-Na

    2014-01-01

    We report the case of a deep sternal wound infection with sternal osteomyelitis caused by Gordonia bronchialis after open-heart surgery. The isolate was identified as a G. bronchialis by 16S rRNA and hsp65 gene sequencing, having initially been misidentified as a Rhodococcus by a commercial phenotypic identification system. PMID:25024874

  8. Sex estimation from sternal measurements using multidetector computed tomography.

    PubMed

    Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur

    2014-12-01

    We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation.Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30-60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation. PMID:25501090

  9. Management of Large Sternal Wound Infections With the Superior Epigastric Artery Perforator Flap.

    PubMed

    Eburdery, H; Grolleau, J L; Berthier, C; Bertheuil, N; Chaput, B

    2016-01-01

    The management of sternal wound infections often requires pedicled flaps. In recent years, the emergence of perforator flaps has changed our management of wounds involving tissue loss. For sternal wounds, the superior epigastric artery perforator (SEAP) flap can be used with the propeller procedure with minimal donor site morbidity. In our practice, this flap has replaced the traditional latissimus dorsi and pectoralis major flaps in the treatment of many sternal wounds. We report our experience with 4 patients with large sternal wound infection after cardiothoracic operations. The SEAP flap appears a safe alternative for low-morbidity coverage of sternal infections. Moreover, muscle flaps remain available in case the SEAP flap fails. PMID:26694288

  10. Sternal Closure With Tie Bands: A Word of Caution.

    PubMed

    Samuels, Louis

    2016-08-01

    The median sternotomy for cardiac operations can be reapproximated in a variety of ways. Traditionally, sternal wires have been used in several configurations to afford satisfactory closure. Alternative techniques include cables, plates, and clip-like devices. A relatively recent addition to the menu of options is the plastic tie band. Although a few studies have suggested its efficacy, this favorable experience has not been universal. The purpose of this report is to describe a failure in closure and the reaction of the soft tissue around it. PMID:27449444

  11. Complete sternal cleft — A rare congenital malformation and its repair in a 3-month-old boy: A case report

    PubMed Central

    Kothari, Paras; Gupta, Abhaya; Patil, Prashant S.; Kekre, Geeta; Kamble, Ravi; Dikshit, Kiran Vishesh

    2016-01-01

    Complete midline sternal cleft is a rare congenital anomaly resulting from failed midline ventral fusion of the sternal bars. Very few cases of complete sternal cleft have been described in literature. We present a case of complete sternal cleft in a 3-month-old child. The patient underwent primary closure of the defect using stainless steel wires. PMID:27046980

  12. Congenital Pseudoarthrosis of Medial Malleolus in A Young Soccer Player - Diagnosis in Clinical setting of Ankle Sprain

    PubMed Central

    Cerulli, Giuliano; Fabiano, Fantasia; Gabriele, Potalivo; Giacomo, Placella; Enrico, Sebastiani

    2014-01-01

    Introduction: We report a case of a young female soccer player affected by congenital medial bilateral malleolus pseudoarthrosis and os subfibulare. Congenital pseudoarthrosis is the failure of the bones to fuse prior or at birth. The etiology is still unknown, although frequency is high in subjects affected by neurofibromatosis or correlated syndromes, so it has been suggested that these congenital disorders may be the cause of congenital pseudoarthrosis. Case Report: Our patient, a 16-year-old female, high level soccer player, was referred to us following a right ankle sprain during a match. She reported no medical history of tibia-tarsus joint injuries or disease. Pain, swelling and functional impairment were noted immediately after the accident. Standard radiographs in the emergency department revealed a displaced fracture of the medial malleolus and the presence of os subfibularis. The patient was transferred to our Traumatology and Orthopaedic Department to undergo malleolus ostheosynthesis. Before surgery swelling, functional impairment and intense pain at the medial malleolus level were confirmed. However, there was no radiological opening of ankle, instability or pronation pain; furthermore the flexion-extension was preserved with slight pain. Twenty-four hours later a considerable remission of symptoms was evident with increased range of motion and reduction in the swelling and post-traumatic edema. A radiograph on the left ankle to compare with that of the right ankle was necessary to overcome the discrepancy between the radiological diagnosis and the clinical examination. The radiographic results of both medial malleoli were comparable although on the left the os subfibularis was absent. Since the diagnosis of fracture by the association between the radiographs and the symptomatology was doubtful, a bilateral CT was performed. The scan revealed a medial bilateral malleolus pseudoarthrosis and an accessory right subfibularis nucleus. The patient was

  13. Occult sternal metastasis identified by laminography in patients with chest pain.

    PubMed

    LaBan, M M; Newman, J M

    1984-04-01

    Six patients with occult sternal metastasis presenting with chest pain, and four with sternal deformity associated with "arthritis" had undergone routine roentgenographic examinations, reported as "normal." Subsequent laminography of the sternum demonstrated lytic lesions confirmed by needle biopsy. Adenocarcinoma of the lung and breast were identified in two each of four patients; myeloma and kidney neoplasms were the primary source of malignancy in the remaining two patients. In widespread malignancy, metastasis to the skeletal chest wall is a well-recognized occurrence. Infrequently, it can be an isolated manifestation of an occult or recurrent malignancy, initially overlooked when routine roentgenograms are read as normal. Although sternal x-rays remain the most important means of diagnosis, in suspected cases of sternal metastasis laminography alone may initially reveal lytic lesions. PMID:6712441

  14. Revision after early aseptic failures in primary total knee arthroplasty.

    PubMed

    Piedade, Sérgio Rocha; Pinaroli, Alban; Servien, Elvire; Neyret, Philippe

    2009-03-01

    The purpose of this study was to evaluate cases of early aseptic failures presented during the first 5-year follow-up in a group of 981 primary total knee arthroplasty (primary TKA). Predisposing factors as well causes of failures and postoperative complications in different groups of aseptic failures were re-assessed and compared to a control group. A retrospective and cohort study compared one group of 944 primary TKA without surgical revision (890 patients) (Group A) with 22 primary TKA (22 patients) (Group B) that had revision TKA secondary to aseptic failure during the first five years follow-up. The cases of isolated patellar button replacement (n = 8) and infection (n = 7) were not considered in this study. All patients underwent a systematic assessment that included clinical and radiographic examinations, and IKS scores. Aseptic failure was more prevalent at the first 2-year follow-up (63%). TKA loosening (n = 11) and undiagnosed pain (n = 7) were considered the most frequent modes of failures, and laxity (n = 1) was a very rare early cause of failure. The aseptic failure group was characterized as average 5 years younger with a greater number of previous knee surgeries, lower IKS scores improvement, and more postoperative pain compared to control group, despite the fact that the aseptic failure group showed a prevalence of cases during the first 2-year follow-up. Inside this group, the undiagnosed pain group had lower improvement of IKS scores, a remarkable prevalence in prior surgical procedure (71%) and a minor mean interval between primary and revision TKA (11.6 months). PMID:19082578

  15. Staged Delayed Sternal Closure Using a Binder Clip After Pediatric Cardiac Surgery.

    PubMed

    Fuchigami, Tai; Nishioka, Masahiko; Akashige, Toru; Higa, Shotaro; Nagata, Nobuhiro

    2016-07-01

    After pediatric cardiac surgery, patients who undergo delayed sternal closure may become hemodynamically unstable. We performed a staged sternal closure technique using a binder clip in 31 consecutive patients to minimize cardiopulmonary instability. Only one patient (3.2%) died of mediastinitis. Thus, our technique may be safe and minimize cardiopulmonary instability. doi: 10.1111/jocs.12767 (J Card Surg 2016;31:464-466). PMID:27277820

  16. Trends in postcoronary artery bypass graft sternal wound dehiscence in a provincial population

    PubMed Central

    Doherty, Christopher; Nickerson, Duncan; Southern, Danielle A; Kieser, Teresa; Appoo, Jehangir; Dawes, Jeffery; De Souza, Michael A; Harrop, Alan R; Rabi, Doreen

    2014-01-01

    BACKGROUND: It appears that the medical profile of patients undergoing coronary artery bypass graft (CABG) surgery has changed. The impact of this demographic shift on CABG outcomes, such as sternal wound dehiscence, is unclear. OBJECTIVES: To quantify the incidence and trends of sternal wound dehiscence, quantify the demographic shift of those undergoing CABG and identify patient factors predictive of disease. METHODS: A prospective analysis was performed on a historical cohort of consecutive patients who underwent CABG (without valve replacement) in Alberta between April 1, 2002 and November 30, 2009. The incidence and trends of sternal wound dehiscence were determined. In addition, the trend of the mean Charlson index score and European System for Cardiac Operative Risk Evaluation (EuroSCORE) (capturing patient comorbidities) was analyzed. Univariable analysis and multivariable models were performed to determine factors predictive of wound dehiscence. RESULTS: A total of 5815 patients underwent CABG during the study period. The incidence proportion of sternal wound dehiscence in Alberta was 1.86% and the incidence rate was 1.98 cases per 100 person-years. Although both the EuroSCORE and Charlson scores significantly increased over the study period, the incidence of sternal wound dehiscence did not change significantly. Factors predictive of sternal wound dehiscence were diabetes (OR 2.97 [95% CI 1.73 to 5.10]), obesity (OR 1.55 [95% CI 1.05 to 2.27]) and female sex (OR 1.90 [95% CI 1.26 to 2.87]). CONCLUSIONS: The incidence proportion of sternal wound dehiscence in Alberta was comparable with the incidence previously published in the literature. While patients undergoing CABG had worsening medical profiles, the incidence of sternal wound dehiscence did not appear to be increasing significantly. PMID:25332650

  17. A new cable-tie-based sternal closure device: infectious considerations†

    PubMed Central

    Melly, Ludovic; Gahl, Brigitta; Meinke, Ruth; Rueter, Florian; Matt, Peter; Reuthebuch, Oliver; Eckstein, Friedrich S.; Grapow, Martin T.R.

    2013-01-01

    OBJECTIVES To determine the difference in sternal infection and other infectious events between conventional wire and cable-tie-based closure techniques post-sternotomy in a collective of patients after cardiac surgery. METHODS The sternal ZipFix™ (ZF) system consists of a biocompatible poly-ether-ether-ketone (PEEK) cable-tie that surrounds the sternum through the intercostal space and provides a large implant-to-bone contact. Between 1 February 2011 and 31 January 2012, 680 cardiac operations were performed via sternotomy at our institution. After the exclusion of operations for active endocarditis and early mortality within 7 days, 95 patients were exclusively closed with ZF and could be compared with 498 who were closed with conventional wires (CWs) during the same period. A multivariable logistic regression analysis, including body mass index, renal impairment and emergency as suspected confounders and inverse propensity weights was performed on the infection rate. RESULTS Total infection rate was 6.1%, with a total of 36 diagnosed sternal infections (5 in ZF and 31 in CW). Comparing ZF with CW with regard to sternal infection, there is no statistically significant difference related to the device (odds ratio: 0.067, confidence interval: 0.04–9.16, P = 0.72). The propensity modelling provided excellent overlap and the mean propensity was almost the same in both groups. Thus, we have observed no difference in receiving either ZF or CW. No sternal instability was observed with the ZF device, unlike 4/31 patients in the CW group. The overall operation time is reduced by 11 min in the ZF group with identical perfusion and clamping times. CONCLUSIONS Our study underlines a neutral effect of the sternal ZipFix™ system in patients regarding sternal infection. Postoperative complications are similar in both sternal closure methods. The cable-tie-based system is fast, easy to use, reliable and safe. PMID:23624983

  18. Fixation of sternal fracture using absorbable plating system, three years follow-up

    PubMed Central

    Katballe, Niels; Pilegaard, Hans

    2015-01-01

    Sternal fractures occur due to severe chest wall trauma in a small number of patients. They are often conservatively treated. The surgical intervention, although controversial, is indicated in case of deformity, severe pain, and ventilatory complications. We report the first case where absorbable plate has been used to fix a traumatic fracture in a 42-year-old female. After 3 years, the patient is still free of symptoms and CT scanning reveals intact sternal bone structure. PMID:26101659

  19. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    SciTech Connect

    Doenmez, Halil Mavili, Ertugrul Ikizceli, Tuerkan; Durak, Ahmet Candan; Kurtsoy, Ali

    2009-07-15

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  20. rhBMP-2 protects against reoperation for pseudoarthrosis and/or instrumentation failure: A matched case-control study of 448 patients.

    PubMed

    Macki, Mohamed; Syeda, Sbaa; Kerezoudis, Panagiotis; Bydon, Ali; Witham, Timothy F; Sciubba, Daniel M; Wolinsky, Jean-Paul; Bydon, Mohamad; Gokaslan, Ziya

    2016-10-01

    The objective of this independent study is to determine the impact of recombinant human bone morphogenetic protein 2 (rhBMP-2) on reoperation for pseudarthrosis and/or instrumentation failure. A nested case-control study of first-time posterolateral, instrumented fusion of the lumbar spine for degenerative spinal disease was undertaken. Cases of reoperation for pseudoarthrosis and/or instrumentation failure were assigned to controls, who did not experience the primary outcome measure at the time of reoperation. Cases and controls were matched on number of interspaces fused and inclusion of interbody. Predictors of reoperation for pseudoarthrosis and/or instrumentation failure were assessed with a conditional logistical regression controlling for rhBMP-2, age, obesity, and smoking. Of the 448 patients, 155 cases of reoperation for pseudoarthrosis and/or instrumentation were matched with 293 controls. Twenty-six percent of first-time surgeries included rhBMP-2, which was statistically more commonly used in the control cohort (33.11%) versus the case cohort (12.90%) (Unadjusted odds ratio [ORunadj]=0.28) (95% confidence interval [CI]: 0.16-0.49). Following a multivariate analysis controlling for age, obesity, and smoking, the rhBMP-2 recipients incurred a 73% lower odds of reoperation for pseudoarthrosis and/or instrumentation failure (95% CI, 0.15-0.48). Neither sarcomatous nor osseous neoplasm was detected in the study population. Mean follow up did not differ between the cases (81.57±standard deviation [SD] 4.98months) versus controls (74.75±2.49month) (ORunadj=1.01) (95% CI: 1.00-1.01). rhBMP-2 in lumbar fusion constructs protects against reoperation for pseudoarthrosis and/or instrumentation failure. However, the decision to include fusion supplements should be weighted between surgical determinants and clinical outcomes. PMID:27396376

  1. Deep sternal wound infection after cardiac surgery: Evidences and controversies

    PubMed Central

    Cotogni, Paolo; Barbero, Cristina; Rinaldi, Mauro

    2015-01-01

    Despite many advances in prevention and perioperative care, deep sternal wound infection (DSWI) remains a pressing concern in cardiac surgery, with a still relevant incidence and with a considerable impact on in-hospital mortality and also on mid- and long-term survival. The permanent high impact of this complication is partially related to the increasing proportion of patients at high-risk for infection, as well as to the many patient and surgical risk factors involved in the pathogenesis of DSWI. The prophylactic antibiotic therapy is one of the most important tools in the prevention of DSWI. However, the choice of antibiotic, the dose, the duration, the adequate levels in serum and tissue, and the timing of antimicrobial prophylaxis are still controversial. The treatment of DSWI ranges from surgical revision with primary closure to surgical revision with open dressings or closed irrigation, from reconstruction with soft tissue flaps to negative pressure wound therapy (NPWT). However, to date, there have been no accepted recommendations regarding the best management of DSWI. Emerging evidence in the literature has validated the efficacy and safety of NPWT either as a single-line therapy, or as a “bridge” prior to final surgical closure. In conclusion, the careful control of patient and surgical risk factors - when possible, the proper antimicrobial prophylaxis, and the choice of validated techniques of treatment could contribute to keep DSWIs at a minimal rate. PMID:26557476

  2. Deep sternal wound infection after cardiac surgery: Evidences and controversies.

    PubMed

    Cotogni, Paolo; Barbero, Cristina; Rinaldi, Mauro

    2015-11-01

    Despite many advances in prevention and perioperative care, deep sternal wound infection (DSWI) remains a pressing concern in cardiac surgery, with a still relevant incidence and with a considerable impact on in-hospital mortality and also on mid- and long-term survival. The permanent high impact of this complication is partially related to the increasing proportion of patients at high-risk for infection, as well as to the many patient and surgical risk factors involved in the pathogenesis of DSWI. The prophylactic antibiotic therapy is one of the most important tools in the prevention of DSWI. However, the choice of antibiotic, the dose, the duration, the adequate levels in serum and tissue, and the timing of antimicrobial prophylaxis are still controversial. The treatment of DSWI ranges from surgical revision with primary closure to surgical revision with open dressings or closed irrigation, from reconstruction with soft tissue flaps to negative pressure wound therapy (NPWT). However, to date, there have been no accepted recommendations regarding the best management of DSWI. Emerging evidence in the literature has validated the efficacy and safety of NPWT either as a single-line therapy, or as a "bridge" prior to final surgical closure. In conclusion, the careful control of patient and surgical risk factors - when possible, the proper antimicrobial prophylaxis, and the choice of validated techniques of treatment could contribute to keep DSWIs at a minimal rate. PMID:26557476

  3. Delayed primary closure of deep sternal wound infections.

    PubMed Central

    Zacharias, A; Habib, R H

    1996-01-01

    Deep infections of the sternum and mediastinum, with prevalence of osteomyelitis and tissue necrosis, were documented in 38 of 8,056 patients (0.47%) who underwent open-heart surgery (1975 through 1994) in our service. The incidences of insulin-dependent diabetes, obesity, and emergency surgery in these patients were relatively high at 39%, 47%, and 18%, respectively. Treatment with antibiotics, débridement, open packing, and delayed closure was administered to 33 patients (87%), with 100% healing. There were no deaths in this group. Flap reconstruction was indicated in 5 gravely ill patients (13%) in whom excessively large wound defects did not allow reapproximation. There were 2 deaths in this group, and 4 reoperations were necessary in the surviving patients because of sequelae arising from flap reconstruction. The overall mortality was 5.3% and the median period of hospitalization was 29 days. The length of stay decreased substantially over the period of this study (median = 21 days, year > or = 1987). Accordingly, we believe that treatment of deep sternal infections with delayed primary closure is safe and effective. Also, given the increased potential for complications and long-term sequelae, we believe that flap reconstruction should be used selectively and should be limited to patients with large defects, uncontrolled mediastinal bleeding, or both. PMID:8885104

  4. Ibuprofen-induced aseptic meningoencephalitis confirmed by drug challenge.

    PubMed

    Moreno-Ancillo, A; Gil-Adrados, A C; Jurado-Palomo, J

    2011-01-01

    Drug-induced aseptic meningitis (DIAM) is a diagnostic challenge. The major causative agents are nonsteroidal anti-inflammatory drugs (particularly ibuprofen), antibiotics, intravenous immunoglobulin, and OKT3 monoclonal antibodies. DIAM is more frequently observed in patients with autoimmune diseases. A 36-year-old woman was attended in our department 3 months after being diagnosed with aseptic meningoencephalitis. She had had 2 episodes in 9 months. Neurological symptoms were associated with ibuprofen. A challenge with acetylsalicylic acid was negative, whereas a drug challenge with ibuprofen was positive. Thirty minutes after ingesting 50 mg of ibuprofen, she experienced general malaise and progressively developed chills, fever (39.5 degrees C), headache, and nuchal rigidity. Lumbar puncture showed normal glucose and high protein levels. Neutrophilic pleocytosis was observed at the first admission; lymphocytosis was predominant in the second and third episodes. DIAM is a rare and severe hypersensitivity reaction. Drug challenge enabled us to make an accurate diagnosis. PMID:21995183

  5. An alternative approach to prescribing sternal precautions after median sternotomy, "Keep Your Move in the Tube".

    PubMed

    Adams, Jenny; Lotshaw, Ana; Exum, Emelia; Campbell, Mark; Spranger, Cathy B; Beveridge, Jim; Baker, Shawn; McCray, Stephanie; Bilbrey, Tim; Shock, Tiffany; Lawrence, Anne; Hamman, Baron L; Schussler, Jeffrey M

    2016-01-01

    Traditional sternal precautions, given to sternotomy patients as part of their discharge education, are intended to help prevent sternal wound complications. They vary widely but generally include arbitrary load and time restrictions (lifting no more than a specified weight for up to 12 weeks) and may prohibit common shoulder joint and shoulder girdle movements. Having observed the negative effects of restrictive sternal precautions for many years, our research team performed a series of studies that measured the forces exerted during various common activities and their relationship to the sternum. The results, though informative, led us to realize that the goal of identifying "the" appropriate load restriction to prescribe for sternotomy patients was futile. The alternative approach that we introduce applies standard kinesiological principles and teaches patients how to perform load-bearing movements in a way that avoids excessive stress to the sternum. PMID:26722187

  6. Feedback to the field: an assessment of sternal intraosseous (IO) infusion.

    PubMed

    Harcke, H Theodore; Crawley, Geoffrey; Mazuchowski, Edward

    2011-01-01

    Intraosseous vascular infusion (IO) is a recognized alternative to peripheral intravenous infusion when access is inadequate. The sternum and proximal tibia are the preferred sites. A review of 98 cases at autopsy revealed successful sternal IO placement in 78 cases (80%). Assuming a worst case scenario for placement (pin mark and no tip in bone [17 cases] and tip present and not in the sternum [3 cases]), attempts were unsuccessful in 20 cases (20%). We draw no specific conclusions regarding sternal IO use, but hope that personnel placing these devices and those providing medical training can use the information. PMID:21455906

  7. Coronary artery bypass surgery in diabetic patients – risk factors for sternal wound infections

    PubMed Central

    Lenz, Kristina; Brandt, Michael; Fraund-Cremer, Sandra; Cremer, Jochen

    2016-01-01

    The incidence of sternal wound infections (SWI) after coronary artery bypass surgery (CABG) as reported worldwide is low. However, it is associated with significant increase of postoperative mortality and treatment costs. The major risk factors discussed are diabetes mellitus and bilateral IMA harvesting of the internal mammary artery. This study analyses data of 590 patients receiving CABG concerning the risk factors for SWI. Sternal wound infections occur significantly more often in diabetic patients, one crucial and significant additional risk factor is obesity. PMID:27547690

  8. Combined use of Ilizarov external fixation and Papineau technique for septic pseudoarthrosis of the distal tibia in a patient with diabetes mellitus

    PubMed Central

    Koutsostathis, Stefanos D.; Lepetsos, Panagiotis; Polyzois, Vasilios D.; Pneumaticos, Spyros G.; Macheras, George A.

    2014-01-01

    The surgical treatment of open pilon fractures has a high complication rate especially in diabetic patients. In this article, we present a case of an infected tibial non-union after an open reduction and internal fixation in a diabetic patient, treated with Ilizarov external fixation combined with Papineau technique. Combined use of external fixation and Papineau technique can provide an alternative option for the treatment of septic pseudoarthrosis of the distal tibia. PMID:24563728

  9. Combined use of Ilizarov external fixation and Papineau technique for septic pseudoarthrosis of the distal tibia in a patient with diabetes mellitus.

    PubMed

    Koutsostathis, Stefanos D; Lepetsos, Panagiotis; Polyzois, Vasilios D; Pneumaticos, Spyros G; Macheras, George A

    2014-01-01

    The surgical treatment of open pilon fractures has a high complication rate especially in diabetic patients. In this article, we present a case of an infected tibial non-union after an open reduction and internal fixation in a diabetic patient, treated with Ilizarov external fixation combined with Papineau technique. Combined use of external fixation and Papineau technique can provide an alternative option for the treatment of septic pseudoarthrosis of the distal tibia. PMID:24563728

  10. Implementing evidence-based practice findings to decrease postoperative sternal wound infections following open heart surgery.

    PubMed

    Haycock, Camille; Laser, Craig; Keuth, Jennifer; Montefour, Kerry; Wilson, Melissa; Austin, Kerry; Coulen, Charmaine; Boyle, Deborah

    2005-01-01

    Sternal wound infections following open heart surgery are an infrequent occurrence but can have significant impact on patient morbidity, length of stay, and cost of care. The objective of this project initiative was to decrease the incidence of sternal wound infections by examining and changing current practice in the preoperative and postoperative management of patients undergoing open heart surgery. Following a literature review of interdisciplinary best practices, process teams were formed to evaluate our own patient cohort with documented infection. Five key areas were addressed: (1) preoperative skin preparation, (2) antibiotic prophylaxis, (3) blood glucose control, (4) wound care management, and (5) hand hygiene. A retrospective chart review of patients with documented sternal wound infections status post-mediastinal open heart surgery revealed that the average postoperative glucose was 201 mg/dL. An inquiry of practice variations determined the absence of a common provider and causative organism. A change model guided project initiatives and sustainability of new behaviors and practice. Each element of the project initiative had defined outcome measures. Staff nurses participated in peer education and outcome data collection. Following the implementation of evidence based practice changes, a linear decrease in sternal wound infections was documented. Nurses play a critical role in identifying, orchestrating, and evaluating change efforts in clinical practice. Outcomes are enhanced when nurses collaborate with all stakeholders in the practice improvement initiative. PMID:16141774

  11. Trail Following Activity in Extracts of Sternal Glands from Anacanthotermes turkestanicus (Isoptera: Hodotermitidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Turkestan termite Anacanthotermes turkestanicus (Isoptera: Hodotermitidae) is a harvester termite found in the Central Asian region. The workers forage before sunrise or late in the evenings. This termite, like most other termites, has a sternal gland under the 4th sternite that produces a phero...

  12. Mesenchymal Stem/Stromal Cells from Discarded Neonatal Sternal Tissue: In Vitro Characterization and Angiogenic Properties

    PubMed Central

    Wang, Shuyun; Mundada, Lakshmi; Colomb, Eric; Ohye, Richard G.; Si, Ming-Sing

    2016-01-01

    Autologous and nonautologous bone marrow mesenchymal stem/stromal cells (MSCs) are being evaluated as proangiogenic agents for ischemic and vascular disease in adults but not in children. A significant number of newborns and infants with critical congenital heart disease who undergo cardiac surgery already have or are at risk of developing conditions related to inadequate tissue perfusion. During neonatal cardiac surgery, a small amount of sternal tissue is usually discarded. Here we demonstrate that MSCs can be isolated from human neonatal sternal tissue using a nonenzymatic explant culture method. Neonatal sternal bone MSCs (sbMSCs) were clonogenic, had a surface marker expression profile that was characteristic of bone marrow MSCs, were multipotent, and expressed pluripotency-related genes at low levels. Neonatal sbMSCs also demonstrated in vitro proangiogenic properties. Sternal bone MSCs cooperated with human umbilical vein endothelial cells (HUVECs) to form 3D networks and tubes in vitro. Conditioned media from sbMSCs cultured in hypoxia also promoted HUVEC survival and migration. Given the neonatal source, ease of isolation, and proangiogenic properties, sbMSCs may have relevance to therapeutic applications. PMID:26770206

  13. [Aseptic bone flap osteonecrosis following cranioplasty after decompressive cranietomy].

    PubMed

    Smoll, Nicolas R; Stienen, Martin N; Schaller, Karl; Gautschi, Oliver P

    2013-06-19

    This case report discusses a case of aseptic osteonecrosis in a cranioplasty bone flap after decompressive craniectomy, which is a known, but rare complication after autologous cranioplasty. We suggest that the pathophysiology of cranial bone flap necrosis may have a similar pathophysiology to free flap necrosis/failure. The key suggested problem causing the osteonecrosis is vessel thrombosis within the smaller vessels of the bone flap due to the prothrombotic effects of the factors released during drilling of the bone flap. Suspicious local findings like wound dehiscence or fluid leakage should lead to a head computed tomography in order to discuss a prophylactic artificial second cranioplasty if necessary. PMID:23773942

  14. [Aseptic osteonecrosis of alcoholic origin: a case report].

    PubMed

    Jissendi Tchofo, P; Brasseur, P

    2001-06-01

    Alcohol-induced aseptic osteonecrosis is not infrequent but multifocal osseous destruction is very rare. Alcoholic patients often present lipidic metabolism perturbation with fat embolism and are susceptible to develop diffuse intravascular coagulation in terminal microcirculation of femoral and humeral heads. The authors report one case of multifocal alcohol-induced osteonecrosis in a 74 year-woman. She presented with bilateral osteonecrosis of the humeral heads and total osteolysis of the neck and the head of the hips. Hepatic cirrhosis and chronic pancreatitis were additional risk factors inducing intra-osseous thrombosis. PMID:11488085

  15. The pathobiology and pathology of aseptic implant failure

    PubMed Central

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  16. The pathobiology and pathology of aseptic implant failure.

    PubMed

    Athanasou, N A

    2016-05-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles.Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162-168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  17. Performance analysis of exam gloves used for aseptic rodent surgery.

    PubMed

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-05-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  18. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-01-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  19. Staphylococcus aureus and repeat bacteremia in febrile patients as early signs of sternal wound infection after cardiac surgery

    PubMed Central

    2014-01-01

    Background Sternal wound infection is a devastating complication of cardiothoracic surgery that carries high postoperative morbidity and mortality rates. We explored whether our current program of extensive bacteriological examination including repeat blood cultures may contribute to the early diagnosis of sternal wound infection. Methods We retrospectively analyzed 112 patients who were subjected to our bacteriological examination protocol including within 90 days after cardiothoracic surgery. Univariate and multivariate analyses were made in order to identify risk factors for sternal infection. Results The median patient age was 75 years, and 65 patients were male. In 35 cases (31.2%) the blood cultures showed the presence of bacterial infection with the following frequencies: Staphylococcus aureus, 18 cases; Coagulase-negative Staphylococcus, 7 cases; other organisms, 10 cases. Eleven patients presented repeat bacteremia on at least 2 different occasions. Twenty patients (17.8%) presented sternal wound infections. There was no difference in operative mortality between the patients with and without sternal wound infection. Univariate and multivariate analyses demonstrated that bilateral mammary artery use (OR, 13.68, 95% CI, 1.09-167.36, p = 0.043), positive blood culture for Staphylococcus aureus (OR, 19.51, 95% CI, 4.46-104.33, p < 0.0001), repeat bacteremia (OR, 17.98, 95% CI, 2.51-161.77, p = 0.004) were risk factors that were associated for sternal wound infection. Conclusion Repeat blood cultures in febrile patients appear to be useful for the early detection of Staphylococcus aureus and repeat bacteremia, and these were associated with sternal wound infection. Bilateral internal mammary artery use was another risk factor of sternal wound infection in febrile patients. These factors may identify patients suitable for expeditious radiological examination and aggressive treatments. PMID:24885820

  20. Surgical Fixation of Sternal Fractures: Preoperative Planning and a Safe Surgical Technique Using Locked Titanium Plates and Depth Limited Drilling

    PubMed Central

    Schulz-Drost, Stefan; Oppel, Pascal; Grupp, Sina; Schmitt, Sonja; Carbon, Roman Th.; Mauerer, Andreas; Hennig, Friedrich F.; Buder, Thomas

    2015-01-01

    Different ways to stabilize a sternal fracture are described in literature. Respecting different mechanisms of trauma such as the direct impact to the anterior chest wall or the flexion-compression injury of the trunk, there is a need to retain each sternal fragment in the correct position while neutralizing shearing forces to the sternum. Anterior sternal plating provides the best stability and is therefore increasingly used in most cases. However, many surgeons are reluctant to perform sternal osteosynthesis due to possible complications such as difficulties in preoperative planning, severe injuries to mediastinal organs, or failure of the performed method. This manuscript describes one possible safe way to stabilize different types of sternal fractures in a step by step guidance for anterior sternal plating using low profile locking titanium plates. Before surgical treatment, a detailed survey of the patient and a three dimensional reconstructed computed tomography is taken out to get detailed information of the fracture’s morphology. The surgical approach is usually a midline incision. Its position can be described by measuring the distance from upper sternal edge to the fracture and its length can be approximated by the summation of 60 mm for the basis incision, the thickness of presternal soft tissue and the greatest distance between the fragments in case of multiple fractures. Performing subperiosteal dissection along the sternum while reducing the fracture, using depth limited drilling, and fixing the plates prevents injuries to mediastinal organs and vessels. Transverse fractures and oblique fractures at the corpus sterni are plated longitudinally, whereas oblique fractures of manubrium, sternocostal separation and any longitudinally fracture needs to be stabilized by a transverse plate from rib to sternum to rib. Usually the high convenience of a patient is seen during follow up as well as a precise reconstruction of the sternal morphology. PMID

  1. Doxycycline inhibits bone resorption by human interface membrane cells from aseptically loose hip replacements.

    PubMed

    Ong, S M; Taylor, G J S

    2003-04-01

    Matrix metalloproteinases (MMPs) may have a role in the process of aseptic loosening. Doxycycline has been shown to inhibit MMPs. Our aim was to investigate the potential pharmacological effect of doxycycline on aseptic loosening. We used radiolabelled mouse calvariae cultured with human interface membrane cells from aseptically loosened hips. Bone resorption was confirmed in this model. The effect of doxycycline was assessed by culturing dead radiolabelled bone discs with cells from the interface membrane with doxycycline. The control group consisted of the same culture system without doxycycline. Supernatant 45calcium and the total 45calcium remaining in the bone discs at the completion of the culture were used to measure osteolysis. We found that doxycycline can inhibit osteolysis at the interface membrane of aseptically loosened hips. This may have therapeutic implications for the treatment of patients with aseptic loosening of total joint replacements. PMID:12729128

  2. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  3. A pituitary abscess masquerading as recurrent hypernatremia and aseptic meningitis.

    PubMed

    Gonzales, Michael; Marik, Paul Ellis; Khardori, Romesh K; O'Brian, John T

    2012-01-01

    Pituitary abscess is a rare condition. In the setting of multiple surgical interventions, the risk of its development increases. A 49-year-old man presented with episodes of altered mental status. He had two surgeries for a recurrent suprasellar arachnoid cyst. The second surgery was complicated by a persistent cerebrospinal fluid (CSF) leak that required two repairs following which he developed panhypopituitarism and central diabetes insipidus. Twelve months after his last surgery he was diagnosed with aseptic meningitis. This was followed by recurrent hospitalisations for severe hypernatremia blamed on poor medication compliance. He was subsequently hospitalised for the evaluation of a febrile illness. Brain MRI showed ventriculitis and enhancement of the sella. Exploratory surgery revealed a purulent collection in the sella and a mucosal graft which had been used to repair the CSF leak. After drainage of pus and replacement of the graft he recovered completely but requiring life-long hormonal replacement. PMID:22751424

  4. A pituitary abscess masquerading as recurrent hypernatremia and aseptic meningitis

    PubMed Central

    Gonzales, Michael; Marik, Paul Ellis; Khardori, Romesh K; O'Brian, John T

    2012-01-01

    Pituitary abscess is a rare condition. In the setting of multiple surgical interventions, the risk of its development increases. A 49-year-old man presented with episodes of altered mental status. He had two surgeries for a recurrent suprasellar arachnoid cyst. The second surgery was complicated by a persistent cerebrospinal fluid (CSF) leak that required two repairs following which he developed panhypopituitarism and central diabetes insipidus. Twelve months after his last surgery he was diagnosed with aseptic meningitis. This was followed by recurrent hospitalisations for severe hypernatremia blamed on poor medication compliance. He was subsequently hospitalised for the evaluation of a febrile illness. Brain MRI showed ventriculitis and enhancement of the sella. Exploratory surgery revealed a purulent collection in the sella and a mucosal graft which had been used to repair the CSF leak. After drainage of pus and replacement of the graft he recovered completely but requiring life-long hormonal replacement. PMID:22751424

  5. Aseptic laboratory techniques: volume transfers with serological pipettes and micropipettors.

    PubMed

    Sanders, Erin R

    2012-01-01

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: ·Work within the sterile field created by the Bunsen burner flame. ·Use serological pipettes without compromising instrument sterility. ·Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. ·Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. ·Identify different applications for plastic versus glass serological pipettes. ·State accuracy limitations for micropipettors.

  6. Delayed sternal closure after vacuum-assisted closure therapy for tracheo-innominate artery fistula repair.

    PubMed

    Suzuki, Ryo; Mikamo, Akihito; Kurazumi, Hiroshi; Hamano, Kimikazu

    2011-08-01

    We report a case of successful innominate artery resection with delayed sternal closure after vacuum-assisted closure (VAC) therapy for a tracheo-innominate artery fistula (TIF). A 42-year-old woman with cerebral palsy underwent tracheostomy for respiratory assistance. On postoperative day 14, she was transferred to our hospital after an episode of massive hemoptysis. TIF was diagnosed based on the findings of multidetector computed tomography. Thus, we resected the innominate artery and started VAC therapy to control the postoperative local infection. The patient recovered uneventfully, without any infectious sequelae. Our strategy, which includes VAC therapy, for TIF repair may eliminate postoperative infective problems that could induce sequential bleeding and sternal compromise. To our knowledge, this is the first report of using VAC therapy for TIF. PMID:21628318

  7. A novel surgical technique for transverse sternal bone defects using flexible intramedullary nailing.

    PubMed

    Böcker, W; Euler, E; Schieker, M; Kettler, M; Mutschler, W

    2006-12-01

    Transverse sternal bone defects as a result of surgery or trauma remain an important clinical condition with serious sequelae. Patients sometimes complain of local pain during movement and breathing. Usually, defects are filled with prosthetic materials which remain permanently IN SITU. Small defects can be treated with autogenous bone grafts, whereas large defects are difficult to stabilize with common osteosynthetic techniques. Here, we report a new surgical technique using flexible intramedullary nailing ("Elastic Stable Intramedullary Nailing"--ESIN or "Embrochage Centro-Medullaire Elastique Stable"--ECMES) to stabilize a sternal defect after surgical removal of an osteochondral lesion. The defect was bridged by two elastic titanium nails and an autogenous corticocancellous bone graft. This new surgical technique showed a good clinical and functional outcome. PMID:17151979

  8. Gallium-67 scanning in the diagnosis of postoperative sternal osteomyelitis: concise communication

    SciTech Connect

    Salit, I.E.; Detsky, A.S.; Simor, A.E.; Weisel, R.D.; Feiglin, D.

    1983-11-01

    Sternal osteomyelitis is an uncommon but serious complication of the median sternotomy incision. Definite diagnosis is clinically difficult and radionuclide scanning is of uncertain value in the early postoperative period. A prospective blind study of gallium scanning was conducted in the early period after caridac surgery and clinically diagnosed cases that also had scans were reviewed. Clinical status and scan interpretation were each independently assessed by three raters. Thirty-eight scans included six true positives, five true negatives (no sternotomy) and 27 post-sternotomy, clinically uninfected patients. Using categories of high, medium and low for scan interpretation, the radiologic assessors agreed 90% of the time. Normal postoperative Ga-67 uptake could usually be differentialted from uptake by an infected sternum. The test had a sensitivity of 83% and specificity of 96%. This study of observer variation and validity indicates that Ga-67 scanning may be useful in confirming the diagnosis of poststernotomy sternal osteomyelitis.

  9. Successful placement of an adult sternal intraosseous line through burned skin.

    PubMed

    Frascone, Ralph; Kaye, Koren; Dries, David; Solem, Lynn

    2003-01-01

    Obtaining vascular access can be difficult in the critical adult patient. This can be especially true in a severely burned patient, where the usual insertion site may be involved in the burn injury. We present a case in which a sternal intraosseous line was placed through a full-thickness injury, in a patient in full arrest, who subsequently underwent a successful cardiac resuscitation. PMID:14501399

  10. Morphology of the sternal gland in workers of Coptotermes gestroi (Isoptera, Rhinotermitidae).

    PubMed

    Costa-Leonardo, A M

    2006-01-01

    The sternal gland is considered the only source of trail pheromones in termites. The morphology of the sternal gland was investigated in workers of Coptotermes gestroi using transmission and scanning electron microscopy. The results showed a small bilobed gland at the anterior part of the fifth abdominal sternite. The cuticular surface of the sternal gland showed a V-shaped structure with two peg sensilla in elevated socket and various campaniform sensilla. Pores and cuticular scale-like protuberances also occur in the glandular area. The ultrastructure showed a gland composed of class 1 cells and two different types of class 3 cells distinguished by location, different size and electron-density of secretory vesicles. Small class 3 cells (type 1) of the anterior lobe are inserted among class 1 cells and have weakly electron-dense vesicles associated with mitochondria, glycogen and smooth endoplasmic reticulum. The class 3 cells (type 2) of posterior lobe showed many round electron-lucent vesicles of secretion, abundant free ribosomes and a well-developed Golgi apparatus. Each class 3 cell is connected to the cuticle by a cuticular duct constituted by the receiving canal and the conducting canal. The secretion of class 1 cells is stored in an inner subcuticular reservoir that is delimited by the microvilli of these cells. This inner reservoir is large and crossed by the campaniform sensilla and ducts of two types of class 3 cells that open outside of the insect body. An exterior reservoir also is present between the fourth and fifth sternite. The complex structure of the sternal gland suggests multicomponents for the trail pheromone in the worker of C. gestroi. PMID:16458523

  11. Intracardiac Abscess with Cutaneous Fistula Secondary to Ventricular Septal Defect Repair Simulating Sternal Wound Infection

    PubMed Central

    Keshavamurthy, Suresh; Sepulveda, Edgardo; Miranda, Cyndee Cruz; Okamoto, Toshihiro; Pettersson, Gosta Bengt

    2014-01-01

    Cutaneous fistula as a clinical presentation of intracardiac abscess of the right side is such an unusual occurrence that it has not until now been reported in the English-language medical literature. We present a rare case of right-sided infective endocarditis caused by Achromobacter xylosoxidans in which recurrent infection presented as sternal wound discharge. The infection was found to have an intracardiac origin and was successfully managed by radical débridement on cardiopulmonary bypass. PMID:24955054

  12. Evolution and functional significance of derived sternal ossification patterns in ornithothoracine birds.

    PubMed

    O'Connor, J K; Zheng, X-T; Sullivan, C; Chuong, C-M; Wang, X-L; Li, A; Wang, Y; Zhang, X-M; Zhou, Z-H

    2015-08-01

    The midline pattern of sternal ossification characteristic of the Cretaceous enantiornithine birds is unique among the Ornithodira, the group containing birds, nonavian dinosaurs and pterosaurs. This has been suggested to indicate that Enantiornithes is not the sister group of Ornithuromorpha, the clade that includes living birds and their close relatives, which would imply rampant convergence in many nonsternal features between enantiornithines and ornithuromorphs. However, detailed comparisons reveal greater similarity between neornithine (i.e. crown group bird) and enantiornithine modes of sternal ossification than previously recognized. Furthermore, a new subadult enantiornithine specimen demonstrates that sternal ossification followed a more typically ornithodiran pattern in basal members of the clade. This new specimen, referable to the Pengornithidae, indicates that the unique ossification pattern observed in other juvenile enantiornithines is derived within Enantiornithes. A similar but clearly distinct pattern appears to have evolved in parallel in the ornithuromorph lineage. The atypical mode of sternal ossification in some derived enantiornithines should be regarded as an autapomorphic condition rather than an indication that enantiornithines are not close relatives of ornithuromorphs. Based on what is known about molecular mechanisms for morphogenesis and the possible selective advantages, the parallel shifts to midline ossification that took place in derived enantiornithines and living neognathous birds appear to have been related to the development of a large ventral keel, which is only present in ornithuromorphs and enantiornithines. Midline ossification can serve to medially reinforce the sternum at a relatively early ontogenetic stage, which would have been especially beneficial during the protracted development of the superprecocial Cretaceous enantiornithines. PMID:26079847

  13. Sternal Cleft associated with Patent Ductus Arteriosus, Atrial Septal Defect, and Subglottic Hemangioma: A rarity.

    PubMed

    Sadeghian, Naser; Mirshemirani, Alireza; Sadeghian, Irandokht

    2014-01-01

    We present a 2-day-old female neonate with cleft of the upper sternum, patent ductus arteriosus (PDA), atrial septal defect (ASD), and subglottic hemangioma. Dimensional and Doppler echocardiography, abdominal ultrasonography, and imaging were performed. She underwent a surgical repair of sternal cleft in neonatal life. After 8 months, she developed respiratory distress, apnea due to subglottic hemangioma. She underwent urgent tracheostomy. Subglottic hemangioma was treated with the KTP532 laser. PMID:24834387

  14. Platelet-rich plasma inside the sternotomy wound reduces the incidence of sternal wound infections.

    PubMed

    Serraino, Giuseppe F; Dominijanni, Andrea; Jiritano, Federica; Rossi, Michele; Cuda, Aldo; Caroleo, Santo; Brescia, Adalgisa; Renzulli, Attilio

    2015-06-01

    Despite the large choice of wide-spectrum antibiotic therapy, deep sternal wound infection (DSWI) following cardiac surgery is a life-threatening complication worldwide. This study evaluated that the use of platelet-rich plasma (PRP) applied inside the sternotomy wound would reduce the effect of sternal wound infections, both superficial and deep. Between January 2007 and January 2012, 1093 consecutive patients underwent cardiac surgery through median sternotomy. Patients were divided into two groups. Group B, the study group, included those who received the PRP applied inside the sternotomy wound before closure. Group A, the control group, included patients who received a median sternotomy but without the application of PRP. Antibiotic prophylaxis remained unchanged across the study and between the two groups. Occurrence of DSWI was significantly higher in group A than in group B [10 of 671 (1·5%) versus 1 of 422 (0·20%), P = 0·043]. Also, superficial sternal wound infections (SSWIs) were significantly higher in group A than in group B [19 of 671 (2·8%) versus 2 of 422 (0·5%), P = 0·006]. The use of PRP can significantly reduce the occurrence of DSWI and SSWI in cardiac surgery. PMID:23692143

  15. Free vascular fibular transfer in congenital pseudoarthrosis of the tibia: results of the EPOS multicenter study. European Paediatric Orthopaedic Society (EPOS).

    PubMed

    Romanus, B; Bollini, G; Dungl, P; Fixsen, J; Grill, F; Hefti, F; Ippolito, E; Tudisco, C; Wientroub, S

    2000-04-01

    This paper presents a review of the literature, describes the principal author's (B.R.) personal experience and provides the results of the European Paediatric Orthopaedic Society (EPOS) multicenter study. The objective is to evaluate the present status and future role of free vascular fibular transfer in treating congenital pseudoarthrosis of the tibia. Variables such as the selection of cases, age at operation, technical surgical details and postoperative results will be considered. The data on the EPOS study were incomplete at the time of writing, but the considerable amount of information already amassed is a valuable contribution to this updated report. PMID:10868357

  16. Comparison of Aseptic Compounding Errors Before and After Modified Laboratory and Introductory Pharmacy Practice Experiences

    PubMed Central

    Owora, Arthur H.; Kirkpatrick, Alice E.

    2015-01-01

    Objective. To determine whether aseptic compounding errors were reduced at the end of the third professional year after modifying pharmacy practice laboratories and implementing an institutional introductory pharmacy practice experience (IPPE). Design. An aseptic compounding laboratory, previously occurring during the third-year spring semester, was added to the second-year spring semester. An 80-hour institutional IPPE was also added in the summer between the second and third years. Instructors recorded aseptic compounding errors using a grading checklist for second-year and third-year student assessments. Third-year student aseptic compounding errors were assessed prior to the curricular changes and for 2 subsequent years for students on the Oklahoma City and Tulsa campuses of the University of Oklahoma. Assessment. Both third-year cohorts committed fewer aseptic technique errors than they did during their second years, and the probability was significantly lower for students on the Oklahoma City campus. The probability of committing major aseptic technique errors was significantly lower for 2 consecutive third-year cohorts after the curricular changes. Conclusion. The addition of second-year aseptic compounding laboratory experiences and third-year institutional IPPE content reduced instructor-assessed errors at the end of the third year. PMID:26889070

  17. Cross-sectional area of the abdomen predicts complication incidence in patients undergoing sternal reconstruction

    PubMed Central

    Kozlow, Jeffrey H.; Lisiecki, Jeffrey; Terjimanian, Michael N.; Rinkinen, Jacob; Brownley, Robert Cameron; Agarwal, Shailesh; Wang, Stewart C.; Levi, Benjamin

    2015-01-01

    Background Sternal reconstruction with vascularized flaps is central to the management of sternal wound infections and mediastinitis but carries a high risk of complications. There is a need to identify reliable predictors of complication risk to help inform patients and clinicians in preparation for surgery. Unfortunately, body mass index and serum albumin may not be reliable predictors of complication rates. Analytic morphomics provides a robust quantitative method to measure patients’ obesity as it pertains to their risk of complications in undergoing sternal reconstruction. Methods We identified 34 patients with preoperative computed tomography scans of the abdomen from a cohort of sternal reconstructions performed between 1997 and 2010. Using semiautomated analytic morphomics, we identified the patients’ skin and fascia layers between the ninth and 12th thoracic spine levels; from these landmarks, we calculated morphomic measurements of the patients’ abdomens, including their total body cross sectional area and the cross sectional area of their subcutaneous fat. We obtained the incidence of complications from chart review and correlated the incidence of complications (including seroma, hematoma, recurrent wounds, mediastinitis, tracheostomy, and death) with patients’ morphomic measurements. Results Sixty-two percent of patients (n = 21) suffered complications after their operation. Those who suffered from complications, relative to those who did not have complications, had increased visceral fat area (12,547.2 mm2 versus 6569.9 mm2, P = 0.0080), subcutaneous fat area (16,520.2 mm2 versus 8020.1 mm2, P = 0.0036), total body area (91,028.6 mm2 versus 67,506.5 mm2, P = 0.0022), fascia area (69,238.4 mm2 versus 56,730.9 mm2, P = 0.0118), total body circumference (1101.8 mm versus 950.2 mm, P = 0.0017), and fascia circumference (967.5 mm versus 868.1 mm, P = 0.0077). We also demonstrated a significant positive correlation between the previously mentioned

  18. A retrospective study of deep sternal wound infections: clinical and microbiological characteristics, treatment, and risk factors for complications.

    PubMed

    Chan, Monica; Yusuf, Erlangga; Giulieri, Stefano; Perrottet, Nancy; Von Segesser, Ludwig; Borens, Olivier; Trampuz, Andrej

    2016-03-01

    Deep sternal wound infection (DSWI) is a feared complication following cardiac surgery. This study describes clinical, microbiological, and treatment outcomes of DSWI and determines risk factors for complications. Of 55 patients with DSWI, 66% were male and mean age was 68.2years. Initial sternotomy was for coronary artery bypass graft in 49% of patients. Sternal debridement at mean 25.4±18.3days showed monomicrobial (94%), mainly Gram-positive infection. Secondary sternal wound infection (SSWI) occurred in 31% of patients, was mostly polymicrobial (71%), and was predominantly due to Gram-negative bacilli. Risk factors for SSWI were at least 1 revision surgery (odds ratio [OR] 4.8 [95% confidence interval {CI} 1.0-22.4], P=0.047), sternal closure by muscle flap (OR 4.6 [1.3-16.8], P=0.02), delayed sternal closure (mean 27 versus 14days, P=0.03), and use of vacuum-assisted closure device (100% versus 58%, P=0.008). Hospital stay was significantly longer in patients with SSWI (69days versus 48days, P=0.04). PMID:26707065

  19. A new cable-tie based sternal closure system: description of the device, technique of implantation and first clinical evaluation

    PubMed Central

    2012-01-01

    Background Wire closure still remains the preferred technique despite reasonable disadvantages. Associated complications, such as infection and sternal instability, cause time- and cost-consuming therapies. We present a new tool for sternal closure with its first clinical experience and results. Methods The sternal ZipFixTM System is based on the cable-tie principle. It primarily consists of biocompatible Poly-Ether-Ether-Ketone implants and is predominantly used peristernally through the intercostal space. The system provides a large implant-to-bone contact for better force distribution and for avoiding bone cut through. Results 50 patients were closed with the ZipFixTM system. No sternal instability was observed at 30 days. Two patients developed a mediastinitis that necessitated the removal of the device; however, the ZipFixTM were intact and the sternum remained stable. Conclusions In our initial evaluation, the short-term results have shown that the sternal ZipFixTM can be used safely and effectively. It is fast, easy to use and serves as a potential alternative for traditional wire closure. PMID:22731778

  20. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... for the Agency's current good manufacturing practice regulations for PET drugs. DATES: Although you... answers written specifically to help manufacturers comply with the Agency's current good manufacturing... media fill is the performance of an aseptic manufacturing procedure using a sterile...

  1. An alternative approach to prescribing sternal precautions after median sternotomy, “Keep Your Move in the Tube”

    PubMed Central

    Lotshaw, Ana; Exum, Emelia; Campbell, Mark; Spranger, Cathy B.; Beveridge, Jim; Baker, Shawn; McCray, Stephanie; Bilbrey, Tim; Shock, Tiffany; Lawrence, Anne; Hamman, Baron L.; Schussler, Jeffrey M.

    2016-01-01

    Traditional sternal precautions, given to sternotomy patients as part of their discharge education, are intended to help prevent sternal wound complications. They vary widely but generally include arbitrary load and time restrictions (lifting no more than a specified weight for up to 12 weeks) and may prohibit common shoulder joint and shoulder girdle movements. Having observed the negative effects of restrictive sternal precautions for many years, our research team performed a series of studies that measured the forces exerted during various common activities and their relationship to the sternum. The results, though informative, led us to realize that the goal of identifying “the” appropriate load restriction to prescribe for sternotomy patients was futile. The alternative approach that we introduce applies standard kinesiological principles and teaches patients how to perform load-bearing movements in a way that avoids excessive stress to the sternum. PMID:26722187

  2. Total hip arthroplasty for failed aseptic Austin Moore prosthesis

    PubMed Central

    Bhosale, Pradeep; Suryawanshi, Ashish; Mittal, Amber

    2012-01-01

    Background: Though Austin Moore (AM) replacement prosthesis has fairly good short term results for intracapsular femoral neck fractures in the elderly, it still is a compromised option and has a high failure rate in the long run. The objective of the present retrospective study is to analyze the functional outcome, assess survivorship of revision total hip arthroplasty (THA) at mid to long term followup, and evaluate intraoperative difficulties faced during conversion of failed aseptic AM prosthesis to cemented THA. Materials and Methods: Eighty-nine cemented THA surgeries for failed AM prosthesis were performed between 1986 and 2005. AM failures were classified into seven groups on the basis of mode of failure. Infected failures were excluded from the study. There were 35 men and 54 women in the study group. The mean age was 68 years (range 57–91 years). Mean followup was 8 years (range 5–13 years). Results: Average Harris Hip Score improved from 65 preoperatively (range 42–73) to 87 (range 76–90) at 1 year postoperatively and to 86 (range 75–89) at the last followup. The overall complication rate was 4.5%. Conclusion: Conversion THA is an excellent treatment strategy for symptomatic failed AM hemiarthroplasty in terms of pain relief and restoration of function and mobility as near as possible to the preinjury level. Also, hemiarthroplasty should not be used in physically active patients, even in elderly individuals. Careful patient selection for hemiarthroplasty versus THA is vital and may decrease the incidence of complications and ameliorate the outcomes in the treatment of intracapsular femoral neck fractures. PMID:22719116

  3. Gentamicin-impregnated collagen sponge for preventing sternal wound infection after cardiac surgery

    PubMed Central

    Targońska, Sylwia; Stążka, Janusz; Kozioł-Montewka, Maria

    2014-01-01

    The frequency of sternal wound infection (SWI) after cardiac surgery ranges from 0.5% to 8% and is associated with significant morbidity, mortality, and treatment cost. Perioperative antibiotic prophylaxis is not sufficient to fully prevent the contamination of the surgical access site. One of the most effective methods for the prevention of wound infection seems to be the use of gentamicin-impregnated collagen sponge, which is successfully used in abdominal and orthopedic surgery. Surgically implantable topical antibiotics can reduce wound infection in cardiac patients as well, but the efficacy of SWI prevention in cardiac surgery still raises many questions. PMID:26336388

  4. Sternal and costochondral infections with gentamicin and methicillin resistant Staphylococcus aureus following thoracic surgery.

    PubMed

    Cafferkey, M T; Luke, D A; Keane, C T

    1983-01-01

    Six patients in a thoracic unit developed sternal osteomyelitis and costochondritis following median sternotomy. Five of the patients were operated on in another hospital. Gentamicin and methicillin resistant Staphylococcus aureus was isolated in pure culture in each case. The S. aureus isolate from 2 patients was of the same phage type suggesting cross-infection. Antibiotic prophylaxis administered in the perioperative period was ineffective. One patient, treated with amikacin (to which all of the strains were sensitive in vitro) and cefuroxime, died from overwhelming infection in spite of débridement and resuturing of the wound. The remaining 5 patients were cured with vancomycin therapy usually coupled with surgical intervention. PMID:6557667

  5. Ant repellent effect of the sternal gland secretion ofPolistes dominulus (Christ) andP. sulcifer (Zimmermann). (Hymenoptera: Vespidae).

    PubMed

    Dani, F R; Cannoni, S; Turillazzi, S; David Morgan, E

    1996-01-01

    The long-chain carboxylic acids identified in the sternal gland secretion ofPolistes dominulus andP. sulcifer females were tested individually on three species of ants,Crematogaster scutellaris, Formica cunicularia, andLasius sp., in order to verify if they have a repellent effect. The unsaturated acids (palmitoleic, linoleic, and oleic) act as repellents of all three ant species, while the saturated acids (lauric, myristic, palmitic, and stearic) have no effect. The mixture reproducing the secretion of the sternal glands ofP. dominulus maintained its repellency for at least four days. PMID:24226981

  6. PET-CT imaging in patients with chronic sternal wound infections prior to reconstructive surgery: A case series.

    PubMed

    Read, Charlotte; Branford, Olivier A; Verjee, Liaquat S; Wood, Simon H

    2015-08-01

    Late presenting and recurrent sternal wound infections post-sternotomy are difficult to treat, with the clinical picture not necessarily reflecting the underlying problem. As a result of our experience, we suggest that these chronic cases should be managed using a different algorithm to acute sternal wound infection. Positron emission tomography combined with computerized tomography (PET-CT) imaging may be potentially useful in enabling accurate localization of disease sites, which guides adequate debridement prior to definitive reconstruction. It may also allow for disease surveillance and monitoring of the response to antimicrobial treatment. We present three cases which support the need for pre-operative imaging using PET-CT. PMID:25986418

  7. Sternal Gland Scent-Marking Signals Sex, Age, Rank, and Group Identity in Captive Mandrills.

    PubMed

    Vaglio, Stefano; Minicozzi, Pamela; Romoli, Riccardo; Boscaro, Francesca; Pieraccini, Giuseppe; Moneti, Gloriano; Moggi-Cecchi, Jacopo

    2016-02-01

    Mandrills are one of the few Old World primates to show scent-marking. We combined ethological and chemical approaches to improve our understanding of this behavior in 3 zoo-managed groups. We observed the olfactory behavior performed by adults and adolescents (N = 39) for 775h. We investigated the volatile components of sternal scent-marks using gas chromatography-mass spectrometry and compared volatile profiles with traits of the signaler. Males marked more than females and within each sex the frequency of scent-marking was related to age and dominance status, but alpha males scent-marked most frequently and particularly in specific areas at the enclosure boundaries. We identified a total of 77 volatile components of sternal gland secretion, including compounds functioning as male sex pheromones in other mammals, in scent-marks spontaneously released on filter paper by 27 male and 18 female mandrills. We confirmed our previous findings that chemical profiles contain information including sex, male age and rank, and we also found that odor may encode information about group membership in mandrills. Our results support the hypotheses that scent-marking signals the status of the dominant male as well as playing territorial functions but also suggest that it is part of sociosexual communication. PMID:26708734

  8. Occult Infection in Aseptic Joint Loosening and the Diagnostic Role of Implant Sonication

    PubMed Central

    Kempthorne, J. T.; Ailabouni, R.; Raniga, S.; Hammer, D.; Hooper, G.

    2015-01-01

    Our aim was to determine the incidence of occult infection and to examine the role of ultrasound sonication of the implants in cases of presumed aseptic loosening in a prospective trial. Joint swabs, aspirates, and deep tissue samples were obtained from around the prosthesis for routine microbiology. Each prosthesis was sonicated and the sonicate examined with Gram staining and extended cultures. There were 106 joints in the study of which 54 were revised for aseptic loosening and 52 were assigned to the control revision group. There were 9 positive cultures with 8/54 positive cultures in the aseptic loosening group and 1/52 in the control revision group (p = 0.017, associated OR 47.7). We found concordant results between sonication fluid culture and conventional samples in 5/9 cultures. Preoperative inflammatory markers were not prognostic for infection. Coagulase-negative Staphylococcus was the most commonly cultured organism (7/9). Previously unrecognised infection was present in 15% of patients undergoing revision for aseptic loosening. Ultrasound sonication of the removed prosthesis was less sensitive than conventional sampling techniques. We recommend routine intraoperative sampling for patients having revision for aseptic loosening, but we do not support the routine use of ultrasound sonication for its detection. PMID:26583149

  9. Stature estimation based on measurements of the sternal medullary cavity using multidetector computed tomography images of Japanese cadavers.

    PubMed

    Torimitsu, Suguru; Makino, Yohsuke; Saitoh, Hisako; Sakuma, Ayaka; Ishii, Namiko; Hayakawa, Mutsumi; Yajima, Daisuke; Inokuchi, Go; Motomura, Ayumi; Chiba, Fumiko; Iwase, Hirotaro

    2014-09-01

    Stature estimation using a skeleton is important for the medicolegal investigation of unidentified human remains. The aims of this study were to identify a correlation between stature and measurements of the sternal medullary cavity using multidetector computed tomography (MDCT) and derive regression equations for stature estimation in the Japanese population. Measurements were conducted on 215 Japanese subjects (107 males, 108 females) who underwent postmortem computed tomography with subsequent forensic autopsy between May 2012 and January 2014. For assessment, MDCT cross-sections through the mid-point of the first costal facets were chosen. The length of a rising diagonal stroke from the bottom left to the top right of the sternal medullary cavity (RS) and the length of a falling diagonal stroke from top left to bottom right of the sternal medullary cavity (FS) were measured. Statistical analyses indicated that both RS and FS were positively correlated with stature regardless of sex. The correlations were stronger for males than for females. The correlation coefficients for RS were higher than those for FS, and standard errors of estimation calculated by regression analysis using RS were lower than those using FS regardless of sex. Measurement of the sternal medullary cavity using MDCT images may be a potentially useful tool for stature estimation, particularly in cases where better predictors such as long bones are not available. PMID:25082372

  10. The Lateral Position Improved Airway Patency in Anesthetized Patient With Burn-Induced Cervico-Mento-Sternal Scar Contracture

    PubMed Central

    Arai, Young-Chang P.; Kawanishi, Jun; Sakakima, Yoshikazu; Ohmoto, Koichi; Ito, Akihiro; Maruyama, Yuki; Ikemoto, Tatsunori

    2016-01-01

    A 78-year-old woman with burn-induced cervico-mento-sternal scar contracture was scheduled for laparoscopic cholecystectomy. During inhalational induction of sevoflurane, her airway patency deteriorated. The right lateral position and assist ventilation using a breathing bag dramatically improved her airway patency. PMID:27252906

  11. Prophylactic sternal plating with pectoralis advancement flaps after sternotomy in patients with a history of chest irradiation.

    PubMed

    Neaman, Keith C; Blount, Andrew L; Kim, John A; Renucci, John D; Hooker, Robert L

    2011-03-01

    Deep sternal infections secondary to bony instability and malunion, can result in mediastinitis. Previous authors have described the use of prophylactic rigid plate fixation in high-risk patients. The purpose of our study is to review the use of prophylactic sternal platting with pectoralis advancement flaps in high-risk patients with a history of chest irradiation. Fourteen patients (July 2003-September 2008) with a history of chest irradiation who underwent a median sternotomy followed by prophylactic rigid plate fixation of the sternum were reviewed. Breast cancer was the most common etiology of chest irradiation (n=11, 78%). The average EuroSCORE was 24.06% with 72% of patients having a preoperative New York Heart Association (NYHA) class≥III. There were no episodes of sternal non-union, mediastinitis or death. Follow-up was 100% with a 0% 30-day and a 7.1% one-year mortality rate (non-cardiac). A comparison between mean preoperative left ventricular ejection fraction (LVEF) (49.6%) and postoperative LVEF (59.7%) was statistically significant (P<0.0001). All living patients currently maintain a NYHA class I/II. Prophylactic rigid plate fixation and pectoralis flap coverage decreases the risk of developing sternal dehiscence and postoperative wound complications and should therefore be considered in high-risk patients with a history of chest irradiation. PMID:21138917

  12. Gordonia bronchialis sternal wound infection in 3 patients following open heart surgery: intraoperative transmission from a healthcare worker.

    PubMed

    Wright, Shaneka N; Gerry, Joanna S; Busowski, Mary T; Klochko, Alena Y; McNulty, Steven G; Brown, Scott A; Sieger, Barry E; Ken Michaels, P; Wallace, Mark R

    2012-12-01

    We describe an investigation of 3 postoperative Gordonia bronchialis sternal infections. A nurse anesthetist was identified as the source of the outbreak, her scrubs likely becoming contaminated by her home washing machine. The outbreak ended after disposal of the implicated washing machine. Domestic laundering of surgical scrubs may need reevaluation. PMID:23143362

  13. District nurses' and aseptic technique: where did it all go wrong?

    PubMed

    Unsworth, John

    2011-01-01

    Concerns have been raised about whether it is possible to perform aseptic procedures within a community setting. Hallett (2000) has described how community nurses often have a fatalistic view about whether such procedures can really be performed at home. At the same time there has been an increase in the number of patients being cared for at home who need interventions which must adhere to the principles of asepsis. While it has been acknowledged for some time that community nurses must be resourceful and adapt the procedure, the view that community nurses cannot really perform aseptic procedures is a fairly new phenomenon. This article explores the reasons why concerns about the performance of aseptic procedures in the community may have arisen and what steps can be taken to address these concerns to ensure that care at home is both safe and effective. PMID:21278647

  14. Novel technique for avoidance of pressure competition between a negative pressure wound therapy device and chest drains in the management of deep sternal wound infections.

    PubMed

    Davis, James S; Kourliouros, Antonios; Deshpande, Ranjit; Cavale, Naveen

    2015-02-01

    In recent years, the use of negative pressure wound therapy (NPWT) devices has changed the way sternal wound infections are being managed. It is not uncommon for deep sternal wound infections to occur together with mediastinal or even pleural collections requiring underwater seal drainage. In these patients in whom there is a communication between the pleural and mediastinal cavities, the concomitant use of an NPWT device negates the pressure gradient within the pleural and mediastinal drains, allowing suppurative fluid to stagnate. We present a novel technique to address this limitation of NPWT devices in patients with sternal wound infections that communicate with a pleural collection. PMID:25415315

  15. Prevention of sternal wound complications after sternotomy: results of a large prospective randomized multicentre trial†

    PubMed Central

    Gorlitzer, Michael; Wagner, Florian; Pfeiffer, Steffen; Folkmann, Sandra; Meinhart, Johann; Fischlein, Theodor; Reichenspurner, Hermann; Grabenwoeger, Martin

    2013-01-01

    OBJECTIVES A prospective randomized multicentre trial was performed to analyse the efficacy of a vest (Posthorax support vest®) to prevent sternal wound infection after cardiac surgery, and to identify risk factors. METHODS From September 2007 to March 2010, 2539 patients undergoing cardiac surgery via median sternotomy were prospectively randomized into those who received a Posthorax® vest and those who did not. Patients were instructed to wear the vest postoperatively for 24 h a day for at least 6 weeks; the duration of follow-up was 90 days. Patients who did not use the vest within a period of 72 h postoperatively were regarded as study dropouts. Statistical calculations were based on an intention-to-treat (ITT) analysis. Further evaluations comprised all subgroups of patients. RESULTS Complete data were available for 2539 patients (age 67 ± 11years, 45% female). Of these, 1351 were randomized to receive a vest, while 1188 received no vest. No significant differences were observed between groups regarding age, gender, diabetes, body mass index, chronic obstructive pulmonary disease (COPD), renal failure, the logistic EuroSCORE and the indication for surgery. The frequency of deep wound complications (dWC: mediastinitis and sternal dehiscence) was significantly lower in vest (n = 14; 1.04%) vs non-vest (n = 27; 2.27%) patients (ITT, P < 0.01), but superficial complications did not differ between groups. Subanalysis of vest patients revealed that only 933 (Group A) wore the vest according to the protocol, while 202 (Group BR) refused to wear the vest (non-compliance) and 216 (Group BN) did not use the vest for other reasons. All dWC occurred in Groups BR (n = 7) and BN (n = 7), although these groups had the same preoperative risk profile as Group A. Postoperatively, Group BN had a prolonged intubation time, a longer stay in the intensive care unit, greater use of intra-aortic balloon pump, higher frequency of COPD and a larger percentage of patients who

  16. Negative-pressure wound therapy and laparoscopic omentoplasty for deep sternal wound infections after median sternotomy.

    PubMed

    De Brabandere, Kristof; Jacobs-Tulleneers-Thevissen, Daniel; Czapla, Jens; La Meir, Mark; Delvaux, Georges; Wellens, Francis

    2012-01-01

    Deep sternal wound infection remains one of the most serious complications in patients who undergo median sternotomy for coronary artery bypass surgery.We describe our experience in treating 6 consecutive patients with our treatment protocol that combines aggressive débridement, broad-spectrum antibiotics, negative-pressure wound therapy, omentoplasty with laparoscopically harvested omentum, and the use of bilateral pectoral muscle advancement flaps.The number of débridements needed in order to attain clinically clean wounds and negative cultures varied between 1 and 10, with a median of 5. The length of stay after omentoplasty and bilateral pectoral muscle advancement flap placement varied between 11 and 22 days. One of the 6 patients developed a small wound dehiscence that was treated conservatively. No bleeding related to vacuum-assisted closure therapy was identified. Three patients had pneumonia. Two of the 3 patients had an episode of acute renal failure. The 30-day mortality rate was zero, although 1 patient died in the hospital 43 days after the reconstructive surgery, of multiple-organ failure due to pneumonia that was induced by end-stage pulmonary fibrosis. No patient died between hospital discharge and the most recent follow-up date (4-12 mo). Late local follow-up results, both functional and aesthetic, were good.We conclude that negative-pressure wound therapy-in combination with omentoplasty using laparoscopically harvested omentum and with the use of bilateral pectoral advancement flaps-is a valuable technique in the treatment of deep sternal wound infection because it produces good functional and aesthetic results. PMID:22719146

  17. Negative-Pressure Wound Therapy and Laparoscopic Omentoplasty for Deep Sternal Wound Infections after Median Sternotomy

    PubMed Central

    De Brabandere, Kristof; Jacobs-Tulleneers-Thevissen, Daniel; Czapla, Jens; La Meir, Mark; Delvaux, Georges; Wellens, Francis

    2012-01-01

    Deep sternal wound infection remains one of the most serious complications in patients who undergo median sternotomy for coronary artery bypass surgery. We describe our experience in treating 6 consecutive patients with our treatment protocol that combines aggressive débridement, broad-spectrum antibiotics, negative-pressure wound therapy, omentoplasty with laparoscopically harvested omentum, and the use of bilateral pectoral muscle advancement flaps. The number of débridements needed in order to attain clinically clean wounds and negative cultures varied between 1 and 10, with a median of 5. The length of stay after omentoplasty and bilateral pectoral muscle advancement flap placement varied between 11 and 22 days. One of the 6 patients developed a small wound dehiscence that was treated conservatively. No bleeding related to vacuum-assisted closure therapy was identified. Three patients had pneumonia. Two of the 3 patients had an episode of acute renal failure. The 30-day mortality rate was zero, although 1 patient died in the hospital 43 days after the reconstructive surgery, of multiple-organ failure due to pneumonia that was induced by end-stage pulmonary fibrosis. No patient died between hospital discharge and the most recent follow-up date (4–12 mo). Late local follow-up results, both functional and aesthetic, were good. We conclude that negative-pressure wound therapy—in combination with omentoplasty using laparoscopically harvested omentum and with the use of bilateral pectoral advancement flaps—is a valuable technique in the treatment of deep sternal wound infection because it produces good functional and aesthetic results. PMID:22719146

  18. Feasibility of raw glycerol conversion into single cell oil by zygomycetes under non-aseptic conditions.

    PubMed

    Moustogianni, Anna; Bellou, Stamatia; Triantaphyllidou, Irene-Eva; Aggelis, George

    2015-04-01

    The use of plant oils as feedstock for the biodiesel manufacture has many drawbacks, thus, the interest has turned to single cell oil (SCO) as an alternative. However, the production of SCO is still too expensive, mainly due to the low oil productivity and the high cost of medium sterilization required. In this work raw glycerol was converted into SCO by oleaginous Zygomycetes under non-aseptic conditions on selective (i.e., containing essential oils and/or antibiotics) nitrogen limited media. The obtained data showed that although bacterial populations inhibited the fungal growth, lipid accumulation remained unaffected by the presence of bacteria in the growth medium compared to control experiments (conducted under aseptic conditions). Therefore, a two-stage process was developed in which growth was performed under aseptic conditions (1st stage) followed by lipid accumulation performed under non-aseptic conditions (2nd stage) in the presence of thyme essential oil as an antibacterial agent. Large amounts of lipids were accumulated inside the mycelia, yielding around 13% wt/wt of oil per glycerol consumed. PMID:25335774

  19. Continuous flow microwave-assisted processing and aseptic packaging of purple-fleshed sweetpotato purees

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pumpable purees from purple-flesh sweetpotatoes (PFSP) were subjected to microwave heating using a 915 MHz continuous flow system, followed by aseptic packaging in flexible containers to obtain a shelf-stable product. Initial test runs were conducted using a 5 kW microwave unit to measure dielectr...

  20. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-11

    ... the Agency's current good manufacturing practice regulations for PET drugs. DATES: Submit either... good manufacturing practices for PET drugs (21 CFR part 212) regarding media fills. A draft guidance of..., such as bacterial endotoxins. The media fill is the performance of an aseptic manufacturing...

  1. 99mTc-MDP bone SPECT for the evaluation of sternal ischaemia following internal mammary artery dissection.

    PubMed

    Lorberboym, M; Medalion, B; Bder, O; Lockman, J; Cohen, N; Schachner, A; Cohen, A J

    2002-01-01

    Coronary artery bypass grafting (CABG) is one of the most frequently performed operations in the United States. The use of internal mammary artery (IMA) grafting has been identified as increasing the risk of sternal wound infections and mediastinitis. The purpose of our study was to prospectively evaluate the effect of different techniques of left internal mammary artery (LIMA) harvesting on sternal vascularity. Thirty-three patients undergoing primary coronary artery bypass grafting were studied. The patients were divided into groups that received a skeletonized IMA (group I, n=11), a pedicled IMA (group II, n=12), or a semiskeletonized IMA (group III, n=10) graft. Each patient underwent a preoperative 99mTc-methylene diphosphonate bone scan using single photon emission computed tomography (SPECT). The ratio of the mean counts/pixel for each side of the sternum was obtained. Post-operatively, all patients had a repeat bone SPECT. Ratios of unilateral sternal uptakes were compared to the preoperative study. A univariable analysis of post-operative to pre-operative ratios revealed statistically significant reduction in vascularity to the left side of the sternum post-operatively in group II compared with groups I and III (0.68 0.12 vs 0.99 0.24 and 0.93 0.09; P<0.01). There was no difference between groups I and III (P=1). Multivariable analysis revealed only the type of harvesting to be associated with post-operative reduction in left to right sternal activity ratio (P<0.02). Pairwise comparisons revealed that differences are due to pedicled type of harvesting (group II vs group I, P=0.03; II vs III, P=0.001; and I vs III, P=0.115). A pedicled IMA graft causes acute post-operative sternal ischaemia. This does not occur when the IMA is skeletonized or semiskeletonized. Hence, it may be prudent to minimize dissection during mobilization of the IMA to decrease the likelihood of post-operative sternal complications. PMID:11748437

  2. Prevention of sternal dehiscence with the Sternum External Fixation (Stern-E-Fix) corset – a randomized trial in 750 patients

    PubMed Central

    2012-01-01

    Background The main objective of this study will be to determine the effects of a new advanced sternum external fixation (Stern-E-Fix) corset on prevention of sternal instability and mediastinitis in high-risk patients. Methods This prospective, randomized study (January 2009 – June 2011) comprised 750 male patients undergoing standard median sternotomy for cardiac procedures (78% CABG). Patients were divided in two randomized groups (A, n = 380: received a Stern-E-Fix corset postoperatively for 6 weeks and B, n = 370: control group received a standard elastic thorax bandage). In both groups, risk factors for sternal dehiscence and preoperative preparations were similar. Results Wound infections occurred in n = 13 (3.42%) pts. in group A vs. n = 35 (9.46%) in group B. In group A, only 1 patient presented with sternal dehiscence vs. 22 pts. in group B. In all 22 patients, sternal rewiring followed by antibiotic therapy was needed. Mediastinitis related mortality was none in A versus two in B. Treatment failure in group B was more than five times higher than in A (p = 0.01); the mean length of stay in hospital was 12.5 ± 7.4 days (A) versus 18 ± 15.1 days (B) (p=0.002). Re-operation for sternal infection was 4 times higher in group B. Mean ventilation time was relatively longer in B (2.5 vs. 1.28 days) (p = 0.01). The mean follow-up period was 8 weeks (range 6 – 12 weeks). Conclusions We demonstrated that using an external supportive sternal corset (Stern-E-Fix) yields a significantly better and effective prevention against development of sternal dehiscence and secondary sternal infection in high-risk poststernotomy patients. PMID:22958313

  3. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  4. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    PubMed

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products. PMID:9143820

  5. Gentamicin-Impregnated Collagen Sponge: Effectiveness in Preventing Sternal Wound Infection in High-Risk Cardiac Surgery

    PubMed Central

    Rapetto, Filippo; Bruno, Vito D.; Guida, Gustavo; Marsico, Roberto; Chivasso, Pierpaolo; Zebele, Carlo

    2016-01-01

    Sternal wound infections represent one of the most frequent complications after cardiac surgery and are associated with high postoperative mortality. Several preventive methods have been introduced, and recently, gentamicin-impregnated collagen sponges (GICSs) have shown a promising effect in reducing the incidence of this type of complications. Gentamicin is an aminoglycoside antibiotic that has been widely used to treat infections caused by multiresistant bacteria; despite its effectiveness, its systemic use carries a risk of toxicity. GICSs appear to overcome this side effect, topically delivering high antibiotic concentrations to the wound and thus reducing the toxic-related events. Although several retrospective analyses and randomized controlled trials have studied the use of GICSs in cardiac surgery, conclusions regarding their efficacy in preventing sternal wound infection are inconsistent. We have reviewed the current literature focusing on high-risk patients. PMID:27279734

  6. Sternal Precautions: Is It Time for Change? Precautions versus Restrictions – A Review of Literature and Recommendations for Revision

    PubMed Central

    LaPier, Tanya Kinney; Shaw, Donald K.

    2011-01-01

    The processes that occur with normal sternal healing and potential complications related to median sternotomy are of particular interest to physical therapists. The premise of patients following sternal precautions (SP) or specific activity restrictions is the belief that avoiding certain movements will reduce risk of sternal complications. However, current research has identified that many patients remain functionally impaired long after cardiothoracic surgery. It is possible that some SP may contribute to such functional impairments. Currently, SP have several limitations including that they: (1) have no universally accepted definition, (2) are often based on anecdotal/expert opinion or at best supported by indirect evidence, (3) are mostly applied uniformly for all patients without regard to individual differences, and (4) may be overly restrictive and therefore impede ideal recovery. The purpose of this article is to present an overview of current research and commentary on median sternotomy procedures and activity restrictions. We propose that the optimal degree and duration of SP should be based on an individual patient's characteristics (eg, risk factors, comorbidities, previous activity level) that would enable physical activity to be targeted to particular limitations rather than restricting specific functional tasks and physical activity. Such patient-specific SP focusing on function may be more likely to facilitate recovery after median sternotomy and less likely to impede it. PMID:21448343

  7. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  8. [Aseptic osteonecrosis of the femoral head in cancer patients with neuropathies caused by vincristine and vinblastine].

    PubMed

    Meneghello, A; Presacco, D; Di Maggio, C

    1989-06-01

    Aseptic osteonecrosis has been described in many and dissimilar pathologic conditions--most frequently as the aftermath of fractures or dislocations; in falciform anemia, obesity, alcoholism; in diseases requiring constant and heavy corticosteroid therapy, and also following renal transplantation. Many of these pathologies, especially alcoholism, diabetes, uremia, and collagen vascular diseases, have a common denominator: peripheral neuropathy, which is believed to be a pathogenetic factor supporting osteonecrosis. The authors analyze 3 cases of aseptic osteonecrosis of the femoral head in cancer patients treated with vincristine and/or vinblastine. Since in these subjects severe and persistent neuropathy preceded the onset of osteonecrosis, a possible relationship is postulated between the vincristine/vinblastine treatment and the onset of femoral head osteonecrosis, through the pathogenetic mechanism of peripheral neuropathy. PMID:2756179

  9. Irradiated or aseptically prepared frozen dairy desserts: acceptability to bone marrow transplant recipients.

    PubMed

    Dong, F M; Hashisaka, A E; Rasco, B A; Einstein, M A; Mar, D R; Aker, S N

    1992-06-01

    Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovery immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be "market-tested" by the targeted patient population before inclusion in the menu. PMID:1607569

  10. Aseptic Endocarditis in Behçet's Disease Presenting as Tricuspid Valve Stenosis

    PubMed Central

    Lee, Hyun Sang; Choi, Won Suk; Kim, Kyun Hee; Kang, Jung Kyu; Kim, Na Young; Park, Sun Hee; Park, Youngwhi; Nam, Eon Jeong; Yang, Dong Heon; Cho, Yongkeun; Lee, Jong-Myung; Chae, Shung-Chull

    2011-01-01

    Aseptic endocarditis is an uncommon complication of Behçet's disease (BD). We describe a rare case of a 39-year-old female who had BD with aseptic endocarditis of the tricuspid valve (TV) presenting as tricuspid stenosis. She was diagnosed with BD four years ago. The mucocutaneous lesions were well-controlled with colchicine and short courses of corticosteroids. She remained free of signs and symptoms of BD for one year without any medication. Three months before admission, she gradually developed dyspnea on exertion and peripheral edema. Echocardiography revealed dilated right atrium and markedly thickened TV with severe stenosis. TV replacement was performed. Pathologic examination of the valve showed fibrinoid necrotic material and inflammatory cell infiltration. Blood cultures and cultures of the excised valve were negative for microorganisms. PMID:21860642

  11. An update review on risk factors and scales for prediction of deep sternal wound infections.

    PubMed

    Buja, Alessandra; Zampieron, Alessandra; Cavalet, Sara; Chiffi, Daniele; Sandonà, Paolo; Vinelli, Angela; Baldovin, Tatjana; Baldo, Vincenzo

    2012-08-01

    Surgical site infections are the most common nosocomial infections in surgical patients. The preventable and the unmodifiable risk factors for deep sternal wound infections (DSWI) have been amply assessed in the literature. The aim of this review was to describe the results of the numerous published studies to describe all the DSWI risk factors and the scales devised to predict SWI, with a view to providing an update on this issue. A comprehensive search of the Medline and Embase databases was performed (considering studies from January 1995 to April 2011); and a manual search was also conducted using references cited in original publications and relevant review articles. There are several risk factors associated with DSWI, which could be classified in four categories as demographic (e.g. sex and age), behavioural (e.g. smoking and obesity), baseline clinical conditions (e.g. diabetes, hypertension and COPD) and surgical operative risk factors (e.g. duration of operation and emergency operation). Six scales for predicting the risk of DSWI are described in the literature: they vary not only in accuracy but also in ease of application and they are applied at different times (some only preoperatively and others also postoperatively). This study provides a broad update on our knowledge of the risk factors for DSWI and the scales for prediction with a view to improving the management of infections at cardiosurgery units. PMID:22151350

  12. Molecular Epidemiology of Human Enterovirus Associated with Aseptic Meningitis in Shandong Province, China, 2006–2012

    PubMed Central

    Liu, Guifang; Xu, Aiqiang; Lin, Xiaojuan; Song, Lizhi; Ji, Feng; Wang, Suting; Cui, Ning; Song, Yanyan

    2014-01-01

    Background Human enteroviruses (HEVs) are common causes of acute meningitis. However, there is limited information about HEV associated with aseptic meningitis in mainland China because it has not been classified as a notifiable disease. Objectives To characterize the HEVs associated with sporadic aseptic meningitis in China and to analyze their genetic features. Study Design Cerebrospinal fluid, throat swab and feces specimens were collected from patients with aseptic meningitis in 5 sentinel hospitals in Shandong Province, China between 2006 and 2012. Virological investigation (viral isolation and molecular identification) and phylogenetic analysis were performed. Results A total of 437 hospitalized patients were reported, and enteroviruses were detected in the specimens from 84 patients (19.2%) and were identified into 17 serotypes. The nine main serotypes were echovirus (E) 30 (27.4%), EV71 (13.1%), coxsackievirus (CV) B1 (9.5%), CVB3 (7.1%), CVB5 (7.1%), E6 (7.1%), E9 (7.1%), CVA9 (6.0%), and CVA10 (3.6%). Monthly distribution of isolated enteroviruses revealed a major peak in summer-fall season and a small second peak in winter constituted totally by EV71. Sequence analysis on VP1 coding region suggested Shandong strains had great genetic divergence with isolates from other countries. Conclusions Multiple serotypes were responsible for enterovirus meningitis in mainland China. Aseptic meningitis caused by EV71 and coxsackie A viruses–the predominant pathogens for the hand, foot, and mouth disease–is currently an important concern in mainland China. PMID:24587020

  13. Detection of Leptospira DNA in Patients with Aseptic Meningitis by PCR

    PubMed Central

    Romero, Eliete C.; Billerbeck, Ana E. C.; Lando, Valéria S.; Camargo, Eide D.; Souza, Candida C.; Yasuda, Paulo H.

    1998-01-01

    Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively. PMID:9574730

  14. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-01-01

    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  15. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis

    PubMed Central

    Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  16. Aseptic versus Sterile Acellular Dermal Matrices in Breast Reconstruction: An Updated Review

    PubMed Central

    Mendenhall, Shaun D.; Neumeister, Michael W.; Cederna, Paul S.; Momoh, Adeyiza O.

    2016-01-01

    Background: As the use of acellular dermal matrices in breast reconstruction has become more commonplace and efforts are made to improve on postoperative outcomes, the method of acellular dermal matrix (ADM) processing (aseptic versus sterile) has become a subject of interest. This article provides an updated overview of the critical aspects of ADM processing in addition to application of ADMs in single- and two-stage breast reconstruction, a review of the morbidity associated with ADM use, and alternatives. Methods: A literature review was performed in PubMed identifying recent systematic reviews, meta-analyses, and head-to-head comparisons on aseptically processed ADM and sterile-processed ADM in implant-based breast reconstruction. Results: Recent meta-analyses have shown a 2- to 3-fold increase in infections and tissue expander/implant explantation rates and a 3- to 4-fold increase in seroma formation compared with non-ADM reconstruction techniques. Comparisons of aseptic and sterile ADMs in multiple studies have shown no significant difference in infection rates and equivocal findings for other specific complications such as seroma formation. Conclusions: Current evidence on the impact of processing techniques that improve ADM sterility on postoperative morbidity in implant breast reconstruction is unclear. Deficiencies of the available data highlight the need for well-designed, multicenter, randomized controlled studies that will aid in optimizing outcomes in implant-based breast reconstruction. PMID:27536502

  17. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis.

    PubMed

    Jha, Pinky; Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  18. Varicella Zoster Aseptic Meningitis: Report of an Atypical Case and Literature Review

    PubMed Central

    Ibrahim, Walid; Elzouki, Abdel-Naser; Husain, Ahmed; Osman, Lubna

    2015-01-01

    Patient: Female, 15 Final Diagnosis: Varicella Zoster aseptic meningitis Symptoms: — Medication: — Clinical Procedure: Lumber punctur Specialty: Infectious Diseases Objective: Unusual clinical course Background: Neurologic complications can occur with varicella zoster virus (VZV) infection, usually after vesicular exanthem. A review of the literature revealed 3 cases of viral meningitis associated with 6th nerve palsy but without significantly increased intracranial pressure. Case Report: We report a case of a previously healthy 15-year-old girl with aseptic meningitis as a result of reactivated-VZV infection with symptoms of increased intracranial pressure and reversible 6th cranial nerve palsy but without exanthema. Diagnosis was made by detection of VZV-DNA in cerebrospinal fluid using polymerase chain reaction and documented high intracranial pressure. Full recovery was achieved after a course of acyclovir and acetazolamide. Conclusions: This case demonstrates that VZV may be considered in cases of aseptic meningitis in immunocompetent individuals, even without exanthema, and it may increase the intracranial pressure, leading to symptoms, and causing reversible neurological deficit. PMID:26342350

  19. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.

    PubMed

    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2015-01-01

    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  20. The BCL2 -938C>A Promoter Polymorphism Is Associated with Risk for and Time to Aseptic Loosening of Total Hip Arthroplasty

    PubMed Central

    Fuest, Lena; Kurscheid, Gina; Gehrke, Thorsten; Klenke, Stefanie; Jäger, Marcus; Kauther, Max D.; Bachmann, Hagen S.

    2016-01-01

    Aseptic loosening is a major cause of revision surgery of total hip arthroplasty (THA). Only few host factors affecting aseptic loosening have been identified until now, although they are urgently needed to identify and possibly treat those patients at higher risk for aseptic loosening. To determine whether the functional single nucleotide polymorphism (SNP) c.-938C>A (rs2279115), located in the promoter region of the BCL2 gene has an impact on aseptic loosening of THA we genotyped and analyzed 234 patients suffering from aseptic loosening and 231 patients after primary THA. The polymorphism is associated with risk for aseptic loosening with the CC genotype at highest risk for aseptic loosening, Odds Ratio CC vs. AA 1.93, 95%CI 1.15–3.25, p = 0.013. In contrast, low risk AA genotype carriers that still developed aseptic loosening showed a significantly shorter time to aseptic loosening than patients carrying the C allele (p = 0.004). These results indicate that the BCL2 -938C>A polymorphism influences the occurrence and course of aseptic loosening and suggests this polymorphism as an interesting candidate for prospective studies and analyses in THA registers. PMID:26881923

  1. Another cause of chest pain: Staphylococcus aureus sternal osteomyelitis in an otherwise healthy adult

    PubMed Central

    Vacek, Thomas P; Rehman, Shahnaz; Yu, Shipeng; Moza, Ankush; Assaly, Ragheb

    2014-01-01

    Chest pain requires a detailed differential diagnosis with good history-taking skills to differentiate between cardiogenic and noncardiogenic causes. Moreover, when other symptoms such as fever and elevated white blood cell count are involved, it may be necessary to consider causes that include infectious sources. A 53-year-old female with no significant past medical history returned to the hospital with recurrent complaints of chest pain that was constant, substernal, reproducible, and exacerbated with inspiration and expiration. The chest pain was thought to be noncardiogenic, as electrocardiography did not demonstrate changes, and cardiac enzymes were found to be negative for signs of ischemia. The patient’s blood cultures were analyzed from a previous admission and were shown to be positive for Staphylococcus aureus. The patient was started empirically on vancomycin, which was later switched to ceftriaxone as the bacteria were more sensitive to this antibiotic. A transthoracic echocardiogram did not demonstrate any vegetation or signs of endocarditis. There was a small right pleural effusion discovered on X-ray. Therefore, computed tomography as well as magnetic resonance imaging of the chest were performed, and showed osteomyelitis of the chest. The patient was continued on intravenous ceftriaxone for a total of 6 weeks. Tests for HIV, hepatitis A, B, and C were all found to be negative. The patient had no history of childhood illness, recurrent infections, or previous trauma to the chest, and had had no recent respiratory infections, pneumonia, or any underlying lung condition. Hence, her condition was thought to be a case of primary sternal osteomyelitis without known cause. PMID:25246811

  2. Charts versus Discharge ICD-10 Coding for Sternal Wound Infection Following Coronary Artery Bypass Grafting

    PubMed Central

    Southern, Danielle A.; Doherty, Christopher; De Souza, Michael A.; Quan, Hude; Harrop, A. Robertson; Nickerson, Duncan; Rabi, Doreen

    2015-01-01

    Background Sternal wound infection (SWI) in patients undergoing coronary artery bypass grafting (CABG) can carry a significant risk of morbidity and mortality. The objective of this work is to describe the methods used to identify cases of SWI in an administrative database and to demonstrate the effectiveness of using an International Classification of Diseases, Tenth Revision (ICD-10) coding algorithm for this purpose. Methods ICD-10 codes were used to identify cases of SWI within one year of CABG between April 2002 and November 2009. We randomly chose 200 charts for detailed chart review (100 from each of the groups coded as having SWI and not having SWI) to determine the utility of the ICD-10 coding algorithm. Results There were 2,820 patients undergoing CABG. Of these, 264 (9.4 percent) were coded as having SWI. Thirty-eight cases of SWI were identified by chart review. The ICD-10 coding algorithm of T81.3 or T81.4 was able to identify incident SWI with a positive predictive value of 35 percent and a negative predictive value of 97 percent. The agreement between the ICD-10 coding algorithm and presence of SWI remained fair, with an overall kappa coefficient of 0.32 (95 percent confidence interval, 0.22–0.43). The effectiveness of identifying deep SWI cases is also presented. Conclusions This article describes an effective algorithm for identifying a cohort of patients with SWI following open sternotomy in large databases using ICD-10 coding. In addition, alternative search strategies are presented to suit researchers' needs. PMID:26396556

  3. Missed low-grade infection in suspected aseptic loosening has no consequences for the survival of total hip arthroplasty

    PubMed Central

    Boot, Willemijn; Moojen, Dirk Jan F; Visser, Els; Lehr, A Mechteld; De Windt, Tommy S; Van Hellemondt, Gijs; Geurts, Jan; Tulp, Niek J A; Schreurs, B Wim; Burger, Bart J; Dhert, Wouter J A; Gawlitta, Debby; Vogely, H Charles

    2015-01-01

    Background and purpose — Aseptic loosening and infection are 2 of the most common causes of revision of hip implants. Antibiotic prophylaxis reduces not only the rate of revision due to infection but also the rate of revision due to aseptic loosening. This suggests under-diagnosis of infections in patients with presumed aseptic loosening and indicates that current diagnostic tools are suboptimal. In a previous multicenter study on 176 patients undergoing revision of a total hip arthroplasty due to presumed aseptic loosening, optimized diagnostics revealed that 4–13% of the patients had a low-grade infection. These infections were not treated as such, and in the current follow-up study the effect on mid- to long-term implant survival was investigated. Patients and methods — Patients were sent a 2-part questionnaire. Part A requested information about possible re-revisions of their total hip arthroplasty. Part B consisted of 3 patient-related outcome measure questionnaires (EQ5D, Oxford hip score, and visual analog scale for pain). Additional information was retrieved from the medical records. The group of patients found to have a low-grade infection was compared to those with aseptic loosening. Results — 173 of 176 patients from the original study were included. In the follow-up time between the revision surgery and the current study (mean 7.5 years), 31 patients had died. No statistically significant difference in the number of re-revisions was found between the infection group (2 out of 21) and the aseptic loosening group (13 out of 152); nor was there any significant difference in the time to re-revision. Quality of life, function, and pain were similar between the groups, but only 99 (57%) of the patients returned part B. Interpretation — Under-diagnosis of low-grade infection in conjunction with presumed aseptic revision of total hip arthroplasty may not affect implant survival. PMID:26364842

  4. Sternal Cleft and Pectus Excavatum: A Combined Approach for the Correction of a Complex Anterior Chest Wall Malformation in a Teenager.

    PubMed

    Tocchioni, Francesca; Ghionzoli, Marco; Lo Piccolo, Roberto; Deaconu, Diana E; Facchini, Flavio; Milanez De Campos, Jose R; Messineo, Antonio

    2015-06-01

    Congenital sternal cleft is a rare chest wall malformation. Because of the flexibility of the chest in infants, surgical repair should be performed by primary closure in the neonatal period. In adolescents and adults, different techniques have been suggested to overcome the lack of sternal bone tissue. We describe a very rare case of an 18-year-old woman with a complete bifid sternum associated with pectus excavatum for whom a satisfactory cosmetic and functional result was obtained by adequate surgical planning, which entailed a combination of two standardized surgical techniques. PMID:26046903

  5. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    USGS Publications Warehouse

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  6. An echovirus 18-associated outbreak of aseptic meningitis in Taiwan: epidemiology and diagnostic and genetic aspects.

    PubMed

    Tsai, Huey-Pin; Huang, Sheng-Wen; Wu, Feng-Ling; Kuo, Pin-Hwa; Wang, Shih-Min; Liu, Ching-Chuan; Su, Ih-Jen; Wang, Jen-Ren

    2011-09-01

    In 2006, an outbreak of aseptic meningitis was noted in Taiwan. From January to October 2006, a total of 3283 specimens collected from patients with viral infection, including 173 cerebrospinal fluid (CSF) samples, were examined for virus isolation and identification. Overall, 339 enterovirus (EV)-positive cases were identified by virus culture: echovirus 18 (E18) formed the majority (27.4 %, 93 cases), followed by coxsackievirus B2 (13.8 %, 47 cases) and coxsackievirus A2 (10.8 %, 37 cases). The manifestations of the 93 E18 cases were aseptic meningitis (44.1 %), viral exanthema (23.6 %), acute tonsillitis (15.1 %), acute pharyngitis (14.0 %), acute gastritis (11.8 %), herpangina (7.5 %) and bronchopneumonia (5.3 %). Of 107 E18 isolates identified, 100, 62.5 and 19 % were obtained following culture in RD, MRC-5 and A549 cells, respectively. E18 was identified most frequently from throat swabs (67.2 %) and less frequently from stool samples (15.9 %) and CSF (16.8 %). The detection rate of E18 was 78.2 % from CSF, 50 % from stool samples and 22.9 % from throat swabs. Phylogenetic relationships among the E18 strains were examined. Analysis of the partial VP1 gene showed 3.7-23.8 % variation in sequence compared with sequences from GenBank and, notably, the amino acid change V152S was detected in a protruding loop within the VP1 protein. These results indicate that a genetic variant of E18 was circulating and caused an outbreak of aseptic meningitis in Taiwan in 2006. PMID:21546563

  7. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    PubMed

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones. PMID:26502645

  8. Cutaneous aseptic neutrophilic abscesses and Yersinia enterocolitica infection in a case subsequently diagnosed as Crohn's disease.

    PubMed

    Safa, G; Loppin, M; Tisseau, L; Lamoril, J

    2008-01-01

    We report the case of a man who presented cutaneous aseptic abscesses, a rare form of neutrophilic disease, associated with Yersinia enterocolitica infection and who was later diagnosed as having Crohn's disease (CD). Genetic analysis showed that the patient had a mutation in the caspase activation recruitment domain 15/nucleotide oligomerization domain 2 gene (R702W heterozygote). This case is in keeping with recent evidence in the literature which suggests that CD is a disease linked to abnormal immune responses to enteric bacteria in genetically susceptible individuals. Further understanding of the innate immune system should provide new insights into the pathogenesis of these inflammatory diseases. PMID:18799880

  9. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    PubMed Central

    Wolf, Marc E.; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G.; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient. PMID:26889150

  10. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI.

    PubMed

    Wolf, Marc E; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient. PMID:26889150

  11. Solvent effect in the polyethylene recovery from multilayer postconsumer aseptic packaging.

    PubMed

    Cervantes-Reyes, Alejandro; Núñez-Pineda, Alejandra; Barrera-Díaz, Carlos; Varela-Guerrero, Víctor; Martínez-Barrera, Gonzalo; Cuevas-Yañez, Erick

    2015-04-01

    Polyethylene films were separated and recovered from polyethylene-aluminum composites derived from recycling multilayer postconsumer aseptic packaging. A brief study about the separation process by dissolving PE-aluminum (PE-Al) composites into a series of organic solvents with a combination of time and temperature is presented. Through this procedure, 56% polyethylene is recovered from this kind of composites in optimized conditions. DSC and TGA studies were performed to determine the thermal stability of recovered polyethylene films and to establish a comparison with a PE reference commercial product, demonstrating that recovered polyethylene films kept their thermal properties. PMID:25681948

  12. Nuss procedure for surgical stabilization of flail chest with horizontal sternal body fracture and multiple bilateral rib fractures

    PubMed Central

    Lee, Sung Kwang

    2016-01-01

    Flail chest is a life-threatening situation that paradoxical movement of the thoracic cage was caused by multiply fractured ribs in two different planes, or a sternal fracture, or a combination of the two. The methods to achieve stability of the chest wall are controversy between surgical fixation and mechanical ventilation. We report a case of a 33-year-old man who fell from a high place with fail chest due to multiple rib fractures bilaterally and horizontal sternal fracture. The conventional surgical stabilization using metal plates by access to the front of the sternum could not provide stability of the flail segment because the fracture surface was obliquely upward and there were multiple bilateral rib fractures adjacent the sternum. The Nuss procedure was performed for supporting the flail segment from the back. Flail chest was resolved immediately after the surgery. The patient was weaned from the mechanical ventilation on third postoperative day successfully and was ultimately discharged without any complications. PMID:27293864

  13. The fine structural organization of sternal glands of pseudergates and workers in termites (Isoptera): a comparative survey.

    PubMed

    Quennedey, André; Sillam-Dussès, David; Robert, Alain; Bordereau, Christian

    2008-05-01

    Thirty-nine species belonging to different families of termites are studied to give a comprehensive view of the evolution of the sternal glands. Several modifications occurring at cuticular and cytological levels are described in neuter castes. The outer epicuticle is always pierced by epicuticular pores. In advanced termites the epicuticular filaments greatly increase in number and length creating a thick layer. The pore canals gradually enlarge while the cuticle changes into a lattice structure lining an extracellular space in which the secretion is stored. Two classes of cells are present in basal termites (Mastotermitidae, Hodotermitidae, Termopsidae and Kalotermitidae) but their glandular structures greatly differ between families. A more complex organization with three classes of cells is found in the Serritermitidae and Rhinotermitidae. A regressive evolution occurs in the Termitidae where only two classes of cells are present. A dual nervous control (campaniform sensilla and neurosecretory fibers) is found in lower termites, except for the Hodotermitidae which have mechanosensory bristles. In the other families, neurosecretory fibers are lacking. A comparison with phylogenetic data is given. A more versatile role of sternal glands in neuter castes is hypothesized. PMID:18207459

  14. Combined exposure to big endothelin-1 and mechanical loading in bovine sternal cores promotes osteogenesis.

    PubMed

    Meyer, Luisa A; Johnson, Michael G; Cullen, Diane M; Vivanco, Juan F; Blank, Robert D; Ploeg, Heidi-Lynn; Smith, Everett L

    2016-04-01

    Increased bone formation resulting from mechanical loading is well documented; however, the interactions of the mechanotransduction pathways are less well understood. Endothelin-1, a ubiquitous autocrine/paracrine signaling molecule promotes osteogenesis in metastatic disease. In the present study, it was hypothesized that exposure to big endothelin-1 (big ET1) and/or mechanical loading would promote osteogenesis in ex vivo trabecular bone cores. In a 2×2 factorial trial of daily mechanical loading (-2000με, 120cycles daily, "jump" waveform) and big ET1 (25ng/mL), 48 bovine sternal trabecular bone cores were maintained in bioreactor chambers for 23days. The bone cores' response to the treatment stimuli was assessed with percent change in core apparent elastic modulus (ΔEapp), static and dynamic histomorphometry, and prostaglandin E2 (PGE2) secretion. Two-way ANOVA with a post hoc Fisher's LSD test found no significant treatment effects on ΔEapp (p=0.25 and 0.51 for load and big ET1, respectively). The ΔEapp in the "no load + big ET1" (CE, 13±12.2%, p=0.56), "load + no big ET1" (LC, 17±3.9%, p=0.14) and "load + big ET1" (LE, 19±4.2%, p=0.13) treatment groups were not statistically different than the control group (CC, 3.3%±8.6%). Mineralizing surface (MS/BS), mineral apposition (MAR) and bone formation rates (BFR/BS) were significantly greater in LE than CC (p=0.037, 0.0040 and 0.019, respectively). While the histological bone formation markers in LC trended to be greater than CC (p=0.055, 0.11 and 0.074, respectively) there was no difference between CE and CC (p=0.61, 0.50 and 0.72, respectively). Cores in LE and LC had more than 50% greater MS/BS (p=0.037, p=0.055 respectively) and MAR (p=0.0040, p=0.11 respectively) than CC. The BFR/BS was more than two times greater in LE (p=0.019) and LC (p=0.074) than CC. The PGE2 levels were elevated at 8days post-osteotomy in all groups and the treatment groups remained elevated compared to the CC group on days 15

  15. Suitability of different construction materials for use in aseptic processing environments decontaminated with gaseous hydrogen peroxide.

    PubMed

    Unger, Beatriz; Rauschnabel, Uta; Düthorn, Berthold; Kottke, Volker; Hertel, Christian; Rauschnabel, Johannes

    2007-01-01

    The purpose of this study is to examine the behavior of different materials towards the microbial inactivation kinetic of gaseous hydrogen peroxide. Samples of 49 materials potentially used in aseptic processing environments were inoculated with 106 spores of Geobacillus stearothermophilus ATCC #12980 and exposed to defined periods using a reproducible hydrogen peroxide bio-decontamination cycle. The inactivation characteristic of each material was investigated by means of repeated D-value calculations. The results demonstrate that different materials show highly variable performance regarding the inactivation pattern of spores on each particular surface. Not only the chemical composition of the material but also differences in manufacturing processes and surface treatments were found to have an effect on the resistance of the test organisms. From the data obtained it is concluded that some correlation exists between the calculated D-values and roughness as well as wettability of the materials. Best- and worst-case materials were identified, and the dependence of specific decontamination characteristics on material properties was investigated. It is suggested to integrate studies regarding the inactivation characteristics of incorporated materials into the construction process of new aseptic processing systems bio-decontaminated with hydrogen peroxide. PMID:17933208

  16. Intravenous Immunoglobulin with Enhanced Polyspecificity Improves Survival in Experimental Sepsis and Aseptic Systemic Inflammatory Response Syndromes

    PubMed Central

    Djoumerska-Alexieva, Iglika; Roumenina, Lubka; Pashov, Anastas; Dimitrov, Jordan; Hadzhieva, Maya; Lindig, Sandro; Voynova, Elisaveta; Dimitrova, Petya; Ivanovska, Nina; Bockmeyer, Clemens; Stefanova, Zvetanka; Fitting, Catherine; Bläss, Markus; Claus, Ralf; von Gunten, Stephan; Kaveri, Srini; Cavaillon, Jean-Marc; Bauer, Michael; Vassilev, Tchavdar

    2015-01-01

    Sepsis is a major cause for death worldwide. Numerous interventional trials with agents neutralizing single proinflammatory mediators have failed to improve survival in sepsis and aseptic systemic inflammatory response syndromes. This failure could be explained by the widespread gene expression dysregulation known as “genomic storm” in these patients. A multifunctional polyspecific therapeutic agent might be needed to thwart the effects of this storm. Licensed pooled intravenous immunoglobulin preparations seemed to be a promising candidate, but they have also failed in their present form to prevent sepsis-related death. We report here the protective effect of a single dose of intravenous immunoglobulin preparations with additionally enhanced polyspecificity in three models of sepsis and aseptic systemic inflammation. The modification of the pooled immunoglobulin G molecules by exposure to ferrous ions resulted in their newly acquired ability to bind some proinflammatory molecules, complement components and endogenous “danger” signals. The improved survival in endotoxemia was associated with serum levels of proinflammatory cytokines, diminished complement consumption and normalization of the coagulation time. We suggest that intravenous immunoglobulin preparations with additionally enhanced polyspecificity have a clinical potential in sepsis and related systemic inflammatory syndromes. PMID:26701312

  17. Use of gentamicin sulfate-impregnated sponges as adjuvant therapy for the treatment of chronic foreign body associated sternal osteomyelitis in a dog

    PubMed Central

    Wainberg, Shannon H.; Brisson, Brigitte A.; Hayes, Galina M.; Mackenzie, Shawn

    2015-01-01

    A 2-year-old Labrador retriever dog was referred for evaluation of parasternal chronic draining sinus tracts associated with sternal osteomyelitis secondary to the presence of a residual wooden foreign body. The use of gentamicin-impregnated collagen sponges as adjunctive therapy to osteomyelitis treatment is reported herein. PMID:26538672

  18. A specific groove design for individualized healing in a canine partial sternal defect model by a polycaprolactone/hydroxyapatite scaffold coated with bone marrow stromal cells.

    PubMed

    Xuan, Yiwen; Tang, Hua; Wu, Bin; Ding, Xinyu; Lu, Zhongyuan; Li, Wei; Xu, Zhifei

    2014-10-01

    The reconstruction of sternal defects remains clinically challenging for thoracic surgeons. Here we aimed to explore the individualized reconstruction of partial sternal defects with new biodegradable material in a large animal model. We used the fused deposition modeling (FDM) technique to manufacture polycaprolactone/hydroxyapatite (PCL/HA) tissue scaffolds with individualized grooves to repair the sternal defect. The defects were surgically created in a sternocostal joint of eighteen Beagle dogs. The animals were separated into three groups (n = 6): Blank group, PCL/HA group, and PCL/HA/BMSCs group. Radiographic examination, histological, and histomorphometric analyses were performed to evaluate the result. In the blank group, the defect site couldn't maintain its original integrity due to no bone union. In the PCL/HA group and PCL/HA/BMSCs group, it was observed that the scaffolds retained their shapes without significant degradation at 12 weeks. Both groups could observe new bone-union by radiographic and histological examination. And PCL/HA/BMSCs would be more mineralized tissue area at implant sites (p < 0.05). These results reveal that using the FDM technique to manufacture the PCL/HA scaffolds with specific grooves could repair the sternal defect satisfactorily. Furthermore the scaffolds with BMSCs-seeded could enhance the amount of bone ingrowth and seemed to be more promising. PMID:24142768

  19. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    PubMed

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  20. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from diplodocidae and their morphological, functional and evolutionary implications.

    PubMed

    Tschopp, Emanuel; Mateus, Octávio

    2013-03-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles - which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  1. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from Diplodocidae and their morphological, functional and evolutionary implications

    PubMed Central

    Tschopp, Emanuel; Mateus, Octávio

    2013-01-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles – which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  2. A Cryosampler Payload for Aseptic Air Sample Collection at Stratospheric Altitudes Using Balloons.

    NASA Astrophysics Data System (ADS)

    Sreenivasan, S.; Dutt, C. B. S.; Bhargava, P.; Shivaji, S.; Manchanda, R. K.

    A balloon borne Astrobiology program is being conducted from the National Balloon Facility of the Tata Institute of Fundamental Research at Hyderabad India in which a liquid Neon cooled cryo pump collects air samples under sterile conditions in the altitude regime 19 - 41 Km Pursuant to the encouraging results obtained from an earlier experiment conducted on January 2001 a new payload was configured and the balloon flight was conducted on April 20 2005 after implementing much more rigorous and enhanced sterilization protocol to completely rule out contamination from ground Air samples were collected in the altitude region 20 - 41 Km and are under analysis in the National laboratories in India for detecting the presence of living microbial cells In this paper we discuss the design and fabrication of the air sample collection probes the stringent sterilization protocol evolved for ensuring that the probes are aseptic before the commencement of the experiment and the sample retrival methods for analysis in the laboratory

  3. Innovative food processing technology using ohmic heating and aseptic packaging for meat.

    PubMed

    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko

    2014-02-01

    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage. PMID:24200557

  4. Overcoming issues associated with the scale-up of a continuous flow microwave system for aseptic processing of vegetable purees

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Continuous flow microwave heating is a promising alternative to conventional heating for aseptic processing of low-acid vegetable purees. However, non-uniform temperature distribution and control of processing parameters are the major hurdles in the implementation of continuous flow microwave heatin...

  5. The value of suction drainage fluid culture during aseptic and septic orthopedic surgery: a prospective study of 901 patients.

    PubMed

    Bernard, L; Pron, B; Vuagnat, A; Gleizes, V; Signoret, F; Denormandie, P; Si-Ali, A; Perrone, C; Feron, J M; Gaillard, J L

    2002-01-01

    There are no guidelines on the value of suction drainage fluid culture (SDC), and it is difficult to determine whether the organisms cultured from suction drainage fluid samples are pathogenic or simply contaminants. We performed 2989 cultures of suction drainage fluid samples obtained, during a 1-year period, from 901 patients who underwent aseptic or septic orthopedic surgery (946 operations). The culture results were analyzed to evaluate their ability to detect postoperative infection after aseptic operations or to detect either a persistent or new episode of sepsis in patients known to have infection. For aseptic operations, the sensitivity of SDC was 25%, the specificity was 99%, the positive predictive value was 25%, and the negative predictive value was 99%. For septic operations, the sensitivity of SDC was 81%, the specificity was 96%, the positive predictive value was 87%, and the negative predictive value was 94%. We conclude that, for aseptic orthopedic surgery, SDC is not useful in detecting postoperative infection. However, for septic orthopedic surgery, it is of clinical importance. PMID:11731944

  6. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Smith, Alistair

    2015-01-01

    Abstract There is growing interest in the development of methods capable of non‐invasive characterization of stem cells prior to their use in cell‐based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm−1 after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up‐regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non‐invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for

  7. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.

    1992-01-01

    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  8. Impact of donor arm cleaning with different aseptic solutions for prevention of contamination in blood bags.

    PubMed

    Patel, Tanvi G; Shukla, Rinku V; Gupte, Snehalata C

    2013-03-01

    Transfusion associated sepsis cases are encountered occasionally and bacterial transmission remains the major cause. The goal of our study was to compare the efficacy of disinfectants in phlebotomy site preparation. After selection of donor the antecubital fossa area of the arm was disinfected with different types of disinfectants namely sprit (70% isopropyl alcohol), povidone iodine (0.5% w/v available iodine in distilled water), savlon (1.5% v/v chlorhexidine gluconate solution and 3.0% cetrimide solution) and combination of sprit and povidone iodine. Swabs were collected from 20 donors using a sterile forceps, after cleaning with different antiseptic solutions. Swab was streaked on blood agar plate aseptically and the plate was incubated at 37°C for 24 h. Colonies were counted and a single colony was re-cultured by growing on nutrient and Mac-Conkey agar. The biochemical characteristics were determined by performing Gram staining, Motility, Catalase and Oxidase tests. The mean values of colonies were significantly higher with savlon compared to other three solutions. The difference was statistically significant by "t" test (t values 1.7-3.0; P < 0.05). Staphylococcus epidermidis, Staphylococcus sp., Streptococcus sp., Micrococcus sp., Bacillus megaterium and Bacillus cereus were the organisms identified. After completion of bleeding, samples from the bag were aseptically inoculated in aerobic and anaerobic culture bottles to be tested on BacT/Alert system. The bag containing donor's blood did not show any contamination when three cleanings were carried out using sprit, povidone iodine and spirit respectively. PMID:24426327

  9. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    PubMed

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. PMID:26441162

  10. Prospective study on the chemokine CXCL13 in neuroborreliosis and other aseptic neuroinfections.

    PubMed

    Pícha, D; Moravcová, L; Smíšková, D

    2016-09-15

    The study evaluates the clinical significance of CXCL13 (leukocyte chemoattractant synthesized in CSF ) in Lyme neuroborreliosis (LNB) and other aseptic CNS infections. 244 patients with symptoms of neuroinfection and/or LNB were divided into groups: A - patients with LNB-positive antibodies in serum and CSF (96) or CSF only (14); B - patients with aseptic non-borrelial neuroinfections (82); C - negative controls (52). Group A was divided into A1-A4 according to pleocytosis in CSF and AIIgG positivity. The highest CSF CXCL13 concentrations (max. 81,287.60pg/ml; median 1766.90pg/ml) were in A1 (positive AI, pleocytosis) and A3 (negative AIIgG, pleocytosis; max. 7201,60pg/ml, median 56.22pg/ml). A2 (positive AI without pleocytosis) and A4 (negative AI without pleocytosis) had low CXCL13 levels - A2 max. 650.50pg/ml (median<7.80pg/ml); A4 max. 118.56pg/ml (median<7.8pg/ml). In B the median was 28.10pg/ml (max. 595.87pg/ml). In C the CXCL13 concentrations were the lowest (max. 83.83pg/ml; median<7.80pg/ml). The lowest cut-off was 29pg/ml (sensitivity 90.0%, specificity 72.2%), the highest one 400pg/ml (sensitivity 59.6%, specificity 94.0%). The group differences of serum CXCL13 were insignificant. The highest concentrations were at the beginning of the disease. In LNB CXCL13 correlates better with the CSF pleocytosis than AI positivity. PMID:27538636

  11. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  12. Tissue Engineered Strategies for Pseudoarthrosis

    PubMed Central

    Longo, Umile Giuseppe; Trovato, Ugo; Loppini, Mattia; Rizzello, Giacomo; Khan, Wasim Sardar; Maffulli, Nicola; Denaro, Vincenzo

    2012-01-01

    Numerous classification systems of non-union have been proposed based on: presence or absence of infection, radiographic features, clinical findings, biologic activity, location and shape. The management of pseudarthrosis is strongly related to the type of non-union (infected versus uninfected, atrophic versus hypertrophic). Surgical management of pseudarthrosis is generally effective with a success rate ranging from 75 to 100%. Nevertheless, in a relatively high number of instances several combined treatments are required for the fracture healing. The current gold standard to stimulate the bone regeneration is represented by the revision surgery with the application of autologous bone grafts. However, several approaches have been described to promote and enhance the bone tissue regeneration, including extracorporeal shock wave therapy (ESWT), ultrasound, electromagnetic, bone morphogenic proteins (BMPs) and platelet-rich-plasma (PRP). The aim of the present study was to perform a systematic review of the literature evaluating the current therapies to promote and enhance the bone tissue healing. The systematic review was performed according to PRISMA guidelines with a PRISMA checklist and algorithm. Limitations of the present systematic review are mainly related to the scanty quality of the studies available in the literature. Although the therapies previously described for the management of patients with non-unions seems to be effective, the limitations of the included studies, especially the extensive clinical heterogeneity, make not possible to provide clear recommendations regarding the application of these approaches. The problems remain the need to better understand the most effective treatment options, subject to surgical stabilization as a first step. PMID:23248729

  13. The protective effect of topical rifamycin treatment against sternal wound infection in diabetic patients undergoing on-pump coronary artery bypass graft surgery

    PubMed Central

    Aygun, Fatih; Kuzgun, Ahmet; Ulucan, Seref; Keser, Ahmet; Akpek, Mahmut; Kaya, Mehmet G

    2014-01-01

    Summary Objectives The aim of this study was to investigate the protective effect of topical rifamycin SV treatment against sternal wound infection (SWI) in diabetic patients undergoing on-pump coronary artery bypass graft (CABG) surgery. Methods One hundred and fifty-nine diabetic patients who were scheduled to undergo isolated on-pump CABG surgery were included. Eight were excluded for various reasons. Of the 151 patients, 51 were on insulin therapy and 100 were on oral anti-diabetics. The risk of mediastinitis was assessed using the American College of Cardiology/American Heart Association 2004 guideline update for CABG surgery. According to the risk scores, patients were divided into two comparable groups: the rifamycin group (n = 78) received topical rifamycin treatment after on-pump CABG surgery, and the control group (n = 73) received no topical treatment. Results Deep sternal wound infection (mediastinitis) was not observed in either group (0/78 vs 0/73, p = 1.0). No superficial sternal wound infection was observed in the rifamycin group, however, it did occur in one patient in the control group (0/78 vs 1/73, p = 0.303). Wound culture was performed and coagulase-negative staphylococci were observed. The infection regressed on initiation of antibiotic therapy against isolated bacteria and the patient was discharged after a full recovery. Conclusion Although the difference in rate of superficial sternal wound infection (SSWI) in the rifamycin and control groups was not statistically significant, locally applied rifamycin SV during closure of the sternum in the CABG operation may have had a protective affect against SWI. PMID:24687038

  14. Delayed Sternal Closure After Continuous Flow Left Ventricle Assist Device Implantation: Analysis of Risk Factors and Impact on Outcomes and Costs.

    PubMed

    Quader, Mohammed; LaPar, Damien J; Wolfe, Luke; Ailawadi, Gorav; Rich, Jeffrey; Speir, Alan; Fonner, Clifford; Kasirajan, Vigneshwar

    2016-01-01

    Patient and institutional factors predictive of delayed sternal closure (DSC) practice and its impact on clinical and cost outcomes when compared with primary sternal closure (PSC) following continuous-flow left ventricular assist device (CF-LVAD) implantation were examined. Statewide Society of Thoracic Surgeons and hospital cost data on CF-LVADs implanted were analyzed. Between January 2007 and December 2013, 558 CF-LVADs were implanted (PSC = 464, 83.2%; DSC = 94, 16.8%). Among the six institutions implanting CF-LVADs, DSC practice ranged from 3.1% to 37.8%. Compared with PSC, the DSC group had higher body mass index (BMI), renal failure, anemia, IIb/IIIa inhibitor use, emergency surgery, and extracorporeal membrane oxygenation (ECMO) support. Delayed sternal closure patients had significantly longer bypass time (139 ± 63 min vs. 107.6 ± 42 min) and higher use of intraoperative blood products (82% vs. 69%) and right ventricular assist device (RVAD) support (4.3% vs. 0.2%). Postoperative morbidities and mortality (23.4% vs. 6.5%; p ≤ 0.0001) were higher in the DSC group compared with PSC. Mean hospital costs for DSC were higher than PSC ($249,144 ± 123,273 vs. $155,915 ± 95,032; p ≤ 0.0001). Multivariate predictors of DSC include institution with higher DSC practice, preoperative ECMO support, use of IIb/IIIa inhibitors, tricuspid valve surgery, and intraoperative red blood cell transfusion. Delayed sternal closure was an independent risk factor for postoperative mortality, odds ratio 3.0 (1.2-7.2). PMID:27164037

  15. Hands-up positioning during asymmetric sternal retraction for internal mammary artery harvest: a possible method to reduce brachial plexus injury.

    PubMed

    Jellish, W S; Blakeman, B; Warf, P; Slogoff, S

    1997-02-01

    This study compares the hands-up (HU) with the arms at side (AAS) position to determine whether one is beneficial in reducing brachial plexus stress during asymmetric sternal retraction. Eighty patients undergoing cardiac surgery were assigned to either Group 1 (AAS) or Group 2 (HU). Perioperative neurologic evaluations of the brachial plexus were performed and somatosensory evoked potentials (SSEPs) were collected during internal mammary artery harvest using asymmetric sternal retraction. Demographic data, SSEP changes, and postoperative brachial plexus symptoms were compared between groups. SSEP amplitude decreased in 95% of all patients during retractor placement with substantial decreases (> 50%) observed on the left side in 50% of the AAS and 35% of the HU patients. Amplitude recovery was normally seen in both groups after asymmetric retractor removal. Similar changes were noted, to a lesser degree, on the right side. During asymmetric sternal retraction, HU positioning offered minimal benefit in reducing brachial plexus stress as measured by SSEP. Three of the seven AAS patients who reported brachial plexus symptoms had an ulnar nerve distribution of injury. However, none of the four patients with plexus symptoms in the HU group had ulnar nerve problems, suggesting that the higher incidence of postoperative symptoms observed with AAS positioning may occur from ulnar nerve compression. PMID:9024012

  16. Bilateral non-traumatic aseptic osteonecrosis in the femoral head. An experimental study of incidence

    SciTech Connect

    Hauzeur, J.P.; Pasteels, J.L.; Orloff, S.

    1987-10-01

    Thirty-five patients who were seen with non-traumatic aseptic osteonecrosis of the femoral head were included in a study of the contralateral hip to evaluate the incidence of bilateral disease. We used not only conventional radiography and scintigraphy but also measurement of intramedullary pressure and core biopsy. Pain was caused by 14.3 per cent of the contralateral hips, a lesion was demonstrated on plain radiographs in 51.4 per cent, and increased isotopic uptake was seen in 31.4 per cent. Histological study of specimens obtained by osteomedullary biopsy (after special procedure) showed bilateral necrosis in 88.5 per cent of the patients. After a mean follow-up of thirty-four months, only one of nine hips that were painless and had negative radiographic and isotopic findings, but had positive findings on biopsy, became painful and radiographically positive. The intramedullary pressure in the intertrochanteric area was recorded in each hip, and no correlation was found with the radiographic stage or with pain.

  17. Aseptic necrosis at multiple localisations in a lupus patient with lymphoma.

    PubMed

    Bazso, A; Bazso, T; Szodoray, P; Poor, G; Kiss, E

    2014-04-01

    Avascular or aseptic necrosis is a well-defined entity leading to the degradation of cellular elements of the bone. The pathogenesis of osteonecrosis (ON) is still unknown. There are two main types of ON: traumatic or non-traumatic. Several clinical entities could associate with ON, systemic diseases, environmental factors, pregnancy, systemic autoimmune or rheumatic diseases, thrombophilia, corticosteroid therapy, cytotoxic dugs, infections, metabolic and hematologic diseases, etc. Corticosteroids (CS) are still the most frequently used therapeutic options in the early phase and during flares of these diseases. Inflammatory cytokines and antibodies have been described to participate in the pathogenesis of ON. The infiltrative disorders of the bone marrow could also contribute to the development of ON. Hereby, we describe a female patient with NHL followed by SLE in whom ON has developed at least in two localisations. Lupus flare, long-term CS therapy, lymphoma relapse or the presence of antiphospholipid antibodies were excluded. Although the bi-localised ON could be contributed to immunologic factors or trauma, the exact aetiology in this case could not be elucidated. PMID:24297095

  18. Controlled Human Malaria Infection of Tanzanians by Intradermal Injection of Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites

    PubMed Central

    Shekalaghe, Seif; Rutaihwa, Mastidia; Billingsley, Peter F.; Chemba, Mwajuma; Daubenberger, Claudia A.; James, Eric R.; Mpina, Maximillian; Ali Juma, Omar; Schindler, Tobias; Huber, Eric; Gunasekera, Anusha; Manoj, Anita; Simon, Beatus; Saverino, Elizabeth; Church, L. W. Preston; Hermsen, Cornelus C.; Sauerwein, Robert W.; Plowe, Christopher; Venkatesan, Meera; Sasi, Philip; Lweno, Omar; Mutani, Paul; Hamad, Ali; Mohammed, Ali; Urassa, Alwisa; Mzee, Tutu; Padilla, Debbie; Ruben, Adam; Lee Sim, B. Kim; Tanner, Marcel; Abdulla, Salim; Hoffman, Stephen L.

    2014-01-01

    Controlled human malaria infection (CHMI) by mosquito bite has been used to assess anti-malaria interventions in > 1,500 volunteers since development of methods for infecting mosquitoes by feeding on Plasmodium falciparum (Pf) gametocyte cultures. Such CHMIs have never been used in Africa. Aseptic, purified, cryopreserved Pf sporozoites, PfSPZ Challenge, were used to infect Dutch volunteers by intradermal injection. We conducted a double-blind, placebo-controlled trial to assess safety and infectivity of PfSPZ Challenge in adult male Tanzanians. Volunteers were injected intradermally with 10,000 (N = 12) or 25,000 (N = 12) PfSPZ or normal saline (N = 6). PfSPZ Challenge was well tolerated and safe. Eleven of 12 and 10 of 11 subjects, who received 10,000 and 25,000 PfSPZ respectively, developed parasitemia. In 10,000 versus 25,000 PfSPZ groups geometric mean days from injection to Pf positivity by thick blood film was 15.4 versus 13.5 (P = 0.023). Alpha-thalassemia heterozygosity had no apparent effect on infectivity. PfSPZ Challenge was safe, well tolerated, and infectious. PMID:25070995

  19. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    PubMed

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products. PMID:20549988

  20. Cardiomyogenic differentiation of human sternal bone marrow mesenchymal stem cells using a combination of basic fibroblast growth factor and hydrocortisone.

    PubMed

    Hafez, Pezhman; Jose, Shinsmon; Chowdhury, Shiplu R; Ng, Min Hwei; Ruszymah, B H I; Abdul Rahman Mohd, Ramzisham

    2016-01-01

    The alarming rate of increase in myocardial infarction and marginal success in efforts to regenerate the damaged myocardium through conventional treatments creates an exceptional avenue for cell-based therapy. Adult bone marrow mesenchymal stem cells (MSCs) can be differentiated into cardiomyocytes, by treatment with 5-azacytidine, thus, have been anticipated as a therapeutic tool for myocardial infarction treatment. In this study, we investigated the ability of basic fibroblastic growth factor (bFGF) and hydrocortisone as a combined treatment to stimulate the differentiation of MSCs into cardiomyocytes. MSCs were isolated from sternal marrow of patients undergoing heart surgery (CABG). The isolated cells were initially monitored for the growth pattern, followed by characterization using ISCT recommendations. Cells were then differentiated using a combination of bFGF and hydrocortisone and evaluated for the expression of characteristic cardiac markers such as CTnI, CTnC, and Cnx43 at protein level using immunocytochemistry and flow cytometry, and CTnC and CTnT at mRNA level. The expression levels and pattern of the cardiac markers upon analysis with ICC and qRT-PCR were similar to that of 5-azacytidine induced cells and cultured primary human cardiomyocytes. However, flow cytometric evaluation revealed that induction with bFGF and hydrocortisone drives MSC differentiation to cardiomyocytes with a marginally higher efficiency. These results indicate that combination treatment of bFGF and hydrocortisone can be used as an alternative induction method for cardiomyogenic differentiation of MSCs for future clinical applications. PMID:26289249

  1. Ultrastructure of posterior sternal glands of Macrotermes annandalei (Silvestri): new members of the sexual glandular set found in termites (Insecta).

    PubMed

    Quennedey, André; Peppuy, Alexis; Courrent, Annie; Robert, Alain; Everaerts, Claude; Bordereau, Christian

    2004-12-01

    In female alates of Macrotermes annandalei, two types of abdominal glands are involved in the secretion of sex pheromone. Tergal glands are found at the anterior margin of tergites 6-10 and posterior sternal glands (PSGs) are located at the anterior margin of sternites 6-7. The cytological features of both types of glands are quite similar. The fine structural organization of PSGs is studied more precisely and described for the first time. The glandular cuticle is pitted with narrow apertures corresponding to the openings of numerous subcuticular pouches. Several Class 3 glandular units open in each pouch. One canal cell and one secretory cell make an individual glandular unit. The canal cell is enlarged apically and is connected with the other canal cells to form a common pouch. Based on the structural features found in these glands, we propose a common secretory process for PSGs and tergal glands. During the physiological maturation of alates inside the nest, secretory vesicles amass in the cytoplasm of secretory cells, while large intercellular spaces collapse the cuticular pouches. At the time of dispersal flight, pouches are filled with the content of secretory vesicles while intercellular spaces are sharply reduced. After calling behavior, no secretion remains in the glands and pouches collapse again, while secretory cells are drastically reduced in size. The structure and the secretory processes of PSGs and tergal glands are compared to those of abdominal sexual glands known in termites. PMID:15487007

  2. Age Estimation in Living Adults using 3D Volume Rendered CT Images of the Sternal Plastron and Lower Chest.

    PubMed

    Oldrini, Guillaume; Harter, Valentin; Witte, Yannick; Martrille, Laurent; Blum, Alain

    2016-01-01

    Age estimation is commonly of interest in a judicial context. In adults, it is less documented than in children. The aim of this study was to evaluate age estimation in adults using CT images of the sternal plastron with volume rendering technique (VRT). The evaluation criteria are derived from known methods used for age estimation and are applicable in living or dead subjects. The VRT images of 456 patients were analyzed. Two radiologists performed age estimation independently from an anterior view of the plastron. Interobserver agreement and correlation coefficients between each reader's classification and real age were calculated. The interobserver agreement was 0.86, and the correlation coefficients between readers classifications and real age classes were 0.60 and 0.65. Spearman correlation coefficients were, respectively, 0.89, 0.67, and 0.71. Analysis of the plastron using VRT allows age estimation in vivo quickly and with results similar than methods such as Iscan, Suchey-Brooks, and radiographs used to estimate the age of death. PMID:27092960

  3. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae)

    NASA Astrophysics Data System (ADS)

    Vujisić, Ljubodrag V.; Vučković, Ivan M.; Makarov, Slobodan E.; Ilić, Bojan S.; Antić, Dragan Ž.; Jadranin, Milka B.; Todorović, Nina M.; Mrkić, Ivan V.; Vajs, Vlatka E.; Lučić, Luka R.; Ćurčić, Božidar P. M.; Mitić, Bojan M.

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6 O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises.

  4. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae).

    PubMed

    Vujisić, Ljubodrag V; Vučković, Ivan M; Makarov, Slobodan E; Ilić, Bojan S; Antić, Dragan Z; Jadranin, Milka B; Todorović, Nina M; Mrkić, Ivan V; Vajs, Vlatka E; Lučić, Luka R; Curčić, Božidar P M; Mitić, Bojan M

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises. PMID:23907296

  5. Osteometric sex discrimination from the sternal extremity of the fourth rib in a recent forensic sample from Southwestern Spain.

    PubMed

    Macaluso, P James; Rico, Antonio; Santos, María; Lucena, Joaquín

    2012-11-30

    The discrimination of sex is central to the process of establishing a personal identification from human skeletal remains. Previous study has demonstrated that osteometric analysis of the sternal extremity of the fourth rib provides a reasonably accurate method for assessing this biological attribute in diverse human groups. As metric standards are generally population-specific, the purpose of the current research was to evaluate the degree of sexual dimorphism present in the fourth rib among contemporary Spaniards, a group thus far not investigated, and generate discriminant function equations which can be used to estimate the sex of unidentified remains in this population. Superior-inferior height and anterior-posterior breadth dimensions of the fourth rib were collected for a sample consisting of 60 males and 57 females derived from postmortem examinations performed at the Institute of Legal Medicine, Seville, Spain. The results demonstrated that both rib dimensions were highly sexually dimorphic (p<0.0001) in this Spanish sample. Univariate discriminant function analyses yielded correct sex classification rates of 76.9% and 83.8% for breadth and height dimensions, respectively. Multivariate analysis incorporating both rib measurements improved the allocation accuracy to 86.3%, with an associated sex bias of only 0.7%. Therefore, the derived discriminant function equations, particularly those that incorporate rib height, can be effectively used in cases involving fragmentary remains in which more dimorphic elements such as the pelvis are not preserved, as well as complete skeletons to complement other metric and morphological sex assessment methods. PMID:23068090

  6. Transmission of seasonal outbreak of childhood enteroviral aseptic meningitis and hand-foot-mouth disease.

    PubMed

    Park, Sue K; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu; Cheong, Hae-Kwan

    2010-05-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD. PMID:20436701

  7. Tissue Engineering Chamber Promotes Adipose Tissue Regeneration in Adipose Tissue Engineering Models Through Induced Aseptic Inflammation

    PubMed Central

    Peng, Zhangsong; Dong, Ziqing; Chang, Qiang; Zhan, Weiqing; Zeng, Zhaowei; Zhang, Shengchang

    2014-01-01

    Tissue engineering chamber (TEC) makes it possible to generate significant amounts of mature, vascularized, stable, and transferable adipose tissue. However, little is known about the role of the chamber in tissue engineering. Therefore, to investigate the role of inflammatory response and the change in mechanotransduction started by TEC after implantation, we placed a unique TEC model on the surface of the groin fat pads in rats to study the expression of cytokines and tissue development in the TEC. The number of infiltrating cells was counted, and vascular endothelial growth factor (VEGF) and monocyte chemotactic protein-1 (MCP-1) expression levels in the chamber at multiple time points postimplantation were analyzed by enzyme-linked immunosorbent assay. Tissue samples were collected at various time points and labeled for specific cell populations. The result showed that new adipose tissue formed in the chamber at day 60. Also, the expression of MCP-1 and VEGF in the chamber decreased slightly from an early stage as well as the number of the infiltrating cells. A large number of CD34+/perilipin− perivascular cells could be detected at day 30. Also, the CD34+/perilipin+ adipose precursor cell numbers increased sharply by day 45 and then decreased by day 60. CD34−/perilipin+ mature adipocytes were hard to detect in the chamber content at day 30, but their number increased and then peaked at day 60. Ki67-positive cells could be found near blood vessels and their number decreased sharply over time. Masson's trichrome showed that collagen was the dominant component of the chamber content at early stage and was replaced by newly formed small adipocytes over time. Our findings suggested that the TEC implantation could promote the proliferation of adipose precursor cells derived from local adipose tissue, increase angiogenesis, and finally lead to spontaneous adipogenesis by inducing aseptic inflammation and changing local mechanotransduction. PMID:24559078

  8. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive. PMID:21225195

  9. Usefulness of inflammatory biomarkers in discriminating between bacterial and aseptic meningitis in hospitalized children from a population with low vaccination coverage

    PubMed Central

    Wysocki, Jacek; Avonts, Dirk; Januszkiewicz-Lewandowska, Danuta; Michalak, Michal

    2016-01-01

    Introduction Neisseria meningitidis and Streptococcus pneumoniae are the most frequent pathogens responsible for meningitis beyond the neonatal period. Aseptic meningitis is a disabling condition, but bacterial meningitis if left untreated is 100% fatal. The aim of the study was to analyze the usefulness of biochemical and hematological parameters in distinguishing between bacterial and non-bacterial meningitis in children with meningitis from a population with low rates of vaccination against S. pneumoniae and N. meningitidis. Material and methods This study is a retrospective chart review of children hospitalized with meningitis. In patients with aseptic and bacterial meningitis the following parameters were compared: C-reactive protein, D-dimers, fibrinogen, glucose level, and leukocyte level, and in cerebrospinal fluid, protein, glucose, and leukocyte concentrations were analyzed. Number of points in the Bacterial Meningitis Score (BMS) was calculated. The predictive value of each parameter to distinguish between bacterial and aseptic meningitis was evaluated. Results In total, 129 patients were included in the study: 65 diagnosed with bacterial meningitis and 64 with aseptic meningitis. Bacterial and aseptic meningitis were statistically significantly different based on each analyzed parameter (p < 0.000001). Among children with aseptic meningitis 42 (66%) scored 0 points in the BMS, while all the children with bacterial meningitis had at least one point. Conclusions In children with meningitis inflammatory biomarkers differ statistically significantly depending on the etiology – bacterial or aseptic. Serum concentration of C-reactive protein higher than 80 mg/dl is a useful marker of bacterial etiology of meningitis. A high Bacterial Meningitis Score is indicative for bacterial meningitis. PMID:27186188

  10. Use of Incisional Negative Pressure Wound Therapy on Closed Median Sternal Incisions after Cardiothoracic Surgery: Clinical Evidence and Consensus Recommendations

    PubMed Central

    Dohmen, Pascal M.; Markou, Thanasie; Ingemansson, Richard; Rotering, Heinrich; Hartman, Jean M.; van Valen, Richard; Brunott, Maaike; Segers, Patrique

    2014-01-01

    to provide recommendations on the optimal use of negative pressure wound therapy on closed median sternal incisions after cardiothoracic surgery. PMID:25280449

  11. Aseptic Raman spectroscopy can detect changes associated with the culture of human dental pulp stromal cells in osteoinductive culture

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Tomlinson, Matthew J.; Smith, Alistair

    2015-01-01

    There is an unmet need for the non-invasive characterisation of stem cells to facilitate the translation of cell-based therapies. Raman spectroscopy has proven utility in stem cell characterisation but as yet no method has been reported capable of taking repeated Raman measurements of living cells aseptically over time. The aim of this study was to determine if Raman spectroscopy could be used to monitor changes in a well characterised cell population (human dental pulp stromal cells (DPSCs)) by taking repeated Raman measurements from the same cell populations in osteoinductive culture over time and under aseptic conditions. DPSCs were isolated from extracted premolar teeth from 3 consenting donors. Following in vitro expansion, DPSCs were maintained for 28 days in osteo-inductive medium. Raman spectra were acquired from the cells at days 0, 3, 7, 10, 14 and 28. Principal component analysis (PCA) was carried out to assess if there was any temporal spectral variation. At day 28, osteoinduction was confirmed using alizarin red staining and qRT-PCR for alkaline phosphatase and osteocalcin. Alizarin red staining was positive in all samples at day 28 and significant increases in alkaline phosphatase (p < 0.001) and osteocalcin (p < 0.05) gene expression were also observed compared with day 0. PCA of the Raman data demonstrated trends in PC1 from days 0–10, influenced by protein associated features and PC2 from days 10–28, influenced by DNA/RNA associated features. We conclude that spectroscopy can be used to monitor changes in Raman signature with time associated with the osteoinduction of DPSCs using repeated measurements via an aseptic methodology. PMID:26374253

  12. Review of the role of dynamic 18F-NaF PET in diagnosing and distinguishing between septic and aseptic loosening in hip prosthesis.

    PubMed

    Adesanya, Olu; Sprowson, Andrew; Masters, James; Hutchinson, Charles

    2015-01-01

    Joint replacements may fail due to infection, dislocation, peri-prosthetic fracture and loosening. Between 0.4 and 4% of joint replacements are known to be complicated by infection and aseptic loosening 2-18%. Differentiating between infection and aseptic loosening has an important bearing on the ongoing strategy for antimicrobial therapy and surgical intervention, but distinguishing one from the other can be difficult and will often require a battery of clinical and biochemical tests including the use of varying radiological modalities to accurately identify whether problematic joints are infected or aseptically loose. Prompt diagnosis is important due to the development of a biofilm on the surface of the infected prosthesis, which makes treatment difficult. There is no consensus among experts on the ideal imaging technique nor the methodology for image interpretation, but there is an increasing trend to apply hybrid imaging in the investigation of painful joint prosthesis and recent attempts have been made using PET-CT to identify aseptic loosening and infection with (18)F-fluorodeoxyglucose (FDG) and sodium fluoride (18)F-Na. The aim of this paper is to evaluate the role of (18)F-NaF sodium fluoride ((18)F-NaF) positron emission tomography (PET) in distinguishing between septic and aseptic failure in hip and knee replacements, in addition to evaluating the feasibility of using multi-sequential (18)F-NaF PET-CT for the assessment of painful lower limb prostheses. PMID:25592441

  13. The Protective Effect of Bafilomycin A1 Against Cobalt Nanoparticle-Induced Cytotoxicity and Aseptic Inflammation in Macrophages In Vitro.

    PubMed

    Wang, Songhua; Liu, Fan; Zeng, Zhaoxun; Yang, Huilin; Jiang, Haitao

    2016-01-01

    Co ions released due to corrosion of Co nanoparticles (CoNPs) in the lysosomes of macrophages may be a factor in the particle-induced cytotoxicity and aseptic inflammation accompanying metal-on-metal (MOM) hip prosthesis failure. Here, we show that CoNPs are easily dissolved under a low pH, simulating the acidic lysosomal environment. We then used bafilomycin A1 to change the pH inside the lysosome to inhibit intracellular corrosion of CoNPs and then investigated its protective effects against CoNP-induced cytotoxicity and aseptic inflammation on murine macrophage RAW264.7 cells. XTT {2,3-bis (2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide} assays revealed that bafilomycin A1 can significantly decrease CoNP-induced cytotoxicity in RAW264.7 cells. Enzyme-linked immunosorbent assays showed that bafilomycin A1 can significantly decrease the subtoxic concentration of CoNP-induced levels of pro-inflammatory cytokines (tumor necrosis factor-α, interleukin-1β, and interleukin-6), but has no effect on anti-inflammatory cytokines (transforming growth factor-β and interleukin-10) in RAW264.7 cells. We studied the protective mechanism of bafilomycin A1 against CoNP-induced effects in RAW264.7 cells by measuring glutathione/oxidized glutathione (GSH/GSSG), superoxide dismutase, catalase, and glutathione peroxidase levels and employed scanning electron microscopy, transmission electron microscopy, and energy dispersive spectrometer assays to observe the ultrastructural cellular changes. The changes associated with apoptosis were assessed by examining the pAKT and cleaved caspase-3 levels using Western blotting. These data strongly suggested that bafilomycin A1 can potentially suppress CoNP-induced cytotoxicity and aseptic inflammation by inhibiting intracellular corrosion of CoNPs and that the reduction in Co ions released from CoNPs may play an important role in downregulating oxidative stress in RAW264.7 cells. PMID:26054709

  14. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling

    PubMed Central

    Bhadane, Bhushan S.; Patil, Ravindra H.

    2016-01-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  15. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  16. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination.

    PubMed

    Atwater, J E; Michalek, W F; Wheeler, R R; Dahl, R; Lunsford, T D; Garmon, F C; Sauer, R L

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus. PMID:11587573

  17. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    PubMed

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  18. Sternal exploration or closure

    MedlinePlus

    ... infections following open heart surgery. Journal of Cardiovascular Nursing. October 2005; 20(5):299-305. PMID: 16141774 http://www.ncbi.nlm.nih.gov/pubmed/16141774 . Kulaylat MN, Dayton MT. Surgical complications. In: Townsend CM Jr, Beauchamp RD, Evers ...

  19. Plasmodium falciparum Malaria Challenge by the Bite of Aseptic Anopheles stephensi Mosquitoes: Results of a Randomized Infectivity Trial

    PubMed Central

    Lyke, Kirsten E.; Laurens, Matthew; Adams, Matthew; Billingsley, Peter F.; Richman, Adam; Loyevsky, Mark; Chakravarty, Sumana; Plowe, Christopher V.; Sim, B. Kim Lee; Edelman, Robert; Hoffman, Stephen L.

    2010-01-01

    Background Experimental infection of malaria-naïve volunteers by the bite of Plasmodium falciparum-infected mosquitoes is a preferred means to test the protective effect of malaria vaccines and drugs. The standard model relies on the bite of five infected mosquitoes to induce malaria. We examined the efficacy of malaria transmission using mosquitoes raised aseptically in compliance with current Good Manufacturing Practices (cGMPs). Methods and Findings Eighteen adults aged 18–40 years were randomized to receive 1, 3 or 5 bites of Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of P. falciparum. Seventeen participants developed malaria; fourteen occurring on Day 11. The mean prepatent period was 10.9 days (9–12 days). The geometric mean parasitemia was 15.7 parasites/µL (range: 4–70) by microscopy. Polymerase chain reaction (PCR) detected parasites 3.1 (range: 0–4) days prior to microscopy. The geometric mean sporozoite load was 16,753 sporozoites per infected mosquito (range: 1,000–57,500). A 1-bite participant withdrew from the study on Day 13 post-challenge and was PCR and smear negative. Conclusions The use of aseptic, cGMP-compliant P. falciparum-infected mosquitoes is safe, is associated with a precise prepatent period compared to the standard model and appears more efficient than the standard approach, as it led to infection in 100% (6/6) of volunteers exposed to three mosquito bites and 83% (5/6) of volunteers exposed to one mosquito bite. Trial Registration ClinicalTrials.gov NCT00744133 PMID:21042404

  20. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    SciTech Connect

    Haydary, J.; Susa, D.; Dudáš, J.

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  1. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  2. Topical versus Systemic Vancomycin for Deep Sternal Wound Infection Caused by Methicillin-Resistant Staphylococcus aureus in a Rodent Experimental Model

    PubMed Central

    Ozcan, Ali V.; Demir, Melek; Onem, Gokhan; Goksin, Ibrahim; Baltalarli, Ahmet; Topkara, Veli K.; Kaleli, Ilknur

    2006-01-01

    In 37 Wistar albino rats, we investigated the effects of topical vancomycin on deep sternal wound infection caused by methicillin-resistant Staphylococcus aureus. Partial median sternotomy was performed under sterile conditions. Group I (n=6) was the sham, and group II (n=7) was the control. Group III (n=8) received topical vancomycin, group IV (n=8) received systemic vancomycin, and group V (n=8) received topical and systemic vancomycin (combined). Rats in groups II through V were inoculated with 0.5 mL × 108 CFU/mL methicillin-resistant S. aureus in the mediastinum and sternum. No medication was given to groups I and II. Twenty-four hours after surgery, 40 mg/kg/day vancomycin was given topically in group III; systemically in group IV; and topically and systemically in group V. After 7 days, smear samples from the mediastinum and tissue cultures from the sternum were obtained. We found 5.00 ± 0 CFU/mL microorganisms in the mediastinum in group II, 1.90 ± 1.70 in group III, 3.33 ± 0.48 in group IV, and 1.70 ± 1.08 in group V. The quantity of microorganisms per gram of tissue in the sternum was 7.36 ± 0.23 in group II, 6.01 ± 0.33 in group III, 5.81 ± 0.81 in group IV, and 3.99 ± 2.47 in group V. The quantity of microorganisms was less in the 3 treatment groups than in the control group (P <0.05). We conclude that topical plus systemic vancomycin treatment might be more effective in patients with deep sternal wound infections caused by methicillin-resistant S. aureus. PMID:16878608

  3. Aseptic Meningitis Associated with ECHO Virus Type 9 Infection—With Special Reference to Variability by Sex and Incidence of Paralytic Sequelae

    PubMed Central

    Portnoy, Bernard; Hanes, Bernard; Pierce, Nathaniel F.; Leedom, John M.; Kunzman, E. Eugene; Wehrle, Paul F.

    1965-01-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable. A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  4. ASEPTIC MENINGITIS ASSOCIATED WITH ECHO VIRUS TYPE 9 INFECTION. WITH SPECIAL REFERENCE TO VARIABILITY BY SEX AND INCIDENCE OF PARALYTIC SEQUELAE.

    PubMed

    PORTNOY, B; HANES, B; PIERCE, N F; LEEDOM, J M; KUNZMAN, E E; WEHRLE, P F

    1965-04-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable.A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  5. Design, development and qualification of a microbiological challenge facility to assess the effectiveness of BFS aseptic processing.

    PubMed

    Leo, F; Poisson, P; Sinclair, C S; Tallentire, A

    2005-01-01

    A programme of work has been initiated to further the understanding of the impact of the environment surrounding a Blow/Fill/Seal (BFS) machine upon the microbiological quality of processed product. A dedicated facility (Challenge Room) has been constructed and qualified to provide for the production and containment of dispersions of micro organisms in air of a room housing an operating BFS machine of a given style and configuration. The facility achieves homogeneous distribution of generated dispersions throughout the Challenge Room air, including that within and close to the critical area in which aseptic BFS operations occur. Generated microbial dispersions can be maintained in the room over extended time periods (up to 600 min) at a desired concentration within the range 10(1) to 10(7) cfu m(-3). They can also be produced employing different cell types, including bacterial endospores, Gram-positive and Gram-negative vegetative cells and yeast cells. Effective containment of dispersions is achieved while 'cards of product' (vials in sets) are conveyed from the Challenge Room to an adjacent Packing and Storage Area. Decontamination of the room and the housed BFS machine is accomplished through exposure to chlorine dioxide gas at a concentration of 1.0 mg dm(-3) for 120 min at room temperature (approximately 23 degrees C). PMID:15796134

  6. The development of invertase activity in slices of the root of Beta vulgaris L. washed under aseptic conditions

    PubMed Central

    Bacon, J. S. D.; MacDonald, I. R.; Knight, A. H.

    1965-01-01

    1. When disks of root tissue from sugar or red beet (Beta vulgaris L.) are washed in running aerated tap water the sucrose contained in them disappears and glucose and fructose are formed. 2. Invertase activity in the disks has been measured by a polarimetric method. Freshly cut tissue has a very low activity, but a considerable increase occurs during the first 3–4 days of washing, the final activity being sufficient to hydrolyse the sucrose contained in the disk within a few hours. 3. Disks of red beet have been cut and shaken in water under aseptic conditions. Sucrose breakdown and invertase development still took place. Microbial contamination is therefore not responsible. 4. Trisaccharides that appear in sugar-beet disks during the washing process have been isolated and identified; their formation also suggests that a higher-plant invertase is acting. 5. The significance of these results is discussed in relation to protein synthesis in washed storage-tissue slices, and the occurrence of high invertase activity in growing plant cells. PMID:14342226

  7. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    PubMed

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. PMID:23428565

  8. Surgical treatment of an aseptic fistulized acromioclavicular joint cyst: a case report and review of the literature

    PubMed Central

    Murena, Luigi; D’angelo, Fabio; Falvo, Daniele A

    2009-01-01

    An acromioclavicular joint cyst is an uncommonly reported condition, which seems to result from a massive rotator cuff tear and degenerative osteoarthritis of the acromioclavicular joint. We present the case of an 81-year-old man affected by an acromioclavicular joint cyst, associated to a massive rotator cuff tear, proximal migration of the humeral head and osteoarthritis of the gleno-humeral joint. The mass was 7 × 2.5 cm in size and the overlying skin presented a fistula that drained clear synovial-like fluid. Plain X-ray examination of the left shoulder showed proximal migration of the humeral head migration and osteoarthritis of the gleno-humeral joint, and further MRI evaluation confirmed the clinical diagnosis of a complete rotator cuff tear and observed a large subcutaneous cyst in communication with the degenerative acromioclavicular joint. The patient underwent surgical excision of the cyst and lateral resection of the clavicle to prevent disease recurrence. To the best of our knowledge, this is the first reported case of an acromioclavicular joint cyst complicated by an aseptic fistula resulting from multiple aspirations. PMID:19918423

  9. Aseptic non-touch technique and catheter-related bloodstream infection in children receiving parenteral nutrition at home

    PubMed Central

    Evans, Victoria; Hughes, Anna; Hill, Susan

    2015-01-01

    Objectives Parenteral nutrition (PN) at home is an acceptable form of delivering long-term PN for children with intestinal failure. Catheter-related bloodstream infection (CRBSI) is one of the serious complications of long-term PN and can lead to increasing morbidity and mortality. Using aseptic non-touch technique (ANTT) was proven to decrease the incidence of CRBSI in hospital patients. In this study we aimed to review the incidence of CRBSI in children receiving PN at home in our institution using the ANTT and a simplified training programme for parents and carers. Methods We retrospectively collected clinical and microbiological data on all children with intestinal failure (IF) who were on treatment with PN at home under our specialist IF rehabilitation service between November 2012 and November 2013. Results Thirty-five children were included, 16 of whom did not have any infection recorded during the study period. The overall CRBSI rate was 1.3 infections per 1000 line-days, with Staphylococcus being the commonest organism. Twenty-one children did not require catheter change and the overall catheter changes were 1.8 per 1000 line-days. Conclusion In this article, we report a low incidence of CRBSI in a single institution by using the principle of ANTT for accessing central venous catheters combined with a simplified, nurse-led, two-week standardised training programme for parents of children going home on PN. PMID:26279849

  10. Comparison of the roles of IL-1, IL-6, and TNFα in cell culture and murine models of aseptic loosening1

    PubMed Central

    Taki, Naoya; Tatro, Joscelyn M.; Lowe, Robert; Goldberg, Victor M.; Greenfield, Edward M.

    2007-01-01

    Pro-inflammatory cytokines, such as IL-1, IL-6, and TNF, are considered to be major mediators of osteolysis and ultimately aseptic loosening. This study demonstrated that synergistic interactions among these cytokines are required for the in vitro stimulation of osteoclast differentiation by titanium particles. In contrast, genetic knock out of these cytokines or their receptors does not protect murine calvaria from osteolysis induced by titanium particles. Thus, the extent of osteolysis was not substantially altered in single knock out mice lacking either the IL-1 receptor or IL-6. Osteolysis also was not substantially altered in double knock out mice lacking both the IL-1 receptor and IL-6 or in double knock out mice lacking both TNF receptor-1 and TNF receptor-2. The differences between the in vivo and the cell culture results make it difficult to conclude whether the pro-inflammatory cytokines contribute to aseptic loosening. One alternative is that in vivo experiments are more physiological and that therefore the current results do not support a role for the pro-inflammatory cytokines in aseptic loosening. We however favor the alternative that, in this case, the cell culture experiments can be more informative. We favor this alternative because the role of the pro-inflammatory cytokines may be obscured in vivo by compensation by other cytokines or by the low signal to noise ratio found in measurements of particle-induced osteolysis. PMID:17236833

  11. The role of Card9 overexpression in peripheral blood mononuclear cells from patients with aseptic acute pancreatitis.

    PubMed

    Yang, Zhi-wen; Weng, Cheng-zhao; Wang, Jing; Xu, Ping

    2016-03-01

    Activated mononuclear cells are an early event in the course of severe acute pancreatitis (SAP). To date, the molecular mechanism triggering peripheral blood mononuclear cells (PBMCs) is poorly understood. The aim of this paper was to determine the potential role of Card9 in SAP. We collected data from 72 subjects between January 2013 and June 2014. Subsequently, PBMCs were isolated on day 1, 3 and 5 of pancreatitis. Immunofluorescence staining, quantitative real-time PCR, Western blotting, immunoprecipitation and ELISA were used to determine the role of Card9 in SAP. Microbial culture showed that SAP patients at the early period did not develop any bacteria and fungi infection. Card9 expression in SAP patients was higher than that in mild acute pancreatitis and volunteer healthy controls, up to the peak on day 1. The monocyte-derived cytokines interleukin (IL)-17, IL-1β, IL-6 and tumour necrosis factor-α mediated by the induction of Card9 markedly increased in SAP patients compared with the control group. Furthermore, the inducible formation of Card9-Bcl10 complex was found in PBMCs, which may be involved in nuclear factor kappa B (NF-κB) and p38 activation in SAP. Receiver operating characteristic curve indicated that Card9 levels had a high sensitivity of 87.5% and specificity of 67.7%, showing the close correlation with SAP patients. Card9 overexpression was firstly found in aseptic SAP, which may be played an important role in NF-κB and p38 activation in PBMCs. It also provided the new insights into therapeutic interventions by targeting monocytes activation in SAP patients. PMID:26893103

  12. 18F-FDG microPET imaging differentiates between septic and aseptic wound healing after orthopedic implant placement

    PubMed Central

    Odekerken, Jim C E; Brans, Boudewijn T; Welting, Tim J M; Walenkamp, Geert H I M

    2014-01-01

    Background and purpose 18F-FDG PET is a widely used tool for molecular imaging of oncological, cardiovascular, and neurological disorders. We evaluated 18F-FDG microPET as an implant osteomyelitis imaging tool using a Staphylococcus aureus-induced peroperative implant infection in rabbits. Methods Intramedullary titanium nails were implanted in contaminated and uncontaminated (control) proximal right tibiae of rabbits. Tibiae were quantitatively assessed with microPET for 18F-FDG uptake before and sequentially at 1, 3, and 6 weeks after surgery. Tracer uptake was assessed in soft tissue and bone in both treatment groups with an additional comparison between the operated and unoperated limb. MicroPET analysis was combined with radiographic assessment and complementary histology of the tibiae. Results At the first postoperative week, the 18F-FDG uptake in the contaminated implant group was significantly higher than the preoperative measurement, without a significant difference between the contaminated and uncontaminated tibiae. From the third postoperative week onward, 18F-FDG uptake allowed discrimination between osteomyelitis and postoperative aseptic bone healing, as well as quantification of the infection at distinct locations around the implant. Interpretation 18F-FDG-based microPET imaging allows differentiation between deep infection and undisturbed wound healing after implantation of a titanium intramedullary nail in this rabbit model. Furthermore, our results indicate that 18F-FDG PET may provide a tool in human clinical diagnostics and for the evaluation of antimicrobial strategies in animal models of orthopedic implant infection. PMID:24673540

  13. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    PubMed

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression. PMID:22318091

  14. Une observation d'un goitre sur dysgénésie thyroïdienne pré-sternale

    PubMed Central

    Fanantenana, Herinirina Nicolas; Hasina, Rajaonarison Ny Ony Narindra Lova; Hery, Rafanomezantsoa; Claude, Rakotoarisoa Andriamihaja Jean; Ahmad, Ahmad

    2015-01-01

    L'hétérotopie thyroïdienne est une localisation anormale de tissus thyroïdiens normaux coexistant avec un organe normal et de localisation normale. Elle se distingue de l'ectopie thyroïdienne et d'une métastase du cancer de la thyroïde. Nous rapportons un cas d'hétérotopie thyroïdienne pré-sternale chez une femme de 65 ans afin de discuter le mécanisme de la migration de la thyroïde, le problème diagnostique et thérapeutique posé par cette topographie exceptionnelle. L'origine thyroïdienne de la masse est confirmée par l'histologie. Dans les lieux isolés, la chirurgie d'exérèse reste le seul moyen pour avoir le diagnostic et pour traiter les patients. PMID:26327954

  15. [A portable sternal compressor for cardiac massage on a patient carried by a litter--Part 3: Applicability of the device tested by a recording manikin].

    PubMed

    Yoshitake, Atsushi; Nishi, Masaaki; Maeda, Asako; Okamoto, Taisuke; Morioka, Tohru; Terasaki, Hidenori

    2002-10-01

    Effects of a portable sternal compressor developed by us was examined by 43 medical students (28 males and 15 females) and 9 anesthesia residents using a recording manikin. Compression over a depth of 3.5 to 5.0 cm was classified as adequate. First, the examinee held the device affixed in front of the chest with a belt hanged over the shoulder and pulled the other handle back and forth at a rate of 100 per minute. The male students could perform adequate compression in 92% of the total number of compression in the first one minute, while female students could in 65%. Though the anesthesia residents accomplished 99% of success rate in the first one minute, the rate fell to nearly 80% in the next minute and about 50% thereafter due to fatigue. When one handle was sustained on the floor with its fold-in stand and held between the knees of the examinee sitting on a chair, adequate compression was performed with the success rate of over 80% for 5 minutes. We conclude this device will be useful for cardiac massage on a patient either transported on a litter or lying on a soft bed. PMID:12428330

  16. On the absence of sternal elements in Anchiornis (Paraves) and Sapeornis (Aves) and the complex early evolution of the avian sternum

    PubMed Central

    Zheng, Xiaoting; O’Connor, Jingmai; Wang, Xiaoli; Wang, Min; Zhang, Xiaomei; Zhou, Zhonghe

    2014-01-01

    Anchiornis (Deinonychosauria: Troodontidae), the earliest known feathered dinosaur, and Sapeornis (Aves: Pygostylia), one of the basalmost Cretaceous birds, are both known from hundreds of specimens, although remarkably not one specimen preserves any sternal ossifications. We use histological analysis to confirm the absence of this element in adult specimens. Furthermore, the excellent preservation of soft-tissue structures in some specimens suggests that no chondrified sternum was present. Archaeopteryx, the oldest and most basal known bird, is known from only 10 specimens and the presence of a sternum is controversial; a chondrified sternum is widely considered to have been present. However, data from Anchiornis and Sapeornis suggest that a sternum may also have been completely absent in this important taxon, suggesting that the absence of a sternum could represent the plesiomorphic avian condition. Our discovery reveals an unexpected level of complexity in the early evolution of the avian sternum; the large amount of observable homoplasy is probably a direct result of the high degree of inherent developmental plasticity of the sternum compared with observations in other skeletal elements. PMID:25201982

  17. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    PubMed

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  18. The inhibitory effect of strontium-doped calcium polyphosphate particles on cytokines from macrophages and osteoblasts leading to aseptic loosening in vitro.

    PubMed

    Huang, Chengcheng; Li, Li; Yu, Xixun; Gu, Zhipeng; Zhang, Xu

    2014-04-01

    Aseptic loosening is a common cause of joint implant failure in humans. In order to enhance implant stability, we need to develop a new material that not only promotes the wear resistance of components of an artificial joint, but also possesses the pharmaceutical efficacy of protecting patients against aseptic loosening. Strontium-doped calcium polyphosphate (SCPP) has been found to have this potential ability. The goal of this study is to respectively quantify the levels of TNF-α (for macrophages), receptor activator of NF-kB ligand (RANKL) and osteoprotegerin (OPG) (for osteoblasts) when osteoblasts and macrophages are challenged with various particles (including SCPP). In this study, the osteoblasts ROS 17/2.8 and macrophages RAW 264.7 were challenged with various wear particles (8% SCPP, the molar percentage of Sr in SCPP is 8%, UHMWPE, hydroxyapatite (HA) and CPP). The secretion of TNF-α (from RAW 264.7), OPG and RANKL protein (from ROS 17/2.8) was analyzed by ELISA. The OPG and RANKL mRNA from ROS 17/2.8 was detected by RT-PCR. The data of ELISA indicated that the amount of TNF-α challenged with 8% SCPP particles was more than three-fold lower than that of all other test groups. The ratio of OPG/RANKL in the 8% SCPP group was significantly increased compared to that of all other test groups. The results of OPG and RANKL mRNA expression showed the same tendency as the ELISA results. In general, this study showed that 8% SCPP particles can inhibit the expression of TNF-α and RANKL, promote the expression of OPG so that SCPP can inhibit bone resorption and promote bone formation, and then inhibit aseptic loosening. Thus SCPP could be a promising material for the construction of artificial joints. PMID:24518283

  19. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66)

    PubMed Central

    1971-01-01

    Report of Decompression Sickness Panel, Medical Research Council (1971). Brit. J. industr. Med., 28, 1-21. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66). This paper describes investigations into the health of compressed air workers during and after the construction of a road tunnel under the River Tyne. Altogether 641 men were exposed to the compressed air environment over a period of approximately 31 months. The maximum working pressure was 42 psig (289·6 kN/m2), and the overall decompression sickness rate for work at pressures of 18 psig (124·1 kN/m2) and above was 2%. Radiological examination of the chest was carried out on 183 men to detect lung cysts but only one was found. Thus lung cysts were not shown to be a common factor in the causation of decompression sickness but the possibility of small sub-radiological collections of trapped air being involved was not excluded. Radiological examinations of the shoulders, hips and knee joints were carried out on 171 men. There was evidence of aseptic necrosis in one or more bones of 44 men (26%). Fifteen of the men with definite lesions of aseptic necrosis of bone and 7 of the men with suspected lesions had never worked in compressed air before this contract. The remaining 14 men with definite lesions and the 8 with suspected lesions had worked elsewhere in compressed air prior to this contract, but a definite lesion in one of these men and a suspected lesion in another can almost certainly be attributed to their work in compressed air on this contract. Images PMID:5543625

  20. Optimizing and developing a continuous separation system for the wet process separation of aluminum and polyethylene in aseptic composite packaging waste.

    PubMed

    Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi

    2015-01-01

    The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved. PMID:25458854

  1. Somatosensory evoked potential monitoring of the brachial plexus to predict nerve injury during internal mammary artery harvest: intraoperative comparisons of the Rultract and Pittman sternal retractors.

    PubMed

    Jellish, W S; Martucci, J; Blakeman, B; Hudson, E

    1994-08-01

    Brachial plexus injury after coronary artery bypass grafting (CABG) continues to be a common problem postoperatively. With the use of somatosensory evoked potential monitoring (SSEP), neurologic integrity of the brachial plexus during internal mammary artery (IMA) harvest was assessed and the Rultract and Pittman sternal retractors were compared to determine what effect they had on SSEP characteristics. Results showed that the Rultract and Pittman retractors caused large decreases in SSEP amplitudes after insertion, (1.25 +/- 0.14 versus 0.72 +/- 0.09, P < 0.05; and 1.64 +/- 0.27 versus 0.91 +/- 0.14, P < 0.05) respectively. This decrease was noted in 85% of Rultract and 68.75% of Pittman patients, respectively. Amplitudes increased after retractor removal but never returned to baseline values. Cooley retractor placement in the patients not undergoing IMA harvest (control) produced only mild decreases in amplitude. Waveform latency increased in all groups after retractor placement, but these increases were thought to be clinically insignificant. Postoperatively, three patients in each of the IMA retractor groups had brachial plexus symptoms (18%), whereas only one patient in the control group had symptoms. Somatosensory evoked potential monitoring seems to be a sensitive intraoperative monitor for assessing brachial plexus injury during CABG. The nerve plexus seems to be most at risk for pathologic injury during retraction of the sternum for IMA harvest. Though the Rultract retractor caused greater changes in SSEP characteristics than the Pittman, no clinical outcome differences between the two could be ascertained. Using SSEP monitoring may reduce brachial plexus injury during IMA harvest by allowing early detection of nerve compromise and therapeutic interventions to alleviate the insult while under general anesthesia. PMID:7948794

  2. The importance of toxoplasma gondii infection in diseases presenting with headaches. Headaches and aseptic meningitis may be manifestations of the Jarisch-Herxheimer reaction.

    PubMed

    Prandota, Joseph

    2009-01-01

    Worldwide, approximately 2 billion people are chronically infected with T. gondii with largely unknown consequences. This review presents clinical symptoms, differential diagnosis, triggering factors, treatment, and pathomechanisms responsible for idiopathic intracranial hypertension, pseudotumor cerebri, and aseptic meningitis. Literature cited in this work illustrates that immune state and other biologic mediator imbalances due to various endogenous and exogenous triggering factors may markedly affect latent central nervous system T. gondii infection/inflammation intensity, and cause reactivation of cerebral toxoplasmosis (CT). Irregularities in pro- and anti-inflammatory processes may markedly disturb the host and/or T. gondii defense mechanisms important for immune control of the parasite thereby manifesting as a wide range of neurologic symptoms and signs observed in some patients with migraine, epilepsy, celiac disease, Henoch-Schönlein purpura, and other brain disorders. This is consistent with reactivation of CT in mice after treatment with dexamethasone associated with depression of type T(H)1 immune response, and development of CT after administration of etanercept or other bioproducts. It seems that various types of headaches, epilepsy, aseptic meningitis, systemic adverse reactions to drugs or other substances represent the Jarisch-Herxheimer reaction due to apoptosis of T. gondii tachyzoites. Also development of some brain tumors, such as ependymoma and glioma may be associated with a chronic course of CT. Thus, all these patients should be tested for T. gondii infection. PMID:19916846

  3. Presence of corrosion products and hypersensitivity-associated reactions in periprosthetic tissue after aseptic loosening of total hip replacements with metal bearing surfaces.

    PubMed

    Huber, Monika; Reinisch, Georg; Trettenhahn, Günter; Zweymüller, Karl; Lintner, Felix

    2009-01-01

    Aseptic loosening of articular implants is frequently associated with tissue reactions to wear particles. Some patients, who had received metal-on-metal articulations, present early symptoms including persistent pain and implant failure. These symptoms raise the suspicion about the development of an immunological response. Furthermore, the generation of rare corrosion products in association with metallic implants has been observed. Corrosion products are known to enhance third-body wear and contribute to the loss of the implant. The purpose of this study was to investigate periprosthetic tissue containing solid corrosion products after aseptic loosening of second-generation metal-on-metal total hip replacements made of low-carbon cobalt-chromium-molybdenum alloy for the presence of immunologically determined tissue changes. Periprosthetic tissue of 11 cases containing uncommon solid deposits was investigated by light microscopy. In order to confirm the presence of corrosion products, additional methods including scanning electron microscopy (SEM) investigation, energy dispersive X-ray (EDX) and Fourier transform infrared microspectroscopy (FTIR) analysis were used. All investigated cases revealed solid chromium orthophosphate corrosion products as well as metallic wear particles to a various extent. Moreover, various intense tissue reactions characteristic of immune response were observed in all cases. The simultaneous presence of corrosion products and hypersensitivity-associated tissue reaction indicates that a relationship between corrosion development and implant-related hypersensitivity may exist. PMID:18725188

  4. Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB.

    PubMed

    Luo, Guotian; Li, Ziqing; Wang, Yu; Wang, Haixing; Zhang, Ziji; Chen, Weishen; Zhang, Yangchun; Xiao, Yinbo; Li, Chaohong; Guo, Ying; Sheng, Puyi

    2016-04-01

    Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol's protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. PMID:26878849

  5. Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are sternal outgrowths and not limbs.

    PubMed

    Wolff, Carsten; Scholtz, Gerhard

    2006-01-01

    The question of arthropod head segmentation has become one of the central issues in Evolutionary Developmental Biology. The number of theories pertaining to head segments progressively enlarges, old concepts have been revitalized, and nearly every conceivable composition of the arthropod head has at some point received discussion. One contentious issue involves a characteristic mouthpart in crustaceans--the lower lips or the so-called paragnaths. The paragnaths build the posterior border of the mouth region antagonistic to the upper lip--the labrum. We show here the development of the appendage-like structures in the mandibular region of the amphipod crustacean Orchestia cavimana at a high level of cellular resolution. The embryos are examined during development of the mouthparts using in vivo labeling. An invariant cell division pattern of the mandibular segment was detected by 4D-microscopy and a preliminary model for pattern of the first cleavages in the mandibular region created. With this indispensable precondition single ectodermal cells of the grid-like pattern were labeled with DiI--a lipophilic fluorescent dye--to trace cell lineages and determine the clonal composition of the developing mouthparts, especially the mandibular segment. From our data it is evident that the paragnaths are sternal outgrowths of the mandible segment. The assumption of the limb nature of paragnaths and the presence of an additional head segment between the mandibular and the second antennal segments are clearly refuted by our data. Our results show the power of cell lineage and clonal analyses for inferences on the nature, origin and thus homology of morphological structures. With this kind of investigation morphological and gene expression data can be complemented. We discuss notable similarities of paragnath anlagen to those of the hypopharynx complex in myriapods and hexapods. The fact that both structures grow out as two lateral buds in the same region of the mandibular

  6. High-Dose Continuous Oxacillin Infusion Results in Achievement of Pharmacokinetics Targets in Critically Ill Patients with Deep Sternal Wound Infections following Cardiac Surgery

    PubMed Central

    Verdier, Marie-Clémence; Launey, Yoann; Malherbe, Alexandre; Dermu, Marine; Piau, Caroline; Flécher, Erwan; Tribut, Olivier; Mallédant, Yannick; Seguin, Philippe

    2014-01-01

    Knowledge regarding antimicrobial therapy strategies in deep sternal wound infections (DSWI) following cardiac surgery is limited. Therefore, we aimed to determine the steady-state plasma and mediastinal concentrations of oxacillin administered by continuous infusion in critically ill patients with DSWI and to compare these concentrations with the susceptibility of staphylococci recovered. A continuous infusion of oxacillin (150 to 200 mg/kg of body weight/24 h) was administered after a loading dose (50 mg/kg). Plasma and mediastinal concentrations of total and unbound oxacillin were determined 4 h after the loading dose (H4) and then at day 1 (H24) and day 2 (H48). Twelve patients were included. Nine patients exhibited bacteremia, 5 were in septic shock, 8 were positive for Staphylococcus aureus, and 4 were positive for coagulase-negative staphylococci. The median MIC (first to third interquartile range) was 0.25 (0.24 to 0.41) mg/liter. Median plasma concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 64.4 (41.4 to 78.5) and 20.4 (12.4 to 30.4) mg/liter, 56.9 (31.4 to 80.6) and 21.7 (6.5 to 27.3) mg/liter, and 57.5 (32.2 to 85.1) and 20 (14.3 to 35.7) mg/liter. The median mediastinal concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 2.3 (0.7 to 25.9) and 0.9 (<0.5 to 15) mg/liter, 29.1 (19.7 to 38.2) and 12.6 (5.9 to 19.8) mg/liter, and 31.6 (14.9 to 42.9) and 17.1 (6.7 to 26.7) mg/liter. High-dose oxacillin delivered by continuous infusion is a valuable strategy to achieve our pharmacokinetic target (4× MIC) at the site of action at H24. But concerns remain in cases of higher MICs, emphasizing the need for clinicians to obtain the MICs for the bacteria and to monitor oxacillin concentrations, especially the unbound forms, at the target site. PMID:24982092

  7. High-dose continuous oxacillin infusion results in achievement of pharmacokinetics targets in critically ill patients with deep sternal wound infections following cardiac surgery.

    PubMed

    Nesseler, Nicolas; Verdier, Marie-Clémence; Launey, Yoann; Malherbe, Alexandre; Dermu, Marine; Piau, Caroline; Flécher, Erwan; Tribut, Olivier; Mallédant, Yannick; Seguin, Philippe

    2014-09-01

    Knowledge regarding antimicrobial therapy strategies in deep sternal wound infections (DSWI) following cardiac surgery is limited. Therefore, we aimed to determine the steady-state plasma and mediastinal concentrations of oxacillin administered by continuous infusion in critically ill patients with DSWI and to compare these concentrations with the susceptibility of staphylococci recovered. A continuous infusion of oxacillin (150 to 200 mg/kg of body weight/24 h) was administered after a loading dose (50 mg/kg). Plasma and mediastinal concentrations of total and unbound oxacillin were determined 4 h after the loading dose (H4) and then at day 1 (H24) and day 2 (H48). Twelve patients were included. Nine patients exhibited bacteremia, 5 were in septic shock, 8 were positive for Staphylococcus aureus, and 4 were positive for coagulase-negative staphylococci. The median MIC (first to third interquartile range) was 0.25 (0.24 to 0.41) mg/liter. Median plasma concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 64.4 (41.4 to 78.5) and 20.4 (12.4 to 30.4) mg/liter, 56.9 (31.4 to 80.6) and 21.7 (6.5 to 27.3) mg/liter, and 57.5 (32.2 to 85.1) and 20 (14.3 to 35.7) mg/liter. The median mediastinal concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 2.3 (0.7 to 25.9) and 0.9 (<0.5 to 15) mg/liter, 29.1 (19.7 to 38.2) and 12.6 (5.9 to 19.8) mg/liter, and 31.6 (14.9 to 42.9) and 17.1 (6.7 to 26.7) mg/liter. High-dose oxacillin delivered by continuous infusion is a valuable strategy to achieve our pharmacokinetic target (4× MIC) at the site of action at H24. But concerns remain in cases of higher MICs, emphasizing the need for clinicians to obtain the MICs for the bacteria and to monitor oxacillin concentrations, especially the unbound forms, at the target site. PMID:24982092

  8. Antibiotic cement was associated with half the risk of re-revision in 1,154 aseptic revision total knee arthroplasties

    PubMed Central

    Bini, Stefano A; Chan, Priscilla H; Inacio, Maria C S; Paxton, Elizabeth W; Khatod, Monti

    2016-01-01

    Background and purpose Aseptic revisions comprise 80% of revision total knee arthroplasties (TKAs). We determined the incidence of re-revision TKA, the reasons for re-revision, and risk factors associated with these procedures. Patients and methods We conducted a retrospective cohort study of 1,154 patients who underwent aseptic revision TKA between 2002 and 2013 and were followed prospectively by a total joint replacement registry in the USA. Revision was defined as any operation in which an implanted component was replaced. Patient-, surgeon-, and procedure-related risk factors were evaluated. Survival analyses were conducted. Results There were 114 re-revisions (10%) with a median time to reoperation of 3.6 years (interquartile range (IQR): 2.6–5.2). The infection rate was 2.9% (34/1,154) and accounted for 30% of re-revisions (34 of 114). In adjusted models, use of antibiotic-loaded cement was associated with a 50% lower risk of all-cause re-revision surgery (hazard ratio (HR) = 0.5, 95% CI: 0.3–0.9), age with a 20% lower risk for every 10-year increase (HR = 0.8, CI: 0.7–1.0), body mass index (BMI) with a 20% lower risk for every 5-unit increase (HR = 0.8, CI: 0.7–1.0), and a surgeon’s greater cumulative experience (≥ 20 cases vs. < 20 cases) with a 3 times higher risk of re-revision (HR = 2.8, CI: 1.5–5). Interpretation Revised TKAs were at high risk of subsequent failure. The use of antibiotic-loaded cement, higher age, and higher BMI were associated with lower risk of further revision whereas a higher degree of surgeon experience was associated with higher risk. PMID:26472086

  9. Long-term Treatment of Teicoplanin for Methicillin-resistant Staphylococcus aureus Sternal Osteomyelitis with Renal Impairment: A Case of High Teicoplanin Trough Levels Maintained by Therapeutic Drug Monitoring.

    PubMed

    Shiohira, Hideo; Nakamatsu, Masashi; Kise, Yuya; Higa, Futoshi; Tateyama, Masao; Hokama, Nobuo; Kuniyoshi, Yukio; Ueda, Shinichiro; Nakamura, Katsunori; Fujita, Jiro

    2016-01-01

    Teicoplanin, a glycopeptide antibiotic for methicillin-resistant Staphylococcus aureus, is recommended for therapeutic drug monitoring during treatment. Maintaining a high trough range of teicoplanin is also recommended for severe infectious disease. However, the optimal dose and interval of treatment for severe renal impairment is unknown. We report a 79-year-old man who received long-term teicoplanin treatment for methicillin-resistant Staphylococcus aureus bacteremia due to postoperative sternal osteomyelitis with renal impairment. Plasma teicoplanin trough levels were maintained at a high range (20-30 μg/mL). Although the patient required long-term teicoplanin treatment, a further decline in renal function was not observed, and blood culture remained negative after the start of treatment. Teicoplanin treatment that is maintained at a high trough level by therapeutic drug monitoring might be beneficial for severe methicillin-resistant Staphylococcus aureus infection accompanied by renal impairment. PMID:27592834

  10. Marked MMP-2 transcriptional up-regulation in mononuclear leukocytes invading the subarachnoidal space in aseptic suppurative steroid-responsive meningitis-arteritis in dogs.

    PubMed

    Schwartz, M; Puff, C; Stein, V M; Baumgärtner, W; Tipold, A

    2010-02-15

    Canine Steroid-Responsive Meningitis-Arteritis (SRMA) is a suitable animal model for studies on the development of neutrophilic pleocytosis in aseptic meningitis. Samples of dogs in the acute phase of SRMA (n=16) were examined for gene expression of matrix metalloproteinases (MMP)-2 and -9 and tissue inhibitors of metalloproteinases (TIMP)-1 and -2. Results were compared to those of dogs under glucocorticosteroid treatment for SRMA (n=16) and dogs with other inflammatory and neoplastic diseases of the central nervous system (CNS) (n=19). Samples included mononuclear (PBMCs) and polymorphonuclear cells (PBPMNs) of peripheral blood and cerebrospinal fluid white blood cells (CSF WBCs). In the acute phase of SRMA CSF WBCs showed mRNA expression for MMP-2 and -9 and TIMP-1 and -2, highlighting a contribution of these cells to the overall content of MMPs and TIMPs in CSF. MMP-2 mRNA levels in CSF WBCs were significantly up-regulated in comparison to PBMC expression levels, suggesting that MMP-2 is relevant for PBMC invasion into the subarachnoidal space and that the expression is influenced by migratory activity through the blood-CSF-barrier. PMID:19733404

  11. A retrospective epidemiological study of clinical signs and familial predisposition associated with aseptic meningitis in the Norwegian population of Nova Scotia duck tolling retrievers born 1994–2003

    PubMed Central

    Anfinsen, Kristin P.; Berendt, Mette; Liste, Flora J.H.; Haagensen, Therese R.; Indrebo, Astrid; Lingaas, Frode; Stigen, Oyvind; Alban, Lis

    2008-01-01

    Aseptic meningitis (AM) is a disease that causes grave clinical signs such as intensive neck pain, fever, and lethargy. The severity of this disease is reflected in the fact that affected animals require long-term, and in chronic cases, lifelong therapy with corticosteroids. A number of dogs must be euthanized because of therapeutic failure. In recent years, the Norwegian population of Nova Scotia duck tolling retrievers has experienced an increase in individuals with AM. The aim of the present study was to investigate the prevalence of AM and to pursue the suspicion of hereditary factors influencing an accumulation of AM cases in the breed. Using the Norwegian Kennel Club registery, a random sample (362 dogs) stratified by year of birth was drawn from the total population born from 1994 to 2003 (1525 individuals). The owners were contacted and questioned about clinical signs of AM in their dogs. Subsequently, the practising veterinarians and the breeders of positive responders were contacted in order to confirm a clinical diagnosis of AM and to identify possible affected family members. Pedigrees of AM positive individuals and affected relatives were investigated. The study estimated a prevalence of AM of 2.5%. For all affected dogs, it was possible to trace the pedigree of both parents of affected dogs back to a specific founder dog. The genealogical investigation strongly indicates that genetic factors are involved in the etiology of the disease. PMID:18783024

  12. Elucidation of Echovirus 30's Origin and Transmission during the 2012 Aseptic Meningitis Outbreak in Guangdong, China, through Continuing Environmental Surveillance

    PubMed Central

    Lu, Jing; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen

    2015-01-01

    An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804

  13. Elucidation of echovirus 30's origin and transmission during the 2012 aseptic meningitis outbreak in Guangdong, China, through continuing environmental surveillance.

    PubMed

    Lu, Jing; Zheng, Huanying; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen

    2015-04-01

    An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804

  14. Ibandronate and cementless total hip arthroplasty: densitometric measurement of periprosthetic bone mass and new therapeutic approach to the prevention of aseptic loosening

    PubMed Central

    Muratore, Maurizio; Quarta, Eugenio; Quarta, Laura; Calcagnile, Fabio; Grimaldi, Antonella; Orgiani, M. Antonio; Marsilio, Antonio; Rollo, Giuseppe

    2012-01-01

    Summary Studies of the mechanisms of periprosthetic bone loss have led to the development of pharmacologic strategies intended to enhance bone mass recovery after surgery and consequently prevent aseptic loosening and prolong the implant survival. Bisphosphonates, potent anti-resorptive drugs widely used in the treatment of osteoporosis and other disorders of bone metabolism, were shown to be particularly effective in reducing periprosthetic bone resorption in the first year after hip and knee arthroplasty, both cemented and cementless. Based on these results, we investigated the inhibitory effects of ibandronate on periprosthetic bone loss in a 2-year study of postmenopausal women that underwent cementless total hip arthroplasty. In the first 6 months both groups (A, treated with ibandronate 3 mg i.v. within five days after surgery and then with oral ibandronate 150 mg/month, plus calcium and vitamin D supplementation; and B, treated with calcium and vitamin D supplementation only) experienced bone loss, though to a lesser extent in group A. After 12 months, group A showed a remarkable BMD recovery, that was statistically significant versus baseline values (about +1, 74% of global BMD) and most evident in region R1 (+3, 81%) and R2 (+4, 12%); in group B, on the contrary, BMD values were unchanged compared with those at 6 months post-surgery. Quality of life scores also showed a greater improvement in group A, both at 6 and 12 months after surgery, likely because of the pain-reducing effects of ibandronate treatment. PMID:22783337

  15. Sensory Characteristics and Consumer Acceptance of Frozen Cooked Rice by a Rapid Freezing Process Compared to Homemade and Aseptic Packaged Cooked Rice

    PubMed Central

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong

    2013-01-01

    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars–IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p<0.05) in IM and SD cultivars. The differences in sensory characteristics between the FCR and ACR were larger than the equivalent differences between the FCR and HCR. Overall consumer acceptance ratings for FCR in overall aspect, appearance, aroma, and texture were not significantly different compared to those for HCR (p>0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  16. Sensory characteristics and consumer acceptance of frozen cooked rice by a rapid freezing process compared to homemade and aseptic packaged cooked rice.

    PubMed

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong

    2013-03-01

    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars-IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p<0.05) in IM and SD cultivars. The differences in sensory characteristics between the FCR and ACR were larger than the equivalent differences between the FCR and HCR. Overall consumer acceptance ratings for FCR in overall aspect, appearance, aroma, and texture were not significantly different compared to those for HCR (p>0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  17. [Treatment of pseudoarthrosis of the carpal scaphoid with fibrin glue].

    PubMed

    Carozzi, S

    1983-08-01

    The author think that "Fibrin Seal Glue" and mechanical syntesis is an opimal method for osteosintesis of the Carpal scaphoid. He speaks about 5 patients treated with optimal results in 50 days mean. PMID:6395974

  18. Does incineration turn infectious waste aseptic?

    PubMed

    Kanemitsu, K; Inden, K; Kunishima, H; Ueno, K; Hatta, M; Gunji, Y; Watanabe, I; Kaku, M

    2005-08-01

    Incineration of infectious waste is considered to be biologically safe. We performed basic experiments to confirm that bacillus spores are killed by incineration in a muffle furnace. Biological samples containing 10(6) spores of Bacillus stearothermophilus were placed in stainless steel Petri dishes and then into hot furnaces. The furnace temperature and duration of incineration were 300 degrees C for 15 min, 300 degrees C for 30 min, 500 degrees C for 15 min, 500 degrees C for 30 min and 1100 degrees C for 3 min. We confirmed that all spores of B. stearothermophilus were killed at each of these settings. The effect of incineration seems to be equivalent to that of sterilization, based on the satisfactory sterilization assurance level of 10(-6). PMID:15963601

  19. [Treatment of long tubular bone pseudoarthrosis with revascularized cortical layer of radius].

    PubMed

    Milanov, N O; Trofimov, E I; Umerenkov, A G

    1997-01-01

    The method of osteogenesis without resection of the false joint was employed in the treatment of long tubular bone pseudarthrosis. The authors used a free revascularized radial flap, including the corticoperiosteal layer of the radius as a source of osteogenesis. A thin corticoperiosteal graft was taken from the distal third of the radius with or without a skin flap, if necessary. The graft was placed into the slotted bed of the false joint and fixed by two screws. Final fixation was made by using an Ilizarov apparatus or a metal plate. The authors used this procedure in the treatment of 12 patients with long tubular bone pseudarthrosis who had undergone at two operations on the false joint or fracture. Eight patients suffered from chronic osteomyelitis. Eleven patients completely recovered at postoperative month 12. Radiographic and scintigraphic investigations showed signs of bed-graft adhesion at month 3 after surgery and those of false joint ossification at month 6 postoperatively. PMID:9376741

  20. Hyperbaric oxygen therapy for primary sternal osteomyelitis: a case report

    PubMed Central

    2013-01-01

    Introduction Primary osteomyelitis of the sternum is a rare condition, which accounts for 0.3% of all cases of osteomyelitis reported in the literature. The diagnosis requires a high degree of suspicion and confirmation by percutaneous biopsy. The treatment consists of resection of the periosteum and affected bone. Despite reports of successful conservative treatment using antibiotics alone, early surgical intervention plus bacterial control is the definitive treatment; it reduces morbidity, and is the most cost-effective approach for the patient. We report a case of primary osteomyelitis surgically treated with debridement and antibiotics, followed by hyperbaric oxygen therapy. Case presentation A 39-year-old Brazilian man without a significant medical history presented with primary osteomyelitis. After a normal chest radiograph and normal laboratory test results, he was treated with 2 weeks of nonsteroidal anti-inflammatory drugs. One month later a presumptive diagnosis of Tietze syndrome was made and he was prescribed prednisolone (60mg/day) for 3 weeks. The following month he presented to our service with swelling, redness, and warmth in the area between his left third and fourth ribs. Subsequent magnetic resonance imaging revealed a large collection of liquid (8.8×6.8×20.2cm) in his chest wall, between the body and the manubrium of the sternum. An area of soft, friable tissue with a large amount of pus was found in his sternum during surgical debridement. Subsequent treatment consisted of antibiotic therapy using metronidazole and cefotaxime plus hyperbaric oxygen therapy. On postoperative day 10 the incision was sutured. The patient was discharged on postoperative day 15 on a regimen of oral ciprofloxacin, and completed hyperbaric oxygen therapy as an out-patient. Conclusions The satisfying outcome of this patient reflects the quick action to promote surgical debridement and use of antibiotics, which are both recommended treatments. The closure of the wound in 10 days after debridement suggests that the hyperbaric oxygen therapy might have indirectly, but not conclusively, aided in the premature closure of the wound, avoiding a longer healing by second intention or muscle flap rotation closure. PMID:23806012

  1. An aseptic meningitis picture from incipient brain abscess.

    PubMed

    Singer, J I

    1992-08-01

    A preadolescent with headache and stiff neck presented for emergency department care. The presumptive diagnosis of viral meningitis was entertained on the basis of clinical examination and cerebrospinal fluid analysis. Events subsequent to his release from the department formed the stimulus for this report. It is apparent that patients with complicated sinusitis may present with a constellation of findings consistent with viral meningitis. PMID:1513739

  2. Pituitary abscess: an unusual presentation of "aseptic meningitis".

    PubMed

    Schwartz, I D; Zalles, M C; Foster, J L; Burry, V F

    1995-01-01

    Granulomatous inflammation of the pituitary and pituitary abscesses are rare entities. These conditions are found even more rarely in the pediatric aged population. We report a case of a radiographic and clinical, sterile pituitary abscess with non-caseating granulomatous inflammation in a girl who presented with hypopituitarism, meningeal irritation, and symptoms of pituitary apoplexy. PMID:7584709

  3. Aseptic polyurethane carotid patch rejection: complication, allergy or miraculous healing?

    PubMed

    Tshomba, Y; De Dominicis, D; Marone, E M; Mascia, D; Sanvito, F; Chiesa, R

    2011-12-01

    Carotid endarterectomy plays an important role in the prevention of ischemic stroke; patching could reduce the risk of intra- and postoperative complications and late restenosis among primary closure. Materials actually available for the patch tailoring are synthetic or biological: which is the best is still debated. We present the case of a polyurethane (PU) carotid patch rejection three years after its implant, with no evident arterial discontinuity and no sign of infection. Histopathological analysis on hematoxylin-eosin stained sections of the regenerated arterial wall tissue removed revealed plasma cell infiltration and clusters of foreign body giant cells. PU patch rejection has been seldom described in literature. This is an unusual late complication that should be considered at long-term follow-up evaluation of these patients. PMID:21750481

  4. A Rare Case of Crowned Dens Syndrome Mimicking Aseptic Meningitis

    PubMed Central

    Takahashi, Teruyuki; Minakata, Yugo; Tamura, Masato; Takasu, Toshiaki; Murakami, Marohito

    2013-01-01

    Background Crowned dens syndrome (CDS), related to microcrystalline deposition in the periodontoid process, is the main cause of acute or chronic cervical pain. Microcrystal-line deposition most often consists of calcium pyrophosphate dehydrate crystals and/or hydroxyapatite crystals. Case Presentation This report describes the case of an 89-year-old woman who presented with sudden onset, high fever, severe occipital headache, and neck stiffness. A laboratory examination revealed a markedly elevated white blood cell count (11,100/µl) and C-reactive protein level (23.8 mg/dl). These clinical findings suggested severe infection such as meningitis with sepsis. However, the results of blood culture, serum endotoxin, and procalcitonin were all negative, and cerebrospinal fluid studies revealed only a slight abnormality. The patient was first diagnosed with meningitis and treated with antiviral and antibiotic agents as well as non-steroidal anti-inflammatory drugs, but they only had limited effects. A cervical plain computed tomography (CT) scan and its three-dimensional (3D) reconstruction detected a remarkable crown-like calcification surrounding the odontoid process. On the basis of the CT findings, the patient was diagnosed as a severe case of CDS and was immediately treated with corticosteroids. The patient's condition drastically improved within a week after one course of corticosteroid therapy. Conclusion Some atypical symptoms of CDS are misleading and may be misdiagnosed as meningitis, as happened in our case. A CT scan, especially a 3D-CT scan, is necessary and useful for a definitive diagnosis of CDS. CDS should be considered as a differential diagnosis of a possible etiology for fever, headache, and cervical pain of unknown origin. PMID:23569451

  5. Gravity, chromosomes, and organized development in aseptically cultured plant cells

    NASA Technical Reports Server (NTRS)

    Krikorian, Abraham D.

    1993-01-01

    The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.

  6. Percutaneous Pedicle Screw Fixation with Polymethylmethacrylate Augmentation for the Treatment of Thoracolumbar Intravertebral Pseudoarthrosis Associated with Kummell's Osteonecrosis

    PubMed Central

    2016-01-01

    Purpose. The purpose of our study is to evaluate the therapeutic efficacy of short-segment percutaneous pedicle screw fixation with polymethylmethacrylate (PMMA) augmentation for the treatment of osteoporotic thoracolumbar compression fracture with osteonecrosis. Methods. Osteoporotic thoracolumbar compression fractures with avascular necrosis were treated by short-segment PPF with PMMA augmentation. Eighteen were followed up for more than 2 years. The kyphotic angle, compression ratio, visual analog scale (VAS) score for back pain, and the Oswestry Disability Index (ODI) were analyzed. In addition, radiologic and clinical parameters of PPF group were compared with percutaneous vertebroplasty (PVP) group. Results. Vertebral height and kyphotic angle of the compressed vertebral bodies were significantly corrected after the operation (P < 0.05). Further, restored vertebral height was maintained during the 2 or more years of postoperative follow-up. Compared to the PVP group the postoperative compression ratio and kyphotic angle were significantly lower in the PPF group (P < 0.05). The postoperative ODI and VAS of the PVP group were significantly higher than the PPF (P < 0.05). Conclusions. According to our results, short-segment PPF with PMMA augmentation may be an effective minimally invasive treatment for osteoporosis in cases of osteoporotic vertebral compression fractures with Kummell's osteonecrosis. PMID:27595101

  7. Percutaneous Pedicle Screw Fixation with Polymethylmethacrylate Augmentation for the Treatment of Thoracolumbar Intravertebral Pseudoarthrosis Associated with Kummell's Osteonecrosis.

    PubMed

    Kim, Hyeun-Sung; Heo, Dong-Hwa

    2016-01-01

    Purpose. The purpose of our study is to evaluate the therapeutic efficacy of short-segment percutaneous pedicle screw fixation with polymethylmethacrylate (PMMA) augmentation for the treatment of osteoporotic thoracolumbar compression fracture with osteonecrosis. Methods. Osteoporotic thoracolumbar compression fractures with avascular necrosis were treated by short-segment PPF with PMMA augmentation. Eighteen were followed up for more than 2 years. The kyphotic angle, compression ratio, visual analog scale (VAS) score for back pain, and the Oswestry Disability Index (ODI) were analyzed. In addition, radiologic and clinical parameters of PPF group were compared with percutaneous vertebroplasty (PVP) group. Results. Vertebral height and kyphotic angle of the compressed vertebral bodies were significantly corrected after the operation (P < 0.05). Further, restored vertebral height was maintained during the 2 or more years of postoperative follow-up. Compared to the PVP group the postoperative compression ratio and kyphotic angle were significantly lower in the PPF group (P < 0.05). The postoperative ODI and VAS of the PVP group were significantly higher than the PPF (P < 0.05). Conclusions. According to our results, short-segment PPF with PMMA augmentation may be an effective minimally invasive treatment for osteoporosis in cases of osteoporotic vertebral compression fractures with Kummell's osteonecrosis. PMID:27595101

  8. Sternal wound infection after cardiac surgery: incidence and risk factors according to clinical presentation.

    PubMed

    Lemaignen, A; Birgand, G; Ghodhbane, W; Alkhoder, S; Lolom, I; Belorgey, S; Lescure, F-X; Armand-Lefevre, L; Raffoul, R; Dilly, M-P; Nataf, P; Lucet, J C

    2015-07-01

    The incidence of surgical site infection (SSI) after cardiac surgery depends on the definition used. A distinction is generally made between mediastinitis, as defined by the US Centers for Disease Control and Prevention (CDC), and superficial SSI. Our objective was to decipher these entities in terms of presentation and risk factors. We performed a 7-year single centre analysis of prospective surveillance of patients with cardiac surgery via median sternotomy. SSI was defined as the need for reoperation due to infection. Among 7170 patients, 292 (4.1%) developed SSI, including 145 CDC-defined mediastinitis (CDC-positive SSI, 2.0%) and 147 superficial SSI without associated bloodstream infection (CDC-negative SSI, 2.1%). Median time to reoperation for CDC-negative SSI was 18 days (interquartile range, 14-26) and 16 (interquartile range, 11-24) for CDC-positive SSI (p 0.02). Microorganisms associated with CDC-negative SSI were mainly skin commensals (62/147, 41%) or originated in the digestive tract (62/147, 42%); only six were due to Staphylococcus aureus (4%), while CDC-positive SSI were mostly due to S. aureus (52/145, 36%) and germs from the digestive tract (52/145, 36%). Risk factors for SSI were older age, obesity, chronic obstructive bronchopneumonia, diabetes mellitus, critical preoperative state, postoperative vasopressive support, transfusion or prolonged ventilation and coronary artery bypass grafting, especially if using both internal thoracic arteries in female patients. The number of internal thoracic arteries used and factors affecting wound healing were primarily associated with CDC-negative SSI, whereas comorbidities and perioperative complications were mainly associated with CDC-positive SSI. These 2 entities differed in time to revision surgery, bacteriology and risk factors, suggesting a differing pathophysiology. PMID:25882356

  9. Single sternal metastasis due to malignant melanoma with unexpected long-term survival: a case report

    PubMed Central

    Gogakos, Apostolos S; Paliouras, Dimitrios; Asteriou, Christos; Rallis, Thomas; Lazopoulos, Achilleas; Chatzinikolaou, Fotios; Zissimopoulos, Athanassios; Tsavlis, Drosos; Tsirgogianni, Katerina; Zarogoulidis, Konstantinos; Porpodis, Konstantinos; Tsakiridis, Kosmas; Pitsiou, Georgia; Kioumis, Ioannis; Karapantzos, Ilias; Karapantzou, Chrysanthi; Sachpekidis, Nikos; Zarogoulidis, Paul; Barbetakis, Nikolaos

    2016-01-01

    Metastases from melanoma have a very poor prognosis for the patient. Single metastatic lesions in the sternum due to melanoma are extremely rare. A rare case of a presternal mass in a 56-year-old patient who had undergone excision for malignant melanoma is presented. Review of the patient’s history and surgical resection of a single metastatic soft tissue lesion offer the best chance of long-term survival. PMID:26848270

  10. A case of syphilitic aortic aneurysm with sternal erosion and impending rupture.

    PubMed

    Mohamed Sarjun Basha, Khadhar; Raman, Karthik; Ahmed, Sheriff Ejaz; Latchumanadoss, Kalidoss; Rajan, Sethuratnam

    2016-02-01

    Syphilitic aortic aneurysm is a rare occurrence in the current antibiotic era. Cardiovascular syphilis has nearly disappeared in developed countries, although it remains a factor in differential diagnosis in developing nations. We report a case of syphilitic aortic aneurysm eroding through the sternum in a 52-year-old man who underwent successful surgical repair. PMID:25344618

  11. Prostaglandin E2 level in tissue surrounding aseptic failed total hips. Effects of materials.

    PubMed

    Sedel, L; Simeon, J; Meunier, A; Villette, J M; Launay, S M

    1992-01-01

    Production of inflammatory mediators (IM) by cells and specifically macrophages around loosened implants may be responsible for their loosening. Our hypothesis was that different materials give rise to different amounts of these IM. It is thought that alumina/alumina for total hip replacement (THR), which has been used for 15 years in our orthopedic department, may produce less IM than other systems. We initiated a clinical prospective study to measure the level of prostaglandin E2 (PGE2) in tissue surrounding loosened prostheses to quantify PGE2 production regarding the types of material involved in the friction couple, i.e., alumina/alumina versus metal/polyethylene, and the type of fixation, i.e., cemented versus cementless. A total of 29 THR revisions were performed in 28 patients. Four implant groups were identified: alumina/alumina cemented, alumina/alumina cementless, metal/polyethylene cemented, and metal/polyethylene cementless. For each revision, tissues surrounding the failed implants were harvested and processed, and the PGE2 was measured in a blind manner using an immunoassay technique. As the measuring technique was difficult, at least three determinations for each sample were necessary. Some samples were excluded from the analysis for various reasons, for example, second or further revisions involving many different materials in the past, conjunction of metallic and alumina debris and samples taken from non-loosened components. Finally, 15 samples were considered adequate for inclusion in this study. Two groups were analyzed and compared: the alumina/alumina couple and the metal/polyethylene couple. Tissue surrounding the first group demonstrated a PGE2 level of 69 +/- 56 fmol/mg wet weight compared to 202 +/- 156 fmol/mg for the second.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1389776

  12. Aseptic stem loosening in primary THA: migration analysis of cemented and cementless fixation

    PubMed Central

    Kroell, Artur; Beaulé, Paul; Krismer, Martin; Behensky, Hannes; Stoeckl, Bernd

    2008-01-01

    Early migration has reportedly been predictive for later implant failure. Using four different migration patterns, this study aimed to analyse migration behaviour of the two types of implant fixation—cemented and cementless—throughout the process of loosening. Migrational behaviour of 69 revised stems (49 cemented, 20 uncemented) was analysed retrospectively with EBRA-FCA (Einzel-Bild-Röntgen-Analyse, Femoral Component Analysis). Uncemented stems failed after early and late onset migration alike, while late migration was the predominant pattern in cemented stems. Mean prosthetic failure after early migration occurred 5.8 (±4.4) years postoperatively due to insufficient primary stability. Initially stable stems with late onset migration were revised after 12.4 (±4.5) years. Measurement of early migration was found to be a valuable tool to screen short-term and mid-term failure. In the long run the method’s sensitivity decreased. Late onset migration, however, preceded long-term failure by a mean of three years. PMID:19066889

  13. Aseptic osteonecrosis of the hip in the adult: current evidence on conservative treatment.

    PubMed

    Klumpp, Raymond; Trevisan, Carlo

    2015-01-01

    Treatment of Avascular Osteonecrosis (AVN) of the femoral head to prevent progression to an arthritic hip is a challenging subject. Many conservative treatment options have been proposed in the literature. Weight bearing restriction as a stand-alone therapy is insufficient in preventing disease progression but it may be useful when combined with pharmacological agents or surgery. Bisphosphonate treatment in AVN might be efficient in early stages of disease, however there are no clear recommendations on length of treatment and therapeutic dosage and, considered the limited evidence and potential side effects of treatment, it could be considered in a pre-collapse stage in selected cases. Current literature suggests that low molecular weight heparin could lower disease progression in idiopathic AVN with quality of evidence being very low. Also the evidence to support the use of statins or vasodilators in the treatment of osteonecrosis is very low and their use cannot be recommended. Extracorporeal shock wave therapy may improve pain and function in early stages of disease with a low evidence, but there doesn't seem to be a significant change in time to the occurrence of femoral head collapse. Only one study has been conducted with pulsed electromagnetic fields therefore no recommendation can be given on clinical use of PEF in AVN. Evidence on hyperbaric oxygen therapy in the treatment of AVN is very limited and the high cost of treatment and the limited availability of structures that can provide the service poses other concerns about its feasibility. Based on current evidence, conservative treatment may be considered in early stages of asymptomatic AVN instead of observation only. PMID:27134631

  14. Aseptic osteonecrosis of the hip in the adult: current evidence on conservative treatment

    PubMed Central

    Klumpp, Raymond; Trevisan, Carlo

    2015-01-01

    Summary Treatment of Avascular Osteonecrosis (AVN) of the femoral head to prevent progression to an arthritic hip is a challenging subject. Many conservative treatment options have been proposed in the literature. Weight bearing restriction as a stand-alone therapy is insufficient in preventing disease progression but it may be useful when combined with pharmacological agents or surgery. Bisphosphonate treatment in AVN might be efficient in early stages of disease, however there are no clear recommendations on length of treatment and therapeutic dosage and, considered the limited evidence and potential side effects of treatment, it could be considered in a pre-collapse stage in selected cases. Current literature suggests that low molecular weight heparin could lower disease progression in idiopathic AVN with quality of evidence being very low. Also the evidence to support the use of statins or vasodilators in the treatment of osteonecrosis is very low and their use cannot be recommended. Extracorporeal shock wave therapy may improve pain and function in early stages of disease with a low evidence, but there doesn’t seem to be a significant change in time to the occurrence of femoral head collapse. Only one study has been conducted with pulsed electromagnetic fields therefore no recommendation can be given on clinical use of PEF in AVN. Evidence on hyperbaric oxygen therapy in the treatment of AVN is very limited and the high cost of treatment and the limited availability of structures that can provide the service poses other concerns about its feasibility. Based on current evidence, conservative treatment may be considered in early stages of asymptomatic AVN instead of observation only. PMID:27134631

  15. Aseptic suppurative meningitis in juvenile boxer dogs: retrospective study of 12 cases.

    PubMed

    Behr, Sebastien; Cauzinille, Laurent

    2006-01-01

    Immune-mediated central nervous system inflammation is described in a series of 12 juvenile boxer dogs. A diagnosis of steroid-responsive meningitis-arteritis was made based on the clinical presentation and on diagnostic findings. The boxer breed was at a higher risk for this inflammatory condition than other breeds. Long-term follow-up (>2 years) confirmed a better prognosis in this breed than in the beagle and the Bernese mountain dog. Complete resolution of clinical signs without significant deficits or recurrences was obtained in all cases. Early clinical recognition and immunosuppressive treatment resulted in a better response and complete resolution of the disorder. PMID:16822766

  16. [Aseptic purulent meningitis in two patients co-infected by HTLV-1 and Strongyloides stercoralis].

    PubMed

    Foucan, L; Genevier, I; Lamaury, I; Strobel, M

    1997-01-01

    Occurrence of anguilluliasis always progresses to hyperinfestation or disseminated anguilluliasis with severe clinical manifestations in carriers of HTLV-1. This prognosis is further illustrated by two new cases of non-septic purulent meningitis observed in two male patients from Guadalope. Ages were 61 and 64 years. In both cases examination of cerebrospinal fluid (CSF) demonstrated pleiocytosis with more than 3000 cells (mostly polynuclear neutrophils) per mm3, protein content greater than 3 g/l, and low sugar level. No soluble germs or antigens were found in the CSF. In both patients Strongyloides stercoralis larvae were detected in stools but not in CSF. Meningitis responded to antibiotic treatment but follow-up tests showed the persistence of larvae in stools despite treatment using thiabendazole. While similar cases of meningitis have been reported in carriers of HTLV-1, the underlying mechanism is still unclear. Co-infection with Strongyloides stercoralis appears to be a predisposing factor. This association may warrant preventive anti-parasitic treatment in patients infected by HTLV-1. PMID:9513154

  17. Idiopathic, aseptic, effusive, fibrinous, nonconstrictive pericarditis with tamponade in a standardbred filly.

    PubMed

    Robinson, J A; Marr, C M; Reef, V B; Sweeney, R W

    1992-11-15

    A Standardbred filly was admitted for evaluation of pleuritis and pneumonia. Heart rate was 80 to 120 beats/min, and the pulse was barely palpable. Thoracic and abdominal ultrasonography and echocardiography revealed substantial pericardial effusion with cardiac tamponade, fibrinous pericarditis, pleural effusion, and ascites. Initial electrocardiography revealed normal sinus rhythm with decreased amplitude of the QRS complexes consistent with pericardial effusion. Following thoracentesis, echocardiogram-guided pericardiocentesis was performed. Bacterial culture yielded no growth from any of the fluids, and bacteria were not seen on cytologic examination. Initial treatment included broad-spectrum antibiotic treatments, IV fluid therapy, and anti-inflammatory agent administration. On the basis of negative culture results, an immune-mediated cause was considered, and dexamethasone was instituted in a decreasing dosage regimen. Pericardial effusion, ventral edema, and ascites began to resolve within 3 days after beginning dexamethasone treatment. Thirty days following discharge, the filly was reexamined, and at that time, the prognosis for athletic performance was considered good so the horse was returned to race training. The final diagnosis in this case was idiopathic, effusive, nonconstrictive pericarditis with tamponade. Early identification, clinical understanding, and application of knowledge of the pathophysiologic mechanisms of pericarditis in horses, combined with use of diagnostic aids such as ultrasonography and aggressive therapy consisting of effusion drainage, pericardial lavage, antibiotics that penetrate the pericardium, and corticosteroids when indicated are critical for a successful outcome in horses with pericarditis. PMID:1289343

  18. Subsurface Organics in Aseptic Cores From the MARTE Robotic Drilling Experiment: Ground truth and Contamination Issues

    NASA Astrophysics Data System (ADS)

    Bonaccorsi, R.; Stoker, C. R.

    2006-12-01

    The subsurface is the key environment for searching for life on planets lacking surface life. This includes the search for past/present life on Mars where possible subsurface life could exist [1]. The Mars-Analog-Rio-Tinto-Experiment (MARTE) performed a simulation of a Mars robotic drilling at the RT Borehole#7 Site ~6.07m, atop a massive-pyrite deposit from the Iberian Pyritic Belt. The RT site is considered an important analog of Sinus Meridiani on Mars, an ideal model analog for a subsurface Martian setting [2], and a relevant example of deep subsurface microbial community including aerobic and anaerobic chemoautotrophs [4-5]. Searching for microbes or bulk organics of biological origin in a subsurface sample from a planet is a key scientific objective of Robotic drilling missions. During the 2005 Field experiment 28 minicores were robotically handled and subsampled for life detection experiments under anti-contamination protocols. Ground truth included visual observation of cores and lab based Elemental and Isotope Ratios Mass Spectrometry analysis (EA-IRMS) of bulk organics in Hematite and Gohetite-rich gossanized tuffs, gossan and clay layers within 0-6m-depth. C-org and N-tot vary up to four orders of magnitude among the litter (~11Wt%, 0-1cm) and the mineralized (~3Wt%, 1-3cm) layers, and the first 6 m-depth (C-org=0.02-0.38Wt%). Overall, the distribution/ preservation of plant and soil-derived organics (d13C-org = 26 per mil to 24 per mil) is ten times higher (C-org=0.33Wt%) that in hematite-poor clays, or where rootlets are present, than in hematite- rich samples (C-org=<0.01Wt%). This is consistent with ATP assay (Lightning-MVP, Biocontrol) for total biomass in subsurface (Borehole#7 ~6.07m, ~avg. 153RLU) vs. surface soil samples (~1,500-81,449RLU) [5]. However, the in-situ ATP assay failed in detecting presence of roots during the in-situ life detection experiment. Furthermore, cm-sized roots were overlooked during remote observations. Finally, ATP Luminometry provided insights for potential contamination from core-handling and environmental dust loadings on cleaned/sterilized control surfaces (e.g., 6,782-36,243RLU/cm2). Cleanliness/sterility can be maintained by applying a simple sterile protocol under field conditions. Science results from this research will support future Astrobiology driven drilling mission planned on Mars. Specifically, ground truth offers relevant insights to assess strengths and limits of in-situ/remote observations vs. laboratory measurements. Results from this experiment will also aid the debate on advantages/ disadvantages of manned vs. robotic drilling missions on Mars or other planets. [1] Boston et al., 1997; [2] http://marte.arc.nasa.gov; [3] Stoker, C., et al., 2006 AbSciCon, [4] Stoker et al., submitted; [5] Bonaccorsi., et al., 2006 AbSciCon.

  19. Determination of the Residence Time of Food Particles During Aseptic Sterilization

    NASA Technical Reports Server (NTRS)

    Carl, J. R.; Arndt, G. D.; Nguyen, T. X.

    1994-01-01

    The paper describes a non-invasive method to measure the time an individual particle takes to move through a length of stainless steel pipe. The food product is in two phase flow (liquids and solids) and passes through a pipe with pressures of approximately 60 psig and temperatures of 270-285 F. The proposed problem solution is based on the detection of transitory amplitude and/or phase changes in a microwave transmission path caused by the passage of the particles of interest. The particles are enhanced in some way, as will be discussed later, such that they will provide transitory changes that are distinctive enough not to be mistaken for normal variations in the received signal (caused by the non-homogeneous nature of the medium). Two detectors (transmission paths across the pipe) will be required and place at a known separation. A minimum transit time calculation is made from which the maximum velocity can be determined. This provides the minimum residence time. Also average velocity and statistical variations can be computed so that the amount of 'over-cooking' can be determined.

  20. C(2)H(4): Its Incorporation and Metabolism by Pea Seedlings under Aseptic Conditions.

    PubMed

    Beyer, E M

    1975-08-01

    The effects of various treatments on the recently reported system in pea (Pisum sativum cv. Alaska), which results in (a) the incorporation of (14)C(2)H(4) into the tissue and (b) the conversion of (14)C(2)H(4) to (14)CO(2), was investigated using 2-day-old etiolated seedlings which exhibit a maximum response. Heat treatment (80 C, 1 min) completely inhibited both a and b, whereas homogenization completely inhibited b but only partially inhibited a. Detaching the cotyledons from the root-shoot axis immediately before exposing the detached cotyledons together with the root-shoot axis to (14)C(2)H(4) markedly reduced both a and b. Increasing the (14)C(2)H(4) concentration from 0.14 to over 100 mul/l progressively increased the rate of a and b with tissue incorporation being greater than (14)C(2)H(4) to (14)CO(2) conversion only below 0.3 mul/l (14)C(2)H(4). Reduction of the O(2) concentration reduced both a and b, with over 99% inhibition occurring under anaerobic conditions. The addition of CO(2) (5%) severely inhibited (14)C(2)H(4) to (14)CO(2) conversion without significantly affecting tissue incorporation. Exposure of etiolated seedlings to fluorescent light during (14)C(2)H(4) treatment was without effect. Similarly, indoleacetic acid, gibberellic acid, benzyladenine, abscisic acid, and dibutyryl cyclic adenosine monophosphate had no significant effect on either a or b.The possibilities that the incorporation of (14)C(2)H(4) into pea tissues and its conversion to (14)CO(2) is linked to ethylene action, or that it represents a means of reducing the endogenous ethylene level, are discussed.Several problems encountered with the use of polyethylene vials, rubber serum stoppers, Clorox, and microbial contamination are also described. PMID:16659286

  1. Decision-making support system based on LCA for aseptic packaging recycling.

    PubMed

    Varžinskas, Visvaldas; Staniškis, Jurgis K; Knašyte, Milda

    2012-09-01

    In Europe post-consumer beverage carton packages are treated in three ways: dumped in a landfill, incinerated for energy recovery, and recycled. In recent years new technologies for beverage carton recycling have been developed and tested. At the same time in Europe the collection of second-hand raw materials is becoming more efficient. In order to facilitate and justify the decision-making process, different possibilities of poly-aluminium handling were analysed. For this reason, the objective of this study was to compare carbon footprints in the whole life cycle of selected technologies and to provide decision-making with data for beverage carton recycling. The paper is based on some of the results of the project 'Sustainable Production through Innovations in small- and medium-sized enterprises (SPIN)'. The SPIN project is providing small- and medium-sized enterprises with a whole set of instruments that put entrepreneurs in a position to innovate their production processes and products leading to improved business and public benefits. PMID:22778144

  2. The Microbiome of Aseptically Collected Human Breast Tissue in Benign and Malignant Disease

    PubMed Central

    Hieken, Tina J.; Chen, Jun; Hoskin, Tanya L.; Walther-Antonio, Marina; Johnson, Stephen; Ramaker, Sheri; Xiao, Jian; Radisky, Derek C.; Knutson, Keith L.; Kalari, Krishna R.; Yao, Janet Z.; Baddour, Larry M.; Chia, Nicholas; Degnim, Amy C.

    2016-01-01

    Globally breast cancer is the leading cause of cancer death among women. The breast consists of epithelium, stroma and a mucosal immune system that make up a complex microenvironment. Growing awareness of the role of microbes in the microenvironment recently has led to a series of findings important for human health. The microbiome has been implicated in cancer development and progression at a variety of body sites including stomach, colon, liver, lung, and skin. In this study, we assessed breast tissue microbial signatures in intraoperatively obtained samples using 16S rDNA hypervariable tag sequencing. Our results indicate a distinct breast tissue microbiome that is different from the microbiota of breast skin tissue, breast skin swabs, and buccal swabs. Furthermore, we identify distinct microbial communities in breast tissues from women with cancer as compared to women with benign breast disease. Malignancy correlated with enrichment in taxa of lower abundance including the genera Fusobacterium, Atopobium, Gluconacetobacter, Hydrogenophaga and Lactobacillus. This work confirms the existence of a distinct breast microbiome and differences between the breast tissue microbiome in benign and malignant disease. These data provide a foundation for future investigation on the role of the breast microbiome in breast carcinogenesis and breast cancer prevention. PMID:27485780

  3. Microbiological Profiles of Deep Terrestrial Sedimentary Rocks Revealed by an Aseptic Drilling Procedure

    NASA Astrophysics Data System (ADS)

    Suzuki, Y.; Suko, T.; Fukuda, A.; Kouduka, M.; Nanba, K.; Sakata, S.; Ito, K.

    2009-12-01

    Unlike the near-surface environments, it is difficult to determine the community structure and biogeochemical functions of microorganisms in the deep subsurface mainly due to accessibility without contamination and disturbance. In an inland fore-arc basin in central Japan, we applied a new drilling procedure using deoxygenated and/or filter-sterilized drilling fluid(s). Although DNA-stained and cultivable cell numbers and the contents of phospholipid fatty acids (PLFA) all indicated the presence of metabolically active microbial populations in sedimentary rocks at a depth range from 200 to 350 m, it was not successful to extract DNA from the drilled core samples. During drilling, drilling fluid used for drilling and coring in the borehole was collected from the borehole bottom and subjected to DNA extraction. Quantitative fluorogenic PCR revealed that bacterial DNA were detected in drilling fluid samples when drilling was performed for siltstone and silty sandstone layers with the limited flow of drilling fluid. Bacterial 16S rRNA gene sequences retrieved from the drilling fluid samples below a depth of 324 m were mostly related to Pseudomonas putida or Flavobacterium succinicans, while those related to other Pseudomonas spp. were predominant at depths of 298 and 299m. PLFA profiles of core samples from a depth range between 250 and 351 m showed the abundance of 16:0, 16:1ω7 and 18:1ω9 fatty acids, which are known as major cellular lipid components of Pseudomonas and Flavobacterium spp. From these results, it was suggested that the members of the genera Pseudomonas and F. succinicans might represent dominant microbial populations that inhabit the deep terrestrial sedimentary rocks in Central Japan. This study was supported by grants from the Nuclear and Industrial Safety Agency (NISA) and Japan Nuclear Energy Safety Organization (JNES).

  4. Aseptic lysis L2-L3 as complication of abdominal aortic aneurysm repair.

    PubMed

    Mancini, Federico; Ascoli-Marchetti, Andrea; Garro, Luca; Caterini, Roberto

    2014-12-01

    Osteolytic vertebral erosion is usually related to tumours, spondylitis or spondylodiscitis. Few reports in the literature describe lytic lesions of anterior lumbar vertebral bodies resulting from abdominal aortic aneurysm or false aneurysm. We report a case of abdominal aortic false aneurysm that caused lytic lesions of the second and third vertebral bodies in an 80-year-old man who underwent endovascular aneurysm repair. Fluoroscopy guided biopsy excluded infection or tumour. We performed a posterior spinal fusion and decompression because of bone loss of the second and third lumbar vertebral bodies and central stenosis. Postoperatively the patient showed satisfactory relief in low-back and thigh pain but, unfortunately, he died 1 month after surgery because of respiratory complications. This case suggests that when a lytic lesion of a lumbar vertebral body is discovered in a patient who has undergone endovascular aneurysm repair, an abdominal aortic false aneurysm may be the cause of the vertebral erosion even in cases without infective pathogenesis. PMID:25017025

  5. Aseptic cavernous sinus thrombosis after internal carotid arterial occlusion in polycythaemia vera.

    PubMed Central

    Melamed, E; Rachmilewitz, E A; Reches, A; Lavy, S

    1976-01-01

    Two patients with untreated polycythaemia vera developed intracranial internal carotid arterial occlusion followed by monocular blindness and the characteristic features of ipsilateral cavernous sinus thrombosis. Primary septic source and signs of systemic infection were absent. It is suggested that the predisposing factors in this unusual syndrome were hyperviscosity and venous sludging induced by the basic haematological disorder and progression of the thrombotic process within the internal carotid artery towards its intracavernous portion with occlusion of the ophthalmic artery and of the arterial branches which supply the walls of the sinus. Images PMID:932749

  6. The Microbiome of Aseptically Collected Human Breast Tissue in Benign and Malignant Disease.

    PubMed

    Hieken, Tina J; Chen, Jun; Hoskin, Tanya L; Walther-Antonio, Marina; Johnson, Stephen; Ramaker, Sheri; Xiao, Jian; Radisky, Derek C; Knutson, Keith L; Kalari, Krishna R; Yao, Janet Z; Baddour, Larry M; Chia, Nicholas; Degnim, Amy C

    2016-01-01

    Globally breast cancer is the leading cause of cancer death among women. The breast consists of epithelium, stroma and a mucosal immune system that make up a complex microenvironment. Growing awareness of the role of microbes in the microenvironment recently has led to a series of findings important for human health. The microbiome has been implicated in cancer development and progression at a variety of body sites including stomach, colon, liver, lung, and skin. In this study, we assessed breast tissue microbial signatures in intraoperatively obtained samples using 16S rDNA hypervariable tag sequencing. Our results indicate a distinct breast tissue microbiome that is different from the microbiota of breast skin tissue, breast skin swabs, and buccal swabs. Furthermore, we identify distinct microbial communities in breast tissues from women with cancer as compared to women with benign breast disease. Malignancy correlated with enrichment in taxa of lower abundance including the genera Fusobacterium, Atopobium, Gluconacetobacter, Hydrogenophaga and Lactobacillus. This work confirms the existence of a distinct breast microbiome and differences between the breast tissue microbiome in benign and malignant disease. These data provide a foundation for future investigation on the role of the breast microbiome in breast carcinogenesis and breast cancer prevention. PMID:27485780

  7. Indirect measurement of water content in an aseptic solid substrate cultivation pilot-scale bioreactor.

    PubMed

    Peña Y Lillo, M; Pérez-Correa, R; Agosin, E; Latrille, E

    2001-01-01

    A lack of models and sensors for describing and monitoring large-scale solid substrate cultivation (SSC) bioreactors has hampered industrial development and application of this type of process. This study presents an indirect dynamic measurement model for a 200-kg-capacity fixed-bed SSC bioreactor under periodic agitation. Growth of the filamentous fungus Gibberella fujikuroi on wheat bran was used as a case study. Real data were preprocessed using previously reported methodology. The model uses CO2 production rate and inlet air conditions to estimate average bed water content and average bed temperature. The model adequately reproduces the evolution of the average bed water content and can therefore be used as an on-line estimator in pilot-scale SSC bioreactors. To obtain a reasonable fit of the bed temperature, however, inlet air humidity measurements will have to be adjusted with a data reconciliation algorithm. Good estimation of temperature is important for the future design of improved water content estimation using state observers. The model also provides insight into understanding the complex behavior of the dynamic system, which could prove useful when establishing advanced model-based operational and control strategies. PMID:11400105

  8. Decreased Tc-99m sestamibi uptake in a sternal brown tumor indicating response to anti metabolic therapy for secondary hyperparathyroidism.

    PubMed

    Ozkan, Elgin; Arslan, Nuri; Arslanoglu, Atilla; Karacalioglu, Alper Ozgur

    2007-08-01

    Brown tumors are rare but serious complications of renal osteodystrophy, and can be treated by parathyroidectomy or by pharmacological treatment of hyperparathyroidism. In addition to parathyroid lesions such as adenoma, hyperplasia, and carcinoma, brown tumors have been detected effectively by using dual phase Tc-99m sestamibi and Tl-201 chloride. We describe an unusual case of brown tumor at the manibrium sterni which shows marked increased Tc-99m sestamibi uptake on the initial scan, with decreasing tracer activity on follow-up scan indicating a response to antimetabolic therapy. PMID:17667448

  9. Selective culturing and genus-specific PCR detection for identification of Aeromonas in tissue samples to assist the medico-legal diagnosis of death by drowning.

    PubMed

    Huys, Geert; Coopman, Vera; Van Varenbergh, Dirk; Cordonnier, Jan

    2012-09-10

    The detection of autochthonous aquatic bacteria in tissue samples from drowning cases is increasingly considered as an alternative approach to assist the medico-legal diagnosis of death by drowning. Bacteria belonging to the genus Aeromonas may be suitable candidates for this application as they are ubiquitous in natural aquatic environments but are generally not part of the human microbiota. The research aims of this study were (i) to develop a sensitive, specific and rapid screening and confirmation method for Aeromonas species in tissue samples and (ii) to evaluate aseptic sternal puncture as a post-mortem sample technique and bone marrow as an alternative matrix to provide evidence of death by drowning. The presence of Aeromonas in tissue samples was verified by cultivation using the selective media Ampicillin Dextrin Agar (ADA) and Ryan's Aeromonas Medium. The use of ADA medium was found most optimal for the sensitive, inexpensive and quick detection of aeromonads in human tissue samples. Positive culture plates were confirmed by harvesting all colonies for DNA extraction and subsequent PCR amplification using Aeromonas genus-specific primers. Aeromonads were detected in lung swab, blood and bone marrow of drowned bodies (n=3), but were negative in these three matrices for all negative controls (n=90) tested. Bone marrow proved to be a suitable alternative matrix and can be sampled post-mortem by an aseptic sternal puncture. In conclusion, this study confirms previous indications that aeromonads in cultures from blood of water bodies can be considered a potential marker for drowning. Given the fact that the number of immersed bodies (drowned and non-drowned) included in this study is statistically not significant, however, more tissue samples need to be investigated to confirm the validity of these methods to aid the diagnosis of death by wet drowning. PMID:22497704

  10. Optimizing Prevention of Healthcare-Acquired Infections After Cardiac Surgery (HAI)_2

    ClinicalTrials.gov

    2016-05-11

    Cardiovascular Disease; Healthcare Associated Infectious Disease; Sternal Superficial Wound Infection; Deep Sternal Infection; Mediastinitis; Thoracotomy; Conduit Harvest or Cannulation Site; Sepsis; Pneumonia

  11. Osseous Consolidation of an Aseptic Delayed Union of a Lower Leg Fracture after Parathyroid Hormone Therapy – A Case Report

    PubMed Central

    Radmer, Sebastian; Andresen, Reimer; Schober, Hans-Christof

    2016-01-01

    The absence of osseous consolidation of a fracture within the normal time period is defined as delayed union or non-union. Both for the patient and from a socio-economic point of view, impaired fracture healing represents a major problem. Risk factors for a delayed fracture healing are insufficient immobilisation, poor adaptation of the fracture surfaces, interposition of soft tissue in the fracture gap, as well as circulation disturbances, metabolic disease, smoking and infections. In animal studies, a positive effect of parathyroid hormone (PTH) on fracture healing has been shown. PTH has a direct stimulatory effect on osteoblasts and osteoclasts. In addition, it appears to influence the effect of osseous growth factors. Few cases with the empiric off-label use of PTH that showed a tendency to support delayed or non-union fractures have been published. We report about a patient with a fracture of the lower leg and no osseous consolidation after 7 months. Four Months after therapy with 20 μg teriparatide per day for 8 weeks the fracture was consolidated and the patient had regained full and pain free weight bearing capacity of the leg with no reported side effects.

  12. Towards Using NMR to Screen for Spoiled Tomatoes Stored in 1,000 L, Aseptically Sealed, Metal-Lined Totes

    PubMed Central

    Pinter, Michael D.; Harter, Tod; McCarthy, Michael J.; Augustine, Matthew P.

    2014-01-01

    Nuclear magnetic resonance (NMR) spectroscopy is used to track factory relevant tomato paste spoilage. It was found that spoilage in tomato paste test samples leads to longer spin lattice relaxation times T1 using a conventional low magnetic field NMR system. The increase in T1 value for contaminated samples over a five day room temperature exposure period prompted the work to be extended to the study of industry standard, 1,000 L, non-ferrous, metal-lined totes. NMR signals and T1 values were recovered from a large format container with a single-sided NMR sensor. The results of this work suggest that a handheld NMR device can be used to study tomato paste spoilage in factory process environments. PMID:24594611

  13. Towards using NMR to screen for spoiled tomatoes stored in 1,000 L, aseptically sealed, metal-lined totes.

    PubMed

    Pinter, Michael D; Harter, Tod; McCarthy, Michael J; Augustine, Matthew P

    2014-01-01

    Nuclear magnetic resonance (NMR) spectroscopy is used to track factory relevant tomato paste spoilage. It was found that spoilage in tomato paste test samples leads to longer spin lattice relaxation times T1 using a conventional low magnetic field NMR system. The increase in T1 value for contaminated samples over a five day room temperature exposure period prompted the work to be extended to the study of industry standard, 1,000 L, non-ferrous, metal-lined totes. NMR signals and T1 values were recovered from a large format container with a single-sided NMR sensor. The results of this work suggest that a handheld NMR device can be used to study tomato paste spoilage in factory process environments. PMID:24594611

  14. An improved, low-cost, hydroponic system for growing Arabidopsis and other plant species under aseptic conditions

    PubMed Central

    2014-01-01

    Background Hydroponics is a plant growth system that provides a more precise control of growth media composition. Several hydroponic systems have been reported for Arabidopsis and other model plants. The ease of system set up, cost of the growth system and flexibility to characterize and harvest plant material are features continually improved in new hydroponic system reported. Results We developed a hydroponic culture system for Arabidopsis and other model plants. This low cost, proficient, and novel system is based on recyclable and sterilizable plastic containers, which are readily available from local suppliers. Our system allows a large-scale manipulation of seedlings. It adapts to different growing treatments and has an extended growth window until adult plants are established. The novel seed-holder also facilitates the transfer and harvest of seedlings. Here we report the use of our hydroponic system to analyze transcriptomic responses of Arabidopsis to nutriment availability and plant/pathogen interactions. Conclusions The efficiency and functionality of our proposed hydroponic system is demonstrated in nutrient deficiency and pathogenesis experiments. Hydroponically grown Arabidopsis seedlings under long-time inorganic phosphate (Pi) deficiency showed typical changes in root architecture and high expression of marker genes involved in signaling and Pi recycling. Genome-wide transcriptional analysis of gene expression of Arabidopsis roots depleted of Pi by short time periods indicates that genes related to general stress are up-regulated before those specific to Pi signaling and metabolism. Our hydroponic system also proved useful for conducting pathogenesis essays, revealing early transcriptional activation of pathogenesis-related genes. PMID:24649917

  15. Bacterial colonization of the skin following aseptic preoperative preparation and impact of the use of plastic adhesive drapes.

    PubMed

    Falk-Brynhildsen, Karin; Friberg, Orjan; Söderquist, Bo; Nilsson, Ulrica G

    2013-04-01

    Surgical site contamination, for example, with coagulase-negative staphylococci, probably derives from both the patient's own skin flora and those of the surgical team. Despite preoperative antiseptic preparation with chlorhexidine solution, complete sterilization of the skin is not possible and gradual recolonization will occur. Plastic adhesive drape is an established method used to prevent direct wound contamination from adjacent skin. In this study, the time to skin recolonization after antiseptic preparation was measured and the impact of using plastic adhesive drape on this recolonization was evaluated. Repeated bacterial sampling using three different methods over 6 hr was conducted after antiseptic preparation in 10 volunteers. Recolonization of skin was observed after 30 min with plastic drape and after 60 min without plastic drape; there were significantly more positive cultures with the plastic drape than without (31% vs. 7.5%, respectively, p < .001). Sampling with a rayon swab was the most sensitive sampling method. In conclusion, covering the skin with a plastic adhesive drape seems to hasten recolonization of the skin after antiseptic preparation. However, clinical trials to confirm this finding are warranted. PMID:22278031

  16. Curt Schimmelbusch (1850-1895)--development of a mask for chloroform and ether anesthesia based on primary aseptic principles.

    PubMed

    Reinhard, M; Eberhardt, E

    1994-02-01

    The German surgeon Curt Schimmelbusch is not generally recognised as a pioneer in anaesthesia, although he is well known by his investigations concerning the development and scientific foundation of mechanical sterilisation methods which he performed under Ernst von Bergmann in Berlin at the end of the 19th century. His book "Anleitung zur aseptischen Wundheilung" is one of the classics in the history of asepsis. Curt Schimmelbusch was born on November 16th, 1860, as the son of a lord of a manor in Gross-Nogath/West-Prussia. Having graduated from high school in 1882, he studied medicine at Würzburg, Göttingen, Berlin and Halle. The physician who was awarded the doctor's degree in Halle in 1886 as a co-worker of the histologist and pathologist Eberth at first dealt with research in the field of thrombosis. His surgical training took place in Cologne where he worked in 1888 with the famous surgeon Bardenheuer at the Bürgerhospital. A year later he returned to Berlin to do research work at the institute at the Ziegelstrasse. Under the main aspects of hygiene he described a mask in 1890, which he used predominantly for ether anaesthesia, although he considered it to be suitable also for chloroform anaesthesia, in itself an exciting contribution he has made characterising the progress of anaesthesia in German-speaking countries up to the mid-50's of the 20th century. PMID:8142567

  17. [Aseptic, simultaneous and bilateral mobilisation due to an acetabular shell fracture in a 43 year-old patient].

    PubMed

    Ceretti, M; Fanelli, M; Pappalardo, S

    2014-01-01

    The acetabular shell mobilization is the main long-term complication in total hip replacement. Metal-back fracture has also to be considered among the possible causes of shell mobilization. A case is presented of bilateral acetabular shell mobilization due to the trabecular covering de-soldering from the metal-back in a 43 year-old patient, 13-14 years after the first surgery. PMID:24360788

  18. [Development of aseptic osteonecrosis during the treatment of acute lymphoblastic leukemia: review of the literature and author's own data].

    PubMed

    Baranova, O Iu; Shirin, A D; Falaleeva, N A; Osmanov, D Sh

    2011-01-01

    We report a case of aceptic osteonecrosis (AON) of the left hymerus epiphysis in programmed treatment of a male patient with lymphoblastic lymphoma to illustrate clinical, laboratory, epidemiological, pathogenetic, diagnostic and therapeutic aspects of AON in programmed therapy of acute lymphoblastic leukemia (ALL). We believe that AON is a rather frequent but often missed for early diagnosis complication of ALL treatment. Even a weak pain in bones and joints under mechanical load in patients on long-term treatment with glucocorticosteroids is an alarming symptom which may indicate a risk of an osteodestructive process and relevant diagnostic and therapeutic measures may be needed. PMID:21894748

  19. Ingestion of BioCell Collagen®, a novel hydrolyzed chicken sternal cartilage extract; enhanced blood microcirculation and reduced facial aging signs

    PubMed Central

    Schwartz, Stephen R; Park, Joosang

    2012-01-01

    Skin aging and its clinical manifestation is associated with altered molecular metabolism in the extracellular matrix of the dermis. In a pilot open-label study, we investigated the effect of a dietary supplement, BioCell Collagen® (BCC), which contains a naturally occurring matrix of hydrolyzed collagen type II and low-molecular-weight hyaluronic acid and chondroitin sulfate, in 26 healthy females who displayed visible signs of natural and photoaging in the face. Daily supplementation with 1 g of BCC for 12 weeks led to a significant reduction of skin dryness/scaling (76%, P = 0.002) and global lines/wrinkles (13.2%, P = 0.028) as measured by visual/tactile score. Additionally, a significant increase in the content of hemoglobin (17.7%, P = 0.018) and collagen (6.3%, P = 0.002) in the skin dermis was observed after 6 weeks of supplementation. At the end of the study, the increase in hemoglobin remained significant (15%, P = 0.008), while the increase in collagen content was maintained, but the difference from baseline was not significant (3.5%, P = 0.134). This study provides preliminary data suggesting that dietary supplementation with BCC elicits several physiological events which can be harnessed to counteract natural photoaging processes to reduce visible aging signs in the human face. A controlled study is necessary to verify these observations. PMID:22956862

  20. Death due to disruption of sternal fixation wire--a rare complication after open heart surgery through sternotomy: report of a case.

    PubMed

    Chang, H; Hung, C R

    1989-04-01

    Following sternotomy for open heart surgery, a 57-year-old man had the sternum closed in the usual manner with six No.22 gauge stainless steel wire sutures. Twenty-four days later, sternum disruption occurred with only one wire suture in place, 3 wire sutures cutting through the bone, and 2 wire sutures fractured. A lacerating injury over the anterior surface of the right ventricle was rendered by these 2 fractured wires followed by fatal outcome. To our knowledge, death induced by fractured wires has not been reported. We report in this communication what we believe to be the first case in the literature. PMID:2794943

  1. Aseptically Sampled Organics in Subsurface Rocks From the Mars Analog Rio Tinto Experiment: An Analog For The Search for Deep Subsurface Life on Mars.}

    NASA Astrophysics Data System (ADS)

    Bonaccorsi, R.; Stoker, C. R.

    2005-12-01

    The subsurface is the key environment for searching for life on planets lacking surface life. Subsurface ecosystems are of great relevance to astrobiology including the search for past/present life on Mars. The surface of Mars has conditions preventing current life but the subsurface might preserve organics and even host some life [1]. The Mars-Analog-Rio-Tinto-Experiment (MARTE) is performing a simulation of a Mars drilling experiment. This comprises conventional and robotic drilling of cores in a volcanically-hosted-massive-pyrite deposit [2] from the Iberian Pyritic Belt (IBP) and life detection experiments applying anti-contamination protocols (e.g., ATP Luminometry assay). The RT is considered an important analog of the Sinus Meridiani site on Mars and an ideal model analog for a deep subsurface Martian environment. Former results from MARTE suggest the existence of a relatively complex subsurface life including aerobic and anaerobic chemoautotrophs and strict anaerobic methanogens sustained by Fe and S minerals in anoxic conditions. A key requirement for the analysis of a subsurface sample on Mars is a set of simple tests that can help determine if the sample contains organic material of biological origin, and its potential for retaining definitive biosignatures. We report here on the presence of bulk organic matter Corg (0.03-0.05 Wt%), and Ntot (0.01-0.04 Wt%) and amount of measured ATP (Lightning MVP, Biocontrol) in weathered rocks (tuffs, gossan, pyrite stockwork from Borehole #8; >166m). This provides key insight on the type of trophic system sustaining the subsurface biosphere (i.e., heterotrophs vs. autotrophs) at RT. ATP data (Relative-Luminosity-Units, RLU) provide information on possible contamination and distribution of viable biomass with core depth (BH#8, and BH#7, ~3m). Avg. 153 RLU, i.e., surface vs. center of core, suggest that cleaness/sterility can be maintained when using a simple sterile protocol under field conditions. Results from this research will support future drilling mission planned on Mars. [1] Boston, P.J., et al., 1992. Icarus 95,300-308; [2] Leistel et al., 1998.

  2. Role of inflammation in the initiation and maintenance of atrial fibrillation and the protective effect of atorvastatin in a goat model of aseptic pericarditis

    PubMed Central

    ZHANG, YE; WANG, YU-TANG; SHAN, ZHAO-LIANG; GUO, HONG-YANG; GUAN, YUAN; YUAN, HONG-TAO

    2015-01-01

    The present study was designed to determine the association between atrial fibrillation (AF) and inflammation in a goat sterile pericarditis model and to assess the effect of atorvastatin, a cholesterol-reducing drug, on AF. A total of 15 adult male goats were randomly divided into control, untreated pericarditis and atorvastatin-treated pericarditis groups. Pericarditis was induced via thoracotomy and atorvastatin was administered orally (60 mg/day) to the goats in the latter group for the duration of the study, commencing 1 week prior to surgery. The levels of high-sensitivity C-reactive protein (hs-CRP), interleukin(IL)-6 and tumor necrosis factor-α (TNF-α) were significantly elevated following surgery in the untreated pericarditis and atorvastatin groups compared with the control group (P<0.05). However, lower levels of hs-CRP, IL-6 and TNF-α were observed in the atorvastatin group compared with the untreated pericarditis group (P<0.05). Additionally, the animals in the atorvastatin-treated pericarditis group had a longer effective refractory period (ERP) and a higher rate adaptation of the ERP compared with those in the untreated pericarditis group (P<0.05). There was a significant negative correlation between the levels of ERP and hs-CRP in the untreated pericarditis group. The inducibility of AF in the left atrium and the duration of AF in the untreated pericarditis and atorvastatin-treated groups increased significantly following surgery (P<0.05). The pericarditis group, however, had a longer duration of AF compared with the atorvastatin group (P<0.05). Thus, inflammation may promote AF by shortening atrial ERP and by reducing the rate adaptation of ERP. These results suggested that atorvastatin can attenuate AF by inhibiting inflammation and may assist in preventing the occurrence and recurrence of AF following cardiac surgery. PMID:25524260

  3. Safety, Immunogenicity, and Protective Efficacy of Intradermal Immunization with Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites in Volunteers under Chloroquine Prophylaxis: A Randomized Controlled Trial

    PubMed Central

    Bastiaens, Guido J. H.; van Meer, Maurits P. A.; Scholzen, Anja; Obiero, Joshua M.; Vatanshenassan, Mansoureh; van Grinsven, Tim; Kim Lee Sim, B.; Billingsley, Peter F.; James, Eric R.; Gunasekera, Anusha; Bijker, Else M.; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Graumans, Wouter; Hermsen, Cornelus C.; de Mast, Quirijn; van der Ven, André J. A. M.; Hoffman, Stephen L.; Sauerwein, Robert W.

    2016-01-01

    Immunization of volunteers under chloroquine prophylaxis by bites of Plasmodium falciparum sporozoite (PfSPZ)–infected mosquitoes induces > 90% protection against controlled human malaria infection (CHMI). We studied intradermal immunization with cryopreserved, infectious PfSPZ in volunteers taking chloroquine (PfSPZ chemoprophylaxis vaccine [CVac]). Vaccine groups 1 and 3 received 3× monthly immunizations with 7.5 × 104 PfSPZ. Control groups 2 and 4 received normal saline. Groups 1 and 2 underwent CHMI (#1) by mosquito bite 60 days after the third immunization. Groups 3 and 4 were boosted 168 days after the third immunization and underwent CHMI (#2) 137 days later. Vaccinees (11/20, 55%) and controls (6/10, 60%) had the same percentage of mild to moderate solicited adverse events. After CHMI #1, 8/10 vaccinees (group 1) and 5/5 controls (group 2) became parasitemic by microscopy; the two negatives were positive by quantitative real-time polymerase chain reaction (qPCR). After CHMI #2, all vaccinees in group 3 and controls in group 4 were parasitemic by qPCR. Vaccinees showed weak antibody and no detectable cellular immune responses. Intradermal immunization with up to 3 × 105 PfSPZ-CVac was safe, but induced only minimal immune responses and no sterile protection against Pf CHMI. PMID:26711509

  4. Safety, Immunogenicity, and Protective Efficacy of Intradermal Immunization with Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites in Volunteers Under Chloroquine Prophylaxis: A Randomized Controlled Trial.

    PubMed

    Bastiaens, Guido J H; van Meer, Maurits P A; Scholzen, Anja; Obiero, Joshua M; Vatanshenassan, Mansoureh; van Grinsven, Tim; Sim, B Kim Lee; Billingsley, Peter F; James, Eric R; Gunasekera, Anusha; Bijker, Else M; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Graumans, Wouter; Hermsen, Cornelus C; de Mast, Quirijn; van der Ven, André J A M; Hoffman, Stephen L; Sauerwein, Robert W

    2016-03-01

    Immunization of volunteers under chloroquine prophylaxis by bites of Plasmodium falciparum sporozoite (PfSPZ)-infected mosquitoes induces > 90% protection against controlled human malaria infection (CHMI). We studied intradermal immunization with cryopreserved, infectious PfSPZ in volunteers taking chloroquine (PfSPZ chemoprophylaxis vaccine [CVac]). Vaccine groups 1 and 3 received 3× monthly immunizations with 7.5 × 10(4) PfSPZ. Control groups 2 and 4 received normal saline. Groups 1 and 2 underwent CHMI (#1) by mosquito bite 60 days after the third immunization. Groups 3 and 4 were boosted 168 days after the third immunization and underwent CHMI (#2) 137 days later. Vaccinees (11/20, 55%) and controls (6/10, 60%) had the same percentage of mild to moderate solicited adverse events. After CHMI #1, 8/10 vaccinees (group 1) and 5/5 controls (group 2) became parasitemic by microscopy; the two negatives were positive by quantitative real-time polymerase chain reaction (qPCR). After CHMI #2, all vaccinees in group 3 and controls in group 4 were parasitemic by qPCR. Vaccinees showed weak antibody and no detectable cellular immune responses. Intradermal immunization with up to 3 × 10(5) PfSPZ-CVac was safe, but induced only minimal immune responses and no sterile protection against Pf CHMI. PMID:26711509

  5. Skin microbial flora and effectiveness of aseptic technique for deep muscle biopsies in Weddell seals (Leptonychotes weddellii ) in McMurdo Sound, Antarctica.

    PubMed

    Mellish, J; Tuomi, P; Hindle, A; Jang, S; Horning, M

    2010-04-01

    Deep muscle biopsies were collected from the pectoralis and longissimus dorsi of wild Weddell seals (Leptonychotes weddellii) in McMurdo Sound, Antarctica, during October-December 2007. Sterile swabs were collected from the surface of each skin site before biopsy and from the deep-needle path after biopsy. No growth occurred in two of six pectoralis and three of six longissimus skin sites, or in four of 10 pectoralis deep biopsy and eight of 12 longissimus deep-biopsy sites. Positive skin culture was not predictive of deep-biopsy contamination, nor did contamination at one body location correlate with contamination at the second site. Psychrobacter species were most common in one or more samples from each of the four sample types. Only one of the eight documented bacteria exhibited resistance to commonly used antibiotics. PMID:20688668

  6. Campylobacter recovery from external and internal organs of commercial broiler carcass prior to scalding.

    PubMed

    Berrang, M E; Buhr, R J; Cason, J A

    2000-02-01

    Campylobacter is a human pathogen commonly found on live broilers and processed carcasses. To plan effective intervention strategies, it would be helpful to know which Campylobacter populations are associated with the external and internal organs of broilers. Six carcasses were collected after exiting the bleed tunnel at a commercial broiler plant on each of three visits (n = 18). Carcasses were placed individually into sterile plastic bags, sealed, and covered with ice for transport to the laboratory. Five locations were sampled aseptically from each carcass: breast feathers (hand picked from the sternal tracts); breast skin, including the sternal tracts; crop; ceca; and colon. Samples included adhering contamination or lumen contents and were covered with phosphate-buffered saline and blended. Serial dilutions were made for examination of Campylobacter, coliform, Escherichia coli, and total aerobic bacterial populations. Average sample weights (grams) were as follows: feathers, 1.5; skin, 6.5; crop, 5.1; ceca, 7.8; and colon, 3.1. Campylobacter populations (mean log10 colony-forming units per gram of sample) found were feathers, 5.4; skin, 3.8; crop, 4.7; ceca, 7.3; and colon, 7.2. Coliform/E. coli populations observed were feathers, 6.4/6.0; skin, 5.3/4.9; crop, 4.3/3.7; ceca, 6.6/6.2; and colon, 5.8/5.3. Total aerobic bacterial populations found were feathers, 7.9; skin, 7.1; crop, 5.8; ceca, 6.8; and colon, 6.4. On a per gram basis, ceca and colon are the internal organs that if ruptured could cause the highest number of Campylobacter to be leaked onto the carcass. The crop also contained more Campylobacter per gram than did the skin, and if compromised may increase the numbers on the surface of the carcass. However, even with no contamination from an internal organ, a substantial population of Campylobacter is already resident on broiler skin as the carcass enters the early stages of processing. PMID:10735759

  7. Avascular Necrosis of Acetabulum: The Hidden Culprit of Resistant Deep Wound Infection and Failed Fixation of Fracture Acetabulum – A Case Report

    PubMed Central

    K, Kandhari V; M, Desai M; S, Bava S; N, Wade R

    2015-01-01

    Introduction: Chances of avascular necrosis of acetabulum are rare as it enjoys a rich blood supply. But cases of post - traumatic avascular necrosis of acetabulum following fracture of posterior column have been well documented. Importance of identifying and suspecting the avascular necrosis of acetabulum is essential in cases of failed fixation of fracture acetabulum, previously operated using extensile approach to acetabulum; either extended anterior ilio - femoral or tri - radiate approach. Such patients usually present with repeated deep bone infection or with early failure of fixation with aseptic loosening and migration of its components. We present a similar case. Case Presentation: 40 years female presented with inadequately managed transverse fracture of left acetabulum done by anterior extended ilio-inguinal approach. The fixation failed. She presented 6 months later with painful hip. Cemented total hip replacement was performed with reconstruction of acetabulum by posterior column plating. Six months postoperatively patient presented with dislodgement of cup, pelvic discontinuity and sinus in the thigh. Two stage revision surgery was planned. First implant, removal; debridement and antibiotic spacer surgery was performed. At second stage of revision total hip replacement, patient had Paprosky grade IIIb defect in acetabulum. Spacer was removed through the posterior approach. Anterior approach was taken for anterior plating. Intra-operatively external iliac pulsations were found to be absent so procedure was abandoned after expert opinion. Postoperatively digital subtraction angiography demonstrated a chronic block in the external iliac artery and corona mortis was the only patent vascular channel providing vascular to the left lower limb. Thus, peripheral limb was stealing blood supply from the acetabulum to maintain perfusion. Patient was ultimately left with pelvic discontinuity, excision arthroplasty and pseudoarthrosis of the left hip. Conclusions

  8. Nonoperative treatment of slipped capital femoral epiphysis: a scientific study

    PubMed Central

    2011-01-01

    Background Treatment of the Slipped Capital Femoral Epiphysis remains a cause of concern due to the fact that the true knowledge of the etiopathogeny is unknown, as well as one of its major complications: chondrolysis. The conservative treatment remains controversial; it has been overlooked in the studies and subjected to intense criticism. The purpose of this study is to investigate the results of treatment on the hip of patients displaying slipped capital femoral epiphysis, using the plaster cast immobilization method and its link to chondrolysis. Methods The research was performed based on the study of the following variables: symptomatology, and the degree of slipping. A hip spica cast and bilateral short/long leg casts in abduction, internal rotation with anti-rotational bars were used for immobilizing the patient's hip for twelve weeks. Statistical analysis was accomplished by Wilcoxon's marked position test and by the Fisher accuracy test at a 5% level. Results A satisfactory result was obtained in the acute group, 70.5%; 94%; in the chronic group (chronic + acute on chronic). Regarding the degree of the slipping, a satisfactory result was obtained in 90.5% of hips tested with a mild slip; in 76% with moderate slip and 73% in the severe slip. The statistical result revealed that a significant improvement was found for flexion (p = 0.0001), abduction (p = 0.0001), internal rotation (p = 0.0001) and external rotation (p = 0.02). Chondrolysis was present in 11.3% of the hips tested. One case of pseudoarthrosis with aseptic capital necrosis was presented. There was no significant variation between age and chondrolysis (p = 1.00).Significant variation between gender/non-white patients versus chondrolysis (p = 0.031) and (p = 0.037), respectively was verified. No causal association between plaster cast and chondrolysis was observed (p = 0.60). In regard to the symptomatology group and the slip degree versus chondrolysis, the p value was not statistically

  9. Semicircular Horizontal Approach in Breast Reduction: Clinical Experience in 38 Cases

    PubMed Central

    Shin, Hee Su; Jung, Sung Gyun; Lee, Doo Hyung; Roe, Young; Cha, Jong Hyun

    2015-01-01

    Background Various techniques are used for performing breast reduction. Wise-pattern and vertical scar techniques are the most commonly employed approaches. However, a vertical scar in the mid-lower breast is prominent and aesthetically less pleasant. In contrast, a semicircular horizontal approach does not leave a vertical scar in the mid breast and transverse scars can be hidden in the inframammary fold. In this paper, we describe the experiences and results of semicircular horizontal breast reductions performed by a single surgeon. Methods Between September 1996 and October 2013, our senior author used this technique in 38 cases in the US and at our institution. We used a superiorly based semicircular incision, where the upper skin paddle was pulled down to the inframammary fold with the nipple-areola complex pulled through the keyhole. Results The average total reduction per breast was 584 g, ranging from 286 to 794 g. The inferior longitudinal pedicle was used in all the cases. The average reduction of the distance from the sternal notch to the nipple was 13 cm (range, 11-15 cm). The mean decrease in the bra cup size was 1.7 cup sizes (range, a decrease of 1 to 3). We obtained very satisfactory results with a less noticeable scar, no complication such as necrosis of the nipple or the skin flap, wound infection, aseptic necrosis of the breast tissue, or wound dehiscence. One patient had a small hematoma that resolved spontaneously. Conclusions This technique is straightforward and easy to learn, and offers a safe, effective, and predictable way for treating mammary hypertrophy. PMID:26217565

  10. [Hygienic handling in cardiac surgery].

    PubMed

    Shimasaki, T; Masaoka, T; Hirooka, S; Abe, H; Watanabe, T; Washio, M

    1993-04-01

    Some points regarding the hygienic handling in cardiac surgery are mentioned. The sternal infection or mediastinitis is still one of the most important complications after cardiac operation especially when ITA is used for CABG. After we paid much attention to these points, the postoperative sternal infection has decreased obviously. PMID:8468855

  11. [Pseudarthrosis of the scaphoid: frequency, pathogenesis and course].

    PubMed

    Schunk, K; Teifke, A; Benning, R; Dahm, M; Thelen, R; Schild, H

    1989-06-01

    Eight-three scaphoid pseudo-arthroses were found amongst 1.104 scaphoid examinations. Sixty-seven were present at the first examination and 16 pseudoarthroses developed amongst 252 scaphoid fractures. Men were affected predominantly, particularly in the 20 to 40-year old group. Fractures in the proximal third of the scaphoid and vertical oblique fractures had a particular tendency to pseudo-arthrosis formation. The operative treatment of choice is a Matti-Russe bone graft. Only one patient in seven with definite scaphoid pseudo-arthrosis showed firm fusion. PMID:2544938

  12. A polymicrobial outbreak of surgical site infections following cardiac surgery at a community hospital in Florida, 2011–2012

    PubMed Central

    Nguyen, Duc B.; Gupta, Neil; Abou-Daoud, Alison; KleKamp, Benjamin G.; Rhone, Chaz; Winston, Tiffany; Hedberg, Trevor; Scuteri, Ana; Evans, Charlotte; Jensen, Bette; Moulton-Meissner, Heather; Török, Thomas; Berríos-Torres, Sandra I.; Noble-Wang, Judith; Kallen, Alexander

    2015-01-01

    We describe an outbreak of 22 sternal surgical site infections following cardiac surgery, including 4 Gordonia infections. Possible operation room environmental contamination and suboptimal infection control practices regarding scrub attire may have contributed to the outbreak. PMID:24679572

  13. Rib fractures in coronary bypass patients: radionuclide detection

    SciTech Connect

    Greenwald, L.V.; Baisden, C.E.; Symbas, P.N.

    1983-08-01

    Sternal retraction can cause the first rib to be fractured posteriorly, injuring the brachial plexus. The authors conducted bone scans of 24 consecutive open-heart surgery patients and found an unexpectedly high number of rib fractures which in all but one case had not been seen on the chest radiograph. Bone scans are recommended whenever there is unexplained non-incisional pain in a patient who has undergone sternal retraction.

  14. Allergic reaction to stainless steel sternotomy wires requiring removal: A case report and literature review.

    PubMed

    Lopez, J; Sachithanandan, A; Leow, M

    2016-06-01

    Hypersensitivity to stainless steel sternal sutures are an uncommon occurrence. We present a case of such a patient who developed chronic tissue overgranulation over a sternotomy wound eight weeks post-operatively. Primary suspicion was infection, a more common complication however radiological and laboratory investigation showed otherwise. Conservative management provided limited ephemeral success. After ensuring adequate sternal bone healing, the sutures and granulation tissue were eventually surgically removed without complication and the reoperated wound healed well. PMID:27495890

  15. Internal fixation of the sternum in median sternotomy dehiscence.

    PubMed

    Chase, C W; Franklin, J D; Guest, D P; Barker, D E

    1999-05-01

    Sternal dehiscence may be defined as separation of the bony sternum and manubrium following median sternotomy. It may occur at any time postoperatively and has various etiologies. Restoration of sternal integrity in sternal dehiscence is a challenging problem, particularly when associated with deep-seated infection. This report reviews a single-stage technique that virtually eliminates the infected sternotomy wound and provides anatomic reduction and stabilization of the sternum. Complete debridement of infected and/or nonviable soft tissue, bone, and cartilage is followed by pulse irrigation. Parallel stainless steel mandibular reconstruction plates are then placed on each side of the remaining sternum and wired together. One or more transmanubrial compression plates may be added. Bilateral pectoralis major musculocutaneous flap advancement and primary skin closure is performed over two to three closed suction drains. From January of 1994 to July of 1996, this technique was used by the same surgeon in 26 male and 4 female patients aged 43 to 78 years (mean = 61). Indications for the operation were sternal dehiscence with infection (osteomyelitis and/or mediastinitis) in 14 patients and sternal dehiscence without infection in 16 patients. All patients survived to discharge with mean time on the ventilator, intensive care unit length of stay, and postoperative length of stay of 0.7, 2, and 8 days, respectively. Choice and duration of antibiotics were based on culture results and operative findings. Subsequent hardware removal was necessary in one patient for hardware loosening and three patients for late periplate infection. A closed wound was eventually achieved in all 30 patients, and sternal stability was restored in 29 patients. In the management of sternal dehiscence, the described technique of internal fixation can provide anatomic sternal reduction and stabilization, elimination of infection, and wound closure in a single-stage operation. Successful outcomes

  16. Management of a failed metatarso-phalangeal joint fusion utilizing a hemicup prosthesis.

    PubMed

    Stadler, Nicola; Hofstätter, Stefan; Trieb, Klemens

    2014-06-18

    We report a case of a 65-year-old man with a painful nonunion of the first metatarsophalangeal joint (MTPJ). It is one of the main severe complications of this surgery. Its prevalence is described between 5% and 10% across different operative techniques. The implantation of hemicup-prosthesis has been successfully used for the hallux rigidus treatment with very promising results. In our case report, we introduce a treatment method of converting a pseudoarthrosis of the first MTPJ, made of two crossing screws into a hemicup-prosthesis as a salvage procedure. This is to our best knowledge the first report using this device for treatment of pseudoarthrosis of the first MTPJ. PMID:25332761

  17. Management of a Failed Metatarso-Phalangeal Joint Fusion Utilizing a Hemicup Prosthesis

    PubMed Central

    Stadler, Nicola; Hofstätter, Stefan; Trieb, Klemens

    2014-01-01

    We report a case of a 65-year-old man with a painful nonunion of the first metatarsophalangeal joint (MTPJ). It is one of the main severe complications of this surgery. Its prevalence is described between 5% and 10% across different operative techniques. The implantation of hemicup-prosthesis has been successfully used for the hallux rigidus treatment with very promising results. In our case report, we introduce a treatment method of converting a pseudoarthrosis of the first MTPJ, made of two crossing screws into a hemicup-prosthesis as a salvage procedure. This is to our best knowledge the first report using this device for treatment of pseudoarthrosis of the first MTPJ. PMID:25332761

  18. Congenital anterolateral bowing of the tibia with ipsilateral polydactyly of the great toe.

    PubMed

    Kitoh, H; Nogami, H; Hattori, T

    1997-12-31

    We report on two cases of congenital unilateral anterolateral bowing and focal defect of the tibia associated with ipsilateral polydactyly of the great toe. Computed tomographic examination showed an unusual partial cleft of the tibia at the site of bowing. A long follow-up of one patient showed spontaneous resolution of the bowing without progression to pseudoarthrosis. These anomalies should be considered as a new entity related to the tibial developmental field. PMID:9415465

  19. [Kinesitherapy in the early postoperative period following intramedullary osteosynthesis of tibial fractures].

    PubMed

    Pavlov, D V; Vorob'ev, A V; Shimbaretskiĭ, A N; Komkova, O V

    2010-01-01

    A program of postoperative kinesitherapy oriented to normalize the muscular force of the shin, reduce the time needed to restore the weight-bearing function of the affected leg, and treat pain syndrome has been developed for the patients presenting with fractures, nonunions, and pseudoarthrosis of the tibia that were treated using intramedullary osteosynthesis. The efficacy of the program was evaluated in terms of restoration of the muscular force in the shin and improvement of microcirculation in the affected region. PMID:21089206

  20. Stress fracture of the mid-tibial shaft.

    PubMed

    Orava, S; Hulkko, A

    1984-02-01

    In a series of 151 tibial stress fractures in athletes and joggers, seven were located at the mid-third of the diaphysis. The diagnosis was made radiographically several months after the onset of symptoms; a transverse fissure line or gap was noted in the middle of the hypertrophied anterior tibial cortex. Histologic examination of a biopsy of the fracture line showed features resembling pseudoarthrosis. All the patients returned to physical activities. PMID:6702426

  1. Platelet-rich plasma for long bone healing

    PubMed Central

    Lenza, Mário; Ferraz, Silvia de Barros; Viola, Dan Carai Maia; dos Santos, Oscar Fernando Pavão; Cendoroglo, Miguel; Ferretti, Mario

    2013-01-01

    ABSTRACT Objective: To evaluate effectiveness of the use of platelet-rich plasma as coadjuvant for union of long bones. Methods: The search strategy included the Cochrane Library (via Central) and MEDLINE (via PubMed). There were no limits as to language or publication media. The latest search strategy was conducted in December 2011. It included randomized clinical trials that evaluated the use of platelet-rich plasma as coadjuvant medication to accelerate union of long bones (acute fractures, pseudoarthrosis and bone defects). The outcomes of interest for this review include bone regeneration, adverse events, costs, pain, and quality of life. The authors selected eligible studies, evaluated the methodological quality, and extracted the data. It was not possible to perform quantitative analysis of the grouped studies (meta-analyses). Results: Two randomized prospective clinical trials were included, with a total of 148 participants. One of them compared recombinant human morphogenic bone protein-7 versus platelet-rich plasma for the treatment of pseudoarthrosis; the other evaluated the effects of three coadjuvant treatments for union of valgising tibial osteotomies (platelet-rich plasma, platelet-rich plasma plus bone marrow stromal cells, and no coadjuvant treatment). Both had low statistical power and moderate to high risk of bias. Conclusion: There was no conclusive evidence that sustained the use of platelet-rich plasma as a coadjuvant to aid bone regeneration of fractures, pseudoarthrosis, or bone defects. PMID:23579757

  2. INTERVENTION TECHNOLOGIES FOR FOOD SAFETY AND PRESERVATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Food preservations with several different technologies, including irradiation, retort, aseptic processing, microwave and hydrostatic high pressure, are discussed in this chapter. Some of the methods are considered relatively mature technologies, e.g. retort and liquid aseptic; however, most of them...

  3. Photobiomodulation of Surgical Wound Dehiscence in a Diabetic Individual by Low-Level Laser Therapy Following Median Sternotomy

    PubMed Central

    Dixit, Snehil; Maiya, Arun; Umakanth, Shashikiran; Borkar, Shirish

    2013-01-01

    In this single case study, we attempt to outline the possible effect of low-level laser therapy (LLLT) on delayed wound healing and pain in chronic dehiscent sternotomy of a diabetic individual. The methods that were employed to evaluate changes pre and post irradiation were wound photography, wound area measurement, pressure ulcer scale of healing (PUSH), and visual analogue scale (VAS) for pain. After irradiation, proliferation of healthy granulation tissue was observed with decrease in scores of PUSH for sternal dehiscence and VAS for bilateral shoulders and sternal dehiscence. We found that LLLT irradiation could be a novel method of treatment for chronic sternal dehiscence following coronary artery bypass grafting, as it augments wound healing with an early closure of the wound deficit. Hence, this might be translated into an early functional rehabilitation and decreased pain perception of an individual following surgical complication. PMID:23766600

  4. Novel Longitudinal Plate-Fixation Technique after Gross Resection of the Sternum

    PubMed Central

    Tasoglu, Irfan; Lafci, Gokhan

    2012-01-01

    Herein, we describe a plate-fixation technique as an alternative method to close a fragile or fractured sternum. A 69-year-old obese woman with diabetes mellitus and chronic obstructive pulmonary disease underwent coronary artery bypass grafting. One week postoperatively, sternal instability was detected, and traditional rewiring was performed. A week later, because of multiple sternal fractures, we performed sternal resection, with use of longitudinally affixed titanium plates and figure-8 steel wires for the anterior chest wall. The procedure was uneventful, and, on short-term follow-up, the anterior chest wall was stable. This longitudinal plate-fixation technique can be tailored to each patient. We think that the technique is safe, effective, economical, and easy to implement, and it is readily reproducible. To evaluate any associated risks, long-term follow-up in additional patients is warranted. PMID:22740734

  5. Morphometric analysis of variation in the sternum with sex and age.

    PubMed

    Weaver, Ashley A; Schoell, Samantha L; Nguyen, Callistus M; Lynch, Sarah K; Stitzel, Joel D

    2014-11-01

    Age and sex-related variations in sternum morphology may affect the thoracic injury tolerance. Male and female sternum size and shape variation was characterized for ages 0-100 from landmarks collected from 330 computed tomography scans. Homologous landmarks were analyzed using Procrustes superimposition to produce age and sex-specific functions of 3D-sternum morphology representing the combined size and shape variation and the isolated shape variation. Significant changes in the combined size and shape variation and isolated shape variation of the sternum were found to occur with age in both sexes. Sternal size increased from birth through age 30 and retained a similar size for ages 30-100. The manubrium expanded laterally from birth through age 30, becoming wider in relation to the sternal body. In infancy, the manubrium was 1.1-1.2 times the width of the sternal body and this width ratio increased to 1.6-1.8 for adults. The manubrium transformed from a circular shape in infancy to an oval shape in early childhood. The distal sternal body became wider in relation to the proximal sternal body from birth through age 30 and retained this characteristic throughout adulthood. The most dramatic changes in sternum morphology occur in childhood and young adulthood when the sternum is undergoing ossification. The lesser degree of ossification in the pediatric sternum may be partly responsible for the prevalence of thoracic organ injuries as opposed to thoracic skeletal injuries in pediatrics. Sternum fractures make up a larger portion of thoracic injury patterns in adults with fully ossified sternums. The lack of substantial size or shape changes in the sternum from age 30-100 suggests that the increased incidence of sternal fracture seen in the elderly may be due to cortical thickness or bone mineral density changes in the sternum as opposed to morphological changes. PMID:24935890

  6. [Primary bone lymphoma with multicentric involvement].

    PubMed

    Graziadio, Marcelo; Medina, Natalia; Amato, Marcelo; Ardaiz, María Del Carmen; Ilutovich, Santiago; Torino, Marcelo

    2012-01-01

    Primary bone lymphoma is a rare disease, which usually has a different presentation and evolution than lymphomas of other locations. We are presenting a case of primary bone lymphoma of rapid growth, in cranial and sternal locations. In its evolution, once the excision of the primary lesion of the skull was performed, the patient presented new lesions of rapid growth at the skull and femur level, and progression of pre-sternal lesion. With large B-cell diffuse non-Hodgkin lymphoma pathology, the patient initiated R-CHOPP (cyclophosphamide, doxorubicin, vincristine, prednisone and rituximab) with rapid reduction of all lesions without evidence of progression after the six cycles. PMID:23089121

  7. Management of the infected median sternotomy wound with muscle flaps. The Emory 20-year experience.

    PubMed Central

    Jones, G; Jurkiewicz, M J; Bostwick, J; Wood, R; Bried, J T; Culbertson, J; Howell, R; Eaves, F; Carlson, G; Nahai, F

    1997-01-01

    OBJECTIVE: The purpose of the study is to define those patient variables that contribute to morbidity and mortality of median sternotomy wound infection and the results of treatment by debridement and closure by muscle flaps. BACKGROUND: Infection of the median sternotomy wound after open heart surgery is a devastating complication associated with significant mortality. Twenty years ago, these wounds were treated with either open packing or antibiotic irrigation, with a mortality approaching 50% in some series. In 1975, the authors began treating these wounds with radical sternal debridement followed by closure using muscle or omental flaps. The mortality of sternal wound infection has dropped to < 10%. METHODS: The authors' total experience with 409 patients treated over 20 years is described in relation to flap choices, hospital days after sternal wound closure, and incidence rates of morbidity and mortality. One hundred eighty-six patients treated since January 1988 were studied to determine which patient variables had impact on rates of flap closure complications, recurrent sternal wound infection, or death. Variables included obesity, history of smoking, hypertension, diabetes, poststernotomy septicemia, internal mammary artery harvest, use of intra-aortic balloon pump, and perioperative myocardial infarction and were analyzed using chi square tests. Fisher's exact tests, and multivariable logistic regression analysis. RESULTS: The mortality rate over 20 years was 8.1% (33/49). Additional procedures for recurrent sternal wound infection were necessary in 5.1% of patients. Thirty-one patients (7.6%) required treatment for hematoma, and 11 patients (2.7%) required hernia repair. Among patients treated since 1988, variables strongly associated with mortality were septicemia (p < 0.00001), perioperative myocardial infarction (p = 0.006), and intra-aortic balloon pump (p = 0.0168). Factors associated with wound closure complications were intra-aortic balloon pump

  8. Asymptomatic (Subclinical) Meningitis in One of Premature Triplets with Simultaneous Enteroviral Meningitis: A Case Report

    PubMed Central

    Gupta, Ashish; Tolan, Robert W.

    2011-01-01

    Most enterovirus infection in the neonate and young infant is asymptomatic, but serious disease may occur, especially if acquired perinatally. We report the first case, to our knowledge, of asymptomatic enterovirus aseptic meningitis, and of concurrent enterovirus aseptic meningitis in premature triplets. Ten-week-old, 31-week-estimated gestational age premature triplet boys were diagnosed with enterovirus aseptic meningitis on the same day. Two of the triplets developed symptoms on the day of admission, while the third remained symptom free throughout the infection. All three recovered completely and are healthy more than a decade later. PMID:23946897

  9. Osteomyelitis Caused by Staphylococcus schleiferi and Evidence of Misidentification of This Staphylococcus Species by an Automated Bacterial Identification System

    PubMed Central

    Calvo, Jorge; Hernández, José L.; Fariñas, Maria C.; García-Palomo, Daniel; Agüero, Jesús

    2000-01-01

    We report a case of sternal osteomyelitis due to Staphylococcus schleiferi in a patient who underwent thoracic surgery. This constitutes the first documented case of osteomyelitis caused by this Staphylococcus species. We also relate our experience in the utilization of commercially available MicroScan panels for the identification of this microorganism. PMID:11015429

  10. 9 CFR 381.170 - Standards for kinds and classes, and for cuts of raw poultry.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... nonflexible breastbone tip. (vi) Cock or rooster. A “cock” or “rooster” is an adult male chicken with coarse skin, toughened and darkened meat, and a nonflexible breastbone tip. (2) Turkeys—(i) Fryer-roaster... and downward from that point along the junction of the vertebral and sternal ribs. The ribs may...

  11. Estimation of respiratory rates based on photoplethysmographic measurements at the sternum.

    PubMed

    Chreiteh, Shadi S; Belhage, Bo; Hoppe, Karsten; Branebjerg, Jens; Haahr, Rasmus; Duun, Sune; Thomsen, Erik V

    2015-08-01

    The respiratory rate (RR) is a clinically important vital sign and is a frequently used parameter in the general hospital wards. In current clinical practice, the monitoring of the RR is by manual count of the chest movement for one minute. This paper addresses a new approach where the respiratory rate is extracted using photoplethysmography (PPG) on the chest bone (sternum). Sternal PPG signals were acquired from 10 healthy subjects resting in a supine position. As reference signals, finger PPG, electrocardiogram (ECG), and capnography were simultaneously recorded during spontaneous and paced breathing. The sternal PPG signals were then compared with the reference signals in terms of Bland-Altman analysis, the power spectrum analysis and the magnitude squared coherence. The Bland-Altman analysis showed an average bias of 0.21 breaths/min between RR extracted from sternal PPG and capnography. The respiratory power content at the sternum was 78.8 (38) % in terms of the median and (the interquartile range). The cardiac content was 19 (18.4) % within the cardiac region. The results from the magnitude squared coherence analysis was 0.97 (0.09) in the respiratory region (6 to 27 breaths/min) and 0.98 (0.01) in the cardiac pulse region (30-120 beats/min). This preliminary study demonstrates the possibility of monitoring the RR from sternal PPG on a healthy group of subjects during rest. PMID:26737798

  12. Manubrial stress fractures diagnosed on MRI: report of two cases and review of the literature.

    PubMed

    Baker, Jonathan C; Demertzis, Jennifer L

    2016-06-01

    In contrast to widely-reported sternal insufficiency fractures, stress fractures of the sternum from overuse are extremely rare. Of the 5 cases of sternal stress fracture published in the English-language medical literature, 3 were in the sternal body and only 2 were in the manubrium. We describe two cases of manubrial stress fracture related to golf and weightlifting, and present the first report of the MR findings of this injury. In each of these cases, the onset of pain was atraumatic, insidious, and associated with increased frequency of athletic activity. Imaging was obtained because of clinical diagnostic uncertainty. On MRI, each patient had a sagittally oriented stress fracture of the lateral manubrium adjacent to the first rib synchondrosis. Both patients had resolution of pain after a period of rest, with subsequent successful return to their respective activities. One patient had a follow-up MRI, which showed resolution of the manubrial marrow edema and fracture line. Based on the sternal anatomy and MR findings, we hypothesize that this rare injury might be caused by repetitive torque of the muscle forces on the first costal cartilage and manubrium, and propose that MRI might be an effective means of diagnosing manubrial stress fracture. PMID:26980227

  13. Hydrolutos piaroa sp.n. (Orthoptera: Anostostomatidae), a new semiaquatic Lutosini species from south-western Venezuelan lowland streams.

    PubMed

    Derka, Tomáš; Svitok, Marek; Fedor, Peter

    2016-01-01

    Hydrolutos piaroa, a new species of Lutosini (Orthoptera: Anostostomatidae) from Tobogán de la Selva (Puerto Ayacucho region, SW Venezuela) is described and figured. Inhabiting aquatic environment it represents an unusual orthopteran with sternal and pleural area covered by fine microtrichia, forming a plastron. This is the first known Hydrolutos species sampled in lowland streams of Venezuelan Guayana. PMID:27395849

  14. Antibiotic concentrations in serum and wound fluid after local gentamicin or intravenous dicloxacillin prophylaxis in cardiac surgery.

    PubMed

    Friberg, Orjan; Jones, Ian; Sjöberg, Lennart; Söderquist, Bo; Vikerfors, Thomas; Källman, Jan

    2003-01-01

    One important aim of antibiotic prophylaxis in cardiac surgery is preventing mediastinitis and thus it would appear to be relevant to study the antibiotic concentrations in pericardial/mediastinal fluid. Local administration of gentamicin in the wound before sternal closure is a novel way of antibiotic prophylaxis and could be effective against bacteria resistant to intravenous antibiotics. This study measured dicloxacillin concentrations in 101 patients in serum and wound fluid following intravenous administration of dicloxacillin. Similarly, concentrations of gentamicin in serum and wound fluid were determined in 30 patients after administration of 260 mg gentamicin in the wound at sternal closure. Median dicloxacillin concentrations in serum and wound fluid at sternal closure were 59.4 and 55.35 mg/l, respectively. Gentamicin levels in the wound were very high (median 304 mg/l), whereas serum concentrations were low (peak median 2.05 mg/l). Dicloxacillin, 1 g given intravenously, according to the clinical protocol, resulted in levels in serum and wound fluid at sternal closure likely to prevent Staphylococcus aureus infections. Locally administered gentamicin resulted in high local concentrations, potentially effective against agents normally considered resistant. PMID:12839154

  15. Erb:YAG and Hol:YAG laser osteotomy: the effect of laser ablation on bone healing.

    PubMed

    Buchelt, M; Kutschera, H P; Katterschafka, T; Kiss, H; Lang, S; Beer, R; Losert, U

    1994-01-01

    Sixty-nine male Sprague Dawley rats were divided into three groups of 23 animals each and osteotomies were performed in group 1 with a power saw, in group 2 with the Erb:Yag laser, and in group 3 with the Hol:YAG laser. Two animals of each group were sacrificed 1 week, 4, 8, and 12 weeks after operation for histologic investigation, and five animals of each group at 4, 8, and 12 weeks after osteotomy for torque testing. Anterior-posterior (AP) radiographs were taken at the same time points and investigated for callus formation and development of pseudoarthrosis. All tibiae osteotomied with the Hol:YAG laser (group 3) developed pseudoarthrosis within 12 weeks and, therefore, torque testing could not be performed for this group. Biomechanical measurements of bone treated by power saw or Erb:YAG laser osteotomies, respectively, showed no significant statistical difference in the stability of bone between the two groups. Histologic examination after 1 week exhibited fibrous tissue at the site of osteotomy in rats of all three groups and additionally carbonization in rats of group 3. Saw osteotomies resulted in more callus formation than Erb:YAG osteotomies, but both techniques provoked a certain reunion within 8 weeks. Hol:YAG laser-treated osteotomies, however, exhibited formation of dense fibrous tissue, carbonization and no callus formation within 12 weeks. Radiographic pictures showed more callus formation for saw osteotomies as compared to those performed with the Erb:YAG laser. For Hol:YAG laser osteotomies pseudoarthrosis was identified also radiologically. PMID:7885171

  16. Ankle Deformity Secondary to Acquired Fibular Segmental Defect in Children

    PubMed Central

    Kang, Soo Hwan; Song, Seok Whan; Chung, Jin Wha; Kim, Yoon Chung; Suhl, Kyung Hwan

    2010-01-01

    Background The authors report the long-term effect of acquired pseudoarthrosis of the fibula on ankle development in children during skeletal growth, and the results of a long-term follow-up of Langenskiold's supramalleolar synostosis to correct an ankle deformity induced by an acquired fibular segmental defect in children. Methods Since 1980, 19 children with acquired pseudoarthrosis of the fibula were treated and followed up for an average of 11 years. Pseudoarthrosis was the result of a fibulectomy for tumor surgery, osteomyelitis of the fibula and traumatic segmental loss of the fibula in 10, 6, and 3 cases, respectively. Initially, a Langenskiold's operation (in 4 cases) and fusion of the lateral malleolus to the distal tibial epiphysis (in 1 case) were performed, whereas only skeletal growth was monitored in the other 14 cases. After a mean follow-up of 11 years, the valgus deformity and external tibial torsion of the ankle joint associated with proximal migration of the lateral malleolus needed to be treated with a supramallolar osteotomy in 12 cases (63%). These ankle deformities were evaluated using the serial radiographs and limb length scintigraphs. Results In all cases, early closure of the lateral part of the distal tibial physis, upward migration of the lateral malleolus, unstable valgus deformity and external tibial torsion of the ankle joint developed during a mean follow-up of 11 years (range, 5 to 21 years). The mean valgus deformity and external tibial torsion of the ankle at the final follow-up were 15.2° (range, 5° to 35°) and 10° (range, 5° to 12°), respectively. In 12 cases (12/19, 63%), a supramalleolar corrective osteotomy was performed but three children had a recurrence requiring an additional supramalleolar corrective osteotomy 2-4 times. Conclusions A valgus deformity and external tibial torsion are inevitable after acquired pseudoarthrosis of the fibula in children. Both Langenskiöld supramalleolar synostosis to prevent these

  17. Intraoperative antepulsion of a posterior lumbar interbody fusion cage: three case reports

    PubMed Central

    Ceylan, Davut; Yaldiz, Can; Asil, Kiyasettin; Kaçira, Tibet; Tatarli, Necati; Can, Aytaç

    2015-01-01

    Spinal fusion surgery techniques develop together with technologic advancements. New complications are seen as the result of new techniques and these may be very severe due to spinal cord and vascular structures in the lumbar region. The posterior lumbar interbody fusion cage (PLIFC) was shown to enhance spinal fusion and to prevent pseudoarthrosis due to its basic dynamic characteristics. PLIFC migrations are usually observed during the postoperative period, just after the mobilization of the patient and usually toward spinal canal. Migration to the retroperitoneal region is a extremely rare condition in the literature. In this article we discussed three cases of PLIFC antepulsion into the retroperitoneal region during the intraoperative period. PMID:26175832

  18. [No evidence of malicious effect of NSAID treatment on bone healing].

    PubMed

    Janum, Susanne; Kristensen, Billy Bjarne

    2012-11-26

    The use of NSAIDs for postoperative pain management following orthopaedic surgery or during conservative treatment of fractures is controversial. Experimental animal models suggest NSAIDs inhibit bone healing. In a review of the literature, there was no clinical evidence to support categorical discard of NSAID for postoperative pain relief in uncomplicated cases. However, NSAID should be considered a potentiel risk factor of impaired bone healing and avoided in patients with a high risk of pseudoarthrosis. Recommended daily doses should be respected and duration of treatment should be limited. PMID:23195353

  19. Role of minimally invasive surgery for adult spinal deformity in preventing complications.

    PubMed

    Yen, Chun-Po; Mosley, Yusef I; Uribe, Juan S

    2016-09-01

    With the aging population, there is a rising prevalence of degenerative spinal deformity and need of surgical care for these patients. Surgical treatment for adult spinal deformity (ASD) is often fraught with a high rate of complications. Minimally invasive surgery (MIS) has for the past decade been adopted by spine surgeons to treat ASD in the hopes of reducing access-related morbidity and perioperative complications. The benefits of MIS approach in general and recent development of MIS techniques to avoid long-term complications such as pseudoarthrosis or proximal junctional kyphosis are reviewed. PMID:27411527

  20. Minimally Invasive Transforaminal Lumbar Interbody Fusion.

    PubMed

    Ahn, Junyoung; Tabaraee, Ehsan; Singh, Kern

    2015-07-01

    Minimally invasive transforaminal lumbar interbody fusion (MIS TLIF) is performed via tubular dilators thereby preserving the integrity of the paraspinal musculature. The decreased soft tissue disruption in the MIS technique has been associated with significantly decreased blood loss, shorter length of hospitalization, and an expedited return to work while maintaining comparable arthrodesis rates when compared with the open technique particularly in the setting of spondylolisthesis (isthmic and degenerative), recurrent symptomatic disk herniation, spinal stenosis, pseudoarthrosis, iatrogenic instability, and spinal trauma. The purpose of this article and the accompanying video wass to demonstrate the techniques for a primary, single-level MIS TLIF. PMID:26079840

  1. Selective instrumentation, reduction and repair in low-grade isthmic spondylolisthesis.

    PubMed

    Morelos, Oscar; Pozzo, Alfredo O

    2004-06-01

    We treated 32 patients with low-grade (<30%) isthmic spondylolisthesis at L5-S1 with selective instrumentation, reduction of the slip, resection of the pseudoarthrosis adding autologous bone grafting and decompressing the root canal. The ages ranged from 18 to 54 years. After a mean of 3.4 (1-7) years, we found good radiological and clinical results in 27 patients. Five patients lost correction, of whom three were asymptomatic whereas two required fusion of L5-S1. We think this technique is a useful surgical option for select patients. PMID:14727083

  2. Cerebrospinal fluid culture

    MedlinePlus

    ... can also be detected using special tests. Finding bacteria does not necessarily mean the infection is contagious, unless it is meningococcal meningitis. It may also include: Aseptic meningitis Cryptococcosis

  3. Endophyte microbiome diversity in micropropagated Atriplex canescens and Atriplex torreyi var griffithsii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Microbial diversity associated with micropropagated Atriplex species was assessed using microscopy, isolate culturing, and sequencing. Light, electron, and confocal microscopy revealed microbial cells in aseptically regenerated leaves and roots. Clone libraries and tag-encoded FLX amplicon pyrosequ...

  4. Feasibility of utilizing bio-indicators for testing microbial inactivation in sweetpotato purees processed with a continuous flow microwave system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Continuous flow microwave heating has potential in aseptic processing of various food products, including the purees from sweetpotatoes and other vegetables. Establishing the feasibility of a new processing technology for achieving commercial sterility requires evaluating microbial inactivation. Thi...

  5. A Course in... Biochemical Engineering.

    ERIC Educational Resources Information Center

    Ng, Terry K-L.; And Others

    1988-01-01

    Describes a chemical engineering course for senior undergraduates and first year graduate students in biochemical engineering. Discusses five experiments used in the course: aseptic techniques, dissolved oxygen measurement, oxygen uptake by yeast, continuous sterilization, and cultivation of microorganisms. (MVL)

  6. Practical Tips for the Safe Handling of Micro-organisms in Schools

    ERIC Educational Resources Information Center

    Holt, G.

    1974-01-01

    Outlines safe laboratory procedures for the handling of micro-organisms including aseptic technique, manipulation of cultures, and treatment of contaminated equipment. Identifies the principal hazard as the microbial aerosol, explains its possible effects, and describes the appropriate precautions. (GS)

  7. 75 FR 16111 - Antimicrobial Pesticide Products; Registration Applications

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-31

    ...: Hydrogen peroxide; Peroxyacetic acid. Proposed Uses: Treatment of wastewater and sewage. Contact: Karen..., TX 77098. Active ingredient: Hydrogen peroxide. Proposed Uses: Sterilant for aseptic food packaging... USA, LLC, 122 C Street, NW, Suite 740, Washington DC 20001. Active ingredient: Hydrogen...

  8. Osteonecrosis

    MedlinePlus

    Avascular necrosis; Bone infarction; Ischemic bone necrosis; AVN; Aseptic necrosis ... Osteonecrosis occurs when part of the bone does not get blood and dies. After a while, the bone can collapse. If osteonecrosis is not treated, the joint deteriorates, leading ...

  9. Trail-following pheromones in basal termites, with special reference to Mastotermes darwiniensis.

    PubMed

    Sillam-Dussès, David; Sémon, Etienne; Lacey, Michael J; Robert, Alain; Lenz, Michael; Bordereau, Christian

    2007-10-01

    In the framework of an evolutionary study, trail pheromones have been studied in the most basal extant termite, Mastotermes darwiniensis (Mastotermitidae), and two other basal termites, the Termopsidae Porotermes adamsoni (Porotermitinae) and Stolotermes victoriensis (Stolotermitinae). Although workers of M. darwiniensis do not walk in single file while exploring a new environment under experimental conditions and are unable to follow artificial trails in 'open field' experiments, they do secrete a trail-following pheromone from their sternal glands. This unique behavior might reflect a primitive function of communication of the sternal gland. The major component of the pheromone appears to be the same in the three basal species: the norsesquiterpene alcohol (E)-2,6,10-trimethyl-5,9-undecadien-1-ol. This represents a new chemical category of trail-following pheromones for termites. The quantity of pheromone was estimated as 20 pg/individual in M. darwiniensis, 700 pg/individual in P. adamsoni, and 4 pg/individual in S. victoriensis. The activity threshold was 1 ng/cm in M. darwiniensis and 10 pg/cm in P. adamsoni. In M. darwiniensis, the trail pheromone was secreted by sternal gland 4 and to a lesser degree by sternal gland 3, sternal gland 5 being almost inactive. This study highlighted phylogenetic relationships between the Mastotermitidae and two subfamilies of the Termopsidae, the Porotermitinae and the Stolotermitinae. Furthermore, it indicated a heterogeneity within the Termopsidae, with Porotermitinae and Stolotermitinae on one hand, and Termopsinae on the other. Finally, Mastotermitidae and Termopsidae, with C14 trail pheromones, are clearly separated from the Kalotermitidae, Rhinotermitidae, and Termitidae that secrete C12 or C20 trail pheromones. PMID:17885791

  10. Segmentation of the sternum from low-dose chest CT images

    NASA Astrophysics Data System (ADS)

    Liu, Shuang; Xie, Yiting; Reeves, Anthony P.

    2015-03-01

    Segmentation of the sternum in medical images is of clinical significance as it frequently serves as a stable reference to image registration and segmentation of other organs in the chest region. In this paper we present a fully automated algorithm to segment the sternum in low-dose chest CT images (LDCT). The proposed algorithm first locates an axial seed slice and then segments the sternum cross section on the seed slice by matching a rectangle model. Furthermore, it tracks and segments the complete sternum in the cranial and caudal direction respectively through sequential axial slices starting from the seed slice. The cross section on each axial slice is segmented using score functions that are designed to have local maxima at the boundaries of the sternum. Finally, the sternal angle is localized. The algorithm is designed to be specifically robust with respect to cartilage calcifications and to accommodate the high noise levels encountered with LDCT images. Segmentation of 351 cases from public datasets was evaluated visually with only 1 failing to produce a usable segmentation. 87.2% of the 351 images have good segmentation and 12.5% have acceptable segmentation. The sternal body segmentation and the localization of the sternal angle and the vertical extents of the sternum were also evaluated quantitatively for 25 good cases and 25 acceptable cases. The overall weighted mean DC of 0.897 and weighted mean distance error of 2.88 mm demonstrate that the algorithm achieves encouraging performance in both segmenting the sternal body and localizing the sternal angle.

  11. Primary Hodgkin’s Lymphoma of the Sternum: Report of a Case and Review of the Literature

    PubMed Central

    Gupta, Naresh

    2016-01-01

    Sternal masses present a unique diagnostic challenge in clinical practice. A wide array of differential diagnosis of a sternal mass includes osteomyelitis, tuberculosis, eosinophilic granuloma, sarcoma and lymphoma (usually Non-Hodgkin’s) amongst others. Sternum is a rare site of Hodgkin’s lymphoma and is usually misdiagnosed as tuberculosis or eosinophilic granuloma on routine histopathology. This delayed diagnosis culminates in death of patients. We report a 30-year-old lady who presented with swelling in upper part of chest wall since 1 month. Past history was significant for a similar swelling 2 years back, which was diagnosed as hodgkin’s lymphoma and treated with 4 cycles of chemotherapy at another centre (which led to resolution of the swelling). Examination revealed a 6x6.5cm firm swelling originating from the upper part of sternum. There was no lymphadenopathy or organomegaly. Histopathological examination (with immunohistochemistry) of the trucut biopsy from the swelling confirmed the diagnosis of Hodgkin’s lymphoma (nodular sclerosis). Patient was diagnosed as a late relapse of primary sternal Hodgkin’s lymphoma (stage IBE) and was administered 4 cycles of ABVD followed by local radiotherapy to the involved site which led to complete resolution of the disease as assessed by PET scan. We present this unusual case of primary sternal Hodgkin’s lymphoma. Rarity of this entity, with diagnostic challenges encountered and treatment options available are highlighted in the current report. A pubmed search revealed 18 cases of sternal involvement in Hodgkin’s lymphoma which have been tabulated. PMID:27504392

  12. Diurnal rhythm and concordance between objective and subjective hot flashes: The Hilo Women’s Health Study

    PubMed Central

    Sievert, Lynnette L.; Reza, Angela; Mills, Phoebe; Morrison, Lynn; Rahberg, Nichole; Goodloe, Amber; Sutherland, Michael; Brown, Daniel E.

    2010-01-01

    Objective To test for a diurnal pattern in hot flashes in a multi-ethnic population living in a hot, humid environment. To examine rates of concordance between objective and subjective measures of hot flashes using ambulatory and laboratory measures. Methods Study participants aged 45–55 were recruited from the general population of Hilo, Hawaii. Women wore a Biolog hot flash monitor, kept a diary for 24-hours, and also participated in 3-hour laboratory measures (n=199). Diurnal patterns were assessed using polynomial regression. For each woman, objectively recorded hot flashes that matched subjective experience were treated as true positive readings. Subjective hot flashes were considered the standard for computing false positive and false negative readings. True positive, false positive, and false negative readings were compared across ethnic groups by chi-square analyses. Results Frequencies of sternal, nuchal and subjective hot flashes peaked at 15:00 ± 1 hour with no difference by ethnicity. Laboratory results supported the pattern seen in ambulatory monitoring. Sternal and nuchal monitoring showed the same frequency of true positive measures, but non-sternal electrodes picked up more false positive readings. Laboratory monitoring showed very low frequencies of false negatives. There were no ethnic differences in the frequency of true positive or false positive measures. Women of European descent were more likely to report hot flashes that were not objectively demonstrated (false negative measures). Conclusions The diurnal pattern and peak in hot flash occurrence in the hot humid environment of Hilo was similar to results from more temperate environments. Lack of variation in sternal vs. non-sternal measures, and in true positive measures across ethnicities suggests no appreciable effect of population variation in sweating patterns. PMID:20220538

  13. Biological performance of a polycaprolactone-based scaffold used as fusion cage device in a large animal model of spinal reconstructive surgery.

    PubMed

    Abbah, Sunny A; Lam, Christopher X L; Hutmacher, Dietmar W; Goh, James C H; Wong, Hee-Kit

    2009-10-01

    A bioactive and bioresorbable scaffold fabricated from medical grade poly (epsilon-caprolactone) and incorporating 20% beta-tricalcium phosphate (mPCL-TCP) was recently developed for bone regeneration at load bearing sites. In the present study, we aimed to evaluate bone ingrowth into mPCL-TCP in a large animal model of lumbar interbody fusion. Six pigs underwent a 2-level (L3/4; L5/6) anterior lumbar interbody fusion (ALIF) implanted with mPCL-TCP + 0.6 mg rhBMP-2 as treatment group while four other pigs implanted with autogenous bone graft served as control. Computed tomographic scanning and histology revealed complete defect bridging in all (100%) specimen from the treatment group as early as 3 months. Histological evidence of continuing bone remodeling and maturation was observed at 6 months. In the control group, only partial bridging was observed at 3 months and only 50% of segments in this group showed complete defect bridging at 6 months. Furthermore, 25% of segments in the control group showed evidence of graft fracture, resorption and pseudoarthrosis. In contrast, no evidence of graft fractures, pseudoarthrosis or foreign body reaction was observed in the treatment group. These results reveal that mPCL-TCP scaffolds could act as bone graft substitutes by providing a suitable environment for bone regeneration in a dynamic load bearing setting such as in a porcine model of interbody spine fusion. PMID:19540586

  14. Evaluating degenerative changes in the wrist after surgical treatment for scaphoid pseudarthrosis using a corticocancellous graft for anatomical reconstruction.

    PubMed

    Markowicz, Agnieszka; Baczkowski, Bogusław; Lorczyński, Adam; Sawicka, Joanna; Siwicka, Karolina

    2006-10-31

    Background. Pseudoarthrosis of the scaphoid results in the development of carpal instability and severe posttraumatic osteoarthritis. Modern methods of treatment focus on reconstruction of the anatomical shape and length of the scaphoid. The purpose of our study was to determine the occurrence of carpal osteoarthritis after surgical treatment of scaphoid pseudoarthrosis using a cortico-cancellous bone grafting technique. Material and methods. 48 patients who had undergone surgical treatment for scaphoid union failure were examined. The surgical method included the anatomical reconstruction of the scaphoid bone, which resulted in normal ligament tension and carpal stability. The clinical examination included pain evaluation, return to work, range of wrist motion, and grip strength. On comparative x-rays of both wrists we evaluated union, the length and shape of the scaphoid bone, the scapho-lunate angle, the carpal height ratio, and the carpal ulnar shift. Results. Union was obtained in 42 cases. In 26 patients there were no signs of osteoarthritis, while 11 patients had slight degenerative changes in the radio-scaphoid joint. Conclusions. According to our analysis, cortico-cancellous bone grafting is an effective surgical procedure, useful not only in obtaining union, but also in reconstructing the shape and length of the scaphoid and preventing posttraumatic carpal asteoarthritis. PMID:17589397

  15. Transitional lumbosacral segment with unilateral transverse process anomaly (Castellvi type 2A) resulting in extraforaminal impingement of the spinal nerve: a pathoanatomical study of four specimens and report of two clinical cases.

    PubMed

    Weber, Jochen; Ernestus, Ralf-Ingo

    2010-04-01

    The spinal nerve can be pinched between the transverse process of the fifth lumbar vertebra and the sacral ala. The patients are divided into two types: elderly persons with degenerative scoliosis and somewhat younger adults with isthmic spondylolisthesis. For the first time, we describe extraforaminal impingement of the spinal nerve in transitional lumbosacral segment with unilateral transverse process anomaly. Selective nerve root blocks were performed in two clinical cases. One patient underwent nerve root decompression via a posterior approach. One year after operation, this patient reported no radicular or lumbar pain. The pathoanatomical study demonstrated pseudoarthrosis between the transverse process and the ala of the sacrum and showed dysplastic facet joints at the level below the transitional vertebra in all specimens. Furthermore, we present the oldest illustration of this pathological condition, published in a book by Carl Wenzel in 1824. Extraforaminal entrapment of the spinal nerve in transitional lumbosacral segment with unilateral transverse process anomaly can cause radiculopathy, and osteophytes are the cause of the entrapment. Dysplastic facet joints on the level below the transitional vertebra could be one reason for "micromotion" resulting in pseudoarthrosis with osteophytes. Sciatica relief was obtained by means of selective nerve root blocks or posterior decompression via a dorsomedial approach. PMID:21128090

  16. Update Review and Clinical Presentation in Congenital Insensitivity to Pain and Anhidrosis

    PubMed Central

    Pérez-López, L. M.; Cabrera-González, M.; Gutiérrez-de la Iglesia, D.; Ricart, S.; Knörr-Giménez, G.

    2015-01-01

    Introduction. Congenital insensitivity to pain and anhidrosis (CIPA) or hereditary sensory and autonomic neuropathy type IV is an extremely rare syndrome. Three clinical findings define the syndrome: insensitivity to pain, impossibility to sweat, and mental retardation. This pathology is caused by a genetic mutation in the NTRK1 gene, which encodes a tyrosine receptor (TrkA) for nerve growth factor (NGF). Methods. The consultation of a child female in our center with CIPA and a tibia fracture in pseudoarthrosis encouraged us to carefully review literature and examine the therapeutic possibilities. A thorough review of literature published in Pubmed was done about CIPA and other connected medical issues mentioned in the paper. Conclusions. The therapeutic approach of CIPA remains unclear. The preventive approach remains the only possible treatment of CIPA. We propose two new important concepts in the therapeutic approach for these patients: (1) early surgical treatment for long bone fractures to prevent pseudoarthrosis and to allow early weight bearing, decreasing the risk of further osteopenia, and (2) bisphosphonates to avoid the progression of osteopenia and to reduce the number of consecutive fractures. PMID:26579324

  17. CT after reconstructive repair of the sternum and chest wall.

    PubMed

    Maddern, I R; Goodman, L R; Almassi, G H; Haasler, G B; McManus, R P; Olinger, G N

    1993-03-01

    Acute mediastinitis and sternal infection after sternotomy are potentially devastating complications, but considerable advances in treatment have been made during the past decade. Sternectomy followed by reconstruction with use of either an omental transposition or a muscle flap has markedly decreased mortality and morbidity. After extensive rib resection, various reconstructive repairs, including the use of polytetrafluoroethylene mesh, have proved successful. The authors retrospectively reviewed 27 postoperative computed tomographic (CT) scans obtained in 19 patients. Twelve of these patients had sternal wounds repaired with either omental or muscle flap procedures. Seven patients had chest wall reconstructions with polytetrafluoroethylene patches, muscle transpositions, or both. The authors found no cases of unexpected or unexplained fluid collections on CT scans obtained beyond the 1st month. Any persistent or recurrent collection is suggestive of infection. If clinical and imaging findings are at odds, imaging-directed needle aspiration can help determine whether a fluid collection is infected and in need of further treatment. PMID:8430171

  18. Bone scan appearances following biopsy of bone and bone marrow

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.

    1984-10-01

    The influence of sternal marrow aspiration, iliac crest marrow aspiration, and iliac crest bone biopsy on bone scan appearances was examined. Eighteen patients were scanned a mean of 9.9 days after sternal marrow aspiration with a Salah needle. Bone scans obtained in 9 patients a mean of 10 days aftr iliac crest trephine marrow biopsy with a Jamshidi needle showed no abnormality at the biopsy site. In 18 patients with metabolic bone disease who had undergone iliac crest bone biopsy with an 8 mm needle, a scan abnormality due to the biopsy was usually present when the interval between the biopsy and the scan was 5 days to 2 months. Patients who were scanned within 3 days of iliac crest bone biopsy or more than 2 months after biopsy had normal scan appearance at the biopsy site.

  19. Wound complications after median sternotomy: A study of 61 patients from a consecutive series of 9,279

    PubMed Central

    Ott, David A.; Cooley, Denton A.; Solis, Robert T.; Harrison, Clanton B.

    1980-01-01

    Among a consecutive series of 9,279 sternotomies performed during a period of 2½ years, 61 (0.66%) patients developed significant wound complications. Of these, 58 (95.1%) survived. Sternal infection occurred in 36 patients (0.39%). Predisposing factors included chronic obstructive pulmonary disease, diabetes mellitus, obesity, closed chest massage, prolonged assisted ventilation, and excessive bleeding after operation. Positive end expiratory pressure (PEEP) did not, in itself, predispose to sternal dehiscence. Intermittent positive pressure breathing (IPPB) treatments caused excessive coughing, which may have increased the likelihood of dehiscence. Disposable drapes and expeditious surgery probably contributed to the low incidence of wound infection. Early diagnosis, surgical debridement, rewiring and primary closure with substernal drainage, without continuous antibiotic irrigation, resulted in satisfactory resolution in most patients. PMID:15216289

  20. Brachial plexus injury as an unusual complication of coronary artery bypass graft surgery

    PubMed Central

    Chong, A; Clarke, C; Dimitri, W; Lip, G

    2003-01-01

    Brachial plexus injury is an unusual and under-recognised complication of coronary artery bypass grafting especially when internal mammary artery harvesting takes place. It is believed to be due to sternal retraction resulting in compression of the brachial plexus. Although the majority of cases are transient, there are cases where the injury is permanent and may have severe implications as illustrated in the accompanying case history. PMID:12612322

  1. C-reactive protein and leucocyte counts drop faster using the HeartShield® device in patients with DSWI.

    PubMed

    Lindstedt, Sandra; Malmsjö, Malin; Ingemansson, Richard

    2015-04-01

    Right ventricular heart rupture is a devastating complication associated with negative pressure wound therapy (NPWT) in cardiac surgery. The use of a rigid barrier disc (HeartShield™) has been suggested to offer protection against this lethal complication by preventing the heart from being drawn up by the negative pressure and damaged by the sharp sternum bone edges. Seven patients treated with conventional NPWT and seven patients treated with NPWT with a protective barrier disc (HeartShield) were compared with regard to bacterial clearance and infection parameters including C-reactive protein levels and leucocyte counts. C-reactive protein levels and leucocyte counts dropped faster and bacterial clearance occurred earlier in the HeartShield® group compared with the conventional NPWT group. Negative biopsy cultures were shown after 3·1 ± 0·4 NPWT dressing changes in the HeartShield group, and after 5·4 ± 0·6 NPWT dressing changes in the conventional NPWT group (P < 0·001). All patients were followed up with clinical check-up after 3 months. None of the patients in the HeartShield group had any signs of reinfection such as deep sternal wound infection (DSWI) or sternal fistulas, whereas in the conventional NPWT group, two patients had signs of sternal fistulas that demanded hospitalisation. HeartShield hinders the right ventricle to come into contact with the sharp sternal edges during NPWT and thereby protects from heart damage. This study shows that using HeartShield is beneficial in treating patients with DSWI. Improved wound healing by HeartShield may be a result of the efficient drainage of wound effluents from the thoracic cavity. PMID:23651118

  2. Mechanism of trail following by the arboreal termite Nasutitermes corniger (Isoptera: Termitidae).

    PubMed

    Gazai, Vinícius; Bailez, Omar; Viana-Bailez, Ana Maria

    2014-01-01

    In this study, we investigated the mechanisms used by the arboreal termite Nasutitermes corniger (Motschulsky, 1855) to follow trails from the nest to sources of food. A plate containing one of seven trail types was used to connect an artificial nest of N. corniger with an artificial foraging arena. The trail types were: termite trail; paraffined termite trail; trail made of paraffin; rectal fluid extract trail; sternal gland extract trail; feces extract trail; and solvent trail (control). In each test, the time was recorded from the start of the test until the occurrence of trail following, at which point the number of termites that followed the trail for least 5 cm in the first 3 min of observation was recorded. The delay for termites initiating trail following along the termite trail was lower (0.55 ± 0.16 min) than in the trails of sternal gland extract (1.05 ± 0.08 min) and trails of termite feces extract (1.57 ± 0.21 min) (F(2), (48) = 22.59, P < 0.001). The number of termites that followed the termite trail was greater (207.3 ± 17.3) than the number that followed the trail of termite feces extract (102.5 ± 9.4) or sternal gland extract (36, 9 ± 1.6) (F(2), (48) = 174.34, P < 0.001). Therefore, feces on the trail may play an important role alongside sternal gland pheromones in increasing the persistence of the trail. PMID:24410489

  3. [Intercostal Lung Hernia after Video-assisted Thoracoscopic Lobectomy].

    PubMed

    Kawaguchi, Takeshi; Yasukawa, Motoaki; Kawai, Norikazu; Tojo, Takashi

    2016-05-01

    A 52-year-old woman had undergone video-assisted thoracoscopic right upper lobectomy for primary lung cancer. Although her postoperative course was uneventful progressive subcutaneous emphysema of the thorax and neck was developed 6 weeks after the lobectomy. Her chest computed tomography revealed intercostal lung herniation and subcutaneous emphysema. Surgical repair was performed via thoracoscopic assistance. The damaged portion of the lung was resected and the ribs were fixed using a wire for sternal suturing. PMID:27220930

  4. Role of topical application of gentamicin containing collagen implants in cardiac surgery

    PubMed Central

    2014-01-01

    Sternal wound infections (SWI) continue to be a major cause of concern after cardiac surgery. It leads to prolonged hospital stay and increased morbidity, mortality and increased hospital costs. Prophylactic systemic antibiotics have been used to prevent surgical site infection (SSI). However, prolonged postoperative use of systemic antibiotics can lead to emergence of resistant organisms. Gentamycin Containing Collagen Implants (GCCI) when used during sternotomy closure produces high local antibiotic concentrations in the wound with a low serum concentration. There is evidence that the concentration of gentamicin in the mediastinal fluid reaches levels high enough to be effective against bacteria that are considered resistant to gentamycin and other antibiotics. However, questions have been raised about the safety and efficacy of GCCI. There were concerns whether GCCI can lead to systemic absorption with renal impairment and whether use of topical antibiotics can lead to emergence of antimicrobial resistance. We, hereby, review the literature on GCCI (Collatamp) and take the opportunity to appraise the scientific community about their role in cardiac surgery. Several recent studies have supported their clinical effectiveness. They should be used in dry condition and should not be soaked in saline even for a short period prior to use. However, for GCCI to become part of routine practice in cardiac surgery further large randomised studies are required. As the incidence of sternal wound infection is low in the specialty of cardiac surgery, for any study to be sufficiently powered to address this issue, multicenter studies might be the way forward. Based on the evidence presented in this manuscript it is recommended GCCI (Collatamp) can be a cost effective adjunct for prevention of sternal wound infection. They can also be used for treatment of Deep Sternal Wound Infection. PMID:25005533

  5. Hypertrophic osteodystrophy preceding canine juvenile cellulitis in an Australian shepherd puppy

    PubMed Central

    Wentzell, Meaghan L.

    2011-01-01

    A 10-week-old intact female Australian shepherd dog was presented sternally recumbent, mildly pyrexic, and painful on long bone palpation of both forelimbs. Based on radiographs she was diagnosed with hypertrophic osteodystrophy. Analgesia was provided with intravenous, oral, and topical medications. Approximately 2 wk later she was presented for facial swelling, regional dermatitis, and lymphadenopathy. Canine juvenile cellulitis was diagnosed and successfully treated. PMID:21731101

  6. Locally extensive angio-invasive Scedosporium prolificans infection following resection for squamous cell lung carcinoma

    PubMed Central

    Holmes, Natasha E.; Trevillyan, Janine M.; Kidd, Sarah E.; Leong, Trishe Y.-M.

    2013-01-01

    We report a case of Scedosporium prolificans infection in a patient following surgery for squamous cell lung carcinoma. Combination therapy with voriconazole and terbinafine was commenced for intrathoracic infection and mycotic vasculitis. In spite of antifungal treatment, he developed culture-positive sternal and rib osteomyelitis four months later. Scedosporiosis is not commonly reported in patients with solid organ malignancies, and this case highlights its aggressive nature and propensity for direct local invasion. PMID:24432228

  7. PHACE(S) Syndrome With Absent Intracranial Internal Carotid Artery and Anomalous Circle of Willis.

    PubMed

    Winter, Pieta R; Itinteang, Tinte; Leadbitter, Philip; FitzJohn, Trevor; Tan, Swee T

    2015-06-01

    The authors present a case of PHACE(S) (posterior fossa malformations, hemangioma, arterial anomalies, cardiac defects, eye anomalies, and sternal cleft or supraumbilical raphe) syndrome with a right-sided segmental infantile hemangioma, and describe in detail, the associated absent ipsilateral intracranial internal carotid artery and anomalous Circle of Willis. Propranolol therapy led to accelerated, complete involution. Nadolol may reduce the theoretical risk of treating PHACE(S) patients with β-blockers. PMID:26080245

  8. Mediastinal tracheostomy.

    PubMed

    Gomes, M N; Kroll, S; Spear, S L

    1987-05-01

    Upper airway obstruction in primary or recurrent carcinomas of the head and neck extending into the mediastinum may demand surgical intervention despite severe technical difficulties in patients with tumors previously considered inoperable. In fact, many of these tumors may be operable and some perhaps curable. A technique has been developed based in part on our experience with previously described procedures. A preliminary sternal split is used to demonstrate the extent of the mediastinal involvement as well as to provide enhanced exposure and proximal control of the great vessels. The pectoralis major muscle is used with a generous flap of overlying skin comprising nearly half of the anterior portion of the chest. A tracheostomy is then created in a fashion similar to the placement of a cardiac valvular prosthesis by creating a circular defect in the pectoralis major flap and suturing it to the tracheal remnant. This technique offers a reasonably safe and reliable means of creating a low anterior mediastinal tracheostomy for tumors previously considered inoperable. The preliminary sternal split makes the procedure safer and easier to perform, and the use of a very large pectoralis major island flap allows for reliable closure of the resulting mediastinal and sternal defects. PMID:3034176

  9. [Solitary metachronous metastasis of the sternum from pancreatic adenocarcinoma].

    PubMed

    Lequaglie, Cosimo; Della Morte, Aniello; Feudale, Elisa; Giudice, Gabriella

    2007-01-01

    Sternal metastases from adenocarcinoma of the pancreas are extremely rare, and even more so when solitary. Two years earlier, the patient reported on here, a 67-year-old man with a solitary osteolytic lesion of the sternal manubrium, had undergone a duodeno-cephalopancreatectomy for adenocarcinoma of the pancreas (G2, pY3, pN1) followed by adjuvant radio-chemotherapy. PET/CT scans, in response to the onset of burning pain in the sternal region, revealed a hypermetabolic area only at the level of the manubrium, while MRI showed a bulging manubrium due to the presence of extensive solid pathological tissue towards the right articulations of the ribs. Abnormal tumour markers were: CEA = 12, n.v. 0-4; Ca 15-3 = 512, n.v. 0-51, Ca 19-9 = 8777, n.v. 0-18. A partial sternectomy was performed with en-bloc resection of the hemiclavicles and the anterior tract of the 1st and 2nd ribs bilaterally with a mediastinic lymphadenectomy and repair with a sandwich prosthesis of prolene mesh and methacrylate, protecting the supra-aortic trunks and the anonymous vein with a polytetrafluoroethylene patch. The histological examination revealed secondary adenocarcinoma with 3 mediastinal metastatic lymph nodes. In view of the severe prognosis, a resection with palliative intent was also performed, which, when carried out in specialised centres, presents no contraindications in terms of cost-benefits. PMID:18361001

  10. Reconstruction of the sternum and chest wall with methyl methacrylate: CT and MRI appearance.

    PubMed

    Gayer, G; Yellin, A; Apter, S; Rozenman, Y

    1998-01-01

    The aim of our study was to define the appearance of methyl methacrylate grafts replacing resected sternum and ribs on CT and MRI and how the sternal graft may mimic an abnormally sclerotic sternum on CT images. We reviewed the CT scans of nine patients who had undergone chest wall resection (eight with malignant and one with benign disease) and reconstruction with a composite of methyl methacrylate and Marlex mesh graft. One of them had an MRI study as well. The size, shape and CT attenuation were assessed on mediastinal and bone window settings. The sternal graft was seen on mediastinal and even better on bone windows as an abnormally wide, irregularly shaped structure, somewhat denser than the normal sternum. The chest wall prosthesis replacing resected ribs was seen as a continuous dense structure and of similar attenuation as that of the sternal graft. On MRI the prosthesis appeared as a well-defined structure with no signal. Reconstruction of the chest wall with methyl methacrylate appears on CT as a diffusely dense sclerotic bone lesion not unlike a malignant lesion. The possibility of a graft has to be included in the differential diagnosis in these cases. PMID:9477274

  11. A new kinorhynch genus, Mixtophyes (Kinorhyncha: Homalorhagida), from the Guinea Basin deep-sea, with new data on the family Neocentrophyidae

    NASA Astrophysics Data System (ADS)

    Sánchez, Nuria; Pardos, Fernando; Sørensen, Martin V.

    2014-06-01

    A new homalorhagid genus and species, Mixtophyes abyssalis gen. et sp. nov., is described from the deep-sea of the Guinea Basin in the Atlantic Ocean. The new genus and species was collected during the R/V Meteor Diva2 M63/2 Cruise, and it is characterized by a trunk with segment 1 consisting of a tergal and a single sternal plate, without any subdivisions or differentiations, segment 2-10 of one tergal and two sternal plates and segment 11 of a tergal and a sternal plate. Lateral terminal spines are present in both sexes. As part of the study of the new taxon, the type material of Neocentrophyes intermedius and N. satyai was re-examined, and new information is provided for both species. Based on the information from Mixtophyes abyssalis gen. et sp. nov. and re-examination of the two Neocentrophyes species, emended diagnoses for Neocentrophyes and Neocentrophyidae are proposed, and an updated identification key to homalorhagid genera and species of Neocentrophyidae is provided. Mixtophyes abyssalis gen. et sp. nov. is tentatively assigned to Neocentrophyidae, but evaluation of our current hypotheses about homalorhagid evolution and phylogeny also indicated that the family most probably is paraphyletic and that revision of homalorhagid classification is required when new results from phylogenetic analyses become available.

  12. The Society of Thoracic Surgeons Clinical Practice Guidelines on Arterial Conduits for Coronary Artery Bypass Grafting.

    PubMed

    Aldea, Gabriel S; Bakaeen, Faisal G; Pal, Jay; Fremes, Stephen; Head, Stuart J; Sabik, Joseph; Rosengart, Todd; Kappetein, A Pieter; Thourani, Vinod H; Firestone, Scott; Mitchell, John D

    2016-02-01

    Internal thoracic arteries (ITAs) should be used to bypass the left anterior descending (LAD) artery when bypass of the LAD is indicated (class of recommendation [COR] I, level of evidence [LOE] B). As an adjunct to left internal thoracic artery (LITA), a second arterial graft (right ITA or radial artery [RA]) should be considered in appropriate patients (COR IIa, LOE B). Use of bilateral ITAs (BITAs) should be considered in patients who do not have an excessive risk of sternal complications (COR IIa, LOE B). To reduce the risk of sternal infection with BITA, skeletonized grafts should be considered (COR IIa, LOE B), smoking cessation is recommended (COR I, LOE C), glycemic control should be considered (COR IIa, LOE B), and enhanced sternal stabilization may be considered (COR IIb, LOE C). As an adjunct to LITA to LAD (or in patients with inadequate LITA grafts), use of a RA graft is reasonable when grafting coronary targets with severe stenoses (COR IIa, LOE: B). When RA grafts are used, it is reasonable to use pharmacologic agents to reduce acute intraoperative and perioperative spasm (COR IIa, LOE C). The right gastroepiploic artery may be considered in patients with poor conduit options or as an adjunct to more complete arterial revascularization (COR IIb, LOE B). Use of arterial grafts (specific targets, number, and type) should be a part of the discussion of the heart team in determining the optimal approach for each patient (COR I, LOE C). PMID:26680310

  13. A Consideration of Breast Imagery in Art as Depicted through Western Painting.

    PubMed

    Hwang, Kun; Park, Ju Yong; Hwang, Se Won

    2015-03-01

    The aim of this study is to consider breast imagery in art as depicted through western painting. Twenty western art paintings were collated. Most of the sample paintings were created from the mid-nineteenth century to the late twentieth century and some are from the Renaissance period. Ten anthropometric items were used to measure 15 distances between two landmarks and 3 angles between three points. The distance from the nipple to the sternal notch and to the midclavicular point was the same and they were 0.46 of the distance from the sternal notch to the umbilicus. The shape of the projection of the breast was almost an isosceles triangle and the altitude of the triangle was at a proportion of 0.45 of the bottom length and 0.16 of the distance from the sternal notch to the umbilicus. The distance between the lateral ends of the breasts was 2.14 times the facial width and the distance between nipples was 1.36 times the facial width. Proportions from works of art are more ideal and attractive than clinically measured proportions. The desirable ratios measured from historical paintings might be useful in planning breast surgeries. PMID:25798397

  14. Anaesthetic and cardiopulmonary effects of intramuscular morphine, medetomidine and ketamine administered to telemetered cats.

    PubMed

    Wiese, Ashley J; Muir, William W

    2007-04-01

    The quality and duration of anaesthesia, cardiorespiratory effects and recovery characteristics of a morphine, medetomidine, ketamine (MMK) drug combination were determined in cats. Six healthy, adult female cats were administered 0.2 mg/kg morphine sulphate, 60 microg/kg medetomidine hydrochloride, and 5 mg/kg ketamine hydrochloride intramuscularly. Atipamezole was administered intramuscularly at 120 min after MMK administration. Time to lateral recumbency, intubation, extubation and sternal recumbency were recorded. Cardiorespiratory variables and response to a noxious stimulus were recorded before and at 3 min and 10 min increments after drug administration until sternal recumbency. The time to lateral recumbency and intubation were 1.9+/-1.2 and 4.3+/-1.2 min, respectively. Body temperature and haemoglobin saturation with oxygen remained unchanged compared to baseline values throughout anaesthesia. Respiratory rate, tidal volume, minute volume, heart rate, and blood pressure were significantly decreased during anaesthesia compared to baseline values. One cat met criteria for hypotension (systolic blood pressure <90 mmHg). End tidal carbon dioxide increased during anaesthesia compared to baseline values. All but one cat remained non-responsive to noxious stimuli from 3 to 120 min. Time to extubation and sternal recumbency following atipamezole were 2.9+/-1.1 and 4.7+/-1.0 min, respectively. MMK drug combination produced excellent short-term anaesthesia and analgesia with minimal cardiopulmonary depression. Anaesthesia lasted for at least 120 min in all but one cat and was effectively reversed by atipamezole. PMID:17198759

  15. Evaluation of implant sonication as a diagnostic tool in implant-associated infections.

    PubMed

    Dapunt, Ulrike; Lehner, Burkhard; Burckhardt, Irene; Zimmermann, Stefan; Hänsch, Gertrud M; Ewerbeck, Volker

    2014-01-01

    Infections of implants pose a severe problem in the field of orthopedic surgery, because they can cause bone degradation with subsequent loosening of the implant. The discrimination between septic implant loosening and aseptic loosening can be a challenge, and hence novel diagnostic methods have been introduced to improve the detection of bacteria. Because a major problem is their firm adherence to implants due to biofilm formation, sonication has been introduced, followed by identification of bacteria by culture or genetic methods. In this study, we compared the results obtained after sonication pretreatment with those of microbiological testing of tissue samples and histopathological evaluation of the same tissue. Furthermore, we related the results obtained following sonication to the clinical diagnosis of septic or aseptic implant loosening, respectively. Sonication of explanted devices also enhances the likelihood of detecting bacterial growth in patients who were considered "aseptic" based on the clinical evaluation. PMID:25199070

  16. Design Considerations of a Compounded Sterile Preparations Course.

    PubMed

    Nemec, Eric C; Petraglia, Christine; Mattison, Melissa J

    2016-02-25

    Objective. To design a comprehensive learning and assessment environment for the practical application of compounded sterile preparations using a constructivist approach. Design. Compounded Sterile Preparations Laboratory is a required 1-credit course that builds upon the themes of training aseptic technique typically used in health system settings and threads application of concepts from other courses in the curriculum. Students used critical-thinking skills to devise appropriate strategies to compound sterile preparations. Assessment. Aseptic technique skills were assessed with objective, structured, checklist-based rubrics. Most students successfully completed practical assessments using appropriate technique (mean assessment grade=83.2%). Almost all students passed the practical media fill (98%) and gloved fingertip sampling (86%) tests on the first attempt; all passed on the second attempt. Conclusion. Employing a constructivist scaffold approach to teaching proper hygiene and aseptic technique prepared students to pass media fill and gloved fingertip tests and to perform well on practical compounding assessments. PMID:26941438

  17. Outcomes of a Newer-Generation Cementless Total Knee Arthroplasty Design.

    PubMed

    Harwin, Steven F; Elmallah, Randa K; Jauregui, Julio J; Cherian, Jeffrey J; Mont, Michael A

    2015-10-01

    Newer-generation cementless total knee arthroplasties (TKAs) aim to improve durability, function, and longevity. In a large series of cementless TKAs at a mean 4-year follow-up, the authors evaluated (1) survivorship, (2) range of motion, (3) patient-reported outcomes, and (4) complications. Mean age was 66 years (range, 34-88 years) and mean body mass index was 32.5 kg/m(2) (range, 20-54 kg/m(2)). Aseptic and septic implant survivorships were 99.6% and 99.5%, respectively. Mean extension, flexion, and Knee Society scores improved significantly. There were 3 septic failures. Aseptic failures included 3 aseptic loosenings, 1 polyethylene revision, and 1 revision to a cemented patella. This study showed excellent clinical and patient-reported outcomes of cementless TKA. PMID:26488775

  18. Computer-assisted navigation in total knee arthroplasty: a review of literature.

    PubMed

    Quack, Valentin Michael; Kathrein, Susanne; Rath, Bijörn; Tingart, Markus; Lüring, Christian

    2012-08-01

    Computer-assisted navigation surgery (CAS) has been performed in total knee arthroplasty (TKA) for approximately 10 years. This technique offers experienced and inexperienced surgeons improved control and reproducible results. Currently, 30% of primary total knee replacements are performed using the CAS technique in Germany. The main problems after total knee replacement are generally aseptic loosening, instability and infection. According to various authors, the main reason for aseptic loosening is an inadequate alignment of the mechanical limb axis. Several level I and II studies have demonstrated that CAS leads to significantly less axial deviation. Nevertheless, there are critical arguments against CAS for routine use, such as longer operation times and higher costs. Additionally, there are still no long-term results available that post a definitive statement about lower revision rates, declining numbers of aseptic loosening, cost-effectiveness and clinical outcomes following CAS. PMID:22718583

  19. Design Considerations of a Compounded Sterile Preparations Course

    PubMed Central

    Petraglia, Christine; Mattison, Melissa J.

    2016-01-01

    Objective. To design a comprehensive learning and assessment environment for the practical application of compounded sterile preparations using a constructivist approach. Design. Compounded Sterile Preparations Laboratory is a required 1-credit course that builds upon the themes of training aseptic technique typically used in health system settings and threads application of concepts from other courses in the curriculum. Students used critical-thinking skills to devise appropriate strategies to compound sterile preparations. Assessment. Aseptic technique skills were assessed with objective, structured, checklist-based rubrics. Most students successfully completed practical assessments using appropriate technique (mean assessment grade=83.2%). Almost all students passed the practical media fill (98%) and gloved fingertip sampling (86%) tests on the first attempt; all passed on the second attempt. Conclusion. Employing a constructivist scaffold approach to teaching proper hygiene and aseptic technique prepared students to pass media fill and gloved fingertip tests and to perform well on practical compounding assessments. PMID:26941438

  20. [Study of circulating fatty globules by filtration of the serum in primary osteonecrosis of the femoral head].

    PubMed

    Roux, H; Serratrice, G; Vovan, L; Savidan-Imbert

    1979-12-01

    The authors carried out in a group of 21 aseptic osteonecroses of the femoral head, a study of circulating fatty globules using a filtering technique on a millipore filter. 7 of these patients showed a normal lipid count, 10 had isolated increases of the prebetalipoproteins, 2 had a type IV hyperlipemia, 1 a type III hyperlipemia, and 1 a global hypolipemia. In all cases, no fatty globules were found. Decreases in the level of triglycerides and prebetalipoproteins were noted after filtering but the differences were not significant. These observations do not add support to the theory of fatty microembolism of aseptic osteonecrosis of the femoral head. PMID:531470

  1. Neurological infections after neuraxial anesthesia.

    PubMed

    Reynolds, Felicity

    2008-03-01

    Infection is the commonest cause of serious neurologic sequelae of neuraxial anesthesia. The incidence depends on operator skill and patient population. Meningitis, a complication of dural puncture, is usually caused by viridans streptococci. The risk factors are dural puncture during labor, no mask and poor aseptic technique, vaginal infection and bacteremia. Epidural abscess is a complication of epidural catheterization, route of entry the catheter track and the organism usually the staphylococcus. Principal risk factors are prolonged catheterization, poor aseptic technique and traumatic insertion. Prevention includes wearing a mask, using a full sterile technique, avoiding prolonged catheterization and prescribing antibiotics in a high-risk situation. PMID:18319178

  2. Maggot therapy for repairing serious infective wound in a severely burned patient.

    PubMed

    Wu, Jun-Cheng; Lu, Ren-Rong; Huo, Ran; Fu, Hong-Bin

    2012-01-01

    The larvae of musca domestica were put in use to discard the dead tissue of a case of severe burn. A total of 50 000 aseptic maggots were put onto the infective wound surface, and aseptic dressings overlaid the surface. Three days later, another 20 000 maggots were put onto the wound for the second therapy. After twice maggot debridement, most necrotic muscle tissues of the wound were cleaned up, and eventually fresh granulation tissue grew and later the wound was covered and healed by 3 times of skin grafting. The result demonstrates that maggot therapy is safe and effective with no adverse complications except pain. PMID:22480679

  3. [Dermatologic aspects of SAPHO-syndrome].

    PubMed

    Károlyi, Z; Harhai, I; Erós, N

    2001-08-19

    SAPHO syndrome (synovitis, acne, pustulosis, hyperostosis, osteitis) as a new disease entity was first described in 1987. The syndrome is characterized by the presence of pustular dermatoses together with aseptic osteoarticular lesions. The bone involvement includes hyperostosis, aseptic osteomyelitis or arthritis of the anterior chest wall, sacroiliac joints or long bones. Skin diseases include acne conglobata or acne fulminans, palmoplantar pustulosis and hidradenitis suppurativa. Authors describe the dermatological relationship of SAPHO syndrome reporting their 7 cases (3 acne fulminans, 4 palmoplantar pustulosis). Authors draw attention to the isotretinoin therapy as a possible provoking factor of the articular symptoms, and they emphasize the diagnostic role of bone scintigraphy. PMID:11573450

  4. Review of early clinical results and complications associated with oblique lumbar interbody fusion (OLIF).

    PubMed

    Phan, Kevin; Maharaj, Monish; Assem, Yusuf; Mobbs, Ralph J

    2016-09-01

    Lumbar interbody fusion represents an effective surgical intervention for patients with lumbar degenerative diseases, spondylolisthesis, disc herniation, pseudoarthrosis and spinal deformities. Traditionally, conventional open anterior lumbar interbody fusion and posterior/transforaminal lumbar interbody fusion techniques have been employed with excellent results, but each with their own advantages and caveats. Most recently, the antero-oblique trajectory has been introduced, providing yet another corridor to access the lumbar spine. Termed the oblique lumbar interbody fusion, this approach accesses the spine between the anterior vessels and psoas muscles, avoiding both sets of structures to allow efficient clearance of the disc space and application of a large interbody device to afford distraction for foraminal decompression and endplate preparation for rapid and thorough fusion. This review aims to summarize the early clinical results and complications of this new technique and discusses potential future directions of research. PMID:27349468

  5. Successful management of simple fractures of the femoral neck with femoral head and neck excision arthroplasty in two free-living avian species.

    PubMed

    Burgdorf-Moisuk, Anne; Whittington, Julia K; Bennett, R Avery; McFadden, Mike; Mitchell, Mark; O'Brien, Robert

    2011-09-01

    A red-tailed hawk (Buteo jamaicensis) and a Canada goose (Branta canadensis) were evaluated for unilateral pelvic limb lameness. Physical examination findings and results of diagnostic imaging revealed femoral neck fractures in both birds. Both birds were treated with a femoral head and neck excision arthroplasty. The affected legs were not immobilized, and the birds were encouraged to use the legs immediately after surgery to encourage formation of a pseudoarthrosis. Within 2 weeks, both birds were using the affected limb well enough to be either successfully released or transferred to a wildlife rehabilitation facility. Femoral head and neck excision arthroplasty without immobilization of the limb is recommended for managing avian femoral neck fractures, especially in free-ranging species in which a rapid and complete or near complete return to function is vital for survival in the wild. PMID:22216722

  6. [Dislocation of the hip in a patient with von Recklinghausen disease].

    PubMed

    Del Bosque-Herrero, A; Ezquerra-Herrando, L; Albareda-Albareda, J

    2014-01-01

    Neurofibromatosis type 1 (NF-1) is one of the most common autosomal dominant disorders affecting humans. Patients with NF-1 may present with characteristic orthopaedic manifestations such as scoliosis, congenital pseudoarthrosis and limb hyperttrophy. Dislocation of the hip associated with NF-1 is a rare occurrence. There is a relative paucity of reported cases of pathological hip dislocation in patients with NF-1, with 13 documented cases found in the published literature. Seven dislocations occurred following trivial trauma and 6 cases were deemed atraumatic. We report a case of hip dislocation in a 26 years old male with NF-1 and scoliosis, that was treated successfully by closed reduction and skin traction. PMID:24094733

  7. [Proximal tibial valgus osteotomy semi-invasive technique. A report on 66 cases].

    PubMed

    González Maza, Carlos; Moscoso López, Luis; Magaña García, Ignacio; Mejía Vargas, Gildardo; López Segundo, José Román

    2007-01-01

    The purpose of the present study is to report sixty six high tibial lateral osteotomies (HTO) make on patients with osteoarthrosis of the medial compartment, using modified semi invasive technique. With this technique the incision is 5-6 mm, fibular head is not resect, biceps femoris tendon is not cut, no internal fixation is place; the median follow-up was 6.4 years. The status of the patient at the final follow-up was analyzed using Knee Society Score (KSS), and Visual Analogue Scale (VAS). An average of 85 points was achieved after HTO compared to 55 points preoperative and 83 points after HTO compared to 51 points preoperative, was obtained at the evaluation with KSS. The only complication was superficial infections (4%). Serious complications did not appear. There was not pseudoarthrosis. PMID:17937173

  8. [The modified Lapidus arthrodesis].

    PubMed

    Trnka, H-J; Hofstätter, S

    2005-08-01

    For the correction of hallux valgus, as one of the most common deformities of the lower limbs, a modified Lapidus arthrodesis is applied at the base of the hallux. After using a lateral tissue technique with medial capsular reefing, a general arthrodesis of the tarsometatarsal 1 joint is carried out. An unstable hallux is the indication for a classic Lapidus arthrodesis. Before determination of the indication, an exact clinical x-ray examination should be made in the dorsoplanar position as well as laterally standing. Complications associated with the Lapidus arthrodesis are postoperative metatarsalgia and pseudoarthrosis. Advantages of this technique are, for example, a high correction potential and better healing, although the surgical technique and post-operative care are more time consuming than for other methods. PMID:16028050

  9. Commonly missed orthopedic problems.

    PubMed

    Ballas, M T; Tytko, J; Mannarino, F

    1998-01-15

    When not diagnosed early and managed appropriately, common musculoskeletal injuries may result in long-term disabling conditions. Anterior cruciate ligament tears are some of the most common knee ligament injuries. Slipped capital femoral epiphysis may present with little or no hip pain, and subtle or absent physical and radiographic findings. Femoral neck stress fractures, if left untreated, may result in avascular necrosis, refractures and pseudoarthrosis. A delay in diagnosis of scaphoid fractures may cause early wrist arthrosis if nonunion results. Ulnar collateral ligament tears are a frequently overlooked injury in skiers. The diagnosis of Achilles tendon rupture is missed as often as 25 percent of the time. Posterior tibial tendon tears may result in fixed bony planus if diagnosis is delayed, necessitating hindfoot fusion rather than simple soft tissue repair. Family physicians should be familiar with the initial assessment of these conditions and, when appropriate, refer patients promptly to an orthopedic surgeon. PMID:9456991

  10. [Osteosynthesis of the clavicle. Indications, surgical technique, results].

    PubMed

    Lindenmaier, H L; Kuner, E H; Becker, B

    1991-05-01

    The osteosynthesis of the clavicle should be the exception and should only be indicated in the case of complicated fractures. The high rate of pseudoarthrosis given in medical literature, is due to errors in indication, selection of implants and in surgical techniques. Procedures like intramedullar wiring, axial screwing and single cerclage-wire suture are unsuited for osteosynthesis of the clavicle. After osteosynthesis of the clavicle we have found exceptional positive results, with respect to functional, radiological and after subjective evaluation, at a low rate of complication without any consequences occurring in the years to come. These results show, that mainly good or even excellent success can be achieved, at a limited indication, combined with careful surgery and a standardized surgery procedure of osteosynthesis of the clavicle. PMID:1874044

  11. Significance of the sexual openings and supplementary structures on the phylogeny of brachyuran crabs (Crustacea, Decapoda, Brachyura), with new nomina for higher-ranked podotreme taxa.

    PubMed

    Guinot, Danièle; Tavares, Marcos; Castro, Peter

    2013-01-01

    The patterns of complexity of the male and female sexual openings in Brachyura, which have been the source of uncertainties and conflicting opinions, are documented, together with a study of the morphologies of the coxal and sternal gonopores in both sexes, penises, spermathecae, and gonopods. The vulvae, male gonopores and penises are described among selected taxa of Eubrachyura, and their function and evolution examined in the context of a wide variety of mating behaviours. The location of female and male gonopores, the condition of the penis (coxal and sternal openings and modalities of protection), and related configurations of thoracic sternites 7 and 8, which are modified by the intercalation of a wide sternal part (thoracic sternites 7 and 8) during carcinisation, show evidence of deep homology. They represent taxonomic criteria at all ranks of the family-series and may be used to test lineages. Of particular significance are the consequences of the posterior expansion of the thoracic sternum, which influences the condition, shape, and sclerotisation of the penis, and its emergence from coxal (heterotreme) to coxo-sternal, which is actually still coxal (heterotreme), in contrast to a sternal emergence (thoracotreme). The heterotreme-thoracotreme distinction results from two different trajectories of the vas deferens and its ejaculatory duct via the P5 coxa (Heterotremata) or through the thoracic sternum (Thoracotremata). Dissections of males of several families have demonstrated that this major difference not only affects the external surface (perforation of the coxa or the sternum by the ejaculatory duct) but also the internal anatomy. There is no evidence for an ejaculatory duct passing through the articular membrane between the P5 coxa and the thoracic sternum in any Brachyura, even when the sternal male gonopore is very close to the P5 coxa. Trends towards the coxo-sternal condition are exemplified by multistate characters, varying from a shallow

  12. Clinical and Radiological Results of Microsurgical Posterior Lumbar Interbody Fusion and Decompression without Posterior Instrumentation for Lateral Recess Stenosis

    PubMed Central

    Şişman, Lokman; Türkmen, Faik; Efe, Duran; Pekince, Oğuzhan; Göncü, Recep Gani; Sever, Cem

    2015-01-01

    Study Design A single-center, retrospective patient review of clinical and radiological outcomes of microsurgical posterior lumbar interbody fusion and decompression, without posterior instrumentation, for the treatment of lateral recess stenosis. Purpose This study documented the clinical and radiological results of microsurgical posterior lumbar interbody fusion and decompression of the lateral recess using interbody cages without posterior instrumentation for the treatment of lateral recess stenosis. Overview of Literature Although microsurgery has some advantages, various complications have been reported following microsurgical decompression, including cage migration, pseudoarthrosis, neurologic deficits, and persistent pain. Methods A total of 34 patients (13 men, 21 women), with a mean age of 56.65±9.1 years (range, 40-77 years) confirmed spinal stability, and preoperative radiological findings of lateral recess stenosis, were included in the study. Interbody polyetheretherketone cages and auto grafts were used in all patients. Posterior instrumentation was not used because of limited resection of the posterior lumbar structures. Preoperative and postoperative radiographs, computed tomography scans, and magnetic resonance imaging were assessed and compared to images taken at the final follow-up. Functional recovery was also evaluated according to the Macnab criteria at the final follow-up. Results The average follow-up time was 35.05±8.65 months (range, 24-46 months). The clinical results, operative time, intraoperative blood loss, and duration of hospital stay were similar to previously published results; the fusion rate (85.2%) was decreased and the migration rate (5.8%) was increased, compared with prior reports. Conclusions Although microsurgery has some advantages, migration and pseudoarthrosis remain challenges to achieving adequate lumbar interbody fusion. PMID:26435789

  13. Effects of nano-TiO2 on the agronomically-relevant Rhizobium-legume symbiosis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The impact of nano-TiO2 on Rhizobium-legume symbiosis was studied using garden peas and the compatible bacterial partner Rhizobium leguminosarum bv. viciae 3841. Exposure to nano-TiO2 did not affect the germination of peas grown aseptically, nor did it impact the gross root structure. However, nano-...

  14. Flow Cytometric Characterization of Peyer’s Patch and Cecal Tonsil T Lymphocytes in Laying Hens Following Challenge with Salmonella enterica serovar Enteritidis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Specific-pathogen-free Single Comb White Leghorn hens, 34 weeks old, were challenged with 6.9 X 107 phage type 13 Salmonella enterica serovar Enteritidis (SE) per os. Each week, crop lavage samples were obtained from four hens, the birds were then sacrificed and their intestinal tracts aseptically e...

  15. Chemical epidural abscess: case report.

    PubMed

    Vijayan, N; Dreyfus, P M

    1971-06-01

    Spinal epidural abscess accompanies blood-borne infection, vertebral osteomyelitis, or an overlying cutaneous source of infection. This report documents the development of non-infective epidural abscess where the inflammatory response was induced by the highly irritant contents (keratin and cholesterol) of an underlying epidermoid. This was associated with aseptic meningitis. PMID:5571318

  16. Outbreak of Pseudomonas Oryzihabitans Pseudobacteremia Related to Contaminated Equipment in an Emergency Room of a Tertiary Hospital in Korea

    PubMed Central

    Woo, Kwang-Sook; Choi, Jae-Lim; Kim, Bo-Ram; Kim, Ji-Eun; Kim, Kyeong-Hee; Kim, Jeong-Man

    2014-01-01

    Pseudomonas oryzihabitans is frequently found in various sites within hospital settings, including sink drains and respiratory therapy equipment. Although it rarely causes human infections, P. oryzihabitans has recently been considered a potential nosocomial pathogen, especially in immunocompromised hosts. We report our experience of an outbreak of P. oryzihabitans pseudobacteremia, presumably due to faulty aseptic preparation of a saline gauze canister. PMID:24693469

  17. Outbreak of pseudomonas oryzihabitans pseudobacteremia related to contaminated equipment in an emergency room of a tertiary hospital in Korea.

    PubMed

    Woo, Kwang-Sook; Choi, Jae-Lim; Kim, Bo-Ram; Kim, Ji-Eun; Kim, Kyeong-Hee; Kim, Jeong-Man; Han, Jin-Yeong

    2014-03-01

    Pseudomonas oryzihabitans is frequently found in various sites within hospital settings, including sink drains and respiratory therapy equipment. Although it rarely causes human infections, P. oryzihabitans has recently been considered a potential nosocomial pathogen, especially in immunocompromised hosts. We report our experience of an outbreak of P. oryzihabitans pseudobacteremia, presumably due to faulty aseptic preparation of a saline gauze canister. PMID:24693469

  18. Medical Laboratory Technician--Microbiology (AFSC 90470).

    ERIC Educational Resources Information Center

    Thompson, Joselyn H.

    This four-volume student text is designed for use by Air Force personnel enrolled in a self-study extension course for medical laboratory technicians. Covered in the individual volumes are laboratory procedures in clinical bacteriology (the history of bacteriology; aseptic techniques and sterilization procedures; bacterial morphology and…

  19. Meningitis in a College Student in Connecticut, 2007

    ERIC Educational Resources Information Center

    Sosa, Lynn E.; Gupta, Shaili; Juthani-Mehta, Manisha; Hadler, James L.

    2009-01-01

    The authors describe a case of aseptic meningitis in a college student that was ultimately attributed to infection with lymphocytic choriomeningitis virus (LCMV). The authors also provide a review of LCMV infection, epidemiology, and public health implications. Providers should be aware of LCMV as a cause of meningitis in college students,…

  20. Fun Microbiology: Using a Plant Pathogenic Fungus To Demonstrate Koch's Postulates.

    ERIC Educational Resources Information Center

    Mitchell, James K.; Orsted, Kathy M.; Warnes, Carl E.

    1997-01-01

    Describes an experiment using a plant pathogenic fungus in which students learn to follow aseptic techniques, grow and produce spores of a fungus, use a hemacytometer for enumerating spores, prepare serial dilutions, grow and inoculate plants, isolate a pure culture using agar streak plates, and demonstrate the four steps of Koch's postulates.…

  1. Lagenidium sp. Ocular Infection Mimicking Ocular Pythiosis

    PubMed Central

    Reinprayoon, Usanee; Permpalung, Nitipong; Plongla, Rongpong; Mendoza, Leonel; Chindamporn, Ariya

    2013-01-01

    This is a report of a Lagenidium sp. in a Thai patient who was diagnosed with severe keratitis that was unresponsive to antibacterial and antifungal drugs. Examination of a corneal biopsy specimen confirmed the presence of aseptate hyphae. The internal transcribed spacer DNA sequence of the strain isolated showed 97% identity with Lagenidium giganteum and other Lagenidium species. PMID:23740721

  2. Lagenidium sp. ocular infection mimicking ocular pythiosis.

    PubMed

    Reinprayoon, Usanee; Permpalung, Nitipong; Kasetsuwan, Ngamjit; Plongla, Rongpong; Mendoza, Leonel; Chindamporn, Ariya

    2013-08-01

    This is a report of a Lagenidium sp. in a Thai patient who was diagnosed with severe keratitis that was unresponsive to antibacterial and antifungal drugs. Examination of a corneal biopsy specimen confirmed the presence of aseptate hyphae. The internal transcribed spacer DNA sequence of the strain isolated showed 97% identity with Lagenidium giganteum and other Lagenidium species. PMID:23740721

  3. Particle Disease: A Current Review of the Biological Mechanisms in Periprosthetic Osteolysis After Hip Arthroplasty

    PubMed Central

    Sukur, Erhan; Akman, Yunus Emre; Ozturkmen, Yusuf; Kucukdurmaz, Fatih

    2016-01-01

    Background: Inflammatory responses to wear debris cause osteolysis that leads to aseptic prosthesis loosening and hip arthroplasty failure. Although osteolysis is usually associated with aseptic loosening, it is rarely seen around stable implants. Aseptic implant loosening is a simple radiologic phenomenon, but a complex immunological process. Particulate debris produced by implants most commonly causes osteolysis, and this is called particle-associated periprosthetic osteolysis (PPO). Objective: The objective of this review is to outline the features of particle-associated periprosthetic osteolysis to allow the physician to recognise this condition and commence early treatment, thereby optimizing patient outcome. Methods: A thorough literature search was performed using available databases, including Pubmed, to cover important research published covering particle-associated PPO. Results: Although osteolysis causes bone resorption, clinical, animal, and in vitro studies of particle bioreactivity suggest that particle-associated PPO represents the culmination of several biological reactions of many cell types, rather than being caused solely by the osteoclasts. The biological activity is highly dependent on the characteristics and quantity of the wear particles. Conclusion: Despite advances in total hip arthroplasty (THA), particle-associated PPO and aseptic loosening continue to be major factors that affect prosthetic joint longevity. Biomarkers could be exploited as easy and objective diagnostic and prognostic targets that would enable testing for osteolysis after THA. Further research is needed to identify new biomarkers in PPO. A comprehensive understanding of the underlying biological mechanisms is crucial for developing new therapeutic interventions to reverse or suppress biological responses to wear particles. PMID:27499822

  4. Humeral windows in revision total elbow arthroplasty.

    PubMed

    Peach, Chris A; Salama, Amir; Stanley, David

    2016-04-01

    The use of cortical windows for revision elbow arthroplasty has not previously been widely reported. Their use aids safe revision of a well fixed humeral prosthesis and can be used in the setting of dislocation, periprosthetic fracture or aseptic loosening of the ulnar component. We describe our technique and results of cortical windows in the distal humerus for revision elbow arthroplasty surgery. PMID:27583011

  5. The prevalence of Salmonella enterica serovars Heidelberg and Kentucky in the scalder water of a commercial poultry processing plant in the southeastern United States.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The purpose of this study was to assess the presence of Salmonella enterica present in the water of scalder and chiller tanks from a commercial chicken processing plant in the southeaster United States. Three liters of scald and chill water were aseptically sampled three times daily for three consec...

  6. Dielectric properties of sweetpotato purees at 915 MHz as affected by temperature and chemical composition

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A process for rapid sterilization and aseptic packaging of sweetpotato puree using a continuous flow microwave system operating at 915 MHz has been successfully developed. This development offers an opportunity for converting sweetpotato roots into a functional ingredient for the food industry....

  7. Infection control practices for dental radiography.

    PubMed

    Palenik, Charles John

    2004-06-01

    Infection control for dental radiography employs the same materials, processes, and techniques used in the operatory, yet unless proper procedures are established and followed, there is a definite potential for cross-contamination to clinical area surfaces and DHCP. In general, the aseptic practices used are relatively simple and inexpensive, yet they require complete application in every situation. PMID:15218669

  8. Application of Tissue Culture in Ornamental Breeding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant tissue culture can be broadly defined as the culture of plant cells, tissues, or organs under sterile or aseptic conditions. To most growers, micropropagation is the term that perhaps best describes plant tissue culture. However, plant tissue culture plays an important role through its many ap...

  9. 21 CFR 522.2424 - Sodium thiamylal for injection.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... § 522.2424 Sodium thiamylal for injection. (a) Specifications. The drug is a sterile dry powder. It is reconstituted aseptically with sterile distilled water, water for injection, or sodium chloride injection, to a... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Sodium thiamylal for injection. 522.2424...

  10. 21 CFR 522.2424 - Sodium thiamylal for injection.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... § 522.2424 Sodium thiamylal for injection. (a) Specifications. The drug is a sterile dry powder. It is reconstituted aseptically with sterile distilled water, water for injection, or sodium chloride injection, to a... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Sodium thiamylal for injection. 522.2424...

  11. 21 CFR 522.2424 - Sodium thiamylal for injection.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... § 522.2424 Sodium thiamylal for injection. (a) Specifications. The drug is a sterile dry powder. It is reconstituted aseptically with sterile distilled water, water for injection, or sodium chloride injection, to a... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Sodium thiamylal for injection. 522.2424...

  12. 21 CFR 522.2424 - Sodium thiamylal for injection.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... § 522.2424 Sodium thiamylal for injection. (a) Specifications. The drug is a sterile dry powder. It is reconstituted aseptically with sterile distilled water, water for injection, or sodium chloride injection, to a... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Sodium thiamylal for injection. 522.2424...

  13. DISTRIBUTION OF PROTOZOA IN SUBSURFACE SEDIMENTS OF A PRISTINE GROUNDWATER STUDY SITE IN OKLAHOMA (JOURNAL VERSION)

    EPA Science Inventory

    Most-probable-number counting methods were applied to determine the distribution of protozoa in a depth profile at a groundwater microbiology study site near Lula, Oklahoma in January and June, 1985. Aseptic procedures were used to ensure minimal airborne contamination samples. N...

  14. AEROBIC SOIL MICROCOSMS FOR LONG-TERM BIODEGRADATION OF HYDROCARBON VAPORS

    EPA Science Inventory

    The aims of this research project included the development of laboratory protocols for the preparation of aerobic soil microcosms using aseptic field soil samples, and for the gas chromatographic analysis of hydrocarbon vapor biodegradation based on vapor samples obtained from th...

  15. Microbiological differences between laying hen strains housed in various production systems.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sister flocks of three strains of laying hens were housed in conventional cage, free range, and cage free production systems. All flocks were located on a single, commercial-style research facility and provided the same dietary and lighting regimens. Once a season, a sample of shell eggs was asept...

  16. Surgical Education: Attitudes toward Animal Use in Teaching Surgery at Louisiana State University.

    ERIC Educational Resources Information Center

    Hedlund, Cheryl S.; Hosgood, Giselle; Naugler, Sasha

    2002-01-01

    Surveyed students and faculty at Louisiana State University about the use of animals for teaching surgery. Found that they favored the practice, finding it helpful for learning aseptic technique and suturing skills but less so for learning tissue handling, dissection, hemostasis, or anesthesia. (EV)

  17. Japanese encephalitis virus in meningitis patients, Japan.

    PubMed

    Kuwayama, Masaru; Ito, Mikako; Takao, Shinichi; Shimazu, Yukie; Fukuda, Shinji; Miyazaki, Kazuo; Kurane, Ichiro; Takasaki, Tomohiko

    2005-03-01

    Cerebrospinal fluid specimens from 57 patients diagnosed with meningitis were tested for Japanese encephalitis virus. Total RNA was extracted from the specimens and amplified. Two products had highest homology with Nakayama strain and 2 with Ishikawa strain. Results suggest that Japanese encephalitis virus causes some aseptic meningitis in Japan. PMID:15757569

  18. Cloning: plants – micropropagation/tissue culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clonal micropropagation is the multiplication of the buds and shoots that occur in leaf axils on a defined nutrient medium in an aseptic in vitro environment. The resulting shoots are either subdivided for continued multiplication or rooted and acclimatized to the greenhouse or field. Micropropagati...

  19. Progress in cryopreservation of dormant winter buds of selected tree species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In cryopreservation of germplasm, using dormant winter buds (DB) as source plant materials is economically favorable over tissue culture options (TC). Processing DB does not require aseptic conditions and involved cryopreservation procedures. Although, the DB cryopreservation method has been known f...

  20. Comparison between Constrained and Semiconstrained Knee Allograft-Prosthesis Composite Reconstructions

    PubMed Central

    Farfalli, German L.; Aponte-Tinao, Luis A.; Ayerza, Miguel A.; Muscolo, D. Luis; Boland, Patrick J.; Morris, Carol D.; Athanasian, Edward A.; Healey, John H.

    2013-01-01

    Allograft-prosthesis composite (APC) can restore capsular and ligamentous tissues of the knee sacrificed in a tumor extirpation. We asked if performing APC would restore knee stability and allow the use of nonconstrained arthroplasty while preventing aseptic loosening. We retrospectively compared 50 knee APCs performed with non-constrained revision knee prosthesis (Group 1) with 36 matched APCs performed with a constrained prosthesis (Group 2). In Group 1, the survival rate was 69% at five and 62% at ten years. Sixteen reconstructions were removed due to complications: eight deep infections, three fractures, two instabilities, one aseptic loosening, one local recurrence, and one nonunion. In Group 2, the survival rate was 80% at five and 53% at ten years. Nine reconstructions were removed: 3 due to deep infections, 3 to fractures, and 3 to aseptic loosening. In both groups, we observed more allograft fractures when the prosthetic stem does not bypass the host-donor osteotomy (P > 0.05). Both groups had mainly good or excellent MSTS functional results. Survival rate and functional scores and aseptic loosening were similar in both groups. A rotating-hinge APC is recommended when host-donor soft tissue reconstruction fails to restore knee instability. The use of a short prosthetic stem has a statistical relationship with APC fractures. PMID:23476114

  1. 9 CFR 147.11 - Laboratory procedure recommended for the bacteriological examination of salmonella.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... lesions are seen. (3) From each bird, aseptically collect 10 to 15 grams of each organ or site listed in... or sites listed in paragraph (a)(2) of this section from the same bird may be pooled into one bag. Do not pool samples from more than one bird. Add sufficient tetrathionate enrichment broth to give a...

  2. 9 CFR 147.11 - Laboratory procedure recommended for the bacteriological examination of salmonella.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... lesions are seen. (3) From each bird, aseptically collect 10 to 15 grams of each organ or site listed in... or sites listed in paragraph (a)(2) of this section from the same bird may be pooled into one bag. Do not pool samples from more than one bird. Add sufficient tetrathionate enrichment broth to give a...

  3. Molecular Phylogeny of the flaA Short Variable Region and invasiveness among Campylobacter spp. isolated from the blood and ceca of commercial broilers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Campylobacter spp. have been recovered from several internal tissues of broilers and broiler breeders including aseptic recovery from the circulating blood of commercial broilers. The objectives of this study were to evaluate the genetic relatedness of the Campylobacter isolates obtained from the c...

  4. 40 CFR Table 2 to Subpart Kkkk of... - Emission Limits for Existing Affected Sources

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... coating a. Two-piece beverage cans—all coatingsb. Two-piece food cans—all coatings c. One-piece aerosol... nonfood cans 1.18 (9.84). e. Side seam stripes on aerosol cans 1.46 (12.14). 4. End coating a. Aseptic...

  5. Chemical epidural abscess: case report

    PubMed Central

    Vijayan, N.; Dreyfus, P. M.

    1971-01-01

    Spinal epidural abscess accompanies blood-borne infection, vertebral osteomyelitis, or an overlying cutaneous source of infection. This report documents the development of non-infective epidural abscess where the inflammatory response was induced by the highly irritant contents (keratin and cholesterol) of an underlying epidermoid. This was associated with aseptic meningitis. Images PMID:5571318

  6. CYTOGENETIC STUDIES OF ETHYL ACRYLATE USING C57BL/6 MICE

    EPA Science Inventory

    The clastogenicity of ethyl acrylate (EA) was examined in vivo by injecting i.p. 5 male C57BL/6 mice per dose group with either 125, 250, 500, 1000 mg/kg EA dissolved in saline. wenty-four hours after injection, the animals were anesthetized, the spleens aseptically removed, and ...

  7. [A case of Sinding-Larsen-Johansson and Osgood-Schlatter disease in both knees].

    PubMed

    Hagner, W; Sosnowski, S; Kaziński, W; Frankowski, S

    1993-01-01

    A case of simultaneous occurrence of two types of aseptic bone necrosis in both knees is presented. The knees of 12 years old hurdle runner became markedly painful after 5 months of competing. The pain has disappeared after 3 months of rest and physical therapy. Radiographic assessment carried out 2 years later demonstrated full remodelling of bony tissue. PMID:7671663

  8. Medical Asepsis. Kit No. 302. Instructor's Manual [and] Student Learning Activity Guide. Health Occupations.

    ERIC Educational Resources Information Center

    Edwards, Gloria

    This instructor's manual and student learning guide comprise a module on medical asepsis for a secondary-level health occupations program. The six activities in the module cover medical asepsis terms; ways organisms spread; types of medical asepsis; aseptic equipment care; proper handwashing; and procedures for using masks, gloves, and gowns.…

  9. Campylobacter can remain in various organs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Day old broiler chicks were obtained from a commercial hatchery and inoculated either orally or intracloacally with a characterized strain of Campylobacter jejuni. After 1 hr, 1day and 1wk post inoculation, the thymus, spleen, liver/gallbladder, bursa of Fabricius and ceca were aseptically removed ...

  10. Isolation of Campylobacter from circulating blood of commercial broilers via vena-puncture of exposed/unexposed brachial veins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Campylobacter spp. have recently been recovered from several lymphoid tissues of commercial poultry. The objective of this study was to determine whether naturally occurring Campylobacter spp. could be recovered from the circulating blood of market age commercial broilers utilizing aseptic techniqu...

  11. 21 CFR 526.464a - Cloxacillin benzathine.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... Staphylococcus aureus and Streptococcus agalactiae including penicillin resistant strains in dairy cows during the dry period. (3) Limitations. For use in dry cows only. Not to be used within 30 days of calving...) of this chapter for use in dairy cows. (1) Amount. Administer aseptically into each...

  12. Microflora in soils of desert regions

    NASA Technical Reports Server (NTRS)

    Cameron, R. E.

    1970-01-01

    Desert soil samples, collected using aseptic techniques, are low in organic matter and cation exchange capacity. Aerobic and microaerophilic bacteria are most abundant, next are algae and molds. Chemical and physical properties are determined by standard procedures, including the Kjeldahl method and the use of Munsell soil color charts.

  13. COMPARISON OF SAMPLING METHODOLOGY FOR THE DETECTION OF SALMONELLA ON WHOLE BROILER CARCASSES PURCHASED FROM RETAIL OUTLETS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An experiment was conducted to compare two Salmonella recovery methods from the same carcass. One hundred fresh, whole broiler chickens were purchased from retail outlets over a 5-week period (20 carcasses per week). After carcasses were aseptically removed from the packages and giblets removed, th...

  14. 77 FR 2481 - United States Standards for Condition of Food Containers

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-18

    ... standards were previously amended in May 1983, innovations in packaging technologies have provided an... destroyed as a result of packaging problems. These standards were developed for use by Government agencies... defects to reflect new packaging technologies such as aseptic packaging, metal cans with easy open...

  15. MICROBIAL ACTIVITY IN SUBSURFACE SAMPLES BEFORE AND DURING NITRATE-ENHANCED BIOREMEDIATION

    EPA Science Inventory

    A study was conducted to determine the microbial activity of a site contaminated with JP-4 jet fuel, before and during nitrate-enhanced bioremediation. amples at three depths from six different locations were collected aseptically under anaerobic conditions before and during trea...

  16. Similar effect of stem geometry on radiological changes with 2 types of cemented straight stem

    PubMed Central

    Clauss, Martin; Bolliger, Lilianna; Brandenberger, Daniel; Ochsner, Peter E; Ilchmann, Thomas

    2016-01-01

    Background and purpose — There are 2 basic principles in cemented stem fixation: shape-closed and force-closed. We investigated 2 shape-closed straight stems, the Müller (MSS) and the Virtec (VSS), which differ only in geometrical cross section, to determine whether the difference in stem shape would affect the radiological results or long-term survival. Patients and methods — We included 711 hips (in 646 patients) that were operated on between July 1996 and July 2003. Patients randomly received either an MSS (n = 356) or a VSS (n = 355) and were followed prospectively. Radiographs taken at a follow-up of > 10 years were analyzed for osteolysis. Kaplan-Meier (KM) survival analysis was performed using various endpoints. We also performed Cox regression analysis to identify risk factors for aseptic loosening and osteolysis of the stem. Results — After 10 years, KM survival with “revision of any component for any reason” was 92% (95% CI: 88–95) for the MSS and 95% (CI: 92–97) for the VSS (p = 0.1). With “revision for aseptic loosening of the stem” as the endpoint, KM survival was 96% (CI: 9–98) for the MSS and 98% (CI: 97–100) for the VSS (p = 0.2). Cox regression showed that none of the risk factors analyzed were independent regarding aseptic loosening of the stem or regarding osteolysis. Interpretation — The MSS and the VSS showed excellent survival for aseptic loosening after 10 years. For the 2 different stem designs, we did not find any independent risk factors for aseptic loosening or development of osteolysis. PMID:26471977

  17. Pressure load on specific body areas of gestating sows lying on rubber mats with different softness.

    PubMed

    Schubbert, A; Hartung, E; Schrader, L

    2014-08-01

    Rubber mats offer a possibility to increase lying comfort for sows with positive effects on sow lying behavior and health. However, until now, no information has been reported about the relationship between the softness of rubber mats and the pressure load on certain body areas of sows. We used a total of 68 (40 multiparous, 28 primiparous) German Landrace × German Landrace sows with a BW within the range of 90 to 330 kg (divided in 3 weight classes) to measure peak force and distribution of pressure during lying in the sternal and half recumbent position. Measures were done in an experimental pen that was equipped with a pressure sensor map system (5400 NTL; Tekscan Inc., Boston, MA). Three rubber mats differing in softness (penetration depth: hard mat, 4.0 mm [HM]; soft mat, 14.6 mm [SM]; very soft mat, 43.0 mm [VSM]) were tested and compared to concrete floor (CF) as a reference. Pressure load was analyzed in the sternal position for the sternum, belly, and ham body regions and also in the half recumbent position for the shoulder. For each lying position we determined the body region with the highest pressure load and analyzed the peak force (PF) and the contact area (CA) using a mixed model ANOVA (MIXED procedure of SAS Enterprise, version 4.3., SAS Inst. Inc., Cary, NC) with floor type, weight class of sows, and their interaction as fixed factors. Overall, the highest values for PF in the sternal position were found on the sternum (median: 1.62 N/cm(2)) and in the half recumbent position on the shoulder (median: 2.72 N/cm(2)). In the sternal position PF on the sternum was lower on VSM compared to CF (P = 0.001). In the half-recumbent position PF on the shoulder was lower on VSM compared to CF (P = 0.013) and compared to HM (P = 0.011). The weight of the sows affected PF on the sternum in the sternal position, with lower values in weight class 1 compared to weight class 2 (P = 0.001) and weight class 3 (P = 0.002). Contact area under the sternum was larger on

  18. Effects on drainage of the mediastinum and pleura during negative pressure wound therapy when using a rigid barrier to prevent heart rupture.

    PubMed

    Lindstedt, Sandra; Malmsjö, Malin; Ingemansson, Richard

    2011-10-01

    Right ventricular heart rupture is a devastating complication associated with negative pressure wound therapy (NPWT) following cardiac surgery. The use of a rigid disc has been suggested to offer protection against this lethal complication by preventing the heart from being drawn up towards, and damaged by, the sharp sternum edges. The aim of the present study was to compare the wound fluid evacuation from the pericardium and the left pleura when using NPWT with such a disc between the sternal edges and the heart, and when using conventional NPWT. Six pigs underwent median sternotomy followed by NPWT at -120 mmHg, using foam, with or without a rigid plastic disc between the heart and the sternal edges. A 250 ml saline was infused into the pericardium, and the time required for fluid evacuation was measured. A 500 ml saline was infused into the left pleura and the time for fluid evacuation measured. The pericardium was effectively drained of 250 ml fluid in both cases [conventional NPWT: 24 ± 0·7 seconds, NPWT with the disc: 25 ± 1·1 seconds (n.s.)]. The left pleura was effectively drained when using NPWT with the disc, but was not drained at all when using conventional NPWT. The left pleura could be effectively drained of 500 ml fluid when a rigid perforated plastic disc was inserted between the sternal edges and the heart during NPWT. Significantly less drainage of the left pleura was possible when using conventional NPWT without the disc. The pericardium was equally good drained using NPWT with or without the disc. PMID:21692991

  19. Pheromones and exocrine glands in Isoptera.

    PubMed

    Costa-Leonardo, Ana Maria; Haifig, Ives

    2010-01-01

    Termites are eusocial insects that have a peculiar and intriguing system of communication using pheromones. The termite pheromones are composed of a blend of chemical substances and they coordinate different social interactions or activities, including foraging, building, mating, defense, and nestmate recognition. Some of these sociochemicals are volatile, spreading in the air, and others are contact pheromones, which are transmitted by trophallaxis and grooming. Among the termite semiochemicals, the most known are alarm, trail, sex pheromones, and hydrocarbons responsible for the recognition of nestmates. The sources of the pheromones are exocrine glands located all over the termite body. The principal exocrine structures considered pheromone-producing glands in Isoptera are the frontal, mandibular, salivary or labial, sternal, and tergal glands. The frontal gland is the source of alarm pheromone and defensive chemicals, but the mandibular secretions have been little studied and their function is not well established in Isoptera. The secretion of salivary glands involves numerous chemical compounds, some of them without pheromonal function. The worker saliva contains a phagostimulating pheromone and probably a building pheromone, while the salivary reservoir of some soldiers contains defensive chemicals. The sternal gland is the only source of trail-following pheromone, whereas sex pheromones are secreted by two glandular sources, the sternal and tergal glands. To date, the termite semiochemicals have indicated that few molecules are involved in their chemical communication, that is, the same compound may be secreted by different glands, different castes and species, and for different functions, depending on the concentration. In addition to the pheromonal parsimony, recent studies also indicate the occurrence of a synergic effect among the compounds involved in the chemical communication of Isoptera. PMID:20831960

  20. Evaluation the consistency of location of moist desquamation and skin high dose area for breast cancer patients receiving adjuvant radiotherapy after breast conservative surgery

    PubMed Central

    2013-01-01

    Background To evaluate whether the location of moist desquamation matches high dose area for breast cancer patients receiving adjuvant radiotherapy (RT) after breast conservative surgery. Methods One hundred and nine breast cancer patients were enrolled to this study. Their highest skin dose area (the hot spot) was estimated from the treatment planning. We divided the irradiated field into breast; sternal/parasternal; axillary; and inframammary fold areas. The location for moist desquamation was recorded to see if it matches the hot spot. We also analyzed other possible risk factors which may be related to the moist desquamation. Results Forty-eight patients with 65 locations developed moist desquamation during the RT course. Patients with larger breast sizes and easy to sweat are two independent risk factors for moist desquamation. The distribution of moist desquamation occurred most in the axillary area. All nine patients with the hot spots located at the axillary area developed moist desquamation at the axillary area, and six out of seven patients with the hot spots located at the inframammary fold developed moist desquamation there. The majority of patients with moist desquamation over the breast or sternal/parasternal areas had the hot spots located at these areas. Conclusions For a patient with moist desquamation, if a hot spot is located at the axillary or inframammary fold areas, it is very likely to have moist desquamation occur there. On the other hand, if moist desquamation occurs over the breast or sternal/parasternal areas, we can highly expect these two areas are also the hot spot locations. PMID:23497574

  1. Double vs single internal thoracic artery harvesting in diabetic patients: role in perioperative infection rate

    PubMed Central

    Agrifoglio, Marco; Trezzi, Matteo; Barili, Fabio; Dainese, Luca; Cheema, Faisal H; Topkara, Veli K; Ghislandi, Chiara; Parolari, Alessandro; Polvani, Gianluca; Alamanni, Francesco; Biglioli, Paolo

    2008-01-01

    Background The aim of this prospective study is to evaluate the role in the onset of surgical site infections of bilateral internal thoracic arteries harvesting in patients with decompensated preoperative glycemia. Methods 81 consecutive patients with uncontrolled diabetes mellitus underwent elective CABG harvesting single or double internal thoracic arteries. Single left ITA was harvested in 41 patients (Group 1, 50.6%), BITAs were harvested in 40 (Group 2, 49.4%). The major clinical end points analyzed in this study were infection rate, type of infection, duration of infection, infection relapse rate and total hospital length of stay. Results Five patients developed sternal SSI in the perioperative period, 2 in group 1 and 3 in group 2 without significant difference. All sternal SSIs were superficial with no sternal dehiscence. The development of infection from the time of surgery took 18.5 ± 2.1 and 7.3 ± 3.0 days for Groups 1 and 2 respectively. The infections were treated with wound irrigation and debridement, and with VAC therapy as well as with antibiotics. The VAC system was removed after a mean of 12.8 ± 5.1 days, when sterilization was achieved. The overall survival estimate at 1 year was 98.7%. Only BMI was a significant predictor of SSI using multivariate stepwise logistic regression analysis (Odds Ratio: 1.34; 95%Conficdence Interval: 1.02–1.83; p value: 0.04). In the model, the use of BITA was not an independent predictor of SSI. Conclusion CABG with bilateral pedicled ITAs grafting could be performed safely even in diabetics with poor preoperative glycaemic control. PMID:18573201

  2. The influence of load carrying on the energetics and kinematics of terrestrial locomotion in a diving bird

    PubMed Central

    Tickle, Peter G.; Lean, Samantha C.; Rose, Kayleigh A. R.; Wadugodapitiya, Avanti P.; Codd, Jonathan R.

    2013-01-01

    Summary The application of artificial loads to mammals and birds has been used to provide insight into the mechanics and energetic cost of terrestrial locomotion. However, only two species of bird have previously been used in loading experiments, the cursorial guinea fowl (Numida meleagris) and the locomotor-generalist barnacle goose (Branta leucopsis). Here, using respirometry and treadmill locomotion, we investigate the energetic cost of carrying trunk loads in a diving bird, the tufted duck (Aythya fuligula). Attachment of back loads equivalent to 10% and 20% of body mass increased the metabolic rate during locomotion (7.94% and 15.92%, respectively) while sternal loads of 5% and 10% had a greater proportional effect than the back loads (metabolic rate increased by 7.19% and 13.99%, respectively). No effect on locomotor kinematics was detected during any load carrying experiments. These results concur with previous reports of load carrying economy in birds, in that there is a less than proportional relationship between increasing load and metabolic rate (found previously in guinea fowl), while application of sternal loads causes an approximate doubling of metabolic rate compared to back loads (reported in an earlier study of barnacle geese). The increase in cost when carrying sternal loads may result from having to move this extra mass dorso-ventrally during respiration. Disparity in load carrying economy between species may arise from anatomical and physiological adaptations to different forms of locomotion, such as the varying uncinate process morphology and hindlimb tendon development in goose, guinea fowl and duck. PMID:24244861

  3. Sex-pairing pheromone of Ancistrotermes dimorphus (Isoptera: Macrotermitinae).

    PubMed

    Wen, Ping; Mo, Jianchu; Lu, Chunwen; Tan, Ken; Šobotník, Jan; Sillam-Dussès, David

    2015-12-01

    Ancistrotermes dimorphus is a common Macrotermitinae representative, facultative inquiline by its life-style, occurring in South-East China. Sex pheromone is used for couple formation and maintenance, and it is produced by and released from the female sternal gland and is highly attractive to males. Based on our combined behavioral, chemical and electrophysiological analyses, we identified (3Z,6Z)-dodeca-3,6-dien-1-ol as the female sex pheromone of A. dimorphus as it evoked the tandem behavior at short distance, and the active quantities ranged from 0.01ng to 10ng. Interestingly, GC-MS analyses of SPME extracts showed another compound specific to the female sternal gland, (3Z)-dodec-3-en-1-ol, which showed a clear GC-EAD response. However, this compound has no behavioral function in natural concentrations (0.1ng), while higher amounts (1ng) inhibit the attraction achieved by (3Z,6Z)-dodeca-3,6-dien-1-ol. The function of (3Z)-dodec-3-en-1-ol is not fully understood, but might be linked to recognition from sympatric species using the same major compound, enhancing the long-distance attraction, or informing about presence of other colonies using the compound as a trail-following pheromone. The sternal gland secretion of Ancistrotermes females contains additional candidate compounds, namely (3E,6Z)-dodeca-3,6-dien-1-ol and (6Z)-dodec-6-en-1-ol, which are not perceived by males' antennae in biologically relevant amounts. PMID:26549129

  4. Adenoid cystic carcinoma of the submandibular gland with rare metastasis to the sternum in a 52-year-old male

    PubMed Central

    Alshammari, Abdullah; Eldeib, Omar Jamal; Eldeib, Ahmed Jamal; Saleh, Waleed

    2016-01-01

    Adenoid cystic carcinoma (ACC) is a rare tumor, described as being one of the most biologically destructive tumors of the head and neck. It is the most common malignancy that affects the minor salivary glands. Lung and bones are the most common regions of ACC distant metastasis. To the best of our knowledge, herein, we report the first ever case of latent isolated sternal metastasis from ACC in a 52-year-old gentleman, who was diagnosed to have ACC of the submandibular gland, excised 10 years ago. PMID:26933463

  5. Parathelphusa pardus, a new species of lowland freshwater crab from swamps in central Sumatra, Indonesia (Crustacea: Brachyura: Gecarcinucidae).

    PubMed

    Ng, Peter K L; Riady, Rikhi; Windarti, Windarti

    2016-01-01

    A new species of gecarcinucid freshwater crab of the genus Parathelphusa H. Milne Edwards, 1853, is described from freshwater swamp habitats in Pekanbaru, Riau Province, in central-eastern Sumatra, Indonesia. Parathelphusa pardus sp. nov., has a very distinctive colour pattern, and in this respect, resembles P. maindroni (Rathbun, 1902) from Sumatra and Peninsular Malaysia; P. batamensis Ng, 1992, from Batam Island, Indonesia; P. reticulata Ng, 1990, from Singapore; and P. oxygona Nobili, 1901, from western Sarawak. It can be distinguished from these species and congeners by a suite of carapace, ambulatory leg, thoracic sternal and most importantly, male first gonopod characters. PMID:27394277

  6. Negative pressure wound therapy.

    PubMed

    Thompson, James T; Marks, Malcolm W

    2007-10-01

    Negative pressure wound therapy has become an increasingly important part of wound management. Over the last decade, numerous uses for this method of wound management have been reported, ranging from acute and chronic wounds, to closure of open sternal and abdominal wounds, to assistance with skin grafts. The biophysics behind the success of this treatment largely have focused on increased wound blood flow, increased granulation tissue formation, decreased bacterial counts, and stimulation of wound healing pathways through shear stress mechanisms. The overall success of negative pressure wound therapy has led to a multitude of clinical applications, which are discussed in this article. PMID:17967622

  7. Clinical experience with Leptospermum honey use for treatment of hard to heal neonatal wounds: case series.

    PubMed

    Boyar, V; Handa, D; Clemens, K; Shimborske, D

    2014-02-01

    Preterm, critically ill neonates represent a challenge in wound healing. Many factors predispose infants to skin injuries, including decreased epidermal-dermal cohesion, deficient stratum corneum, relatively alkaline pH of skin surface, impaired nutrition and presence of multiple devices on the skin. We present a case series describing the use of medical-grade honey-Leptospermum honey (Medihoney), for successful treatment of slowly healing neonatal wounds, specifically stage 3 pressure ulcer, dehiscent and infected sternal wound, and full-thickness wound from an extravasation injury. PMID:24476663

  8. Avian Soft Tissue Surgery.

    PubMed

    Guzman, David Sanchez-Migallon

    2016-01-01

    Basic surgical instrumentation for avian soft tissue surgery includes soft tissue retractors, microsurgical instrumentation, surgical loupes, and head-mounted lights. Hemostasis is fundamental during the surgical procedures. The indications, approach, and complications associated with soft tissue surgeries of the integumentary (digit constriction repair, feather cyst excision, cranial wound repair, sternal wound repair, uropygial gland excision), gastrointestinal (ingluviotomy, crop biopsy, crop burn repair, celiotomy, coelomic hernia and pseudohernia repair, proventriculotomy, ventriculotomy, enterotomy, intestinal resection and anastomosis, cloacoplasty, cloacopexy), respiratory (rhinolith removal, sinusotomy, tracheotomy, tracheal resection and anastomosis, tracheostomy, pneumonectomy) and reproductive (ovocentesis, ovariectomy, salpingohysterectomy, cesarean section, orchidectomy, vasectomy, phallectomy) systems are reviewed. PMID:26611927

  9. Management of severe asymmetric pectus excavatum complicating aortic repair in a patient with Marfan's syndrome.

    PubMed

    Yeung, Jonathan C; Marcuzzi, Danny; Peterson, Mark D; Ko, Michael A

    2016-05-01

    We describe the case of a 28-year old man with Marfan's syndrome and severe pectus excavatum who required an aortic root replacement for an ascending aortic aneurysm. There was a near-vertical angulation of the sternum that presented challenges with opening and exposure of the heart during aortic surgery. Furthermore, removal of the sternal retractor after aortic repair resulted in sudden loss of cardiac output. A Ravitch procedure was then performed to successfully close the chest without further cardiovascular compromise. We propose that patients with a severe pectus excavatum and mediastinal displacement seen on preoperative CT scanning should be considered for simultaneous, elective repair. PMID:26874148

  10. Minimally Invasive Atrial Fibrillation Surgery: Hybrid Approach

    PubMed Central

    Beller, Jared P.; Downs, Emily A.; Ailawadi, Gorav

    2016-01-01

    Atrial fibrillation is a challenging pathologic process. There continues to be a great need for the development of a reproducible, durable cure when medical management has failed. An effective, minimally invasive, sternal-sparing intervention without the need for cardiopulmonary bypass is a promising treatment approach. In this article, we describe a hybrid technique being refined at our center that combines a thoracoscopic epicardial surgical approach with an endocardial catheter-based procedure. We also discuss our results and review the literature describing this unique treatment approach. PMID:27127561

  11. Ambaeolothrips: a new genus of Neotropical Aeolothripidae (Thysanoptera), with observations on the type-species from mango trees in Mexico.

    PubMed

    Mound, Laurence; Cavalleri, Adriano; O'donnell, Cheryle; Infante, Francisco; Ortiz, Antonio; Goldarazena, Arturo

    2016-01-01

    Ambaeolothrips gen. n. is diagnosed for three Neotropical species: the type species romanruizi Ruiz-De la Cruz et al. comb. n. from Mexico, microstriatus Hood comb. n. from Panama, and pampeanus sp. n. from southern Brazil. Variation is discussed among character states that are used in the generic classification of the family Aeolothripidae, including segmentation of the antennae and maxillary palps, sculpture of the metanotum and presence of sternal discal setae. New field observations on the biology of romanruizi indicate that this species is phytophagous in flowers and on leaves, with no evidence of predation on the larvae of other thrips. PMID:27395682

  12. Closure of esophagotracheal fistula after esophagectomy for esophageal cancer.

    PubMed

    Arimoto, Junji; Hatada, Atsutoshi; Kawago, Mitsumasa; Nishimura, Osamu; Maebeya, Shinji; Okamura, Yoshitaka

    2015-11-01

    Fistula between the trachea and esophagogastric anastomosis after esophagectomy is rare. We successfully treated a 75-year-old woman with such a lesion by single-stage repair. The patient had undergone radical esophagectomy 20 years ago, and repeatedly developed aspiration pneumonia for recent 5 years. Radiological and endoscopic examinations demonstrated the fistula between the trachea at the level of sternal notch and esophagogastric anastomosis. The fistula was separated and the defects on both sides were closed. A sternocleidomastoid muscle flap was inserted between the two structures. The postoperative course was uneventful. PMID:26189183

  13. Avoidance of a potential tracheoinnominate fistula by innominate artery re-implantation in a four year old girl with tracheostomy dependence and Pfeiffer syndrome.

    PubMed

    Olson, Michael D; Boesch, R Paul; Duncan, Audra A; Cofer, Shelagh A

    2016-02-01

    A 4 year old tracheostomy dependent girl with Pfeiffer syndrome was noted on bronchoscopy to have a pulsatile tracheostomal mass. CT chest angiography was consistent with the innominate artery crossing anterior to the trachea and superior to the sternal notch. The patient underwent reimplantation of the innominate artery via a median sternotomy approach. Tracheoinnominate fistula is a potentially devastating complication of tracheostomy. We report discovery of a near tracheoinnominate fistula in order to highlight the importance of regular interval surveillance endoscopy in tracheostomy dependent children and to discuss a preventative surgical intervention employed in prevention of this potentially devastating complication. PMID:26810298

  14. [Hybrid revascularization: a combined approach to multivessel coronary artery lesions].

    PubMed

    Repossini, A; Roĭtberg, G E; Kotelnikov, I; Sokolov, D V

    2013-01-01

    Analysis of effectiveness and feasibility of hybrid approach to multivessel coronary artery disease and problems of interaction between cardiac surgeons and interventional cardiologists in deciding on the choice of revascularization method is performed in the article. Hybrid approach to multivessel disease defined as sternal sparing, off-pump, minimally invasive, hand sewn left internal mammary - left anterior descending (LAD) arteries by-pass graft with percutaneous coronary revascularization of non-LAD lesions to achieve functionally complete revascularization is described in detail. Data of multicenter studies and clinical recommendations for myocardial revascularization is discussed. PMID:24090389

  15. Radical treatment of recurrent cytosarcoma phylloides.

    PubMed

    Faraci, R P; Schour, L

    1974-11-01

    Malignant cystosarcoma phylloides is a rare breast cancer which frequently recurs locally before metastasizing. Local recurrence of cystosarcoma phylloides is unlike adenocarcinoma of the breast since it does not necessarily indicate systemic metastases; and, therefore, aggressive surgery can cure a number of patients with locally recurrent tumor. The present report is an extreme example of a patient with locally recurrent malignant cystosarcoma phylloides, and it illustrates the value of radical surgery in controlling this disease which had previously recurred 21 times. Fifteen months following sternal resection, the patient enjoys her longest tumor-free interval in 16 years. PMID:4370747

  16. New species of Dinychus Kramer, 1886 from fragments of the former Gondwanaland (Acari: Uropodina: Dinychidae).

    PubMed

    Kontschán, Jenő; Ripka, Géza

    2016-01-01

    We describe two new species of Dinychus Kramer, 1886 from fragments of the former Gondwanaland supercontinent. Dinychus indica sp. nov. from India belongs to the Dinychus woelkei-group It differs from the previously known Dinychus species on the basis of the sculptural pattern of the sternal and genital shields of female. The female of Dinychus chilensis sp. nov. from Chile has a quadrangular genital shield, which is a unique character state in the genus Dinychus. New keys to the Central and South American Dinychus and to Dinychus woelkei-group are presented. PMID:27470769

  17. Early subsidence of shape-closed hip arthroplasty stems is associated with late revision

    PubMed Central

    van der Voort, Paul; Pijls, Bart G; Nieuwenhuijse, Marc J; Jasper, Jorrit; Fiocco, Marta; Plevier, Josepha W M; Middeldorp, Saskia; Valstar, Edward R; Nelissen, Rob G H H

    2015-01-01

    Background and purpose Few studies have addressed the association between early migration of femoral stems and late aseptic revision in total hip arthroplasty. We performed a meta-regression analysis on 2 parallel systematic reviews and meta-analyses to determine the association between early migration and late aseptic revision of femoral stems. Patients and methods Of the 2 reviews, one covered early migration data obtained from radiostereometric analysis (RSA) studies and the other covered long-term aseptic revision rates obtained from survival studies with endpoint revision for aseptic loosening. Stems were stratified according to the design concept: cemented shape-closed, cemented force-closed, and uncemented. A weighted regression model was used to assess the association between early migration and late aseptic revision, and to correct for confounders. Thresholds for acceptable and unacceptable migration were determined in accordance with the national joint registries (≤ 5% revision at 10 years) and the NICE criteria (≤ 10% revision at 10 years). Results 24 studies (731 stems) were included in the RSA review and 56 studies (20,599 stems) were included in the survival analysis review. Combining both reviews for the 3 design concepts showed that for every 0.1-mm increase in 2-year subsidence, as measured with RSA, there was a 4% increase in revision rate for the shape-closed stem designs. This association remained after correction for age, sex, diagnosis, hospital type, continent, and study quality. The threshold for acceptable migration of shape-closed designs was defined at 0.15 mm; stems subsiding less than 0.15 mm in 2 years had revision rates of less than 5% at 10 years, while stems exceeding 0.15 mm subsidence had revision rates of more than 5%. Interpretation There was a clinically relevant association between early subsidence of shape-closed femoral stems and late revision for aseptic loosening. This association can be used to assess the safety of

  18. Genetic susceptibility to total hip arthroplasty failure: a preliminary study on the influence of matrix metalloproteinase 1, interleukin 6 polymorphisms and vitamin D receptor

    PubMed Central

    Malik, M H A; Jury, F; Bayat, A; Ollier, W E R; Kay, P R

    2007-01-01

    Background Matrix metalloproteinase (MMP)1, interleukin(IL)6 and vitamin D receptor (VDR) have been implicated in the biological cascade of events initiated by particulate wear debris and bacterial infection, resulting in periprosthetic bone loss around loosened total hip replacements (THRs). The individual responses to such stimuli may be dictated by genetic variation. Objective To study the effect of single‐nucleotide polymorphisms (SNPs) within these candidate genes. Methods A case–control study of the MMP1, IL6 and VDR genes was performed for possible association with deep sepsis or aseptic loosening. All cases included in the study were Caucasian patients with osteoarthritis who had received a cemented Charnley total hip arthroplasty (THA) and polyethylene acetabular cup. Cases consisted of 91 patients with early aseptic loosening and 71 patients with microbiological evidence of deep infection on surgery. Controls consisted of 150 patients with THAs that were clinically asymptomatic for over 10 years and showed no radiographic features of aseptic loosening. DNA samples from all individuals were genotyped using Taqman allelic discrimination. Results The C allele (p = 0.001; OR = 3.27; 95% CI 2.21 to 4.83) and C/C genotype (p = 0.001) for the MMP1 SNP were highly associated with aseptic failure when compared with controls. No statistically significant relationships were found between aseptic loosening and the MMP2, MMP4, IL6 –174 or VDRL SNPs. The T allele (p = 0.007; OR = 1.76; 95% CI 1.16 to 2.66) and T/T genotype (p = 0.028) for VDR‐T were statistically associated with osteolysis owing to deep infection as compared with controls. No statistically significant relationship was found between septic failure and any of the other SNPs examined in this study. Conclusions Aseptic loosening and possibly deep infection of THR may be due to the genetic influence of candidate susceptibility genes. SNP markers may serve as predictors of

  19. Fatal Scopulariopsis infection in a lung transplant recipient: lessons of organ procurement.

    PubMed

    Shaver, C M; Castilho, J L; Cohen, D N; Grogan, E L; Miller, G G; Dummer, J S; Gray, J N; Lambright, E S; Loyd, J E; Robbins, I M

    2014-12-01

    Seventeen days after double lung transplantation, a 56-year-old patient with idiopathic pulmonary fibrosis developed respiratory distress. Imaging revealed bilateral pulmonary infiltrates with pleural effusions and physical examination demonstrated sternal instability. Broad-spectrum antibacterial and antifungal therapy was initiated and bilateral thoracotomy tubes were placed. Both right and left pleural cultures grew a mold subsequently identified as Scopulariopsis brumptii. The patient underwent pleural irrigation and sternal debridement three times but pleural and wound cultures continued to grow S. brumptii. Despite treatment with five antifungal agents, the patient succumbed to his illness 67 days after transplantation. Autopsy confirmed the presence of markedly invasive fungal disease and pleural rind formation. The patient's organ donor had received bilateral thoracostomy tubes during resuscitation in a wilderness location. There were no visible pleural abnormalities at the time of transplantation. However, the patient's clinical course and the location of the infection, in addition to the lack of similar infection in other organ recipients, strongly suggest that Scopulariopsis was introduced into the pleural space during prehospital placement of thoracostomy tubes. This case of lethal infection transmitted through transplantation highlights the unique risk of using organs from donors who are resuscitated in an outdoor location. PMID:25376207

  20. Recovery from desflurane anesthesia in horses with and without post-anesthetic xylazine

    PubMed Central

    Aarnes, Turi K.; Bednarski, Richard M.; Bertone, Alicia L.; Hubbell, John A.E.; Lerche, Phillip

    2014-01-01

    The objective of this study was to compare recovery from desflurane anesthesia in horses with or without post-anesthetic xylazine. Six adult horses were anesthetized on 2 occasions, 14 d apart using a prospective, randomized crossover design. Horses were sedated with xylazine, induced to lateral recumbency with ketamine and diazepam, and anesthesia was maintained with desflurane. One of 2 treatments was administered intravenously at the end of anesthesia: xylazine [0.2 mg/kg body weight (BW)] or an equivalent volume of saline. Recovery parameters were recorded and assessed by 2 blinded observers. A Wilcoxon signed-rank test was used to analyze recovery data. Heart rate, arterial blood pressures, and arterial blood gas data were analyzed using 2-way analysis of variance (ANOVA) for repeated measures. Values of P < 0.05 were considered significant. Duration of anesthesia was not different between groups. Administration of xylazine at the end of desflurane anesthesia was associated with significantly longer times to first movement, endotracheal tube removal, first attempt to achieve sternal recumbency, sternal recumbency, first attempt to stand, and standing. Number of attempts to stand and quality of recovery scores were not different between groups. Administering xylazine after desflurane anesthesia resulted in longer recovery times. Recovery scores were not significantly different between groups. PMID:24688171

  1. Nonadecadienone, a new termite trail-following pheromone identified in Glossotermes oculatus (Serritermitidae).

    PubMed

    Hanus, Robert; Šobotník, Jan; Krasulová, Jana; Jiroš, Pavel; Žáček, Petr; Kalinová, Blanka; Dolejšová, Klára; Cvačka, Josef; Bourguignon, Thomas; Roisin, Yves; Lacey, Michael J; Sillam-Dussès, David

    2012-01-01

    Within the multitude of chemical signals used by termites, the trail marking by means of pheromones is ubiquitous. Chemistry and biology of the trail-following communication have been described in more than 60 species from all families except for the Neotropical Serritermitidae. The chemical ecology of Serritermitidae is of special interest not only as a missing piece of knowledge on the diversity and evolution of isopteran pheromones but also because it may contribute to the debate on the phylogenetic position of this family, which is still unresolved. Therefore, we aimed in this study to identify the trail-following pheromone of the serritermitid Glossotermes oculatus. Based on a combined approach of analytical chemistry, electrophysiology, and behavioral bioassays, we propose (10Z,13Z)-nonadeca-10,13-dien-2-one to be the trail-following pheromone of G. oculatus, secreted by the sternal gland of pseudergates. Thus, we report on a new termite trail-following pheromone of an unexpected chemical structure, a ketone with 19 carbons, contrasting with unsaturated alcohols containing 12 carbons as trail-following pheromones in other advanced termite families. In addition to this unique trail-following pheromone, we also describe the sternal gland in pseudergates as an organ of unusual shape, size, and structure when compared with other isopteran species. These results underline the peculiarity of the family Serritermitidae and prompt our interest in the chemistry of pheromones in the other genus of the family, Serritermes. PMID:21835765

  2. A new C12 alcohol identified as a sex pheromone and a trail-following pheromone in termites: the diene (Z,Z)-dodeca-3,6-dien-1-ol.

    PubMed

    Robert, Alain; Peppuy, Alexis; Sémon, Etienne; Boyer, François D; Lacey, Michael J; Bordereau, Christian

    2004-01-01

    The diunsaturated C12 alcohol (Z,Z)-dodeca-3,6-dien-1-ol (dodecadienol) has been characterized by GC-MS and FTIR as a novel releaser pheromone in termites. This alcohol identified in Ancistrotermes pakistanicus (Termitidae, Macrotermitinae) possesses a double pheromonal function which again illustrates the chemical parsimony of termites compared with other social insects. In workers, dodecadienol elicits trail-following at a very low concentration (activity threshold at 0.1 pg/cm of trail); in male alates it induces trail-following at a low concentration (1-10 pg/cm) and sexual attraction at a higher concentration (about 1 ng). Traces of the monounsaturated C12 alcohol (Z)-dodec-3-en-1-ol (dodecenol), known as a trail pheromone of several Macrotermitinae, were also found in the sternal gland extracts of A. pakistanicus, although only dodecadienol was present at the surface of the sternal gland. Workers of A. pakistanicus are not sensitive to dodecenol, but they are as sensitive to dodecatrienol as to dodecadienol. However, in the study area (Vietnam), A. pakistanicus is living in sympatry only with those Macrotermitinae using dodecenol as a trail pheromone, the foraging populations therefore being well isolated through their respective trail pheromones. The presence of three types of unsaturated C12 alcohols as releaser pheromones in the only Macrotermitinae subfamily is discussed, and a possible biosynthetic pathway from linoleic acid is proposed for dodecadienol. PMID:14740102

  3. Sex pheromone and trail pheromone of the sand termite Psammotermes hybostoma.

    PubMed

    Sillam-Dussès, David; Hanus, Robert; Abd El-Latif, Ashraf Oukasha; Jiroš, Pavel; Krasulová, Jana; Kalinová, Blanka; Valterová, Irena; Sobotník, Jan

    2011-02-01

    Within the complex network of chemical signals used by termites, trail pheromones and sex pheromones are among the best known. Numerous recent papers map the chemical identity and glandular origin of these pheromones in nearly all major isopteran taxa. In this study, we aimed to describe the sex pheromone and the trail pheromone of a poorly known sand termite, Psammotermes hybostoma. We identified (3Z,6Z,8E)-dodeca-3,6,8-trien-1-ol (dodecatrienol) as the sex pheromone released by tergal and sternal glands of female imagos and, at the same time, as the trail pheromone secreted from the sternal gland of workers. We conclude that chemical communication in Psammotermes does not differ from that of most other Rhinotermitidae, such as Reticulitermes, despite the presence of a diterpene as a major component of the trail pheromone of Prorhinotermes to which Psammotermes is presumed to be phylogenetically close. Our findings underline once again the conservative nature of chemical communication in termites, with dodecatrienol being a frequent component of pheromonal signals in trail following and sex attraction and, at the same time, a tight evolutionary relationship between the trail following of working castes and the sex attraction of imagos. PMID:21318399

  4. Behavioral bioassays of termite trail pheromones : Recruitment and orientation effects of cembrene-A inNasutitermes costalis (Isoptera: Termitidae) and discussion of factors affecting termite response in experimental contexts.

    PubMed

    Hall, P; Traniello, J F

    1985-11-01

    The monocyclic 14-membered ring diterpene, cembrene-A, previously identified as a nasutitermitine trail pheromone, was tested for its effectiveness as a trail pheromone inNasutitermes costalis. Artificial trails prepared from serial dilutions of racemic cembrene-A over a concentration range of 10(-1)-10(-6) mg/ml were ineffective in recruiting termites. Serial dilutions of racemic cembrene-A ranging in concentration from 10(-1) to 10(-5) mg/ml produced an orientation effect. Chiral cembrene-A produced recruitment in soldiers at 10(-1) and 10(-3) mg/ml and was less ineffective in recruiting workers. Soldiers always showed a lower and more variable recruitment response to chiral cembrene-A than to sternal gland extracts. The behavioral response to both chiral and racemic cembrene-A was different in quantity and quality from that observed for sternal gland extract. Based on the results of these behavioral tests, cembrene-A appears to be a generalized nasute orientation pheromone which may show recruitment properties at unnaturally high concentrations. PMID:24311243

  5. Effects of tail fat on recovery times of anesthesia with isoflurane in fat-tailed Iranian Lori-Bakhtiyari lambs

    PubMed Central

    Sharifi, Siavash; Raisi Sarteshnizi, Abbas; Sharifi, Farangis; Yousefian, Elham

    2015-01-01

    In the present study, the effect of tail fat on recovery times in intact sheep and sheep with a ligated median sacral artery following similar anesthetic exposure with isoflurane was investigated. This study was performed using seven healthy fat-tailed Iranian Lori-Bakhtiyari ewe lambs. The lambs were anesthetized twice at two week intervals (the experiment was performed in two stages). After mask induction with isoflurane in 100% oxygen, sheep were intubated and anesthesia was maintained for 4 hr using a rebreathing system. Induction and extubation times and time to sternal recumbency and attempts to stand were recorded during anesthetic induction and recovery (Stage 1). Two weeks later, prior to the second anesthesia, the median sacral artery (MSA) was ligated under epidural anesthesia in sheep. All sheep were anesthetized as mentioned above (Stage 2). No significant differences were observed for the induction time between two stages (p > 0.05) but extubation, sternal recumbency and attempts to stand times were significantly longer in intact sheep (Stage 1) after 4 hr anesthesia with isoflurane (p < 0.05). Recovery time was decreased following MSA ligation in fat-tailed sheep, which suggested that body fat had a major role in the recovery time of isoflurane in sheep. We developed an animal model to investigate fat drug solubility of isoflurane gas. Therefore, using less-soluble in fat anesthetics is better than high-soluble anesthetics for prolonged anesthesia to decrease postoperative complication in obese patient. PMID:26893809

  6. Surface anatomy and anatomical planes in the adult turkish population.

    PubMed

    Uzun, C; Atman, E D; Ustuner, E; Mirjalili, S A; Oztuna, D; Esmer, T S

    2016-03-01

    Surface anatomy and anatomical planes are widely used in education and clinical practice. The planes are largely derived from cadaveric studies and their projections on the skin show discrepancies between and within anatomical reference textbooks. In this study, we reassessed the accuracy of common thoracic and abdominopelvic anatomical planes using computed tomography (CT) imaging in the live adult Turkish population. After patients with distorting pathologies had been excluded, CT images of 150 supine patients at the end tidal inspiration were analyzed. Sternal angle, transpyloric, subcostal, supracristal and pubic crest planes and their relationships to anatomical structures were established by dual consensus. The tracheal bifurcation, azygos vein/superior vena cava (SVC) junction and pulmonary bifurcation were usually below the sternal angle while the concavity of the aortic arch was generally within the plane. The tip of the tenth rib, the superior mesenteric artery and the portal vein were usually within the transpyloric plane while the renal hila and the fundus of the gallbladder were below it. The inferior mesenteric artery was below the subcostal plane and the aortic bifurcation was below the supracristal plane in most adults. Projectional surface anatomy is fundamental to medical education and clinical practice. Modern cross-sectional imaging techniques allow large groups of live patients to be examined. Classic textbook information regarding anatomy needs to be reviewed and updated using the data gathered from these recent studies, taking ethnic differences into consideration. Clin. Anat. 29:183-190, 2016. © 2015 Wiley Periodicals, Inc. PMID:26403267

  7. Bone scan appearances following bone and bone marrow biopsy

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.

    1984-01-01

    Bone marrow and bone biopsies are performed not infrequently in patients referred for bone scans and represent a potential cause of a ''false positive'' focal abnormality on the bone scan. The authors have therefore examined the scan appearances in a series of patients who had undergone either sternal marrow biopsy, (Salah needle, diameter 1.2 mm) trephine iliac crest marrow biopsy (Jamshidi 11 gauge needle, diameter 3.5 mm) or a transiliac bone biopsy (needle diameter 8 mm). Of 18 patients studied 1 to 45 days after sternal marrow 17 had normal scan appearances at the biopsy site and 1 had a possible abnormality. None of 9 patients studied 4 to 19 days after trephine iliac crest marrow biopsy had a hot spot at the biopsy site. A focal scan abnormality was present at the biopsy site in 9/11 patients studied 5 to 59 days after a trans iliac bone biopsy. No resultant scan abnormality was seen in 4 patients imaged within 3 days of the bone biopsy or in 3 patients imaged 79 to 138 days after the procedure. Bone marrow biopsy of the sternum or iliac crest does not usually cause bone scan abnormalities. A focal abnormality at the biopsy site is common in patients imaged 5 days to 2 months after bone biopsy. The gauge of the needle employed in the biopsy and thus the degree of bone trauma inflicted, is likely to be main factor determining the appearance of bone scan abnormalities at the biopsy site.

  8. Effects of tail fat on recovery times of anesthesia with isoflurane in fat-tailed Iranian Lori-Bakhtiyari lambs.

    PubMed

    Sharifi, Siavash; Raisi Sarteshnizi, Abbas; Sharifi, Farangis; Yousefian, Elham

    2015-01-01

    In the present study, the effect of tail fat on recovery times in intact sheep and sheep with a ligated median sacral artery following similar anesthetic exposure with isoflurane was investigated. This study was performed using seven healthy fat-tailed Iranian Lori-Bakhtiyari ewe lambs. The lambs were anesthetized twice at two week intervals (the experiment was performed in two stages). After mask induction with isoflurane in 100% oxygen, sheep were intubated and anesthesia was maintained for 4 hr using a rebreathing system. Induction and extubation times and time to sternal recumbency and attempts to stand were recorded during anesthetic induction and recovery (Stage 1). Two weeks later, prior to the second anesthesia, the median sacral artery (MSA) was ligated under epidural anesthesia in sheep. All sheep were anesthetized as mentioned above (Stage 2). No significant differences were observed for the induction time between two stages (p > 0.05) but extubation, sternal recumbency and attempts to stand times were significantly longer in intact sheep (Stage 1) after 4 hr anesthesia with isoflurane (p < 0.05). Recovery time was decreased following MSA ligation in fat-tailed sheep, which suggested that body fat had a major role in the recovery time of isoflurane in sheep. We developed an animal model to investigate fat drug solubility of isoflurane gas. Therefore, using less-soluble in fat anesthetics is better than high-soluble anesthetics for prolonged anesthesia to decrease postoperative complication in obese patient. PMID:26893809

  9. Side effects and complication of Port-A-Cath.

    PubMed

    Iannarone, Claudio; Sacco, Fabrizio; Micozzi, Marco; Fegiz, Alessandra; Fiorelli, Silvia; Vendittelli, Vincenza; Pinto, Giovanni

    2012-01-01

    Central venous catheter techniques find at present use for administering of NPT, for the drug injection ( especially chemiotherapeutic drugs) because of the possible damage of a few substances when perfused in a peripheral way. At present port-a-cath find their most extensive use: these are systems which can be set up and tolerated for many months. For the access to subclavian vein must be necessary put in supine decubitus, with light Trendelenburg position, with the opposite arm along the body and the head turned on the opposite side. In this way the clavicle is in perpendicular position with regard to the sternal handlebar, except for patient affected with bpco, kypho-scoliosis, scapular-homeral arthrosis. In these patients the clavicle can put on a particular course, oblique and upper as to the sternal articular face. So there is a serious obstacle to the passage to the metal needle under the clavicle. KEY WORDS: Chemiotherapy, CVC, NPT, Port-a-Cath. PMID:23103553

  10. Simultaneous aortic valve replacement and pectus excavatum correction in a 76-year-old man.

    PubMed

    Suzuki, Shigemitsu; Kiyokawa, Kensuke; Nakamura, Katsuhiko; Kashikie, Hideyuki; Akaiwa, Keiichi; Watanabe, Koichi; Hara, Shigeru

    2014-01-01

    A 76-year-old man was admitted to our department to undergo surgical treatment for aortic valve regurgitation. On physical examination, a bowl-shaped concavity was noted. Chest computed tomography revealed left-sided heart displacement by severe pectus excavatum with a Haller index of 6.40. Considering the postoperative cardiopulmonary complications that may result from mechanical compression due to uncorrected sternal deformities, we decided to perform a simultaneous aortic valve replacement and pectus excavatum correction. The operation time was long (570 min) and involved a high-volume transfusion due to excessive bleeding caused by resection of the deformed costal cartilages and sternal osteotomy under the use of heparin. The endotracheal tube was removed on the fifth postoperative day, but reintubation was required because of hypercapnea and difficulty in sputum discharge. With the aid of tube feeding for nutritional management, his cardiopulmonary function gradually ameliorated and his general condition improved. Consequently, he was weaned from mechanical ventilation on the 14th postoperative day. The patient is doing well 1 year after surgery. We report on the surgical management for pectus excavatum in adult patients. PMID:24088909

  11. Optimal chest compression in cardiopulmonary resuscitation depends upon thoracic and back support stiffness.

    PubMed

    Dellimore, Kiran H; Scheffer, Cornie

    2012-12-01

    A biomechanical analysis of the constant peak displacement and constant peak force methods of cardiopulmonary resuscitation (CPR) has revealed that optimal CC performance strongly depends on back support stiffness, CC rate, and the thoracic stiffness of the patient being resuscitated. Clinically the results presented in this study suggest that the stiffness of the back support surfaces found in many hospitals may be sub-optimal and that a backboard or a concrete floor can be used to enhance CC effectiveness. In addition, the choice of optimal CC rate and maximum sternal force applied by clinicians during peak force CPR is ought to be based on a general assessment of the patient's thoracic stiffness, taking into account the patient's age, gender, and physical condition; which is consistent with current clinical practice. In addition, it is important for clinicians to note that very high peak sternal forces, exceeding the limit above which severe chest wall trauma and abdominal injury occurs, may be required for optimal CC during peak force CPR on patients with very stiff chests. In these cases an alternative CPR technique may be more appropriate. PMID:23054380

  12. Pulmonary scintigraphic findings in children with pectus excavatum by the comparison of chest radiograph indices.

    PubMed

    Kao, C H; Liao, S Q; Wang, S J; Yeh, S H

    1992-11-01

    Pulmonary scintigraphy, including Xe-133 ventilation combined with Tc-99m MAA perfusion scans, was performed in 23 children (3 girls, 20 boys, ages: 2-9 years) with pectus excavatum, and the indices from lateral chest radiography were used for comparison. The findings of pulmonary scintigraphy were analyzed as 1) ventilation fractions (VF), and 2) perfusion fractions (PF) between bilateral lungs; and 3) ventilation-perfusion ratios (V/Q ratio) of both lungs. The results showed that 6 of 23 cases had impaired VF, 11 of 23 cases had impaired PF, and 7 of 23 cases had an impaired V/Q ratio in the right and left lung, respectively. The severity of sternal depression in pectus excavatum was shown as certain indices that were obtained on routine lateral chest radiographs. However, no significant correlations existed between the differences in the fractions and the indices. Our results suggest that pulmonary scintigraphy is not necessary for children with pectus excavatum to predict the severity of sternal depression and pulmonary function, because 1) pulmonary scintigraphy is very difficult to perform in children; 2) unnecessary radiation exposure should be avoided; and 3) it is not well correlated with the severity of the depressed sternum. PMID:1424376

  13. Anesthetic techniques for neutering 6- to 14-week-old kittens.

    PubMed

    Faggella, A M; Aronsohn, M G

    1993-01-01

    Forty-eight male and 48 female 6- to 14-week-old kittens were neutered by use of 4 anesthetic protocols. Preanesthetic disposition, depth of sedation, loss of resistance to handling, induction quality, induction time, sternal and stand times, and recovery quality were evaluated. Analgesia and muscle relaxation without supplemental inhalational anesthetics were evaluated in male kittens, and the time until extubation was recorded in female kittens. Intramuscular administration of tiletamine/zolazepam (TZ), midazolam/ketamine, atropine/midazolam/ketamine/butorphanol (AMKB), and atropine/midazolam/ketamine/oxymorphone (AMKO) produced rapid sedation and smooth induction into anesthesia. In male kittens, there were no significant differences in sedation, relaxation, induction time, or quality. Tiletamine/zolazepam administration induced the best analgesia, and midazolam/ketamine administration induced the least analgesia for castration. The recovery time in male kittens was longest with TZ and shortest with the opioid groups (AMKB, AMKO). In females, TZ produced significantly faster induction times, but the degree of sedation and relaxation after administration of injectable agents was not significantly different among the groups. More females given TZ could be intubated without supplemental inhalational agents than females in other groups. Extubation time was rapid in all groups, but the times until sternal and standing were significantly longer, and recovery quality was significantly poorer in females given TZ. In kittens given opioids, reversal of the opioid did not shorten recovery time or improve recovery quality.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8420907

  14. Morphological variations of the anterior thoracic skeleton and their forensic significance: radiographic findings in a Spanish autopsy sample.

    PubMed

    Macaluso, P James; Lucena, Joaquín

    2014-08-01

    The anterior thoracic skeleton may exhibit a number of morphological variations or anomalies, including accessory ossicles, atypical fusion or nonfusion of bony segments, and accessory foramina. Awareness of these minor skeletal variants is important in forensic medicine given that they may be mistakenly identified as pathological or traumatic lesions. The identification of subtle morphological anomalies may also aid in the process of individualization by serving as points of similarity if their occurrence was recorded antemortem. This study assessed the prevalence of anatomical variants of the sternum and ribs in a modern population from Spain, since the frequency of these skeletal anomalies differs between population groups. The occurrence of sternal clefts and foramina, bifurcated ribs, fusion of the manubriosternal and sternoxiphoidal junctions, and type of xiphoid process end was evaluated on posterior-anterior digital radiographs. None of the morphological variations were associated with sex or age, with the exception of two traits related to the xiphoid process. The xiphoid process was absent more often in younger individuals, particularly specimens below the age of 30 years, whereas, complete fusion of the sternoxiphoidal junction was more often observed in individuals above 50 years of age. However, these morphological variants are highly variable in the study sample and thus they have limited utility in forensic age estimation in the Spanish population. Nonetheless, the presence of various morphological anomalies such as sternal foramina, bifid ribs, and triple-ended xiphoid processes may provide information useful for establishing a personal identification. PMID:24933632

  15. Open Reduction Internal Fixation Poststernotomy Mediastinitis

    PubMed Central

    Dionisopoulos, Tassos

    2013-01-01

    Introduction. Mediastinitis has been reported to complicate 5% of sternotomy surgery. We have adopted an open reduction and rigid internal fixation (ORIF) approach during the conventional rescue surgery in the treatment of mediastinitis. Methods. A retrospective review was performed to compare the outcomes of patients that had an ORIF to correct postoperative mediastinitis following median sternotomy. These were compared with the outcome of the patients that did not undergo ORIF. Results. In the 5-year study period, we reviewed 35 mediastinitis patient charts. Postoperatively, the ORIF patient group remained in the Intensive Care Unit (ICU) and on a ventilator for a mean of 1.5 and 0.75 days, respectively. Patients treated without ORIF spent significantly more days in the ICU (mean of 7.5 days, P < 0.05) and on a ventilator (mean of 2.15 days, P = 0.1). Furthermore, it was found that none of the patients (0%) who underwent ORIF complained of any postoperative sternal instability or pain. Preoperatively, however, these rates were as high as 72%. Conclusions. In the select patient, ORIF can be a safe option in the management of mediastinitis, which we have shown to significantly decrease morbidity and mortality by providing anatomic reduction as well as physiologic stabilization. We have shown that ORIF will improve the quality of life of the patient by minimizing abnormal sternal mobility and pain and will also decrease inpatient costs by decreasing days spent in the ICU and ventilator dependence. PMID:23970966

  16. Enterococcus faecium Mediastinitis Complicated by Disseminated Candida parapsilosis Infection after Congenital Heart Surgery in a 4-Week-Old Baby.

    PubMed

    Renk, Hanna; Neunhoeffer, Felix; Hölzl, Florian; Hofbeck, Michael; Kumpf, Matthias

    2015-01-01

    Background. Cardiac surgery offers multiple treatment options for children with congenital heart defects. However, infectious complications still remain a major cause of morbidity and mortality in these patients. Mediastinitis is a detrimental complication in children undergoing cardiac surgery. The risk of mediastinitis after delayed sternal closure is up to 10%. Case Presentation. We report a case of Enterococcus faecium mediastinitis in a 4-week-old female baby on extracorporeal membrane oxygenation after Norwood procedure. Although repeated antibiotic irrigation, debridement, and aggressive antibiotic treatment were started early, the pulmonary situation deteriorated. Candida parapsilosis was isolated from bronchoalveolar lavage after pulmonary hemorrhage. Disseminated C. parapsilosis infection with pulmonary involvement was treated with liposomal amphotericin B. Subsequently, inflammatory markers increased again and eventually C. parapsilosis was isolated from the central venous catheter. Conclusion. Children undergoing delayed sternal closure have a higher risk of mediastinitis. Therefore, antibiotic prophylaxis, for example, for soft tissue infection seems justified. However, long-term antibiotic treatment is a risk factor for fungal superinfection. Antifungal treatment of disseminated C. parapsilosis infection may fail in PICU patients with nonbiological material in place due to capacity of this species to form biofilms on medical devices. Immediate removal of central venous catheters and other nonbiological material is life-saving in these patients. PMID:26605096

  17. Enterococcus faecium Mediastinitis Complicated by Disseminated Candida parapsilosis Infection after Congenital Heart Surgery in a 4-Week-Old Baby

    PubMed Central

    Renk, Hanna; Neunhoeffer, Felix; Hölzl, Florian; Hofbeck, Michael; Kumpf, Matthias

    2015-01-01

    Background. Cardiac surgery offers multiple treatment options for children with congenital heart defects. However, infectious complications still remain a major cause of morbidity and mortality in these patients. Mediastinitis is a detrimental complication in children undergoing cardiac surgery. The risk of mediastinitis after delayed sternal closure is up to 10%. Case Presentation. We report a case of Enterococcus faecium mediastinitis in a 4-week-old female baby on extracorporeal membrane oxygenation after Norwood procedure. Although repeated antibiotic irrigation, debridement, and aggressive antibiotic treatment were started early, the pulmonary situation deteriorated. Candida parapsilosis was isolated from bronchoalveolar lavage after pulmonary hemorrhage. Disseminated C. parapsilosis infection with pulmonary involvement was treated with liposomal amphotericin B. Subsequently, inflammatory markers increased again and eventually C. parapsilosis was isolated from the central venous catheter. Conclusion. Children undergoing delayed sternal closure have a higher risk of mediastinitis. Therefore, antibiotic prophylaxis, for example, for soft tissue infection seems justified. However, long-term antibiotic treatment is a risk factor for fungal superinfection. Antifungal treatment of disseminated C. parapsilosis infection may fail in PICU patients with nonbiological material in place due to capacity of this species to form biofilms on medical devices. Immediate removal of central venous catheters and other nonbiological material is life-saving in these patients. PMID:26605096

  18. The effect of intravenous administration of variable-dose flumazenil after fixed-dose ketamine and midazolam in healthy cats.

    PubMed

    Ilkiw, J E; Farver, T B; Suter, C; McNeal, D; Steffey, E P

    2002-06-01

    The effects of intravenous administration of variable-dose flumazenil (0, 0.001, 0.005, 0.01, and 0.1 mg/kg) after ketamine (3 mg/kg) and midazolam (0.0 and 0.5 mg/kg) were studied in 18 healthy unmedicated cats from time of administration until full recovery. End-points were chosen to determine whether flumazenil shortened the recovery period and/or modified behaviors previously identified and attributed to midazolam. Overall, flumazenil administration had little effect on recovery or behaviors. One minute after flumazenil administration, all cats were recumbent but a greater proportion of cats which received the highest dose assumed sternal recumbency with head up than any other group. Although not significant, those cats that received the highest flumazenil dose also had shorter mean times for each of the initial recovery stages (lateral recumbency with head up, sternal recumbency with head up and walking with ataxia) than any of the other treatment groups that received midazolam. For complete recovery, flumazenil did decrease the proportion of the cats that was sedated, but did not shorten the time to walking without ataxia. Based on this study, the administration of flumazenil in veterinary practice, at the doses studied, to shorten and/or improve the recovery from ketamine and midazolam in healthy cats cannot be recommended. PMID:12081613

  19. Combined MEK inhibition and BMP2 treatment promotes osteoblast differentiation and bone healing in Nf1Osx−/− mice

    PubMed Central

    de la Croix Ndong, Jean; Stevens, David M.; Vignaux, Guillaume; Uppuganti, Sasidhar; Perrien, Daniel S.; Yang, Xiangli; Nyman, Jeffry S.; Harth, Eva; Elefteriou, Florent

    2014-01-01

    Neurofibromatosis type I (NF1) is an autosomal dominant disease with an incidence of 1/3000, caused by mutations in the NF1 gene, which encodes the RAS/GTPase-activating protein neurofibromin. Non-bone union following fracture (pseudarthrosis) in children with NF1 remains a challenging orthopedic condition to treat. Recent progress in understanding the biology of neurofibromin suggested that NF1 pseudarthrosis stems primarily from defects in the bone mesenchymal lineage and hypersensitivity of hematopoietic cells to TGFβ. However, clinically relevant pharmacological approaches to augment bone union in these patients remain limited. In this study, we report the generation of a novel conditional mutant mouse line used to model NF1 pseudoarthrosis, in which Nf1 can be ablated in an inducible fashion in osteoprogenitors of post-natal mice, thus circumventing the dwarfism associated with previous mouse models where Nf1 is ablated in embryonic mesenchymal cell lineages. An ex vivo-based cell culture approach based on the use of Nf1flox/flox bone marrow stromal cells showed that loss of Nf1 impairs osteoprogenitor cell differentiation in a cell-autonomous manner, independent of developmental growth plate-derived or paracrine/hormonal influences. In addition, in vitro gene expression and differentiation assays indicated that chronic ERK activation in Nf1-deficient osteoprogenitors blunts the pro-osteogenic property of BMP2, based on the observation that only combination treatment with BMP2 and MEK inhibition promoted the differentiation of Nf1-deficient osteoprogenitors. The in vivo preclinical relevance of these findings was confirmed by the improved bone healing and callus strength observed in Nf1osx−/− mice receiving Trametinib (a MEK inhibitor) and BMP2 released locally at the fracture site via a novel nanoparticle and polyglycidol (PEG)-based delivery method. Collectively, these results provide novel evidence for a cell-autonomous role of neurofibromin in

  20. A fatal case of JC virus meningitis presenting with hydrocephalus in an HIV-seronegative patient

    PubMed Central

    Agnihotri, Shruti P.; Wuthrich, Christian; Dang, Xin; Nauen, David; Karimi, Reza; Viscidi, Raphael; Bord, Evelyn; Batson, Stephanie; Troncoso, Juan; Koralnik, Igor J.

    2014-01-01

    JC virus (JCV) is the etiologic agent of progressive multifocal leukoencephalopathy, JCV granule cell neuronopathy and JCV encephalopathy. Whether JCV can also cause meningitis, has not yet been demonstrated. We report a case of aseptic meningitis resulting in symptomatic hydrocephalus in an HIV-seronegative patient. Brain imaging showed enlargement of ventricles but no parenchymal lesion. She had a very high JC viral load in the CSF and developed progressive cognitive dysfunction despite ventricular drainage. She was diagnosed with pancytopenia and passed away after 5 ½ months. Post-mortem exam revealed productive JCV infection of leptomeningeal and choroid plexus cells, and limited parenchymal involvement. Sequencing of JCV CSF strain showed an archetype-like regulatory region. Further studies of the role of JCV in aseptic meningitis and in idiopathic hydrocephalus are warranted. PMID:24895208

  1. [Empyema and subdural effusion after meningitis. 2 cases of unusual location].

    PubMed

    Thauvoy, C; Brucher, J M; Evrard, P; Dechef, G; Plaen, J; Stroobandt, G

    1975-01-01

    A 12-year old child and a 2-month old infant developed, in the wane of a purulent meningitis, the former, an infratentorial subdural empyema, the latter, a large, encapsulated, haemoorhagic, aseptic subdural effusion, in the right parieto-temporo-occipital region. In both cases, signs of intracranial hypertension dominated the clinical picture. Neuroradiological investigations permitted diagnosis and localisation of the expansive processes, whose subdural position was recognized at operation and confirmed by histopathological examination. According to the literature, purulent meningitis is a rare cause of subdural empyema, except in infants; the solely infratentorial location is also unusual. Sterile subdural effusion is a more common complication of purulent meningitis in infancy, but the unilateral posterior supratentorial location is also a peculiar feature. Subdural collections after memingitis may be aseptic and possibly haemorrhagic, or septic and purulent; these different modes of presentation correspond perhaps to different degrees or stages of subdural pathological changes in the neighbourhood of leptomeningeal infection. PMID:1233386

  2. Isokinetic performance of hip muscles after revision total hip arthroplasty via previous anterolateral approach.

    PubMed

    Cankaya, Deniz; Aydin, Cemal; Karakus, Dilek; Toprak, Ali; Ozkurt, Bulent; Tabak, Yalçın

    2015-09-01

    We investigated the isokinetic performance of hip muscles and clinical outcomes after revision total hip arthroplasty (THA) via same anterolateral approach used in primary surgery. Thirty patients who had undergone previous THA via an anterolateral approach underwent both acetabular and femoral component revision after aseptic loosening. The Harris Hip Score (HHS) was evaluated during a minimum 2-year follow-up. The isokinetic muscle strength of the operated and nonoperated hips was assessed 1 year after surgery. The HHS improved from 49.0 to 77.4. Operated and nonoperated hips exhibited similar isokinetic performance during all measurements (flexion, extension, and abduction) (p>0.05). This prospective study showed that the anterolateral approach preserves abductor strength after revision THA in aseptic cases with acceptable functional and clinical results. The main clinical relevance of this study is that the same anterolateral approach used in previous primary THA is also safe and viable for revision THA. PMID:26435233

  3. Calicobenedenia Polyprioni n. gen., n. sp. (Monogenoidea: Capsalidae) from the external surfaces of wreckfish, Polyprion americanus (Teleostei: Polyprionidae), in the north Atlantic.

    PubMed

    Kritsky, D C; Fennessy, C J

    1999-04-01

    Calicobenedenia polyprioni n. sp. (Capsalidae) is described from the external surfaces (skin and eye) of wreckfish, Polyprion americanus (Teleostei, Perciformes, Polyprionidae), from the north Atlantic Ocean. The monotypic Calicobenedenia n. gen. is proposed for this species and is characterized, in part, by its members possessing an aseptate haptor armed with 14 submarginal hooks and 1 pair of anchors, a common genital pore opening marginally immediately posterior to the left cephalic lobe, 2 testes juxtaposed near the body midlength, and by lacking cephalic suckers or adhesive discs, accessory haptoral sclerites, and a uterine valve. The new genus most closely resembles Entobdella, which differs from Calicobenedenia by having an aseptate haptor armed with 14 submarginal hooks, 2 pairs of anchors, and a pair of accessary sclerites. PMID:10219294

  4. Mars Analog Rio Tinto Experiment (MARTE): 2003 Drilling Campaign to Search for a Subsurface Biosphere at Rio Tinto Spain

    NASA Technical Reports Server (NTRS)

    Stoker, Carol; Dunagan, Stephen; Stevens, Todd; Amils, Ricardo; Gomez-Elvira, Javier; Fernandez, David; Hall, James; Lynch, Kennda; Cannon, Howard; Zavaleta, Jhony

    2004-01-01

    The MARTE (Mars Astrobiology Research and Technology Experiment) project, an ASTEP field experiment, is exploring for a hypothesized subsurface anaerobic chemoautotrophic biosphere in the region of the Tinto River- or Rio Tinto- in southwestern Spain. It is also demonstrating technology needed to search for a subsurface biosphere on Mars. The project has three primary objectives: (1) search for and characterize subsurface life at Rio Tinto along with the physical and chemical properties and sustaining energy sources of its environment, (2) perform a high fidelity simulation of a robotic Mars drilling mission to search for life, and (3) demonstrate the drilling, sample handling, and instrument technologies relevant to searching for life on Mars. The simulation of the robotic drilling mission is guided by the results of the aseptic drilling campaign to search for life at Rio Tinto. This paper describes results of the first phase of the aseptic drilling campaign.

  5. Experimental study on cheng zai wan for treatment of necrosis of the femoral head.

    PubMed

    Chen, Yanping; Huang, Keqin; Lang, Fengping; Huang, Yongxun; Huang, Hui; Huang, Hong; Zhou, Chongguang; Zhang, Wanqiang

    2003-12-01

    Cheng Zai Wan ([symbol: see text]), a Chinese herbal preparation was administrated in the two-leg rat model of aseptic necrosis of the femoral head established by taking prednisone acetate for a long period and the osteoporosis model rat by castration in order to explore the effects of the prescription on necrosis of the femoral head. The results showed that after treatment, the pitting on the surface of the femoral head disappeared, the reticular structure with filling cells was restored; the fat droplets in bone cells or cartilage cells of the femoral head were significantly reduced; sparse capillaries were improved, density and width of the bone trabecula were increased somewhat; bone mineral density, bone weight, bone strength and rigidity were significantly increased; and the low level of estrin was improved. It is suggested that Cheng Zai Wan has definite therapeutic effects on aseptic necrosis of the femoral head. PMID:14719304

  6. Twenty-year survivorship of cementless anatomic graduated component total knee arthroplasty.

    PubMed

    Ritter, Merrill A; Meneghini, R Michael

    2010-06-01

    There is a renewed interest in cementless total knee arthroplasty (TKA) due to improved biomaterials, desire for decreased surgical times and the potential increased longevity. Seventy-three cementless TKAs (AGC, Biomet, Warsaw, Ind) were performed from 1984 to 1986. All components were implanted without cement and without screws and obtained minimum 10 years of follow-up. No patient was lost to follow-up. Fifteen failures occurred, including 12 failed metal-backed patellae, and survivorship for aseptic loosening of any component was 76.4% at 20 years. Two tibial components failed of aseptic loosening at 1.1 and 2.2 years. Excluding patella failures, the survivorship for the cementless tibial component was 96.8% at 20 years. There were no femoral component failures. After eliminating patella failures, this cementless monoblock tibial component without screws demonstrated excellent 20-year survivorship. PMID:19427163

  7. Vital staining of palatal soft tissue in horseshoe Le Fort I osteotomy for superior repositioning of the maxilla.

    PubMed

    Omura, Susumu; Iwai, Toshinori; Honda, Koji; Shibutani, Naoki; Fujita, Koichi; Yamashita, Yosuke; Takasu, Hikaru; Murata, Shogo; Tohnai, Iwai

    2015-05-01

    In maxillary orthognathic surgery, superior repositioning of the maxilla is sometimes difficult, and removal of the bony interference, especially around the descending palatine artery, is very time-consuming in cases of severe maxillary impaction. A useful method introduced for superior repositioning of the maxilla is horseshoe-shaped osteotomy combined with Le Fort I osteotomy (horseshoe Le Fort I osteotomy). However, injury to the palatal soft tissue during horseshoe-shaped osteotomy may cause aseptic complications of the maxilla. Therefore, a safe method is required to prevent such injury to reduce the risk for aseptic necrosis. We describe here vital staining of palatal soft tissue in horseshoe Le Fort I osteotomy for safer superior repositioning of the maxilla. PMID:25887202

  8. Varicella-zoster meningitis with a late-onset of skin eruption.

    PubMed

    Sanguankeo, Anawin; Upala, Sikarin; Sornprom, Suthanya; Thamcharoen, Natanong

    2015-01-01

    Viral meningitis caused by varicella-zoster virus (VZV) is an uncommon neurological complication of herpes zoster. It may occur before or after the onset of the vesicular rash along the dermatomal distribution, which is the classic presentation of herpes zoster. We describe a case of a 51-year-old immunocompetent Caucasian man who presented with neck and severe right-sided facial pain. Eight days later, he had photophobia and papular rash on his forehead. Cerebrospinal fluid (CSF) examination confirmed aseptic meningitis and CSF PCR detected the presence of VZV DNA. Neurological complications of VZV infection, such as aseptic meningitis, may be difficult to diagnose and can cause delay in treatment, especially in cases with late onset of dermatological manifestations of herpes zoster. Definite diagnosis requires evidence of acute VZV infection in blood or cerebrospinal fluid. PMID:25691578

  9. Free-hand ultrasound guidance permits safe and efficient minimally invasive intrathymic injections in both young and aged mice.

    PubMed

    Tuckett, Andrea Z; Zakrzewski, Johannes L; Li, Duan; van den Brink, Marcel R M; Thornton, Raymond H

    2015-04-01

    The goal of this study was to evaluate whether use of an aseptic free-hand approach to ultrasound-guided injection facilitates injection into the thymic gland in mice. We used this interventional radiology technique in young, aged and immunodeficient mice and found that the thymus was visible in all cases. The mean injection period was 8 seconds in young mice and 19 seconds in aged or immunodeficient mice. Injection accuracy was confirmed by intrathymic location of an injected dye or by in vivo bioluminescence imaging of injected luciferase-expressing cells. Accurate intrathymic injection was confirmed in 97% of cases. No major complications were observed. We conclude that an aseptic freehand technique for ultrasound-guided intrathymic injection is safe and accurate and reduces the time required for intrathymic injections. This method facilitates large-scale experiments and injection of individual thymic lobes and is clinically relevant. PMID:25701534

  10. Free-hand ultrasound guidance permits safe and efficient minimally invasive intrathymic injections in both young and aged mice

    PubMed Central

    Tuckett, Andrea Z.; Zakrzewski, Johannes L.; Li, Duan; van den Brink, Marcel R.M.; Thornton, Raymond H.

    2014-01-01

    The goal of this study was to evaluate whether using an aseptic free-hand approach for ultrasound-guided injection facilitates injection into the thymic gland in mice. We used this interventional radiology technique in young, aged, and immunodeficient mice and found that the thymus was visible in all cases. The mean injection period was 8 s in young mice and 19 s in aged or immunodeficient mice. Injection accuracy was confirmed by intrathymic location of an injected dye, or by in vivo bioluminescence imaging of injected luciferase-expressing cells. Accurate intrathymic injection was confirmed in 97% of cases. No major complications were observed. We conclude that an aseptic free-hand technique for ultrasound-guided intrathymic injection is safe, accurate, and reduces the time required for intrathymic injections. This method facilitates large-scale experiments, injection of individual thymic lobes, and is clinically relevant. PMID:25701534

  11. Does Co-Existing Lumbar Spinal Canal Stenosis Impair Functional Outcomes and Activity Levels after Primary Total Hip Arthroplasty?

    PubMed

    Jauregui, Julio J; Banerjee, Samik; Issa, Kimona; Cherian, Jeffrey J; Mont, Michael A

    2015-09-01

    Degenerative lumbar spinal stenosis (LSS) is a cause for substantial morbidity in the elderly population: many often undergo total hip arthroplasty for associated hip arthritis. With a matched cohort we investigated the effect of co-existing LSS on aseptic survivorship, functional outcomes, activity levels, overall subjective physical and mental health status, and satisfaction rates in patients undergoing primary THA. The aseptic-implant survivorship was similar in LSS and non-stenosis cohort. Although both cohorts significantly improved, the LSS cohort achieved lower improvements in HHS, UCLA, SF-36 physical, and satisfaction rates than the matched non-stenotic cohort. Surgeons should consider cautioning patients with LSS that although they can expect relief of their arthritic symptoms following THA, they may continue to expect limitations in function, physical-status, activity-levels, and satisfaction rates. PMID:25865814

  12. Long-Term Survivorship and Clinical Outcomes Following Total Knee Arthroplasty.

    PubMed

    Jauregui, Julio J; Cherian, Jeffrey J; Pierce, Todd P; Beaver, Walter B; Issa, Kimona; Mont, Michael A

    2015-12-01

    Total knee arthroplasty (TKA) is one of the most successful commonly performed orthopedic procedures; as such, the purpose was to assess the long-term outcomes and survivorship of primary TKAs with a dual-radius prosthesis. We evaluated 125-patients (145-knees), with a mean age of 63 years (37-90 years) for a mean 11-year follow-up (10-13 years). Outcomes were assessed with KSS, UCLA, SF-36, satisfaction scores, and aseptic survivorship analysis. At 10-year follow-up, the UCLA (6-points), KSS objective (84-points) and functional (73-points), SF-36 physical (41-points) and mental (51-points), and patient satisfaction (14-points) scores were reported to be good to excellent. The 10-year Kaplan-Meier survivorship rate was 99%; one TKA demonstrated radiographic loosening. At a minimum 10-year follow-up, this device demonstrated satisfactory outcomes and outstanding aseptic-survivorship rates. PMID:26100473

  13. Cementless total hip arthroplasty using a threaded cup and a rectangular tapered stem. Follow-up for ten to 17 years.

    PubMed

    Pospischill, M; Knahr, K

    2005-09-01

    We carried out a clinical and radiological review of 103 cementless primary hip arthroplasties with a tapered rectangular grit-blasted titanium press-fit femoral component and a threaded conical titanium acetabular component at a mean follow-up of 14.4 years (10.2 to 17.1). The mean Harris hip score at the last follow-up was 89.2 (32 to 100). No early loosening and no fracture of the implant were found. One patient needed revision surgery because of a late deep infection. In 11 hips (10.7%), the reason for revision was progressive wear of the polyethylene liner. Exchange of the acetabular component because of aseptic loosening without detectable liner wear was carried out in three hips (2.9%). After 15 years the survivorship with aseptic loosening as the definition for failure was 95.6% for the acetabular component and 100% for the femoral component. PMID:16129743

  14. The results of acetabular impaction grafting in 129 primary cemented total hip arthroplasties.

    PubMed

    Wilson, Matthew J; Whitehouse, Sarah L; Howell, Jonathan R; Hubble, Matthew J W; Timperley, A John; Gie, Graham A

    2013-09-01

    Between 1995 and 2003, 129 cemented primary THAs were performed using full acetabular impaction grafting to reconstruct acetabular deficiencies. These were classified as cavitary in 74 and segmental in 55 hips. Eighty-one patients were reviewed at mean 9.1 (6.2-14.3) years post-operatively. There were seven acetabular component revisions due to aseptic loosening, and a further 11 cases that had migrated >5mm or tilted >5° on radiological review - ten of which reported no symptoms. Kaplan-Meier analysis of revisions for aseptic loosening demonstrates 100% survival at nine years for cavitary defects compared to 82.6% for segmental defects. Our results suggest that the medium-term survival of this technique is excellent when used for purely cavitary defects but less predictable when used with large rim meshes in segmental defects. PMID:23523217

  15. Seven-year results of a press-fit, hydroxyapatite-coated double mobility acetabular component in patients aged 65 years or older.

    PubMed

    Fresard, Pierre-Luc; Alvherne, Charles; Cartier, Jean-Loup; Cuinet, Patrick; Lantuejoul, Jean-Pierre

    2013-05-01

    One hundred and thirty-four THA were done between 1998 and 2002 with AVANTAGE(®) Press-Fit double mobility cup. The mean age of patients was 74 ± 6 years (range 65-94 years). The mean follow-up was 5.4 years (range, 0.15-10 years). The mean preoperative Harris Hip Score was 51.3 ± 14 versus 88 ± 12, at the latest follow-up, and the mean Merle d'Aubigné hip functional score was 8 ± 3 versus 16.3 ± 2.91; patients (68 %) were alive at a mean of 7.2 years postoperatively (range, 5-10 years). Three revisions were documented for aseptic loosening. The overall survival rate at 7.2 years was 96.3 % (95 % confidence interval 92.2-100) using cup revision for aseptic loosening as the end point. PMID:23412297

  16. Congenital dermal sinuses, dermoid and epidermoid cysts of the posterior fossa.

    PubMed

    Schijman, E; Monges, J; Cragnaz, R

    1986-01-01

    Dermal sinuses are abnormal communications between the skin and deeper tissues. Seven cases are presented of occipital dermal sinuses associated with dermoid or epidermoid cysts of the posterior fossa. The cysts were interdural, subdural and intracerebellar. Although they are benign lesions, there is a high incidence of complications, especially infections such as bacterial or aseptic meningitis and cerebellar abscess. The clinical features, radiological and tomographical characteristics, and the relationship to meningeal structures, dural sinuses and cerebellar parenchyma are described. PMID:3731173

  17. Case report: arachnoiditis following intracranial 'Thorotrast'.

    PubMed

    Pandya, P M; Keogh, A J

    1992-02-01

    A patient is reported with a painless, progressive cauda equina lesion due to arachnoiditis, the result of the contrast medium 'Thorotrast' (thorium dioxide) introduced into the brain over 30 years previously. Contrast medium introduced into the lumbar spine can give rise to aseptic adhesive inflammation (arachnoiditis). It rarely gives rise to clinical problems but, when it does so, is usually associated with back pain and only very rarely with progressive neurological deficit. PMID:1310644

  18. Abducens nerve palsy in a girl with incomplete Kawasaki disease.

    PubMed

    Emiroglu, Melike; Alkan, Gulsum; Kartal, Ayse; Cimen, Derya

    2016-08-01

    Kawasaki disease (KD) is a systemic vasculitis that can involve the nervous system, including the cranial nerves. Central nervous system findings, especially irritability, lethargy, and aseptic meningitis, occur in 1-30 % of KD patients (1). Cranial nerve palsies are seen rarely, and abducens nerve palsy has been reported in only three children. We describe a 2.5-year-old girl with incomplete KD who developed transient abducens nerve palsy after intravenous immunoglobulin (IVIG) treatment. PMID:27329470

  19. Multiple strokes associated with herpes simplex virus type-2 infection: case report.

    PubMed

    Joshi, Prajwol

    2016-04-01

    Herpes simplex virus (HSV) type-2 is known to cause meningitis and usually runs a benign course. Association of such infection with vasculitis of the central nervous system is not well known. Presented here is a case initially diagnosed as aseptic meningitis that subsequently evolved as stroke and exhibited angiographic evidence of widespread vasculitis of the intracranial vessels in association with a positive polymerase chain reaction (PCR) for HSV-2 in the cerebrospinal fluid (CSF). PMID:26443565

  20. Scintigraphy of infected total hip arthroplasty (THA): A canine model

    SciTech Connect

    Merkel, K.D.; Brown, M.L.; Fitzgerald, R.H.; Dewanjee, M.K.

    1984-01-01

    Differentiating low-grade sepsis from aseptic loosening of an orthopedic prosthesis is difficult. This study was designed to compare the ability of Tc-99m-HMDP, Ga-67, and In-111 leukocytes (WC) to differentiate low-grade sepsis from aseptic THA component loosening in a canine model. A canine THA was implanted in 14 dogs. Six dogs were given infected femoral components by injecting 10/sup 5/ colony-forming units of Staphylococcus aureus into the femoral canal 6y0 to 90 seconds prior to cementing. Four dogs had an aseptic loose femoral component, and four dogs had an aseptic tight femoral component (control). At six months all dogs were evaluated with X-ray, lab scintigraphy, and tissue quantitation of each tracer. Diagnosis was confirmed by histology and quantitative microbiology. White blood cell counts and differentials were normal in all dogs, and in only one out of six infected dogs was the sedimentation rate abnormal. X-rays were interpreted as possible infection in five dogs and probable infection in only one dog. In-111 WBC scans were more accurate than sequential Tc-Ga scans (sensitivity 94% vs 61%, specificity 86% vs 71% accuracy 90% vs 67%). Quantitative counting of gamma camera data and tissue samples demonstrated significantly (P < .01) higher accumulation of In-111 WBC about the infected than the loose or control component. No significant difference was demonstrated between the loose and septic components with TC-HMDP or Ga. These results correlate well and confirm our clinical data that In-111 WBC scanning is accurate and useful in the workup of the painful orthopedic prosthesis.

  1. The legacy of William Henry Welch.

    PubMed

    Malkin, H M

    2000-08-01

    This paper is a brief biography of William Henry Welch, generally considered not only the father of American pathology but also the dean of medicine in the United States during the first quarter of the 20th century. This biography emphasizes Welch's seldom-recognized contribution to the development and understanding of wound and surgical infection that resulted in the delayed universal acceptance of aseptic procedure by surgeons. PMID:10982305

  2. Debonding of porous coating of a threaded acetabular component: retrieval analysis.

    PubMed

    Łapaj, Łukasz; Markuszewski, Jacek; Rybak, Tomasz; Wierusz-Kozłowska, Małgorzata

    2013-01-01

    This report presents a case of debonding of plasma sprayed porous titanium coating from a threaded acetabular component which caused aseptic loosening of the implant. Weight bearing after delamination caused abrasive damage of the acetabular shell, and particles of the coating embedded in the acetabular liner. Microscopic examination of periprosthetic tissues showed presence of metal particles and macrophage infiltration. Despite microscopic examination of the retrieved component the cause of debonding remains unclear. PMID:23127634

  3. Coxsackievirus-positive cervices in women with febrile illnesses during the third trimester in pregnancy.

    PubMed

    Reyes, M P; Zalenski, D; Smith, F; Wilson, F M; Lerner, A M

    1986-07-01

    Coxsackievirus B5 infection was demonstrated in five of seven third-trimester pregnant women with undifferentiated febrile illnesses or aseptic meningitis. Coxsackievirus B5 was recovered from the cervix and throat in four women and from the rectum in three. No obvious illnesses were evident in the babies. These findings suggest that previously unrecognized cervical enterovirus carriage or infection is common in infected pregnant women in the last trimester and that subsequent neonatal infection at delivery may result. PMID:3014880

  4. Use of closed-system drug transfer devices in the handling and administration of MABs.

    PubMed

    Meade, Elizabeth

    2015-09-01

    There is a lack of research and consensus on the long-term risks of occupational exposure to monoclonal antibodies. There is, however, some risk to health professionals who are involved in their preparation and administration. This article discusses the use of closed-system drug transfer devices to minimise exposure, and touches on the importance of aseptic techniques, personal protective equipment, and appropriate education and training for health professionals. PMID:26946648

  5. Case Report of Sepsis in Neonates Fed Expressed Mother's Milk.

    PubMed

    Smith, Sandra L; Serke, Laura

    2016-01-01

    Mother's milk is the recommended food for premature infants cared for in the NICU. In the cases presented in this article, mothers pumped their milk into food-grade aseptic plastic containers. Milk was refrigerated before use. In Case 1, an infant developed Pseudomonas aeruginosa sepsis. In Case 2, an infant developed methicillin-resistant Staphylococcus aureus. Both cases were attributed to contaminated mother's milk. Proper cleaning and sterilization of pump parts is essential to prevent milk contamination. PMID:27486089

  6. Deficiency of interleukin-1 receptor antagonist responsive to anakinra.

    PubMed

    Schnellbacher, Charlotte; Ciocca, Giovanna; Menendez, Roxanna; Aksentijevich, Ivona; Goldbach-Mansky, Raphaela; Duarte, Ana M; Rivas-Chacon, Rafael

    2013-01-01

    We describe a 3-month-old infant who presented to our institution with interleukin (IL)-1 receptor antagonist deficiency (DIRA), which consists of neutrophilic pustular dermatosis, periostitis, aseptic multifocal osteomyelitis, and persistently high acute-phase reactants. Skin findings promptly improved upon initiation of treatment with anakinra (recombinant human IL-1 receptor antagonist), and the bony lesions and systemic inflammation resolved with continued therapy. PMID:22471702

  7. Osteolysis around total knee arthroplasty: a review of pathogenetic mechanisms.

    PubMed

    Gallo, J; Goodman, S B; Konttinen, Y T; Wimmer, M A; Holinka, M

    2013-09-01

    Aseptic loosening and other wear-related complications are some of the most frequent late reasons for revision of total knee arthroplasty (TKA). Periprosthetic osteolysis (PPOL) pre-dates aseptic loosening in many cases, indicating the clinical significance of this pathogenic mechanism. A variety of implant-, surgery- and host-related factors have been delineated to explain the development of PPOL. These factors influence the development of PPOL because of changes in mechanical stresses within the vicinity of the prosthetic device, excessive wear of the polyethylene liner, and joint fluid pressure and flow acting on the peri-implant bone. The process of aseptic loosening is initially governed by factors such as implant/limb alignment, device fixation quality and muscle coordination/strength. Later, large numbers of wear particles detached from TKA trigger and perpetuate particle disease, as highlighted by progressive growth of inflammatory/granulomatous tissue around the joint cavity. An increased accumulation of osteoclasts at the bone-implant interface, impairment of osteoblast function, mechanical stresses and increased production of joint fluid contribute to bone resorption and subsequent loosening of the implant. In addition, hypersensitivity and adverse reactions to metal debris may contribute to aseptic TKA failure, but should be determined more precisely. Patient activity level appears to be the most important factor when the long-term development of PPOL is considered. Surgical technique, implant design and material factors are the most important preventative factors, because they influence both the generation of wear debris and excessive mechanical stresses. New generations of bearing surfaces and designs for TKA should carefully address these important issues in extensive preclinical studies. Currently, there is little evidence that PPOL can be prevented by pharmacological intervention. PMID:23669623

  8. Alternative bearings in total knee arthroplasty: risk of early revision compared to traditional bearings

    PubMed Central

    2013-01-01

    Background and purpose There is no substantial clinical evidence for the superiority of alternative bearings in total knee arthroplasty (TKA). We compared the short-term revision risk in alternative surface bearing knees (oxidized zirconium (OZ) femoral implants or highly crosslinked polyethylene (HXLPE) inserts) with that for traditional bearings (cobalt-chromium (CoCR) on conventional polyethelene (CPE)). The risk of revision with commercially available HXLPE inserts was also evaluated. Methods All 62,177 primary TKA cases registered in a Total Joint Replacement Registry between April 2001 and December 2010 were retrospectively analyzed. The endpoints for the analysis were all-cause revisions, septic revisions, or aseptic revisions. Bearing surfaces were categorized as OZ-CPE, CoCr-HXLPE, or CoCr-CPE. HXLPE inserts were stratified according to brand name. Confounding was addressed using propensity score weights. Marginal Cox-regression models adjusting for surgeon clustering were used. Results The proportion of females was 62%. Average age was 68 (SD 9.3) years, and median follow-up time was 2.8 (IQR 1.2–4.9) years. After adjustments, the risks of all-cause, aseptic, and septic revision with CoCr-HXLPE and OZ-CPE bearings were not statistically significantly higher than with traditional CoCr-CPE bearings. No specific brand of HXLPE insert was associated with a higher risk of all-cause, aseptic, or septic revision compared to CoCr-CPE. Interpretation At least in the short term, none of the alternative knee bearings evaluated (CoCr-HXLPE or OZ-CPE) had a greater risk of all-cause, aseptic, and septic revision than traditional CoCr-CPE bearings. PMID:23485105

  9. OSTEOLYSIS AROUND TOTAL KNEE ARTHOPLASTY: A REVIEW OF PATHOGENETIC MECHANISMS

    PubMed Central

    Gallo, Jiri; Goodman, Stuart B.; Konttinen, Yrjö T.; Wimmer, Markus A.; Holinka, Martin

    2014-01-01

    Aseptic loosening and other wear-related complications are one of the most frequent late reasons for revision of total knee arthroplasty (TKA). Periprosthetic osteolysis (PPOL) predates aseptic loosening in many cases indicating the clinical significance of this pathogenic mechanism. A variety of implant-, surgery-, and host-related factors have been delineated to explain the development of PPOL. These factors influence the development of PPOL due to changes in mechanical stresses within the vicinity of the prosthetic device, excessive wear of the polyethylene liner, and joint fluid pressure and flow acting on the peri-implant bone. The process of aseptic loosening is initially governed by factors such as implant/limb alignment, device fixation quality, and muscle coordination/strength. Later large numbers of wear particles detached from TKAs trigger and perpetuate particle disease, as highlighted by progressive growth of inflammatory/granulomatous tissue around the joint cavity. An increased accumulation of osteoclasts at the bone-implant interface, an impairment of osteoblast function, mechanical stresses, and an increased production of joint fluid contribute to bone resorption and subsequent loosening of the implant. In addition, hypersensitivity and adverse reactions to metal debris may contribute to aseptic TKA failure but should be determined more precisely. Patient activity level appears to be the most important factor when the long-term development of PPOL is considered. Surgical technique, implant design, and material factors are the most important preventative factors because they influence both the generation of wear debris and excessive mechanical stresses. New generations of bearing surfaces and designs for TKA should carefully address these important issues in extensive preclinical studies. Currently, there is little evidence that PPOL can be prevented with pharmacological interventions. PMID:23669623

  10. Helium leak test for sterility assurance of a sealed bag. II: Establishing a test method for the manufacturing process.

    PubMed

    Miyako, Yasuhiro; Tai, Hideaki; Saitoh, Izumi; Ikeda, Kaori

    2003-01-01

    To establish a simpler and more reliable method for retaining the aseptic condition of freeze-dried bulk product of a drug substance, a helium leak test method was developed. The bulk product is for the new kit system for infusion of our antibiotic product. In manufacturing the kit system, the bulk product needs to be transported outside of the aseptic area. We had to use a proper container to enclose the bulk product under aseptic conditions and establish an appropriate method for sterility assurance of the container. We decided to use a flexible aluminum laminate bag as a container and to seal it in a polyethylene bag. To detect tears or pinholes in the bag, a helium leak test was considered. As a tear model, a pinhole of known diameter was made in the aluminum laminate bag which was then filled with helium and sealed in a polyethylene bag. Helium leaking from the pinholes was measured with a helium leak detector, and leakage from a pinhole of more than 50 microm in the aluminum laminate bag could be detected. The amount of leakage was strongly affected by the pinhole diameter, and we developed a scientific approach for measuring leakage using the Poiseiulle Equation. The detection sensitivity of our method was enough to retain an aseptic condition inside the aluminum laminate bag, confirmed by the results of the process simulation test using our helium leak test. We concluded that our helium leak test was useful for sterility assurance of the bulk product sealed in the aluminum laminate bag in the manufacturing process of our kit system for infusion of our antibiotic product. PMID:12877329

  11. Left vein of Labbé thrombosis associated with ipsilateral dural sinus thrombosis: non-enhanced CT and contrast-enhanced CT (CTV) findings.

    PubMed

    Stýblo-Sramek, D I; De Temmerman, G; Verbist, B M

    2012-01-01

    A rare case of aseptic thrombosis of the left vein of Labbé in a young woman is reported. Cerebral venous thrombosis was suggested by computed tomography and confirmed after intravenous administration of contrast by computed tomography venography. The combination of the clinical setting with the findings on the non-enhanced CT may favour the diagnosis of vein of Labbé thrombosis. The diagnosis can be confirmed on computed tomography venography. PMID:23019987

  12. Aerobic microorganism for the degradation of chlorinated aliphatic hydrocarbons

    DOEpatents

    Fliermans, Carl B.

    1989-01-01

    A chlorinated aliphatic hydrocarbon-degrading microorganism, having American Type Culture Collection accession numbers ATCC 53570 and 53571, in a biologically pure culture aseptically collected from a deep subsurface habitat and enhanced, mineralizes trichloroethylene and tetrachloroethylene to HCl, H.sub.2 O and Co.sub.2 under aerobic conditions stimulated by methane, acetate, methanol, tryptone-yeast extract, propane and propane-methane.

  13. Indolent infection in nonunion of the distal femur.

    PubMed

    Kim, Ji Wan; Byun, Seong-Eun; Oh, Hyoung Keun; Kim, Jung Jae

    2015-04-01

    In the treatment of nonunions of the distal femur, infection should be excluded. However, it is difficult to determine whether the nonunion is infected or not with negative history and signs of infection. The purpose of this study was to investigate indolent infection as a cause of presumptive aseptic distal femur nonunion. All presumptive aseptic distal femur nonunions treated from 1998 to 2008 were retrospectively reviewed. Any patient with suspected of having an infection clinically was excluded. Multiple tissue cultures were performed at the nonunion site. The main outcomes were to analyze the rate of positive cultures in presumptive aseptic distal femur nonunion and to compare the rate of secondary surgery in positive and negative culture groups. Of the 22 patients, 3 (13.6%) had positive culture results. The organisms cultured were Staphylococcus aureus, Staphylococcus epidermidis, and Enterobacter cloacae. The overall rate of infection was 9.1% (2/22), and one patient underwent a secondary procedure. In the open fracture group, 2 of 10 patients (20%) had positive cultures; all developed infection. In the closed fracture group, 1 of 12 patients (8.3%) had positive culture results, but Infection did not occur in the patient with a 3-week intravenous antibiotic treatment. The postoperative infection rate was 67% (2/3) in patients with positive intraoperative cultures, while 0% (0/18) in the group with negative intraoperative cultures (p<0.001). The presence of indolent infection can be verified in patients with presumptive aseptic nonunion of distal femoral fractures by obtaining intraoperative biopsy tissue cultures. Positive intraoperative culture results were related with postoperative infection. PMID:25189289

  14. A Presentation of Lyme Disease: Pseudotumor Cerebri.

    PubMed

    Şahin, Burcu; İncecik, Faruk; Hergüner, Özlem M; Alabaz, Derya; Beşen, Şeyda

    2015-01-01

    Lyme disease is caused by a tick-transmitted spirochete, B. burgdorferi. It can present with both central and peripheral nervous system manifestations, including aseptic meningitis, meningoencephalitis, Bell's palsy and other cranial neuropathies, radiculoneuritis, and myelitis. However, pseudotumor cerebri associated with Lyme disease is rare. Here, we report a eight-year-old girl with the unusual manifestation of pseudotumor cerebri associated Lyme disease. PMID:27411423

  15. Ureaplasma urealyticum infection in total hip arthroplasty leading to revision.

    PubMed

    Sköldenberg, Olof G; Rysinska, Agata D; Neander, Gustaf; Muren, Olle H; Ahl, Torbjörn E

    2010-10-01

    We describe an infection with Ureaplasma urealyticum causing rapid loosening of a cemented total hip arthroplasty. When reviewing the literature we found that no such case has been reported previously. Taking intraoperative cultures for U urealyticum during revision surgery is not a standard procedure. In cases with rapid, presumed aseptic, loosening of a total hip arthroplasty, an infection with U urealyticum should be considered. PMID:20705423

  16. Evidence for grow-through penetration of 0.2-μm-pore-size filters by Serratia marcescens and Brevundimonas diminuta.

    PubMed

    Kaushal, Simran; Gervais, Brandi; Lute, Scott; Eroraha, Ajiri; Faustino, Patrick; Brorson, Kurt; Hussong, David

    2013-04-01

    We find that both Brevundimonas diminuta and Serratia marcescens can grow through sterilizing grade filter membranes of different membrane polymer compositions. Although this passage does not occur on a consistent basis, generation of "grow-through positive" results indicate that grow-through can occur stochastically at basal levels. This observation argues that the following risk mitigation strategies during pharmaceutical aseptic processing are warranted: minimization of processing times, and monitoring, minimizing and characterizing pre-filter bioburden. PMID:23385852

  17. Contributions of human tissue analysis to understanding the mechanisms of loosening and osteolysis in total hip replacement

    PubMed Central

    Gallo, Jiri; Vaculova, Jana; Goodman, Stuart B.; Konttinen, Yrjö T.; Thyssen, Jacob P.

    2015-01-01

    Aseptic loosening and osteolysis are the most frequent late complications of total hip arthroplasty (THA) leading to revision of the prosthesis. This review aims to demonstrate how histopathological studies contribute to our understanding of the mechanisms of aseptic loosening/osteolysis development. Only studies analysing periprosthetic tissues retrieved from failed implants in humans were included. Data from 101 studies (5532 patients with failure of THA implants) published in English or German between 1974 and 2013 were included. “Control” samples were reported in 45 of the 101 studies. The most frequently examined tissues were the bone-implant interface membrane and pseudosynovial tissues. Histopathological studies contribute importantly to determination of key cell populations underlying the biological mechanisms of aseptic loosening and osteolysis. The studies demonstrated the key molecules of the host response at the protein level (chemokines, cytokines, nitric oxide metabolites, metalloproteinases). However, these studies also have important limitations. Tissues harvested at revision surgery reflect specifically end-stage failure and may not adequately reveal the evolution of pathophysiological events that lead to prosthetic loosening and osteolysis. One possible solution is to examine tissues harvested from stable total hip arthroplasties that have been revised at various time periods due to dislocation or periprosthetic fracture in multicenter studies. PMID:24525037

  18. Survival analysis of cementless grit-blasted titanium total hip arthroplasties.

    PubMed

    Delaunay, C; Kapandji, A I

    2001-04-01

    Although about 200000 cementless Zweymüller-Alloclassic total hip arthroplasties (THAs) were carried out worldwide in the last decade, the survival analysis of these prostheses was not available in the 2000 report of the Swedish national hip arthroplasty registry. We report a prospective survivorship analysis of 200 consecutive grit-blasted cementless Alloclassic primary THAs carried out since 1988. Using surgical, clinical and radiological endpoints for the stem and the threaded cup the ten-year survivorship was 91.5% for reoperation for any cause, 96.4% for hip pain (Merle d'Aubigné score < 5 points, clinical failure), 99.4% for definite aseptic loosening (radiological failure) and 99.3% for revision for aseptic loosening. Using the Swedish registry criteria of primary osteoarthritis and revision for aseptic loosening as the endpoint, the survival rate of 99.1% at ten years for the subgroup of 157 Alloclassic THAs in osteoarthritis compares favourably with that of the best modern cemented hip replacements reported in the Swedish arthroplasty registry. PMID:11341429

  19. Microbiota in Breast Milk of Chinese Lactating Mothers.

    PubMed

    Sakwinska, Olga; Moine, Déborah; Delley, Michèle; Combremont, Séverine; Rezzonico, Enea; Descombes, Patrick; Vinyes-Pares, Gerard; Zhang, Yumei; Wang, Peiyu; Thakkar, Sagar K

    2016-01-01

    The microbiota of breast milk from Chinese lactating mothers at different stages of lactation was examined in the framework of a Maternal Infant Nutrition Growth (MING) study investigating the dietary habits and breast milk composition in Chinese urban mothers. We used microbiota profiling based on the sequencing of fragments of 16S rRNA gene and specific qPCR for bifidobacteria, lactobacilli and total bacteria to study microbiota of the entire breast milk collected using standard protocol without aseptic cleansing (n = 60), and the microbiota of the milk collected aseptically (n = 30). We have also investigated the impact of the delivery mode and the stage of lactation on the microbiota composition. The microbiota of breast milk was dominated by streptococci and staphylococci for both collection protocols and, in the case of standard collection protocol, Acinetobacter sp. While the predominance of streptococci and staphylococci was consistently reported previously for other populations, the abundance of Acinetobacter sp. was reported only once before in a study where milk collection was done without aseptic cleansing of the breast and rejection of foremilk. Higher bacterial counts were found in the milk collected using standard protocol. Bifidobacteria and lactobacilli were present in few samples with low abundance. We observed no effect of the stage of lactation or the delivery mode on microbiota composition. Methodological and geographical differences likely explain the variability in microbiota composition reported to date. PMID:27529821

  20. Infections in neurosurgery: a retrospective study of 1143 patients and 1517 operations.

    PubMed

    Blomstedt, G C

    1985-01-01

    The files of 1143 neurosurgical patients, operated on between November 1, 1979 and June 4, 1981 were examined for records of post-operative infections. Eighty-three patients had developed infections (7%). In addition there were 33 instances of aseptic meningitis. Patients with a shunt were prone to infection (12%). Bone flap infections accounted for more than half of all infections after supratentorial craniotomy. Bacterial meningitis accounted for more than half of all infections after suboccipital craniotomy and translabyrinthine operations. In these patients bacterial meningitis was six times more common, and aseptic meningitis three times more common than in those who had had supratentorial operations. Shunt infection was more common after repeated shunt operations in quick succession. Craniotomy increased the risk of a shunt becoming infected. Antibiotic prophylaxis should be used not only in shunt operations but in all operations performed on patients with a shunt. If bacteria are recovered in a suspected shunt infection, immediate removal of the shunt is the best treatment. However, if the shunt's removal or replacement is exceptionally difficult intraventricular antibiotic treatment may be tried. The age of the patient, the duration of the operation, the individual surgeon and the number of operations did not affect the rate of infection. Clinical signs and conventional laboratory tests, apart from bacterial culture, cannot differentiate between bacterial and aseptic meningitis, but a drop in the level of consciousness suggests bacterial meningitis. PMID:3911746