Science.gov

Sample records for assays transcriptional activity

  1. Fe65 does not stabilize AICD during activation of transcription in a luciferase assay

    SciTech Connect

    Huysseune, Sandra; Kienlen-Campard, Pascal; Octave, Jean-Noel . E-mail: octave@nchm.ucl.ac.be

    2007-09-21

    The APP intracellular domain (AICD) could be involved in signaling via interaction with the adaptor protein Fe65, and with the histone acetyl transferase Tip60. However, the real function of AICD and Fe65 in regulation of transcription remains controversial. In this study, the human APPGal4 fusion protein was expressed in CHO cells and the transcriptional activity of AICDGal4 was measured in a luciferase-based reporter assay. AICDGal4 was stabilized by expression of Fe65 and levels of AICDGal4 controlled luciferase activity. On the contrary, when human APP was expressed in CHO cells, coexpression of Fe65 increased luciferase activity without affecting the amount of AICD fragment. AICD produced from APP was protected from degradation by orthophenanthroline, but not by lactacystine, indicating that AICD is not a substrate of the chymotryptic activity of the proteasome. It is concluded that Fe65 can control luciferase activity without stabilizing the labile AICD fragment.

  2. Development of a fluorescent microsphere-based multiplexed high-throughput assay system for profiling of transcription factor activation.

    PubMed

    Yaoi, Takuro; Jiang, Xin; Li, Xianqiang

    2006-06-01

    Transcription factors (TFs), which play crucial roles in the regulation of gene expression in the human genome, are highly regulated by a variety of mechanisms. A single extracellular stimulus can trigger multiple signaling pathways, and these in turn can activate multiple TFs to mediate the inducible expression of target genes. Alterations in the activities of TFs are often associated with human diseases, such as altered activating factor 1, estrogen receptor, and p53 function in cancer, nuclear factor kappaB in inflammatory diseases, and peroxisome proliferator-activated receptor gamma in obesity. A systematic assay for profiling the activation of TFs will aid in elucidating the mechanisms of TF activation, reveal altered TFs associated with human diseases, and aid in developing assays for drug discovery. Here, we developed a 24-plex fluorescent microsphere-based TF activation assay system with a 96-well plate format. The assay system enabled high-throughput profiling of the DNA binding activity of TFs in multiple samples with high sensitivity. PMID:16834534

  3. High throughput assays for analyzing transcription factors.

    PubMed

    Li, Xianqiang; Jiang, Xin; Yaoi, Takuro

    2006-06-01

    Transcription factors are a group of proteins that modulate the expression of genes involved in many biological processes, such as cell growth and differentiation. Alterations in transcription factor function are associated with many human diseases, and therefore these proteins are attractive potential drug targets. A key issue in the development of such therapeutics is the generation of effective tools that can be used for high throughput discovery of the critical transcription factors involved in human diseases, and the measurement of their activities in a variety of disease or compound-treated samples. Here, a number of innovative arrays and 96-well format assays for profiling and measuring the activities of transcription factors will be discussed. PMID:16834538

  4. Mitochondrial run-on transcription assay using biotin labeling.

    PubMed

    Kühn, Kristina

    2015-01-01

    RNA synthesis and different posttranscriptional processes shape the transcriptome of plant mitochondria. It is believed that mitochondrial transcription in plants is not stringently controlled, and that RNA degradation has a major impact on mitochondrial steady-state transcript levels. Nevertheless, the presence of two RNA polymerases with different gene specificities in mitochondria of dicotyledonous species indicates that transcriptional mechanisms may provide a means to control mitochondrial steady-state RNA pools and gene expression. To experimentally assess transcriptional activities in mitochondria, run-on transcription assays have been developed. These assays measure elongation rates for endogenous transcripts in freshly prepared mitochondrial extracts. The mitochondrial run-on transcription protocol described here has been optimized for the model plant Arabidopsis (Arabidopsis thaliana). It uses mitochondria prepared from soil-grown Arabidopsis plants and employs nonradioactive labeling for the subsequent detection of run-on transcripts. PMID:25910725

  5. An exploration of the estrogen receptor transcription activity of capsaicin analogues via an integrated approach based on in silico prediction and in vitro assays.

    PubMed

    Li, Juan; Ma, Duo; Lin, Yuan; Fu, Jianjie; Zhang, Aiqian

    2014-06-16

    Capsaicin has been considered as an alternative template of dichlorodiphenyl trichloroethane (DDT) in antifouling paint. However, information regarding the estrogenic activity of capsaicin analogues is rather limited in comparison to that of DDT analogues and their metabolites. We here explore the ER transcription activity of selected capsaicin analogues via an integrated approach based on in silico prediction and in vitro assays. Molecular simulation and the agonist/antagonist differential-docking screening identified 6-iodonordihydrocapsaicin (6-I-CPS) as a weak ERα agonist, while anti-estrogenicity was expected for N-arachidonoyldopamine, capsazepine, dihydrocapsaicin, trichostatin A, and capsaicin. On the contrary, the large volume of analogues, such as phorbol 12-phenylacetate 13-acetate 20-homovanillate and phorbol 12,13-dinonanoate 20-homovanillate, cannot fit well with the ER cavity. The result of MVLN assay was in accord with the in silico prediction. 6-I-CPS was demonstrated to induce luciferase gene expression, while the other analogues of relatively small molecular volume reduced luciferase gene expression in MVLN cells, both in the absence and presence of estradiol. This finding suggested that the ER transcription activity of capsaicin analogues is generated at least partly through the ERα-mediated pathway. Moreover, receptor polymorphism analysis indicated that capsaicin analogues may exhibit diverse species selectivity for human beings and marine species. PMID:24747365

  6. Determining estrogenic activity in serum from ovariectomized rats treated with environmental compounds using an in vitro estrogen-mediated transcriptional activation assay (T47D-KBluc).

    EPA Science Inventory

    The use of cell-based assays to quantify low levels of estrogen in human serum is an accepted method. These assays are more sensitive but less specific than radioimmunoassays (RIA). Thus, we hypothesized that estrogen responsive T47D-KBluc cells would detect estrogenic activity i...

  7. Transcriptional activators in yeast

    PubMed Central

    2006-01-01

    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  8. In vitro-to-in vivo extrapolation of xenoestrogens using an estrogen responsive in vitro transcriptional activation assay and the in vivo uterotrophic assay

    EPA Science Inventory

    Widespread contamination of waters with both natural and synthetic estrogens is a concern for potential adverse ecological and human health effects. In vitro assays are valuable screening tools for identifying contaminated environmental samples and chemical specific mechanisms o...

  9. In vitro-to-in vivo extrapolation of xenoestrogens using an estrogen responsive in vitro transcriptional activation assay and the in vivo uterotrophic assay##

    EPA Science Inventory

    Widespread contamination of waters with both natural and synthetic estrogens is a concern for potential adverse ecological and human health effects. In vitro assays are valuable screening tools for identifying contaminated environmental samples and chemical specific mechanisms of...

  10. Reverse protection assay: a tool to analyze transcriptional rates from individual promoters

    PubMed Central

    2011-01-01

    Transcriptional activity of entire genes in chloroplasts is usually assayed by run-on analyses. To determine not only the overall intensity of transcription of a gene, but also the rate of transcription from a particular promoter, we created the Reverse RNase Protection Assay (RePro): in-organello run-on transcription coupled to RNase protection to define distinct transcript ends during transcription. We demonstrate successful application of RePro in plastid promoter analysis and transcript 3' end processing. PMID:22185205

  11. Substitution of synthetic chimpanzee androgen receptor for human androgen receptor in competitive binding and transcriptional activation assays for EDC screening

    EPA Science Inventory

    The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...

  12. A rice transient assay system identifies a novel domain in NRR required for interaction with NH1/OsNPR1 and inhibition of NH1-mediated transcriptional activation

    PubMed Central

    2012-01-01

    Background Arabidopsis NPR1 is a master regulator of systemic acquired resistance. NPR1 binds to TGA transcription factors and functions as a transcriptional co-activator. In rice, NH1/OsNPR1 functions to enhance innate immunity. NRR disrupts NH1 function, when over-expressed. Results We have established a rice transient protoplast assay to demonstrate that NH1 is a transcriptional co-activator and that NRR represses NH1-mediated activation. We identified three NRR homologues (RH1, RH2, and RH3). RH1 and RH3, but not RH2, also effectively repress NH1-mediated transcriptional activation. NRR, RH1, RH2, and RH3 share sequence similarity in a region beyond the previously identified NPR1-interacting domain. This region is required for strong interaction with NH1. A double point mutation, W66A/F70A, in this novel NH1-interacting domain severely reduces interaction with NH1. Mutation W66A/F70A also greatly reduces the ability of NRR to repress NH1-mediated activation. RH2 carries a deviation (amino acids AV) in this region as compared to consensus sequences (amino acids ED) among NRR, RH1, and RH3. A substitution (AV to ED) in RH2 results in strong binding of mutant RH2ED to NH1 and effective repression of NH1-mediated activation. Conclusions The protoplast-based transient system can be used to dissect protein domains associated with their functions. Our results demonstrate that the ability of NRR and its homologues to repress NH1-mediated transcriptional activation is tightly correlated with their ability to bind to NH1. Furthermore, a sequence is identified as a novel NH1-interacting domain. Importantly, this novel sequence is widely present in plant species, from cereals to castor bean plants, to poplar trees, to Arabidopsis, indicating its significance in plants. PMID:22353606

  13. Structural basis of transcription activation.

    PubMed

    Feng, Yu; Zhang, Yu; Ebright, Richard H

    2016-06-10

    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. PMID:27284196

  14. Rubisco Activase Activity Assays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activase functions as a mechano-chemical motor protein using the energy from ATP hydrolysis to contort the structure of its target protein, Rubisco. This action modulates the activation state of Rubisco by removing tightly-bound inhibitory s...

  15. Recent advances in transcription factor assays in vitro.

    PubMed

    Zhang, Yan; Ma, Fei; Tang, Bo; Zhang, Chun-yang

    2016-04-01

    Transcription factors (TFs) play central roles in the regulation of gene expression through binding to specific DNA sequences, and may influence multiple transcription-associated cellular processes including cell development, differentiation, and growth. Alterations in TF levels may lead to a variety of human diseases. Consequently, rapid and sensitive detection of TFs is crucial to both biological research and clinical diagnostics. However, conventional methods for TF assays are usually laborious and time-consuming with poor sensitivity, and sometimes involve the radioactive materials. To overcome these limitations, some new approaches have been developed with a low detection limit, high specificity, high throughput, and low cost. In this paper, we review the recent advances in TF assays and highlight the emerging trends as well. PMID:26923224

  16. Use of the heteroduplex mobility assay and cell sorting to select genome sequences of the CCR5 gene in HEK 293T cells edited by transcription activator-like effector nucleases

    PubMed Central

    Nerys-Junior, Arildo; Costa, Lendel C.; Braga-Dias, Luciene P.; Oliveira, Márcia; Rossi, Átila D.; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S.; Tanuri, Amilcar

    2014-01-01

    Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity. PMID:24688299

  17. Use of the heteroduplex mobility assay and cell sorting to select genome sequences of the CCR5 gene in HEK 293T cells edited by transcription activator-like effector nucleases.

    PubMed

    Nerys-Junior, Arildo; Costa, Lendel C; Braga-Dias, Luciene P; Oliveira, Márcia; Rossi, Atila D; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S; Tanuri, Amilcar

    2014-03-01

    Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity. PMID:24688299

  18. Fluorescence monitoring of riboswitch transcription regulation using a dual molecular beacon assay

    PubMed Central

    Chinnappan, Raja; Dubé, Audrey; Lemay, Jean-François; Lafontaine, Daniel A.

    2013-01-01

    Riboswitches are mRNA elements that specifically bind cellular metabolites and control gene expression by modifying their structure. As riboswitches often control essential genes in pathogenic bacteria, riboswitches have been proposed as new targets for antibiotics. High-throughput screening provides a powerful approach to identify riboswitch ligand analogs that could act as powerful antibacterial drugs. Biochemical assays have already been used to find riboswitch-binding analogs, but those methods do take into account the transcriptional context for riboswitch regulation. As the importance of co-transcriptional ligand binding has been shown for several riboswitches, it is vital to develop an assay that screens riboswitch-binding analogs during the transcriptional process. Here, we describe the development of a dual molecular beacon system monitoring the transcriptional regulation activity of the Bacillus subtilis pbuE adenine riboswitch. This system relies on two molecular beacons that enable the monitoring of transcription efficiency, as well as the regulatory activity of the riboswitch. Different analogs were tested using our system, and a good correlation was observed between riboswitch activity and reported metabolite affinities. This method is specific, reliable and could be applied at the high-throughput level for the identification of new potential antibiotics targeting any riboswitch-regulating gene expression at the mRNA level. PMID:23525464

  19. Creating small transcription activating RNAs.

    PubMed

    Chappell, James; Takahashi, Melissa K; Lucks, Julius B

    2015-03-01

    We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

  20. Isolation of Catharanthus roseus (L.) G. Don Nuclei and Measurement of Rate of Tryptophan decarboxylase Gene Transcription Using Nuclear Run-On Transcription Assay

    PubMed Central

    Kumar, Santosh; Bhatia, Sabhyata

    2015-01-01

    Background An accurate assessment of transcription ‘rate’ is often desired to describe the promoter activity. In plants, isolation of transcriptionally active nuclei and their subsequent use in nuclear run-on assays has been challenging and therefore limit an accurate measurement of gene transcription ‘rate’. Catharanthus roseus has emerged as a model medicinal plant as it exhibits an unsurpassed spectrum of chemodiversity, producing over 130 alkaloids through the terpenoid indole alkaloid (TIA) pathway and therefore serves as a ‘molecular hub’ to understand gene expression profiles. Results The protocols presented here streamline, adapt and optimize the existing methods of nuclear run-on assay for use in C. roseus. Here, we fully describe all the steps to isolate transcriptionally active nuclei from C. roseus leaves and utilize them to perform nuclear run-on transcription assay. Nuclei isolated by this method transcribed at a level consistent with their response to external stimuli, as transcription rate of TDC gene was found to be higher in response to external stimuli i.e. when seedlings were subjected to UV-B light or to methyl jasmonate (MeJA). However, the relative transcript abundance measured parallel through qRT-PCR was found to be inconsistent with the synthesis rate indicating that some post transcriptional events might have a role in transcript stability in response to stimuli. Conclusions Our study provides an optimized, efficient and inexpensive method of isolation of intact nuclei and nuclear ‘run-on’ transcription assay to carry out in-situ measurement of gene transcription rate in Catharanthus roseus. This would be valuable in investigating the transcriptional and post transcriptional response of other TIA pathway genes in C. roseus. Isolated nuclei may also provide a resource that could be used for performing the chip assay as well as serve as the source of nuclear proteins for in-vitro EMSA studies. Moreover, nascent nuclear run

  1. Linking Smads and transcriptional activation.

    PubMed

    Inman, Gareth J

    2005-02-15

    TGF-beta1 (transforming growth factor-beta1) is the prototypical member of a large family of pleiotropic cytokines that regulate diverse biological processes during development and adult tissue homoeostasis. TGF-beta signals via membrane bound serine/threonine kinase receptors which transmit their signals via the intracellular signalling molecules Smad2, Smad3 and Smad4. These Smads contain conserved MH1 and MH2 domains separated by a flexible linker domain. Smad2 and Smad3 act as kinase substrates for the receptors, and, following phosphorylation, they form complexes with Smad4 and translocate to the nucleus. These Smad complexes regulate gene expression and ultimately determine the biological response to TGF-beta. In this issue of the Biochemical Journal, Wang et al. have shown that, like Smad4, the linker domain of Smad3 contains a Smad transcriptional activation domain. This is capable of recruiting the p300 transcriptional co-activator and is required for Smad3-dependent transcriptional activation. This study raises interesting questions about the nature and regulation of Smad-regulated gene activation and elevates the status of the linker domain to rival that of the much-lauded MH1 and MH2 domains. PMID:15702493

  2. Indirect conductimetric assay of antibacterial activities.

    PubMed

    Sawai, J; Doi, R; Maekawa, Y; Yoshikawa, T; Kojima, H

    2002-11-01

    The applicability of indirect conductimetric assays for evaluation of antibacterial activity was examined. The minimal inhibitory concentration (MIC) obtained by the indirect method was consistent with that by the direct conductimetric assay and the turbidity method. The indirect assay allows use of growth media, which cannot be used in the direct conductimetric assay, making it possible to evaluate the antibacterial activity of insoluble or slightly soluble materials with high turbidity, such as antibacterial ceramic powders. PMID:12407467

  3. Multiplexed DNA repair assays for multiple lesions and multiple doses via transcription inhibition and transcriptional mutagenesis.

    PubMed

    Nagel, Zachary D; Margulies, Carrie M; Chaim, Isaac A; McRee, Siobhan K; Mazzucato, Patrizia; Ahmad, Anwaar; Abo, Ryan P; Butty, Vincent L; Forget, Anthony L; Samson, Leona D

    2014-05-01

    The capacity to repair different types of DNA damage varies among individuals, making them more or less susceptible to the detrimental health consequences of damage exposures. Current methods for measuring DNA repair capacity (DRC) are relatively labor intensive, often indirect, and usually limited to a single repair pathway. Here, we describe a fluorescence-based multiplex flow-cytometric host cell reactivation assay (FM-HCR) that measures the ability of human cells to repair plasmid reporters, each bearing a different type of DNA damage or different doses of the same type of DNA damage. FM-HCR simultaneously measures repair capacity in any four of the following pathways: nucleotide excision repair, mismatch repair, base excision repair, nonhomologous end joining, homologous recombination, and methylguanine methyltransferase. We show that FM-HCR can measure interindividual DRC differences in a panel of 24 cell lines derived from genetically diverse, apparently healthy individuals, and we show that FM-HCR may be used to identify inhibitors or enhancers of DRC. We further develop a next-generation sequencing-based HCR assay (HCR-Seq) that detects rare transcriptional mutagenesis events due to lesion bypass by RNA polymerase, providing an added dimension to DRC measurements. FM-HCR and HCR-Seq provide powerful tools for exploring relationships among global DRC, disease susceptibility, and optimal treatment. PMID:24757057

  4. Multiplexed DNA repair assays for multiple lesions and multiple doses via transcription inhibition and transcriptional mutagenesis

    PubMed Central

    Nagel, Zachary D.; Margulies, Carrie M.; Chaim, Isaac A.; McRee, Siobhan K.; Mazzucato, Patrizia; Ahmad, Anwaar; Abo, Ryan P.; Butty, Vincent L.; Forget, Anthony L.; Samson, Leona D.

    2014-01-01

    The capacity to repair different types of DNA damage varies among individuals, making them more or less susceptible to the detrimental health consequences of damage exposures. Current methods for measuring DNA repair capacity (DRC) are relatively labor intensive, often indirect, and usually limited to a single repair pathway. Here, we describe a fluorescence-based multiplex flow-cytometric host cell reactivation assay (FM-HCR) that measures the ability of human cells to repair plasmid reporters, each bearing a different type of DNA damage or different doses of the same type of DNA damage. FM-HCR simultaneously measures repair capacity in any four of the following pathways: nucleotide excision repair, mismatch repair, base excision repair, nonhomologous end joining, homologous recombination, and methylguanine methyltransferase. We show that FM-HCR can measure interindividual DRC differences in a panel of 24 cell lines derived from genetically diverse, apparently healthy individuals, and we show that FM-HCR may be used to identify inhibitors or enhancers of DRC. We further develop a next-generation sequencing-based HCR assay (HCR-Seq) that detects rare transcriptional mutagenesis events due to lesion bypass by RNA polymerase, providing an added dimension to DRC measurements. FM-HCR and HCR-Seq provide powerful tools for exploring relationships among global DRC, disease susceptibility, and optimal treatment. PMID:24757057

  5. NF-Y activates mouse tryptophan hydroxylase transcription.

    PubMed

    Reed, G E; Kirchner, J E; Carr, L G

    1995-06-01

    Tryptophan hydroxylase catalyses the rate-limiting step in the biosynthesis of serotonin, a neurotransmitter which has been implicated in the etiologies of clinically important psychiatric illnesses. Tryptophan hydroxylase is expressed in a tissue-specific manner, but little is known about its transcriptional regulation. By analysing transcriptional activities of a set 5'-deletion constructs of promoter-reporter plasmids in P815-HTR mastocytoma cells, we found that transcription was activated by sequences between nucleotides -343 and -21. DNase I footprint analysis, using nuclear protein extracts from P815-HTR cells, revealed a protein-DNA interaction between nucleotides -77 and -46. A double stranded oligonucleotide, representing this binding site, specifically bound nuclear protein in a gel shift assay. Methylation interference analysis of this complex revealed that nuclear protein interacted with an inverted GGCCAAT element, which is a high-affinity binding motif for the transcription factor NF-Y (also known as CP1 or CBF). An NF-Y specific antibody abolished protein binding in a gel shift assay. Mutagenesis of specific base pairs abolished protein binding in vitro, and mutagenesis of the same base pairs in a reporter gene construct resulted in a 65% decrease in transcriptional activity. Our results suggest that the transcription factor NF-Y binds to a GGCCAAT motif in the tph proximal promoter and activates transcription. PMID:7552299

  6. Modelling defined mixtures of environmental oestrogens found in domestic animal and sewage treatment effluents using an in vitro oestrogen-mediated transcriptional activation assay (T47D-KBluc).

    PubMed

    Bermudez, Dieldrich S; Gray, L Earl; Wilson, Vickie S

    2012-06-01

    There is growing concern of exposure of fish, wildlife and humans to water sources contaminated with oestrogens and the potential impact on reproductive health. Environmental oestrogens can come from various sources including concentrated animal feedlot operations (CAFO), municipal waste, agricultural and industrial effluents. US EPA's drinking water contaminant candidate list 3 (CCL3) includes several oestrogenic compounds. Although these contaminants are currently not subject to any proposed or promulgated national primary drinking water regulations, they are known or anticipated to occur in public water systems and may require future regulation under the Safe Drinking Water Act. Using an in vitro transcriptional activation assay, this study evaluated oestrogens from CCL3 both individually and as a seven oestrogen mixture (fixed ray design) over a broad range of concentrations, including environmentally relevant concentrations. Log EC(50) and Hillslope values for individual oestrogens were as follows: estrone, -11.92, 1.283; estradiol-17α, -9.61, 1.486; estradiol-17β, 11.77, 1.494; estriol, -11.14, 1.074; ethinyl estradiol-17α, -12.63, 1.562; Mestranol, -11.08, 0.809 and Equilin, -11.48, 0.946. In addition, mixtures that mirrored the primary oestrogens found in swine, poultry and dairy CAFO effluent (fixed-ratio ray design), and a ternary mixture (4 × 4 × 4 factorial design) of oestrogens found in hormone replacement therapy and/or oral contraceptives were tested. Mixtures were evaluated for additivity using both the concentration addition (CA) model and oestrogen equivalence (EEQ) model. For each of the mixture studies, a broad range of concentrations were tested, both above and below environmentally relevant concentrations. Results show that the observed data did not vary consistently from either the CA or EEQ predictions for any mixture. Therefore, either the CA or EEQ model should be useful predictors for modelling oestrogen mixtures. PMID:22612477

  7. DNA Methyltransferase Activity Assays: Advances and Challenges

    PubMed Central

    Poh, Wan Jun; Wee, Cayden Pang Pee; Gao, Zhiqiang

    2016-01-01

    DNA methyltransferases (MTases), a family of enzymes that catalyse the methylation of DNA, have a profound effect on gene regulation. A large body of evidence has indicated that DNA MTase is potentially a predictive biomarker closely associated with genetic disorders and genetic diseases like cancer. Given the attention bestowed onto DNA MTases in molecular biology and medicine, highly sensitive detection of DNA MTase activity is essential in determining gene regulation, epigenetic modification, clinical diagnosis and therapeutics. Conventional techniques such as isotope labelling are effective, but they often require laborious sample preparation, isotope labelling, sophisticated equipment and large amounts of DNA, rendering them unsuitable for uses at point-of-care. Simple, portable, highly sensitive and low-cost assays are urgently needed for DNA MTase activity screening. In most recent technological advances, many alternative DNA MTase activity assays such as fluorescent, electrochemical, colorimetric and chemiluminescent assays have been proposed. In addition, many of them are coupled with nanomaterials and/or enzymes to significantly enhance their sensitivity. Herein we review the progress in the development of DNA MTase activity assays with an emphasis on assay mechanism and performance with some discussion on challenges and perspectives. It is hoped that this article will provide a broad coverage of DNA MTase activity assays and their latest developments and open new perspectives toward the development of DNA MTase activity assays with much improved performance for uses in molecular biology and clinical practice. PMID:26909112

  8. Forcing FAK into Transcriptional Activity.

    PubMed

    Lietha, Daniel

    2016-08-01

    Focal adhesion kinase (FAK) has known signaling roles in cytoplasmic adhesion structures, but was recently shown to act as a transcriptional regulator in the nucleus. In this issue of Structure, Cardoso et al. (2016) report that mechanical forces translocate FAK to the nucleus of cardiomyocytes, and provide structural insights into how FAK interacts with the MEF2 transcription factor to control cardiac hypertrophy. PMID:27486913

  9. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K

    1999-01-01

    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  10. Assaying nonspecific phospholipase C activity.

    PubMed

    Pejchar, Přemysl; Scherer, Günther F E; Martinec, Jan

    2013-01-01

    Plant nonspecific phospholipase C (NPC) is a recently described enzyme which plays a role in membrane rearrangement during phosphate starvation. It is also involved in responses of plants to brassinolide, abscisic acid (ABA), elicitors, and salt. The NPC activity is decreased in cells treated with aluminum. In the case of salt stress, the molecular mechanism of NPC action is based on accumulation of diacylglycerol (DAG) by hydrolysis of phospholipids and conversion of DAG, the product of NPC activity, to phosphatidic acid (PA) that participates in ABA signaling pathways. Here we describe a step-by-step protocol, which can be used to determine in situ or in vitro NPC activity. Determination is based on quantification of fluorescently labeled DAG as a product of cleavage of the fluorescently labeled substrate lipid, phosphatidylcholine. High-performance thin-layer chromatography is used for separation of fluorescent DAG. The spot is visualized with a laser scanner and the relative amounts of fluorescent DAG are quantified using imaging software. PMID:23681535

  11. Complementary assays reveal a relationship between HIV-1 uncoating and reverse transcription.

    PubMed

    Hulme, Amy E; Perez, Omar; Hope, Thomas J

    2011-06-14

    During the early stages of HIV-1 replication the conical capsid composed of p24(CA) protein dissociates from the rest of the cytoplasmic viral complex by a process called uncoating. Although proper uncoating is known to be required for HIV-1 infection, many questions remain about the timing and factors involved in the process. Here we have used two complementary assays to study the process of uncoating in HIV-1-infected cells, specifically looking at the timing of uncoating and its relationship to reverse transcription. We developed a fluorescent microscopy-based uncoating assay that detects the association of p24(CA) with HIV-1 viral complexes in cells. We also used an owl monkey kidney (OMK) cell assay that is based on timed TRIM-CypA-mediated restriction of HIV-1 replication. Results from both assays indicate that uncoating is initiated within 1 h of viral fusion. In addition, treatment with the reverse transcriptase inhibitor nevirapine delayed uncoating in both assays. Analysis of reverse transcription products in OMK cells revealed that the generation of early reverse transcription products coincides with the timing of uncoating in these assays. Collectively, these results suggest that some aspect of reverse transcription has the ability to influence the kinetics of uncoating. PMID:21628558

  12. Cyclin D1 transcriptional activation in MCL.

    PubMed

    Beà, Sílvia

    2014-03-27

    In this issue of Blood, Allinne et al propose the nucleolin-dependent activation of the translocated CCND1 allele in mantle cell lymphoma (MCL) because of its relocalization to a transcriptionally favorable area in the perinucleolar region. PMID:24677400

  13. Chromatin insulation by a transcriptional activator

    PubMed Central

    Sutter, Nathan B.; Scalzo, David; Fiering, Steven; Groudine, Mark; Martin, David I. K.

    2003-01-01

    In eukaryotic genomes, transcriptionally active regions are interspersed with silent chromatin that may repress genes in its vicinity. Chromatin insulators are elements that can shield a locus from repressive effects of flanking chromatin. Few such elements have been characterized in higher eukaryotes, but transcriptional activating elements are an invariant feature of active loci and have been shown to suppress transgene silencing. Hence, we have assessed the ability of a transcriptional activator to cause chromatin insulation, i.e., to relieve position effects at transgene integration sites in cultured cells. The transgene contained a series of binding sites for the metal-inducible transcriptional activator MTF, linked to a GFP reporter. Clones carrying single integrated transgenes were derived without selection for expression, and in most clones the transgene was silent. Induction of MTF resulted in transition of the transgene from the silent to the active state, prolongation of the active state, and a marked narrowing of the range of expression levels at different genomic sites. At one genomic site, prolonged induction of MTF resulted in suppression of transgene silencing that persisted after withdrawal of the induction stimulus. These results are consistent with MTF acting as a chromatin insulator and imply that transcriptional activating elements can insulate active loci against chromatin repression. PMID:12547916

  14. Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays.

    PubMed

    Wang, Xiaohong; Zheng, Zhi-Ming

    2016-01-01

    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5'- and 3'-rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full-length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281

  15. Identification of transcriptional regulatory nodes in soybean defense networks using transient co-transactivation assays

    PubMed Central

    Wang, Yongli; Wang, Hui; Ma, Yujie; Du, Haiping; Yang, Qing; Yu, Deyue

    2015-01-01

    Plant responses to major environmental stressors, such as insect feeding, not only occur via the functions of defense genes but also involve a series of regulatory factors. Our previous transcriptome studies proposed that, in addition to two defense-related genes, GmVSPβ and GmN:IFR, a high proportion of transcription factors (TFs) participate in the incompatible soybean-common cutworm interaction networks. However, the regulatory mechanisms and effects of these TFs on those induced defense-related genes remain unknown. In the present work, we isolated and identified 12 genes encoding MYB, WRKY, NAC, bZIP, and DREB TFs from a common cutworm-induced cDNA library of a resistant soybean line. Sequence analysis of the promoters of three co-expressed genes, including GmVSPα, GmVSPβ, and GmN:IFR, revealed the enrichment of various TF-binding sites for defense and stress responses. To further identify the regulatory nodes composed of these TFs and defense gene promoters, we performed extensive transient co-transactivation assays to directly test the transcriptional activity of the 12 TFs binding at different levels to the three co-expressed gene promoters. The results showed that all 12 TFs were able to transactivate the GmVSPβ and GmN:IFR promoters. GmbZIP110 and GmMYB75 functioned as distinct regulators of GmVSPα/β and GmN:IFR expression, respectively, while GmWRKY39 acted as a common central regulator of GmVSPα/β and GmN:IFR expression. These corresponding TFs play crucial roles in coordinated plant defense regulation, which provides valuable information for understanding the molecular mechanisms involved in insect-induced transcriptional regulation in soybean. More importantly, the identified TFs and suitable promoters can be used to engineer insect-resistant plants in molecular breeding studies. PMID:26579162

  16. Development of reverse transcription loop mediated isothermal amplification assay for rapid detection of bluetongue viruses.

    PubMed

    Mohandas, Sreekala S; Muthuchelvan, Dhanavelu; Pandey, Awadh Bihari; Biswas, Sanchay Kumar; Chand, Karam; Venkatesan, Gnanavel; Choudhary, Dheeraj; Ramakrishnan, Muthannan Andavar; Mondal, Bimalendu

    2015-09-15

    A single-step reverse transcription loop mediated isothermal amplification (RT-LAMP) assay targeting NS1 - a highly conserved gene among BTV serotypes was optimized and validated with seven serotypes: BTV-1, BTV-2, BTV-9, BTV-10, BTV-16, BTV-21 and BTV-23. The relative sensitivity of the assay was 0.3 TCID50 and no cross reactivity could be observed with foot and mouth disease, peste-des-petits-ruminants, goatpox, sheeppox and orf viruses. The established assay was also assessed by screening of clinical samples and the result is comparable with conventional RT-PCR. The RT-LAMP assay described here could be an additional tool to the existing assays for diagnosis/surveillance of BTV. PMID:26073661

  17. The CREB Transcription Factor Controls Transcriptional Activity of the Human RIC8B Gene.

    PubMed

    Maureira, Alejandro; Sánchez, Rodolfo; Valenzuela, Nicole; Torrejón, Marcela; Hinrichs, María V; Olate, Juan; Gutiérrez, José L

    2016-08-01

    Proper regulation of gene expression is essential for normal development, cellular growth, and differentiation. Differential expression profiles of mRNA coding for vertebrate Ric-8B during embryo and adult stages have been observed. In addition, Ric-8B is expressed in few cerebral nuclei subareas. These facts point to a dynamic control of RIC8B gene expression. In order to understand the transcriptional regulation of this gene, we searched for cis-elements in the sequence of the human RIC8B promoter region, identifying binding sites for the basic/leucine zipper (bZip) CREB transcription factor family (CRE sites) and C/EBP transcription factor family (C/EBP sites). CRE sites were found clustered near the transcription start site, while the C/EBP sites were found clustered at around 300 bp upstream the CRE sites. Here, we demonstrate the ability of CREB1 and C/EBPβ to bind their respective elements identified in the RIC8B promoter. Comparative protein-DNA interaction analyses revealed only the proximal elements as high affinity sites for CREB1 and only the distal elements as high affinity sites for C/EBPβ. Chromatin immunoprecipitation analyses, carried out using a human neuroblastoma cell line, confirmed the preferential association of CREB to the proximal region of the RIC8B promoter. By performing luciferase reporter assays, we found the CRE sites as the most relevant elements for its transcriptional activity. Taken together, these data show the existence of functional CREB and C/EBP binding sites in the human RIC8B gene promoter, a particular distribution of these sites and demonstrate a relevant role of CREB in stimulating transcriptional activity of this gene. J. Cell. Biochem. 117: 1797-1805, 2016. © 2016 Wiley Periodicals, Inc. PMID:26729411

  18. Sensitive detection of transcription factors by isothermal exponential amplification-based colorimetric assay.

    PubMed

    Zhang, Yan; Hu, Juan; Zhang, Chun-Yang

    2012-11-01

    Transcription factors regulate gene expression by binding to specific DNA sequences within the regulatory regions of genes and have become potential targets in clinical diagnosis and drug development. However, traditional approaches for the detection of transcription factors are usually laborious and time-consuming with a low sensitivity. Here, we develop an isothermal exponential amplification reaction (EXPAR)-based colorimetric assay for simple and sensitive detection of transcription factor NF-κB p50. In this assay, the presence of NF-κB p50 is converted to the reporter oligonucleotides through protein-DNA interaction, exonuclease III digestion, and isothermal exponential amplification. The subsequent sandwich hybridization of the reporter oligonucleotides with the gold nanoparticle (AuNP)-labeled DNA probes generates a red-to-purple color change, allowing the visual detection of NF-κB p50 with the naked eye. Notably, this method converts the detection of transcription factors to the detection of DNA without the requirement of DNA marker-linked antibodies in the case of immuno-PCR and can sensitively measure NF-κB p50 with a detection limit of 3.8 pM, which has improved by as much as 4 orders of magnitude as compared with the conventional AuNP-based colorimetric assay and the label-free luminescence assay and up to 4 orders of magnitude as compared with fluorescence resonance energy transfer (FRET)-based assay as well. Importantly, this method can be used to measure TNF-α-induced endogenous NF-κB p50 in HeLa cell nuclear extracts and might be further applied for the detection of various DNA-binding proteins and aptamer-binding molecules. PMID:23050558

  19. Reverse transcription-PCR assays for the differentiation of various US porcine epidemic diarrhea virus strains.

    PubMed

    Liu, Xinsheng; Wang, Qiuhong

    2016-08-01

    Concurrently, several porcine epidemic diarrhea virus (PEDV) variants are circulating in US swine farms, including the original US and the spike insertion-deletion (S-INDEL) strains. In this study, reverse transcription (RT)-PCR assays for the detection and differentiation of different US PEDV variants were developed based on the differences in the S1 domain of the spike (S) gene. This assay successfully differentiated three PEDV strains: PC22A (the original US virulent), Iowa106 (S-INDEL), and PC177 (S-197DEL) that was derived from cell culture adaptation and has a 197 amino acid-deletion in the S1 domain. The assays did not amplify the porcine deltacoronavirus OH-FD22 strain or transmissible gastroenteritis virus Miller strain. It is the first report on the development of RT-PCR assays allowing the detection and differentiation of all major types of US PEDV variants. PMID:27134071

  20. Real-Time Reverse Transcription-PCR Assay for Comprehensive Detection of Human Rhinoviruses▿

    PubMed Central

    Lu, Xiaoyan; Holloway, Brian; Dare, Ryan K.; Kuypers, Jane; Yagi, Shigeo; Williams, John V.; Hall, Caroline B.; Erdman, Dean D.

    2008-01-01

    Human rhinoviruses (HRVs) are important contributors to respiratory disease, but their healthcare burden remains unclear, primarily because of the lack of sensitive, accurate, and convenient means of determining their causal role. To address this, we developed and clinically validated the sensitivity and specificity of a real-time reverse transcription-PCR (RT-PCR) assay targeting the viral 5′ noncoding region defined by sequences obtained from all 100 currently recognized HRV prototype strains and 85 recently circulating field isolates. The assay successfully amplified all HRVs tested and could reproducibly detect 50 HRV RNA transcript copies, with a dynamic range of over 7 logs. In contrast, a quantified RNA transcript of human enterovirus 68 (HEV68) that showed the greatest sequence homology to the HRV primers and probe set was not detected below a concentration of 5 × 105 copies per reaction. Nucleic acid extracts of 111 coded respiratory specimens that were culture positive for HRV or HEV were tested with the HRV real-time RT-PCR assay and by two independent laboratories that used different in-house HRV/HEV RT-PCR assays. Eighty-seven HRV-culture-positive specimens were correctly identified by the real-time RT-PCR assay, and 4 of the 24 HEV-positive samples were positive for HRV. HRV-specific sequences subsequently were identified in these four specimens, suggesting HRV/HEV coinfection in these patients. The assay was successfully applied in an investigation of a coincidental outbreak of HRV respiratory illness among laboratory staff. PMID:18057136

  1. Divergent transcriptional activities determine limb identity

    PubMed Central

    Ouimette, Jean-François; Jolin, Marisol Lavertu; L'honoré, Aurore; Gifuni, Anthony; Drouin, Jacques

    2010-01-01

    Limbs develop using a common genetic programme despite widely differing morphologies. This programme is modulated by limb-restricted regulators such as hindlimb (HL) transcription factors Pitx1 and Tbx4 and the forelimb (FL) Tbx5. Both Tbx factors have been implicated in limb patterning and growth, but their relative activities and underlying mechanisms remain unclear. In this paper, we show that Tbx4 and Tbx5 harbour conserved and divergent transcriptional regulatory domains that account for their roles in limb development. In particular, both factors share an activator domain and the ability to stimulate limb growth. However, we find that Tbx4 is the primary effector of HL identity for both skeletal and muscle development; this activity relies on a repressor domain that is inactivated by a human TBX4 small-patella syndrome mutation. We propose that limb identity is largely achieved by default in FL, whereas a specific repressor activity unique to Tbx4 determines HL identity. PMID:20975709

  2. Requirement of nuclear localization and transcriptional activity of p53 for its targeting to the yolk syncytial layer (YSL) nuclei in zebrafish embryo and its use for apoptosis assay

    SciTech Connect

    Chen, G.-D.; Chou, C.-M.; Hwang, S.-P.L.; Wang, F.-F.; Chen, Y.-C.; Hung, C.-C.; Chen, Jeou-Yuan . E-mail: bmchen@ibms.sinica.edu.tw; Huang, C.-J. . E-mail: cjibc@gate.sinica.edu.tw

    2006-05-26

    We expressed zebrafish p53 protein fused to GFP by a neuron-specific HuC promoter in zebrafish embryos. Instead of displaying neuronal expression patterns, p53-GFP was targeted to zebrafish YSL nuclei. This YSL targeting is p53 sequence-specific because GFP fusion proteins of p63 and p73 displayed neuronal-specific patterns. To dissect the underlying mechanisms, various constructs encoding a series of p53 mutant proteins under the control of different promoters were generated. Our results showed that expression of p53, in early zebrafish embryo, is preferentially targeted to the nuclei of YSL, which is mediated by importin. Similarly, this targeting is abrogated when p53 nuclear localization signal is disrupted. In addition, the transcriptional activity of p53 is required for this targeting. We further showed that fusion of pro-apoptotic BAD protein to p53-GFP led to apoptosis of YSL cells, and subsequent imperfect microtubule formation and abnormal blastomere movements.

  3. Evaluation of the Hologic Panther Transcription-Mediated Amplification Assay for Detection of Mycoplasma genitalium.

    PubMed

    Tabrizi, S N; Costa, A M; Su, J; Lowe, P; Bradshaw, C S; Fairley, C K; Garland, S M

    2016-08-01

    The detection of Mycoplasma genitalium was evaluated on 1,080 urine samples by the use of a Panther instrument. Overall sensitivity, specificity, positive predictive values, and negative predictive values were 100%, 99.4%, 93.6%, and 100%, respectively. Detection of M. genitalium by the use of the Panther transcription-mediated amplification assay offers a simple, accurate, and sensitive platform for diagnostic laboratories. PMID:27307453

  4. Activating transcription factor 2 in mesenchymal tumors.

    PubMed

    Endo, Makoto; Su, Le; Nielsen, Torsten O

    2014-02-01

    Activating transcription factor 2 (ATF2) is a member of activator protein 1 superfamily, which can heterodimerize with other transcription factors regulating cell differentiation and survival. ATF2 assembles into a complex with the synovial sarcoma translocation, chromosome 18 (SS18)-synovial sarcoma, X breakpoint (SSX) fusion oncoprotein, and the transducin-like enhancer of split 1 (TLE1) corepressor, driving oncogenesis in synovial sarcoma. The fusion oncoproteins in many other translocation-associated sarcomas incorporate transcription factors from the ATF/cAMP response element binding or E26 families, which potentially form heterodimers with ATF2 to regulate transcription. ATF2 may therefore play an important role in the oncogenesis of many mesenchymal tumors, but as yet, little is known about its protein expression in patient specimens. Herein we perform immunohistochemical analyses using a validated specific antibody for ATF2 expression and intracellular localization on a cohort of 594 malignant and 207 benign mesenchymal tumors representing 47 diagnostic entities. Melanoma served as a positive control for nuclear and cytoplasmic staining. High nuclear ATF2 expression was mainly observed in translocation-associated and/or spindle cell sarcomas including synovial sarcoma, desmoplastic small round cell tumor, endometrial stromal sarcoma, gastrointestinal stromal tumor, malignant peripheral nerve sheath tumor, and solitary fibrous tumor. Cytoplasmic ATF2 expression was less frequently seen than nuclear expression in malignant mesenchymal tumors. Benign mesenchymal tumors mostly showed much lower nuclear and cytoplasmic ATF2 expression. PMID:24289970

  5. Assay of DAGLα/β Activity.

    PubMed

    Bisogno, Tiziana

    2016-01-01

    The endocannabinoid 2-arachidonoylglycerol (2-AG) exerts its physiological action by binding to and functionally activating type-1 (CB1) and type-2 (CB2) cannabinoid receptors. It is thought to be produced through the action of sn-1 selective diacylglycerol lipase (DAGL) that catalyzes 2-AG biosynthesis from sn-2-arachidonate-containing diacylglycerols. Since 2-AG biosynthetic enzymes have been identified only recently, little information on methodological approaches for measuring DAGL activity is as yet available. Here, a highly sensitive radiometric assay to measure DAGL activity by using 1-oleoyl[1-(14)C]-2-arachidonoylglycerol as the substrate is reported. All the steps needed to perform lipid extraction, fractionation by thin-layer chromatography (TLC), and quantification of radiolabeled [(14)C]-oleic acid via scintillation counting are described in detail. PMID:27245901

  6. A new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay.

    PubMed

    Amer, H M; Abd El Wahed, A; Shalaby, M A; Almajhdi, F N; Hufert, F T; Weidmann, M

    2013-11-01

    Bovine coronavirus (BCoV) is an economically significant cause of calf scours and winter dysentery of adult cattle, and may induce respiratory tract infections in cattle of all ages. Early diagnosis of BCoV helps to diminish its burden on the dairy and beef industry. Real-time RT-PCR assay for the detection of BCoV has been described, but it is relatively expensive, requires well-equipped laboratories and is not suitable for on-site screening. A novel assay, using reverse transcription recombinase polymerase amplification (RT-RPA), for the detection of BCoV is developed. The BCoV RT-RPA was rapid (10-20 min) and has an analytical sensitivity of 19 molecules. No cross-reactivity with other viruses causing bovine gastrointestinal and/or respiratory infections was observed. The assay performance on clinical samples was validated by testing 16 fecal and 14 nasal swab specimens and compared to real-time RT-PCR. Both assays provided comparable results. The RT-RPA assay was significantly more rapid than the real-time RT-PCR assay. The BCoV RT-RPA constitutes a suitable accurate, sensitive and rapid alternative to the common measures used for BCoV diagnosis. In addition, the use of a portable fluorescence reading device extends its application potential to use in the field and point-of-care diagnosis. PMID:23811231

  7. A miniaturized fibrinolytic assay for plasminogen activators

    NASA Technical Reports Server (NTRS)

    Lewis, M. L.; Nachtwey, D. S.; Damron, K. L.

    1991-01-01

    This report describes a micro-clot lysis assay (MCLA) for evaluating fibrinolytic activity of plasminogen activators (PA). Fibrin clots were formed in wells of microtiter plates. Lysis of the clots by PA, indicated by change in turbidity (optical density, OD), was monitored with a microplate reader at five minutes intervals. Log-log plots of PA dilution versus endpoint, the time at which the OD value was halfway between the maximum and minimum value for each well, were linear over a broad range of PA concentrations (2-200 International units/ml). The MCLA is a modification and miniaturization of well established fibrinolytic methods. The significant practical advantages of the MCLA are that it is a simple, relatively sensitive, non-radioactive, quantitative, kinetic, fibrinolytic micro-technique which can be automated.

  8. Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Bovine Rotavirus

    PubMed Central

    2012-01-01

    Background Bovine rotavirus (BRV) infection is common in young calves. This viral infection causes acute diarrhea leading to death. Rapid identification of infected calves is essential to control BRV successfully. Therefore development of simple, highly specific, and sensitive detection method for BRV is needed. Results A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed and optimized for rapid detection of BRV. Specific primer sets were designed to target the sequences of the VP6 gene of the neonatal calf diarrhea virus (NCDV) strain of BRV. The RT-LAMP assay was performed in a water bath for 60 minutes at 63°C, and the amplification products were visualized either directly or under ultraviolet light. This BRV specific RT-LAMP assay could detect 3.32 copies of subtype A BRV. No cross-reactions were detected with other bovine pathogens. The ability of RT-LAMP to detect bovine rotavirus was further evaluated with 88 bovine rectal swab samples. Twenty-nine of these samples were found to be positive for BRV using RT-LAMP. The BRV-specific-RT-LAMP results were also confirmed by real-time RT-PCR assay. Conclusions The bovine rotavirus-specific RT-LAMP assay was highly sensitive and holds promise as a prompt and simple diagnostic method for the detection of group A bovine rotavirus infection in young calves. PMID:22894568

  9. Use of Bacteriophage MS2 as an Internal Control in Viral Reverse Transcription-PCR Assays

    PubMed Central

    Dreier, Jens; Störmer, Melanie; Kleesiek, Knut

    2005-01-01

    Diagnostic systems based on reverse transcription (RT)-PCR are widely used for the detection of viral genomes in different human specimens. The application of internal controls (IC) to monitor each step of nucleic acid amplification is necessary to prevent false-negative results due to inhibition or human error. In this study, we designed various real-time RT-PCRs utilizing the coliphage MS2 replicase gene, which differ in detection format, amplicon size, and efficiency of amplification. These noncompetitive IC assays, using TaqMan, hybridization probe, or duplex scorpion probe techniques, were tested on the LightCycler and Rotorgene systems. In our approach, clinical specimens were spiked with the control virus to monitor the efficiency of extraction, reverse transcription, and amplification steps. The MS2 RT-PCR assays were applied for internal control when using a second target hepatitis C virus RNA in duplex PCR in blood donor screening. The 95% detection limit was calculated by probit analysis to 44.9 copies per PCR (range, 38.4 to 73.4). As demonstrated routinely, application of MS2 IC assays exhibits low variability and can be applied in various RT-PCR assays. MS2 phage lysates were obtained under standard laboratory conditions. The quantification of phage and template RNA was performed by plating assays to determine PFU or via real-time RT-PCR. High stability of the MS2 phage preparations stored at −20°C, 4°C, and room temperature was demonstrated. PMID:16145106

  10. Analyte detection using an active assay

    DOEpatents

    Morozov, Victor; Bailey, Charles L.; Evanskey, Melissa R.

    2010-11-02

    Analytes using an active assay may be detected by introducing an analyte solution containing a plurality of analytes to a lacquered membrane. The lacquered membrane may be a membrane having at least one surface treated with a layer of polymers. The lacquered membrane may be semi-permeable to nonanalytes. The layer of polymers may include cross-linked polymers. A plurality of probe molecules may be arrayed and immobilized on the lacquered membrane. An external force may be applied to the analyte solution to move the analytes towards the lacquered membrane. Movement may cause some or all of the analytes to bind to the lacquered membrane. In cases where probe molecules are presented, some or all of the analytes may bind to probe molecules. The direction of the external force may be reversed to remove unbound or weakly bound analytes. Bound analytes may be detected using known detection types.

  11. Modulating temporal control of NF-kappaB activation: implications for therapeutic and assay selection.

    PubMed

    Klinke, David J; Ustyugova, Irina V; Brundage, Kathleen M; Barnett, John B

    2008-06-01

    The activation of transcription factor NF-kappaB (nuclear factor-kappaB) plays a central role in the induction of many inflammatory response genes. This process is characterized by either oscillations or stable induction of NF-kappaB nuclear binding. Changes in dynamics of binding result in the expression of distinct subsets of genes leading to different physiological outcomes. We examined NF-kappaB DNA binding activity in lipopolysaccharide (LPS)-stimulated IC-21 cells by electromobility shift assay and nonradioactive transcription factor assay and interpreted the results using a kinetic model of NF-kappaB activation. Both assays detected damped oscillatory behavior of NF-kappaB with differences in sensitivity and reproducibility. 3,4-Dichloropropionaniline (DCPA) was used to modulate the oscillatory behavior of NF-kappaB after LPS stimulation. DCPA is known to inhibit the production of two NF-kappaB-inducible cytokines, IL-6 and tumor necrosis factor alpha, by reducing but not completely abrogating NF-kappaB-induced transcription. DCPA treatment resulted in a potentiation of early LPS-induced NF-kappaB activation. The nonradioactive transcription factor assay, which has a higher signal/noise ratio than the electromobility shift assay, combined with in silico modeling, produced results that revealed changes in NF-kappaB dynamics which, to the best of our knowledge, have never been previously reported. These results highlight the importance of cell type and stimulus specificity in transcription factor activity assessment. In addition, assay selection has important implications for network inference and drug discovery. PMID:18281385

  12. Modulating Temporal Control of NF-κB Activation: Implications for Therapeutic and Assay Selection

    PubMed Central

    Klinke, David J.; Ustyugova, Irina V.; Brundage, Kathleen M.; Barnett, John B.

    2008-01-01

    The activation of transcription factor NF-κB (nuclear factor-κB) plays a central role in the induction of many inflammatory response genes. This process is characterized by either oscillations or stable induction of NF-κB nuclear binding. Changes in dynamics of binding result in the expression of distinct subsets of genes leading to different physiological outcomes. We examined NF-κB DNA binding activity in lipopolysaccharide (LPS)-stimulated IC-21 cells by electromobility shift assay and nonradioactive transcription factor assay and interpreted the results using a kinetic model of NF-κB activation. Both assays detected damped oscillatory behavior of NF-κB with differences in sensitivity and reproducibility. 3,4-Dichloropropionaniline (DCPA) was used to modulate the oscillatory behavior of NF-κB after LPS stimulation. DCPA is known to inhibit the production of two NF-κB-inducible cytokines, IL-6 and tumor necrosis factor α, by reducing but not completely abrogating NF-κB-induced transcription. DCPA treatment resulted in a potentiation of early LPS-induced NF-κB activation. The nonradioactive transcription factor assay, which has a higher signal/noise ratio than the electromobility shift assay, combined with in silico modeling, produced results that revealed changes in NF-κB dynamics which, to the best of our knowledge, have never been previously reported. These results highlight the importance of cell type and stimulus specificity in transcription factor activity assessment. In addition, assay selection has important implications for network inference and drug discovery. PMID:18281385

  13. Transcriptional activation in an improved whole-cell extract from Saccharomyces cerevisiae.

    PubMed Central

    Woontner, M; Wade, P A; Bonner, J; Jaehning, J A

    1991-01-01

    We report an improved in vitro transcription system for Saccharomyces cerevisiae. Small changes in assay and whole-cell extraction procedures increase selective initiation by RNA polymerase II up to 60-fold over previous conditions (M. Woontner and J. A. Jaehning, J. Biol. Chem. 265:8979-8982, 1990), to levels comparable to those obtained with nuclear extracts. We have found that the simultaneous use of distinguishable templates with and without an upstream activation sequence is critical to the measurement of apparent activation. Transcription from any template was very sensitive to the concentrations of template and nontemplate DNA, extract, and activator (GAL4/VP16). Alterations in reaction conditions led to proportionately greater changes from a template lacking an upstream activation sequence; thus, the apparent ratio of activation is largely dependent on the level of basal transcription. Using optimal conditions for activation, we have also demonstrated activation by a bona fide yeast activator, heat shock transcription factor. Images PMID:1875938

  14. Transcriptional activation in an improved whole-cell extract from Saccharomyces cerevisiae.

    PubMed

    Woontner, M; Wade, P A; Bonner, J; Jaehning, J A

    1991-09-01

    We report an improved in vitro transcription system for Saccharomyces cerevisiae. Small changes in assay and whole-cell extraction procedures increase selective initiation by RNA polymerase II up to 60-fold over previous conditions (M. Woontner and J. A. Jaehning, J. Biol. Chem. 265:8979-8982, 1990), to levels comparable to those obtained with nuclear extracts. We have found that the simultaneous use of distinguishable templates with and without an upstream activation sequence is critical to the measurement of apparent activation. Transcription from any template was very sensitive to the concentrations of template and nontemplate DNA, extract, and activator (GAL4/VP16). Alterations in reaction conditions led to proportionately greater changes from a template lacking an upstream activation sequence; thus, the apparent ratio of activation is largely dependent on the level of basal transcription. Using optimal conditions for activation, we have also demonstrated activation by a bona fide yeast activator, heat shock transcription factor. PMID:1875938

  15. Staphylococcus aureus Cell Extract Transcription-Translation Assay: Firefly Luciferase Reporter System for Evaluating Protein Translation Inhibitors

    PubMed Central

    Murray, Robert W.; Melchior, Earline P.; Hagadorn, Jeanne C.; Marotti, Keith R.

    2001-01-01

    The promoter for the Staphylococcus aureus capsule polysaccharide synthesis gene (cap1A) was cloned in front of the firefly luciferase gene for use in a cell extract S. aureus transcription-translation system. The assay is rapid, reproducible, and sensitive and has a lower background level than the radiolabeled amino acid incorporation translation assays. We present data evaluating a transcription inhibitor and a number of protein translation inhibitors in this system. PMID:11353649

  16. Modified bimolecular fluorescence complementation assay to study the inhibition of transcription complex formation by JAZ proteins.

    PubMed

    Qi, Tiancong; Song, Susheng; Xie, Daoxin

    2013-01-01

    The jasmonate (JA) ZIM-domain (JAZ) proteins of Arabidopsis thaliana repress JA signaling and negatively regulate the JA responses. Recently, JAZ proteins have been found to inhibit the transcriptional function of several transcription factors, among which the basic helix-loop-helix (bHLH) (GLABRA3 [GL3], ENHANCER OF GLABRA3 [EGL3], and TRANSPARENT TESTA8 [TT8]) and R2R3-MYB (GL1 and MYB75) that can interact with each other to form bHLH-MYB complexes and further control gene expression. The bimolecular fluorescence complementation (BiFC) assay is a widely used technique to study protein-protein interactions in living cells. Here we describe a modified BiFC experimental procedure to study the inhibition of the formation of the bHLH (GL3)-MYB (GL1) complex by JAZ proteins. PMID:23615997

  17. The synchronous active neutron detection assay system

    SciTech Connect

    Pickrell, M.M.; Kendall, P.K.

    1994-08-01

    We have begun to develop a novel technique for active neutron assay of fissile material in spent nuclear fuel. This approach will exploit a 14-MeV neutron generator developed by Schlumberger. The technique, termed synchronous active neutron detection (SAND), follows a method used routinely in other branches of physics to detect very small signals in presence of large backgrounds. Synchronous detection instruments are widely available commercially and are termed ``lock-in`` amplifiers. We have implemented a digital lock-in amplifier in conjunction with the Schlumberger neutron generator to explore the possibility of synchronous detection with active neutrons. The Schlumberger system can operate at up to a 50% duty factor, in effect, a square wave of neutron yield. Results are preliminary but promising. The system is capable of resolving the fissile material contained in a small fraction of the fuel rods in a cold fuel assembly; it also appears resilient to background neutron interference. The interrogating neutrons appear to be non-thermal and penetrating. Work remains to fully explore relevant physics and optimize instrument design.

  18. The synchronous active neutron detection assay system

    SciTech Connect

    Pickrell, M.M.; Kendall, P.K.

    1994-09-01

    The authors have begun to develop a novel technique for active neutron assay of fissile material in spent nuclear fuel. They are using a Schlumberger neutron generator for the direct measurement of the fissile material content in spent fuel, in place of the indirect measures used at present. The technique they are investigating is termed synchronous active neutron detection (SAND). It closely follows a method that has been used routinely in other branches of physics for the detection of very small signals in the presence of large backgrounds. Synchronous detection instruments are widely available commercially and are termed ``lock-in`` amplifiers. They have implemented a digital lock-in amplifier in conjunction with the Schlumberger neutron generator to explore the possibility of synchronous detection with active neutrons. The results to data are preliminary but quite promising. The system is capable of resolving the fissile material contained in a small fraction of the fuel rods in a cold fuel assembly. It also appears to be quite resilient to background neutron interference.

  19. A Reverse Transcription Loop-Mediated Isothermal Amplification Assay Optimized to Detect Multiple HIV Subtypes

    PubMed Central

    Ocwieja, Karen E.; Sherrill-Mix, Scott; Liu, Changchun; Song, Jinzhao; Bau, Haim; Bushman, Frederic D.

    2015-01-01

    Diagnostic methods for detecting and quantifying HIV RNA have been improving, but efficient methods for point-of-care analysis are still needed, particularly for applications in resource-limited settings. Detection based on reverse-transcription loop-mediated isothermal amplification (RT-LAMP) is particularly useful for this, because when combined with fluorescence-based DNA detection, RT-LAMP can be implemented with minimal equipment and expense. Assays have been developed to detect HIV RNA with RT-LAMP, but existing methods detect only a limited subset of HIV subtypes. Here we report a bioinformatic study to develop optimized primers, followed by empirical testing of 44 new primer designs. One primer set (ACeIN-26), targeting the HIV integrase coding region, consistently detected subtypes A, B, C, D, and G. The assay was sensitive to at least 5000 copies per reaction for subtypes A, B, C, D, and G, with Z-factors of above 0.69 (detection of the minor subtype F was found to be unreliable). There are already rapid and efficient assays available for detecting HIV infection in a binary yes/no format, but the rapid RT-LAMP assay described here has additional uses, including 1) tracking response to medication by comparing longitudinal values for a subject, 2) detecting of infection in neonates unimpeded by the presence of maternal antibody, and 3) detecting infection prior to seroconversion. PMID:25675344

  20. Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Papaya ringspot virus.

    PubMed

    Shen, Wentao; Tuo, Decai; Yan, Pu; Yang, Yong; Li, Xiaoying; Zhou, Peng

    2014-08-01

    Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV), which causes disease symptoms similar to PRSV, threaten commercial production of both non-transgenic-papaya and PRSV-resistant transgenic papaya in China. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay to detect PLDMV was developed previously. In this study, the development of another RT-LAMP assay to distinguish among transgenic, PRSV-infected and PLDMV-infected papaya by detection of PRSV is reported. A set of four RT-LAMP primers was designed based on the highly conserved region of the P3 gene of PRSV. The RT-LAMP method was specific and sensitive in detecting PRSV, with a detection limit of 1.15×10(-6)μg of total RNA per reaction. Indeed, the reaction was 10 times more sensitive than one-step RT-PCR. Field application of the RT-LAMP assay demonstrated that samples positive for PRSV were detected only in non-transgenic papaya, whereas samples positive for PLDMV were detected only in commercialized PRSV-resistant transgenic papaya. This suggests that PRSV remains the major limiting factor for non-transgenic-papaya production, and the emergence of PLDMV threatens the commercial transgenic cultivar in China. However, this study, combined with the earlier development of an RT-LAMP assay for PLDMV, will provide a rapid, sensitive and cost-effective diagnostic power to distinguish virus infections in papaya. PMID:24769198

  1. Analysis of LPS-induced, NFκB-dependent interleukin-8 transcription in kidney embryonic cell line expressing TLR4 using luciferase assay.

    PubMed

    Yunusova, Tamara; Akhtar, Mumtaz; Poltoratsky, Vladimir

    2014-01-01

    Gene expression is orchestrated by a complex network of signal transduction pathways that typically originate on cell surface receptors and culminate in DNA-binding transcription factors, which translocate to the nucleus and bind cis-regulatory elements in promoter regions of genes, thereby inducing de novo synthesis of the nascent RNA transcripts and their splicing. Gene expression arrays monitor abundance of the matured, spliced cDNA, which undergoes additional posttranscriptional modifications that greatly affect the half-life of the cDNA. Thus, the relative abundance of cDNA is not necessarily commensurable with the activity of promoters of the corresponding genes. In contrast, reporter gene assays provide valuable insight into the regulation of gene expression at the level of transcription and allow for discerning the contribution of individual transcription factors into changes in gene expression. Here, we describe a robust reporter gene assay method that is useful for exploration of transcription regulatory network, which regulates gene expression in response to inflammation. The method is exemplified by using the promoter region of the prototypic pro-inflammatory chemokine interleukin-8 (IL-8, CXCL8), which plays an important role in immune response as well as carcinogenesis. Using the luciferase reporter gene assay, we analyze the activation status of the IL-8 promoter in lipopolysaccharide (LPS)-stimulated human embryonic kidney cells. PMID:24908317

  2. A Spectrophotometric Assay Optimizing Conditions for Pepsin Activity.

    ERIC Educational Resources Information Center

    Harding, Ethelynda E.; Kimsey, R. Scott

    1998-01-01

    Describes a laboratory protocol optimizing the conditions for the assay of pepsin activity using the Coomasie Blue dye binding assay of protein concentration. The dye bonds through strong, noncovalent interactions to basic and aromatic amino acid residues. (DDR)

  3. Quantitative comparisons of in vitro assays for estrogenic activities.

    PubMed Central

    Fang, H; Tong, W; Perkins, R; Soto, A M; Prechtl, N V; Sheehan, D M

    2000-01-01

    Substances that may act as estrogens show a broad chemical structural diversity. To thoroughly address the question of possible adverse estrogenic effects, reliable methods are needed to detect and identify the chemicals of these diverse structural classes. We compared three assays--in vitro estrogen receptor competitive binding assays (ER binding assays), yeast-based reporter gene assays (yeast assays), and the MCF-7 cell proliferation assay (E-SCREEN assay)--to determine their quantitative agreement in identifying structurally diverse estrogens. We examined assay performance for relative sensitivity, detection of active/inactive chemicals, and estrogen/antiestrogen activities. In this examination, we combined individual data sets in a specific, quantitative data mining exercise. Data sets for at least 29 chemicals from five laboratories were analyzed pair-wise by X-Y plots. The ER binding assay was a good predictor for the other two assay results when the antiestrogens were excluded (r(2) is 0.78 for the yeast assays and 0.85 for the E-SCREEN assays). Additionally, the examination strongly suggests that biologic information that is not apparent from any of the individual assays can be discovered by quantitative pair-wise comparisons among assays. Antiestrogens are identified as outliers in the ER binding/yeast assay, while complete antagonists are identified in the ER binding and E-SCREEN assays. Furthermore, the presence of outliers may be explained by different mechanisms that induce an endocrine response, different impurities in different batches of chemicals, different species sensitivity, or limitations of the assay techniques. Although these assays involve different levels of biologic complexity, the major conclusion is that they generally provided consistent information in quantitatively determining estrogenic activity for the five data sets examined. The results should provide guidance for expanded data mining examinations and the selection of appropriate

  4. In simple synthetic promoters YY1-induced DNA bending is important in transcription activation and repression.

    PubMed Central

    Kim, J; Shapiro, D J

    1996-01-01

    Depending on promoter context, YY1 can activate or repress transcription, or provide a site for transcription initiation. To investigate whether the ability of YY1 to induce DNA bending influenced its ability to activate and repress transcription, simple synthetic promoters were constructed in which the YY1 binding site was inserted between the TATA box and either the NF1 or AP1 recognition sequences. In transient transfections of COS cells, the NF1YY1TATA and NF1RYY1TATA promoters exhibited a dramatic 15-20-fold increase in correctly initiated transcription. These promoters exhibited even larger 60-80-fold increases in transcription in HeLa cells. Neither multiple copies of the YY1 binding site alone, nor placement of a YY1 site upstream of the NF1 site activated transcription. Deletion of 4 bp between the NF1 and YY1 sites, which changes the phase of the DNA bends, abolished the 16-fold activation of transcription by NF1YY1TATA. Insertion of the YY1 site between the AP1 site and the TATA box decreased transcription approximately 3-fold. Replacing the YY1 binding site with an intrinsic DNA bending sequence mimicked this transcription repression. Sequences of similar length which do not bend DNA fail to repress AP1-mediated transcription. Gel mobility shift assays were used to show that binding of YY1 to its recognition sequence did not repress binding of AP1 to its recognition sequences. Our data indicate that YY1-induced DNA bending may activate and repress transcription by changing the spatial relationships between transcription activators and components of the basal transcription apparatus. PMID:8932392

  5. Reverse transcription genome exponential amplification reaction assay for rapid and universal detection of human rhinoviruses.

    PubMed

    Guan, Li; Zhao, Lin-Qing; Zhou, Hang-Yu; Nie, Kai; Li, Xin-Na; Zhang, Dan; Song, Juan; Qian, Yuan; Ma, Xue-Jun

    2016-07-01

    Human rhinoviruses (HRVs) have long been recognized as the cause of more than one-half of acute viral upper respiratory illnesses, and they are associated with more-serious diseases in children, such as asthma, acute otitis media and pneumonia. A rapid and universal test for of HRV infection is in high demand. In this study, a reverse transcription genome exponential amplification reaction (RT-GEAR) assay targeting the HRV 5' untranslated region (UTR) was developed for pan-HRV detection. The reaction was performed in a single tube in one step at 65 °C for 60 min using a real-time fluorometer (Genie(®)II; Optigene). The RT-GEAR assay showed no cross-reactivity with common human enteroviruses, including HEV71, CVA16, CVA6, CVA10, CVA24, CVB5, Echo30, and PV1-3 or with other common respiratory viruses including FluA H3, FluB, PIV1-4, ADV3, RSVA, RSVB and HMPV. With in vitro-transcribed RNA containing the amplified regions of HRV-A60, HRV-B06 and HRV-C07 as templates, the sensitivity of the RT-GEAR assay was 5, 50 and 5 copies/reaction, respectively. Experiments to evaluate the clinical performance of the RT-GEAR assay were also carried out with a panel of 143 previously verified samples, and the results were compared with those obtained using a published semi-nested PCR assay followed by sequencing. The tested panel comprised 91 HRV-negative samples and 52 HRV-positive samples (18 HRV-A-positive samples, 3 HRV-B-positive samples and 31 HRV-C-positive samples). The sensitivity and specificity of the pan-HRVs RT-GEAR assay was 98.08 % and 100 %, respectively. The kappa correlation between the two methods was 0.985. The RT-GEAR assay based on a portable Genie(®)II fluorometer is a sensitive, specific and rapid assay for the universal detection of HRV infection. PMID:27132014

  6. The transcriptional corepressor DSP1 inhibits activated transcription by disrupting TFIIA-TBP complex formation.

    PubMed Central

    Kirov, N C; Lieberman, P M; Rushlow, C

    1996-01-01

    Transcriptional repression of eukaryotic genes is essential for many cellular and developmental processes, yet the precise mechanisms of repression remain poorly understood. The Dorsal Switch Protein (DSP1) was identified in a genetic screen for activities which convert Dorsal into a transcriptional repressor. DSP1 shares structural homology with the HMG-1/2 family and inhibits activation by the rel transcription factors Dorsal and NF-kappaB in transfection studies. Here we investigate the mechanism of transcriptional repression by DSP1. We found that DSP1 protein can act as a potent transcriptional repressor for multiple activator families in vitro and in transfection studies. DSP1 bound directly to the TATA binding protein (TBP), and formed a stable ternary complex with TBP bound to DNA. DSP1 preferentially disrupted the DNA binding of TBP complexes containing TFIIA and displaced TFIIA from binding to TBP. Consistent with the inhibition of TFIIA-bound complexes, DSP1 was shown to inhibit activated but not basal transcription reactions in vitro. The ability of DSP1 to interact with TBP and to repress transcription was mapped to the carboxy-terminal domain which contains two HMG boxes. Our results support the model that DSP1 represses activated transcription by interfering with the binding of TFIIA, a general transcription factor implicated in activated transcription pathways. Images PMID:9003783

  7. A position-dependent transcription-activating domain in TFIIIA.

    PubMed

    Mao, X; Darby, M K

    1993-12-01

    Transcription of the Xenopus 5S RNA gene by RNA polymerase III requires the gene-specific factor TFIIIA. To identify domains within TFIIIA that are essential for transcriptional activation, we have expressed C-terminal deletion, substitution, and insertion mutants of TFIIIA in bacteria as fusions with maltose-binding protein (MBP). The MBP-TFIIIA fusion protein specifically binds to the 5S RNA gene internal control region and complements transcription in a TFIIIA-depleted oocyte nuclear extract. Random, cassette-mediated mutagenesis of the carboxyl region of TFIIIA, which is not required for promoter binding, has defined a 14-amino-acid region that is critical for transcriptional activation. In contrast to activators of RNA polymerase II, the activity of the TFIIIA activation domain is strikingly sensitive to its position relative to the DNA-binding domain. When the eight amino acids that separate the transcription-activating domain from the last zinc finger are deleted, transcriptional activity is lost. Surprisingly, diverse amino acids can replace these eight amino acids with restoration of full transcriptional activity, suggesting that the length and not the sequence of this region is important. Insertion of amino acids between the zinc finger region and the transcription-activating domain causes a reduction in transcription proportional to the number of amino acids introduced. We propose that to function, the transcription-activating domain of TFIIIA must be correctly positioned at a minimum distance from the DNA-binding domain. PMID:8246967

  8. Biochemical assays on plasminogen activators and hormones from kidney sources

    NASA Technical Reports Server (NTRS)

    Barlow, Grant H.; Lewis, Marian L.; Morrison, Dennis R.

    1988-01-01

    Investigations were established for the purpose of analyzing the conditioned media from human embryonic kidney cell subpopulations separated in space by electrophoresis. This data is based on the experiments performed on STS-8 on the continuous flow electrophoresis system. The primary biological activity that was analyzed was plasminogen activator activity, but some assays for erythropoeitin and human granulocyte colony stimulating activity were also performed. It is concluded that a battery of assays are required to completely define the plasminogen activator profile of a conditioned media from cell culture. Each type of assay measures different parts of the mixture and are influenced by different parameters. The functional role of each assay is given along with an indication of which combination of assays are required to answer specific questions. With this type of information it is possible by combinations of assays with mathematical analysis to pinpoint a specific component of the system.

  9. Protein Inhibitors of Activated STAT (Pias1 and Piasy) Differentially Regulate Pituitary Homeobox 2 (PITX2) Transcriptional Activity*

    PubMed Central

    Wang, Jianbo; Sun, Zhao; Zhang, Zichao; Saadi, Irfan; Wang, Jun; Li, Xiao; Gao, Shan; Engle, Jamison J.; Kuburas, Adisa; Fu, Xueyao; Yu, Wenjie; Klein, William H.; Russo, Andrew F.; Amendt, Brad A.

    2013-01-01

    Protein inhibitors of activated STAT (Pias) proteins can act independent of sumoylation to modulate the activity of transcription factors and Pias proteins interacting with transcription factors can either activate or repress their activity. Pias proteins are expressed in many tissues and cells during development and we asked if Pias proteins regulated the pituitary homeobox 2 (PITX2) homeodomain protein, which modulates developmental gene expression. Piasy and Pias1 proteins are expressed during craniofacial/tooth development and directly interact and differentially regulate PITX2 transcriptional activity. Piasy and Pias1 are co-expressed in craniofacial tissues with PITX2. Yeast two-hybrid, co-immunoprecipitation and pulldown experiments demonstrate Piasy and Pias1 interactions with the PITX2 protein. Piasy interacts with the PITX2 C-terminal tail to attenuate its transcriptional activity. In contrast, Pias1 interacts with the PITX2 C-terminal tail to increase PITX2 transcriptional activity. The E3 ligase activity associated with the RING domain in Piasy is not required for the attenuation of PITX2 activity, however, the RING domain of Pias1 is required for enhanced PITX2 transcriptional activity. Bimolecular fluorescence complementation assays reveal PITX2 interactions with Piasy and Pias1 in the nucleus. Piasy represses the synergistic activation of PITX2 with interacting co-factors and Piasy represses Pias1 activation of PITX2 transcriptional activity. In contrast, Pias1 did not affect the synergistic interaction of PITX2 with transcriptional co-factors. Last, we demonstrate that Pias proteins form a complex with PITX2 and Lef-1, and PITX2 and β-catenin. Lef-1, β-catenin, and Pias interactions with PITX2 provide new molecular mechanisms for the regulation of PITX2 transcriptional activity and the activity of Pias proteins. PMID:23515314

  10. Transcriptional Control by A-Factor of strR, the Pathway-Specific Transcriptional Activator for Streptomycin Biosynthesis in Streptomyces griseus

    PubMed Central

    Tomono, Ayami; Tsai, Yisan; Yamazaki, Haruka; Ohnishi, Yasuo; Horinouchi, Sueharu

    2005-01-01

    A-factor (2-isocapryloyl-3R-hydroxymethyl-γ-butyrolactone) triggers streptomycin production by inducing the transcription of strR, encoding the pathway-specific transcriptional activator, through signal transduction in the A-factor regulatory cascade in Streptomyces griseus. AdpA, one of the key transcriptional activators in the cascade, bound two upstream activation sites, approximately at nucleotide positions −270 and −50 with respect to the transcriptional start point of strR, as determined by gel mobility shift assays and DNase I footprinting. Transcriptional analysis of the strR promoter with mutated AdpA-binding sites showed that both sites were required for full transcriptional activation of strR by AdpA. Potassium permanganate footprinting showed that AdpA assisted RNA polymerase in forming an open complex at an appropriate position for transcriptional initiation of strR. Nine transcriptional units within the streptomycin biosynthesis gene cluster, including the strR-aphD operon, depended on StrR, indicating that StrR is the pathway-specific transcriptional activator for the whole gene cluster. Consistent with this, expression of strR under the control of a constitutively expressed promoter in an adpA null mutant caused the host to produce streptomycin. PMID:16077104

  11. Reverse transcription loop-mediated isothermal amplification assay for detecting tomato chlorosis virus.

    PubMed

    Zhao, Li-ming; Li, Gang; Gao, Ying; Zhu, You-rong; Liu, Jin; Zhu, Xiao-ping

    2015-03-01

    A betaine-free reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed and optimised for detecting tomato chlorosis virus (ToCV), one of the most important viruses that infect tomato crops worldwide. A set of four specific primers was designed against the RNA-dependent RNA polymerase (RdRp) gene. The betaine-free RT-LAMP procedure could be completed within 40 min under isothermal conditions at 60 °C without a thermal cycler, and no cross-reactivity was seen with other tomato viral pathogens. Sensitivity analysis showed that RT-LAMP could detect viral dilutions up to 2.0×10(-7)ng, which is 100-times more sensitive than reverse transcription-polymerase chain reaction (RT-PCR). In addition, naked-eye observation after staining in-tube RT-LAMP products with SYBR Green I facilitated detection of ToCV by avoiding the requirement for ethidium staining following gel electrophoresis. These results suggest that ToCV RT-LAMP is a rapid, sensitive, and affordable diagnostic tool that is more suitable than RT-PCR for the detection and surveillance of ToCV in field samples. PMID:25486081

  12. Recent Applications for in Vitro Antioxidant Activity Assay.

    PubMed

    Bunaciu, Andrei A; Danet, Andrei Florin; Fleschin, Şerban; Aboul-Enein, Hassan Y

    2016-09-01

    This review presents some of the most recent aspects related to antioxidants and the basic kinetic models of inhibited autoxidation and analyzes the chemical principles of antioxidant capacity assays. Taking into account the reactions involved, in the antioxidant activity determinations, the assays can be classified into two main types: hydrogen atom transfer reactions and electron transfer. This review focuses on analytical methods used for antioxidant activity assay, published in the period 2009-2014. PMID:26575594

  13. IL-1 beta-dependent regulation of C/EBP delta transcriptional activity.

    PubMed

    Svotelis, Amy; Doyon, Geneviève; Bernatchez, Gérald; Désilets, Antoine; Rivard, Nathalie; Asselin, Claude

    2005-03-11

    We have previously shown that the transcription factor C/EBP delta is involved in the intestinal inflammatory response. C/EBP delta regulates several inflammatory response genes, such as haptoglobin, in the rat intestinal epithelial cell line IEC-6 in response to IL-1. However, the different C/EBP delta domains involved in IL-1 beta-mediated transcriptional activation and the kinases implicated have not been properly defined. To address this, we determined the role of the p38 MAP kinase in the regulation of C/EBP delta transcriptional activity. The IL-1-dependent induction of the acute phase protein gene haptoglobin in IEC-6 cells was decreased in response to the p38 MAP kinase inhibitor SB203580, as determined by Northern blot. Transcriptional activity of C/EBP delta was repressed by the specific inhibitor of the p38 MAP kinase, as assessed by transient transfection assays. Mutagenesis studies and transient transfection assays revealed an important domain for transcriptional activation between amino acids 70 and 108. This domain overlapped with a docking site for the p38 MAP kinase, between amino acids 75 and 85, necessary to insure C/EBP delta phosphorylation. Deletion of this domain led to a decrease in basal transcriptional activity of C/EBP delta and in p300-dependent transactivation, as assessed by transient transfection assays, and in IL-1-dependent haptoglobin induction. This unusual arrangement of a kinase docking site within a transactivation domain may functionally be important for the regulation of C/EBP delta transcriptional activity. PMID:15694370

  14. A Rapid and Quantitative Recombinase Activity Assay

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We present here a comparison between the recombinase systems FLP-FRT and Cre-loxP. A transient excision based dual luciferase expression assay is used for its rapid and repeatable nature. The detection system was designed within an intron to remove the remaining recombinase recognition site and no...

  15. Mechanisms of specificity in neuronal activity-regulated gene transcription

    PubMed Central

    Lyons, Michelle R.; West, Anne E.

    2011-01-01

    The brain is a highly adaptable organ that is capable of converting sensory information into changes in neuronal function. This plasticity allows behavior to be accommodated to the environment, providing an important evolutionary advantage. Neurons convert environmental stimuli into long-lasting changes in their physiology in part through the synaptic activity-regulated transcription of new gene products. Since the neurotransmitter-dependent regulation of Fos transcription was first discovered nearly 25 years ago, a wealth of studies have enriched our understanding of the molecular pathways that mediate activity-regulated changes in gene transcription. These findings show that a broad range of signaling pathways and transcriptional regulators can be engaged by neuronal activity to sculpt complex programs of stimulus-regulated gene transcription. However, the shear scope of the transcriptional pathways engaged by neuronal activity raises the question of how specificity in the nature of the transcriptional response is achieved in order to encode physiologically relevant responses to divergent stimuli. Here we summarize the general paradigms by which neuronal activity regulates transcription while focusing on the molecular mechanisms that confer differential stimulus-, cell-type-, and developmental-specificity upon activity-regulated programs of neuronal gene transcription. In addition, we preview some of the new technologies that will advance our future understanding of the mechanisms and consequences of activity-regulated gene transcription in the brain. PMID:21620929

  16. Constraints on transcriptional activator function contribute to transcriptional quiescence during early Xenopus embryogenesis.

    PubMed Central

    Almouzni, G; Wolffe, A P

    1995-01-01

    We have examined the cause of transcriptional quiescence prior to the mid-blastula transition (MBT) in Xenopus laevis. We have found distinct requirements for transcription of class II and class III genes. An artificial increase of the amount of DNA present within the embryo over that found at the MBT allows precocious transcription of tRNA genes, but not of the adenovirus E4 or human cytomegalovirus (CMV) promoters. Thus titration of an inhibitor by exogenous DNA determines class III but not class II gene activation. We demonstrate that the action of the inhibitor depends on the association of core histones with DNA. The addition of exogenous TBP, together with an increase in the amount of DNA within the embryo, allows significant basal transcription of class II genes prior to the MBT, whereas it does not increase transcription of tRNA genes. To examine the activation of transcription above basal levels, we used a defined minimal promoter containing five Gal4 binding sites and the activator Gal4-VP16. Precocious transcriptional activation is directed by Gal4-VP16 prior to the MBT, demonstrating that a functional transcriptional machinery exists at this early developmental stage. Furthermore, since this activation can occur in the absence of exogenous TBP or chromatin titration, a transcription factor that can penetrate chromatin is sufficient for recruitment of this machinery to a promoter. Our results support the hypothesis that the temporal regulation of transcription during early embryogenesis in Xenopus reflects not only a titration of inhibitors by DNA, but also a deficiency in the activity of transcriptional activators prior to the MBT. Images PMID:7737126

  17. Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

    PubMed Central

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

    2013-01-01

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

  18. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus.

    PubMed

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

  19. Mediator protein mutations that selectively abolish activated transcription.

    PubMed

    Myers, L C; Gustafsson, C M; Hayashibara, K C; Brown, P O; Kornberg, R D

    1999-01-01

    Deletion of any one of three subunits of the yeast Mediator of transcriptional regulation, Med2, Pgd1 (Hrs1), and Sin4, abolished activation by Gal4-VP16 in vitro. By contrast, other Mediator functions, stimulation of basal transcription and of TFIIH kinase activity, were unaffected. A different but overlapping Mediator subunit dependence was found for activation by Gcn4. The genetic requirements for activation in vivo were closely coincident with those in vitro. A whole genome expression profile of a Deltamed2 strain showed diminished transcription of a subset of inducible genes but only minor effects on "basal" transcription. These findings make an important connection between transcriptional activation in vitro and in vivo, and identify Mediator as a "global" transcriptional coactivator. PMID:9874773

  20. The Smad3 linker region contains a transcriptional activation domain.

    PubMed

    Wang, Guannan; Long, Jianyin; Matsuura, Isao; He, Dongming; Liu, Fang

    2005-02-15

    Transforming growth factor-beta (TGF-beta)/Smads regulate a wide variety of biological responses through transcriptional regulation of target genes. Smad3 plays a key role in TGF-beta/Smad-mediated transcriptional responses. Here, we show that the proline-rich linker region of Smad3 contains a transcriptional activation domain. When the linker region is fused to a heterologous DNA-binding domain, it activates transcription. We show that the linker region physically interacts with p300. The adenovirus E1a protein, which binds to p300, inhibits the transcriptional activity of the linker region, and overexpression of p300 can rescue the linker-mediated transcriptional activation. In contrast, an adenovirus E1a mutant, which cannot bind to p300, does not inhibit the linker-mediated transcription. The native Smad3 protein lacking the linker region is unable to mediate TGF-beta transcriptional activation responses, although it can be phosphorylated by the TGF-beta receptor at the C-terminal tail and has a significantly increased ability to form a heteromeric complex with Smad4. We show further that the linker region and the C-terminal domain of Smad3 synergize for transcriptional activation in the presence of TGF-beta. Thus our findings uncover an important function of the Smad3 linker region in Smad-mediated transcriptional control. PMID:15588252

  1. APTIMA® Trichomonas vaginalis, a transcription-mediated amplification assay for detection of Trichomonas vaginalis in urogenital specimens.

    PubMed

    Chapin, Kimberle; Andrea, Sarah

    2011-09-01

    The APTIMA(®) Trichomonas vaginalis (APTIMA TV; Gen-Probe Inc.) assay is the only amplification-based assay for T. vaginalis (TV) currently cleared by the US FDA. The assay was cleared in April 2011. APTIMA TV utilizes target capture specimen processing, transcription-mediated amplification and chemiluminescent probe hybridization for the qualitative detection of TV ribosomal RNA. The assay is used for the screening/diagnosis of trichomoniasis in women. Specimen types that can be used include physician-collected endocervical swabs, vaginal swabs, endocervical specimens collected in PreservCyt(®) (Thin Prep, Hologic Incorporated, MA, USA) solution and female urine specimens. The APTIMA TV assay has shown superior performance in side-by-side comparisons with other diagnostic methods in all patient populations and specimen types tested. Clinical sensitivity and specificity are >95 and 98%, respectively. The APTIMA TV assay fills a significant void in sexually transmitted infection diagnostics. PMID:21902528

  2. Cooperative activation of Xenopus rhodopsin transcription by paired-like transcription factors

    PubMed Central

    2014-01-01

    Background In vertebrates, rod photoreceptor-specific gene expression is regulated by the large Maf and Pax-like transcription factors, Nrl/LNrl and Crx/Otx5. The ubiquitous occurrence of their target DNA binding sites throughout rod-specific gene promoters suggests that multiple transcription factor interactions within the promoter are functionally important. Cooperative action by these transcription factors activates rod-specific genes such as rhodopsin. However, a quantitative mechanistic explanation of transcriptional rate determinants is lacking. Results We investigated the contributions of various paired-like transcription factors and their cognate cis-elements to rhodopsin gene activation using cultured cells to quantify activity. The Xenopus rhodopsin promoter (XOP) has a bipartite structure, with ~200 bp proximal to the start site (RPP) coordinating cooperative activation by Nrl/LNrl-Crx/Otx5 and the adjacent 5300 bp upstream sequence increasing the overall expression level. The synergistic activation by Nrl/LNrl-Crx/Otx5 also occurred when XOP was stably integrated into the genome. We determined that Crx/Otx5 synergistically activated transcription independently and additively through the two Pax-like cis-elements, BAT1 and Ret4, but not through Ret1. Other Pax-like family members, Rax1 and Rax2, do not synergistically activate XOP transcription with Nrl/LNrl and/or Crx/Otx5; rather they act as co-activators via the Ret1 cis-element. Conclusions We have provided a quantitative model of cooperative transcriptional activation of the rhodopsin promoter through interaction of Crx/Otx5 with Nrl/LNrl at two paired-like cis-elements proximal to the NRE and TATA binding site. Further, we have shown that Rax genes act in cooperation with Crx/Otx5 with Nrl/LNrl as co-activators of rhodopsin transcription. PMID:24499263

  3. Inhibition of transcriptional activity of c-JUN by SIRT1

    SciTech Connect

    Gao Zhanguo; Ye Jianping

    2008-11-28

    c-JUN is a major component of heterodimer transcription factor AP-1 (Activator Protein-1) that activates gene transcription in cell proliferation, inflammation and stress responses. SIRT1 (Sirtuin 1) is a histone deacetylase that controls gene transcription through modification of chromatin structure. However, it is not clear if SIRT1 regulates c-JUN activity in the control of gene transcription. Here, we show that SIRT1 associated with c-JUN in co-immunoprecipitation of whole cell lysate, and inhibited the transcriptional activity of c-JUN in the mammalian two hybridization system. SIRT1 was found in the AP-1 response element in the matrix metalloproteinase-9 (MMP9) promoter DNA leading to inhibition of histone 3 acetylation as shown in a ChIP assay. The SIRT1 signal was reduced by the AP-1 activator PMA, and induced by the SIRT1 activator Resveratrol in the promoter DNA. SIRT1-mediaetd inhibition of AP-1 was demonstrated in the MMP9 gene expression at the gene promoter, mRNA and protein levels. In mouse embryonic fibroblast (MEF) with SIRT1 deficiency (SIRT1{sup -/-}), mRNA and protein of MMP9 were increased in the basal condition, and the inhibitory activity of Resveratrol was significantly attenuated. Glucose-induced MMP9 expression was also inhibited by SIRT1 in response to Resveratrol. These data consistently suggest that SIRT1 directly inhibits the transcriptional activity of AP-1 by targeting c-JUN.

  4. The transcriptional activity of human Chromosome 22

    PubMed Central

    Rinn, John L.; Euskirchen, Ghia; Bertone, Paul; Martone, Rebecca; Luscombe, Nicholas M.; Hartman, Stephen; Harrison, Paul M.; Nelson, F. Kenneth; Miller, Perry; Gerstein, Mark; Weissman, Sherman; Snyder, Michael

    2003-01-01

    A DNA microarray representing nearly all of the unique sequences of human Chromosome 22 was constructed and used to measure global-transcriptional activity in placental poly(A)+ RNA. We found that many of the known, related and predicted genes are expressed. More importantly, our study reveals twice as many transcribed bases as have been reported previously. Many of the newly discovered expressed fragments were verified by RNA blot analysis and a novel technique called differential hybridization mapping (DHM). Interestingly, a significant fraction of these novel fragments are expressed antisense to previously annotated introns. The coding potential of these novel expressed regions is supported by their sequence conservation in the mouse genome. This study has greatly increased our understanding of the biological information encoded on a human chromosome. To facilitate the dissemination of these results to the scientific community, we have developed a comprehensive Web resource to present the findings of this study and other features of human Chromosome 22 at http://array.mbb.yale.edu/chr22. PMID:12600945

  5. SENSITIVE TO PROTON RHIZOTOXICITY1, CALMODULIN BINDING TRANSCRIPTION ACTIVATOR2, and Other Transcription Factors Are Involved in ALUMINUM-ACTIVATED MALATE TRANSPORTER1 Expression1[OPEN

    PubMed Central

    Tokizawa, Mutsutomo; Kobayashi, Yuriko; Saito, Tatsunori; Kobayashi, Masatomo; Iuchi, Satoshi; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y.; Koyama, Hiroyuki

    2015-01-01

    In Arabidopsis (Arabidopsis thaliana) the root apex is protected from aluminum (Al) rhizotoxicity by excretion of malate, an Al chelator, by ALUMINUM-ACTIVATED MALATE TRANSPORTER1 (AtALMT1). AtALMT1 expression is fundamentally regulated by the SENSITIVE TO PROTON RHIZOTOXICITY1 (STOP1) zinc finger protein, but other transcription factors have roles that enable Al-inducible expression with a broad dynamic range. In this study, we characterized multiple cis-elements in the AtALMT1 promoter that interact with transcription factors. In planta complementation assays of AtALMT1 driven by 5′ truncated promoters of different lengths showed that the promoter region between –540 and 0 (the first ATG) restored the Al-sensitive phenotype of atalm1 and thus contains cis-elements essential for AtALMT1 expression for Al tolerance. Computation of overrepresented octamers showed that eight regions in this promoter region contained potential cis-elements involved in Al induction and STOP1 regulation. Mutation in a position around –297 from the first ATG completely inactivated AtALMT1 expression and Al response. In vitro binding assays showed that this region contained the STOP1 binding site, which accounted for the recognition by four zinc finger domains of the protein. Other positions were characterized as cis-elements that regulated expression by repressors and activators and a transcription factor that determines root tip expression of AtALMT1. From the consensus of known cis-elements, we identified CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR2 to be an activator of AtALMT1 expression. Al-inducible expression of AtALMT1 changed transcription starting sites, which increased the abundance of transcripts with a shortened 5′ untranslated region. The present analyses identified multiple mechanisms that regulate AtALMT1 expression. PMID:25627216

  6. Transcription activation at class II CRP-dependent promoters: the role of different activating regions.

    PubMed Central

    Rhodius, V A; West, D M; Webster, C L; Busby, S J; Savery, N J

    1997-01-01

    Transcription activation by the Escherichia coli cyclic AMP receptor protein (CRP) at Class II promoters is dependent on direct interactions between two surface-exposed activating regions (AR1 and AR2) and two contact sites in RNA polymerase. The effects on transcription activation of disrupting either AR1 or AR2 have been measured at different Class II promoters. AR2 but not AR1 is essential for activation at all the Class II promoters that were tested. The effects of single positive control substitutions in AR1 and AR2 vary from one promoter to another: the effects of the different substitutions are contingent on the -35 hexamer sequence. Abortive initiation assays have been used to quantify the effects of positive control substitutions in each activating region on the kinetics of transcription initiation at the Class II CRP- dependent promoter pmelRcon. At this promoter, the HL159 substitution in AR1 results in a defect in the initial binding of RNA polymerase whilst the KE101 substitution in AR2 reduces the rate of isomerization from the closed to the open complex. PMID:9016561

  7. FHL2 mediates p53-induced transcriptional activation through a direct association with HIPK2

    SciTech Connect

    Lee, Sang-Wang . E-mail: umsj@sejong.ac.kr

    2006-01-27

    To understand the molecular mechanism underlying HIPK2 regulation of the transcriptional activation by p53, we sought to identify the protein that interacts with HIPK2. From our yeast two-hybrid screen, we found that four and a half LIM domains 2 (FHL2) could bind to the C-terminal half of HIPK2. Further assays in yeast mapped the minimal interaction domain to amino acids 812-907 in HIPK2. The interaction was confirmed using a GST pull-down assay in vitro, and an immunoprecipitation (IP) assay and fluorescence microscopy in vivo. FHL2 alone spread throughout both the cytoplasm and nucleus but was redistributed to dot-like structures in the nucleus when HIPK2 was coexpressed in HEK293 cells. When tethered to the Gal4-responsive promoter through the Gal4 DBD fusion, FHL2 showed autonomous transcriptional activity that was enhanced by wild-type HIPK2, but not by the kinase-defective mutant. In addition, FHL2 increased the p53-dependent transcriptional activation and had an additive effect on the activation when coexpressed with HIPK2, which was again not observed with the kinase-defective mutant of HIPK2. Finally, we found a ternary complex of p53, HIPK2, and FHL2 using IP, and their recruitment to the p53-responsive p21Waf1 promoter in chromatin IP assays. Overall, our findings indicate that FHL2 can also regulate p53 via a direct association with HIPK2.

  8. LRE2, an active human L1 element, has low level transcriptional activity and extremely low reverse transcriptase activity

    SciTech Connect

    Holmes, S.E.; Dombroski, B.A.; Sassaman, D.M.

    1994-09-01

    Previously, we found a 2 kb insertion containing a rearranged L1 element plus a unique sequence component (USC) within exon 48 of the dystrophin gene of a patient with muscular dystrophy. We used the USC to clone the precursor of this insertion, the second known {open_quotes}active{close_quotes} human L1 element. The locus LRE2 (L1 Retrotransposable Element 2) has an allele derived from the patient which matches the insertion sequence exactly. LRE2 has a perfect 13-15 bp target site duplication, 2 open reading frames (ORFs), and an unusual 21 bp truncation of the 5{prime} end in a region known to be important for L1 transcription. The truncated LRE2 promoter has about 20% of the transcriptional activity of a previously studied L1 promoter after transfection into NTera2D1 cells of a construct in which the L1 promoter drives the expression of a lacZ gene. In addition, the reverse transcriptase (RT) encoded by LRE2 is active in an in vivo pseudogene assay in yeast and an in vitro assay. However, in both assays the RT of LRE2 is 1-5% as active as that of LRE1. These data demonstrate that multiple {open_quotes}active{close_quotes} L1 elements exist in the human genome, and that active elements can have highly variable rates of transcription and reverse transcriptase activity. That the RT of LRE2 has extremely low activity suggests the possibility that retrotransposition of an L1 element may in some cases involve an RT encoded by another L1 element.

  9. PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a)

    PubMed Central

    Emerling, Brooke M.; Weinberg, Frank; Liu, Juinn-Lin; Mak, Tak W.; Chandel, Navdeep S.

    2008-01-01

    The tumor suppressor PTEN is mutated or deleted in many tumors, causing the activation of the PI3K pathway. Here, we show that the loss of PTEN increases the transcriptional activity of hypoxia-inducible factor 1 (HIF-1) through the inactivation of Forkhead transcription factors (FOXO) in PTEN-null cells. Reintroduction of PTEN into the nucleus, overexpression of a nonphosphorylatable FOXO3a, which accumulates in the nucleus, or inhibition of nuclear export of FOXO3a by leptomycin B represses HIF-1 transcriptional activity in PTEN-null cells. HIF-1 transcriptional activity increases in PTEN-positive cells depleted of FOXO3a with siRNA. PTEN and FOXO3a regulate the transactivation domain of HIF-1α. Chromatin immunoprecipitation indicates that FOXO3a complexes with HIF-1α and p300 on the Glut-1 promoter, a HIF-1 target gene. Overexpression of p300 reverses FOXO3a-mediated repression of HIF-1 transcriptional activity. Coimmunoprecipitation and GAL4-HIF-1α transactivation assays reveal that FOXO3a interferes with p300-dependent HIF-1 transcriptional activity. Thus, FOXO3a negatively regulates HIF-1 transcriptional activity. PMID:18268343

  10. Activation domains of transcription factors mediate replication dependent transcription from a minimal HIV-1 promoter.

    PubMed Central

    Williams, R D; Lee, B A; Jackson, S P; Proudfoot, N J

    1996-01-01

    Transcription from a minimal HIV-1 promoter containing the three Sp1 binding sites and TATA box can be activated without Tat by template DNA replication. Here we show that this activation can also be mediated by recombinant GAL4 fusion proteins containing the activation domains of Sp1, VP16 or CTF (or by full-length GAL4) targeted to the HIV-1 promoter by replacing the Sp1 sites with five GAL4 binding sites. Thus Sp1 is not unique in its ability to mediate replication activated transcription, although the degree of processivity elicited by the different activators varied significantly from strongly processive (GAL4-VP16) to relatively non-processive (GAL4-Sp1 or -CTF). Processive GAL4-VP16-activated transcription, but not efficient initiation, required multiple GAL4 binding sites. In the presence of Tat, transcription with GAL4-SP1 and GAL4-CTF was further activated (principally at the level of processivity) but GAL4-VP16-potentiated transcription was only slightly stimulated. The Tat-dependent switch from non-processive to fully processive transcription was particularly marked for GAL4-Sp1, an effect which may be relevant to the selection of Sp1 binding sites by the HIV-1 promoter. PMID:8604293

  11. Quantitative Analysis of the Relative Transcript Levels of ABC Transporter Atr Genes in Aspergillus nidulans by Real-Time Reverse Transcription-PCR Assay

    PubMed Central

    Pizeta Semighini, Camile; Marins, Mozart; Goldman, Maria Helena S.; Goldman, Gustavo Henrique

    2002-01-01

    The development of assays for quantitative analysis of the relative transcript levels of ABC transporter genes by real-time reverse transcription-PCR (RT-PCR) might provide important information about multidrug resistance in filamentous fungi. Here, we evaluate the potential of real-time RT-PCR to quantify the relative transcript levels of ABC transporter Atr genes from Aspergillus nidulans. The AtrA to AtrD genes showed different and higher levels in the presence of structurally unrelated drugs, such as camptothecin, imazalil, itraconazole, hygromycin, and 4-nitroquinoline oxide. We also verified the relative transcript levels of the Atr genes in the A. nidulans imazalil-resistant mutants. These genes displayed a very complex pattern in different ima genetic backgrounds. The imaB mutant has higher basal transcript levels of AtrB and -D than those of the wild-type strain. The levels of these two genes are comparable when the imaB mutant is grown in the presence and absence of imazalil. The imaC, -D, and -H mutants have higher basal levels of AtrA than that of the wild type. The same behavior is observed for the relative transcript levels of AtrB in the imaG mutant background. PMID:11872487

  12. Development of a consensus reverse transcription PCR assay for the specific detection of tortoise picornaviruses.

    PubMed

    Marschang, Rachel E; Ihász, Katalin; Kugler, Renáta; Lengyel, György; Fehér, Enikő; Marton, Szilvia; Bányai, Krisztián; Aqrawi, Tara; Farkas, Szilvia L

    2016-05-01

    Picornaviruses (PVs) of different terrestrial tortoise species, previously designated as Virus "X," have been frequently detected from various tissues by virus isolation in Terrapene heart cell culture as the preferred laboratory method for diagnosis. Here, we describe the development of 2 diagnostic reverse transcription (RT)-PCR-based assays for the identification and characterization of tortoise PVs belonging to the tentative genus Topivirus To test the novel diagnostic systems, PVs were isolated from swab and tissue samples collected in Germany, Italy, and Hungary between 2000 and 2013. All 25 tested isolates gave positive results with both novel consensus primer sets. Sequencing of the amplified products confirmed that all studied viruses were members of the new proposed genus Topivirus Phylogenetic analyses clearly distinguished 2 lineages within the genus. Based on sequence analysis, no association was observed between the geographic distribution and genetic relatedness. Furthermore, no strict host specificity was indicated. The PCR-based diagnosis may provide a time-saving and sensitive method to detect tortoise PVs, and evaluation of PV presence in these animals may help control virus spread. PMID:27034342

  13. The Small Molecule IMR-1 Inhibits the Notch Transcriptional Activation Complex to Suppress Tumorigenesis.

    PubMed

    Astudillo, Luisana; Da Silva, Thiago G; Wang, Zhiqiang; Han, Xiaoqing; Jin, Ke; VanWye, Jeffrey; Zhu, Xiaoxia; Weaver, Kelly; Oashi, Taiji; Lopes, Pedro E M; Orton, Darren; Neitzel, Leif R; Lee, Ethan; Landgraf, Ralf; Robbins, David J; MacKerell, Alexander D; Capobianco, Anthony J

    2016-06-15

    In many cancers, aberrant Notch activity has been demonstrated to play a role in the initiation and maintenance of the neoplastic phenotype and in cancer stem cells, which may allude to its additional involvement in metastasis and resistance to therapy. Therefore, Notch is an exceedingly attractive therapeutic target in cancer, but the full range of potential targets within the pathway has been underexplored. To date, there are no small-molecule inhibitors that directly target the intracellular Notch pathway or the assembly of the transcriptional activation complex. Here, we describe an in vitro assay that quantitatively measures the assembly of the Notch transcriptional complex on DNA. Integrating this approach with computer-aided drug design, we explored potential ligand-binding sites and screened for compounds that could disrupt the assembly of the Notch transcriptional activation complex. We identified a small-molecule inhibitor, termed Inhibitor of Mastermind Recruitment-1 (IMR-1), that disrupted the recruitment of Mastermind-like 1 to the Notch transcriptional activation complex on chromatin, thereby attenuating Notch target gene transcription. Furthermore, IMR-1 inhibited the growth of Notch-dependent cell lines and significantly abrogated the growth of patient-derived tumor xenografts. Taken together, our findings suggest that a novel class of Notch inhibitors targeting the transcriptional activation complex may represent a new paradigm for Notch-based anticancer therapeutics, warranting further preclinical characterization. Cancer Res; 76(12); 3593-603. ©2016 AACR. PMID:27197169

  14. O-GlcNAc modification of Sp3 and Sp4 transcription factors negatively regulates their transcriptional activities.

    PubMed

    Ha, Changhoon; Lim, Kihong

    2015-11-13

    The addition of O-linked N-acetylglucosamine (O-GlcNAc) on serine or threonine modifies a myriad of proteins and regulates their function, stability and localization. O-GlcNAc modification is common among chromosome-associated proteins, such as transcription factors, suggesting its extensive involvement in gene expression regulation. In this study, we demonstrate the O-GlcNAc status of the Sp family members of transcription factors and the functional impact on their transcriptional activities. We highlight the presence of O-GlcNAc residues in Sp3 and Sp4, but not Sp2, as demonstrated by their enrichment in GlcNAc positive protein fractions and by detection of O-GlcNAc residues on Sp3 and Sp4 co-expressed in Escherichia coli together with O-GlcNAc transferase (OGT) using an O-GlcNAc-specific antibody. Deletion mutants of Sp3 and Sp4 indicate that the majority of O-GlcNAc sites reside in their N-terminal transactivation domain. Overall, using reporter gene assays and co-immunoprecipitations, we demonstrate a functional inhibitory role of O-GlcNAc modifications in Sp3 and Sp4 transcription factors. Thereby, our study strengthens the current notion that O-GlcNAc modification is an important regulator of protein interactome. PMID:26431879

  15. A DIRECT METHOD TO ASSAY NEUROTOXIC ESTERASE ACTIVITY

    EPA Science Inventory

    A direct photometric method for assaying neurotoxic esterase (NTE) activity of chicken brain microsomal preparation has been developed using 4-nitrophenyl esters as substrates. Paired samples of the microsomal preparation were preincubated for 20 min. with paraoxon plus either (a...

  16. SUMOylation of DLX3 by SUMO1 promotes its transcriptional activity

    PubMed Central

    Duverger, O.; Chen, S.X.; Lee, D.; Li, T.; Chock, P.B.; Morasso, M.I.

    2011-01-01

    Small Ubiquitin-Like Modifiers (SUMO) are posttranslational modifiers that regulate target protein activity in diverse ways. The most common group of SUMO substrates is transcription factors, whose transcriptional activity can be altered positively or negatively as a result of SUMOylation. DLX3 is a homeodomain transcription factor involved in placental development, in the differentiation of structures involving epithelial-mesenchymal interactions, such as hair, teeth and nails, and in bone mineralization. We identified two potential SUMOylation sites in the N-terminal domain of DLX3 at positions K83 and K112. Among the six members of the Distal-less family, DLX3 is the only member containing these sites, which are highly conserved among vertebrates. Co-expression experiments demonstrated that DLX3 can be SUMOylated by SUMO1. Site-directed mutagenesis of lysines 83 and 112 to arginines (K83R and K112R) demonstrated that only K112 is involved in SUMOylation. Immunocytochemical analysis showed that SUMOylation does not affect DLX3 subcellular localization. Moreover, using electrophoresis mobility shift assay, we found that DLX3 is still able to bind DNA when SUMOylated. Using luciferase reporter assays, we showed that DLX3K112R exhibits a significantly lower transcriptional activity compared to DLX3WT, suggesting that SUMOylation has a positive effect on DLX3 activity. We identified a new level of regulation in the activity of DLX3 that may play a crucial role in the regulation of hair, teeth and bone development. PMID:21268066

  17. HMG1 interacts with HOX proteins and enhances their DNA binding and transcriptional activation.

    PubMed Central

    Zappavigna, V; Falciola, L; Helmer-Citterich, M; Mavilio, F; Bianchi, M E

    1996-01-01

    High mobility group protein 1 (HMG1) is a non-histone, chromatin-associated nuclear protein with a proposed role in the regulation of eukaryotic gene expression. We show that HMG1 interacts with proteins encoded by the HOX gene family by establishing protein-protein contacts between the HMG box domains and the HOX homeodomain. The functional role of these interactions was studied using the transcriptional activity of the human HOXD9 protein as a model. HMG1 enhances, in a dose-dependent fashion, the sequence-specific DNA binding activity in vitro, and the transcriptional activation in a co-transfection assay in vivo, of the HOXD9 protein. Functional interaction between HMG1 and HOXD9 is dependent on the DNA binding activity of the homeodomain, and requires the HOXD9 transcriptional activation domain. HMG1 enhances activation by HOXD9, but not by HOXD8, of the HOXD9-controlled element. Specific target recognition and functional interaction with HMG1 can be transferred to HOXD8 by homeodomain swapping. We propose that HMG1-like proteins might be general co-factors in HOX-mediated transcriptional activation, which facilitate access of HOX proteins to specific DNA targets, and/or introduce architectural constraints in the assembly of HOX-containing transcriptional complexes. Images PMID:8890171

  18. Constitutively expressed ERF-VII transcription factors redundantly activate the core anaerobic response in Arabidopsis thaliana.

    PubMed

    Bui, Liem T; Giuntoli, Beatrice; Kosmacz, Monika; Parlanti, Sandro; Licausi, Francesco

    2015-07-01

    Plant adaptation to hypoxic conditions is mediated by the transcriptional activation of genes involved in the metabolic reprogramming of plant cells to cope with reduced oxygen availability. Recent studies indicated that members of the group VII of the Ethylene Responsive Transcription Factor (ERFs) family act as positive regulators of this molecular response. In the current study, the five ERF-VII transcription factors of Arabidopsis thaliana were compared to infer a hierarchy in their role with respect to the anaerobic response. When the activity of each transcription factor was tested on a set of hypoxia-responsive promoters, RAP2.2, RAP2.3 and RAP2.12 appeared to be the most powerful activators. RAP2.12 was further dissected in transactivation assays in Arabidopsis protoplasts to identify responsible regions for transcriptional activation. An ultimate C-terminal motif was identified as sufficient to drive gene transcription. Finally, using realtime RT-PCR in single and double mutants for the corresponding genes, we confirmed that RAP2.2 and RAP2.12 exert major control upon the anaerobic response. PMID:26025519

  19. Topoisomerase Assays

    PubMed Central

    Nitiss, John L.; Soans, Eroica; Rogojina, Anna; Seth, Aman; Mishina, Margarita

    2012-01-01

    Topoisomerases are nuclear enzymes that play essential roles in DNA replication, transcription, chromosome segregation, and recombination. All cells have two major forms of topoisomerases: type I, which makes single-stranded cuts in DNA, and type II enzymes, which cut and pass double-stranded DNA. DNA topoisomerases are important targets of approved and experimental anti-cancer agents. The protocols described in this unit are of assays used to assess new chemical entities for their ability to inhibit both forms of DNA topoisomerase. Included are an in vitro assay for topoisomerase I activity based on relaxation of supercoiled DNA and an assay for topoisomerase II based on the decatenation of double-stranded DNA. The preparation of mammalian cell extracts for assaying topoisomerase activity is described, along with a protocol for an ICE assay for examining topoisomerase covalent complexes in vivo and an assay for measuring DNA cleavage in vitro. PMID:22684721

  20. Cohesin and Polycomb Proteins Functionally Interact to Control Transcription at Silenced and Active Genes

    PubMed Central

    Schaaf, Cheri A.; Misulovin, Ziva; Gause, Maria; Koenig, Amanda; Gohara, David W.; Watson, Audrey; Dorsett, Dale

    2013-01-01

    Cohesin is crucial for proper chromosome segregation but also regulates gene transcription and organism development by poorly understood mechanisms. Using genome-wide assays in Drosophila developing wings and cultured cells, we find that cohesin functionally interacts with Polycomb group (PcG) silencing proteins at both silenced and active genes. Cohesin unexpectedly facilitates binding of Polycomb Repressive Complex 1 (PRC1) to many active genes, but their binding is mutually antagonistic at silenced genes. PRC1 depletion decreases phosphorylated RNA polymerase II and mRNA at many active genes but increases them at silenced genes. Depletion of cohesin reduces long-range interactions between Polycomb Response Elements in the invected-engrailed gene complex where it represses transcription. These studies reveal a previously unrecognized role for PRC1 in facilitating productive gene transcription and provide new insights into how cohesin and PRC1 control development. PMID:23818863

  1. Activation of archaeal transcription mediated by recruitment of transcription factor B.

    PubMed

    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried

    2012-05-25

    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  2. Development and utilization of activated STAT3 detection assays for screening a library of secreted proteins.

    PubMed

    Fursov, Natalie; Gates, Irina V; Panavas, Tadas; Giles-Komar, Jill; Powers, Gordon

    2011-08-01

    Interleukin-6 (IL-6) family of cytokines are multifunctional proteins that play an important role in host defenses, acute phase reactions, immune responses, hematopoiesis, and tumorigenesis. The cytokines are produced by various lymphoid and nonlymphoid cells and mediate their biological activity through initial low-affinity binding to cell surface receptors, which are specific for their respective ligands. Ligand-specific receptor binding results in the receptor heterodimerization with ubiquitously expressed signal-transducing transmembrane component gp130 followed by activation of the gp130-associated Janus kinase, which, in turn, phosphorylates signal transducer and activator of transcription 3 (STAT3). Phosphorylated STAT3 (pSTAT3) dimerizes and translocates to the nucleus, where it activates gene transcription. Activation of STAT3 is essential to IL-6 family-associated physiological effects. Therefore, the ability to assess STAT3 phosphorylation is important for drug discovery efforts targeting IL-6 family cytokines. Various reagents and technologies are available to detect the effect of IL-6 type cytokines in treated cells. The present study describes the development of two pSTAT3 detection assays: the high-throughput screening assay based on Meso-Scale Discovery technology, which utilizes electrochemoluminescent signal measurements for the detection of pSTAT3 in treated cell extracts, and the secondary characterization assay based on fluorescent imaging analysis, which monitors pSTAT3 nuclear translocation in cells after activation. We have successfully utilized these assays to screen a small library of secreted proteins and identified inducers of STAT3 phosphorylation. The results obtained in this study demonstrate that both assays are robust, reliable, and amenable to high-throughput screening applications. PMID:21294636

  3. Regulation of maternal transcript destabilization during egg activation in Drosophila.

    PubMed Central

    Tadros, Wael; Houston, Simon A; Bashirullah, Arash; Cooperstock, Ramona L; Semotok, Jennifer L; Reed, Bruce H; Lipshitz, Howard D

    2003-01-01

    In animals, the transfer of developmental control from maternal RNAs and proteins to zygotically derived products occurs at the midblastula transition. This is accompanied by the destabilization of a subset of maternal transcripts. In Drosophila, maternal transcript destabilization occurs in the absence of fertilization and requires specific cis-acting instability elements. We show here that egg activation is necessary and sufficient to trigger transcript destabilization. We have identified 13 maternal-effect lethal loci that, when mutated, result in failure of maternal transcript degradation. All mutants identified are defective in one or more additional processes associated with egg activation. These include vitelline membrane reorganization, cortical microtubule depolymerization, translation of maternal mRNA, completion of meiosis, and chromosome condensation (the S-to-M transition) after meiosis. The least pleiotropic class of transcript destabilization mutants consists of three genes: pan gu, plutonium, and giant nuclei. These three genes regulate the S-to-M transition at the end of meiosis and are thought to be required for the maintenance of cyclin-dependent kinase (CDK) activity during this cell cycle transition. Consistent with a possible functional connection between this S-to-M transition and transcript destabilization, we show that in vitro-activated eggs, which exhibit aberrant postmeiotic chromosome condensation, fail to initiate transcript degradation. Several genetic tests exclude the possibility that reduction of CDK/cyclin complex activity per se is responsible for the failure to trigger transcript destabilization in these mutants. We propose that the trigger for transcript destabilization occurs coincidently with the S-to-M transition at the end of meiosis and that pan gu, plutonium, and giant nuclei regulate maternal transcript destabilization independent of their role in cell cycle regulation. PMID:12871909

  4. A Portable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Foot-and-Mouth Disease Virus

    PubMed Central

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A.; Hufert, Frank T.; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4–10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection. PMID:23977101

  5. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

    PubMed

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4-10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection. PMID:23977101

  6. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity. PMID:26225482

  7. A transcriptionally active form of TFIIIC is modified in poliovirus-infected HeLa cells.

    PubMed Central

    Clark, M E; Dasgupta, A

    1990-01-01

    In HeLa cells, RNA polymerase III (pol III)-mediated transcription is severely inhibited by poliovirus infection. This inhibition is due primarily to the reduction in transcriptional activity of the pol III transcription factor TFIIIC in poliovirus-infected cells. However, the specific binding of TFIIIC to the VAI gene B-box sequence, as assayed by DNase I footprinting, is not altered by poliovirus infection. We have used gel retardation analysis to analyze TFIIIC-DNA complexes formed in nuclear extracts prepared from mock- and poliovirus-infected cells. In mock-infected cell extracts, two closely migrating TFIIIC-containing complexes, complexes I and II, were detected in the gel retardation assay. The slower migrating complex, complex I, was absent in poliovirus-infected cell extracts, and an increase occurred in the intensity of the faster-migrating complex (complex II). Also, in poliovirus-infected cell extracts, a new, rapidly migrating complex, complex III, was formed. Complex III may have been the result of limited proteolysis of complex I or II. These changes in TFIIIC-containing complexes in poliovirus-infected cell extracts correlated kinetically with the decrease in TFIIIC transcriptional activity. Complexes I, II, and III were chromatographically separated; only complex I was transcriptionally active and specifically restored pol III transcription when added to poliovirus-infected cell extracts. Acid phosphatase treatment partially converted complex I to complex II but did not affect the binding of complex II or III. Dephosphorylation and limited proteolysis of TFIIIC are discussed as possible mechanisms for the inhibition of pol III-mediated transcription by poliovirus. Images PMID:2204807

  8. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  9. An Asp7Gly substitution in PPARG is associated with decreased transcriptional activation activity.

    PubMed

    Hua, Liushuai; Wang, Jing; Li, Mingxun; Sun, Xiaomei; Zhang, Liangzhi; Lei, Chuzhao; Lan, Xianyong; Fang, Xingtang; Zhao, Xin; Chen, Hong

    2014-01-01

    As the master regulator of adipogenesis, peroxisome proliferator-activated receptor gamma (PPARG) is required for the accumulation of adipose tissue and hence contributes to obesity. A previous study showed that the substitution of +20A>G in PPARG changed the 7(th) amino acid from Asp to Gly, creating a mutant referred to as PPARG Asp7Gly. In this study, association analysis indicated that PPARG Asp7Gly was associated with lower body height, body weight and heart girth in cattle (P<0.05). Overexpression of PPARG in NIH3T3-L1 cells showed that the Asp7Gly substitution may cause a decrease in its adipogenic ability and the mRNA levels of CIDEC (cell death-inducing DFFA-like effector c) and aP2, which are all transcriptionally activated by PPARG during adipocyte differentiation. A dual-luciferase reporter assay was used to analyze the promoter activity of CIDEC. The results confirmed that the mutant PPARG exhibited weaker transcriptional activation activity than the wild type (P<0.05). These findings likely explain the associations between the Asp7Gly substitution and the body measurements. Additionally, the Asp7Gly mutation may be used in molecular marker assisted selection (MAS) of cattle breeding in the future. PMID:24466299

  10. Proteins of the ETS family with transcriptional repressor activity.

    PubMed

    Mavrothalassitis, G; Ghysdael, J

    2000-12-18

    ETS proteins form one of the largest families of signal-dependent transcriptional regulators, mediating cellular proliferation, differentiation and tumorigenesis. Most of the known ETS proteins have been shown to activate transcription. However, four ETS proteins (YAN, ERF, NET and TEL) can act as transcriptional repressors. In three cases (ERF, NET and TEL) distinct repression domains have been identified and there are indications that NET and TEL may mediate transcription via Histone Deacetylase recruitment. All four proteins appear to be regulated by MAPKs, though for YAN and ERF this regulation seems to be restricted to ERKs. YAN, ERF and TEL have been implicated in cellular proliferation although there are indications suggesting a possible involvement of YAN and TEL in differentiation as well. Other ETS-domain proteins have been shown to repress transcription in a context specific manner, and there are suggestions that the ETS DNA-binding domain may act as a transcriptional repressor. Transcriptional repression by ETS domain proteins adds an other level in the orchestrated regulation by this diverse family of transcription factors that often recognize similar if not identical binding sites on DNA and are believed to regulate critical genes in a variety of biological processes. Definitive assessment of the importance of this novel regulatory level will require the identification of ETS proteins target genes and the further analysis of transcriptional control and biological function of these proteins in defined pathways. PMID:11175368

  11. An in vivo assay for chemoattractant activity.

    PubMed

    Zetter, B R; Rasmussen, N; Brown, L

    1985-09-01

    We have devised an implantable device for the study of leukocyte chemoattraction. The device consists of a 0.25-mm thick patch of Dacron fabric coupled to a disc of ethylene vinyl acetate copolymer. Such polymers can release biologically active molecules at a constant rate for at least 18 days. Attracted cells invade and are trapped within the Dacron fabric. Upon removal from the host, the fabric patches are sectioned and stained to reveal the distribution of attracted cells. Distinct patterns of cellular accumulation can be seen for different chemoattractant molecules. These include the attraction of eosinophils by histamine, monocytes by tuftsin, and mast cells by glycyl-histidyl-lysine. Maximal accumulation of specific cell types occurs at postimplantation days 1 to 2 for neutrophils, days 3 to 5 for monocytes, and days 5 to 6 for macrophages and eosinophils. Control polymers fail to cause significant leukocyte accumulation, indicating that neither the polymer nor the Dacron fabric provokes an inflammatory response. PMID:3162062

  12. Selective Activation of Transcription by a Novel CCAAT Binding Factor

    NASA Astrophysics Data System (ADS)

    Maity, Sankar N.; Golumbek, Paul T.; Karsenty, Gerard; de Crombrugghe, Benoit

    1988-07-01

    A novel CCAAT binding factor (CBF) composed of two different subunits has been extensively purified from rat liver. Both subunits are needed for specific binding to DNA. Addition of this purified protein to nuclear extracts of NIH 3T3 fibroblasts stimulates transcription from several promoters including the α 2(I) collagen, the α 1(I) collagen, the Rous sarcoma virus long terminal repeat (RSV-LTR), and the adenovirus major late promoter. Point mutations in the CCAAT motif that show either no binding or a decreased binding of CBF likewise abolish or reduce activation of transcription by CBF. Activation of transcription requires, therefore, the specific binding of CBF to its recognition sites.

  13. ortho-Carboranylphenoxyacetanilides as inhibitors of hypoxia-inducible factor (HIF)-1 transcriptional activity and heat shock protein (HSP) 60 chaperon activity.

    PubMed

    Li, Guangzhe; Azuma, Soyoko; Sato, Shinichi; Minegishi, Hidemitsu; Nakamura, Hiroyuki

    2015-07-01

    ortho-Carboranylphenoxy derivatives were synthesized and evaluated for their ability to inhibit hypoxia-induced HIF-1 transcriptional activity using a cell-based reporter gene assay. Among the compounds synthesized, compound 1d showed the most significant inhibition of hypoxia-induced HIF-1 transcriptional activity with the IC50 of 0.53μM. Furthermore, compound 1h was found to possess the most significant inhibition of heat shock protein (HSP) 60 chaperon activity among the reported inhibitors: the IC50 toward the porcine heart malate dehydrogenase (MDH) refolding assay was 0.35μM. PMID:25981686

  14. MafG Sumoylation Is Required for Active Transcriptional Repression

    PubMed Central

    Motohashi, Hozumi; Katsuoka, Fumiki; Miyoshi, Chika; Uchimura, Yasuhiro; Saitoh, Hisato; Francastel, Claire; Engel, James Douglas; Yamamoto, Masayuki

    2006-01-01

    A straightforward mechanism for eliciting transcriptional repression would be to simply block the DNA binding site for activators. Such passive repression is often mediated by transcription factors that lack an intrinsic repressor activity. MafG is a bidirectional regulator of transcription, a repressor in its homodimeric state but an activator when heterodimerized with p45. Here, we report that MafG is conjugated to SUMO-2/3 in vivo. To clarify the possible physiological role(s) for sumoylation in regulating MafG activity, we evaluated mutant and wild-type MafG in transgenic mice and cultured cells. Whereas sumoylation-deficient MafG activated p45-dependent transcription normally and did not affect heterodimer activity, repression by the sumoylation-deficient MafG mutant was severely compromised in vivo. Furthermore, the SUMO-dependent repression activity of MafG was sensitive to histone deacetylase inhibition. Thus, repression by MafG is not achieved through simple passive repression by competing for the activator binding site but requires sumoylation, which then mediates transcriptional repression through recruitment of a repressor complex containing histone deacetylase activity. PMID:16738329

  15. Potential Role of Activating Transcription Factor 5 during Osteogenesis.

    PubMed

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo

    2016-01-01

    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology. PMID:26770207

  16. Improved assays for xenosensor activation based on reverse transfection.

    PubMed

    Küblbeck, Jenni; Anttila, Teemu; Pulkkinen, Juha T; Honkakoski, Paavo

    2015-10-01

    Discovery of receptor-dependent mechanisms for regulation of drug metabolism has provided a new way to evaluate the propensity of drug candidates to cause induction of cytochrome P450 enzymes. Therefore, receptor-based reporter assays have become common in early stages of drug development projects and in mechanistic studies. Here, we report a reverse transfection system to conduct activation assays for human xenosensors AhR, CAR and PXR. The assay format is based on long-term stability and uniformity of DNA/carrier complexes on culture plates, avoiding multiple stages and variation inherent in conventional transfection methods. Consequently, these improved assays are streamlined, reproducible and formally validated with Z' factors exceeding 0.5. This novel reverse transfection system is expected to find use in diverse areas of early drug development such prediction of CYP induction, evaluation of species differences and in mechanistic studies. PMID:26187274

  17. ELK3 Suppresses Angiogenesis by Inhibiting the Transcriptional Activity of ETS-1 on MT1-MMP

    PubMed Central

    Heo, Sun-Hee; Cho, Je-Yoel

    2014-01-01

    Ets transcription factors play important roles in vasculogenesis and angiogenesis. Knockout of the Ets gene family members in mice resulted in disrupted angiogenesis and malformed vascular systems. In this study, the role and mechanism of ELK3, an Ets factor, in angiogenesis was investigated using ELK3-specific siRNA in human vascular endothelial cells (HUVECs) and in vivo implantation assay. The suppression of ELK3 expression resulted in the reinforcement of VEGF-induced tube formation in HUVECs. The in vivo Matrigel plug assay also showed that ELK3 knockdown resulted in increased angiogenesis. Luciferase activity of the MT1-MMP promoter induced by ETS-1 factor was attenuated ELK3 co-transfection. CHIP assay showed the binding of ELK3 on the MT1-MMP promoter. MT1-MMP knockdown in the ELK3 knockdowned cells resulted in the decrease of tube formation suggesting that MT1-MMP transcriptional repression is required for ELK3-mediated anti-angiogenesis effect. Our data also showed that the suppressive effect of ELK3 on the angiogenesis was partly due to the inhibitory effect of ELK3 to the ETS-1 transcriptional activity on the MT1-MMP promoter rather than direct suppression of ELK3 on the target gene, since the expression level of co-repressor Sin3A is low in endothelial cells. Our results suggest that ELK3 plays a negative role of VEGF-induced angiogenesis through indirectly inhibiting ETS-1 function. PMID:24719561

  18. ELK3 suppresses angiogenesis by inhibiting the transcriptional activity of ETS-1 on MT1-MMP.

    PubMed

    Heo, Sun-Hee; Cho, Je-Yoel

    2014-01-01

    Ets transcription factors play important roles in vasculogenesis and angiogenesis. Knockout of the Ets gene family members in mice resulted in disrupted angiogenesis and malformed vascular systems. In this study, the role and mechanism of ELK3, an Ets factor, in angiogenesis was investigated using ELK3-specific siRNA in human vascular endothelial cells (HUVECs) and in vivo implantation assay. The suppression of ELK3 expression resulted in the reinforcement of VEGF-induced tube formation in HUVECs. The in vivo Matrigel plug assay also showed that ELK3 knockdown resulted in increased angiogenesis. Luciferase activity of the MT1-MMP promoter induced by ETS-1 factor was attenuated ELK3 co-transfection. CHIP assay showed the binding of ELK3 on the MT1-MMP promoter. MT1-MMP knockdown in the ELK3 knockdowned cells resulted in the decrease of tube formation suggesting that MT1-MMP transcriptional repression is required for ELK3-mediated anti-angiogenesis effect. Our data also showed that the suppressive effect of ELK3 on the angiogenesis was partly due to the inhibitory effect of ELK3 to the ETS-1 transcriptional activity on the MT1-MMP promoter rather than direct suppression of ELK3 on the target gene, since the expression level of co-repressor Sin3A is low in endothelial cells. Our results suggest that ELK3 plays a negative role of VEGF-induced angiogenesis through indirectly inhibiting ETS-1 function. PMID:24719561

  19. Theory on the dynamic memory in the transcription-factor-mediated transcription activation

    NASA Astrophysics Data System (ADS)

    Murugan, R.

    2011-04-01

    We develop a theory to explain the origin of the static and dynamical memory effects in transcription-factor-mediated transcription activation. Our results suggest that the following inequality conditions should be satisfied to observe such memory effects: (a) τL≫max(τR,τE), (b) τLT≫τT, and (c) τI⩾(τEL+τTR) where τL is the average time required for the looping-mediated spatial interactions of enhancer—transcription-factor complex with the corresponding promoter—RNA-polymerase or eukaryotic RNA polymerase type II (PolII in eukaryotes) complex that is located L base pairs away from the cis-acting element, (τR,τE) are respectively the search times required for the site-specific binding of the RNA polymerase and the transcription factor with the respective promoter and the cis-regulatory module, τLT is the time associated with the relaxation of the looped-out segment of DNA that connects the cis-acting site and promoter, τT is the time required to generate a complete transcript, τI is the transcription initiation time, τEL is the elongation time, and τTR is the termination time. We have theoretically derived the expressions for the various searching, looping, and loop-relaxation time components. Using the experimentally determined values of various time components we further show that the dynamical memory effects cannot be experimentally observed whenever the segment of DNA that connects the cis-regulatory element with the promoter is not loaded with bulky histone bodies. Our analysis suggests that the presence of histone-mediated compaction of the connecting segment of DNA can result in higher values of looping and loop-relaxation times, which is the origin of the static memory in the transcription activation that is mediated by the memory gene loops in eukaryotes.

  20. Bortezomib attenuates HIF-1- but not HIF-2-mediated transcriptional activation

    PubMed Central

    ABD-AZIZ, NORAINI; STANBRIDGE, ERIC J.; SHAFEE, NORAZIZAH

    2015-01-01

    Bortezomib is the first proteasomal inhibitor (PI) to be used therapeutically for treating relapse cases of multiple myeloma and mantle cell lymphoma. A proposed mechanism for its action is that it prevents the proteasomal degradation of proapoptotic proteins, leading to enhanced apoptosis. Although the α subunit of hypoxia-inducible factor (HIF)-1 is not degraded with bortezomib treatment, the heterodimeric HIF-1 fails to transactivate target genes. HIF-1 and HIF-2 are related hypoxia-inducible transcription factors that are important for the survival of hypoxic tumor cells. The majority of reports have focused on the effects of bortezomib on the transcriptional activities of HIF-1, but not HIF-2. The present study investigated the effects of bortezomib on HIF-2 activity in cancer cells with different levels of HIF-1α and HIF-2α subunits. HIF-α subunit levels were detected using specific antibodies, while HIF transcriptional activities were evaluated using immunodetection, reverse transcription-polymerase chain reaction and luciferase reporter assay. Bortezomib treatment was found to suppress the transcription and expression of CA9, a HIF-1-specific target gene; however, it had minimal effects on EPO and GLUT-1, which are target genes of both HIF-1 and HIF-2. These data suggest that bortezomib attenuates the transcriptional activity only of HIF-1, and not HIF-2. This novel finding on the lack of an inhibitory effect of bortezomib on HIF-2 transcriptional activity has implications for the improvement of design and treatment modalities of bortezomib and other PI drugs. PMID:26622817

  1. Identification of active transcriptional regulatory elements from GRO-seq data.

    PubMed

    Danko, Charles G; Hyland, Stephanie L; Core, Leighton J; Martins, Andre L; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G; Kraus, W Lee; Lis, John T; Siepel, Adam

    2015-05-01

    Modifications to the global run-on and sequencing (GRO-seq) protocol that enrich for 5'-capped RNAs can be used to reveal active transcriptional regulatory elements (TREs) with high accuracy. Here, we introduce discriminative regulatory-element detection from GRO-seq (dREG), a sensitive machine learning method that uses support vector regression to identify active TREs from GRO-seq data without requiring cap-based enrichment (https://github.com/Danko-Lab/dREG/). This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Predicted TREs are more enriched for several marks of transcriptional activation—including expression quantitative trait loci, disease-associated polymorphisms, acetylated histone 3 lysine 27 (H3K27ac) and transcription factor binding—than those identified by alternative functional assays. Using dREG, we surveyed TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  2. Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated isothermal amplification assay

    PubMed Central

    2011-01-01

    Background Recent epidemiological investigation of different HA subtypes of avian influenza viruses (AIVs) shows that the H3 subtype is the most predominant among low pathogenic AIVs (LPAIVs), and the seasonal variations in isolation of H3 subtype AIVs are consistent with that of human H3 subtype influenza viruses. Consequently, the development of a rapid, simple, sensitive detection method for H3 subtype AIVs is required. The loop-mediated isothermal amplification (LAMP) assay is a simple, rapid, sensitive and cost-effective nucleic acid amplification method that does not require any specialized equipment. Results A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to detect the H3 subtype AIVs visually. Specific primer sets target the sequences of the hemagglutinin (HA) gene of H3 subtype AIVs were designed, and assay reaction conditions were optimized. The established assay was performed in a water bath for 50 minutes, and the amplification result was visualized directly as well as under ultraviolet (UV) light reflections. The detection limit of the RT-LAMP assay was 0.1pg total RNA of virus, which was one hundred-fold higher than that of RT-PCR. The results on specificity indicated that the assay had no cross-reactions with other subtype AIVs or avian respiratory pathogens. Furthermore, a total of 176 clinical samples collected from birds at the various live-bird markets (LBMs) were subjected to the H3-subtype-specific RT-LAMP (H3-RT-LAMP). Thirty-eight H3 subtype AIVs were identified from the 176 clinical samples that were consistent with that of virus isolation. Conclusions The newly developed H3-RT-LAMP assay is simple, sensitive, rapid and can identify H3 subtype AIVs visually. Consequently, it will be a very useful screening assay for the surveillance of H3 subtype AIVs in underequipped laboratories as well as in field conditions. PMID:21729297

  3. Nitric Oxide Is a Signal for NNR-Mediated Transcription Activation in Paracoccus denitrificans

    PubMed Central

    Van Spanning, Rob J. M.; Houben, Edith; Reijnders, Willem N. M.; Spiro, Stephen; Westerhoff, Hans V.; Saunders, Neil

    1999-01-01

    By using the ′lacZ gene, the activities of the nirI, nirS, and norC promoters were assayed in the wild type and in NNR-deficient mutants of Paracoccus denitrificans grown under various growth conditions. In addition, induction profiles of the three promoters in response to the presence of various nitrogenous oxides were determined. Transcription from the three promoters required the absence of oxygen and the presence both of the transcriptional activator NNR and of nitric oxide. The activity of the nnr promoter itself was halved after the cells had been switched from aerobic respiration to denitrification. This response was apparently not a result of autoregulation or of regulation by FnrP, since the nnr promoter was as active in the wild-type strain as it was in NNR- or FnrP-deficient mutants. PMID:10383987

  4. A novel CRE recombinase assay for quantification of GAL10-non coding RNA suppression on transcriptional leakage.

    PubMed

    Zacharioudakis, Ioannis; Tzamarias, Dimitris

    2016-05-13

    Eukaryotic promoters are tightly regulated and often securely repressed. However, recent reports indicated that transcripts originating from the strictly regulated GAL1-10 promoter can be detected by single-yeast cell imaging under repressive conditions. Such leaky, noisy transcription events were suppressed by a long non-coding RNA (GAL10-ncRNA) transcribed within the GAL1-10 locus. It was further suggested that GAL10-ncRNA repression of GAL1-10 promoter leakage tunes the bimodal expression pattern of the GAL network. Independent evidence has indicated that GAL10-ncRNA transcription establishes a repressive chromatin structure through the Set2 histone methyl-transferase and the Rpd3s histone deacetylase complex. In this report we set up a novel, simple genetic Cre recombinase assay in order to readily quantify transcriptional leakage from tightly repressed promoters. By applying this method we demonstrate that GAL10-ncRNA, Set2p and Rpd3p all suppress leaky GAL1-10 driven transcription. However, GAL10-ncRNA repression is not mediated by Set2p or Rpd3p. Moreover, as opposed to GAL10-ncRNA transcription, Set2 and Rpd3 do not influence the bimodal expression of GAL genes, despite their effect on GAL1-10 promoter leakage. We suggest that GAL10-ncRNA tunes the expression of GAL genes by additional mechanisms besides suppressing leaky transcription from the GAL1-10 promoter. PMID:27073161

  5. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation.

    PubMed

    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun

    2016-01-01

    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease. PMID:27570485

  6. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation

    PubMed Central

    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun

    2016-01-01

    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease. PMID:27570485

  7. Transcriptional Activation of Human Matrix Metalloproteinase-9 Gene Expression by Multiple Coactivators

    PubMed Central

    Zhao, Xueyan; Benveniste, Etty N.

    2008-01-01

    Summary Matrix metalloproteinase-9 (MMP-9), a proteolytic enzyme for matrix proteins, chemokines and cytokines, is a major target in cancer and autoimmune diseases since it is aberrantly upregulated. To control MMP-9 expression in pathological conditions, it is necessary to understand the regulatory mechanisms of MMP-9 expression. MMP-9 gene expression is regulated primarily at the transcriptional level. In this study, we investigated the role of multiple coactivators in regulating MMP-9 transcription. We demonstrate that multiple transcriptional coactivators are involved in MMP-9 promoter activation, including CBP/p300, PCAF, CARM1 and GRIP1. Furthermore, enhancement of MMP-9 promoter activity requires the histone acetyltransferase activity of PCAF but not that of CBP/p300, and the methyltransferase activity of CARM1. More importantly, these coactivators are not only able to activate MMP-9 promoter activity independently, but also function in a synergistic manner. Significant synergy was observed among CARM1, p300 and GRIP1, which is dependent on the interaction of p300 and CARM1 with the AD1 and AD2 domains of GRIP1, respectively. This suggests the formation of a ternary coactivator complex on the MMP-9 promoter. Chromatin immunoprecipitation assays demonstrate that these coactivators associate with the endogenous MMP-9 promoter, and that siRNA knockdown of expression of these coactivators reduces endogenous MMP-9 expression. Taken together, these studies demonstrate a new level of transcriptional regulation of MMP-9 expression by the cooperative action of coactivators. PMID:18790699

  8. Development and Use of a Reverse Transcription-PCR Assay To Study Expression of Tri5 by Fusarium Species In Vitro and In Planta

    PubMed Central

    Doohan, F. M.; Weston, G.; Rezanoor, H. N.; Parry, D. W.; Nicholson, P.

    1999-01-01

    The Tri5 gene encodes trichodiene synthase, which catalyzes the first reaction in the trichothecene biosynthetic pathway. In vitro, a direct relationship was observed between Tri5 expression and the increase in deoxynivalenol production over time. We developed a reverse transcription (RT)-PCR assay to quantify Tri5 gene expression in trichothecene-producing strains of Fusarium species. We observed an increase in Tri5 expression following treatment of Fusarium culmorum with fungicides, and we also observed an inverse relationship between Tri5 expression and biomass, as measured by β-d-glucuronidase activity, during colonization of wheat (cv. Avalon) seedlings by F. culmorum. RT-PCR analysis also showed that for ears of wheat cv. Avalon inoculated with F. culmorum, there were different levels of Tri5 expression in grain and chaff at later growth stages. We used the Tri5-specific primers to develop a PCR assay to detect trichothecene-producing Fusarium species in infected plant material. PMID:10473385

  9. Targeting Gli Transcription Activation by Small Molecule Suppresses Tumor Growth

    PubMed Central

    Bosco-Clément, Geneviève; Zhang, Fang; Chen, Zhao; Zhou, Hai-Meng; Li, Hui; Mikami, Iwao; Hirata, Tomomi; Yagui-Beltran, Adam; Lui, Natalie; Do, Hanh T.; Cheng, Tiffany; Tseng, Hsin-Hui; Choi, Helen; Fang, Li-Tai; Kim, Il-Jin; Yue, Dongsheng; Wang, Changli; Zheng, Qingfeng; Fujii, Naoaki; Mann, Michael; Jablons, David M.; He, Biao

    2014-01-01

    Targeted inhibition of Hedgehog signaling at the cell membrane has been associated with anti-cancer activity in preclinical and early clinical studies. Hedgehog signaling involves activation of Gli transcription factors that can also be induced by alternative pathways. In this study we identified an interaction between Gli proteins and a transcription co-activator TAF9, and validated its functional relevance in regulating Gli transactivation. We also describe a novel, synthetic small molecule, FN1-8, that efficiently interferes with Gli/TAF9 interaction and down-regulate Gli/TAF9 dependent transcriptional activity. More importantly, FN1-8 suppresses cancer cell proliferation in vitro and inhibits tumor growth in vivo. Our results suggest that blocking Gli transactivation, a key control point of multiple oncogenic pathways, may be an effective anti-cancer strategy. PMID:23686308

  10. Development of a new colorimetric assay for lipoxygenase activity.

    PubMed

    Lu, Weiqiang; Zhao, Xue; Xu, Zhongyu; Dong, Ningning; Zou, Shien; Shen, Xu; Huang, Jin

    2013-10-15

    Lipoxygenases (LOXs) are a family of non-heme iron-containing dioxygenases that catalyze the hydroperoxidation of lipids, containing a cis,cis-1,4-pentadiene structure. A rapid and reliable colorimetric assay for determination of the activity of three human functional lipoxygenase isoforms (5-lipoxygenase, platelet 12-lipoxygenase, and 15-lipoxygenase-1) is developed in this article. In the new assay, LOX-derived lipid hydroperoxides oxidize the ferrous ion (Fe²⁺) to the ferric ion (Fe³⁺), the latter of which binds with thiocyanate (SCN⁻) to generate a red ferrithiocyanate (FTC) complex. The absorbance of the FTC complex can be easily measured at 480 nm. Because 5-LOX can be stimulated by many cofactors, the effects of its cofactors (Ca²⁺, ATP, dithiothreitol, glutathione, L-α-phosphatidylcholine, and ethylenediaminetetraacetic acid) on the color development of the FTC complex are also determined. The assay is adaptive for purified LOXs and cell lysates containing active LOXs. We use the new colorimetric assay in a 96-well format to evaluate several well-known LOX inhibitors, the IC₅₀ values of which are in good agreement with previously reported data. The reliability and reproducibility of the assay make it useful for in vitro screening for inhibitors of LOXs and, therefore, should accelerate drug discovery for clinical application. PMID:23811155

  11. Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco.

    PubMed

    Aoyama, T; Dong, C H; Wu, Y; Carabelli, M; Sessa, G; Ruberti, I; Morelli, G; Chua, N H

    1995-11-01

    The Arabidopsis thaliana Athb-1 is a homeobox gene of unknown function. By analogy with homeobox genes of other organisms, its gene product, Athb-1, is most likely a transcription factor involved in developmental processes. We constructed a series of Athb-1-derived genes to examine the roles of Athb-1 in transcriptional regulation and plant development. Athb-1 was found to transactivate a promoter linked to a specific DNA binding site by transient expression assays. In transgenic tobacco plants, overexpression of Athb-1 or its chimeric derivatives with heterologous transactivating domains of the yeast transcription factor GAL4 or herpes simplex virus transcription factor VP16 conferred deetiolated phenotypes in the dark, including cotyledon expansion, true leaf development, and an inhibition of hypocotyl elongation. Expression of Athb-1 or the two chimeric derivatives also affected the development of palisade parenchyma under normal growth conditions, resulting in light green sectors in leaves and cotyledons, whereas other organs in the transgenic plants remained normal. Both developmental phenotypes were induced by glucocorticoid in transgenic plants expressing a chimeric transcription factor comprising the Athb-1 DNA binding domain, the VP16 transactivating domain, and the glucocorticoid receptor domain. Plants with severe inducible phenotypes showed additional abnormality in cotyledon expansion. Our results suggest that Athb-1 is a transcription activator involved in leaf development. PMID:8535134

  12. Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco.

    PubMed Central

    Aoyama, T; Dong, C H; Wu, Y; Carabelli, M; Sessa, G; Ruberti, I; Morelli, G; Chua, N H

    1995-01-01

    The Arabidopsis thaliana Athb-1 is a homeobox gene of unknown function. By analogy with homeobox genes of other organisms, its gene product, Athb-1, is most likely a transcription factor involved in developmental processes. We constructed a series of Athb-1-derived genes to examine the roles of Athb-1 in transcriptional regulation and plant development. Athb-1 was found to transactivate a promoter linked to a specific DNA binding site by transient expression assays. In transgenic tobacco plants, overexpression of Athb-1 or its chimeric derivatives with heterologous transactivating domains of the yeast transcription factor GAL4 or herpes simplex virus transcription factor VP16 conferred deetiolated phenotypes in the dark, including cotyledon expansion, true leaf development, and an inhibition of hypocotyl elongation. Expression of Athb-1 or the two chimeric derivatives also affected the development of palisade parenchyma under normal growth conditions, resulting in light green sectors in leaves and cotyledons, whereas other organs in the transgenic plants remained normal. Both developmental phenotypes were induced by glucocorticoid in transgenic plants expressing a chimeric transcription factor comprising the Athb-1 DNA binding domain, the VP16 transactivating domain, and the glucocorticoid receptor domain. Plants with severe inducible phenotypes showed additional abnormality in cotyledon expansion. Our results suggest that Athb-1 is a transcription activator involved in leaf development. PMID:8535134

  13. Field Validation of a Transcriptional Assay for the Prediction of Age of Uncaged Aedes aegypti Mosquitoes in Northern Australia

    PubMed Central

    Hugo, Leon E.; Cook, Peter E.; Johnson, Petrina H.; Rapley, Luke P.; Kay, Brian H.; Ryan, Peter A.; Ritchie, Scott A.; O'Neill, Scott L.

    2010-01-01

    Background New strategies to eliminate dengue have been proposed that specifically target older Aedes aegypti mosquitoes, the proportion of the vector population that is potentially capable of transmitting dengue viruses. Evaluation of these strategies will require accurate and high-throughput methods of predicting mosquito age. We previously developed an age prediction assay for individual Ae. aegypti females based on the transcriptional profiles of a selection of age responsive genes. Here we conducted field testing of the method on Ae. aegypti that were entirely uncaged and free to engage in natural behavior. Methodology/Principal Findings We produced “free-range” test specimens by releasing 8007 adult Ae. aegypti inside and around an isolated homestead in north Queensland, Australia, and recapturing females at two day intervals. We applied a TaqMan probe-based assay design that enabled high-throughput quantitative RT-PCR of four transcripts from three age-responsive genes and a reference gene. An age prediction model was calibrated on mosquitoes maintained in small sentinel cages, in which 68.8% of the variance in gene transcription measures was explained by age. The model was then used to predict the ages of the free-range females. The relationship between the predicted and actual ages achieved an R2 value of 0.62 for predictions of females up to 29 days old. Transcriptional profiles and age predictions were not affected by physiological variation associated with the blood feeding/egg development cycle and we show that the age grading method could be applied to differentiate between two populations of mosquitoes having a two-fold difference in mean life expectancy. Conclusions/Significance The transcriptional profiles of age responsive genes facilitated age estimates of near-wild Ae. aegypti females. Our age prediction assay for Ae. aegypti provides a useful tool for the evaluation of mosquito control interventions against dengue where mosquito

  14. Benzimidazoles diminish ERE transcriptional activity and cell growth in breast cancer cells

    PubMed Central

    Payton-Stewart, Florastina; Tilghman, Syreeta L.; Williams, LaKeisha G.; Winfield, Leyte L.

    2014-01-01

    Estrogen receptors (ERα and ERβ) are members of the nuclear receptor superfamily. They regulate the transcription of estrogen-responsive genes and mediate numerous estrogen related diseases (i.e., fertility, osteoporosis, cancer, etc.). As such, ERs are potentially useful targets for developing therapies and diagnostic tools for hormonally responsive human breast cancers. In this work, two benzimidazole-based sulphonamides originally designed to reduce proliferation in prostate cancer, have been evaluated for their ability to modulate growth in estrogen dependent and independent cell lines (MCF-7 and MDA-MB 231) using cell viability assays. The molecules reduced growth in MCF-7 cells, but differed in their impact on the growth of MDA-MB 231 cells. Although both molecules reduced estrogen response element (ERE) transcriptional activity in a dose dependent manner, the contrasting activity in the MDA-MB-231 cells seems to suggest that the molecules may act through alternate ER-mediated pathways. Further, the methyl analog showed modest selectivity for the ERβ receptor in an ER gene expression array panel. However, the napthyl analog diminished gene expression. The molecules were docked in the ligand binding domains of the ERα-antagonist and ERβ-agonist crystal structures to evaluate the potential of the molecules to interact with the receptors. The computational analysis complimented the results obtained in the assay of transcriptional activity and gene expression suggesting that the molecules upregulate ERβ activity while down regulating that of ERα. PMID:24997336

  15. Oxytocin-Stimulated NFAT Transcriptional Activation in Human Myometrial Cells

    PubMed Central

    McArdle, Craig A.; López Bernal, Andrés

    2012-01-01

    Oxytocin (OXT) is a peptide hormone that binds the OXT receptor on myometrial cells, initiating an intracellular signaling cascade, resulting in accumulation of intracellular calcium and smooth muscle contraction. In other systems, an elevation of intracellular Ca2+ stimulates nuclear translocation of the transcription factor, nuclear factor of activated T cells (NFAT), which is transcriptionally active in arterial and ileal smooth muscle. Here we have investigated the role of NFAT in the mechanism of action of OXT. Human myometrial cells expressed all five NFAT isoforms (NFATC1–C4 and -5). Myometrial cells were transduced with a recombinant adenovirus expressing a NFATC1-EFP reporter, and a semi-automated imaging system was used to monitor effects of OXT on reporter localization in live cells. OXT induced a concentration-dependent nuclear translocation of NFATC1-EFP in a reversible manner, which was inhibited by OXT antagonists and calcineurin inhibitors. Pulsatile stimulation with OXT caused intermittent, pulse-frequency-dependent, nuclear translocation of NFATC1-EFP, which was more efficient than sustained stimulation. OXT induced nuclear translocation of endogenous NFAT that was transcriptionally active, because OXT stimulated activity of a NFAT-response element-luciferase reporter and induced calcineurin-NFAT dependent expression of RGS2, RCAN1, and PTGS2 (COX2) mRNA. Furthermore, OXT-dependent transcription was dependent on protein neosynthesis; cycloheximide abolished RGS2 transcription but augmented RCAN1 and COX2 transcriptional readouts. This study identifies a novel signaling mechanism within the myometrium, whereby calcineurin-NFAT signaling mediates OXT-induced transcriptional activity. Furthermore, we show NFATC1-EFP is responsive to pulses of OXT, a mechanism by which myometrial cells could decode OXT pulse frequency. PMID:22902539

  16. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs.

    PubMed

    Haist, Kelsey; Ziegler, Christopher; Botten, Jason

    2015-01-01

    Arenaviruses are bi-segmented, single-stranded RNA viruses that cause significant human disease. The manner in which they regulate the replication of their genome is not well-understood. This is partly due to the absence of a highly sensitive assay to measure individual species of arenavirus replicative RNAs. To overcome this obstacle, we designed a quantitative reverse transcription (RT)-PCR assay for selective quantitation of each of the lymphocytic choriomeningitis virus (LCMV) genomic or antigenomic RNAs. During the course of assay design, we identified a nonspecific priming phenomenon whereby, in the absence of an RT primer, cDNAs complementary to each of the LCMV replicative RNA species are generated during RT. We successfully circumvented this nonspecific priming event through the use of biotinylated primers in the RT reaction, which permitted affinity purification of primer-specific cDNAs using streptavidin-coated magnetic beads. As proof of principle, we used the assay to map the dynamics of LCMV replication at acute and persistent time points and to determine the quantities of genomic and antigenomic RNAs that are incorporated into LCMV particles. This assay can be adapted to measure total S or L segment-derived viral RNAs and therefore represents a highly sensitive diagnostic platform to screen for LCMV infection in rodent and human tissue samples and can also be used to quantify virus-cell attachment. PMID:25978311

  17. A quantitative reverse transcription-PCR assay for rapid, automated analysis of breast cancer sentinel lymph nodes.

    PubMed

    Hughes, Steven J; Xi, Liqiang; Gooding, William E; Cole, David J; Mitas, Michael; Metcalf, John; Bhargava, Rohit; Dabbs, David; Ching, Jesus; Kozma, Lynn; McMillan, William; Godfrey, Tony E

    2009-11-01

    We have previously reported that a quantitative reverse transcription (QRT)-PCR assay accurately analyzes sentinel lymph nodes (SLNs) from breast cancer patients. The aim of this study was to assess a completely automated, cartridge-based version of the assay for accuracy, predictive value, and reproducibility. The triplex (two markers + control) QRT-PCR assay was incorporated into a single-use cartridge for point-of-care use on the GeneXpert system. Three academic centers participated equally. Twenty-nine positive lymph nodes and 30 negative lymph nodes were analyzed to establish classification rules. SLNs from 120 patients were subsequently analyzed by QRT-PCR and histology (including immunohistochemistry), and the predetermined decision rules were used to classify the SLNs; 112 SLN specimens produced an informative result by both QRT-PCR and histology. By histological analysis, 21 SLNs were positive and 91 SLNs were negative for metastasis. QRT-PCR characterization produced a classification with 100% sensitivity, 97.8% specificity, and 98.2% accuracy compared with histology (91.3% positive predictive value and 100% negative predictive value). Interlaboratory reproducibility analyses demonstrated that a 95% prediction interval for a new measurement (DeltaCt) ranged between 0.403 and 0.956. This fully automated QRT-PCR assay accurately characterizes breast cancer SLNs for the presence of metastasis. Furthermore, the assay is not dependent on subjective interpretation, is reproducible across three clinical environments, and is rapid enough to allow intraoperative decision making. PMID:19797614

  18. Functional characterization of the principal sigma factor RpoD of phytoplasmas via an in vitro transcription assay

    PubMed Central

    Miura, Chihiro; Komatsu, Ken; Maejima, Kensaku; Nijo, Takamichi; Kitazawa, Yugo; Tomomitsu, Tatsuya; Yusa, Akira; Himeno, Misako; Oshima, Kenro; Namba, Shigetou

    2015-01-01

    Phytoplasmas (class, Mollicutes) are insect-transmissible and plant-pathogenic bacteria that multiply intracellularly in both plants and insects through host switching. Our previous study revealed that phytoplasmal sigma factor rpoD of OY-M strain (rpoDOY) could be a key regulator of host switching, because the expression level of rpoDOY was higher in insect hosts than in plant hosts. In this study, we developed an in vitro transcription assay system to identify RpoDOY-dependent genes and the consensus promoter elements. The assay revealed that RpoDOY regulated some housekeeping, virulence, and host–phytoplasma interaction genes of OY-M strain. The upstream region of the transcription start sites of these genes contained conserved –35 and –10 promoter sequences, which were similar to the typical bacterial RpoD-dependent promoter elements, while the –35 promoter elements were variable. In addition, we searched putative RpoD-dependent genes based on these promoter elements on the whole genome sequence of phytoplasmas using in silico tools. The phytoplasmal RpoD seems to mediate the transcription of not only many housekeeping genes as the principal sigma factor, but also the virulence- and host-phytoplasma interaction-related genes exhibiting host-specific expression patterns. These results indicate that more complex mechanisms exist than previously thought regarding gene regulation enabling phytoplasmas to switch hosts. PMID:26150080

  19. Toxin activity assays, devices, methods and systems therefor

    DOEpatents

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

    2016-04-05

    Embodiments of the present invention are directed toward devices, system and method for conducting toxin activity assay using sedimentation. The toxin activity assay may include generating complexes which bind to a plurality of beads in a fluid sample. The complexes may include a target toxin and a labeling agent, or may be generated due to presence of active target toxin and/or labeling agent designed to be incorporated into complexes responsive to the presence of target active toxin. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a lower density than a density of the beads and higher than a density of the fluid sample, and wherein the transporting occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.

  20. Transcriptional regulator Leu3 of Saccharomyces cerevisiae: separation of activator and repressor functions.

    PubMed Central

    Sze, J Y; Remboutsika, E; Kohlhaw, G B

    1993-01-01

    The Leu3 protein of Saccharomyces cerevisiae binds to specific DNA sequences present in the 5' noncoding region of at least five RNA polymerase II-transcribed genes. Leu3 functions as a transcriptional activator only when the metabolic intermediate alpha-isopropylmalate is also present. In the absence of alpha-isopropylmalate, Leu3 causes transcription to be repressed below basal levels. We show here that different portions of the Leu3 protein are responsible for activation and repression. Fusion of the 30 C-terminal residues of Leu3 to the DNA-binding domain of the Gal4 protein created a strong cross-species activator, demonstrating that the short C-terminal region is not only required but also sufficient for transcriptional activation. Using a recently developed Leu3-responsive in vitro transcription assay as a test system for repression (J. Sze, M. Woontner, J. Jaehning, and G. B. Kohlhaw, Science 258:1143-1145, 1992), we show that mutant forms of the Leu3 protein that lack the activation domain still function as repressors. The shortest repressor thus identified had only about 15% of the mass of the full-length Leu3 protein and was centered on the DNA-binding region of Leu3. Implications of this finding for the mechanism of repression are discussed. Images PMID:8355711

  1. Transcriptional regulator Leu3 of Saccharomyces cerevisiae: separation of activator and repressor functions.

    PubMed

    Sze, J Y; Remboutsika, E; Kohlhaw, G B

    1993-09-01

    The Leu3 protein of Saccharomyces cerevisiae binds to specific DNA sequences present in the 5' noncoding region of at least five RNA polymerase II-transcribed genes. Leu3 functions as a transcriptional activator only when the metabolic intermediate alpha-isopropylmalate is also present. In the absence of alpha-isopropylmalate, Leu3 causes transcription to be repressed below basal levels. We show here that different portions of the Leu3 protein are responsible for activation and repression. Fusion of the 30 C-terminal residues of Leu3 to the DNA-binding domain of the Gal4 protein created a strong cross-species activator, demonstrating that the short C-terminal region is not only required but also sufficient for transcriptional activation. Using a recently developed Leu3-responsive in vitro transcription assay as a test system for repression (J. Sze, M. Woontner, J. Jaehning, and G. B. Kohlhaw, Science 258:1143-1145, 1992), we show that mutant forms of the Leu3 protein that lack the activation domain still function as repressors. The shortest repressor thus identified had only about 15% of the mass of the full-length Leu3 protein and was centered on the DNA-binding region of Leu3. Implications of this finding for the mechanism of repression are discussed. PMID:8355711

  2. A new robust kinetic assay for DAP epimerase activity.

    PubMed

    Hor, Lilian; Peverelli, Martin G; Perugini, Matthew A; Hutton, Craig A

    2013-10-01

    DAP epimerase is the penultimate enzyme in the lysine biosynthesis pathway. The most versatile assay for DAP epimerase catalytic activity employs a coupled DAP epimerase-DAP dehydrogenase enzyme system with a commercial mixture of DAP isomers as substrate. DAP dehydrogenase converts meso-DAP to THDP with concomitant reduction of NADP(+) to NADPH. We show that at high concentrations, accumulation of NADPH results in inhibition of DAPDH, resulting in spurious kinetic data. A new assay has been developed employing DAP decarboxylase that allows the reliable characterisation of DAP epimerase enzyme kinetics. PMID:23838343

  3. A chromogenic assay for limit dextrinase and pullulanase activity.

    PubMed

    Bøjstrup, Marie; Christensen, Caspar Elo; Windahl, Michael Skovbo; Henriksen, Anette; Hindsgaul, Ole

    2014-03-15

    A new chromogenic substrate to assay the starch debranching enzymes limit dextrinase and pullulanase is described. The 2-chloro-4-nitrophenyl glycoside of a commercially available branched heptasaccharide (Glc-maltotriosyl-maltotriose) was found to be a suitable specific substrate for starch debranching enzymes and allows convenient assays of enzymatic activities in a format suited for high-throughput analysis. The kinetic parameters of these enzymes toward the synthesized substrate are determined, and the selectivity of the substrate in a complex cereal-based extract is established. PMID:24333247

  4. Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter.

    PubMed Central

    Samet, James M; Silbajoris, Robert; Huang, Tony; Jaspers, Ilona

    2002-01-01

    Metallic constituents contained in ambient particulate matter have been associated with adverse effects in a number of epidemiologic, in vitro, and in vivo studies. Residual oil fly ash (ROFA) is a metallic by-product of the combustion of fossil fuel oil, which has been shown to induce a variety of proinflammatory responses in lung cells. We have examined signaling pathways activated in response to ROFA exposure and recently reported that ROFA treatment activates multiple mitogen-activated protein (MAP) kinases in the rat lung. In the present study we extended our investigations on the mechanism of toxicity of ROFA to include transcription factors whose activities are regulated by MAP kinases as well as possible effectors of transcriptional changes that mediate the effects of ROFA. We applied immunohistochemical methods to detect ROFA-induced activation of nuclear factor-kappa B (NF kappa B), activating transcription factor-2 (ATF-2), c-Jun, and cAMP response element binding protein (CREB) in intact lung tissue and confirmed and characterized their functional activation using DNA binding assays. We performed these studies using a perfused rabbit lung model that is devoid of blood elements in order to distinguish between intrinsic lung cell effects and effects that are secondary to inflammatory cell influx. We report here that exposure to ROFA results in a rapid activation of all of the transcription factors studied by exerting direct effects on lung cells. These findings validate the use of immunohistochemistry to detect transcription factor activation in vivo and demonstrate the utility of studying signaling changes in response to environmental exposures. PMID:12361922

  5. n-Butyrate inhibits Jun NH(2)-terminal kinase activation and cytokine transcription in mast cells

    SciTech Connect

    Diakos, Christos; Prieschl, Eva E.; Saeemann, Marcus D.; Boehmig, Georg A.; Csonga, Robert; Sobanov, Yury; Baumruker, Thomas; Zlabinger, Gerhard J. . E-mail: gerhard.zlabinger@meduniwien.ac.at

    2006-10-20

    Mast cells are well known to contribute to type I allergic conditions but only recently have been brought in association with chronic relapsing/remitting autoimmune diseases such as celiac disease and ulcerative colitis. Since the bacterial metabolite n-butyrate is considered to counteract intestinal inflammation we investigated the effects of this short chain fatty acid on mast cell activation. Using RNAse protection assays and reporter gene technology we show that n-butyrate downregulates TNF-{alpha} transcription. This correlates with an impaired activation of the Jun NH(2)-terminal kinase (JNK) but not other MAP kinases such as ERK and p38 that are largely unaffected by n-butyrate. As a consequence, we observed a decreased nuclear activity of AP-1 and NF-AT transcription factors. These results indicate that n-butyrate inhibits critical inflammatory mediators in mast cells by relatively selectively targeting the JNK signalling.

  6. Sug1 modulates yeast transcription activation by Cdc68.

    PubMed Central

    Xu, Q; Singer, R A; Johnston, G C

    1995-01-01

    The Cdc68 protein is required for the transcription of a variety of genes in the yeast Saccharomyces cerevisiae. In a search for proteins involved in the activity of the Cdc68 protein, we identified four suppressor genes in which mutations reverse the temperature sensitivity caused by the cdc68-1 allele. We report here the molecular characterization of mutations in one suppressor gene, the previously identified SUG1 gene. The Sug1 protein has been implicated in both transcriptional regulation and proteolysis. sug1 suppressor alleles reversed most aspects of the cdc68-1 mutant phenotype but did not suppress the lethality of a cdc68 null allele, indicating that sug1 suppression is by restoration of Cdc68 activity. Our evidence suggests that suppression by sug1 is unlikely to be due to increased stability of mutant Cdc68 protein, despite the observation that Sug1 affected proteolysis of mutant Cdc68. We report here that attenuated Sug1 activity strengthens mutant Cdc68 activity, whereas increased Sug1 activity further inhibits enfeebled Cdc68 activity, suggesting that Sug1 antagonizes the activator function of Cdc68 for transcription. Consistent with this hypothesis, we find that Sug1 represses transcription in vivo. PMID:7565755

  7. Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

    NASA Technical Reports Server (NTRS)

    Morrow, Maureen A.

    2003-01-01

    Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

  8. Rapid detection of European orthobunyaviruses by reverse transcription loop-mediated isothermal amplification assays.

    PubMed

    Camp, Jeremy V; Nowotny, Norbert

    2016-10-01

    The development of reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) assays are described herein for the detection of two orthobunyaviruses (Bunyaviridae), which represent the two main serogroups found in mosquitoes in Central Europe. The RT-LAMP assays were optimized for the detection of Ťahyňa virus (a California encephalitis group virus found in Aedes sp or Ochlerotatus sp mosquitoes) and Batai virus (also called Čalovo virus, a Bunyamwera group virus found in Anopheles maculipennis s.l. mosquitoes) nucleic acid using endemic European virus isolates. The sensitivity of the RT-LAMP assays was determined to be comparable to that of conventional tests, with a limit of detection<0.1 pfu per reaction. The assays can be performed in 60min under isothermal conditions using very simple equipment. Furthermore, it was possible to proceed with the assays without nucleic acid extraction, albeit at a 100-fold loss of sensitivity. The RT-LAMP assays are a sensitive, cost-efficient method for both arbovirus surveillance as well as diagnostic laboratories to detect the presence of these endemic orthobunyaviruses. PMID:27491341

  9. Assay for Lipolytic and Proteolytic Activity Using Marine Substrates

    PubMed Central

    Tom, Raymond A.; Crisan, Eli V.

    1975-01-01

    Nondestructive assay procedures for determining microbial lipolytic and proteolytic activity on marine substrates were developed and tested with 287 isolates of bacteria, filamentous fungi, and yeasts. A definite substrate specificity was noted when the enzymatic activities on marine and nonmarine substrates was compared. Of 170 lipolytic isolates, 14 were only active on menhaden oil, 11 could hydrolyze menhaden oil and Tween 80 and/or tributyrin, and 145 isolates could only hydrolyze one or both of the nonmarine lipids. Of the 198 proteolytic isolates, 10 were specific for codfish extract, 152 were active against the marine substrate plus casein and/or gelatin, and 36 were specific for nonmarine substrates. PMID:1167775

  10. Model of transcriptional activation by MarA in escherichia coli

    SciTech Connect

    Wall, Michael E; Rosner, Judah L; Martin, Robert G

    2009-01-01

    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

  11. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for rapid diagnosis of chilli veinal mottle virus.

    PubMed

    Banerjee, Amrita; Roy, Somnath; Sharma, Susheel Kumar; Dutta, Sudip Kumar; Chandra, Satish; Ngachan, S V

    2016-07-01

    Chilli veinal mottle virus (ChiVMV) causes significant economic loss to chilli cultivation in northeastern India, as well as in eastern Asia. In this study, we have developed a single-tube one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for rapid, sensitive and specific diagnosis of ChiVMV. Amplification could be visualized after adding SYBR Green I (1000×) dye within 60 min under isothermal conditions at 63 °C, with a set of four primers designed based on the large nuclear inclusion protein (NIb) domain of ChiVMV (isolate KC-ML1). The RT-LAMP method was 100 times more sensitive than one-step reverse transcription polymerase chain reaction (RT-PCR), with a detection limit of 0.0001 ng of total RNA per reaction. PMID:27063408

  12. An arcane role of DNA in transcription activation.

    PubMed Central

    Ryu, S; Garges, S; Adhya, S

    1994-01-01

    The mechanism by which the cAMP receptor protein (CRP) activates transcription has been investigated using the lac promoter of Escherichia coli. For transcription activation, an interaction between DNA-bound CRP and RNA polymerase is not sufficient. CRP must bind to a site in the same DNA and close to the promoter. CRP action requires an intact spacer DNA to provide a rigid support in building a CRP-RNA polymerase protein bridge or to allow a conformational change in the DNA to be transmitted to the lac promoter using the protein bridge as a structural support. Images PMID:7811325

  13. Nucleosomes unfold completely at a transcriptionally active promoter.

    PubMed

    Boeger, Hinrich; Griesenbeck, Joachim; Strattan, J Seth; Kornberg, Roger D

    2003-06-01

    It has long been known that promoter DNA is converted to a nuclease-sensitive state upon transcriptional activation. Recent findings have raised the possibility that this conversion reflects only a partial unfolding or other perturbation of nucleosomal structure, rather than the loss of nucleosomes. We report topological, sedimentation, nuclease digestion, and ChIP analyses, which demonstrate the complete unfolding of nucleosomes at the transcriptionally active PHO5 promoter of the yeast Saccharomyces cerevisiae. Although nucleosome loss occurs at all promoter sites, it is not complete at any of them, suggesting the existence of an equilibrium between the removal of nucleosomes and their reformation. PMID:12820971

  14. More insights into a human adipose tissue GPAT activity assay

    PubMed Central

    Morgan-Bathke, Maria; Chen, Liang; Oberschneider, Elisabeth; Harteneck, Debra; Jensen, Michael D

    2016-01-01

    ABSTRACT Adipose tissue fatty acid storage varies according to sex, adipose tissue depot and degree of fat gain. However, the mechanism(s) for these variations is not completely understood. We recently published findings based on the glycerol 3-phosphate acyltransferase (GPAT) enzyme activity assay we optimized for use with human adipose tissue. These findings include a decrease in total GPAT and GPAT1 as a function of adipocyte size in both omental and subcutaneous adipose tissue and a strong, positive correlations between ACS, GPAT, and DGAT activities for both sexes and depots and between these storage factors and palmitate storage rates into TAG. The aim of this commentary is to expand upon the data from our recent publication. We describe here additional details on the optimization of the GPAT enzyme activity assay, a correlation between DGAT and percentage palmitate in the diacylglycerol fraction, and sex differences in fatty acid storage factors and storage rates into TAG at high palmitate concentrations. PMID:27144101

  15. PKG-1α mediates GATA4 transcriptional activity.

    PubMed

    Ma, Yanlin; Wang, Jun; Yu, Yanhong; Schwartz, Robert J

    2016-06-01

    GATA4, a zinc-finger transcription factor, is central for cardiac development and diseases. Here we show that GATA4 transcriptional activity is mediated by cell signaling via cGMP dependent PKG-1α activity. Protein kinase G (PKG), a serine/tyrosine specific kinase is the major effector of cGMP signaling. We observed enhanced transcriptional activity elicited by co-expressed GATA4 and PKG-1α. Phosphorylation of GATA4 by PKG-1α was detected on serine 261 (S261), while the C-terminal activation domain of GATA4 associated with PKG-1α. GATA4's DNA binding activity was enhanced by PKG-1α via by both phosphorylation and physical association. More importantly, a number of human disease-linked GATA4 mutants exhibited impaired S261 phosphorylation, pointing to defective S261 phosphorylation in the elaboration of human heart diseases. We showed S261 phosphorylation was favored by PKG-1α but not by PKA, and several other kinase signaling pathways such as MAPK and PKC. Our observations demonstrate that cGMP-PKG signaling mediates transcriptional activity of GATA4 and links defective GATA4 and PKG-1α mutations to the development of human heart disease. PMID:26946174

  16. The AP-1 transcription factor homolog Pf-AP-1 activates transcription of multiple biomineral proteins and potentially participates in Pinctada fucata biomineralization

    PubMed Central

    Zheng, Xiangnan; Cheng, Minzhang; Xiang, Liang; Liang, Jian; Xie, Liping; Zhang, Rongqing

    2015-01-01

    Activator protein-1 (AP-1) is an important bZIP transcription factor that regulates a series of physiological processes by specifically activating transcription of several genes, and one of its well-chartered functions in mammals is participating in bone mineralization. We isolated and cloned the complete cDNA of a Jun/AP-1 homolog from Pinctada fucata and called it Pf-AP-1. Pf-AP-1 had a highly conserved bZIP region and phosphorylation sites compared with those from mammals. A tissue distribution analysis showed that Pf-AP-1 was ubiquitously expressed in P. fucata and the mRNA level of Pf-AP-1 is extremely high in mantle. Pf-AP-1 expression was positively associated with multiple biomineral proteins in the mantle. The luciferase reporter assay in a mammalian cell line showed that Pf-AP-1 significantly up-regulates the transcriptional activity of the promoters of KRMP, Pearlin, and Prisilkin39. Inhibiting the activity of Pf-AP-1 depressed the expression of multiple matrix proteins. Pf-AP-1 showed a unique expression pattern during shell regeneration and pearl sac development, which was similar to the pattern observed for biomineral proteins. These results suggest that the Pf-AP-1 AP-1 homolog is an important transcription factor that regulates transcription of several biomineral proteins simultaneously and plays a role in P. fucata biomineralization, particularly during pearl and shell formation. PMID:26404494

  17. Detection of DNA polymerase activities associated with purified duck hepatitis B virus core particles by using an activity gel assay.

    PubMed Central

    Oberhaus, S M; Newbold, J E

    1993-01-01

    Replication of hepadnaviruses involves reverse transcription of an intermediate RNA molecule. It is generally accepted that this replication scheme is carried out by a virally encoded, multifunctional polymerase which has DNA-dependent DNA polymerase, reverse transcriptase, and RNase H activities. Biochemical studies of the polymerase protein(s) have been limited by the inability to purify useful quantities of functional enzyme from virus particles and, until recently, to express enzymatically active polymerase proteins in heterologous systems. An activity gel assay which detects in situ catalytic activities of DNA polymerases after electrophoresis in partially denaturing polyacrylamide gels was used by M.R. Bavand and O. Laub (J. Virol. 62:626-628, 1988) to show the presence of DNA- and RNA-dependent DNA polymerase activities associated with hepatitis B virus particles produced in vitro. This assay has provided the only means by which hepadnavirus polymerase proteins have been detected in association with enzymatic activities. Since conventional methods have not allowed purification of useful quantities of enzymatically active polymerase protein(s), we have devised a protocol for purifying large quantities of duck hepatitis B virus (DHBV) core particles to near homogeneity. These immature virus particles contain DNA- and RNA-dependent DNA polymerase activities, as shown in the endogenous DNA polymerase assay. We have used the activity gel assay to detect multiple DNA- and RNA-dependent DNA polymerase proteins associated with these purified DHBV core particles. These enzymatically active proteins appear larger than, approximately the same size as, and smaller than an unmodified DHBV polymerase protein predicted from the polymerase open reading frame. This is the first report of the detection of active hepadnavirus core-associated DNA polymerase proteins derived from a natural host. Images PMID:8411359

  18. Mining Chemical Activity Status from High-Throughput Screening Assays

    PubMed Central

    Soufan, Othman; Ba-alawi, Wail; Afeef, Moataz; Essack, Magbubah; Rodionov, Valentin; Kalnis, Panos; Bajic, Vladimir B.

    2015-01-01

    High-throughput screening (HTS) experiments provide a valuable resource that reports biological activity of numerous chemical compounds relative to their molecular targets. Building computational models that accurately predict such activity status (active vs. inactive) in specific assays is a challenging task given the large volume of data and frequently small proportion of active compounds relative to the inactive ones. We developed a method, DRAMOTE, to predict activity status of chemical compounds in HTP activity assays. For a class of HTP assays, our method achieves considerably better results than the current state-of-the-art-solutions. We achieved this by modification of a minority oversampling technique. To demonstrate that DRAMOTE is performing better than the other methods, we performed a comprehensive comparison analysis with several other methods and evaluated them on data from 11 PubChem assays through 1,350 experiments that involved approximately 500,000 interactions between chemicals and their target proteins. As an example of potential use, we applied DRAMOTE to develop robust models for predicting FDA approved drugs that have high probability to interact with the thyroid stimulating hormone receptor (TSHR) in humans. Our findings are further partially and indirectly supported by 3D docking results and literature information. The results based on approximately 500,000 interactions suggest that DRAMOTE has performed the best and that it can be used for developing robust virtual screening models. The datasets and implementation of all solutions are available as a MATLAB toolbox online at www.cbrc.kaust.edu.sa/dramote and can be found on Figshare. PMID:26658480

  19. Novel yeast cell dehydrogenase activity assay in situ.

    PubMed

    Berłowska, Joanna; Kregiel, Dorota; Klimek, Leszek; Orzeszyna, Bartosz; Ambroziak, Wojciech

    2006-01-01

    The aim of this research was to develop a suitable method of succinate dehydrogenase activity assay in situ for different industrial yeast strains. For this purpose different compounds: EDTA, Triton X-100, sodium deoxycholate, digitonin, nystatin and beta-mercaptoethanol were used. The permeabilization process was controlled microscopically by primuline staining. Enzyme assay was conducted in whole yeast cells with Na-succinate as substrate, phenazine methosulfate (PMS) as electron carrier and in the presence one of two different tetrazolium salts: tetrazolium blue chloride (BT) or cyanoditolyl tetrazolium chloride (CTC) reduced during the assay. In comparabile studies of yeast vitality the amount of intracellular ATP was determined according to luciferin/luciferase method. During the succinate dehydrogenase assay in intact yeast cells without permeabilization, BT formazans were partially visualized in the cells, but CTC formazans appeared to be totally extracellular or associated with the plasma membrane. Under these conditions there was no linear relationship between formazan color intensity signal and yeast cell density. From all chemical compounds tested, only digitonin was effective in membrane permeabilization without negative influence on cell morphology. Furthermore, with digitonin-treated cells a linear relationship between formazan color intensity signal and yeast cell number was noticed. Significant decreasing of succinate dehydrogenase activity and ATP content were observed during aging of the tested yeast strains. PMID:17419290

  20. Ubiquitously expressed transcript is a novel interacting protein of protein inhibitor of activated signal transducer and activator of transcription 2

    PubMed Central

    KONG, XIANG; MA, SHIKUN; GUO, JIAQIAN; MA, YAN; HU, YANQIU; WANG, JIANJUN; ZHENG, YING

    2015-01-01

    Protein inhibitor of activated signal transducer and activator of transcription 2 (PIAS2) is a member of the PIAS protein family. This protein family modulates the activity of several transcription factors and acts as an E3 ubiquitin ligase in the sumoylation pathway. To improve understanding of the physiological roles of PIAS2, the current study used a yeast two-hybrid system to screen mouse stem cell cDNA libraries for proteins that interact with PIAS2. The screening identified an interaction between PIAS2 and ubiquitously expressed transcript (UXT). UXT, also termed androgen receptor trapped clone-27, is an α-class prefoldin-type chaperone that acts as a coregulator for various transcription factors, including nuclear factor-κB and androgen receptor (AR). A direct interaction between PIAS2 and UXT was confirmed by direct yeast two-hybrid analysis. In vitro evidence of the association of UXT with PIAS2 was obtained by co-immunoprecipitation. Colocalization between PIAS2 and UXT was identified in the nucleus and cytoplasm of HEK 293T and human cervical carcinoma HeLa cells. The results of the current study suggested that UXT is a binding protein of PIAS2, and interaction between PIAS2 and UXT may be important for the transcriptional activation of AR. PMID:25434787

  1. A Novel PCR Assay for Listeria welshimeri Targeting Transcriptional Regulator Gene lwe1801

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional regulator genes encode a group of specialized molecules that play essential roles in microbial responses to changing external conditions. These genes have been shown to possess species or group specificity and are useful as detection targets for diagnostic application. The present st...

  2. Internal Ribosome Entry Site-Based Bicistronic In Situ Reporter Assays for Discovery of Transcription-Targeted Lead Compounds.

    PubMed

    Lang, Liwei; Ding, Han-Fei; Chen, Xiaoguang; Sun, Shi-Yong; Liu, Gang; Yan, Chunhong

    2015-07-23

    Although transgene-based reporter gene assays have been used to discover small molecules targeting expression of cancer-driving genes, the success is limited due to the fact that reporter gene expression regulated by incomplete cis-acting elements and foreign epigenetic environments does not faithfully reproduce chemical responses of endogenous genes. Here, we present an internal ribosome entry site-based strategy for bicistronically co-expressing reporter genes with an endogenous gene in the native gene locus, yielding an in situ reporter assay closely mimicking endogenous gene expression without disintegrating its function. This strategy combines the CRISPR-Cas9-mediated genome-editing tool with the recombinase-mediated cassette-exchange technology, and allows for rapid development of orthogonal assays for excluding false hits generated from primary screens. We validated this strategy by developing a screening platform for identifying compounds targeting oncogenic eIF4E, and demonstrated that the novel reporter assays are powerful in searching for transcription-targeted lead compounds with high confidence. PMID:26144883

  3. Physical coupling of activation and derepression activities to maintain an active transcriptional state at FLC.

    PubMed

    Yang, Hongchun; Howard, Martin; Dean, Caroline

    2016-08-16

    Establishment and maintenance of gene expression states is central to development and differentiation. Transcriptional and epigenetic mechanisms interconnect in poorly understood ways to determine these states. We explore these mechanisms through dissection of the regulation of Arabidopsis thaliana FLOWERING LOCUS C (FLC). FLC can be present in a transcriptionally active state marked by H3K36me3 or a silent state marked by H3K27me3. Here, we investigate the trans factors modifying these opposing histone states and find a physical coupling in vivo between the H3K36 methyltransferase, SDG8, and the H3K27me3 demethylase, ELF6. Previous modeling has predicted this coupling would exist as it facilitates bistability of opposing histone states. We also find association of SDG8 with the transcription machinery, namely RNA polymerase II and the PAF1 complex. Delivery of the active histone modifications is therefore likely to be through transcription at the locus. SDG8 and ELF6 were found to influence the localization of each other on FLC chromatin, showing the functional importance of the interaction. In addition, both influenced accumulation of the associated H3K27me3 and H3K36me3 histone modifications at FLC We propose the physical coupling of activation and derepression activities coordinates transcriptional activity and prevents ectopic silencing. PMID:27482092

  4. Physical coupling of activation and derepression activities to maintain an active transcriptional state at FLC

    PubMed Central

    Yang, Hongchun; Howard, Martin; Dean, Caroline

    2016-01-01

    Establishment and maintenance of gene expression states is central to development and differentiation. Transcriptional and epigenetic mechanisms interconnect in poorly understood ways to determine these states. We explore these mechanisms through dissection of the regulation of Arabidopsis thaliana FLOWERING LOCUS C (FLC). FLC can be present in a transcriptionally active state marked by H3K36me3 or a silent state marked by H3K27me3. Here, we investigate the trans factors modifying these opposing histone states and find a physical coupling in vivo between the H3K36 methyltransferase, SDG8, and the H3K27me3 demethylase, ELF6. Previous modeling has predicted this coupling would exist as it facilitates bistability of opposing histone states. We also find association of SDG8 with the transcription machinery, namely RNA polymerase II and the PAF1 complex. Delivery of the active histone modifications is therefore likely to be through transcription at the locus. SDG8 and ELF6 were found to influence the localization of each other on FLC chromatin, showing the functional importance of the interaction. In addition, both influenced accumulation of the associated H3K27me3 and H3K36me3 histone modifications at FLC. We propose the physical coupling of activation and derepression activities coordinates transcriptional activity and prevents ectopic silencing. PMID:27482092

  5. Benzimidazoles diminish ERE transcriptional activity and cell growth in breast cancer cells

    SciTech Connect

    Payton-Stewart, Florastina; Tilghman, Syreeta L.; Williams, LaKeisha G.; Winfield, Leyte L.

    2014-08-08

    Highlights: • The methyl-substituted benzimidazole was more effective at inhibiting growth in MDA-MB 231 cells. • The naphthyl-substituted benzimidazole was more effective at inhibiting growth in MCF-7 cells than ICI. • The benzimidazole molecules demonstrated a dose-dependent reduction in ERE transcriptional activity. • The benzimidazole molecules had binding mode in ERα and ERβ comparable to that of the co-crystallized ligand. - Abstract: Estrogen receptors (ERα and ERβ) are members of the nuclear receptor superfamily. They regulate the transcription of estrogen-responsive genes and mediate numerous estrogen related diseases (i.e., fertility, osteoporosis, cancer, etc.). As such, ERs are potentially useful targets for developing therapies and diagnostic tools for hormonally responsive human breast cancers. In this work, two benzimidazole-based sulfonamides originally designed to reduce proliferation in prostate cancer, have been evaluated for their ability to modulate growth in estrogen dependent and independent cell lines (MCF-7 and MDA-MB 231) using cell viability assays. The molecules reduced growth in MCF-7 cells, but differed in their impact on the growth of MDA-MB 231 cells. Although both molecules reduced estrogen response element (ERE) transcriptional activity in a dose dependent manner, the contrasting activity in the MDA-MB-231 cells seems to suggest that the molecules may act through alternate ER-mediated pathways. Further, the methyl analog showed modest selectivity for the ERβ receptor in an ER gene expression array panel, while the naphthyl analog did not significantly alter gene expression. The molecules were docked in the ligand binding domains of the ERα-antagonist and ERβ-agonist crystal structures to evaluate the potential of the molecules to interact with the receptors. The computational analysis complimented the results obtained in the assay of transcriptional activity and gene expression suggesting that the molecules

  6. SUMOylation of DLX3 by SUMO1 promotes its transcriptional activity.

    PubMed

    Duverger, Olivier; Chen, Susie X; Lee, Delia; Li, Tianwei; Chock, P Boon; Morasso, Maria I

    2011-02-01

    Small ubiquitin-like modifiers (SUMO) are post-translational modifiers that regulate target protein activity in diverse ways. The most common group of SUMO substrates is transcription factors, whose transcriptional activity can be altered positively or negatively as a result of SUMOylation. DLX3 is a homeodomain transcription factor involved in placental development, in the differentiation of structures involving epithelial-mesenchymal interactions, such as hair, teeth and nails, and in bone mineralization. We identified two potential SUMOylation sites in the N-terminal domain of DLX3 at positions K83 and K112. Among the six members of the Distal-less family, DLX3 is the only member containing these sites, which are highly conserved among vertebrates. Co-expression experiments demonstrated that DLX3 can be SUMOylated by SUMO1. Site-directed mutagenesis of lysines 83 and 112 to arginines (K83R and K112R) demonstrated that only K112 is involved in SUMOylation. Immunocytochemical analysis determined that SUMOylation does not affect DLX3 translocation to the nucleus and favors perinuclear localization. Moreover, using electrophoresis mobility shift assay (EMSA), we found that DLX3 is still able to bind DNA when SUMOylated. Using luciferase reporter assays, we showed that DLX3(K112R) exhibits a significantly lower transcriptional activity compared to DLX3(WT), suggesting that SUMOylation has a positive effect on DLX3 activity. We identified a new level of regulation in the activity of DLX3 that may play a crucial role in the regulation of hair, teeth, and bone development. PMID:21268066

  7. Aerobic glycolysis tunes YAP/TAZ transcriptional activity

    PubMed Central

    Enzo, Elena; Santinon, Giulia; Pocaterra, Arianna; Aragona, Mariaceleste; Bresolin, Silvia; Forcato, Mattia; Grifoni, Daniela; Pession, Annalisa; Zanconato, Francesca; Guzzo, Giulia; Bicciato, Silvio; Dupont, Sirio

    2015-01-01

    Increased glucose metabolism and reprogramming toward aerobic glycolysis are a hallmark of cancer cells, meeting their metabolic needs for sustained cell proliferation. Metabolic reprogramming is usually considered as a downstream consequence of tumor development and oncogene activation; growing evidence indicates, however, that metabolism on its turn can support oncogenic signaling to foster tumor malignancy. Here, we explored how glucose metabolism regulates gene transcription and found an unexpected link with YAP/TAZ, key transcription factors regulating organ growth, tumor cell proliferation and aggressiveness. When cells actively incorporate glucose and route it through glycolysis, YAP/TAZ are fully active; when glucose metabolism is blocked, or glycolysis is reduced, YAP/TAZ transcriptional activity is decreased. Accordingly, glycolysis is required to sustain YAP/TAZ pro-tumorigenic functions, and YAP/TAZ are required for the full deployment of glucose growth-promoting activity. Mechanistically we found that phosphofructokinase (PFK1), the enzyme regulating the first committed step of glycolysis, binds the YAP/TAZ transcriptional cofactors TEADs and promotes their functional and biochemical cooperation with YAP/TAZ. Strikingly, this regulation is conserved in Drosophila, where phosphofructokinase is required for tissue overgrowth promoted by Yki, the fly homologue of YAP. Moreover, gene expression regulated by glucose metabolism in breast cancer cells is strongly associated in a large dataset of primary human mammary tumors with YAP/TAZ activation and with the progression toward more advanced and malignant stages. These findings suggest that aerobic glycolysis endows cancer cells with particular metabolic properties and at the same time sustains transcription factors with potent pro-tumorigenic activities such as YAP/TAZ. PMID:25796446

  8. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    SciTech Connect

    Taulan, M. Lopez, E.; Guittard, C.; Rene, C.; Baux, D.; Altieri, J.P.; DesGeorges, M.; Claustres, M.; Romey, M.C.

    2007-09-28

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter.

  9. TBP domain symmetry in basal and activated archaeal transcription.

    PubMed

    Ouhammouch, Mohamed; Hausner, Winfried; Geiduschek, E Peter

    2009-01-01

    The TATA box binding protein (TBP) is the platform for assembly of archaeal and eukaryotic transcription preinitiation complexes. Ancestral gene duplication and fusion events have produced the saddle-shaped TBP molecule, with its two direct-repeat subdomains and pseudo-two-fold symmetry. Collectively, eukaryotic TBPs have diverged from their present-day archaeal counterparts, which remain highly symmetrical. The similarity of the N- and C-halves of archaeal TBPs is especially pronounced in the Methanococcales and Thermoplasmatales, including complete conservation of their N- and C-terminal stirrups; along with helix H'1, the C-terminal stirrup of TBP forms the main interface with TFB/TFIIB. Here, we show that, in stark contrast to its eukaryotic counterparts, multiple substitutions in the C-terminal stirrup of Methanocaldococcus jannaschii (Mja) TBP do not completely abrogate basal transcription. Using DNA affinity cleavage, we show that, by assembling TFB through its conserved N-terminal stirrup, Mja TBP is in effect ambidextrous with regard to basal transcription. In contrast, substitutions in either its N- or the C-terminal stirrup abrogate activated transcription in response to the Lrp-family transcriptional activator Ptr2. PMID:19007415

  10. A Capsid Gene-Based Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Detection of Marine Vesiviruses in the Caliciviridae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A real-time reverse transcription polymerase chain reaction (rtRT-PCR) assay was developed for the identification of marine vesiviruses. The primers were designed to target a 176-nucleotide fragment within a highly conserved region of the San Miguel sea lion viruses (SMSVs) capsid gene. The assay de...

  11. Combinatorial influence of environmental parameters on transcription factor activity

    PubMed Central

    Knijnenburg, T.A.; Wessels, L.F.A.; Reinders, M.J.T.

    2008-01-01

    Motivation: Cells receive a wide variety of environmental signals, which are often processed combinatorially to generate specific genetic responses. Changes in transcript levels, as observed across different environmental conditions, can, to a large extent, be attributed to changes in the activity of transcription factors (TFs). However, in unraveling these transcription regulation networks, the actual environmental signals are often not incorporated into the model, simply because they have not been measured. The unquantified heterogeneity of the environmental parameters across microarray experiments frustrates regulatory network inference. Results: We propose an inference algorithm that models the influence of environmental parameters on gene expression. The approach is based on a yeast microarray compendium of chemostat steady-state experiments. Chemostat cultivation enables the accurate control and measurement of many of the key cultivation parameters, such as nutrient concentrations, growth rate and temperature. The observed transcript levels are explained by inferring the activity of TFs in response to combinations of cultivation parameters. The interplay between activated enhancers and repressors that bind a gene promoter determine the possible up- or downregulation of the gene. The model is translated into a linear integer optimization problem. The resulting regulatory network identifies the combinatorial effects of environmental parameters on TF activity and gene expression. Availability: The Matlab code is available from the authors upon request. Contact: t.a.knijnenburg@tudelft.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18586711

  12. Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme

    PubMed Central

    Levati, Elisabetta; Sartini, Sara; Bolchi, Angelo; Ottonello, Simone; Montanini, Barbara

    2016-01-01

    Moonlighting proteins, including metabolic enzymes acting as transcription factors (TF), are present in a variety of organisms but have not been described in higher fungi so far. In a previous genome-wide analysis of the TF repertoire of the plant-symbiotic fungus Tuber melanosporum, we identified various enzymes, including the sulfur-assimilation enzyme phosphoadenosine-phosphosulfate reductase (PAPS-red), as potential transcriptional activators. A functional analysis performed in the yeast Saccharomyces cerevisiae, now demonstrates that a specific variant of this enzyme, PAPS-red A, localizes to the nucleus and is capable of transcriptional activation. TF moonlighting, which is not present in the other enzyme variant (PAPS-red B) encoded by the T. melanosporum genome, relies on a transplantable C-terminal polypeptide containing an alternating hydrophobic/hydrophilic amino acid motif. A similar moonlighting activity was demonstrated for six additional proteins, suggesting that multitasking is a relatively frequent event. PAPS-red A is sulfur-state-responsive and highly expressed, especially in fruitbodies, and likely acts as a recruiter of transcription components involved in S-metabolism gene network activation. PAPS-red B, instead, is expressed at low levels and localizes to a highly methylated and silenced region of the genome, hinting at an evolutionary mechanism based on gene duplication, followed by epigenetic silencing of this non-moonlighting gene variant. PMID:27121330

  13. Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme.

    PubMed

    Levati, Elisabetta; Sartini, Sara; Bolchi, Angelo; Ottonello, Simone; Montanini, Barbara

    2016-01-01

    Moonlighting proteins, including metabolic enzymes acting as transcription factors (TF), are present in a variety of organisms but have not been described in higher fungi so far. In a previous genome-wide analysis of the TF repertoire of the plant-symbiotic fungus Tuber melanosporum, we identified various enzymes, including the sulfur-assimilation enzyme phosphoadenosine-phosphosulfate reductase (PAPS-red), as potential transcriptional activators. A functional analysis performed in the yeast Saccharomyces cerevisiae, now demonstrates that a specific variant of this enzyme, PAPS-red A, localizes to the nucleus and is capable of transcriptional activation. TF moonlighting, which is not present in the other enzyme variant (PAPS-red B) encoded by the T. melanosporum genome, relies on a transplantable C-terminal polypeptide containing an alternating hydrophobic/hydrophilic amino acid motif. A similar moonlighting activity was demonstrated for six additional proteins, suggesting that multitasking is a relatively frequent event. PAPS-red A is sulfur-state-responsive and highly expressed, especially in fruitbodies, and likely acts as a recruiter of transcription components involved in S-metabolism gene network activation. PAPS-red B, instead, is expressed at low levels and localizes to a highly methylated and silenced region of the genome, hinting at an evolutionary mechanism based on gene duplication, followed by epigenetic silencing of this non-moonlighting gene variant. PMID:27121330

  14. MEIS C termini harbor transcriptional activation domains that respond to cell signaling.

    PubMed

    Huang, He; Rastegar, Mojgan; Bodner, Caroline; Goh, Siew-Lee; Rambaldi, Isabel; Featherstone, Mark

    2005-03-18

    MEIS proteins form heteromeric DNA-binding complexes with PBX monomers and PBX.HOX heterodimers. We have shown previously that transcriptional activation by PBX.HOX is augmented by either protein kinase A (PKA) or the histone deacetylase inhibitor trichostatin A (TSA). To examine the contribution of MEIS proteins to this response, we used the chromatin immunoprecipitation assay to show that MEIS1 in addition to PBX1, HOXA1, and HOXB1 was recruited to a known PBX.HOX target, the Hoxb1 autoregulatory element following Hoxb1 transcriptional activation in P19 cells. Subsequent to TSA treatment, MEIS1 recruitment lagged behind that of HOX and PBX partners. MEIS1A also enhanced the transcriptional activation of a reporter construct bearing the Hoxb1 autoregulatory element after treatment with TSA. The MEIS1 homeodomain and protein-protein interaction with PBX contributed to this activity. We further mapped TSA-responsive and CREB-binding protein-dependent PKA-responsive transactivation domains to the MEIS1A and MEIS1B C termini. Fine mutation of the 56-residue MEIS1A C terminus revealed four discrete regions required for transcriptional activation function. All of the mutations impairing the response to TSA likewise reduced activation by PKA, implying a common mechanistic basis. C-terminal deletion of MEIS1 impaired transactivation without disrupting DNA binding or complex formation with HOX and PBX. Despite sequence similarity to MEIS and a shared ability to form heteromeric complexes with PBX and HOX partners, the PREP1 C terminus does not respond to TSA or PKA. Thus, MEIS C termini possess transcriptional regulatory domains that respond to cell signaling and confer functional differences between MEIS and PREP proteins. PMID:15654074

  15. Dehydrogenase activity of forest soils depends on the assay used

    NASA Astrophysics Data System (ADS)

    Januszek, Kazimierz; Długa, Joanna; Socha, Jarosław

    2015-01-01

    Dehydrogenases are exclusively intracellular enzymes, which play an important role in the initial stages of oxidation of soil organic matter. One of the most frequently used methods to estimate dehydrogenase activity in soil is based on the use of triphenyltetrazolium chloride as an artificial electron acceptor. The purpose of this study was to compare the activity of dehydrogenases of forest soils with varied physicochemical properties using different triphenyltetrazolium chloride assays. The determination was carried out using the original procedure by Casida et al., a modification of the procedure which involves the use of Ca(OH)2 instead of CaCO3, the Thalmann method, and the assay by Casida et al. without addition of buffer or any salt. Soil dehydrogenase activity depended on the assay used. Dehydrogenase determined by the Casida et al. method without addition of buffer or any salt correlated with the pH values of soils. The autoclaved strongly acidic samples of control soils showed high concentrations of triphenylformazan, probably due to chemical reduction of triphenyltetrazolium chloride. There is, therefore, a need for a sterilization method other than autoclaving, ie a process that results in significant changes in soil properties, thus helping to increase the chemical reduction of triphenyltetrazolium chloride.

  16. Active and passive computed tomography for nondestructive assay

    SciTech Connect

    Bernardi, R T; Camp, D E; Clard, D; Jackson, J A; Martz, H E, Decman, D J; Roberson, G P

    1998-10-28

    Traditional gamma-ray methods used to characterize nuclear waste introduce errors that are related to non-uniform measurement responses associated with unknown radioactive source and matrix material distributions. These errors can be reduced by applying an active and passive tomographic technique (A&PCT) developed at the Lawrence Livermore National Laboratory (LLNL). The technique uses an external radioactive source and active tomography to map the attenuation within a waste barrel as a function of mono-energetic gamma-ray energy. Passive tomography is used to localize and identify specific radioactive waste within the same container. Reconstruction of the passive data using the attenuation maps at specific energies allows internal waste radioactivity to be corrected for any overlying heterogeneous materials, thus yielding an absolute assay of the waste activity. LLNL and Bio-Imaging Research, Inc. have collaborated in a technology transfer effort to integrate an A&PCT assay system into a mobile waste characterization trailer. This mobile system has participated in and passed several formal DOE-sponsored performance demonstrations, tests and evaluations. The system is currently being upgraded with multiple detectors to improve throughput, automated gamma-ray analysis code to simplify the assay, and a new emission reconstruction code to improve accuracy

  17. Model of Transcriptional Activation By MarA in Escherichia Coli

    NASA Astrophysics Data System (ADS)

    Wall, Michael E.; Markowitz, David A.; Rosner, Judah L.; Martin, Robert G.

    2010-01-01

    We have developed a mathematical model of transcriptional activation by MarA in Escherichia coli, and used the model to analyze measurements of MarA-dependent activity of the marRAB, sodA, and micF promoters in mar-rob- cells. The model rationalizes an unexpected poor correlation between the mid-point of in vivo promoter activity profiles and in vitro equilibrium constants for MarA binding to promoter sequences. Analysis of the promoter activity data using the model yielded the following predictions regarding activation mechanisms: (1) MarA activation of the marRAB, sodA, and micF promoters involves a net acceleration of the kinetics of transitions after RNA polymerase binding, up to and including promoter escape and message elongation; (2) RNA polymerase binds to these promoters with nearly unit occupancy in the absence of MarA, making recruitment of polymerase an insignificant factor in activation of these promoters; and (3) instead of recruitment, activation of the micF promoter might involve a repulsion of polymerase combined with a large acceleration of the kinetics of polymerase activity. These predictions are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. A lack of recruitment in transcriptional activation represents an exception to the textbook description of activation of bacterial sigma-70 promoters. However, use of accelerated polymerase kinetics instead of recruitment might confer a competitive advantage to E. coli by decreasing latency in gene regulation.

  18. Enzymatic assay for calmodulins based on plant NAD kinase activity

    SciTech Connect

    Harmon, A.C.; Jarrett, H.W.; Cormier, M.J.

    1984-01-01

    NAD kinase with increased sensitivity to calmodulin was purified from pea seedlings (Pisum sativum L., Willet Wonder). Assays for calmodulin based on the activities of NAD kinase, bovine brain cyclic nucleotide phosphodiesterase, and human erythrocyte Ca/sup 2 -/-ATPase were compared for their sensitivities to calmodulin and for their abilities to discriminate between calmodulins from different sources. The activities of the three enzymes were determined in the presence of various concentrations of calmodulins from human erythrocyte, bovine brain, sea pansy (Renilla reniformis), mung bean seed (Vigna radiata L. Wilczek), mushroom (Agaricus bisporus), and Tetrahymena pyriformis. The concentrations of calmodulin required for 50% activation of the NAD kinase (K/sub 0.5/) ranged from 0.520 ng/ml for Tetrahymena to 2.20 ng/ml for bovine brain. The A/sub 0.5/ s ranged from 19.6 ng/ml for bovine brain calmodulin to 73.5 ng/ml for mushroom calmodulin for phosphodiesterase activation. The K/sub 0.5/'s for the activation of Ca/sup 2 +/-ATPase ranged from 36.3 ng/mol for erythrocyte calmodulin to 61.7 ng/ml for mushroom calmodulin. NAD kinase was not stimulated by phosphatidylcholine, phosphatidylserine, cardiolipin, or palmitoleic acid in the absence or presence of Ca/sup 2 +/. Palmitic acid had a slightly stimulatory effect in the presence of Ca/sup 2 +/ (10% of maximum), but no effect in the absence of Ca/sup 2 +/. Palmitoleic acid inhibited the calmodulin-stimulated activity by 50%. Both the NAD kinase assay and radioimmunoassay were able to detect calmodulin in extracts containing low concentrations of calmodulin. Estimates of calmodulin contents of crude homogenates determined by the NAD kinase assay were consistent with amounts obtained by various purification procedures. 30 references, 1 figure, 4 tables.

  19. Transcriptional Activation of the Cyclin A Gene by the Architectural Transcription Factor HMGA2

    PubMed Central

    Tessari, Michela A.; Gostissa, Monica; Altamura, Sandro; Sgarra, Riccardo; Rustighi, Alessandra; Salvagno, Clio; Caretti, Giuseppina; Imbriano, Carol; Mantovani, Roberto; Del Sal, Giannino; Giancotti, Vincenzo; Manfioletti, Guidalberto

    2003-01-01

    The HMGA2 protein belongs to the HMGA family of architectural transcription factors, which play an important role in chromatin organization. HMGA proteins are overexpressed in several experimental and human tumors and have been implicated in the process of neoplastic transformation. Hmga2 knockout results in the pygmy phenotype in mice and in a decreased growth rate of embryonic fibroblasts, thus indicating a role for HMGA2 in cell proliferation. Here we show that HMGA2 associates with the E1A-regulated transcriptional repressor p120E4F, interfering with p120E4F binding to the cyclin A promoter. Ectopic expression of HMGA2 results in the activation of the cyclin A promoter and induction of the endogenous cyclin A gene. In addition, chromatin immunoprecipitation experiments show that HMGA2 associates with the cyclin A promoter only when the gene is transcriptionally activated. These data identify the cyclin A gene as a cellular target for HMGA2 and, for the first time, suggest a mechanism for HMGA2-dependent cell cycle regulation. PMID:14645522

  20. Novel Mechanism for Regulation of Extracellular SOD Transcription and Activity by Copper: Role of Antioxidant-1

    PubMed Central

    Itoh, Shinichi; Ozumi, Kiyoshi; Kim, Ha Won; Nakagawa, Osamu; McKinney, Ronald D.; Folz, Rodney J.; Zelko, Igor N.; Ushio-Fukai, Masuko; Fukai, Tohru

    2009-01-01

    Extracellular superoxide dismutase (SOD3), a secretory copper-containing antioxidant enzyme, plays an important role in various oxidative stress-dependent cardiovascular diseases. Although cofactor copper is required for SOD3 activity, it remains unknown whether it can regulate SOD3 transcription. We previously demonstrated that SOD3 activity requires the copper chaperone Antioxidant-1 (Atox1) involved in copper delivery to SOD3 at the trans-Golgi network (TGN). Here we show that copper treatment in mouse fibroblasts significantly increases mRNA and protein levels of SOD3, but not SOD1, which is abolished in Atox1-deficient cells. Copper promotes Atox1 translocation to the nucleus. Promoter deletion analysis identifies copper- and Atox1-response element (RE) at the SOD3 promoter. Gel shift and ChIP assays reveal that Atox1 directly binds to the Atox1-RE in a copper-dependent manner in vitro and in vivo. Adenovirus-mediated re-expression in Atox1-/- cells with nucleus-targeted Atox1 (Atox1-NLS), but not TGN-targeted Atox1 (Atox1-TGN), increases SOD3 transcription without affecting SOD3 activity. Importantly, re-expression of both Atox1-NLS and Atox1-TGN together, but not either alone, in Atox1-/- cells increases SOD3 activity. SOD3 transcription is positively regulated by copper through transcription factor function of Atox1, while full activity of SOD3 requires both copper chaperone and transcription factor function of Atox1. Thus, Atox1 is a potential therapeutic target for oxidant stress-dependent cardiovascular disease. PMID:18977292

  1. An Essential Viral Transcription Activator Modulates Chromatin Dynamics

    PubMed Central

    Gibeault, Rebecca L.; Bildersheim, Michael D.

    2016-01-01

    Although ICP4 is the only essential transcription activator of herpes simplex virus 1 (HSV-1), its mechanisms of action are still only partially understood. We and others propose a model in which HSV-1 genomes are chromatinized as a cellular defense to inhibit HSV-1 transcription. To counteract silencing, HSV-1 would have evolved proteins that prevent or destabilize chromatinization to activate transcription. These proteins should act as HSV-1 transcription activators. We have shown that HSV-1 genomes are organized in highly dynamic nucleosomes and that histone dynamics increase in cells infected with wild type HSV-1. We now show that whereas HSV-1 mutants encoding no functional ICP0 or VP16 partially enhanced histone dynamics, mutants encoding no functional ICP4 did so only minimally. Transient expression of ICP4 was sufficient to enhance histone dynamics in the absence of other HSV-1 proteins or HSV-1 DNA. The dynamics of H3.1 were increased in cells expressing ICP4 to a greater extent than those of H3.3. The dynamics of H2B were increased in cells expressing ICP4, whereas those of canonical H2A were not. ICP4 preferentially targets silencing H3.1 and may also target the silencing H2A variants. In infected cells, histone dynamics were increased in the viral replication compartments, where ICP4 localizes. These results suggest a mechanism whereby ICP4 activates transcription by disrupting, or preventing the formation of, stable silencing nucleosomes on HSV-1 genomes. PMID:27575707

  2. Lack of activity of cadmium in in vitro estrogenicity assays

    SciTech Connect

    Silva, Elisabete . E-mail: elisabete.silva@pharmacy.ac.uk; Lopez-Espinosa, Maria Jose; Molina-Molina, Jose-Manuel; Fernandez, Marieta; Olea, Nicolas; Kortenkamp, Andreas

    2006-10-01

    Prompted by reports about strong estrogenic effects of cadmium, attempts were made to reproduce these observations using the yeast estrogen screen (YES) and the E-Screen assays. For the first time, possible activation of the Src/MAPK pathway was also investigated. In the YES, only a slight activation (10% of a maximal effect) of the estrogen receptor alpha (ER{alpha}) was observed at cadmium concentrations between 5 x 10{sup -7} M and 5 x 10{sup -6} M. In the E-Screen assay, carried out by two laboratories, the heavy metal was without observable cell proliferative effects when tested in the range between 6 x 10{sup -11} M and 1 x 10{sup -5} M. However, in both assays, cadmium led to a reduction of the effects of 17{beta}-estradiol (E2). Treatment of MCF-7 human breast cancer cells with 1 x 10{sup -7} M cadmium failed to induce phosphorylation of Src and the MAP kinases Erk1 and Erk2-effects shown to occur with E2 and epidermal growth factor (EGF). In summary, we were unable to confirm the strong estrogenicity of cadmium reported recently by a number of laboratories. This apparent absence of effects in our hands is not due to a lack of uptake of the metal or to effective protection against cadmium by high levels of glutathione or metallothionein, since toxicity and an antagonism of E2 responses were observed both in the YES and the E-Screen.

  3. Selective activity of butyrylcholinesterase in serum by a chemiluminescent assay.

    PubMed

    Yavo, B; Brunetti, I L; da Fonseca, L M; Catalani, L H; Campa, A

    2001-01-01

    In a previous study, we showed that purified commercial esterase activity can be detected in a chemiluminescent assay based on the hydrolysis of 2-methyl-1-propenylbenzoate (MPB) to 2-methyl-1-propenol, which is subsequently oxidized by the horseradish peroxidase (HRP)-H(2)O(2) system. The purpose of this study was to verify the applicability of this assay to human serum. The existence of an esterase activity capable of hydrolysing MPB is indicated by the fact that the MPB-serum-HRP-H(2)O(2) system consumes oxygen and emits light. Both signals were abolished by prior serum heat inactivation and were preserved when serum was stored at < or =4 degrees C. Addition of aliesterase inhibitors, such as fluoride ion and trichlorfon or the cholinesterase inhibitor eserine, totally prevents light emission. The butyrylcholinesterase-specific substrate benzoylcholine causes a delay in both O(2) uptake and light emission, while the specific acetylcholinesterase substrate, acetyl-beta-methylcholine, had practically no effect. Purified butyrylcholinesterase, but not acetylcholinesterase, triggered light emission. The finding that butyrylcholinesterase is responsible for the hydrolysis of MPB in serum should serve as the basis for the development of a specific chemiluminescent assay for this enzyme. PMID:11590700

  4. In Vitro Activation of the Transcription of araBAD Operon by araC Activator

    PubMed Central

    Lee, Nancy; Wilcox, Gary; Gielow, William; Arnold, John; Cleary, Paul; Englesberg, Ellis

    1974-01-01

    The transcription of araBAD operon requires araC activator and cyclic AMP. D-Fucose inhibits ara mRNA synthesis. Our results indicate that the positive control by araC activator is exerted at the level of transcription. PMID:4362626

  5. KPC2 relocalizes HOXA2 to the cytoplasm and decreases its transcriptional activity.

    PubMed

    Bridoux, Laure; Bergiers, Isabelle; Draime, Amandine; Halbout, Mathias; Deneyer, Noémie; Twizere, Jean-Claude; Rezsohazy, René

    2015-10-01

    Regulation of transcription factor activity relies on molecular interactions or enzymatic modifications which influence their interaction with DNA cis-regulatory sequences, their transcriptional activation or repression, and stability or intracellular distribution of these proteins. Regarding the well-conserved Hox protein family, a restricted number of activity regulators have been highlighted thus far. In the framework of a proteome-wide screening aiming at identifying proteins interacting with Hoxa2, KPC2, an adapter protein constitutive of the KPC ubiquitin-ligase complex, was identified. In this work, KPC2 was confirmed as being a genuine interactor of Hoxa2 by co-precipitation and bimolecular fluorescence complementation assays. At functional level, KPC2 diminishes the transcriptional activity and induces the nuclear exit of Hoxa2. Gene expression analyses revealed that Kpc2 is active in restricted areas of the developing mouse embryo which overlap with the Hoxa2 expression domain. Together, our data support that KPC2 regulates Hoxa2 by promoting its relocation to the cytoplasm. PMID:26303204

  6. Signal Transducer and Activator of Transcription-3, Inflammation, and Cancer

    PubMed Central

    Aggarwal, Bharat B.; Kunnumakkara, Ajaikumar B.; Harikumar, Kuzhuvelil B.; Gupta, Shan R.; Tharakan, Sheeja T.; Koca, Cemile; Dey, Sanjit; Sung, Bokyung

    2011-01-01

    Signal transducer and activator of transcription-3 (STAT-3) is one of six members of a family of transcription factors. It was discovered almost 15 years ago as an acute-phase response factor. This factor has now been associated with inflammation, cellular transformation, survival, proliferation, invasion, angiogenesis, and metastasis of cancer. Various types of carcinogens, radiation, viruses, growth factors, oncogenes, and inflammatory cytokines have been found to activate STAT-3. STAT-3 is constitutively active in most tumor cells but not in normal cells. Phosphorylation of STAT-3 at tyrosine 705 leads to its dimerization, nuclear translocation, DNA binding, and gene transcription. The phosphorylation of STAT-3 at serine 727 may regulate its activity negatively or positively. STAT-3 regulates the expression of genes that mediate survival (survivin, bcl-xl, mcl-1, cellular FLICE-like inhibitory protein), proliferation (c-fos, c-myc, cyclin D1), invasion (matrix metalloproteinase-2), and angiogenesis (vascular endothelial growth factor). STAT-3 activation has also been associated with both chemoresistance and radioresistance. STAT-3 mediates these effects through its collaboration with various other transcription factors, including nuclear factor-κB, hypoxia-inducible factor-1, and peroxisome proliferator activated receptor-γ. Because of its critical role in tumorigenesis, inhibitors of this factor’s activation are being sought for both prevention and therapy of cancer. This has led to identification of small peptides, oligonucleotides, and small molecules as potential STAT-3 inhibitors. Several of these small molecules are chemo-preventive agents derived from plants. This review discusses the intimate relationship between STAT-3, inflammation, and cancer in more detail. PMID:19723038

  7. Development of a neutralization assay for influenza virus using an endpoint assessment based on quantitative reverse-transcription PCR.

    PubMed

    Teferedegne, Belete; Lewis, Andrew M; Peden, Keith; Murata, Haruhiko

    2013-01-01

    A microneutralization assay using an ELISA-based endpoint assessment (ELISA-MN) is widely used to measure the serological response to influenza virus infection and vaccination. We have developed an alternative microneutralization assay for influenza virus using a quantitative reverse transcription PCR-based endpoint assessment (qPCR-MN) in order to improve upon technical limitations associated with ELISA-MN. For qPCR-MN, infected MDCK-London cells in 96-well cell-culture plates are processed with minimal steps such that resulting samples are amenable to high-throughput analysis by downstream one-step quantitative reverse transcription PCR (qRT-PCR; SYBR Green chemistry with primers targeting a conserved region of the M1 gene of influenza A viruses). The growth curves of three recent vaccine strains demonstrated that the qRT-PCR signal detected at 6 hours post-infection reflected an amplification of at least 100-fold over input. Using ferret antisera, we have established the feasibility of measuring virus neutralization at 6 hours post-infection, a duration likely confined to a single virus-replication cycle. The neutralization titer for qPCR-MN was defined as the highest reciprocal serum dilution necessary to achieve a 90% inhibition of the qRT-PCR signal; this endpoint was found to be in agreement with ELISA-MN using the same critical reagents in each assay. qPCR-MN was robust with respect to assay duration (6 hours vs. 12 hours). In addition, qPCR-MN appeared to be compliant with the Percentage Law (i.e., virus neutralization results appear to be consistent over an input virus dose ranging from 500 to 12,000 TCID(50)). Compared with ELISA-MN, qPCR-MN might have inherent properties conducive to reducing intra- and inter-laboratory variability while affording suitability for automation and high-throughput uses. Finally, our qRT-PCR-based approach may be broadly applicable to the development of neutralization assays for a wide variety of viruses. PMID:23437084

  8. Real-Time Reverse Transcription-PCR Assay for Detection of Mumps Virus RNA in Clinical Specimens▿

    PubMed Central

    Boddicker, Jennifer D.; Rota, Paul A.; Kreman, Trisha; Wangeman, Andrea; Lowe, Louis; Hummel, Kimberly B.; Thompson, Robert; Bellini, William J.; Pentella, Michael; DesJardin, Lucy E.

    2007-01-01

    The mumps virus is a negative-strand RNA virus in the family Paramyxoviridae. Mumps infection results in an acute illness with symptoms including fever, headache, and myalgia, followed by swelling of the salivary glands. Complications of mumps can include meningitis, deafness, pancreatitis, orchitis, and first-trimester abortion. Laboratory confirmation of mumps infection can be made by the detection of immunoglobulin M-specific antibodies to mumps virus in acute-phase serum samples, the isolation of mumps virus in cell culture, or by detection of the RNA of the mumps virus by reverse transcription (RT)-PCR. We developed and validated a multiplex real-time RT-PCR assay for rapid mumps diagnosis in a clinical setting. This assay used oligonucleotide primers and a TaqMan probe targeting the mumps SH gene, as well as primers and a probe that targeted the human RNase P gene to assess the presence of PCR inhibitors and as a measure of specimen quality. The test was specific, since it did not amplify a product from near-neighbor viruses, as well as sensitive and accurate. Real-time RT-PCR results showed 100% correlation with results from viral culture, the gold standard for mumps diagnostic testing. Assay efficiency was over 90% and displayed good precision after performing inter- and intraassay replicates. Thus, we have developed and validated a molecular method for rapidly diagnosing mumps infection that may be used to complement existing techniques. PMID:17652480

  9. Fluorescence Assay for Evaluating Microbicidal Activity of Hand Antiseptics

    PubMed Central

    Lopez-Gigosos, Rosa M.; Mariscal-Lopez, Eloisa; Gutierrez-Bedmar, Mario; Fernandez, Joaquin

    2015-01-01

    We developed a fluorescent β-d-glucuronidase activity (BGA)-based assay for detecting and quantifying Escherichia coli in samples to assess the biocide efficacy of hand antiseptics. The fluorescence level is proportional to the number of viable E. coli organisms present. We compared our assay results to those of the E. coli plate count method specified by the European standard for testing hygienic hand rub disinfectant products (EN1500). The plate count method requires excessive handling and materials and is not valid if the number of organisms per plate is too low or high for counting in many of the samples. We optimized the fluorescent assay based on the cleavage of 4-methylumbelliferyl-β-d-glucuronide by adding 4-nitrophenyl-β-d-glucuronide, a nonfluorogenic BGA substrate, to induce glucuronidase activity and reduce assay time. Furthermore, our method can be automated and eliminates the need for multiple dilutions. Fluorescence was temporally monitored, and the time required to reach a specific value of fluorescence was correlated with the initial number of viable E. coli organisms on the samples. There was a positive correlation (P < 0.05) with a high correlation coefficient (R2 = 0.82) between the E. coli counts by plate count and fluorescence methods. Reported effects in fluorescent BGA were compared to the EN1500 plate count method with five hand disinfectants. We found our method more advantageous, because it was as sensitive as the EN1500 method, requires less time to complete, and is less expensive and less laborious than conventional plating techniques. PMID:26276114

  10. Transcriptional activation of the cholesterol 7alpha-hydroxylase gene (CYP7A) by nuclear hormone receptors.

    PubMed

    Crestani, M; Sadeghpour, A; Stroup, D; Galli, G; Chiang, J Y

    1998-11-01

    The gene encoding cholesterol 7alpha-hydroxylase (CYP7A), the rate-limiting enzyme in bile acid synthesis, is transcriptionally regulated by bile acids and hormones. Previously, we have identified two bile acid response elements (BARE) in the promoter of the CYP7A gene. The BARE II is located in nt -149/-118 region and contains three hormone response element (HRE)-like sequences that form two overlapping nuclear receptor binding sites. One is a direct repeat separated by one nucleotide DR1 (-146- TGGACTtAGTTCA-134) and the other is a direct repeat separated by five nucleotides DR5 (-139-AGTTCAaggccGGG TAA-123). Mutagenesis of these HRE sequences resulted in lower transcriptional activity of the CYP7A promoter/reporter genes in transient transfection assay in HepG2 cells. The orphan nuclear receptor, hepatocyte nuclear factor 4 (HNF-4)1, binds to the DR1 sequence as assessed by electrophoretic mobility shift assay, and activates the CYP7A promoter/reporter activity by about 9-fold. Cotransfection of HNF-4 plasmid with another orphan nuclear receptor, chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII), synergistically activated the CYP7A transcription by 80-fold. The DR5 binds the RXR/RAR heterodimer. A hepatocyte nuclear factor-3 (HNF-3) binding site (-175-TGTTTGTTCT-166) was identified. HNF-3 was required for both basal transcriptional activity and stimulation of the rat CYP7A promoter activity by retinoic acid. Combinatorial interactions and binding of these transcription factors to BAREs may modulate the promoter activity and also mediate bile acid repression of CYP7A gene transcription. PMID:9799805

  11. Isolated HIV-1 core is active for reverse transcription.

    PubMed

    Warrilow, David; Stenzel, Deborah; Harrich, David

    2007-01-01

    Whether purified HIV-1 virion cores are capable of reverse transcription or require uncoating to be activated is currently controversial. To address this question we purified cores from a virus culture and tested for the ability to generate authentic reverse transcription products. A dense fraction (approximately 1.28 g/ml) prepared without detergent, possibly derived from disrupted virions, was found to naturally occur as a minor sub-fraction in our preparations. Core-like particles were identified in this active fraction by electron microscopy. We are the first to report the detection of authentic strong-stop, first-strand transfer and full-length minus strand products in this core fraction without requirement for an uncoating activity. PMID:17956635

  12. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis.

    PubMed

    Hai, T; Hartman, M G

    2001-07-25

    The mammalian ATF/CREB family of transcription factors represents a large group of basic region-leucine zipper (bZip) proteins which was originally defined in the late 1980s by their ability to bind to the consensus ATF/CRE site 'TGACGTCA'. Over the past decade, cDNA clones encoding identical or homologous proteins have been isolated by different laboratories and given different names. These proteins can be grouped into subgroups according to their amino acid similarity. In this review, we will briefly describe the classification of these proteins with a historical perspective of their nomenclature. We will then review three members of the ATF/CREB family of proteins: ATF3, ATF4 and ATF6. We will address four issues for each protein: (a) homologous proteins and alternative names, (b) dimer formation with other bZip proteins, (c) transcriptional activity, and (d) potential physiological functions. Although the name Activating Transcription Factor (ATF) implies that they are transcriptional activators, some of these proteins are transcriptional repressors. ATF3 homodimer is a transcriptional repressor and ATF4 has been reported to be either an activator or a repressor. We will review the reports on the transcriptional activities of ATF4, and propose potential explanations for the discrepancy. Although the physiological functions of these proteins are not well understood, some clues can be gained from studies with different approaches. When the data are available, we will address the following questions. (a) How is the expression (at the mRNA level or protein level) regulated? (b) How are the transcriptional activities regulated? (c) What are the interacting proteins (other than bZip partners)? (d) What are the consequences of ectopically expressing the gene (gain-of-function) or deleting the gene (loss-of-function)? Although answers to these questions are far from being complete, together they provide clues to the functions of these ATF proteins. Despite the

  13. Potentiation of glucocorticoid receptor transcriptional activity by sumoylation.

    PubMed

    Le Drean, Yves; Mincheneau, Nathalie; Le Goff, Pascale; Michel, Denis

    2002-09-01

    The glucocorticoid receptor (GR) is a transcription factor, subject to several types of posttranslational modifications including phosphorylation and ubiquitination. We showed that the GR is covalently modified by the small ubiquitin-related modifier-1 (SUMO-1) peptide in mammalian cells. We demonstrated that GR sumoylation is not dependent on the presence of the ligand and regulates the stability of the protein as well as its transcriptional activity. SUMO-1 overexpression induces dramatic GR degradation, abolished by proteasome inhibition. We also found that SUMO-1 stimulates the transactivation capacity of GRs to an extent largely exceeding those observed so far for other sumoylated transcription factors. Overexpression of SUMO-1 specifically enhances the ligand-induced transactivation of GR up to 8-fold. However, this hyperactivation occurs only in the context of a synergy between multiple molecules of GRs. It requires more than one receptor DNA-binding site in promoter and becomes more prominent as the number of sites increases. Interestingly, these observations may be related to the transcriptional properties of the synergy control region of GRs, which precisely contains two evolutionary conserved sumoylation sites. We propose a model in which SUMO-1 regulates the synergy control function of GR and serves as a unique signal for activation and destruction. PMID:12193561

  14. Acetylation of lysine 109 modulates pregnane X receptor DNA binding and transcriptional activity.

    PubMed

    Pasquel, Danielle; Doricakova, Aneta; Li, Hao; Kortagere, Sandhya; Krasowski, Matthew D; Biswas, Arunima; Walton, William G; Redinbo, Matthew R; Dvorak, Zdenek; Mani, Sridhar

    2016-09-01

    Pregnane X receptor (PXR) is a major transcriptional regulator of xenobiotic metabolism and transport pathways in the liver and intestines, which are critical for protecting organisms against potentially harmful xenobiotic and endobiotic compounds. Inadvertent activation of drug metabolism pathways through PXR is known to contribute to drug resistance, adverse drug-drug interactions, and drug toxicity in humans. In both humans and rodents, PXR has been implicated in non-alcoholic fatty liver disease, diabetes, obesity, inflammatory bowel disease, and cancer. Because of PXR's important functions, it has been a therapeutic target of interest for a long time. More recent mechanistic studies have shown that PXR is modulated by multiple PTMs. Herein we provide the first investigation of the role of acetylation in modulating PXR activity. Through LC-MS/MS analysis, we identified lysine 109 (K109) in the hinge as PXR's major acetylation site. Using various biochemical and cell-based assays, we show that PXR's acetylation status and transcriptional activity are modulated by E1A binding protein (p300) and sirtuin 1 (SIRT1). Based on analysis of acetylation site mutants, we found that acetylation at K109 represses PXR transcriptional activity. The mechanism involves loss of RXRα dimerization and reduced binding to cognate DNA response elements. This mechanism may represent a promising therapeutic target using modulators of PXR acetylation levels. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. PMID:26855179

  15. Rapid detection of newly isolated Tembusu-related Flavivirus by reverse-transcription loop-mediated isothermal amplification assay

    PubMed Central

    2011-01-01

    Background From April 2010 to January 2011, a severe new viral disease had devastated most duck-farming regions in China. This disease affected not only laying ducks but also meat ducks, causing huge economic losses for the poultry industry. The objective of this study is to develop a one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of the new virus related to Tembusu-related Flavivirus. Results The RT-LAMP assay is very simple and rapid, and the amplification can be completed within 50 min under isothermal conditions at 63°C by a set of 6 primers targeting the E gene based on the sequences analysis of the newly isolated viruses and other closely related Flavivirus.The monitoring of gene amplification can also be visualized by using SYBR green I fluorescent dye. In addition, the RT-LAMP assay for newly isolated Tembusu-related Flavivirus showed higher sensitivity with an RNA detection-limit of 2 copies/μL compared with 190 copies/μL of the conventional RT-PCR method. The specificity was identified without cross reaction to other common avian pathogens. By screening a panel of clinical samples this method was more feasible in clinical settings and there was higher positive coincidence rate than conventional RT-PCR and virus isolation. Conclusion The RT-LAMP assay for newly isolated Tembusu-related Flavivirus is a valuable tool for the rapid and real-time detection not only in well-equipped laboratories but also in general conditions. PMID:22185513

  16. Filamin A negatively regulates the transcriptional activity of p73{alpha} in the cytoplasm

    SciTech Connect

    Kim, Eun-Joo; Park, Jong-Sup; Um, Soo-Jong

    2007-11-03

    The transcription regulator p73{alpha} is structurally different from p53 in that it possesses a unique C-terminal domain, which has been implicated in transcriptional repression. To dissect the mechanism of repression by this domain, we performed a yeast two-hybrid screen of a HeLa cDNA library using residues 487-636 of p73{alpha} as bait and isolated a cDNA clone encoding the C-terminal portion (residues 2210-2647) of filamin A, a 280-kDa actin-binding protein. Additional yeast two-hybrid assays indicated that filamin A specifically interacts with the p73{alpha} C-terminus, which is lacking in p53 and p73{beta}. The interaction was confirmed by GST pull-down assays in vitro and by immunoprecipitation analysis in vivo. Immunofluorescence microscopy revealed that p73{alpha} remained in the cytoplasm in A7 melanoma cells stably expressing filamin A, whereas it was localized in the nucleus of filamin A-deficient M2 cells. Deletion of the C-terminus of p73{alpha} (residues 487-636) resulted in nuclear localization in both cell types. Consistent with our interaction data, transient co-expression of filamin A resulted in the down-regulation of p73{alpha}, but not of p53, transcriptional activity on various p53-responsive promoters. Taken together, our data suggest that p73{alpha} is sequestered in the cytoplasm by filamin A, thereby inhibiting its transcriptional activity.

  17. SARS Coronavirus 3b Accessory Protein Modulates Transcriptional Activity of RUNX1b

    PubMed Central

    Varshney, Bhavna; Agnihotram, Sudhakar; Tan, Yee-Joo; Baric, Ralph; Lal, Sunil K.

    2012-01-01

    Background The causative agent of severe acute respiratory syndrome, SARS coronavirus (SARS-CoV) genome encodes several unique group specific accessory proteins with unknown functions. Among them, accessory protein 3b (also known as ORF4) was lately identified as one of the viral interferon antagonist. Recently our lab uncovered a new role for 3b in upregulation of AP-1 transcriptional activity and its downstream genes. Thus, we believe that 3b might play an important role in SARS-CoV pathogenesis and therefore is of considerable interest. The current study aims at identifying novel host cellular interactors of the 3b protein. Methodology/Principal Findings In this study, using yeast two-hybrid and co-immunoprecipitation techniques, we have identified a host transcription factor RUNX1b (Runt related transcription factor, isoform b) as a novel interacting partner for SARS-CoV 3b protein. Chromatin immunoprecipitaion (ChIP) and reporter gene assays in 3b expressing jurkat cells showed recruitment of 3b on the RUNX1 binding element that led to an increase in RUNX1b transactivation potential on the IL2 promoter. Kinase assay and pharmacological inhibitor treatment implied that 3b also affect RUNX1b transcriptional activity by regulating its ERK dependent phosphorylation levels. Additionally, mRNA levels of MIP-1α, a RUNX1b target gene upregulated in SARS-CoV infected monocyte-derived dendritic cells, were found to be elevated in 3b expressing U937 monocyte cells. Conclusions/Significance These results unveil a novel interaction of SARS-CoV 3b with the host factor, RUNX1b, and speculate its physiological relevance in upregulating cytokines and chemokine levels in state of SARS virus infection. PMID:22253733

  18. A Sensitive and Versatile Fluorescent Activity Assay for ABHD12.

    PubMed

    Savinainen, Juha R; Navia-Paldanius, Dina; Laitinen, Jarmo T

    2016-01-01

    Despite great progress in identifying and deorphanizing members of the human metabolic serine hydrolase (mSH) family, the fundamental role of numerous enzymes in this large protein class has remained unclear. One recently found mSH is α/β-hydrolase domain containing 12 (ABHD12) enzyme, whose natural substrate in vivo appears to be the lysophospholipid lysophosphatidylserine (LPS). In vitro, ABHD12 together with monoacylglycerol lipase (MAGL) and ABHD6 hydrolyzes also monoacylglycerols (MAGs) such as the primary endocannabinoid 2-arachidonoyl glycerol (2-AG). Traditional approaches for determining 2-AG hydrolase activity are rather laborious, and often utilize unnatural substrates. Here, we describe a sensitive fluorescent assay of ABHD12 activity in a 96-well-plate format that allows simultaneous testing of inhibitor activities of up to 40 compounds in a single assay. The method utilizes lysates of HEK293 cells transiently overexpressing human ABHD12 as the enzymatic source, and kinetically monitors glycerol liberated in the hydrolysis of 1(3)-AG, the preferred MAG substrate of this enzyme. Glycerol output is coupled to an enzymatic cascade generating the fluorescent end-product resorufin. This methodology has helped to identify the first class of inhibitors showing selectivity for ABHD12 over the other mSHs. PMID:27245904

  19. Novel assay for direct fluorescent imaging of sialidase activity

    NASA Astrophysics Data System (ADS)

    Tomin, A.; Shkandina, T.; Bilyy, R.

    2011-07-01

    Here we describe a novel approach to sialidase activity estimation. Sialidases (EC 3.2.1.18, exo-α-sialidases), also known as neuraminidases, are the group of enzymes, which hydrolyze the glycoside bound between terminal sialic acid and subsequent carbohydrate residue in glycoproteins and glycolipids. Sialic acids are the group of monosaccharides with acidic properties, since they are acetylated or glycolylated derivates of neuraminic acid. Flu and some other viruses use neuraminidase activity to infect host cells. The level of sialylation was shown to be tightly connected with tumor cell invasiveness and metastatic potential, sialylation level also determines the clearance of aged or virus-infected cells. Thus, detection of sialidase activity is of primary importance for clinical diagnostics as well as life science research. The authors developed the assay for both visualization and estimation of sialidase activity in living cells. Previously known methods for sialidase activity detection required destruction of cellular material, or were low-sensitive, or provided no information on the activity localization in certain intracellular compartment. To overcome these problems, a fluorogenic neuraminidase substrate, 4-MUNA was utilized, and the method for detection of neuraminidase activity using fluorescent microscopy was proposed, it provided a high signal level and information on cellular localization of the studied enzyme. By using this approach the increase of sialidase activity on apoptotic cells was demonstrated in comparison to viable and primary necrotic cells.

  20. Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.

    PubMed Central

    Piedrafita, F J; Pfahl, M

    1997-01-01

    Vitamin A and its derivatives, the retinoids, are essential regulators of many important biological functions, including cell growth and differentiation, development, homeostasis, and carcinogenesis. Natural retinoids such as all-trans retinoic acid can induce cell differentiation and inhibit growth of certain cancer cells. We recently identified a novel class of synthetic retinoids with strong anti-cancer cell activities in vitro and in vivo which can induce apoptosis in several cancer cell lines. Using an electrophoretic mobility shift assay, we analyzed the DNA binding activity of several transcription factors in T cells treated with apoptotic retinoids. We found that the DNA binding activity of the general transcription factor Sp1 is lost in retinoid-treated T cells undergoing apoptosis. A truncated Sp1 protein is detected by immunoblot analysis, and cytosolic protein extracts prepared from apoptotic cells contain a protease activity which specifically cleaves purified Sp1 in vitro. This proteolysis of Sp1 can be inhibited by N-ethylmaleimide and iodoacetamide, indicating that a cysteine protease mediates cleavage of Sp1. Furthermore, inhibition of Sp1 cleavage by ZVAD-fmk and ZDEVD-fmk suggests that caspases are directly involved in this event. In fact, caspases 2 and 3 are activated in T cells after treatment with apoptotic retinoids. The peptide inhibitors also blocked retinoid-induced apoptosis, as well as processing of caspases and proteolysis of Sp1 and poly(ADP-ribose) polymerase in intact cells. Degradation of Sp1 occurs early during apoptosis and is therefore likely to have profound effects on the basal transcription status of the cell. Interestingly, retinoid-induced apoptosis does not require de novo mRNA and protein synthesis, suggesting that a novel mechanism of retinoid signaling is involved, triggering cell death in a transcriptional activation-independent, caspase-dependent manner. PMID:9343396

  1. Human Kruppel-related 3 (HKR3) is a novel transcription activator of alternate reading frame (ARF) gene.

    PubMed

    Yoon, Jae-Hyeon; Choi, Won-Il; Jeon, Bu-Nam; Koh, Dong-In; Kim, Min-Kyeong; Kim, Myung-Hwa; Kim, Jungho; Hur, Sujin Susanne; Kim, Kyung-Sup; Hur, Man-Wook

    2014-02-14

    HKR3 (Human Krüppel-related 3) is a novel POK (POZ-domain Krüppel-like zinc-finger) family transcription factor. Recently, some of the POK (POZ-domain Krüppel-like zinc finger) family proteins have been shown to play roles in cell cycle arrest, apoptosis, cell proliferation, and oncogenesis. We investigated whether HKR3, an inhibitor of cell proliferation and an uncharacterized POK family protein, could regulate the cell cycle by controlling expression of genes within the p53 pathway (ARF-MDM2-TP53-p21WAF/CDKN1A). HKR3 potently activated the transcription of the tumor suppressor gene ARF by acting on the proximal promoter region (bp, -149∼+53), which contains Sp1 and FBI-1 binding elements (FREs). HKR3 interacted with the co-activator p300 to activate ARF transcription, which increased the acetylation of histones H3 and H4 within the proximal promoter. Oligonucleotide pull-down assays and ChIP assays revealed that HKR3 interferes with the binding of the proto-oncogenic transcription repressor FBI-1 to proximal FREs, thus derepressing ARF transcription. PMID:24382891

  2. Human Krüppel-related 3 (HKR3) Is a Novel Transcription Activator of Alternate Reading Frame (ARF) Gene*

    PubMed Central

    Yoon, Jae-Hyeon; Choi, Won-Il; Jeon, Bu-Nam; Koh, Dong-In; Kim, Min-Kyeong; Kim, Myung-Hwa; Kim, Jungho; Hur, Sujin Susanne; Kim, Kyung-Sup; Hur, Man-Wook

    2014-01-01

    HKR3 (Human Krüppel-related 3) is a novel POK (POZ-domain Krüppel-like zinc-finger) family transcription factor. Recently, some of the POK (POZ-domain Krüppel-like zinc finger) family proteins have been shown to play roles in cell cycle arrest, apoptosis, cell proliferation, and oncogenesis. We investigated whether HKR3, an inhibitor of cell proliferation and an uncharacterized POK family protein, could regulate the cell cycle by controlling expression of genes within the p53 pathway (ARF-MDM2-TP53-p21WAF/CDKN1A). HKR3 potently activated the transcription of the tumor suppressor gene ARF by acting on the proximal promoter region (bp, −149∼+53), which contains Sp1 and FBI-1 binding elements (FREs). HKR3 interacted with the co-activator p300 to activate ARF transcription, which increased the acetylation of histones H3 and H4 within the proximal promoter. Oligonucleotide pull-down assays and ChIP assays revealed that HKR3 interferes with the binding of the proto-oncogenic transcription repressor FBI-1 to proximal FREs, thus derepressing ARF transcription. PMID:24382891

  3. The Positive Transcription Elongation Factor b Is an Essential Cofactor for the Activation of Transcription by Myocyte Enhancer Factor 2

    PubMed Central

    Nojima, Masanori; Huang, Yehong; Tyagi, Mudit; Kao, Hung-Ying; Fujinaga, Koh

    2014-01-01

    The positive transcription elongation factor b (P-TEFb), composed of cyclin-dependent kinase 9 and cyclin T1, stimulates the elongation of transcription by hyperphosphorylating the C-terminal region of RNA polymerase II. Aberrant activation of P-TEFb results in manifestations of cardiac hypertrophy in mice, suggesting that P-TEFb is an essential factor for cardiac myocyte function and development. Here, we present evidence that P-TEFb selectively activates transcription mediated by the myocyte enhancer factor 2 (MEF2) family of transcription factors, key regulatory factors for myocyte development. Knockdown of endogenous cyclin T1 in murine C2C12 cells abolishes MEF2-dependent reporter gene expression as well as transcription of endogenous MEF2 target genes, whereas overexpression of P-TEFb enhances MEF2-dependent transcription. P-TEFb interacts with MEF2 both in vitro and in vivo. Activation of MEF2-dependent transcription induced by serum starvation is mediated by a rapid dissociation of P-TEFb from its inhibitory subunit, HEXIM1, and a subsequent recruitment of P-TEFb to MEF2 binding sites in the promoter region of MEF2 target genes. These results indicate that recruitment of P-TEFb is a critical step for stimulation of MEF2-dependent transcription, therefore providing a fundamentally important regulatory mechanism underlying the transcriptional program in muscle cells. PMID:18662700

  4. Rb binds c-Jun and activates transcription.

    PubMed Central

    Nead, M A; Baglia, L A; Antinore, M J; Ludlow, J W; McCance, D J

    1998-01-01

    The retinoblastoma protein (Rb) acts as a critical cell-cycle regulator and loss of Rb function is associated with a variety of human cancer types. Here we report that Rb binds to members of the AP-1 family of transcription factors, including c-Jun, and stimulates c-Jun transcriptional activity from an AP-1 consensus sequence. The interaction involves the leucine zipper region of c-Jun and the B pocket of Rb as well as a C-terminal domain. We also present evidence that the complexes are found in terminally differentiating keratinocytes and cells entering the G1 phase of the cell cycle after release from serum starvation. The human papillomavirus type 16 E7 protein, which binds to both c-Jun and Rb, inhibits the ability of Rb to activate c-Jun. The results provide evidence of a role for Rb as a transcriptional activator in early G1 and as a potential modulator of c-Jun expression during keratinocyte differentiation. PMID:9545246

  5. Targeted mutagenesis of the human papillomavirus type 16 E2 transactivation domain reveals separable transcriptional activation and DNA replication functions.

    PubMed

    Sakai, H; Yasugi, T; Benson, J D; Dowhanick, J J; Howley, P M

    1996-03-01

    The E2 gene products of papillomavirus play key roles in viral replication, both as regulators of viral transcription and as auxiliary factors that act with E1 in viral DNA replication. We have carried out a detailed structure-function analysis of conserved amino acids within the N-terminal domain of the human papillomavirus type 16 (HPV16) E2 protein. These mutants were tested for their transcriptional activation activities as well as transient DNA replication and E1 binding activities. Analysis of the stably expressed mutants revealed that the transcriptional activation and replication activities of HPV16 E2 could be dissociated. The 173A mutant was defective for the transcriptional activation function but retained wild-type DNA replication activity, whereas the E39A mutant wild-type transcriptional activation function but was defective in transient DNA replication assays. The E39A mutant was also defective for HPV16 E1 binding in vitro, suggesting that the ability of E2 protein to form a complex with E1 appears to be essential for its function as an auxiliary replication factor. PMID:8627680

  6. Arabidopsis GARP transcriptional activators interact with the Pro-rich activation domain shared by G-box-binding bZIP factors.

    PubMed

    Tamai, Hiroki; Iwabuchi, Masaki; Meshi, Tetsuo

    2002-01-01

    The Pro-rich regions, found in a subset of plant bZIP transcription factors, including G-box-binding factors (GBFs) of Arabidopsis thaliana, are thought to be deeply involved in transcriptional regulation. However, the molecular mechanisms of the Pro-rich region-mediated transcriptional regulation are still largely unknown. Here we report evidence showing that two closely related Arabidopsis proteins, designated GPRI1 and GPRI2, containing a GARP DNA-binding domain, are likely partners of one or more GBFs. The results of yeast two-hybrid assays and in vitro binding assays indicated that GPRI1 can interact with the Pro-rich regions of GBF1 and GBF3. GPRI2 interacted with the Pro-rich region of GBF1. GPRI1 and GPRI2 transactivated transcription in yeast. In GPRI1 the region responsible for this activation was mapped in the N-terminal third of the protein. Transient assays showed that in Arabidopsis cells not only the N-terminal but also the C-terminal regions of GPRI1 can function as a separable activation domain. GPRI1 and GPRI2 may function in some promoters in concert with a GBF through interaction with its Pro-rich region to enhance the transcriptional level of the corresponding genes. PMID:11828027

  7. Transcriptional and replicational activation functions in the bovine papillomavirus type 1 E2 protein are encoded by different structural determinants.

    PubMed Central

    Abroi, A; Kurg, R; Ustav, M

    1996-01-01

    A set of E2 proteins with mutations in the amino-terminal transactivation domain was made by a scheme called clustered charged-to-alanine scan. These mutant E2 proteins were tested for expression, stability, and compartmentalization in cells and for sequence-specific DNA binding, as well as in functional assays for transcriptional and replicational activation. We identified four groups of mutants. First, mutants K111A, K112A, and E176A were unable to activate replication and transcription because of oligomerization-induced retention of oligomers in the cytoplasm. Second, although fractions of the mutant proteins E74A and D143A/ R172C existed in the oligomeric form, they were localized in the nucleus. Certain fractions of these proteins existed as a dimer able to form a specific complex and activate replication; however, these proteins were inactive in transcriptional activation. Third, mutants R37A and D122A were localized in the nucleus, existed in the dimeric form, supported replication efficiently, and were severely crippled in transcriptional activation. The fourth group of mutants did not differ considerably from the wild-type protein. The activation of transcription by the wild type as well as mutant E2 proteins was dependent on the concentration of input E2 expression vector DNA and had a bell-like shape. We suggest that the reduction of transcriptional activation at higher E2 concentrations, the self-squelching activity, is caused by oligomerization of the E2 transactivator and is one of the mechanisms for the regulation of E2 activity. Our results also show that transcriptional and replicational activation activities are encoded by different determinants in the E2 protein. PMID:8709243

  8. Separation of the transcriptional activation and replication functions of the bovine papillomavirus-1 E2 protein.

    PubMed

    Winokur, P L; McBride, A A

    1992-11-01

    Replication of bovine papillomavirus-1 (BPV-1) DNA requires two viral gene products, the E1 protein and the full-length E2 protein. The 48 kDa E2 protein is a site-specific DNA-binding protein that binds to several sites which lie adjacent to the BPV-1 origin of replication. The 85 amino acid C-terminal domain contains the specific DNA binding and dimerization properties of the protein. The approximately 200 amino acid N-terminal domain is crucial for transcriptional activation. Both of these domains are highly conserved among different papillomaviruses. An internal hinge region separates the two functional domains. The region varies in amino acid sequence and length among the E2 proteins of different papillomaviruses. A series of mutations were constructed within the E2 open reading frame which delete various regions of the conserved DNA binding and transactivation domains as well as the internal hinge region. Two mutated E2 proteins that lack portions of the conserved DNA-binding domain but which support DNA replication were identified using transient replication assays. These mutated E2 proteins were unable to function as transcriptional activators. Conversely, two E2 proteins containing large deletions of the hinge region were able to activate transcription, but were defective for replication. Thus, the replication and transactivation functions of the E2 protein are separable. PMID:1327758

  9. Neutron coincidence imaging for active and passive neutron assays

    SciTech Connect

    Estep, R. J.; Brunson, G. S.; Melton, S. G.

    2001-01-01

    Neutron multiplicity assay algorithms for {sup 240}Pu assume a point source of fission neutrons that are detected in a single detector channel. The {sup 240}Pu in real waste, however, is more likely to be distributed throughout the container in some random way. For different reasons, this leads to significant errors when using either multiplicity or simpler coincidence analyses. Reduction of these errors can be achieved using tomographic imaging. In this talk we report on our results from using neutron singles and coincidence data between tagged detector pairs to provide enhanced tomographic imaging capabilities to a crate nondestructive assay system. Only simulated passive coincidence data is examined here, although the higher signal rates from active coincidence counting hold more promise for waste management. The active coincidence approach has significantly better sensitivity than the passive and is not significantly perturbed by (alpha,n) contributions. Our study was based primarily on simulated neutron pulse trains derived from the Los Alamos SIM3D software, which were subjected to analysis using the Los Alamos CTEN-FIT and TGS-FIT software. We found significantly improved imaging capability using the coincidence and singles rate data than could be obtained using the singles rate alone.

  10. Activity-based assay for ricin-like toxins

    DOEpatents

    Keener, William K.; Ward, Thomas E.

    2007-02-06

    A method of detecting N-glycosylase activity in a sample involves incubating an oligodeoxyribonucleotide substrate containing a deoxyadenosine or deoxyuridine residue with the sample to be tested such that the N-glycosylase, if present, hydrolyzes the deoxyadenosine or deoxyuridine residue to result in an N-glycosylase product having an abasic site. A primer is annealed to the N-glycosylase product, and the primer is extended with a DNA polymerase, such as Taq DNA polymerase, that pauses at abasic sites. The resulting extension products are melted from the N-glycosylase product, allowed to form hairpins due to self-complementarity, and further extended in the presence of labeled precursors to result in labeled products. Extension products synthesized from undigested substrate as template do not result in labeled products. Thus, detection of labeled products results in detection of N-glycosylase activity. Oligodeoxyribonucleotide substrates, primer, and positive controls and a kit for N-glycosylase assay are also disclosed.

  11. Urea-inducible Egr-1 transcription in renal inner medullary collecting duct (mIMCD3) cells is mediated by extracellular signal-regulated kinase activation.

    PubMed Central

    Cohen, D M

    1996-01-01

    Urea (200-400 milliosmolar) activates transcription, translation of, and trans-activation by the immediate-early gene transcription factor Egr-1 in a renal epithelial cell-specific fashion. The effect at the transcriptional level has been attributed to multiple serum response elements and their adjacent Ets motifs located within the Egr-1 promoter. Elk-1, a principal ternary complex factor and Ets domain-containing protein, is a substrate of the extracellular signal-regulated kinase (ERK) mitogen-activated protein kinases. In the renal medullary mIMCD3 cell line, urea (200-400 milliosmolar) activated both ERK1 and ERK2 as determined by in-gel kinase assay and immune-complex kinase assay of epitope-tagged] ERK1 and ERK2. Importantly, urea did not affect abundance of either ERK. Urea-inducible Egr-1 transcription was a consequence of ERK activation because the ERK-specific inhibitor, PD98059, abrogated transcription from the murine Egr-1 promoter in a luciferase reported gene assay. In addition, activators of protein kinase A, including forskolin and 8-Br-cAMP, which are known to inhibit ERK-mediated events, also inhibited urea-inducible Egr-1 transcription. Furthermore, urea-inducible activation of the physiological ERK substrate and transcription factor, Elk-1, was demonstrated through transient cotransfection of a chimeric Elk-1/GAL4 expression plasmid and a GAL4-driven luciferase reporter plasmid. Taken together, these data indicate that, in mIMCD3 cells, urea activates ERKs and the ERK substrate, Elk-1, and that ERK inhibition abrogates urea-inducible Egr-1 transcription. These data are consistent with a model of urea-inducible renal medullary gene expression wherein sequential activation of ERKs and Elk-1 results in increased transcription of Egr-1 through serum response element/Ets motifs. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8855340

  12. CerS6 Is a Novel Transcriptional Target of p53 Protein Activated by Non-genotoxic Stress.

    PubMed

    Fekry, Baharan; Jeffries, Kristen A; Esmaeilniakooshkghazi, Amin; Ogretmen, Besim; Krupenko, Sergey A; Krupenko, Natalia I

    2016-08-01

    Our previous study suggested that ceramide synthase 6 (CerS6), an enzyme in sphingolipid biosynthesis, is regulated by p53: CerS6 was elevated in several cell lines in response to transient expression of p53 or in response to folate stress, which is known to activate p53. It was not clear, however, whether CerS6 gene is a direct transcriptional target of p53 or whether this was an indirect effect through additional regulatory factors. In the present study, we have shown that the CerS6 promoter is activated by p53 in luciferase assays, whereas transcriptionally inactive R175H p53 mutant failed to induce the luciferase expression from this promoter. In vitro immunoprecipitation assays and gel shift analyses have further demonstrated that purified p53 binds within the CerS6 promoter sequence spanning 91 bp upstream and 60 bp downstream of the transcription start site. The Promo 3.0.2 online tool for the prediction of transcription factor binding sites indicated the presence of numerous putative non-canonical p53 binding motifs in the CerS6 promoter. Luciferase assays and gel shift analysis have identified a single motif upstream of the transcription start as a key p53 response element. Treatment of cells with Nutlin-3 or low concentrations of actinomycin D resulted in a strong elevation of CerS6 mRNA and protein, thus demonstrating that CerS6 is a component of the non-genotoxic p53-dependent cellular stress response. This study has shown that by direct transcriptional activation of CerS6, p53 can regulate specific ceramide biosynthesis, which contributes to the pro-apoptotic cellular response. PMID:27302066

  13. A new type of NtrC transcriptional activator.

    PubMed Central

    Foster-Hartnett, D; Cullen, P J; Monika, E M; Kranz, R G

    1994-01-01

    The enteric NtrC (NRI) protein has been the paradigm for a class of bacterial enhancer-binding proteins (EBPs) that activate transcription of RNA polymerase containing the sigma 54 factor. Activators in the NtrC class are characterized by essentially three properties: (i) they bind to sites distant from the promoters that they activate (> 100 bp upstream of the transcriptional start site), (ii) they contain a conserved nucleotide-binding fold and exhibit ATPase activity that is required for activation, and (iii) they activate the sigma 54 RNA polymerase. We have characterized the NtrC protein from a photosynthetic bacterium, Rhodobacter capsulatus, which represents a metabolically versatile group of bacteria found in aquatic environments. We have shown that the R. capsulatus NtrC protein (RcNtrC) binds to two tandem sites that are distant from promoters that it activates, nifA1 and nifA2. These tandem binding sites are shown to be important for RcNtrC-dependent nitrogen regulation in vivo. Moreover, the conserved nucleotide-binding fold of RcNtrC is required to activate nifA1 and nifA2 but is not required for DNA binding of RcNtrC to upstream activation sequences. However, nifA1 and nifA2 genes do not require the sigma 54 for activation and do not contain the highly conserved nucleotides that are present in all sigma 54-type, EBP-activated promoters. Thus, the NtrC from this photosynthetic bacterium represents a novel member of the class of bacterial EBPs. It is probable that this class of EBPs is more versatile in prokaryotes than previously envisioned. Images PMID:7928986

  14. Impact of Heavy Metals on Transcriptional and Physiological Activity of Nitrifying Bacteria.

    PubMed

    Kapoor, Vikram; Li, Xuan; Elk, Michael; Chandran, Kartik; Impellitteri, Christopher A; Santo Domingo, Jorge W

    2015-11-17

    Heavy metals can inhibit nitrification, a key process for nitrogen removal in wastewater treatment. The transcriptional responses of amoA, hao, nirK, and norB were measured in conjunction with specific oxygen uptake rate (sOUR) for nitrifying enrichment cultures exposed to different metals (Ni(II), Zn(II), Cd(II), and Pb(II)). There was significant decrease in sOUR with increasing concentrations for Ni(II) (0.03-3 mg/L), Zn(II) (0.1-10 mg/L), and Cd(II) (0.03-1 mg/L) (p < 0.05). However, no considerable changes in sOUR were observed with Pb(II) (1-100 mg/L), except at a dosage of 1000 mg/L causing 84% inhibition. Based on RT-qPCR data, the transcript levels of amoA and hao decreased when exposed to Ni(II) dosages. Slight up-regulation of amoA, hao, and nirK (0.5-1.5-fold) occurred after exposure to 0.3-3 mg/L Zn(II), although their expression decreased for 10 mg/L Zn(II). With the exception of 1000 mg/L Pb(II), stimulation of all genes occurred on Cd(II) and Pb(II) exposure. While overall the results show that RNA-based function-specific assays can be used as potential surrogates for measuring nitrification activity, the degree of inhibition inferred from sOUR and gene transcription is different. We suggest that variations in transcription of functional genes may supplement sOUR based assays as early warning indicators of upsets in nitrification. PMID:26501957

  15. Transcriptional activation of JC virus by human T-lymphotropic virus type I Tax protein in human neuronal cell lines.

    PubMed

    Okada, Y; Sawa, H; Tanaka, S; Takada, A; Suzuki, S; Hasegawa, H; Umemura, T; Fujisawa, J; Tanaka, Y; Hall, W W; Nagashima, K

    2000-06-01

    Polyomavirus JC (JCV) causes the human demyelinating disease, progressive multifocal leukoencephalopathy (PML). The recent demonstration of cases of PML in association with human T-lymphotropic virus type I (HTLV-I) infection prompted us to examine whether the HTLV-I-encoded regulatory protein Tax activates JCV transcription. By employing a dual luciferase assay, we initially found that the expression of Tax activated the transcriptional potential of both early and late promoters of JCV in human neuronal but not in non-neuronal cells. We subsequently analyzed the mechanism of Tax-induced activation of the JCV promoter in neuronal cells with the following results: 1) the JCV promoter that lacks the NF-kappaB-binding motif could not be activated by Tax; 2) the overexpression of IkappaBalpha abolished Tax-induced transcriptional activation of the JCV promoter; 3) a Tax mutant (M22) lacking the potential for activation via the NF-kappaB pathway did not activate the JCV promoter. Furthermore, Tax enhances the gene expression of JCV T antigen and VP1. We examined mechanisms of the cell-specific activation of the JCV promoter by Tax. Electrophoretic mobility shift assay demonstrated the presence of Tax-bound protein(s) that were specifically present in non-neuronal cells. This study is the first demonstration of the activation of JCV promoter by HTLV-I Tax in an NF-kappaB-dependent manner. PMID:10828075

  16. Promoter occlusion: transcription through a promoter may inhibit its activity.

    PubMed

    Adhya, S; Gottesman, M

    1982-07-01

    Induction of prophage lambda inhibits the expression of the gal operon from its cognate promoters. The effect is observed only in cis, and is due to frequent transcription of the gal promoter region by RNA polymerase molecules initiating upstream at the prophage PL promoter. The frequency of transcription initiation at PL is some 30 times greater than that at the gal promoter, Pg1. PL is one of the strongest procaryotic promoters. This "promoter occlusion" is essentially complete when the distance between gal and PL is small (less than or equal to 10 kb); and when PL is fully active (that is, in the absence of the cl or cro repressors). We discuss the possibility that promoter occlusion at two lambda promoters, Pint and PR', might play a role in the sequential expression of viral functions. PMID:6217898

  17. DNA binding and transcription activation by chicken interferon regulatory factor-3 (chIRF-3)

    PubMed Central

    Grant, Caroline E.; May, Donna L.; Deeley, Roger G.

    2000-01-01

    Interferon regulatory factors (IRFs) are a family of transcription factors involved in the cellular response to interferons and viral infection. Previously we isolated an IRF from a chicken embryonic liver cDNA library. Using a PCR-based binding site selection assay, we have characterised the binding specificity of chIRF-3. The optimal binding site (OBS) fits within the consensus interferon-stimulated response element (ISRE) but the specificity of chIRF-3 binding allows less variation in nucleotides outside the core IRF-binding sequence. A comparison of IRF-1 and chIRF-3 binding to ISREs in electrophoretic mobility shift assays confirmed that the binding specificity of chIRF-3 was clearly distinguishable from IRF-1. The selection assay also showed that chIRF-3 is capable of binding an inverted repeat of two half OBSs separated by 10–13 nt. ChIRF-3 appears to bind both the OBS and inverted repeat sites as a dimer with the protein–protein interaction requiring a domain between amino acids 117 and 311. In transfection experiments expression of chIRF-3 strongly activated a promoter containing the OBS. The activation domain was mapped to between amino acids 138 and 221 and a domain inhibitory to activation was also mapped to the C-terminal portion of chIRF-3. PMID:11095692

  18. Single cell multiplexed assay for proteolytic activity using droplet microfluidics.

    PubMed

    Ng, Ee Xien; Miller, Miles A; Jing, Tengyang; Chen, Chia-Hung

    2016-07-15

    Cellular enzymes interact in a post-translationally regulated fashion to govern individual cell behaviors, yet current platform technologies are limited in their ability to measure multiple enzyme activities simultaneously in single cells. Here, we developed multi-color Förster resonance energy transfer (FRET)-based enzymatic substrates and use them in a microfluidics platform to simultaneously measure multiple specific protease activities from water-in-oil droplets that contain single cells. By integrating the microfluidic platform with a computational analytical method, Proteolytic Activity Matrix Analysis (PrAMA), we are able to infer six different protease activity signals from individual cells in a high throughput manner (~100 cells/experimental run). We characterized protease activity profiles at single cell resolution for several cancer cell lines including breast cancer cell line MDA-MB-231, lung cancer cell line PC-9, and leukemia cell line K-562 using both live-cell and in-situ cell lysis assay formats, with special focus on metalloproteinases important in metastasis. The ability to measure multiple proteases secreted from or expressed in individual cells allows us to characterize cell heterogeneity and has potential applications including systems biology, pharmacology, cancer diagnosis and stem cell biology. PMID:26995287

  19. Transcriptional activation of Epstein-Barr virus BRLF1 by USF1 and Rta.

    PubMed

    Hung, Chen-Chia; Kuo, Chung-Wen; Wang, Wen-Hung; Chang, Tzu-Hsuan; Chang, Pey-Jium; Chang, Li-Kwan; Liu, Shih-Tung

    2015-09-01

    During its lytic cycle, Epstein-Barr virus (EBV) expresses Rta, a factor encoded by BRLF1 that activates the transcription of viral lytic genes. We found that upstream stimulating factor (USF) binds to E1, one of the five E boxes located at - 79 in the BRLF1 promoter (Rp), to activate BRLF1 transcription. Furthermore, Rta was shown to interact with USF1 in coimmunoprecipitation and glutathione S-transferase (GST)-pulldown assays, and confocal laser-scanning microscopy further confirmed that these two proteins colocalize in the nucleus. Rta was also found to bind with the E1 sequence in a biotin-labelled E1 probe, but only in the presence of USF1, suggesting that these two proteins likely form a complex on E1. We subsequently constructed p188mSZ, a reporter plasmid that contained the sequence from - 188 to +5 in Rp, within which the Sp1 site and Zta response element were mutated. In EBV-negative Akata cells cotransfected with p188mSZ and plasmids expressing USF1 and Rta, synergistic activation of Rp transcription was observed. However, after mutating the E1 sequence in p188mSZ, USF1 and Rta were no longer able to transactivate Rp, indicating that Rta autoregulates BRLF1 transcription via its interaction with USF1 on E1. This study showed that pUSF1 transfection after EBV lytic induction in P3HR1 cells increases Rta expression, indicating that USF1 activates Rta expression after the virus enters the lytic cycle. Together, these results reveal a novel mechanism by which USF interacts with Rta to promote viral lytic development, and provide additional insight into the viral-host interactions of EBV. PMID:26297580

  20. Transcriptional activation of melanocortin 2 receptor accessory protein by PPARγ in adipocytes

    SciTech Connect

    Kim, Nam Soo; Kim, Yoon-Jin; Cho, Si Young; Lee, Tae Ryong; Kim, Sang Hoon

    2013-09-27

    Highlights: •MRAP enhanced HSL expression. •ACTH-mediated MRAP reduced glycerol release. •PPARγ induced MRAP expression. •PPARγ bound to the MRAP promoter. -- Abstract: Adrenocorticotropic hormone (ACTH) in rodents decreases lipid accumulation and body weight. Melanocortin receptor 2 (MC2R) and MC2R accessory protein (MRAP) are specific receptors for ACTH in adipocytes. Peroxisome proliferator-activated receptor γ (PPARγ) plays a role in the transcriptional regulation of metabolic pathways such as adipogenesis and β-oxidation of fatty acids. In this study we investigated the transcriptional regulation of MRAP expression during differentiation of 3T3-L1 cells. Stimulation with ACTH affected lipolysis in murine mature adipocytes via MRAP. Putative peroxisome proliferator response element (PPRE) was identified in the MRAP promoter region. In chromatin immunoprecipitation and reporter assays, we observed binding of PPARγ to the MRAP promoter. The mutagenesis experiments showed that the −1209/−1198 region of the MRAP promoter could function as a PPRE site. These results suggest that PPARγ is required for transcriptional activation of the MRAP gene during adipogenesis, which contributes to understanding of the molecular mechanism of lipolysis in adipocytes.

  1. Characterization of a novel transcriptionally active domain in the transforming growth factor beta-regulated Smad3 protein.

    PubMed

    Prokova, Vassiliki; Mavridou, Sofia; Papakosta, Paraskevi; Kardassis, Dimitris

    2005-01-01

    Transforming growth factor beta (TGFbeta) regulates transcriptional responses via activation of cytoplasmic effector proteins termed Smads. Following their phosphorylation by the type I TGFbeta receptor, Smads form oligomers and translocate to the nucleus where they activate the transcription of TGFbeta target genes in cooperation with nuclear cofactors and coactivators. In the present study, we have undertaken a deletion analysis of human Smad3 protein in order to characterize domains that are essential for transcriptional activation in mammalian cells. With this analysis, we showed that Smad3 contains two domains with transcriptional activation function: the MH2 domain and a second middle domain that includes the linker region and the first two beta strands of the MH2 domain. Using a protein-protein interaction assay based on biotinylation in vivo, we were able to show that a Smad3 protein bearing an internal deletion in the middle transactivation domain is characterized by normal oligomerization and receptor activation properties. However, this mutant has reduced transactivation capacity on synthetic or natural promoters and is unable to interact physically and functionally with the histone acetyltransferase p/CAF. The loss of interaction with p/CAF or other coactivators could account, at least in part, for the reduced transactivation capacity of this Smad3 mutant. Our data support an essential role of the previously uncharacterized middle region of Smad3 for nuclear functions, such as transcriptional activation and interaction with coactivators. PMID:15994459

  2. A Transgenic Mouse Assay for Agouti Protein Activity

    PubMed Central

    Perry, W. L.; Hustad, C. M.; Swing, D. A.; Jenkins, N. A.; Copeland, N. G.

    1995-01-01

    The mouse agouti gene encodes an 131 amino acid paracrine signaling molecule that instructs hair follicle melanocytes to switch from making black to yellow pigment. Expression of agouti during the middle part of the hair growth cycle in wild-type mice produces a yellow band on an otherwise black hair. The ubiquitous unregulated expression of agouti in mice carrying dominant yellow alleles is associated with pleiotropic effects including increased yellow pigment in the coat, obesity, diabetes and increased tumor susceptibility. Agouti shows no significant homology to known genes, and the molecular analysis of agouti alleles has shed little new light on the important functional elements of the agouti protein. In this paper, we show that agouti expression driven by the human β-ACTIN promoter produces obese yellow transgenic mice and that this can be used as an assay for agouti activity. We used this assay to evaluate a point mutation associated with the a(16H) allele within the region encoding agouti's putative signal sequence and our results suggest that this mutation is sufficient to cause the a(16H) phenotype. Thus, in vitro mutagenesis followed by the generation of transgenic mice should allow us to identify important functional elements of the agouti protein. PMID:7635291

  3. A General Strategy to Enhance the Potency of Chimeric Transcriptional Activators

    NASA Astrophysics Data System (ADS)

    Natesan, Sridaran; Molinari, Elizabeth; Rivera, Victor M.; Rickles, Richard J.; Gilman, Michael

    1999-11-01

    Efforts to increase the potency of transcriptional activators are generally unsuccessful because poor expression of activators in mammalian cells limits their delivery to target promoters. Here we report that the effectiveness of chimeric activators can be dramatically improved by expressing them as noncovalent tetrameric bundles. Bundled activation domains are much more effective at activating a reporter gene than simple monomeric activators, presumably because, at similar expression levels, up to 4 times as many the activation domains are delivered to the target promoter. These bundled activation domains are also more effective than proteins in which activation domains are tandemly reiterated in the same polypeptide chain, because such proteins are very poorly expressed and therefore not delivered effectively. These observations suggest that there is a threshold number of activation domains that must be bound to a promoter for activation, above which promoter activity is simply a function of the number of activators bound. We show that bundling can be exploited practically to enhance the sensitivity of mammalian two-hybrid assays, enabling detection of weak interactions or those between poorly expressed proteins. Bundling also dramatically improves the performance of a small-molecule-regulated gene expression system when the expression level of regulatory protein is limiting, a situation that may be encountered in gene therapy applications.

  4. Genome-wide activities of Polycomb complexes control pervasive transcription.

    PubMed

    Lee, Hun-Goo; Kahn, Tatyana G; Simcox, Amanda; Schwartz, Yuri B; Pirrotta, Vincenzo

    2015-08-01

    Polycomb group (PcG) complexes PRC1 and PRC2 are well known for silencing specific developmental genes. PRC2 is a methyltransferase targeting histone H3K27 and producing H3K27me3, essential for stable silencing. Less well known but quantitatively much more important is the genome-wide role of PRC2 that dimethylates ∼70% of total H3K27. We show that H3K27me2 occurs in inverse proportion to transcriptional activity in most non-PcG target genes and intergenic regions and is governed by opposing roaming activities of PRC2 and complexes containing the H3K27 demethylase UTX. Surprisingly, loss of H3K27me2 results in global transcriptional derepression proportionally greatest in silent or weakly transcribed intergenic and genic regions and accompanied by an increase of H3K27ac and H3K4me1. H3K27me2 therefore sets a threshold that prevents random, unscheduled transcription all over the genome and even limits the activity of highly transcribed genes. PRC1-type complexes also have global roles. Unexpectedly, we find a pervasive distribution of histone H2A ubiquitylated at lysine 118 (H2AK118ub) outside of canonical PcG target regions, dependent on the RING/Sce subunit of PRC1-type complexes. We show, however, that H2AK118ub does not mediate the global PRC2 activity or the global repression and is predominantly produced by a new complex involving L(3)73Ah, a homolog of mammalian PCGF3. PMID:25986499

  5. Estrogenic activity assessment of environmental chemicals using in vitro assays: identification of two new estrogenic compounds.

    PubMed Central

    Lascombe, I; Beffa, D; Rüegg, U; Tarradellas, J; Wahli, W

    2000-01-01

    Environmental chemicals with estrogenic activities have been suggested to be associated with deleterious effects in animals and humans. To characterize estrogenic chemicals and their mechanisms of action, we established in vitro and cell culture assays that detect human estrogen receptor [alpha] (hER[alpha])-mediated estrogenicity. First, we assayed chemicals to determine their ability to modulate direct interaction between the hER[alpha] and the steroid receptor coactivator-1 (SRC-1) and in a competition binding assay to displace 17ss-estradiol (E(2)). Second, we tested the chemicals for estrogen-associated transcriptional activity in the yeast estrogen screen and in the estrogen-responsive MCF-7 human breast cancer cell line. The chemicals investigated in this study were o,p'-DDT (racemic mixture and enantiomers), nonylphenol mixture (NPm), and two poorly analyzed compounds in the environment, namely, tris-4-(chlorophenyl)methane (Tris-H) and tris-4-(chlorophenyl)methanol (Tris-OH). In both yeast and MCF-7 cells, we determined estrogenic activity via the estrogen receptor (ER) for o,p'-DDT, NPm, and for the very first time, Tris-H and Tris-OH. However, unlike estrogens, none of these xenobiotics seemed to be able to induce ER/SRC-1 interactions, most likely because the conformation of the activated receptor would not allow direct contacts with this coactivator. However, these compounds were able to inhibit [(3)H]-E(2) binding to hER, which reveals a direct interaction with the receptor. In conclusion, the test compounds are estrogen mimics, but their molecular mechanism of action appears to be different from that of the natural hormone as revealed by the receptor/coactivator interaction analysis. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:10903615

  6. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease

    PubMed Central

    Naranjo, José R.; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M.; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C.; Arrabal, María D.; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-01-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  7. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease.

    PubMed

    Naranjo, José R; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C; Arrabal, María D; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-02-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  8. Visualization of Estrogen Receptor Transcriptional Activation in Zebrafish

    PubMed Central

    Halpern, Marnie E.

    2011-01-01

    Estrogens regulate a diverse range of physiological processes and affect multiple tissues. Estrogen receptors (ERs) regulate transcription by binding to DNA at conserved estrogen response elements, and such elements have been used to report ER activity in cultured cells and in transgenic mice. We generated stable, transgenic zebrafish containing five consecutive elements upstream of a c-fos minimal promoter and green fluorescent protein (GFP) to visualize and quantify transcriptional activation in live larvae. Transgenic larvae show robust, dose-dependent estrogen-dependent fluorescent labeling in the liver, consistent with er gene expression, whereas ER antagonists inhibit GFP expression. The nonestrogenic steroids dexamethasone and progesterone fail to activate GFP, confirming ER selectivity. Natural and synthetic estrogens activated the transgene with varying potency, and two chemicals, genistein and bisphenol A, preferentially induce GFP expression in the heart. In adult fish, fluorescence was observed in estrogenic tissues such as the liver, ovary, pituitary gland, and brain. Individual estrogen-responsive neurons and their projections were visualized in the adult brain, and GFP-positive neurons increased in number after 17β-estradiol exposure. The transgenic estrogen-responsive zebrafish allow ER signaling to be monitored visually and serve as in vivo sentinels for detection of estrogenic compounds. PMID:21540282

  9. Clinical application of transcriptional activators of bile salt transporters☆

    PubMed Central

    Baghdasaryan, Anna; Chiba, Peter; Trauner, Michael

    2014-01-01

    Hepatobiliary bile salt (BS) transporters are critical determinants of BS homeostasis controlling intracellular concentrations of BSs and their enterohepatic circulation. Genetic or acquired dysfunction of specific transport systems causes intrahepatic and systemic retention of potentially cytotoxic BSs, which, in high concentrations, may disturb integrity of cell membranes and subcellular organelles resulting in cell death, inflammation and fibrosis. Transcriptional regulation of canalicular BS efflux through bile salt export pump (BSEP), basolateral elimination through organic solute transporters alpha and beta (OSTα/OSTβ) as well as inhibition of hepatocellular BS uptake through basolateral Na+-taurocholate cotransporting polypeptide (NTCP) represent critical steps in protection from hepatocellular BS overload and can be targeted therapeutically. In this article, we review the potential clinical implications of the major BS transporters BSEP, OSTα/OSTβ and NTCP in the pathogenesis of hereditary and acquired cholestatic syndromes, provide an overview on transcriptional control of these transporters by the key regulatory nuclear receptors and discuss the potential therapeutic role of novel transcriptional activators of BS transporters in cholestasis. PMID:24333169

  10. Regulating the regulators: modulators of transcription factor activity.

    PubMed

    Everett, Logan; Hansen, Matthew; Hannenhalli, Sridhar

    2010-01-01

    Gene transcription is largely regulated by DNA-binding transcription factors (TFs). However, the TF activity itself is modulated via, among other things, post-translational modifications (PTMs) by specific modification enzymes in response to cellular stimuli. TF-PTMs thus serve as "molecular switchboards" that map upstream signaling events to the downstream transcriptional events. An important long-term goal is to obtain a genome-wide map of "regulatory triplets" consisting of a TF, target gene, and a modulator gene that specifically modulates the regulation of the target gene by the TF. A variety of genome-wide data sets can be exploited by computational methods to obtain a rough map of regulatory triplets, which can guide directed experiments. However, a prerequisite to developing such computational tools is a systematic catalog of known instances of regulatory triplets. We first describe PTM-Switchboard, a recent database that stores triplets of genes such that the ability of one gene (the TF) to regulate a target gene is dependent on one or more PTMs catalyzed by a third gene, the modifying enzyme. We also review current computational approaches to infer regulatory triplets from genome-wide data sets and conclude with a discussion of potential future research. PTM-Switchboard is accessible at http://cagr.pcbi.upenn.edu/PTMswitchboard / PMID:20827600

  11. KLF4 and SOX9 Transcription Factors Antagonize β-Catenin and Inhibit TCF-Activity In Cancer Cells

    PubMed Central

    Sellak, Hassan; Wu, Songwei; Lincoln, Thomas M

    2013-01-01

    The transcriptional activator β-catenin is a key mediator of the canonical Wnt signaling pathway. β-catenin itself does not bind DNA but functions via interaction with T-cell factor (TCF)/ lymphoid-enhancing factor (LEF) transcription factors. Thus, in the case of active Wnt signaling, β-catenin, in cooperation with TCF/LEF proteins family, activates the expression of a wide variety of genes. To date, the list of established β-catenin interacting targets is far from complete. In this study, we aimed to establish the interaction between β-catenin and transcription factors that might affect TCF activity. We took advantage of EMSA, using TCF as a probe, to screen oligonucleotides known to bind specific transcription factors that might dislodge or antagonize β-catenin/TCF binding. We found that Sox9 and KLF4 antagonize β-catenin/TCF binding in HEK293, A549, SW480, and T47D cells. This inhibition of TCF binding was concentration-dependent and correlated to the in vitro TCF-luciferase functional assays. Overexpression of Sox9 and KLF4 transcription factors in cancer cells show a concentration-dependent reduction of TCF-luciferase as well as the TCF-binding activities. In addition, we demonstrated that both Sox9 and KLF4 interact with β-catenin in an immunoprecipitation assay and reduce its binding to TCF4. Together, these results demonstrate that Sox9 and KLF4 transcription factors antagonize β-catenin/TCF in cancer cells. PMID:22766303

  12. Assays for Hepatitis B Virus DNA-and RNA-Dependent DNA Polymerase Activities.

    PubMed

    Shaw, T; Locarnini, S A

    2000-01-01

    Genomes of the hepatitis B viruses (HBVs) consist of approx 3.2 kb of partly double-stranded DNA containing three or four overlapping open reading frames, the largest of which encodes the viral polymerase (Pol) protein. After entry into the cell and uncoating, the viral genome is transported to the nucleus where it is converted into a covalently closed circular (CCC) or supercoiled molecule by cellular repair mechanisms. The viral CCC DNA is transcribed, presumably by host cell RNA polymerase II, into unspliced, capped polyadenylated mRNA species from which viral proteins are transcribed. In addition, terminally redundant 3.5-kb RNA transcripts, which function as pregenomes, are produced and exported to the cytoplasm where they are packaged into viral core particles in which reverse transcription, pregenome degradation, and duplication occurs, reproducing the partly double-stranded HBV genome (for recent review, see ref. 1). Besides its essential role in HBV genome replication, HBV Pol is also involved in virus assembly, and because hepadnaviruses do not encode enzymes functionally equivalent to deoxynucleoside kinases (2), functions associated with HBV Pol are probably the only virus-specific targets for antiviral activity of nucleoside analogs. In vitro assays for inhibition of HBV Pol functions by deoxynucleoside triphosphate (dNTP) analogs are useful indicators but, because of restrictions imposed by hepatocyte enzymology, provide no guarantee of potential anti-HBV activity of the parent (deoxy)nucleoside analogs in intact cells (2). PMID:21331902

  13. Nondestructive assay using active and passive computed tomography

    SciTech Connect

    Roberson, G. P. ,LLNL

    1998-07-01

    The United States Department of Energy (DOE) has over 600,000 transuranic (TRU) waste drums temporarily stored at nearly 40 sites within the United States. Contents of these drums must be characterized before they are transported for permanent disposal. Traditional gamma-ray methods used to characterize nuclear waste introduce errors that are related to nonuniform measurement responses associated with unknown radioactive source and matrix material distributions. These errors can be reduced by application of tomographic techniques, that measure these distributions. The Lawrence Livermore National Laboratory (LLNL) has developed two tomographic-based waste assay systems. They use external radioactive sources and tomography-protocol to map the attenuation within a waste drum as a function of mono-energetic gamma-ray energy in waste containers. Passive tomography is used to localize and identify specific radioactive waste contents within the same waste containers. Reconstruction of the passive data via the active images allows internal waste radioactivities in a drum to be corrected for any overlying heterogeneous materials, thus yielding an absolute assay of the waste radioactivities. Calibration of both systems requires only point source measurements and are independent of matrix materials. The first system is housed at LLNL and was developed to study and validate research concepts. The second system is being developed with Bioimaging Research, Inc. (BIR) and is housed within a mobile waste characterization trailer. This system has traveled to three DOE facilities to demonstrate the active and passive computed tomography capability. Both systems have participated in and successfully passed the requirements of formal DOE-sponsored intercomparison studies. The systems have measured approximately 1 to 100 grains of plutonium within a variety of waste matrix materials. Laboratory and field results from these two systems over the past several years show that both systems

  14. Cell-free NADPH oxidase activation assays: "in vitro veritas".

    PubMed

    Pick, Edgar

    2014-01-01

    The superoxide (O2 (∙-))-generating NADPH oxidase complex of phagocytes comprises a membrane-imbedded heterodimeric flavocytochrome, known as cytochrome b 558 (consisting of Nox2 and p22 (phox) ) and four cytosolic regulatory proteins, p47 (phox) , p67 (phox) , p40 (phox) , and the small GTPase Rac. Under physiological conditions, in the resting phagocyte, O2 (∙-) generation is initiated by engagement of membrane receptors by a variety of stimuli, followed by specific signal transduction sequences leading to the translocation of the cytosolic components to the membrane and their association with the cytochrome. A consequent conformational change in Nox2 initiates the electron "flow" along a redox gradient, from NADPH to oxygen, leading to the one-electron reduction of molecular oxygen to O2 (∙-). Methodological difficulties in the dissection of this complex mechanism led to the design "cell-free" systems (also known as "broken cells" or in vitro systems). In these, membrane receptor stimulation and all or part of the signal transduction sequence are missing, the accent being placed on the actual process of "NADPH oxidase assembly," thus on the formation of the complex between cytochrome b 558 and the cytosolic components and the resulting O2 (∙-) generation. Cell-free assays consist of a mixture of the individual components of the NADPH oxidase complex, derived from resting phagocytes or in the form of purified recombinant proteins, exposed in vitro to an activating agent (distinct from and unrelated to whole cell stimulants), in the presence of NADPH and oxygen. Activation is commonly quantified by measuring the primary product of the reaction, O2 (∙-), trapped immediately after its generation by an appropriate acceptor in a kinetic assay, permitting the calculation of the linear rate of O2 (∙-) production, but numerous variations exist, based on the assessment of reaction products or the consumption of substrates. Cell-free assays played a paramount

  15. Transcriptional activity of acetylcholinesterase gene is regulated by DNA methylation during C2C12 myogenesis.

    PubMed

    Lau, Kei M; Gong, Amy G W; Xu, Miranda L; Lam, Candy T W; Zhang, Laura M L; Bi, Cathy W C; Cui, D; Cheng, Anthony W M; Dong, Tina T X; Tsim, Karl W K; Lin, Huangquan

    2016-07-01

    The expression of acetylcholinesterase (AChE), an enzyme hydrolyzes neurotransmitter acetylcholine at vertebrate neuromuscular junction, is regulated during myogenesis, indicating the significance of muscle intrinsic factors in controlling the enzyme expression. DNA methylation is essential for temporal control of myogenic gene expression during myogenesis; however, its role in AChE regulation is not known. The promoter of vertebrate ACHE gene carries highly conserved CG-rich regions, implying its likeliness to be methylated for epigenetic regulation. A DNA methyltransferase inhibitor, 5-azacytidine (5-Aza), was applied onto C2C12 cells throughout the myotube formation. When DNA methylation was inhibited, the promoter activity, transcript expression and enzymatic activity of AChE were markedly increased after day 3 of differentiation, which indicated the putative role of DNA methylation. By bisulfite pyrosequencing, the overall methylation rate was found to peak at day 3 during C2C12 cell differentiation; a SP1 site located at -1826bp upstream of mouse ACHE gene was revealed to be heavily methylated. The involvement of transcriptional factor SP1 in epigenetic regulation of AChE was illustrated here: (i) the SP1-driven transcriptional activity was increased in 5-Aza-treated C2C12 culture; (ii) the binding of SP1 onto the SP1 site of ACHE gene was fully blocked by the DNA methylation; and (iii) the sequence flanking SP1 sites of ACHE gene was precipitated by chromatin immuno-precipitation assay. The findings suggested the role of DNA methylation on AChE transcriptional regulation and provided insight in elucidating the DNA methylation-mediated regulatory mechanism on AChE expression during muscle differentiation. PMID:27021952

  16. Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity

    PubMed Central

    Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.

    2011-01-01

    Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252

  17. Distinct TFIID complexes mediate the effect of different transcriptional activators.

    PubMed Central

    Brou, C; Chaudhary, S; Davidson, I; Lutz, Y; Wu, J; Egly, J M; Tora, L; Chambon, P

    1993-01-01

    Multiple chromatographically separable complexes containing the TATA binding protein (TBP), which exhibit different functional properties, exist in HeLa cells. At least three distinct subpopulations of such complexes can be functionally defined as TFIID since they function with RNA polymerase II. Using a partially reconstituted HeLa cell in vitro transcription system and immunoprecipitation with a monoclonal antibody directed against TBP, we show that stimulation of transcription by the chimeric activators GAL-VP16, GAL-TEF-1 and GAL-ER(EF) requires the presence of factors which are tightly associated with these TFIID complexes. Moreover, the activity of GAL-TEF-1 appears to be mediated by at least two chromatographically distinct populations of TFIID. The factor(s) associated with one of these populations is also required for the activity of GAL-ER (EF) and GAL-VP16, while the factor(s) associated with the other population functions selectively with GAL-TEF-1. These two TFIID populations are composed of both common and unique TBP associated factors (TAFs). Images PMID:8440239

  18. The synchronous active neutron detection system for spent fuel assay

    SciTech Connect

    Pickrell, M.M.; Kendall, P.K.

    1994-10-01

    The authors have begun to develop a novel technique for active neutron assay of fissile material in spent nuclear fuel. This approach will exploit the unique operating features of a 14-MeV neutron generator developed by Schlumberger. This generator and a novel detection system will be applied to the direct measurement of the fissile material content in spent fuel in place of the indirect measures used at present. The technique they are investigating is termed synchronous active neutron detection (SAND). It closely follows a method that has been used routinely in other branches of physics to detect very small signals in the presence of large backgrounds. Synchronous detection instruments are widely available commercially and are termed {open_quotes}lock-in{close_quotes} amplifiers. The authors have implemented a digital lock-in amplifier in conjunction with the Schlumberger neutron generator to explore the possibility of synchronous detection with active neutrons. This approach is possible because the Schlumberger system can operate at up to a 50% duty factor, in effect, a square wave of neutron yield. The results to date are preliminary but quite promising. The system is capable of resolving the fissile material contained in a small fraction of the fuel rods in a cold fuel assembly. It also appears to be quite resilient to background neutron interference. The interrogating neutrons appear to be nonthermal and penetrating. Although a significant amount of work remains to fully explore the relevant physics and optimize the instrument design, the underlying concept appears sound.

  19. Activating Transcription Factor 4 and X Box Binding Protein 1 of Litopenaeus vannamei Transcriptional Regulated White Spot Syndrome Virus Genes Wsv023 and Wsv083

    PubMed Central

    Li, Xiao-Yun; Pang, Li-Ran; Chen, Yong-Gui; Weng, Shao-Ping; Yue, Hai-Tao; Zhang, Ze-Zhi; Chen, Yi-Hong; He, Jian-Guo

    2013-01-01

    In response to endoplasmic reticulum (ER) stress, the signaling pathway termed unfolded protein response (UPR) is activated. To investigate the role of UPR in Litopenaeus vannamei immunity, the activating transcription factor 4 (designated as LvATF4) which belonged to a branch of the UPR, the [protein kinase RNA (PKR)-like ER kinase, (PERK)]-[eukaryotic initiation factor 2 subunit alpha (eIF2α)] pathway, was identified and characterized. The full-length cDNA of LvATF4 was 1972 bp long, with an open reading frame of 1299 bp long that encoded a 432 amino acid protein. LvATF4 was highly expressed in gills, intestines and stomach. For the white spot syndrome virus (WSSV) challenge, LvATF4 was upregulated in the gills after 3 hpi and increased by 1.9-fold (96 hpi) compared to the mock-treated group. The LvATF4 knock-down by RNA interference resulted in a lower cumulative mortality of L. vannamei under WSSV infection. Reporter gene assays show that LvATF4 could upregulate the expression of the WSSV gene wsv023 based on the activating transcription factor/cyclic adenosine 3′, 5′-monophosphate response element (ATF/CRE). Another transcription factor of L. vannamei, X box binding protein 1 (designated as LvXBP1), has a significant function in [inositol-requiring enzyme-1(IRE1) – (XBP1)] pathway. This transcription factor upregulated the expression of the WSSV gene wsv083 based on the UPR element (UPRE). These results suggest that in L. vannamei UPR signaling pathway transcription factors are important for WSSV and might facilitate WSSV infection. PMID:23638122

  20. Development and Assay of RNA Transcripts of Enterovirus Species A to D, Rhinovirus Species A to C, and Human Parechovirus: Assessment of Assay Sensitivity and Specificity of Real-Time Screening and Typing Methods

    PubMed Central

    McLeish, Nigel J.; Witteveldt, Jeroen; Clasper, Lucy; McIntyre, Chloe; McWilliam Leitch, E. Carol; Hardie, Alison; Bennett, Susan; Gunson, Rory; Carman, William F.; Feeney, Susan A.; Coyle, Peter V.; Vipond, Barry; Muir, Peter; Benschop, Kimberley; Wolthers, Katja; Waris, Matti; Osterback, Riikka; Johannessen, Ingo; Templeton, Kate; Harvala, Heli

    2012-01-01

    Nucleic acid amplification methods such as the PCR have had a major impact on the diagnosis of viral infections, often achieving greater sensitivities and shorter turnaround times than conventional assays and an ability to detect viruses refractory to conventional isolation methods. Their effectiveness is, however, significantly influenced by assay target sequence variability due to natural diversity and rapid sequence changes in viruses that prevent effective binding of primers and probes. This was investigated for a diverse range of enteroviruses (EVs; species A to D), human rhinoviruses (HRVs; species A to C), and human parechovirus (HPeV) in a multicenter assay evaluation using a series of full-length prequantified RNA transcripts. RNA concentrations were quantified by absorption (NanoDrop) and fluorescence methods (RiboGreen) prior to dilution in buffer supplemented with RNase inhibitors and carrier RNA. RNA transcripts were extremely stable, showing minimal degradation after prolonged storage at temperatures between ambient and −20°C and after multiple freeze-thaw cycles. Transcript dilutions distributed to six referral laboratories were screened by real-time reverse transcriptase PCR assays using different primers and probes. All of the laboratories reported high assay sensitivities for EV and HPeV transcripts approaching single copies and similar amplification kinetics for all four EV species. HRV detection sensitivities were more variable, often with substantially impaired detection of HRV species C. This could be accounted for in part by the placement of primers and probes to genetically variable target regions. Transcripts developed in this study provide reagents for the ongoing development of effective diagnostics that accommodate increasing knowledge of genetic heterogeneity of diagnostic targets. PMID:22740708

  1. False-Positive Transcription-Mediated Amplification Assay Detection of West Nile Virus in Blood from a Patient with Viremia Caused by an Usutu Virus Infection▿

    PubMed Central

    Gaibani, Paolo; Pierro, Anna Maria; Cavrini, Francesca; Rossini, Giada; Landini, Maria Paola; Sambri, Vittorio

    2010-01-01

    Detection of West Nile virus (WNV) by nucleic acid amplification technology (NAAT) is used widely to screen blood and organ donations in areas where WNV is endemic. We report a false-positive result of a WNV transcription-mediated amplification assay (TMA) in a patient with viremia that was caused by Usutu virus, a mosquito-borne flavivirus. PMID:20592138

  2. Development of a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of Sugarcane mosaic virus and Sorghum mosaic virus in sugarcane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for detecting Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV) in sugarcane. Six sets of four primers corresponding to the conserved coat protein gene were designed for each virus and their succ...

  3. Rapid Differentiation and Identification of Potential Severe Strains of Citrus tristeza Virus by Real-Time Reverse Transcription Polymerase Chain Reaction Assays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multiplex Taqman®-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to detect all strains of Citrus tristeza virus (CTV) and to identify potentially severe strains of the virus. A CTV TaqMan probe (CTV-CY5) based on the coat protein (CP) gene sequences...

  4. Development of reverse transcription loop-mediated isothermal amplification assay for rapid detection of an emerging potyvirus: tomato necrotic stunt virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tomato necrotic stunt virus (ToNStV) is an emerging potyvirus that causes severe stunting to the infected tomato plants. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for a sensitive detection of ToNStV. The sensitivity of RT-LAMP was comparable to th...

  5. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

  6. Activation of transcription factor AP-1 and mitogen-activated protein kinases in aniline-induced splenic toxicity

    SciTech Connect

    Khan, M. Firoze . E-mail: mfkhan@utmb.edu; Kannan, Subburaj; Wang Jianling

    2006-01-15

    Signaling mechanisms in aniline-induced fibrogenic and/or tumorigenic response in the spleen are not known. Previous studies have shown that aniline exposure leads to iron accumulation and oxidative stress in the spleen, which may cause activation of redox-sensitive transcription factors and regulate the transcription of genes involved in fibrosis and/or tumorigenesis. To test this, male SD rats were treated with 0.5 mmol/kg/day aniline via drinking water for 30 days, and activation of transcription factor AP-1 was determined in the splenocyte nuclear extracts (NEs). AP-1 DNA-binding activity in the NEs of freshly isolated splenocytes from aniline-treated rats increased in comparison to the controls, as determined by electrophoretic mobility shift assay (EMSA). AP-1 binding was also determined in the NEs of cultured splenocytes (2 h and 24 h), which showed even a greater increase in binding activity at 2 h. The specificity of AP-1 binding for relevant DNA motifs was confirmed by competition EMSA and by supershift EMSA using antibodies specific to c-Jun and c-Fos. To further explore the signaling mechanisms in the AP-1 activation, phosphorylation patterns of mitogen-activated protein kinases (MAPKs) were pursued. Aniline exposure induced increases in the phosphorylation of the three classes of MAPKs: extracellular-signal-regulated kinase (ERK 1/2), c-Jun N-terminal kinase (JNK 1/2), and p38 MAPKs. Furthermore, TGF-{beta}1 mRNA expression showed a 3-fold increase in the spleens of aniline-treated rats. These observations suggest a strong association among MAPK phosphorylation, AP-1 activation, and enhanced TGF-{beta}1 gene expression. The observed sequence of events subsequent to aniline exposure could regulate genes that lead to fibrogenic and/or tumorigenic response in the spleen.

  7. Reporter Phage and Breath Tests: Emerging Phenotypic Assays for Diagnosing Active Tuberculosis, Antibiotic Resistance, and Treatment Efficacy

    PubMed Central

    Jain, Paras; Thaler, David S.; Maiga, Mamoudou; Timmins, Graham S.; Bishai, William R.; Hatfull, Graham F.; Larsen, Michelle H.; Jacobs, William R.

    2011-01-01

    The rapid and accurate diagnosis of active tuberculosis (TB) and its drug susceptibility remain a challenge. Phenotypic assays allow determination of antibiotic susceptibilities even if sequence data are not available or informative. We review 2 emerging diagnostic approaches, reporter phage and breath tests, both of which assay mycobacterial metabolism. The reporter phage signal, Green fluorescent protein (GFP) or β-galactosidase, indicates transcription and translation inside the recipient bacilli and its attenuation by antibiotics. Different breath tests assay, (1) exhaled antigen 85, (2) mycobacterial urease activity, and (3) detection by trained rats of disease-specific odor in sputum, have also been developed. When compared with culture, reporter phage assays shorten the time for initial diagnosis of drug susceptibility by several days. Both reporter phage and breath tests have promise as early markers to determine the efficacy of treatment. While sputum often remains smear and Mycobacterium tuberculosis DNA positive early in the course of efficacious antituberculous treatment, we predict that both breath and phage tests will rapidly become negative. If this hypothesis proves correct, phage assays and breath tests could become important surrogate markers in early bactericidal activity (EBA) studies of new antibiotics. PMID:21996696

  8. Identification of a Caulobacter basal body structural gene and a cis-acting site required for activation of transcription.

    PubMed Central

    Dingwall, A; Gober, J W; Shapiro, L

    1990-01-01

    The genes that encode the components and regulatory proteins of the Caulobacter crescentus flagellum are transcribed at specific times in the cell cycle. One of these genes, flbN, is required early in the flagellar assembly process. The flbN gene was cloned and sequenced, and the time of transcription activation was determined. The derived amino acid sequence indicates that fibN encodes a 25-kilodalton protein with a cleavable leader peptide. The flbN-encoded protein has 30.8% identity with the protein encoded by the Salmonella typhimurium basal body L-ring gene, flgH. Site-directed mutagenesis and gel mobility shift assays identified a binding site at -100 from the transcription start site for a trans-acting protein, RF-2, that functions to partially activate flbN transcription at a defined time in the cell cycle. The RF-2 binding region is similar to a NifA binding site normally used in the activation of some sigma 54 promoters involved in nitrogen fixation in other bacteria. Transcription of a flbN-reporter gene fusion in an Escherichia coli background was dependent on the presence of a NifA transcription factor supplied by a plasmid-borne Rhizobium meliloti gene encoding NifA. A deletion or base changes in the RF-2 binding region eliminated expression of the flbN gene in E. coli even when a NifA protein was provided in trans, suggesting that a sigma 54 promoter with an upstream activator element is used by the C. crescentus flbN gene. A consensus sequence for a sigma 54 promoter was found at the appropriate distance 5' to one of two identified transcription start sites. Site-directed mutagenesis confirmed that a conserved nucleotide in this sigma 54 promoter consensus sequence was required for transcription. Deletion of the region 5' to the apparent sigma 54 promoter caused a complete loss of transcription activation. Transcription activation of flbN in C. crescentus involves the combination of several elements: the NifA-like site is required for full

  9. Dynamic Mechanism for the Transcription Apparatus Orchestrating Reliable Responses to Activators

    NASA Astrophysics Data System (ADS)

    Wang, Yaolai; Liu, Feng; Wang, Wei

    2012-05-01

    The transcription apparatus (TA) is a huge molecular machine. It detects the time-varying concentrations of transcriptional activators and initiates mRNA transcripts at appropriate rates. Based on the general structural organizations of the TA, we propose how the TA dynamically orchestrates transcriptional responses. The activators rapidly cycle in and out of a clamp-like space temporarily formed between the enhancer and the Mediator, with the concentration of activators encoded as their temporal occupancy rate (RTOR) within the space. The entry of activators into this space induces allostery in the Mediator, resulting in a facilitated circumstance for transcriptional reinitiation. The reinitiation rate is much larger than the cycling rate of activators, thereby RTOR guiding the amount of transcripts. Based on this mechanism, stochastic simulations can qualitatively reproduce and interpret multiple features of gene expression, e.g., transcriptional bursting is not mere noise as traditionally believed, but rather the basis of reliable transcriptional responses.

  10. Helicase Assays

    PubMed Central

    Wang, Xin; Li, Jing; Diaz, Jason; You, Jianxin

    2016-01-01

    Helicases are a class of enzymes which are motor proteins using energy derived from ATP hydrolysis to move directionally along a nucliec acid phosphodiester backbone (such as DNA, RNA and DNA-RNA hybrids) and separate two annealed nucleic acid strands. Many cellular processes, such as transcription, DNA replication, recombination and DNA repair involve helicase activity. Here, we provide a protocol to analyze helicase activities in vitro. In this protocol, the DNA helicase protein Merkel cell polyomavirus large T-antigen was expressed in the mammalian cell line HEK293 and immoblized on an IgG resin. The helicase assay is performing while the protein is immoblized on IgG resin.

  11. Effects of Indole-3-Acetic Acid on the Transcriptional Activities and Stress Tolerance of Bradyrhizobium japonicum

    PubMed Central

    Donati, Andrew J.; Lee, Hae-In; Leveau, Johan H. J.; Chang, Woo-Suk

    2013-01-01

    A genome-wide transcriptional profile of Bradyrhizobium japonicum, the nitrogen-fixing endosymbiont of the soybean plant, revealed differential expression of approximately 15% of the genome after a 1 mM treatment with the phytohormone indole-3-acetic acid (IAA). A total of 1,323 genes were differentially expressed (619 up-regulated and 704 down-regulated) at a two-fold cut off with q value ≤ 0.05. General stress response genes were induced, such as those involved in response to heat, cold, oxidative, osmotic, and desiccation stresses and in exopolysaccharide (EPS) biosynthesis. This suggests that IAA is effective in activating a generalized stress response in B. japonicum. The transcriptional data were corroborated by the finding that stress tolerance of B. japonicum in cell viability assays was enhanced when pre-treated with 1 mM IAA compared to controls. The IAA treatment also stimulated biofilm formation and EPS production by B. japonicum, especially acidic sugar components in the total EPS. The IAA pre-treatment did not influence the nodulation ability of B. japonicum. The data provide a comprehensive overview of the potential transcriptional responses of the symbiotic bacterium when exposed to the ubiquitous hormone of its plant host. PMID:24098533

  12. Nuclear Factor 90(NF90) targeted to TAR RNA inhibits transcriptional activation of HIV-1

    PubMed Central

    Agbottah, Emmanuel T; Traviss, Christine; McArdle, James; Karki, Sambhav; St Laurent, Georges C; Kumar, Ajit

    2007-01-01

    Background Examination of host cell-based inhibitors of HIV-1 transcription may be important for attenuating viral replication. We describe properties of a cellular double-stranded RNA binding protein with intrinsic affinity for HIV-1 TAR RNA that interferes with Tat/TAR interaction and inhibits viral gene expression. Results Utilizing TAR affinity fractionation, North-Western blotting, and mobility-shift assays, we show that the C-terminal variant of nuclear factor 90 (NF90ctv) with strong affinity for the TAR RNA, competes with Tat/TAR interaction in vitro. Analysis of the effect of NF90ctv-TAR RNA interaction in vivo showed significant inhibition of Tat-transactivation of HIV-1 LTR in cells expressing NF90ctv, as well as changes in histone H3 lysine-4 and lysine-9 methylation of HIV chromatin that are consistent with the epigenetic changes in transcriptionally repressed gene. Conclusion Structural integrity of the TAR element is crucial in HIV-1 gene expression. Our results show that perturbation Tat/TAR RNA interaction by the dsRNA binding protein is sufficient to inhibit transcriptional activation of HIV-1. PMID:17565699

  13. Development of reverse transcription loop-mediated isothermal amplification assay as a simple detection method of Chrysanthemum stem necrosis virus in chrysanthemum and tomato.

    PubMed

    Suzuki, Ryoji; Fukuta, Shiro; Matsumoto, Yuho; Hasegawa, Toru; Kojima, Hiroko; Hotta, Makiko; Miyake, Noriyuki

    2016-10-01

    For a simple and rapid detection of Chrysanthemum stem necrosis virus (CSNV) from chrysanthemum and tomato, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed. A primer set designed to the genome sequences of CSNV worked most efficiently at 63°C and could detect CSNV RNA within 12min by fluorescence monitoring using an isothermal DNA amplification and fluorescence detection device. The result of a specificity test using seven other viruses and one viroid-infectable chrysanthemum or tomato showed that the assay could amplify CSNV specifically, and a sensitivity comparison showed that the RT-LAMP assay was as sensitive as the reverse transcriptase polymerase chain reaction. The RT-LAMP assay using crude RNA, extracted simply, could detect CSNV. Overall, the RT-LAMP assay was found to be a simple, specific, convenient, and time-saving method for CSNV detection. PMID:27400833

  14. Development of Conventional and Real-Time Reverse Transcription Polymerase Chain Reaction Assays to Detect Tembusu Virus in Culex tarsalis Mosquitoes

    PubMed Central

    Petz, Lawrence N.; Turell, Michael J.; Padilla, Susana; Long, Lewis S.; Reinbold-Wasson, Drew D.; Smith, Darci R.; O'Guinn, Monica L.; Melanson, Vanessa R.; Lee, John S.

    2014-01-01

    Tembusu virus (TMUV) is an important emerging arthropod-borne virus that may cause encephalitis in humans and has been isolated in regions of southeast Asia, including Malaysia, Thailand, and China. Currently, detection and identification of TMUV are limited to research laboratories, because quantitative rapid diagnostic assays for the virus do not exist. We describe the development of sensitive and specific conventional and real-time quantitative reverse transcription polymerase chain reaction assays for detecting TMUV RNA in infected cell culture supernatant and Culex tarsalis mosquitoes. We used this assay to document the replication of TMUV in Cx. tarsalis, where titers increased 1,000-fold 5 days after inoculation. These assays resulted in the detection of virus-specific RNA in the presence of copurified mosquito nucleic acids. The use of these rapid diagnostic assays may have future applications for field pathogen surveillance and may assist in early detection, diagnosis, and control of the associated arthropod-borne pathogens. PMID:25114013

  15. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases.

    PubMed

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-03-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals. PMID:26950874

  16. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases

    PubMed Central

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-01-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals. PMID:26950874

  17. Transcriptional Responses to Estrogen and Progesterone in Mammary Gland Identify Networks Regulating p53 Activity

    PubMed Central

    Lu, Shaolei; Becker, Klaus A.; Hagen, Mary J.; Yan, Haoheng; Roberts, Amy L.; Mathews, Lesley A.; Schneider, Sallie S.; Siegelmann, Hava T.; MacBeth, Kyle J.; Tirrell, Stephen M.; Blanchard, Jeffrey L.; Jerry, D. Joseph

    2008-01-01

    Estrogen and progestins are essential for mammary growth and differentiation but also enhance the activity of the p53 tumor suppressor protein in the mammary epithelium. However, the pathways by which these hormones regulate p53 activity are unknown. Microarrays were used to profile the transcriptional changes within the mammary gland after administration of either vehicle, 17β-estradiol (E), or progesterone (P) individually and combined (EP). Treatment with EP yielded 1182 unique genes that were differentially expressed compared to the vehicle-treated group. Although 30% of genes were responsive to either E or P individually, combined treatment with both EP had a synergistic effect accounting for 60% of the differentially regulated genes. Analysis of protein-protein interactions identified p53, RelA, Snw1, and Igfals as common targets of genes regulated by EP. RelA and p53 form hubs within a network connected by genes that are regulated by EP and that may coordinate the competing functions of RelA and p53 in proliferation and survival of cells. Induction of early growth response 1 (Egr1) and Stratifin (Sfn) (also known as 14–3-3σ) by EP was confirmed by reverse transcription-quantitative PCR and shown to be p53 independent. In luciferase reporter assays, Egr1 was shown to enhance transcriptional activation by p53 and inhibit nuclear factor κB activity. These results identify a gene expression network that provides redundant activation of RelA to support proliferation as well as sensitize p53 to ensure proper surveillance and integration of their competing functions through factors such as Egr1, which both enhance p53 and inhibit RelA. PMID:18556351

  18. Repression in vitro, by human adenovirus E1A protein domains, of basal or Tat-activated transcription of the human immunodeficiency virus type 1 long terminal repeat.

    PubMed Central

    Song, C Z; Loewenstein, P M; Green, M

    1995-01-01

    Human adenovirus E1A proteins can repress the expression of several viral and cellular genes. By using a cell-free transcription system, we demonstrated that the gene product of the E1A 12S mRNA, the 243-residue protein E1A243R, inhibits basal transcription from the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR). The HIV-1 transactivator protein Tat greatly stimulates transcription from the viral promoter in vitro. However, E1A243R can repress Tat-activated transcription in vitro. Strong repression of both basal and Tat-activated transcriptions requires only E1A N-terminal amino acid residues 1 to 80. Deletion analysis showed that E1A N-terminal amino acids 4 to 25 are essential for repression, whereas amino acid residues 30 to 49 and 70 to 80 are dispensable. Transcriptional repression by E1A in the cell-free transcription system is promoter specific, since under identical conditions, transcription of the adenovirus major late promoter and the Rous sarcoma virus LTR promoter was unaffected. The repression of transcription by small E1A peptides in vitro provides an assay for investigation of molecular mechanisms governing E1A-mediated repression of both basal and Tat-activated transcriptions of the HIV-1 LTR promoter. PMID:7707515

  19. LIM homeobox transcription factor Lhx2 inhibits skeletal muscle differentiation in part via transcriptional activation of Msx1 and Msx2.

    PubMed

    Kodaka, Yusaku; Tanaka, Kiyoko; Kitajima, Kenji; Tanegashima, Kosuke; Matsuda, Ryoichi; Hara, Takahiko

    2015-02-15

    LIM homeobox transcription factor Lhx2 is known to be an important regulator of neuronal development, homeostasis of hair follicle stem cells, and self-renewal of hematopoietic stem cells; however, its function in skeletal muscle development is poorly understood. In this study, we found that overexpression of Lhx2 completely inhibits the myotube-forming capacity of C2C12 cells and primary myoblasts. The muscle dedifferentiation factors Msx1 and Msx2 were strongly induced by the Lhx2 overexpression. Short interfering RNA-mediated knockdown of Lhx2 in the developing limb buds of mouse embryos resulted in a reduction in Msx1 and Msx2 mRNA levels, suggesting that they are downstream target genes of Lhx2. We found two Lhx2 consensus-binding sites in the -2097 to -1189 genomic region of Msx1 and two additional sites in the -536 to +73 genomic region of Msx2. These sequences were shown by luciferase reporter assay to be essential for Lhx2-mediated transcriptional activation. Moreover, electrophoretic mobility shift assays and chromatin immunoprecipitation assays showed that Lhx2 is present in chromatin DNA complexes bound to the enhancer regions of the Msx1 and Msx2 genes. These data demonstrate that Msx1 and Msx2 are direct transcriptional targets of Lhx2. In addition, overexpression of Lhx2 significantly enhanced the mRNA levels of bone morphogenetic protein 4 and transforming growth factor beta family genes. We propose that Lhx2 is involved in the early stage of skeletal muscle development by inducing multiple differentiation inhibitory factors. PMID:25460335

  20. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  1. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    PubMed Central

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  2. Transcriptional profiling of TLR-4/7/8-stimulated guinea pig splenocytes and whole blood by bDNA assay

    PubMed Central

    Ching, Lance K.; Mompoint, Farah; Guderian, Jeffrey A.; Picone, Alex; Orme, Ian M.; Coler, Rhea N.; Reed, Steven G.; Baldwin, Susan L.

    2011-01-01

    Toll-like receptor (TLR) agonists are currently being examined as adjuvants for vaccines, with several lead candidates now in licensed products or in late-stage clinical development. Guinea pigs are widely used for preclinical testing of drugs and vaccines; however, evaluation of TLR agonists in this model is hindered by the limited availability of immunological tools and reagents. In this study, we validated the use of a branched-chain DNA (bDNA) assay known as the QuantiGene Plex 2.0 Reagent System for measuring innate cytokine and chemokine mRNA levels following TLR stimulation of guinea pig cells. Gene expression for T-helper-1 (Th1) polarizing cytokines (TNF-α, IL-1β, IL-12) and chemokines (CXCL1, CCL2) was upregulated following ex vivo stimulation of guinea pig splenocytes and whole blood with TLR-4 or TLR-7/8 agonists. These data confirm the utility of the QuantiGene system both as an alternative to RT-PCR for measuring transcript levels and as a high-throughput screening tool for dissecting the immunological response to TLR stimulation in guinea pigs. Overall, the QuantiGene platform is reliable, reproducible, and sensitive. These agonists have the potential to be used as adjuvant components in vaccines against various pathogens. PMID:21839740

  3. Real-time fluorogenic reverse transcription polymerase chain reaction assay for the specific detection of Bagaza virus.

    PubMed

    Buitrago, Dolores; Rocha, Ana; Tena-Tomás, Cristina; Vigo, Marta; Agüero, Montserrat; Jiménez-Clavero, Miguel Angel

    2012-09-01

    In September 2010, an outbreak of disease in 2 wild bird species (red-legged partridge, Alectoris rufa; ring-necked pheasant, Phasianus colchicus) occurred in southern Spain. Bagaza virus (BAGV) was identified as the etiological agent of the outbreak. BAGV had only been reported before in Western Africa (Central African Republic, Senegal) and in India. The first occurrence of BAGV in Spain stimulated a demand for rapid, reliable, and efficacious diagnostic methods to facilitate the surveillance of this disease in the field. This report describes a real-time reverse transcription polymerase chain reaction (RT-PCR) method based on a commercial 5'-Taq nuclease-3' minor groove binder DNA probe and primers targeting the Bagaza NS5 gene. The method allowed the detection of BAGV with a high sensitivity, whereas other closely related flaviviruses (Usutu virus, West Nile virus, and Japanese encephalitis virus) were not detected. The assay was evaluated using field samples of red-legged partridges dead during the outbreak (n = 11), as well as samples collected from partridges during surveillance programs (n = 81). The results were compared to those obtained with a pan-flaviviral hemi-nested RT-PCR followed by nucleotide sequencing, which was employed originally to identify the virus involved in the outbreak. The results obtained with both techniques were 100% matching, indicating that the newly developed real-time RT-PCR is a valid technique for BAGV genome detection, useful in both diagnosis and surveillance studies. PMID:22807508

  4. Transcriptional Regulation During Zygotic Genome Activation in Zebrafish and Other Anamniote Embryos.

    PubMed

    Wragg, J; Müller, F

    2016-01-01

    embryological tools and genome-wide assays. In this review we summarize recent advances in the characterization of epigenetic regulation, transcription control, and gene promoter function during zygotic genome activation and how they fit with old models for the mechanisms of the maternal to zygotic transition. This review will focus on the zebrafish embryo but draw comparisons with other vertebrate model systems and refer to invertebrate models where informative. PMID:27503357

  5. The metabolic activator FOXO1 binds hepatitis B virus DNA and activates its transcription

    SciTech Connect

    Shlomai, Amir; Shaul, Yosef

    2009-04-17

    Hepatitis B virus (HBV) is a small DNA virus that targets the liver and infects humans worldwide. Recently we have shown that the metabolic regulator PGC-1{alpha} coactivates HBV transcription thereby rendering the virus susceptible to fluctuations in the nutritional status of the liver. PGC-1{alpha} coactivation of HBV is mediated through the liver-enriched nuclear receptor HNF4{alpha} and through another yet unknown transcription factor(s). Here we show that the forkhead transcription factor FOXO1, a known target for PGC-1{alpha} coactivation and a central mediator of glucose metabolism in the liver, binds HBV core promoter and activates its transcription. This activation is further enhanced in the presence of PGC-1{alpha}, implying that FOXO1 is a target for PGC-1{alpha} coactivation of HBV transcription. Thus, our results identify another key metabolic regulator as an activator of HBV transcription, thereby supporting the principle that HBV gene expression is regulated in a similar way to key hepatic metabolic genes.

  6. Transcriptional cofactors exhibit differential preference toward peroxisome proliferator-activated receptors alpha and delta in uterine cells.

    PubMed

    Lim, Hyunjung J; Moon, Irene; Han, Kyuyong

    2004-06-01

    We previously showed that peroxisome proliferator-activated receptor delta (PPARdelta) is crucial for embryo implantation as a receptor for cyclooxygenase-2-derived prostacyclin in mice. PPARs belong to the nuclear receptor superfamily. They form heterodimer with a retinoid X receptor, recruit transcriptional cofactors, and bind to a specific recognition element for regulation of target genes. Although cofactors are generally shared by various nuclear receptors, some are involved in cell-specific events. The objective of this investigation was to examine interactions of transcriptional cofactors with PPARdelta in uterine cells for its effectiveness in regulating gene expression. We chose two uterine cellular systems: periimplantation mouse uterus and AN(3)CA human uterine cell line. As examined by in situ hybridization, steroid receptor coactivator (SRC)-2, SRC-3, PPAR-interacting protein, receptor-interacting protein 140 (RIP140), nuclear receptor corepressor (N-CoR), and silencing mediator for retinoid and thyroid hormone receptor (SMRT) exhibit overlapping expression with that of PPARdelta in the periimplantation mouse uterus. Glutathione-S-transferase (GST) pull-down assays show that PPARdelta physically interacts with SRC 1-3, RIP140, PPAR-binding protein, N-CoR, and SMRT in the absence of ligands, suggesting their potent interactions with PPARdelta. Transient transfection assays in AN(3)CA cells show that among members of the SRC family, only SRC-2 serves as a true coactivator for PPARdelta, whereas all SRC members could enhance PPARalpha-induced transcriptional activation. Interestingly, N-CoR and SMRT potently repress PPARdelta-induced transcriptional activation but fail to repress PPARalpha activity. RIP140 is effective in repressing basal and PPAR-induced transcriptional activation. Collectively, the results suggest that gene regulation by PPARdelta in the uterine cells uniquely responds to SRC-2, N-CoR, SMRT, or RIP140, and these interactions may be

  7. An auxiliary peptide required for the function of two activation domains in upstream stimulatory factor 2 (USF2) transcription factor.

    PubMed

    Gourdon, L; Lefrançois-Martinez, A M; Viollet, B; Martinez, A; Kahn, A; Raymondjean, M

    1997-04-01

    Ubiquitous upstream stimulatory factors (USF1, USF2a and USF2b) are members of the basic-helix-loop-helix-leucine-zipper family of transcription factors that have been shown to be involved in the transcriptional response of the L-type pyruvate kinase (L-PK) gene to glucose. To understand the mechanisms of action of the USF2 isoforms, we initiated a series of co-transfection assays with deletion mutants and Ga14-USF2 fusions. The transactivating efficiency of the different native and mutant factors was determined at similar DNA binding activity. We found that: (i) exons 3- and 5-encoded regions are activation domains, (ii) a modulator domain encoded by exon 4 could be necessary to their additive action, (iii) a hexapeptide encoded by the first 5' codons of exon 6 is indispensable for transmitting activation due to both exon 3- and exon 5-encoded domains to the transcriptional machinery. Therefore, USF2 presents a modular structure and mediates transcriptional activation thanks to two non-autonomous activation domains dependent on an auxiliary peptide for expressing their activating potential. PMID:9680311

  8. Association of transcription factor YY1 with the high molecular weight Notch complex suppresses the transactivation activity of Notch.

    PubMed

    Yeh, Tien-Shun; Lin, Yu-Min; Hsieh, Rong-Hong; Tseng, Min-Jen

    2003-10-24

    Notch receptors are evolutionarily conserved from Drosophila to human and play important roles in cell fate decisions. After ligand binding, Notch receptors are cleaved to release their intracellular domains. The intracellular domains, the activated form of Notch receptors, are then translocated into the nucleus where they interact with other transcriptional machinery to regulate the expression of cellular genes. To dissect the molecular mechanisms of Notch signaling, the cellular targets that interact with Notch1 receptor intracellular domain (N1IC) were screened. In this study, we found that endogenous transcription factor Ying Yang 1 (YY1) was associated with exogenous N1IC in human K562 erythroleukemic cells. The ankyrin (ANK) domain of N1IC and zinc finger domains of YY1 were essential for the association of N1IC and YY1 according to the pull-down assay of glutathione S-transferase fusion proteins. Furthermore, both YY1 and N1IC were present in a large complex of the nucleus to suppress the luciferase reporter activity transactivated by Notch signaling. The transcription factor YY1 indirectly regulated the transcriptional activity of the wild-type CBF1-response elements via the direct interaction of N1IC and CBF1. We also demonstrated the association between endogenous N1IC and intrinsic YY1 in human acute T-cell lymphoblastic leukemia cell lines. Taken together, these results indicate that transcription factor YY1 may modulate Notch signaling via association with the high molecular weight Notch complex. PMID:12913000

  9. Pre-Clinical Validation of a Novel, Highly Sensitive Assay to Detect PML-RARα mRNA Using Real-Time Reverse-Transcription Polymerase Chain Reaction

    PubMed Central

    Slack, James L.; Bi, WanLi; Livak, Kenneth J.; Beaubier, Nike; Yu, Min; Clark, Michelle; Kim, Soon H.; Gallagher, Robert E.; Willman, Cheryl L.

    2001-01-01

    We have developed a sensitive and quantitative reverse-transcription polymerase chain reaction (RT-PCR) assay for detection of PML-RARα, the fusion oncogene present as a specific marker in >99% of cases of acute promyelocytic leukemia (APL). The assay is linear over at least 5 orders of magnitude of input DNA or RNA, and detects as few as 4 copies of PML-RARα plasmid DNA. PML-RARα transcripts could be detected in mixtures containing 2 to 5 pg of RNA from fusion-containing cells in a background of 1 μg of RNA from PML-RARα-negative cells. Using 1.0 to 2.5 μg of input RNA, the sensitivity of the assay was between 10−5 and 10−6. Furthermore, determination of GAPDH copy number in each reaction allowed an accurate assessment of sample-to-sample variation in RNA quality and reaction efficiency, with consequent definition of a detection limit for each sample assayed. Using an internal calibrator, assay precision was high, with coefficients of variation between 10 and 20%. An interlaboratory study using coded samples demonstrated excellent reproducibility and high concordance between laboratories. This assay will be used to test the hypothesis that sensitive and quantitative measurement of leukemic burden, during or after therapy of APL, can stratify patients into discrete risk groups, and thereby serve as a basis for risk-adapted therapy in APL. PMID:11687597

  10. The ERF11 Transcription Factor Promotes Internode Elongation by Activating Gibberellin Biosynthesis and Signaling1[OPEN

    PubMed Central

    Zhou, Xin; Zhang, Zhong-Lin; Tyler, Ludmila; Yusuke, Jikumaru; Qiu, Kai; Lumba, Shelley; Desveaux, Darrell; McCourt, Peter; Sun, Tai-ping

    2016-01-01

    The phytohormone gibberellin (GA) plays a key role in promoting stem elongation in plants. Previous studies show that GA activates its signaling pathway by inducing rapid degradation of DELLA proteins, GA signaling repressors. Using an activation-tagging screen in a reduced-GA mutant ga1-6 background, we identified AtERF11 to be a novel positive regulator of both GA biosynthesis and GA signaling for internode elongation. Overexpression of AtERF11 partially rescued the dwarf phenotype of ga1-6. AtERF11 is a member of the ERF (ETHYLENE RESPONSE FACTOR) subfamily VIII-B-1a of ERF/AP2 transcription factors in Arabidopsis (Arabidopsis thaliana). Overexpression of AtERF11 resulted in elevated bioactive GA levels by up-regulating expression of GA3ox1 and GA20ox genes. Hypocotyl elongation assays further showed that overexpression of AtERF11 conferred elevated GA response, whereas loss-of-function erf11 and erf11 erf4 mutants displayed reduced GA response. In addition, yeast two-hybrid, coimmunoprecipitation, and transient expression assays showed that AtERF11 enhances GA signaling by antagonizing the function of DELLA proteins via direct protein-protein interaction. Interestingly, AtERF11 overexpression also caused a reduction in the levels of another phytohormone ethylene in the growing stem, consistent with recent finding showing that AtERF11 represses transcription of ethylene biosynthesis ACS genes. The effect of AtERF11 on promoting GA biosynthesis gene expression is likely via its repressive function on ethylene biosynthesis. These results suggest that AtERF11 plays a dual role in promoting internode elongation by inhibiting ethylene biosynthesis and activating GA biosynthesis and signaling pathways. PMID:27255484

  11. The ERF11 Transcription Factor Promotes Internode Elongation by Activating Gibberellin Biosynthesis and Signaling.

    PubMed

    Zhou, Xin; Zhang, Zhong-Lin; Park, Jeongmoo; Tyler, Ludmila; Yusuke, Jikumaru; Qiu, Kai; Nam, Edward A; Lumba, Shelley; Desveaux, Darrell; McCourt, Peter; Kamiya, Yuji; Sun, Tai-Ping

    2016-08-01

    The phytohormone gibberellin (GA) plays a key role in promoting stem elongation in plants. Previous studies show that GA activates its signaling pathway by inducing rapid degradation of DELLA proteins, GA signaling repressors. Using an activation-tagging screen in a reduced-GA mutant ga1-6 background, we identified AtERF11 to be a novel positive regulator of both GA biosynthesis and GA signaling for internode elongation. Overexpression of AtERF11 partially rescued the dwarf phenotype of ga1-6 AtERF11 is a member of the ERF (ETHYLENE RESPONSE FACTOR) subfamily VIII-B-1a of ERF/AP2 transcription factors in Arabidopsis (Arabidopsis thaliana). Overexpression of AtERF11 resulted in elevated bioactive GA levels by up-regulating expression of GA3ox1 and GA20ox genes. Hypocotyl elongation assays further showed that overexpression of AtERF11 conferred elevated GA response, whereas loss-of-function erf11 and erf11 erf4 mutants displayed reduced GA response. In addition, yeast two-hybrid, coimmunoprecipitation, and transient expression assays showed that AtERF11 enhances GA signaling by antagonizing the function of DELLA proteins via direct protein-protein interaction. Interestingly, AtERF11 overexpression also caused a reduction in the levels of another phytohormone ethylene in the growing stem, consistent with recent finding showing that AtERF11 represses transcription of ethylene biosynthesis ACS genes. The effect of AtERF11 on promoting GA biosynthesis gene expression is likely via its repressive function on ethylene biosynthesis. These results suggest that AtERF11 plays a dual role in promoting internode elongation by inhibiting ethylene biosynthesis and activating GA biosynthesis and signaling pathways. PMID:27255484

  12. Significant Closure of the Human Immunodeficiency Virus Type 1 and Hepatitis C Virus Preseroconversion Detection Windows with a Transcription-Mediated-Amplification-Driven Assay

    PubMed Central

    Kolk, Daniel P.; Dockter, Janel; Linnen, Jeff; Ho-Sing-Loy, Marcy; Gillotte-Taylor, Kristin; McDonough, Sherrol H.; Mimms, Larry; Giachetti, Cristina

    2002-01-01

    While the present generation of serology-based assays has significantly decreased the number of human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) infections acquired by transfusion, the possibility of infected donations escaping detection still exists. The average seronegative viremic window duration during which immunological assays are unable to detect the virus is estimated to be between 16 and 22 days for HIV-1 and approximately 70 days for HCV. Significant reduction of detection window duration was demonstrated using a nucleic acid amplification assay, the Procleix HIV-1/HCV Assay, which utilizes transcription-mediated amplification technology to simultaneously detect HIV-1 and HCV RNAs. For 26 commercially available HIV-1 seroconversion panels tested, specimens were reactive in the HIV-1/HCV assay at the same time as or earlier than in serological assays. Overall, the HIV-1/HCV assay was able to reduce the detection window duration by an average of 14 days and 6 days compared to tests relying on recognition of HIV-1 antibody and p24 antigen, respectively. For 24 commercially available HCV seroconversion panels tested, the specimens were reactive in the HIV-1/HCV assay at an earlier blood sampling date than in serological assays, reducing the detection window duration by an average of 26 days. Similar results were obtained in testing the HIV-1 and HCV seroconversion panels in the virus-specific HIV-1- and HCV-discriminatory assays, respectively. In conclusion, the HIV-1/HCV assay and corresponding discriminatory assays significantly reduced detection window durations compared to immunoassays. PMID:11980957

  13. GATA2 Mediates Thyrotropin-Releasing Hormone-Induced Transcriptional Activation of the Thyrotropin β Gene

    PubMed Central

    Ohba, Kenji; Sasaki, Shigekazu; Matsushita, Akio; Iwaki, Hiroyuki; Matsunaga, Hideyuki; Suzuki, Shingo; Ishizuka, Keiko; Misawa, Hiroko; Oki, Yutaka; Nakamura, Hirotoshi

    2011-01-01

    Thyrotropin-releasing hormone (TRH) activates not only the secretion of thyrotropin (TSH) but also the transcription of TSHβ and α-glycoprotein (αGSU) subunit genes. TSHβ expression is maintained by two transcription factors, Pit1 and GATA2, and is negatively regulated by thyroid hormone (T3). Our prior studies suggest that the main activator of the TSHβ gene is GATA2, not Pit1 or unliganded T3 receptor (TR). In previous studies on the mechanism of TRH-induced activation of the TSHβ gene, the involvements of Pit1 and TR have been investigated, but the role of GATA2 has not been clarified. Using kidney-derived CV1 cells and pituitary-derived GH3 and TαT1 cells, we demonstrate here that TRH signaling enhances GATA2-dependent activation of the TSHβ promoter and that TRH-induced activity is abolished by amino acid substitution in the GATA2-Zn finger domain or mutation of GATA-responsive element in the TSHβ gene. In CV1 cells transfected with TRH receptor expression plasmid, GATA2-dependent transactivation of αGSU and endothelin-1 promoters was enhanced by TRH. In the gel shift assay, TRH signal potentiated the DNA-binding capacity of GATA2. While inhibition by T3 is dominant over TRH-induced activation, unliganded TR or the putative negative T3-responsive element are not required for TRH-induced stimulation. Studies using GH3 cells showed that TRH-induced activity of the TSHβ promoter depends on protein kinase C but not the mitogen-activated protein kinase, suggesting that the signaling pathway is different from that in the prolactin gene. These results indicate that GATA2 is the principal mediator of the TRH signaling pathway in TSHβ expression. PMID:21533184

  14. Comparison of two methods for assaying reducing sugars in the determination of carbohydrase activities.

    PubMed

    Gusakov, Alexander V; Kondratyeva, Elena G; Sinitsyn, Arkady P

    2011-01-01

    The Nelson-Somogyi (NS) and 3,5-dinitrosalicylic acid (DNS) assays for reducing sugars are widely used in measurements of carbohydrase activities against different polysaccharides. Using twelve commercial enzyme preparations, the comparison of the NS and DNS assays in determination of cellulase, β-glucanase, xylanase, and β-mannanase activities was carried out. When cellulase activities against CMC were measured, the DNS assay gave activity values, which were typically 40-50% higher than those obtained with the NS assay. In the analysis of the xylanase, β-mannanase, and β-glucanase activities, the overestimations by the DNS assay were much more pronounced (the observed differences in the activities were 3- to 13-fold). Reasons for preferential use of the NS assay for measuring activities of carbohydrases other than cellulases are discussed. PMID:21647284

  15. Molecular mechanisms of COUP-TF-mediated transcriptional repression: evidence for transrepression and active repression.

    PubMed Central

    Leng, X; Cooney, A J; Tsai, S Y; Tsai, M J

    1996-01-01

    COUP-TF, an orphan member of the nuclear receptor superfamily, has been proposed to play a key role in regulating organogenesis, neurogenesis, and cellular differentiation during embryonic development. Since heterodimierization is a common theme within the nuclear receptor superfamily and has been demonstrated to modulate transcriptional properties of heterodimeric partners via allosteric interactions, we have devised a strategy to examine the silencing function of COUP-TF in a heterodimeric context. We find that the intrinsic active repression function of COUP-TF is not affected by heterodimerization. Moreover, COUP-TF can transrepress the ligand-dependent activation of its heterodimeric partners without its own DNA binding site. Using receptor deletion mutants in transfection assays, we show that the region necessary for COUP-TF silencing function is not sufficient for its transrepression activity. Furthermore, our studies indicate that in addition to its active repression function, COUP-TF can repress several different types of activator-dependent transactivation. However, this active repression function of COUP-TF may be differentially regulated by some other activator(s). These studies provide new insights into the molecular mechanism(s) of COUP-TF-mediated repression. PMID:8628300

  16. Domains with transcriptional regulatory activity within the ALL1 and AF4 proteins involved in acute leukemia.

    PubMed Central

    Prasad, R; Yano, T; Sorio, C; Nakamura, T; Rallapalli, R; Gu, Y; Leshkowitz, D; Croce, C M; Canaani, E

    1995-01-01

    The ALLI gene, located at chromosome band 11q23, is involved in acute leukemia through a series of chromosome translocations and fusion to a variety of genes, most frequently to A4 and AF9. The fused genes encode chimeric proteins proteins. Because the Drosophila homologue of ALL1, trithorax, is a positive regulator of homeotic genes and acts at the level of transcription, it is conceivable that alterations in ALL1 transcriptional activity may underlie its action in malignant transformation. To begin studying this, we examined the All1, AF4, AF9, and AF17 proteins for the presence of potential transcriptional regulatory domains. This was done by fusing regions of the proteins to the yeast GAL4 DNA binding domain and assaying their effect on transcription of a reporter gene. A domain of 55 residues positioned at amino acids 2829-2883 of ALL1 was identified as a very strong activator. Further analysis of this domain by in vitro mutagenesis pointed to a core of hydrophobic and acidic residues as critical for the activity. An ALL1 domain that repressed transcription of the reporter gene coincided with the sequence homologous to a segment of DNA methyltransferase. An AF4 polypeptide containing residues 480-560 showed strong activation potential. The C-terminal segment of AF9 spanning amino acids 478-568 transactivated transcription of the reporter gene in HeLa but not in NIH 3T3 cells. These results suggest that ALL1, AF4, and probably AF9 interact with the transcriptional machinery of the cell. Images Fig. 1 Fig. 4 Fig. 5 PMID:8618864

  17. In vitro transcriptional activation by a metabolic intermediate: activation by Leu3 depends on alpha-isopropylmalate.

    PubMed

    Sze, J Y; Woontner, M; Jaehning, J A; Kohlhaw, G B

    1992-11-13

    In the absence of the leucine biosynthetic precursor alpha-isopropylmalate (alpha-IPM), the yeast LEU3 protein (Leu3p) binds DNA and acts as a transcriptional repressor in an in vitro extract. Addition of alpha-IPM resulted in a dramatic increase in Leu3p-dependent transcription. The presence of alpha-IPM was also required for Leu3p to compete effectively with another transcriptional activator, GAL4/VP16, for limiting transcription factors. Therefore, the addition of alpha-IPM appears to convert a transcriptional repressor into an activator. This represents an example in eukaryotes of direct transcriptional regulation by a small effector molecule. PMID:1439822

  18. PAX5 IS THE TRANSCRIPTIONAL ACTIVATOR OF MUCOLIPIN-2 (MCOLN2) GENE

    PubMed Central

    Valadez, Jessica A.; Cuajungco, Math P.

    2014-01-01

    Transient Receptor Potential Mucolipin (TRPML) proteins belong to the TRP superfamily of non-selective cation channels. The TRPML1, -2, and -3 proteins are encoded by Mucolipin (MCOLN)-1, -2 and -3 genes, respectively. TRPML1 has been associated with Mucolipidosis type IV (MLIV), while no disease phenotype has been linked with TRPML2 or -3 protein. The TRPML proteins share high sequence similarities, form hetero-tetramers, and serve in membrane trafficking, autophagy, and metal homeostasis. Previous studies suggest that TRPML2 serves a role in the immune system; however, the evidence is mostly indirect. We hypothesize that if TRPML2 is involved in immune function its expression would be likely regulated by an immune-associated transcription factor protein. Thus, we set out to identify the core promoter region and the transcription factor responsible for MCOLN2 gene expression. Using dual-luciferase assay and over-expression analyses, we reveal for the first time that B-cell lineage specific activator protein (BSAP), also known as paired box 5 (PAX5), controls MCOLN2 expression. Specifically, heterologous expression of PAX5 in HEK-293 cells significantly increased endogenous MCOLN2 transcript and TRPML2 protein levels, while RNA interference targeting endogenous PAX5 reduced its effect. Site-directed mutagenesis studies showed that the core promoter and PAX5 binding region to be between -79 and -60 base pairs upstream of the transcriptional start site. Thus, our findings add to a growing list of evidence for TRPML2’s possible involvement in the immune system. The knowledge gained from this study could be used to further characterize the role of TRPML2 in B-cell development and function. PMID:25445271

  19. Transcriptional activation by simian virus 40 large T antigen: interactions with multiple components of the transcription complex.

    PubMed Central

    Gruda, M C; Zabolotny, J M; Xiao, J H; Davidson, I; Alwine, J C

    1993-01-01

    Simian virus 40 (SV40) large T antigen is a potent transcriptional activator of both viral and cellular promoters. Within the SV40 late promoter, a specific upstream element necessary for T-antigen transcriptional activation is the binding site for transcription-enhancing factor 1 (TEF-1). The promoter structure necessary for T-antigen-mediated transcriptional activation appears to be simple. For example, a promoter consisting of upstream TEF-1 binding sites (or other factor-binding sites) and a downstream TATA or initiator element is efficiently activated. It has been demonstrated that transcriptional activation by T antigen does not require direct binding to the DNA; thus, the most direct effect that T antigen could have on these simple promoters would be through protein-protein interactions with either upstream-bound transcription factors, the basal transcription complex, or both. To determine whether such interactions occur, full-length T antigen or segments of it was fused to the glutathione-binding site (GST fusions) or to the Gal4 DNA-binding domain (amino acids 1 to 147) (Gal4 fusions). With the GST fusions, it was found that TEF-1 and the TATA-binding protein (TBP) bound different regions of T antigen. A GST fusion containing amino acids 5 to 172 (region T1) efficiently bound TBP. TEF-1 bound neither region T1 nor a region between amino acids 168 and 373 (region T2); however, it bound efficiently to the combined region (T5) containing amino acids 5 to 383.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8423815

  20. Signal transducers and activators of transcription 3 (STAT3) inhibits transcription of the inducible nitric oxide synthase gene by interacting with nuclear factor kappaB.

    PubMed Central

    Yu, Zhiyuan; Zhang, Wenzheng; Kone, Bruce C

    2002-01-01

    Prolific generation of NO by inducible nitric oxide synthase (iNOS) can cause unintended injury to host cells during glomerulonephritis and other inflammatory diseases. While much is known about the mechanisms of iNOS induction, few transcriptional repressors have been found. We explored the role of signal transducers and activators of transcription 3 (STAT3) proteins in interleukin (IL)-1beta- and lipopolysaccharide (LPS)+interferon (IFN)-gamma-mediated iNOS induction in murine mesangial cells. Both stimuli induced rapid phosphorylation of STAT3 and sequence-specific STAT3 DNA-binding activity. Supershift assays with a STAT3 element probe demonstrated that nuclear factor kappaB (NF-kappaB) p65 and p50 complexed with STAT3 in the DNA-protein complex. The direct interaction of STAT3 and NF-kappaB p65 was verified in vivo by co-immunoprecipitation and in vitro by pull-down assays with glutathione S-transferase-NF-kappaB p65 fusion protein and in vitro -translated STAT3alpha. Overexpression of STAT3 dramatically inhibited IL-1beta- or LPS+IFN-gamma-mediated induction of iNOS promoter-luciferase constructs that contained the wild-type iNOS promoter or ones harbouring mutated STAT-binding elements. In tests of indirect inhibitory effects of STAT3, overexpression of STAT3 dramatically inhibited the activity of an NF-kappaB-dependent promoter devoid of STAT-binding elements without affecting NF-kappaB DNA-binding activity. Thus STAT3, via direct interactions with NF-kappaB p65, serves as a dominant-negative inhibitor of NF-kappaB activity to suppress indirectly cytokine induction of the iNOS promoter in mesangial cells. These results provide a new model for the termination of NO production by activated iNOS following exposure to pro-inflammatory stimuli. PMID:12057007

  1. Activator role of the pneumococcal Mga-like virulence transcriptional regulator.

    PubMed

    Solano-Collado, Virtu; Espinosa, Manuel; Bravo, Alicia

    2012-08-01

    Global transcriptional regulators that respond to specific environmental signals are crucial in bacterial pathogenesis. In the case of the Gram-positive pathogen Streptococcus pneumoniae (the pneumococcus), the sp1800 gene of the clinical isolate TIGR4 encodes a protein that exhibits homology to the Mga "stand-alone" response regulator of the group A Streptococcus. Such a pneumococcal protein was shown to play a significant role in both nasopharyngeal colonization and development of pneumonia in murine infection models. Moreover, it was shown to repress the expression of several genes located within the rlrA pathogenicity islet. The pneumococcal R6 strain, which derives from the D39 clinical isolate, lacks the rlrA islet but has a gene (here named mga(Spn)) equivalent to the sp1800 gene. In this work, and using in vivo approaches, we have identified the promoter of the mga(Spn) gene (Pmga) and demonstrated that four neighboring open reading frames of unknown function (spr1623 to spr1626) constitute an operon. Transcription of this operon is under the control of two promoters (P1623A and P1623B) that are divergent from the Pmga promoter. Furthermore, we have shown that the Mga(Spn) protein activates the P1623B promoter in vivo. This activation requires sequences located around 50 to 120 nucleotides upstream of the P1623B transcription start site. By DNase I footprinting assays, we have also demonstrated that such a region includes an Mga(Spn) binding site. This is the first report on the activator role of the pneumococcal Mga-like protein. PMID:22661692

  2. LATS1 phosphorylates forkhead L2 and regulates its transcriptional activity.

    PubMed

    Pisarska, Margareta D; Kuo, Fang-Ting; Bentsi-Barnes, Ikuko K; Khan, Salma; Barlow, Gillian M

    2010-07-01

    Forkhead L2 (FOXL2) is expressed in the ovary and acts as a transcriptional repressor of the steroidogenic acute regulatory (StAR) gene, a marker of granulosa cell differentiation. Human FOXL2 mutations that produce truncated proteins lacking the COOH terminus result in blepharophimosis/ptosis/epicanthus inversus (BPES) syndrome type I, which is associated with premature ovarian failure (POF). In this study, we investigated whether FOXL2's activity as a transcriptional repressor is regulated by phosphorylation. We found that FOXL2 is phosphorylated at a serine residue and, using yeast two-hybrid screening, identified LATS1 as a potential FOXL2-interacting protein. LATS1 is a serine/threonine kinase whose deletion in mice results in an ovarian phenotype similar to POF. Using coimmunoprecipitation and kinase assays, we confirmed that LATS1 binds to FOXL2 and demonstrated that LATS1 phosphorylates FOXL2 at a serine residue. Moreover, we found that FOXL2 and LATS1 are coexpressed in developing mouse gonads and in granulosa cells of small and medium follicles in the mouse ovary. Last, we demonstrated that coexpression with LATS1 enhances FOXL2's activity as a repressor of the StAR promoter, and this results from the kinase activity of LATS1. These results provide novel evidence that FOXL2 is phosphorylated by LATS1 and that this phosphorylation enhances the transcriptional repression of the StAR gene, a marker of granulosa cell differentiation. These data support our hypothesis that phosphorylation of FOXL2 may be a control mechanism regulating the rate of granulosa cell differentiation and hence, follicle maturation, and its dysregulation may contribute to accelerated follicular development and POF in BPES type I. PMID:20407010

  3. Post-transcriptional gene silencing activity of human GIGYF2.

    PubMed

    Kryszke, Marie-Hélène; Adjeriou, Badia; Liang, Feifei; Chen, Hong; Dautry, François

    2016-07-01

    In mammalian post-transcriptional gene silencing, the Argonaute protein AGO2 indirectly recruits translation inhibitors, deadenylase complexes, and decapping factors to microRNA-targeted mRNAs, thereby repressing mRNA translation and accelerating mRNA decay. However, the exact composition and assembly pathway of the microRNA-induced silencing complex are not completely elucidated. As the GYF domain of human GIGYF2 was shown to bind AGO2 in pulldown experiments, we wondered whether GIGYF2 could be a novel protein component of the microRNA-induced silencing complex. Here we show that full-length GIGYF2 coimmunoprecipitates with AGO2 in human cells, and demonstrate that, upon tethering to a reporter mRNA, GIGYF2 exhibits strong, dose-dependent silencing activity, involving both mRNA destabilization and translational repression. PMID:27157137

  4. The Regulatory Role of Activating Transcription Factor 2 in Inflammation

    PubMed Central

    Yu, Tao; Li, Yong Jun; Bian, Ai Hong; Zuo, Hui Bin; Zhu, Ti Wen; Ji, Sheng Xiang; Kong, Fanming; Yin, De Qing; Wang, Chuan Bao; Wang, Zi Fu; Wang, Hong Qun; Yang, Yanyan; Yoo, Byong Chul

    2014-01-01

    Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs. PMID:25049453

  5. A High-Throughput MALDI-TOF Mass Spectrometry-Based Assay of Chitinase Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A high-throughput MALDI-TOF mass spectrometric assay is described for assay of chitolytic enzyme activity. The assay uses unmodified chitin oligosaccharide substrates, and is readily achievable on a microliter scale (2 µL total volume, containing 2 µg of substrate and 1 ng of protein). The speed a...

  6. Contrahelicase activity of the mitochondrial transcription termination factor mtDBP

    PubMed Central

    Polosa, Paola Loguercio; Deceglie, Stefania; Roberti, Marina; Gadaleta, Maria Nicola; Cantatore, Palmiro

    2005-01-01

    The sea urchin mitochondrial D-loop binding protein (mtDBP) is a transcription termination factor that is able to arrest bidirectionally mitochondrial RNA chain elongation. The observation that the mtDBP binding site in the main non-coding region is located in correspondence of the 3′ end of the triplex structure, where the synthesis of heavy strand mitochondrial (mt) DNA is either prematurely terminated or allowed to continue, raised the question whether mtDBP could also regulate mtDNA replication. By using a helicase assay in the presence of the replicative helicase of SV40, we show that mtDBP is able to inhibit the enzyme thus acting as a contrahelicase. The impairing activity of mtDBP is bidirectional as it is independent of the orientation of the protein binding site. The inhibition is increased by the presence of the guanosine-rich sequence that flanks mtDBP binding site. Finally, a mechanism of abrogation of mtDBP contrahelicase activity is suggested that is based on the dissociation of mtDBP from DNA caused by the passage of the RNA polymerase through the protein–DNA complex. All these findings favour the view that mtDBP, besides serving as transcription termination factor, could also act as a negative regulator of mtDNA synthesis at the level of D-loop expansion. PMID:16006625

  7. Enhancement of Zta-activated lytic transcription of Epstein-Barr virus by Ku80.

    PubMed

    Chen, Chien-Chang; Yang, Ya-Chun; Wang, Wen-Hung; Chen, Chien-Sin; Chang, Li-Kwan

    2011-03-01

    Zta, encoded by the BZLF1 gene of Epstein-Barr virus (EBV), is a transcription factor that is expressed during the immediate-early stage of the lytic cycle. The expression of Zta is crucial to viral lytic development. Earlier studies showed that Ku80 is a binding partner of Zta in ZKO-293 cells and is co-purified with Zta. This study verifies the interaction between Ku80 and Zta by using glutathione S-transferase-pull-down and co-immunoprecipitation assays, and also by indirect immunofluorescence analysis. This investigation also reveals that Ku80 binds to Zta on Zta-response elements in the BHLF1 promoter, enhancing the promoter activity. This study also reveals that the interaction between Zta and Ku80 involves the C-terminal region of Zta and the 425 aa N-terminal region of Ku80. The interaction between these two proteins and the enhancement of transcription that is activated by Zta suggest that Ku80 is important to EBV lytic development. PMID:21123545

  8. A Trihelix DNA Binding Protein Counterbalances Hypoxia-Responsive Transcriptional Activation in Arabidopsis

    PubMed Central

    Licausi, Francesco; Kosmacz, Monika; Oosumi, Teruko; van Dongen, Joost T.; Bailey-Serres, Julia; Perata, Pierdomenico

    2014-01-01

    Transcriptional activation in response to hypoxia in plants is orchestrated by ethylene-responsive factor group VII (ERF-VII) transcription factors, which are stable during hypoxia but destabilized during normoxia through their targeting to the N-end rule pathway of selective proteolysis. Whereas the conditionally expressed ERF-VII genes enable effective flooding survival strategies in rice, the constitutive accumulation of N-end-rule–insensitive versions of the Arabidopsis thaliana ERF-VII factor RAP2.12 is maladaptive. This suggests that transcriptional activation under hypoxia that leads to anaerobic metabolism may need to be fine-tuned. However, it is presently unknown whether a counterbalance of RAP2.12 exists. Genome-wide transcriptome analyses identified an uncharacterized trihelix transcription factor gene, which we named HYPOXIA RESPONSE ATTENUATOR1 (HRA1), as highly up-regulated by hypoxia. HRA1 counteracts the induction of core low oxygen-responsive genes and transcriptional activation of hypoxia-responsive promoters by RAP2.12. By yeast-two-hybrid assays and chromatin immunoprecipitation we demonstrated that HRA1 interacts with the RAP2.12 protein but with only a few genomic DNA regions from hypoxia-regulated genes, indicating that HRA1 modulates RAP2.12 through protein–protein interaction. Comparison of the low oxygen response of tissues characterized by different levels of metabolic hypoxia (i.e., the shoot apical zone versus mature rosette leaves) revealed that the antagonistic interplay between RAP2.12 and HRA1 enables a flexible response to fluctuating hypoxia and is of importance to stress survival. In Arabidopsis, an effective low oxygen-sensing response requires RAP2.12 stabilization followed by HRA1 induction to modulate the extent of the anaerobic response by negative feedback regulation of RAP2.12. This mechanism is crucial for plant survival under suboptimal oxygenation conditions. The discovery of the feedback loop regulating the oxygen

  9. A trihelix DNA binding protein counterbalances hypoxia-responsive transcriptional activation in Arabidopsis.

    PubMed

    Giuntoli, Beatrice; Lee, Seung Cho; Licausi, Francesco; Kosmacz, Monika; Oosumi, Teruko; van Dongen, Joost T; Bailey-Serres, Julia; Perata, Pierdomenico

    2014-09-01

    Transcriptional activation in response to hypoxia in plants is orchestrated by ethylene-responsive factor group VII (ERF-VII) transcription factors, which are stable during hypoxia but destabilized during normoxia through their targeting to the N-end rule pathway of selective proteolysis. Whereas the conditionally expressed ERF-VII genes enable effective flooding survival strategies in rice, the constitutive accumulation of N-end-rule-insensitive versions of the Arabidopsis thaliana ERF-VII factor RAP2.12 is maladaptive. This suggests that transcriptional activation under hypoxia that leads to anaerobic metabolism may need to be fine-tuned. However, it is presently unknown whether a counterbalance of RAP2.12 exists. Genome-wide transcriptome analyses identified an uncharacterized trihelix transcription factor gene, which we named HYPOXIA RESPONSE ATTENUATOR1 (HRA1), as highly up-regulated by hypoxia. HRA1 counteracts the induction of core low oxygen-responsive genes and transcriptional activation of hypoxia-responsive promoters by RAP2.12. By yeast-two-hybrid assays and chromatin immunoprecipitation we demonstrated that HRA1 interacts with the RAP2.12 protein but with only a few genomic DNA regions from hypoxia-regulated genes, indicating that HRA1 modulates RAP2.12 through protein-protein interaction. Comparison of the low oxygen response of tissues characterized by different levels of metabolic hypoxia (i.e., the shoot apical zone versus mature rosette leaves) revealed that the antagonistic interplay between RAP2.12 and HRA1 enables a flexible response to fluctuating hypoxia and is of importance to stress survival. In Arabidopsis, an effective low oxygen-sensing response requires RAP2.12 stabilization followed by HRA1 induction to modulate the extent of the anaerobic response by negative feedback regulation of RAP2.12. This mechanism is crucial for plant survival under suboptimal oxygenation conditions. The discovery of the feedback loop regulating the oxygen

  10. Intrinsic HER4/4ICD transcriptional activation domains are required for STAT5A activated gene expression.

    PubMed

    Han, Wen; Sfondouris, Mary E; Semmes, Eleanor C; Meyer, Alicia M; Jones, Frank E

    2016-10-30

    The epidermal growth factor receptor family member HER4 undergoes proteolytic processing at the cell surface to release the HER4 intracellular domain (4ICD) nuclear protein. Interestingly, 4ICD directly interacts with STAT5 and functions as an obligate STAT5 nuclear chaperone. Once in the nucleus 4ICD binds with STAT5 at STAT5 target genes, dramatically potentiating STAT5 transcriptional activation. These observations raise the possibility that 4ICD directly coactivates STAT5 gene expression. Using both yeast and mammalian transactivation reporter assays, we performed truncations of 4ICD fused to a GAL4 DNA binding domain and identified two independent 4ICD transactivation domains located between residues 1022 and 1090 (TAD1) and 1192 and 1225 (TAD2). The ability of the 4ICD DNA binding domain fusions to transactivate reporter gene expression required deletion of the intrinsic tyrosine kinase domain. In addition, we identified the 4ICD carboxyl terminal TVV residues, a PDZ domain binding motif (PDZ-DBM), as a potent transcriptional repressor. The transactivation activity of the HER4 carboxyl terminal domain lacking the tyrosine kinase (CTD) was significantly lower than similar EGFR or HER2 CTD. However, deletion of the HER4 CTD PDZ-DBM enhanced HER4 CTD transactivation to levels equivalent to the EGFR and HER2 CTDs. To determine if 4ICD TAD1 and TAD2 have a physiologically relevant role in STAT5 transactivation, we coexpressed 4ICD or 4ICD lacking TAD2 or both TAD1 and TAD2 with STAT5 in a luciferase reporter assay. Our results demonstrate that each 4ICD TAD contributes additively to STAT5A transactivation and the ability of STAT5A to transactivate the β-casein promoter requires the 4ICD TADs. Taken together, published data and our current results demonstrate that both 4ICD nuclear chaperone and intrinsic coactivation activities are essential for STAT5 regulated gene expression. PMID:27502417

  11. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    PubMed Central

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  12. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    PubMed

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  13. A Measurable Activation of the bZIP Transcription Factor Atf1 in a Fission Yeast Strain Devoid of Stress-activated and Cell Integrity Mitogen-activated Protein Kinase (MAPK) Activities*

    PubMed Central

    Zhou, Xin; Ma, Yan; Kato, Toshiaki; Kuno, Takayoshi

    2012-01-01

    In Schizosaccharomyces pombe, the stress-activated Sty1 MAPK pathway is essential for cell survival under stress conditions. The Sty1 MAPK regulates Atf1 transcription factor to elicit stress responses in extreme conditions of osmolarity and reactive oxygen species-generating agents such as hydrogen peroxide, heat, low glucose, and heavy metal. Herein, using a newly developed Renilla luciferase reporter assay with enhanced detection sensitivity and accuracy, we show that distinct signaling pathways respond to cadmium and other reactive oxygen species-generating agents for the activation of Atf1. Also, surprisingly, a measurable activation of Atf1 transcription factor was still observed devoid of Sty1 MAPK activity. Further genetic and biological analyses revealed that the residual activation is caused by the activation of the cell wall integrity Pmk1 MAPK pathway and a redox-mediated activation of Atf1. PMID:22661707

  14. Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.

    PubMed

    Shelton, Dale; Stranne, Maria; Mikkelsen, Lisbeth; Pakseresht, Nima; Welham, Tracey; Hiraka, Hideki; Tabata, Satoshi; Sato, Shusei; Paquette, Suzanne; Wang, Trevor L; Martin, Cathie; Bailey, Paul

    2012-06-01

    Isoflavonoids are a class of phenylpropanoids made by legumes, and consumption of dietary isoflavonoids confers benefits to human health. Our aim is to understand the regulation of isoflavonoid biosynthesis. Many studies have shown the importance of transcription factors in regulating the transcription of one or more genes encoding enzymes in phenylpropanoid metabolism. In this study, we coupled bioinformatics and coexpression analysis to identify candidate genes encoding transcription factors involved in regulating isoflavonoid biosynthesis in Lotus (Lotus japonicus). Genes encoding proteins belonging to 39 of the main transcription factor families were examined by microarray analysis of RNA from leaf tissue that had been elicited with glutathione. Phylogenetic analyses of each transcription factor family were used to identify subgroups of proteins that were specific to L. japonicus or closely related to known regulators of the phenylpropanoid pathway in other species. R2R3MYB subgroup 2 genes showed increased expression after treatment with glutathione. One member of this subgroup, LjMYB14, was constitutively overexpressed in L. japonicus and induced the expression of at least 12 genes that encoded enzymes in the general phenylpropanoid and isoflavonoid pathways. A distinct set of six R2R3MYB subgroup 2-like genes was identified. We suggest that these subgroup 2 sister group proteins and those belonging to the main subgroup 2 have roles in inducing isoflavonoid biosynthesis. The induction of isoflavonoid production in L. japonicus also involves the coordinated down-regulation of competing biosynthetic pathways by changing the expression of other transcription factors. PMID:22529285

  15. Fluctuation of Rac1 activity is associated with the phenotypic and transcriptional heterogeneity of glioma cells.

    PubMed

    Yukinaga, Hiroko; Shionyu, Clara; Hirata, Eishu; Ui-Tei, Kumiko; Nagashima, Takeshi; Kondo, Shinji; Okada-Hatakeyama, Mariko; Naoki, Honda; Matsuda, Michiyuki

    2014-04-15

    Phenotypic heterogeneity of cancer cells is caused not only by genetic and epigenetic alterations but also by stochastic variation of intracellular signaling molecules. Using cells that stably express Förster resonance energy transfer (FRET) biosensors, we show here a correlation between a temporal fluctuation in the activity of Rac1 and the invasive properties of C6 glioma cells. By using long-term time-lapse imaging, we found that Rac1 activity in C6 glioma cells fluctuated over a timescale that was substantially longer than that of the replication cycle. Because the relative level of Rac1 activity in each cell was unaffected by a suspension-adhesion procedure, we were able to sort C6 glioma cells according to the levels of Rac1 activity, yielding Rac1(high) and Rac1(low) cells. The Rac1(high) cells invaded more efficiently than did Rac1(low) cells in a Matrigel invasion assay. We assessed the transcriptional profiles of Rac1(high) and Rac1(low) cells and performed gene ontology analysis. Among the 14 genes that were most associated with the term 'membrane' (membrane-related genes) in Rac1(high) cells, we identified four genes that were associated with glioma invasion and Rac1 activity by using siRNA knockdown experiments. Among the transcription factors upregulated in Rac1(high) cells, Egr2 was found to positively regulate expression of the four membrane-related invasion-associated genes. The identified signaling network might cause the fluctuations in Rac1 activity and the heterogeneity in the invasive capacity of glioma cells. PMID:24522191

  16. An in vitro investigation on the cytotoxic and nuclear receptor transcriptional activity of the mycotoxins fumonisin B1 and beauvericin.

    PubMed

    Fernández-Blanco, Celia; Frizzell, Caroline; Shannon, Maeve; Ruiz, Maria-Jose; Connolly, Lisa

    2016-08-22

    Fumonisin B1 (FB1) and beauvericin (BEA) are secondary metabolites of filamentous fungi, which under appropriate temperature and humidity conditions may develop on various foods and feeds. To date few studies have been performed to evaluate the toxicological and endocrine disrupting effects of FB1 and BEA. The present study makes use of various in vitro bioassays including; oestrogen, androgen, progestagen and glucocorticoid reporter gene assays (RGAs) for the study of nuclear receptor transcriptional activity, the thiazolyl blue tetrazolium bromide (MTT) assay to monitor cytotoxicity and high content analysis (HCA) for the detection of pre-lethal toxicity in the RGA and Caco-2 human colon adenocarcinoma cells. At the receptor level, 0.001-10μM BEA or FB1 did not induce any agonist responses in the RGAs. However at non-cytotoxic concentrations, an antagonistic effect was exhibited by FB1 on the androgen nuclear receptor transcriptional activity at 10μM and BEA on the progestagen and glucocorticoid receptors at 1μM. MTT analysis showed no decrease in cell viability at any concentration of FB1, whereas BEA showed a significant decrease in viability at 10μM. HCA analysis confirmed that the reduction in the progestagen receptor transcriptional activity at 1μM BEA was not due to pre-lethal toxicity. In addition, BEA (10μM) induced significant toxicity in both the TM-Luc (progestagen responsive) and Caco-2 cells. PMID:27234500

  17. Transcriptional activation of Brassica napus β-ketoacyl-ACP synthase II with an engineered zinc finger protein transcription factor.

    PubMed

    Gupta, Manju; DeKelver, Russell C; Palta, Asha; Clifford, Carla; Gopalan, Sunita; Miller, Jeffrey C; Novak, Stephen; Desloover, Daniel; Gachotte, Daniel; Connell, James; Flook, Josh; Patterson, Thomas; Robbins, Kelly; Rebar, Edward J; Gregory, Philip D; Urnov, Fyodor D; Petolino, Joseph F

    2012-09-01

    Targeted gene regulation via designed transcription factors has great potential for precise phenotypic modification and acceleration of novel crop trait development. Canola seed oil composition is dictated largely by the expression of genes encoding enzymes in the fatty acid biosynthetic pathway. In the present study, zinc finger proteins (ZFPs) were designed to bind DNA sequences common to two canola β-ketoacyl-ACP Synthase II (KASII) genes downstream of their transcription start site. Transcriptional activators (ZFP-TFs) were constructed by fusing these ZFP DNA-binding domains to the VP16 transcriptional activation domain. Following transformation using Agrobacterium, transgenic events expressing ZFP-TFs were generated and shown to have elevated KASII transcript levels in the leaves of transgenic T(0) plants when compared to 'selectable marker only' controls as well as of T(1) progeny plants when compared to null segregants. In addition, leaves of ZFP-TF-expressing T(1) plants contained statistically significant decreases in palmitic acid (consistent with increased KASII activity) and increased total C18. Similarly, T(2) seed displayed statistically significant decreases in palmitic acid, increased total C18 and reduced total saturated fatty acid contents. These results demonstrate that designed ZFP-TFs can be used to regulate the expression of endogenous genes to elicit specific phenotypic modifications of agronomically relevant traits in a crop species. PMID:22520333

  18. High-Content Positional Biosensor Screening Assay for Compounds to Prevent or Disrupt Androgen Receptor and Transcriptional Intermediary Factor 2 Protein–Protein Interactions

    PubMed Central

    Hua, Yun; Shun, Tong Ying; Strock, Christopher J.

    2014-01-01

    Abstract The androgen receptor–transcriptional intermediary factor 2 (AR-TIF2) positional protein–protein interaction (PPI) biosensor assay described herein combines physiologically relevant cell-based assays with the specificity of binding assays by incorporating structural information of AR and TIF2 functional domains along with intracellular targeting sequences and fluorescent reporters. Expression of the AR-red fluorescent protein (RFP) “prey” and TIF2-green fluorescent protein (GFP) “bait” components of the biosensor was directed by recombinant adenovirus constructs that expressed the ligand binding and activation function 2 surface domains of AR fused to RFP with nuclear localization and nuclear export sequences, and three α-helical LXXLL motifs from TIF2 fused to GFP and an HIV Rev nucleolar targeting sequence. In unstimulated cells, AR-RFP was localized predominantly to the cytoplasm and TIF2-GFP was localized to nucleoli. Dihydrotestosterone (DHT) treatment induced AR-RFP translocation into the nucleus where the PPIs between AR and TIF2 resulted in the colocalization of both biosensors within the nucleolus. We adapted the translocation enhanced image analysis module to quantify the colocalization of the AR-RFP and TIF2-GFP biosensors in images acquired on the ImageXpress platform. DHT induced a concentration-dependent AR-TIF2 colocalization and produced a characteristic condensed punctate AR-RFP PPI nucleolar distribution pattern. The heat-shock protein 90 inhibitor 17-N-allylamino-17-demethoxygeldanamycin (17-AAG) and antiandrogens flutamide and bicalutamide inhibited DHT-induced AR-TIF2 PPI formation with 50% inhibition concentrations (IC50s) of 88.5±12.5 nM, 7.6±2.4 μM, and 1.6±0.4 μM, respectively. Images of the AR-RFP distribution phenotype allowed us to distinguish between 17-AAG and flutamide, which prevented AR translocation, and bicalutamide, which blocked AR-TIF2 PPIs. We screened the Library of Pharmacologically Active

  19. Small Ubiquitin-like Modifier (SUMO) Modification Inhibits GLI2 Protein Transcriptional Activity in Vitro and in Vivo*♦

    PubMed Central

    Han, Lizhang; Pan, Yong; Wang, Baolin

    2012-01-01

    The Gli transcription factors are key downstream mediators of the Hedgehog (Hh) signaling pathway. How the activities of Gli transcription factors are regulated by upstream Hh signaling events and protein modifications are not fully understood. Here we show that GLI2 is conjugated by small ubiquitin-like modifier (SUMO) at lysine residues 630 and 716 in the cell. The level of GLI2 sumoylation is reduced by either mutations in six serine residues that are normally phosphorylated by protein kinase A (PKA) or stimulation by HH. This suggests that PKA phosphorylation enhances GLI2 sumoylation, whereas HH signaling inhibits it. In addition, mutation of these two lysines into arginine residues significantly increases GLI2 transcriptional activity in a cell-based reporter assay. The same mutations in the GLI2 locus also result in an increase in GLI2 activity in the mouse. Interestingly, GLI2 can interact with HDAC5 (histone deacetylase 5), but the GLI2 mutant cannot. Taken together, our results suggest that SUMO modification inhibits GLI2 transcriptional activity by recruiting HDAC5. PMID:22549777

  20. E proteins are required to activate germline transcription of the TCR Vbeta8.2 gene.

    PubMed

    Jia, Jingquan; Dai, Meifang; Zhuang, Yuan

    2008-10-01

    Each TCR Vbeta gene is regulated by an individual Vbeta promoter, which becomes active prior to V(D) J recombination and drives germline transcription. It has been shown that Vbeta gene locus activation and recombination are dependent on the Vbeta promoter. However, transcription factors that regulate Vbeta germline transcription remain largely undefined. A major challenge in studying Vbeta gene germline transcription is the quantitative assessment of relatively low-level transcripts in T-cell progenitors. Here we used the established Vbeta8.2(CD2) knock-in mouse model to assess functions of E-protein transcription factors in Vbeta8.2 germline transcription. We show that E proteins are required for the activation but not the maintenance of the Vbeta8.2 germline transcription during thymocyte development. The activation of Vbeta8.2 germline transcription depends more on the E proteins encoded by the E2A gene than by the HEB gene. We further show that IL-7 receptor (IL-7R)-mediated signals are essential for Vbeta8.2 germline transcription. We provide evidence that IL-7R expression is only partially controlled by E2A, suggesting a role for E2A in driving Vbeta8.2 germline transcription independent of IL-7R activation. PMID:18958875

  1. Erythroid Krüppel-like factor (EKLF) contains a multifunctional transcriptional activation domain important for inter- and intramolecular interactions.

    PubMed Central

    Chen, X; Bieker, J J

    1996-01-01

    Erythroid Krüppel-like factor (EKLF) is a red cell-restricted transcriptional activator that plays a dominant role in establishing high levels of beta-globin gene expression during erythroid ontogeny. Although its DNA binding domain belongs to the well-studied class of Krüppel-like zinc fingers, its proline-rich activation region has not been thoroughly examined. We have analyzed this region by monitoring the functional effects of its mutagenesis upon EKLF activity in vivo and in vitro. First, using co-transfection assays, we find that the transactivation region contains discrete stimulatory and inhibitory subdomains. Second, in vitro binding assays indicate that the inhibitory domain exerts its effect in cis by interfering with DNA binding. Third, in vivo competition assays demonstrate that EKLF interacts with a positive-acting cellular factor, and that the domain responsible for this trans interaction lies within a 40 amino acid sequence that is coincident with the EKLF minimal transactivation domain. Finally, site-directed mutagenesis of this domain implies that conformation and/or phosphorylation status of its central core may be critical for such interactions. These results point towards post-translational steric and/or allosteric control of EKLF function that may be important not just for its DNA binding ability, but also for its potential to interact with other proteins that fully establish the correct stereospecific array leading to efficient switching of beta-globin transcription during development. Images PMID:8918466

  2. [Development of a Real-Time Reverse Transcription PCR Assay System for Detection of Three Subtypes of Influenza A and Influenza B Viruses].

    PubMed

    Yanagita, Mitsutoshi; Kuwamura, Yoshitaka; Kinoshita, Satoru; Nakajima, Takashi; Tomizawa, Syuichi; Ozawa, Tetsuo

    2015-12-01

    We developed the initial real-time reverse transcription PCR assay system for seasonal influenza viruses in 2011. This prototype assay system could detect and identify specific influenza A virus subtypes[H1N1, H3N2 and (H1N1) pdm09] and influenza B virus. In the 2012-2013 season, our prototype PCR assay didn't work well because of point mutations occurred in the neuraminidase (NA) gene of the A (H3N2) strain. We improved the prototype assay by changing the target gene for A (H3N2) strain (2013 improved PCR assay). Moreover, we added the measurement system for the matrix (M) gene that was well conserved and common to all influenza A subtypes. In the 2013-2014 season, point mutations in the hemagglutinin (HA) gene of the A (H1N1) pdm09 strain lowered the sensitivity of the 2013 improved PCR assay, so that we changed the target gene for A (H1N1)pdm09 strain (2014 improved PCR assay). We analyzed swab samples from 1,721 patients in total by at least one of the three PCR assays we developed, and demonstrated that the PCR assays had excellent sensitivity and specificity compared with those of the commercially available rapid immunochromatography kit we used. In this study, the M gene was positive in all patients who were finally diagnosed as influenza A positive by 2013 or 2014 improved PCR assay. Therefore, measurement of the M gene, which is hardly to be affected by antigenic drift of influenza viruses, is thought to be useful in clinical practice. PMID:27089652

  3. Molecular Dynamics of "Fuzzy" Transcriptional Activator-Coactivator Interactions.

    PubMed

    Scholes, Natalie S; Weinzierl, Robert O J

    2016-05-01

    Transcriptional activation domains (ADs) are generally thought to be intrinsically unstructured, but capable of adopting limited secondary structure upon interaction with a coactivator surface. The indeterminate nature of this interface made it hitherto difficult to study structure/function relationships of such contacts. Here we used atomistic accelerated molecular dynamics (aMD) simulations to study the conformational changes of the GCN4 AD and variants thereof, either free in solution, or bound to the GAL11 coactivator surface. We show that the AD-coactivator interactions are highly dynamic while obeying distinct rules. The data provide insights into the constant and variable aspects of orientation of ADs relative to the coactivator, changes in secondary structure and energetic contributions stabilizing the various conformers at different time points. We also demonstrate that a prediction of α-helical propensity correlates directly with the experimentally measured transactivation potential of a large set of mutagenized ADs. The link between α-helical propensity and the stimulatory activity of ADs has fundamental practical and theoretical implications concerning the recruitment of ADs to coactivators. PMID:27175900

  4. Role of hippocampal activity-induced transcription in memory consolidation.

    PubMed

    Eagle, Andrew L; Gajewski, Paula A; Robison, Alfred J

    2016-08-01

    Experience-dependent changes in the strength of connections between neurons in the hippocampus (HPC) are critical for normal learning and memory consolidation, and disruption of this process drives a variety of neurological and psychiatric diseases. Proper HPC function relies upon discrete changes in gene expression driven by transcription factors (TFs) induced by neuronal activity. Here, we describe the induction and function of many of the most well-studied HPC TFs, including cyclic-AMP response element binding protein, serum-response factor, AP-1, and others, and describe their role in the learning process. We also discuss the known target genes of many of these TFs and the purported mechanisms by which they regulate long-term changes in HPC synaptic strength. Moreover, we propose that future research in this field will depend upon unbiased identification of additional gene targets for these activity-dependent TFs and subsequent meta-analyses that identify common genes or pathways regulated by multiple TFs in the HPC during learning or disease. PMID:27180338

  5. Molecular Dynamics of "Fuzzy" Transcriptional Activator-Coactivator Interactions

    PubMed Central

    Scholes, Natalie S.; Weinzierl, Robert O. J.

    2016-01-01

    Transcriptional activation domains (ADs) are generally thought to be intrinsically unstructured, but capable of adopting limited secondary structure upon interaction with a coactivator surface. The indeterminate nature of this interface made it hitherto difficult to study structure/function relationships of such contacts. Here we used atomistic accelerated molecular dynamics (aMD) simulations to study the conformational changes of the GCN4 AD and variants thereof, either free in solution, or bound to the GAL11 coactivator surface. We show that the AD-coactivator interactions are highly dynamic while obeying distinct rules. The data provide insights into the constant and variable aspects of orientation of ADs relative to the coactivator, changes in secondary structure and energetic contributions stabilizing the various conformers at different time points. We also demonstrate that a prediction of α-helical propensity correlates directly with the experimentally measured transactivation potential of a large set of mutagenized ADs. The link between α-helical propensity and the stimulatory activity of ADs has fundamental practical and theoretical implications concerning the recruitment of ADs to coactivators. PMID:27175900

  6. A discrete element 3' of human immunodeficiency virus 1 (HIV-1) and HIV-2 mRNA initiation sites mediates transcriptional activation by an HIV trans activator

    SciTech Connect

    Jakobovits, A.; Smith, D.H.; Jakobovits, E.B.; Capon, D.J.

    1988-06-01

    An important point of regulation in the reproductive growth and latency of the human and simian immunodeficiency viruses (HIV and SIV, respectively) is provided by virally encoded trans-activators (tat), proteins capable of dramatically increasing viral gene expression. The mechanism of this autostimulatory pathway has remained unclear, however, with substantial effects having been reported at the level of either mRNA accumulation, translational efficiency, or both. The authors' previous findings indicated that trans-activation results primarily from induction of RNA levels but could not distinguish between the roles of transcriptional rate, RNA stabilization, and RNA transport in this event. In addition, the boundaries of tat-responding elements, which would be valuable in elucidating the mode of tat action, are not precisely known. In this study, HIV-1 and HIV-2 long terminal repeat-directed expression was characterized by using in an vitro nuclear transcription assay to clarify this mechanism, and a detailed mutational analysis was undertaken to localize precisely the sequences participating in this process. Two key findings were revealed: an increased transcription rate was the primary event in tat-mediated activation of HIV-1 and HIV-2, and trans-activation was impaired by mutations in two regions, the TATA box and sequences between +19 to +42, a region lacking enhancer activity. These results implicate a discrete 3' regulatory element in the transcriptional activation of the HIVs.

  7. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity

    PubMed Central

    Ahmed, Afsar U.; Williams, Bryan R. G.; Hannigan, Gregory E.

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  8. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.

    PubMed

    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  9. A novel high-throughput activity assay for the Trypanosoma brucei editosome enzyme REL1 and other RNA ligases

    PubMed Central

    Zimmermann, Stephan; Hall, Laurence; Riley, Sean; Sørensen, Jesper; Amaro, Rommie E.; Schnaufer, Achim

    2016-01-01

    The protist parasite Trypanosoma brucei causes Human African trypanosomiasis (HAT), which threatens millions of people in sub-Saharan Africa. Without treatment the infection is almost always lethal. Current drugs for HAT are difficult to administer and have severe side effects. Together with increasing drug resistance this results in urgent need for new treatments. T. brucei and other trypanosomatid pathogens require a distinct form of post-transcriptional mRNA modification for mitochondrial gene expression. A multi-protein complex called the editosome cleaves mitochondrial mRNA, inserts or deletes uridine nucleotides at specific positions and re-ligates the mRNA. RNA editing ligase 1 (REL1) is essential for the re-ligation step and has no close homolog in the mammalian host, making it a promising target for drug discovery. However, traditional assays for RELs use radioactive substrates coupled with gel analysis and are not suitable for high-throughput screening of compound libraries. Here we describe a fluorescence-based REL activity assay. This assay is compatible with a 384-well microplate format and sensitive, satisfies statistical criteria for high-throughput methods and is readily adaptable for other polynucleotide ligases. We validated the assay by determining kinetic properties of REL1 and by identifying REL1 inhibitors in a library of small, pharmacologically active compounds. PMID:26400159

  10. Cell cycle-dependent regulation of RNA polymerase II basal transcription activity.

    PubMed Central

    Yonaha, M; Chibazakura, T; Kitajima, S; Yasukochi, Y

    1995-01-01

    Regulation of transcription by RNA polymerase II (pol II) in eukaryotic cells requires both basal and regulatory transcription factors. In this report we have investigated in vitro pol II basal transcription activity during the cell cycle by using nuclear extracts from synchronized HeLa cells. It is shown that pol II basal transcription activity is low in the S and G2 phases and high in early G1 phase and TFIID is the rate limiting component of pol II basal transcription activity during the cell cycle. Further analyses reveal that TFIID exists as a less active form in the S and G2 phases and nuclear extracts from S and G2 phase cells contain a heat-sensitive repressor(s) of TATA box binding protein (TBP). These results suggest that pol II basal transcription activity is regulated by a qualitative change in the TFIID complex, which could involve repression of TBP, during the cell cycle. Images PMID:7479063

  11. Arginase activity in mitochondria - An interfering factor in nitric oxide synthase activity assays

    SciTech Connect

    Venkatakrishnan, Priya; Nakayasu, Ernesto S.; Almeida, Igor C.; Miller, R.T.

    2010-04-09

    Previously, in tightly controlled studies, using three independent, yet complementary techniques, we refuted the claim that a mitochondrial nitric oxide synthase (mtNOS) isoform exists within pure, rat liver mitochondria (MT). Of those techniques, the NOS-catalyzed [{sup 14}C]-L-arginine to [{sup 14}C]-L-citrulline conversion assay (NOS assay) with MT samples indicated a weak, radioactive signal that was NOS-independent . Aliquots of samples from the NOS assays were then extracted with acetone, separated by high performance thin-layer chromatography (HPTLC) and exposed to autoradiography. Results obtained from these samples showed no radioactive band for L-citrulline. However, a fast-migrating, diffuse, radioactive band was observed in the TLC lanes loaded with MT samples. In this manuscript, we identify and confirm that this radioactive signal in MT samples is due to the arginase-catalyzed conversion of [{sup 14}C]-L-arginine to [{sup 14}C]-urea. The current results, in addition to reconfirming the absence of NOS activity in rat liver MT, also show the need to include arginase inhibitors in studies using MT samples in order to avoid confounding results when using NOS activity assays.

  12. Constitutively Active FOXO1 Diminishes Activin Induction of Fshb Transcription in Immortalized Gonadotropes

    PubMed Central

    Park, Chung Hyun; Skarra, Danalea V.; Rivera, Alissa J.; Arriola, David J.; Thackray, Varykina G.

    2014-01-01

    In the present study, we investigate whether the FOXO1 transcription factor modulates activin signaling in pituitary gonadotropes. Our studies show that overexpression of constitutively active FOXO1 decreases activin induction of murine Fshb gene expression in immortalized LβT2 cells. We demonstrate that FOXO1 suppression of activin induction maps to the −304/−95 region of the Fshb promoter containing multiple activin response elements and that the suppression requires the FOXO1 DNA-binding domain (DBD). FOXO1 binds weakly to the −125/−91 region of the Fshb promoter in a gel-shift assay. Since this region of the promoter contains a composite SMAD/FOXL2 binding element necessary for activin induction of Fshb transcription, it is possible that FOXO1 DNA binding interferes with SMAD and/or FOXL2 function. In addition, our studies demonstrate that FOXO1 directly interacts with SMAD3/4 but not SMAD2 in a FOXO1 DBD-dependent manner. Moreover, we show that SMAD3/4 induction of Fshb-luc and activin induction of a multimerized SMAD-binding element-luc are suppressed by FOXO1 in a DBD-dependent manner. These results suggest that FOXO1 binding to the proximal Fshb promoter as well as FOXO1 interaction with SMAD3/4 proteins may result in decreased activin induction of Fshb in gonadotropes. PMID:25423188

  13. O-GlcNAc-glycosylation of {beta}-catenin regulates its nuclear localization and transcriptional activity

    SciTech Connect

    Sayat, Ria; Leber, Brian; Grubac, Vanja; Wiltshire, Lesley; Persad, Sujata

    2008-09-10

    {beta}-catenin plays a role in intracellular adhesion and regulating gene expression. The latter role is associated with its oncogenic properties. Phosphorylation of {beta}-catenin controls its intracellular expression but mechanism/s that regulates the nuclear localization of {beta}-catenin is unknown. We demonstrate that O-GlcNAc glycosylation (O-GlcNAcylation) of {beta}-catenin negatively regulates its levels in the nucleus. We show that normal prostate cells (PNT1A) have significantly higher amounts of O-GlcNAcylated {beta}-catenin compared to prostate cancer (CaP) cells. The total nuclear levels of {beta}-catenin are higher in the CaP cells than PNT1A but only a minimal fraction of the nuclear {beta}-catenin in the CaP cells are O-GlcNAcylated. Increasing the levels of O-GlcNAcylated {beta}-catenin in the CaP cells with PUGNAc (O- (2-acetamido-2-deoxy-D-gluco-pyranosylidene) amino-N-phenylcarbamate) treatment is associated with a progressive decrease in the levels of {beta}-catenin in the nucleus. TOPFlash reporter assay and mRNA expressions of {beta}-catenin's target genes indicate that O-GlcNAcylation of {beta}-catenin results in a decrease in its transcriptional activity. We define a novel modification of {beta}-catenin that regulates its nuclear localization and transcriptional function.

  14. Using constitutive activity to define appropriate high-throughput screening assays for orphan g protein-coupled receptors.

    PubMed

    Ngo, Tony; Coleman, James L J; Smith, Nicola J

    2015-01-01

    Orphan G protein-coupled receptors represent an underexploited resource for drug discovery but pose a considerable challenge for assay development because their cognate G protein signaling pathways are often unknown. In this methodological chapter, we describe the use of constitutive activity, that is, the inherent ability of receptors to couple to their cognate G proteins in the absence of ligand, to inform the development of high-throughput screening assays for a particular orphan receptor. We specifically focus on a two-step process, whereby constitutive G protein coupling is first determined using yeast Gpa1/human G protein chimeras linked to growth and β-galactosidase generation. Coupling selectivity is then confirmed in mammalian cells expressing endogenous G proteins and driving accumulation of transcription factor-fused luciferase reporters specific to each of the classes of G protein. Based on these findings, high-throughput screening campaigns can be performed on the already miniaturized mammalian reporter system. PMID:25563179

  15. Bisphenol AF-induced endogenous transcription is mediated by ERα and ERK1/2 activation in human breast cancer cells.

    PubMed

    Li, Ming; Guo, Jing; Gao, Wenhui; Yu, Jianlong; Han, Xiaoyu; Zhang, Jing; Shao, Bing

    2014-01-01

    Bisphenol AF (BPAF)-induced transcriptional activity has been evaluated by luciferase reporter assay. However, the molecular mechanism of BPAF-induced endogenous transcription in human breast cancer cells has not been fully elucidated. In the present study, we investigated the effect and mechanism of BPAF-induced endogenous transcription detected by real-time PCR in human breast cancer cells. We found that BPAF stimulated transcription of estrogen responsive genes, such as trefoil factor 1 (TFF1), growth regulation by estrogen in breast cancer 1 (GREB1) and cathepsin D (CTSD), through dose-dependent and time-dependent manners in T47D and MCF7 cells. Gene-silencing of ERα, ERβ and G protein-coupled estrogen receptor 1 (GPER) by small interfering RNA revealed that BPAF-induced endogenous transcription was dependent on ERα and GPER, implying both genomic and nongenomic pathways might be involved in the endogenous transcription induced by BPAF. ERα-mediated gene transcription was further confirmed by inhibition of ER activity using ICI 182780 in ERα-positive T47D and MCF7 cells as well as overexpression of ERα in ERα-negative MDA-MB-231 breast cancer cells. Moreover, we utilized Src tyrosine kinase inhibitor PP2 and two MEK inhibitors PD98059 and U0126 to elucidate the rapid nongenomic activation of Src/MEK/ERK1/2 cascade on endogenous transcription. Our data showed that BPAF-induced transcription could be significantly blocked by PP2, PD98059 and U0126, suggesting activation of ERK1/2 was also required to regulate endogenous transcription. Taken together, these results indicate that BPAF-induced endogenous transcription of estrogen responsive genes is mediated through both genomic and nongenomic pathways involving the ERα and ERK1/2 activation in human breast cancer cells. PMID:24727858

  16. Bisphenol AF-Induced Endogenous Transcription Is Mediated by ERα and ERK1/2 Activation in Human Breast Cancer Cells

    PubMed Central

    Li, Ming; Guo, Jing; Gao, Wenhui; Yu, Jianlong; Han, Xiaoyu; Zhang, Jing; Shao, Bing

    2014-01-01

    Bisphenol AF (BPAF)-induced transcriptional activity has been evaluated by luciferase reporter assay. However, the molecular mechanism of BPAF-induced endogenous transcription in human breast cancer cells has not been fully elucidated. In the present study, we investigated the effect and mechanism of BPAF-induced endogenous transcription detected by real-time PCR in human breast cancer cells. We found that BPAF stimulated transcription of estrogen responsive genes, such as trefoil factor 1 (TFF1), growth regulation by estrogen in breast cancer 1 (GREB1) and cathepsin D (CTSD), through dose-dependent and time-dependent manners in T47D and MCF7 cells. Gene-silencing of ERα, ERβ and G protein-coupled estrogen receptor 1 (GPER) by small interfering RNA revealed that BPAF-induced endogenous transcription was dependent on ERα and GPER, implying both genomic and nongenomic pathways might be involved in the endogenous transcription induced by BPAF. ERα-mediated gene transcription was further confirmed by inhibition of ER activity using ICI 182780 in ERα-positive T47D and MCF7 cells as well as overexpression of ERα in ERα-negative MDA-MB-231 breast cancer cells. Moreover, we utilized Src tyrosine kinase inhibitor PP2 and two MEK inhibitors PD98059 and U0126 to elucidate the rapid nongenomic activation of Src/MEK/ERK1/2 cascade on endogenous transcription. Our data showed that BPAF-induced transcription could be significantly blocked by PP2, PD98059 and U0126, suggesting activation of ERK1/2 was also required to regulate endogenous transcription. Taken together, these results indicate that BPAF-induced endogenous transcription of estrogen responsive genes is mediated through both genomic and nongenomic pathways involving the ERα and ERK1/2 activation in human breast cancer cells. PMID:24727858

  17. Assays to Measure PTEN Lipid Phosphatase Activity In Vitro from Purified Enzyme or Immunoprecipitates.

    PubMed

    Spinelli, Laura; Leslie, Nicholas R

    2016-01-01

    PTEN is a one of the most frequently mutated tumor suppressors in human cancers. It is essential for regulating diverse biological processes and through its lipid phosphatase activity regulates the PI 3-Kinase signaling pathway. Sensitive phosphatase assays are employed to study the catalytic activity of PTEN against phospholipid substrates. Here we describe protocols to assay PTEN lipid phosphatase activity using either purified enzyme (purified PTEN lipid phosphatase assay) or PTEN immunopurified from tissues or cultured cells (cellular IP PTEN lipid phosphatase assay) against vesicles containing radiolabeled PIP3 substrate. PMID:27514802

  18. ATF4 (activating transcription factor 4) from grass carp (Ctenopharyngodon idella) modulates the transcription initiation of GRP78 and GRP94 in CIK cells.

    PubMed

    Fan, Qidi; Mao, Huiling; Wu, Chuxin; Liu, Yong; Hu, Yousheng; Zhong, Bin; Mi, Yichuan; Hu, Chengyu

    2014-05-01

    GRP78 and GRP94, belong to GRP (glucose-regulated protein) family of endoplasmatic reticulum (ER) chaperone superfamily, are essential for cell survival under ER stress. ATF4 is a protective protein which regulates the adaptation of cells to ER stress by modulating the transcription of UPR (Unfolded Protein Response) target genes, including GRP78 and GRP94. To understand the molecular mechanism of ATF4 modulates the transcription initiation of CiGRP78 and CiGRP94, we cloned ATF4 ORF cDNA sequences (CiATF4) by homologous cloning techniques. The expression trend of CiATF4 was similar to CiGRP78 and CiGRP94 did under 37 °C thermal stress, namely, the expression of CiATF4 was up-regulated twice at 2 h post-thermal stress and at 18 h post recovery from thermal stress. In this paper, CiATF4 was expressed in BL21 Escherichia coli, and the expressed protein was purified by affinity chromatography with the Ni-NTA His-Bind Resin. On the basis of the cloned CiGRP78 and CiGRP94 cDNA in our laboratory previously, we cloned their promoter sequences by genomic walking approach. In vitro, gel mobility shift assays revealed that CiATF4 could bind to CiGRP78 and CiGRP94 promoter with high affinity. Subsequently, the recombinant plasmid of pGL3-CiGRPs and pcDNA3.1-CiATF4 were constructed and transiently co-transfected into Ctenopharyngodon idella kidney (CIK) cells. The impact of CiATF4 on CiGRP promoter sequences were measured by luciferase assays. These results demonstrated that CiATF4 could activate the transcription of CiGRP78 and CiGRP94. What's more, for better understanding the molecular mechanism of CiATF4 modulate the transcription initiation of CiGRP, three mutant fragments of CiGRP78 promoter recombinant plasmids (called CARE-mut/LUC, CRE1-mut/LUC and CRE2-mut/LUC) were constructed and transiently co-transfected with CiATF4 into CIK cells. The results indicated that CRE or CARE elements were the regulatory element for transcription initiation of CiGRP78. Between them, CRE

  19. A minimally invasive assay for individual assessment of the ATM/CHEK2/p53 pathway activity

    PubMed Central

    Kabacik, Sylwia; Ortega-Molina, Ana; Efeyan, Alejo; Finnon, Paul; Bouffler, Simon; Serrano, Manuel

    2011-01-01

    Ionizing radiation induces DNA Double-Strand Breaks (DSBs), which activate the ATM/CHEK2/p53 pathway leading to cell cycle arrest and apoptosis through transcription of genes including CDKN1A (p21) and BBC3 (PUMA). This pathway prevents genomic instability and tumorigenesis as demonstrated in heritable syndromes [e.g., Ataxia Telangiectasia (AT); Li-Fraumeni syndrome (LFS)]. Here, a simple assay based on gene expression in peripheral blood to measure accurately ATM/CHEK2/p53 pathway activity is described. The expression of p21, Puma and Sesn2 was determined in blood from mice with different gene copy numbers of Atm, Trp53 (p53), Chek2 or Arf and in human blood and mitogen stimulated T-lymphocyte (MSTL) cultures from AT, AT carriers, LFS patients and controls, both before and after ex vivo ionizing irradiation. Mouse Atm/Chek2/p53 activity was highly dependent on the copy number of each gene except Arf. In human MSTL, an AT case, AT carriers and LFS patients showed responses distinct from healthy donors. The relationship between gene copy number and transcriptional induction upon radiation was linear for p21 and Puma and correlated well with cancer incidence in p53 variant mice. This reliable blood test provides an assay to determine ATM/CHEK2/p53 pathway activity and demonstrates the feasibility of assessing the activity of this essential cancer protection pathway in simple assays. These findings may have implications for the individualized prediction of cancer susceptibility. PMID:21389785

  20. Detection of leucine-independent DNA site occupancy of the yeast Leu3p transcriptional activator in vivo.

    PubMed Central

    Kirkpatrick, C R; Schimmel, P

    1995-01-01

    The product of the Saccharomyces cerevisiae LEU3 gene, Leu3p, is a transcriptional activator which regulates leucine biosynthesis in response to intracellular levels of leucine through the biosynthetic intermediate alpha-isopropylmalate. We devised a novel assay to examine the DNA site occupancy of Leu3p under different growth conditions, using a reporter gene with internal Leu3p-binding sites. Expression of the reporter is inhibited by binding of nuclear Leu3p to these sites; inhibition is dependent on the presence of the sites in the reporter, on the integrity of the Leu3p DNA-binding domain, and, surprisingly, on the presence of a transcriptional activation domain in the inhibiting protein. By this assay, Leu3p was found to occupy its binding site under all conditions tested, including high and low levels of leucine and in the presence and absence of alpha-isopropylmalate. The localization of Leu3p to the nucleus was confirmed by immunofluorescence staining of cells expressing epitope-tagged Leu3p derivatives. We conclude that Leu3p regulates transcription in vivo without changing its intracellular localization and DNA site occupancy. PMID:7623798

  1. Genetic Variants in the STMN1 Transcriptional Regulatory Region Affect Promoter Activity and Fear Behavior in English Springer Spaniels

    PubMed Central

    Zhang, Hanying; Xu, Yinxue

    2016-01-01

    Stathmin 1 (STMN1) is a neuronal growth-associated protein that is involved in microtubule dynamics and plays an important role in synaptic outgrowth and plasticity. Given that STMN1 affects fear behavior, we hypothesized that genetic variations in the STMN1 transcriptional regulatory region affect gene transcription activity and control fear behavior. In this study, two single nucleotide polymorphisms (SNPs), g. -327 A>G and g. -125 C>T, were identified in 317 English Springer Spaniels. A bioinformatics analysis revealed that both were loci located in the canine STMN1 putative promoter region and affected transcription factor binding. A statistical analysis revealed that the TT genotype at g.-125 C>T produced a significantly greater fear level than that of the CC genotype (P < 0.05). Furthermore, the H4H4 (GTGT) haplotype combination was significantly associated with canine fear behavior (P < 0.01). Using serially truncated constructs of the STMN1 promoters and the luciferase reporter, we found that a 395 bp (−312 nt to +83 nt) fragment constituted the core promoter region. The luciferase assay also revealed that the H4 (GT) haplotype promoter had higher activity than that of other haplotypes. Overall, our results suggest that the two SNPs in the canine STMN1 promoter region could affect canine fear behavior by altering STMN1 transcriptional activity. PMID:27390866

  2. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2016-01-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  3. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase.

    PubMed

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2014-09-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5'- and 3'-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  4. Environmental Detection of Genogroup I, II, and IV Noroviruses by Using a Generic Real-Time Reverse Transcription-PCR Assay

    PubMed Central

    Miura, Takayuki; Parnaudeau, Sylvain; Grodzki, Marco; Okabe, Satoshi; Atmar, Robert L.

    2013-01-01

    Norovirus is the most common agent implicated in food-borne outbreaks and is frequently detected in environmental samples. These viruses are highly diverse, and three genogroups (genogroup I [GI], GII, and GIV) infect humans. Being noncultivable viruses, real-time reverse transcription-PCR (RT-PCR) is the only sensitive method available for their detection in food or environmental samples. Selection of consensus sequences for the design of sensitive assays has been challenging due to sequence diversity and has led to the development of specific real-time RT-PCR assays for each genogroup. Thus, sample screening can require several replicates for amplification of each genogroup (without considering positive and negative controls or standard curves). This study reports the development of a generic assay that detects all three human norovirus genogroups on a qualitative basis using a one-step real-time RT-PCR assay. The generic assay achieved good specificity and sensitivity for all three genogroups, detected separately or in combination. At variance with multiplex assays, the choice of the same fluorescent dye for all three probes specific to each genogroup allows the levels of fluorescence to be added and may increase assay sensitivity when multiple strains from different genogroups are present. When it was applied to sewage sample extracts, this generic assay successfully detected norovirus in all samples found to be positive by the genogroup-specific RT-PCRs. The generic assay also identified all norovirus-positive samples among 157 archived nucleic acid shellfish extracts, including samples contaminated by all three genogroups. PMID:23956397

  5. Environmental detection of genogroup I, II, and IV noroviruses by using a generic real-time reverse transcription-PCR assay.

    PubMed

    Miura, Takayuki; Parnaudeau, Sylvain; Grodzki, Marco; Okabe, Satoshi; Atmar, Robert L; Le Guyader, Françoise S

    2013-11-01

    Norovirus is the most common agent implicated in food-borne outbreaks and is frequently detected in environmental samples. These viruses are highly diverse, and three genogroups (genogroup I [GI], GII, and GIV) infect humans. Being noncultivable viruses, real-time reverse transcription-PCR (RT-PCR) is the only sensitive method available for their detection in food or environmental samples. Selection of consensus sequences for the design of sensitive assays has been challenging due to sequence diversity and has led to the development of specific real-time RT-PCR assays for each genogroup. Thus, sample screening can require several replicates for amplification of each genogroup (without considering positive and negative controls or standard curves). This study reports the development of a generic assay that detects all three human norovirus genogroups on a qualitative basis using a one-step real-time RT-PCR assay. The generic assay achieved good specificity and sensitivity for all three genogroups, detected separately or in combination. At variance with multiplex assays, the choice of the same fluorescent dye for all three probes specific to each genogroup allows the levels of fluorescence to be added and may increase assay sensitivity when multiple strains from different genogroups are present. When it was applied to sewage sample extracts, this generic assay successfully detected norovirus in all samples found to be positive by the genogroup-specific RT-PCRs. The generic assay also identified all norovirus-positive samples among 157 archived nucleic acid shellfish extracts, including samples contaminated by all three genogroups. PMID:23956397

  6. Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone modifications or chromatin accessibility

    SciTech Connect

    Dogan, Nergiz; Wu, Weisheng; Morrissey, Christapher S.; Chen, Kuan-Bei; Stonestrom, Aaron; Long, Maria; Keller, Cheryl A.; Cheng, Yong; Jain, Deepti; Visel, Axel; Pennacchio, Len A.; Weiss, Mitchell J.; Blobel, Gerd A.; Hardison, Ross C.

    2015-04-23

    Regulated gene expression controls organismal development, and variation in regulatory patterns has been implicated in complex traits. Thus accurate prediction of enhancers is important for further understanding of these processes. Genome-wide measurement of epigenetic features, such as histone modifications and occupancy by transcription factors, is improving enhancer predictions, but the contribution of these features to prediction accuracy is not known. Given the importance of the hematopoietic transcription factor TAL1 for erythroid gene activation, we predicted candidate enhancers based on genomic occupancy by TAL1 and measured their activity. Contributions of multiple features to enhancer prediction were evaluated based on the results of these and other studies. Results: TAL1-bound DNA segments were active enhancers at a high rate both in transient transfections of cultured cells (39 of 79, or 56%) and transgenic mice (43 of 66, or 65%). The level of binding signal for TAL1 or GATA1 did not help distinguish TAL1-bound DNA segments as active versus inactive enhancers, nor did the density of regulation-related histone modifications. A meta-analysis of results from this and other studies (273 tested predicted enhancers) showed that the presence of TAL1, GATA1, EP300, SMAD1, H3K4 methylation, H3K27ac, and CAGE tags at DNase hypersensitive sites gave the most accurate predictors of enhancer activity, with a success rate over 80% and a median threefold increase in activity. Chromatin accessibility assays and the histone modifications H3K4me1 and H3K27ac were sensitive for finding enhancers, but they have high false positive rates unless transcription factor occupancy is also included. Conclusions: Occupancy by key transcription factors such as TAL1, GATA1, SMAD1, and EP300, along with evidence of transcription, improves the accuracy of enhancer predictions based on epigenetic features.

  7. Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone modifications or chromatin accessibility

    DOE PAGESBeta

    Dogan, Nergiz; Wu, Weisheng; Morrissey, Christapher S.; Chen, Kuan-Bei; Stonestrom, Aaron; Long, Maria; Keller, Cheryl A.; Cheng, Yong; Jain, Deepti; Visel, Axel; et al

    2015-04-23

    Regulated gene expression controls organismal development, and variation in regulatory patterns has been implicated in complex traits. Thus accurate prediction of enhancers is important for further understanding of these processes. Genome-wide measurement of epigenetic features, such as histone modifications and occupancy by transcription factors, is improving enhancer predictions, but the contribution of these features to prediction accuracy is not known. Given the importance of the hematopoietic transcription factor TAL1 for erythroid gene activation, we predicted candidate enhancers based on genomic occupancy by TAL1 and measured their activity. Contributions of multiple features to enhancer prediction were evaluated based on the resultsmore » of these and other studies. Results: TAL1-bound DNA segments were active enhancers at a high rate both in transient transfections of cultured cells (39 of 79, or 56%) and transgenic mice (43 of 66, or 65%). The level of binding signal for TAL1 or GATA1 did not help distinguish TAL1-bound DNA segments as active versus inactive enhancers, nor did the density of regulation-related histone modifications. A meta-analysis of results from this and other studies (273 tested predicted enhancers) showed that the presence of TAL1, GATA1, EP300, SMAD1, H3K4 methylation, H3K27ac, and CAGE tags at DNase hypersensitive sites gave the most accurate predictors of enhancer activity, with a success rate over 80% and a median threefold increase in activity. Chromatin accessibility assays and the histone modifications H3K4me1 and H3K27ac were sensitive for finding enhancers, but they have high false positive rates unless transcription factor occupancy is also included. Conclusions: Occupancy by key transcription factors such as TAL1, GATA1, SMAD1, and EP300, along with evidence of transcription, improves the accuracy of enhancer predictions based on epigenetic features.« less

  8. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome

    PubMed Central

    Wood, Lauren W.; Cox, Nicole I.; Phelps, Cody A.; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1+ lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1+ lung cancer cells (designated EDM-TTF-1+) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1+ conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1+ lung adenocarcinomas. PMID:26912193

  9. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome.

    PubMed

    Wood, Lauren W; Cox, Nicole I; Phelps, Cody A; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1(+) lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1(+) lung cancer cells (designated EDM-TTF-1(+)) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1(+) conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1(+) lung adenocarcinomas. PMID:26912193

  10. Direct observation of transcription activator-like effector (TALE) protein dynamics

    NASA Astrophysics Data System (ADS)

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

    2014-03-01

    In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.

  11. Intermedin/adrenomedullin 2 is a stress-inducible gene controlled by activating transcription factor 4.

    PubMed

    Kovaleva, Irina E; Garaeva, Alisa A; Chumakov, Peter M; Evstafieva, Alexandra G

    2016-09-15

    Intermedin or adrenomedullin 2 is a set of calcitonin-related peptides with a putative tumor angiogenesis promoting activity that are formed by proteolytic processing of the ADM2 gene product. It has been proposed that the ADM2 gene is regulated by the estrogen response element (ERE) and hypoxia response elements (HRE) found within its promoter region. In the present study we reveal a functional mechanism by which ADM2 participates in the unfolded protein response (UPR) and in responses to the mitochondrial respiration chain inhibition. We show that the ADM2 gene is controlled by activating transcription factor 4 (ATF4), the principal regulator of the integrated stress response (ISR). The upregulation of ADM2 mRNA could be prevented by the pharmacological ISR inhibitor ISRIB and by the downregulation of ATF4 with specific shRNA, while ectopic expression of ATF4 cDNA resulted in a notable increase in ADM2 gene transcription. A potential ATF4-binding site was identified in the coding region of the ADM2 gene and the requirement of this site during the ATF4-mediated ADM2 gene promoter activation was validated by the luciferase reporter assay. Mutagenesis of the putative ATF4-response element prevented the induction of luciferase activity in response to ATF4 overproduction, as well as in response to mitochondrial electron transfer chain inhibition by piericidin A and ER stress induction by tunicamycin and brefeldin A. Since ADM2 was shown to inhibit ATF4 expression during myocardial ER stress, a feedback mechanism could be proposed for the ADM2 regulation under ER stress conditions. PMID:27328454

  12. Characterization of the human CD4 gene promoter: transcription from the CD4 gene core promoter is tissue-specific and is activated by Ets proteins.

    PubMed Central

    Salmon, P; Giovane, A; Wasylyk, B; Klatzmann, D

    1993-01-01

    We analyzed the 5' transcription control sequences of the human CD4 gene. We located the transcription initiation site and showed that the CD4 core promoter (positions -40 to +16) lacks a classical "TATA" or initiator positioning consensus sequence but directs precise and efficient transcription when coupled to the ubiquitously active simian virus 40 enhancer. The transcriptional activity of the CD4 gene promoter correlated with CD4 expression in various cell types. Interestingly, the CD4 core promoter also displayed a tissue-specific transcriptional activity. Within this fragment, three nucleic acid sequences are completely conserved in the murine CD4 gene. One of these sequences contains a perfect ETS consensus sequence. Another ETS consensus sequence is located 1060 nt upstream. Electrophoretic-mobility-shift assays showed that the core promoter ETS motif binds an Ets-related protein specifically expressed at high levels in CD4+ cells. Moreover, in CD4- cells, overexpression of Ets-1 or Ets-2 efficiently and specifically activated transcription from the CD4 promoter and core promoter. These data indicate that Ets transcription factors play a central role in controlling CD4 gene expression, by binding to both a classical remote site and an unusual proximal activator sequence. Images Fig. 2 Fig. 4 PMID:8356078

  13. The vaccinia virus E8R gene product is required for formation of transcriptionally active virions.

    PubMed

    Kato, Sayuri E M; Condit, Richard C; Moussatché, Nissin

    2007-10-25

    Two vaccinia virus temperature-sensitive mutants were mapped to the E8R gene and subjected to phenotypic characterization. Dts23 contains a missense mutation in the coding region of E8R (L81F), and in Cts19 the initiating methionine codon is changed from ATG to ATA (M1I). The two ts mutants display normal patterns of gene expression and DNA replication during infection. The E8 protein is synthesized exclusively late during infection and packaged into virion cores Western blot analysis revealed that E8 synthesis is reduced in Dts23 infected cells at permissive (31 degrees C) and non-permissive temperature (39.7 degrees C) and absent in Cts19 infection under both conditions. Dts23 virions produced at 39.7 degrees C were indistinguishable in appearance from wt virions. Cts19 fails to produce identifiable viral structures when incubated at 39.7 degrees C. Purified Dts23 virions produced at 39.7 degrees C contain reduced amounts of E8 and have a high particle to infectivity ratio; purified Cts19 virions grown at 31 degrees C also show reduced infectivity and do not contain detectable E8. Dts23 grown at 39.7 degrees C could enter cells but failed to synthesize early mRNA or produce CPE. Soluble extracts from mutant virions were active in a promoter dependent in vitro transcription assay, however intact mutant cores were defective in transcription. We suggest that E8 plays a subtle role in virion core structure that impacts directly or indirectly on core transcription. PMID:17619043

  14. High-throughput screening assays for antibacterial and antifungal activities of Lactobacillus species.

    PubMed

    Inglin, Raffael C; Stevens, Marc J A; Meile, Lukas; Lacroix, Christophe; Meile, Leo

    2015-07-01

    We describe high-throughput screening techniques to rapidly detect either antimicrobial activity, using an agar-well diffusion assay in microtiter plates, or antifungal activity using an agar-spot assay in 24-well plates. 504 Lactobacillus isolates were screened with minimal laboratory equipment and screening rates of 2000-5000 individual antimicrobial interactions. PMID:25937247

  15. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification.

    PubMed

    Hammond, Rosemarie W; Zhang, Shulu

    2016-10-01

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39°C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in infected leaf and seed tissues. The performance of the AmplifyRP(®) Acceler8™ RT-RPA diagnostic assay, utilizing a lateral flow strip contained within an amplicon detection chamber, was evaluated and the results were compared with a standard RT-PCR assay. The AmplifyRP(®) Acceler8™ assay was specific for TCDVd in leaf and seed tissues, its sensitivity was comparable to conventional RT-PCR in leaf tissues, and it does not require extensive sample purification, specialized equipment, or technical expertise. This is the first report utilizing an RT-RPA assay to detect viroids and the assay can be used both in the laboratory and in the field for TCDVd detection. PMID:27427473

  16. Sensitive, coupled assay for plasminogen activator using a thiol ester substrate for plasmin

    SciTech Connect

    Coleman, P L; Green, G D.J.

    1980-01-01

    Several assays for plasminogen activator employ a direct assay method. These are remarkably sensitive methods, yet they suffer in comparison to the sensitivity of coupled methods. Coupling the assay with plasminogen not only amplifies the sensitivity by the multiplicative effect of plasmin, but insures that only those proteases specific for plasminogen are assayed. The choice of substrate for plasmin is critical. A thiol ester substrate, thiobenzyl benzyloxy-carbonyl-L-lysinate (Z-Lys-SBzl), has been synthesized which combines high k/sub cat/ with alkaline stability. In an effort to characterize the plasminogen activator from hepatoma tissue culture (HTC) and its hormonally-controlled inhibitor, Z-Lys-SBzl was used in a coupled approach providing an assay which is superior to the /sup 125/I-fibrinolytic assay. It is also extremely sensitive to plasminogen activator and can be used for routine analysis of purification as well as kinetic and binding studies. (ERB)

  17. N6-Methyldeoxyadenosine Marks Active Transcription Start Sites in Chlamydomonas

    PubMed Central

    Chen, Kai; Deng, Xin; Yu, Miao; Han, Dali; Hao, Ziyang; Liu, Jianzhao; Lu, Xingyu; Dore, Louis C; Weng, Xiaocheng; Ji, Quanjiang; Mets, Laurens; He, Chuan

    2015-01-01

    SUMMARY N6-methyldeoxyadenosine (6mA or m6A) is a DNA modification preserved in prokaryotes to eukaryotes. It is widespread in bacteria, and functions in DNA mismatch repair, chromosome segregation, and virulence regulation. In contrast, the distribution and function of 6mA in eukaryotes have been unclear. Here we present a comprehensive analysis of the 6mA landscape in the genome of Chlamydomonas using new sequencing approaches. We identified the 6mA modification in 84% of genes in Chlamydomonas. We found that 6mA mainly locates at ApT dinucleotides around transcription start sites (TSS) with a bimodal distribution, and appears to mark active genes. A periodic pattern of 6mA deposition was also observed at base resolution, which is associated with nucleosome distribution near the TSS, suggesting a possible role in nucleosome positioning. The new genome-wide mapping of 6mA and its unique distribution in the Chlamydomonas genome suggest potential regulatory roles of 6mA in gene expression in eukaryotic organisms. PMID:25936837

  18. Transcription factor PIF4 controls the thermosensory activation of flowering.

    PubMed

    Kumar, S Vinod; Lucyshyn, Doris; Jaeger, Katja E; Alós, Enriqueta; Alvey, Elizabeth; Harberd, Nicholas P; Wigge, Philip A

    2012-04-12

    Plant growth and development are strongly affected by small differences in temperature. Current climate change has already altered global plant phenology and distribution, and projected increases in temperature pose a significant challenge to agriculture. Despite the important role of temperature on plant development, the underlying pathways are unknown. It has previously been shown that thermal acceleration of flowering is dependent on the florigen, FLOWERING LOCUS T (FT). How this occurs is, however, not understood, because the major pathway known to upregulate FT, the photoperiod pathway, is not required for thermal acceleration of flowering. Here we demonstrate a direct mechanism by which increasing temperature causes the bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4) to activate FT. Our findings provide a new understanding of how plants control their timing of reproduction in response to temperature. Flowering time is an important trait in crops as well as affecting the life cycles of pollinator species. A molecular understanding of how temperature affects flowering will be important for mitigating the effects of climate change. PMID:22437497

  19. TRIC: Capturing the direct cellular targets of promoter-bound transcriptional activators.

    PubMed

    Dugan, Amanda; Pricer, Rachel; Katz, Micah; Mapp, Anna K

    2016-08-01

    Transcriptional activators coordinate the dynamic assembly of multiprotein coactivator complexes required for gene expression to occur. Here we combine the power of in vivo covalent chemical capture with p-benzoyl-L-phenylalanine (Bpa), a genetically incorporated photo-crosslinking amino acid, and chromatin immunoprecipitation (ChIP) to capture the direct protein interactions of the transcriptional activator VP16 with the general transcription factor TBP at the GAL1 promoter in live yeast. PMID:27213278

  20. Validation of the β-amy1 transcription profiling assay and selection of reference genes suited for a RT-qPCR assay in developing barley caryopsis.

    PubMed

    Ovesná, Jaroslava; Kučera, Ladislav; Vaculová, Kateřina; Štrymplová, Kamila; Svobodová, Ilona; Milella, Luigi

    2012-01-01

    Reverse transcription coupled with real-time quantitative PCR (RT-qPCR) is a frequently used method for gene expression profiling. Reference genes (RGs) are commonly employed to normalize gene expression data. A limited information exist on the gene expression and profiling in developing barley caryopsis. Expression stability was assessed by measuring the cycle threshold (Ct) range and applying both the GeNorm (pair-wise comparison of geometric means) and Normfinder (model-based approach) principles for the calculation. Here, we have identified a set of four RGs suitable for studying gene expression in the developing barley caryopsis. These encode the proteins GAPDH, HSP90, HSP70 and ubiquitin. We found a correlation between the frequency of occurrence of a transcript in silico and its suitability as an RG. This set of RGs was tested by comparing the normalized level of β-amylase (β-amy1) transcript with directly measured quantities of the BMY1 gene product in the developing barley caryopsis. This panel of genes could be used for other gene expression studies, as well as to optimize β-amy1 analysis for study of the impact of β-amy1 expression upon barley end-use quality. PMID:22860024

  1. A MEMBRANE FILTER PROCEDURE FOR ASSAYING CYTOTOXIC ACTIVITY IN HETEROTROPHIC BACTERIA ISOLATED FROM DRINKING WATER

    EPA Science Inventory

    Cytotoxic activity assays of Gram-negative, heterotrophic bacteria are often laborious and time consuming. The objective of this study was to develop in situ procedures for testing potential cytotoxic activities of heterotrophic bacteria isolated from drinking water systems. Wate...

  2. Single molecule microscopy reveals mechanistic insight into RNA polymerase II preinitiation complex assembly and transcriptional activity

    PubMed Central

    Horn, Abigail E.; Kugel, Jennifer F.; Goodrich, James A.

    2016-01-01

    Transcription by RNA polymerase II (Pol II) is a complex process that requires general transcription factors and Pol II to assemble on DNA into preinitiation complexes that can begin RNA synthesis upon binding of NTPs (nucleoside triphosphate). The pathways by which preinitiation complexes form, and how this impacts transcriptional activity are not completely clear. To address these issues, we developed a single molecule system using TIRF (total internal reflection fluorescence) microscopy and purified human transcription factors, which allows us to visualize transcriptional activity at individual template molecules. We see that stable interactions between polymerase II (Pol II) and a heteroduplex DNA template do not depend on general transcription factors; however, transcriptional activity is highly dependent upon TATA-binding protein, TFIIB and TFIIF. We also found that subsets of general transcription factors and Pol II can form stable complexes that are precursors for functional transcription complexes upon addition of the remaining factors and DNA. Ultimately we found that Pol II, TATA-binding protein, TFIIB and TFIIF can form a quaternary complex in the absence of promoter DNA, indicating that a stable network of interactions exists between these proteins independent of promoter DNA. Single molecule studies can be used to learn how different modes of preinitiation complex assembly impact transcriptional activity. PMID:27112574

  3. Functional characterization of NAC55 transcription factor from oilseed rape (Brassica napus L.) as a novel transcriptional activator modulating reactive oxygen species accumulation and cell death.

    PubMed

    Niu, Fangfang; Wang, Chen; Yan, Jingli; Guo, Xiaohua; Wu, Feifei; Yang, Bo; Deyholos, Michael K; Jiang, Yuan-Qing

    2016-09-01

    NAC transcription factors (TFs) are plant-specific and play important roles in development, responses to biotic and abiotic cues and hormone signaling. So far, only a few NAC genes have been reported to regulate cell death. In this study, we identified and characterized a NAC55 gene isolated from oilseed rape (Brassica napus L.). BnaNAC55 responds to multiple stresses, including cold, heat, abscisic acid (ABA), jasmonic acid (JA) and a necrotrophic fungal pathogen Sclerotinia sclerotiorum. BnaNAC55 has transactivation activity and is located in the nucleus. BnaNAC55 is able to form homodimers in planta. Unlike ANAC055, full-length BnaNAC55, but not either the N-terminal NAC domain or C-terminal regulatory domain, induces ROS accumulation and hypersensitive response (HR)-like cell death when expressed both in oilseed rape protoplasts and Nicotiana benthamiana. Furthermore, BnaNAC55 expression causes obvious nuclear DNA fragmentation. Moreover, quantitative reverse transcription PCR (qRT-PCR) analysis identified that the expression levels of multiple genes regulating ROS production and scavenging, defense response as well as senescence are significantly induced. Using a dual luciferase reporter assay, we further confirm that BnaNAC55 could activate the expression of a few ROS and defense-related gene expression. Taken together, our work has identified a novel NAC TF from oilseed rape that modulates ROS accumulation and cell death. PMID:27312204

  4. SUMO-activating SAE1 transcription is positively regulated by Myc

    PubMed Central

    Amente, Stefano; Lavadera, Miriam Lubrano; Palo, Giacomo Di; Majello, Barbara

    2012-01-01

    Myc protein plays a fundamental role in regulation of cell cycle, proliferation, differentiation and apoptosis by modulating the expression of a large number of targets. Here we report the transactivation ability of the human Myc protein to activate the SUMO-activating enzyme SAE1 transcription. We found that Myc activates SAE1 transcription via direct binding to canonical E-Boxes sequences located close to the SAE1 transcription start site. A recent report has highlighted the crucial role of the SAE gene expression in Myc mediated oncogenesis. Our study adds new insight in this context since we show here that Myc directly activates SAE1 transcription, suggesting that Myc oncogenic activity which depends on SAE1 is ensured by Myc itself through direct binding and transcriptional activation of SAE1 expression. PMID:22679563

  5. Investigation of environmental influences on a transcriptional assay for the prediction of age of Aedes aegypti (Diptera: Culicidae) mosquitoes.

    PubMed

    Hugo, Leon E; Kay, Brian H; O'Neill, Scott L; Ryan, Peter A

    2010-11-01

    We examined the effects of environmental regulation of gene transcription on the accuracy of a transcriptional profiling method for determining insect age. In combined temperature/nutrition treatments, Aedes aegypti (L.) mosquitoes were maintained in the laboratory at three different temperatures (20, 26, and 32 degrees C), and larvae were fed on low, medium, and high diet regimens. Adult mosquitoes of distinct size classes were produced. Transcription of three age-responsive genes (Ae-15848, Ae-8505, and Ae-4274) was measured from 1-, 10-, and 19-d-old specimens using a quantitative reverse-transcription polymerase chain reaction method incorporating dual-labeled TaqMan probes. Temperature had a significant effect on transcript abundance for two of the model genes (Ae-15848 and Ae-8505), and transcription of model genes was unaffected by the main effect of larval diet level; however, significant temperature by diet level interactions were observed. Total RNA yield from individual mosquitoes varied according to adult age and temperature, and when combined with wing length, provided a useful predictor variable in age prediction models. More accurate age predictions were achieved from models generated at the same temperature as test mosquitoes; however, whereas significant differences in mean predicted ages were observed between 1- and 10-d-old mosquitoes, differences between 10 and 19 d were nonsignificant. This study highlights the effect of environmental regulation on gene transcription age grading and the need to identify additional gene biomarkers of age to improve the classification of older mosquitoes. PMID:21175052

  6. The BM2 protein of influenza B virus interacts with p53 and inhibits its transcriptional and apoptotic activities.

    PubMed

    Zhang, H; Yu, H; Wang, J; Zhang, M; Wang, X; Ahmad, W; Duan, M; Guan, Z

    2015-05-01

    The influenza virus integral membrane proteins BM2 (M2 of influenza B virus) and A/M2 (M2 of influenza A virus) functions as an ion channel, important for virus uncoating in endosomes of virus-infected cells and essential for viral replication. M2 ion channel activity is also required to stimulate NLRP3 inflammasome activation by perturbing ionic concentrations in the Golgi. In the present study, we have investigated further the interaction between BM2 and p53 to confirm our previous studies using yeast two-hybrid assays. The interaction between BM2 and p53 was confirmed by GST pull-down, co-immunoprecipitation assays, and confocal microscopy. Expression of BM2 results in down-regulation of p53 mRNA and protein expression in a dose-dependent manner. In addition, we demonstrated that exogenous expression of BM2 functionally blocked p53-mediated transcriptional activity and apoptosis by luciferase reporter assay and TUNEL assay, respectively. Together, the present results indicate that BM2 is able to functionally interact with p53, and provide valuable insights into the modulation of p53 functions by influenza virus. PMID:25670017

  7. Scc2 regulates gene expression by recruiting cohesin to the chromosome as a transcriptional activator during yeast meiosis

    PubMed Central

    Lin, Weiqiang; Jin, Hui; Liu, Xiuwen; Hampton, Kristin; Yu, Hong-Guo

    2011-01-01

    To tether sister chromatids, a protein-loading complex, including Scc2, recruits cohesin to the chromosome at discrete loci. Cohesin facilitates the formation of a higher-order chromosome structure that could also influence gene expression. How cohesin directly regulates transcription remains to be further elucidated. We report that in budding yeast Scc2 is required for sister-chromatid cohesion during meiosis for two reasons. First, Scc2 is required for activating the expression of REC8, which encodes a meiosis-specific cohesin subunit; second, Scc2 is necessary for recruiting meiotic cohesin to the chromosome to generate sister-chromatid cohesion. Using a heterologous reporter assay, we have found that Scc2 increases the activity of its target promoters by recruiting cohesin to establish an upstream cohesin-associated region in a position-dependent manner. Rec8-associated meiotic cohesin is required for the full activation of the REC8 promoter, revealing that cohesin has a positive feedback on transcriptional regulation. Finally, we provide evidence that chromosomal binding of cohesin is sufficient for target-gene activation during meiosis. Our data support a noncanonical role for cohesin as a transcriptional activator during cell differentiation. PMID:21508318

  8. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.

    PubMed

    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël

    2002-03-19

    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  9. Deduction of upstream sequences of Xanthomonas campestris flagellar genes responding to transcription activation by FleQ

    SciTech Connect

    Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H. . E-mail: yhtseng@chtai.ctc.edu.tw

    2005-10-07

    Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of {sigma}{sup 54} in transcription from several {sigma}{sup 54}-dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative {sigma}{sup 54}-dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted {sigma}{sup 54}-binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ.

  10. Transcriptional activation of human 12-lipoxygenase gene promoter is mediated through Sp1 consensus sites in A431 cells.

    PubMed Central

    Liu, Y W; Arakawa, T; Yamamoto, S; Chang, W C

    1997-01-01

    The functional 5' flanking region of the human 12-lipoxygenase in epidermoid carcinoma A431 cells was characterized. By a primer extension method, the transcription initiation sites were mapped at -47 adenosine, -48 guanosine and -55 guanosine upstream of the ATG translation start codon. Transient transfection with a series of 5' and 3' deletion constructs showed that the 5' flanking region spanning from -224 to -100 bp was important for the basal expression of 12-lipoxygenase gene. Gel mobility shift assays with antibodies of transcription factors showed that both Sp1 and Sp3 required highly GC-rich Sp1 sites within this region for binding. Disruption of two Sp1 recognition motifs residing at -158 to -150 bp and -123 to -114 bp by site-directed mutagenesis markedly reduced the basal 12-lipoxygenase promoter activity and abolished the retarded bands in a gel-shift assay, indicating that these two Sp1-binding sites were essential for gene expression. The same two Sp1-binding sites in this promoter region were also responsible for epidermal growth factor (EGF)-induced expression of 12-lipoxygenase gene. Moreover, EGF also induced the transcriptional activation of luciferase driven by SV40 early promoter, which contained rich Sp1-binding sites. Taken together, the results suggest that two specific Sp1 consensus sites are involved in the mediation of the basal promoter activity as well as EGF induction of the 12-lipoxygenase gene and that Sp1 and Sp3 transcription factors might have a role in their regulation. PMID:9164849

  11. Development and evaluation of a real-time reverse transcription-PCR assay for quantification of gamma interferon mRNA to diagnose tuberculosis in multiple animal species.

    PubMed

    Harrington, Noel P; Surujballi, Om P; Waters, W Ray; Prescott, John F

    2007-12-01

    Tuberculosis of free-ranging and captive wildlife, including species implicated in the maintenance and transmission of Mycobacterium bovis, is a difficult disease to diagnose and control. Historically, diagnosis of tuberculosis has relied largely upon assays of cell-mediated immunity (CMI), such as tuberculin skin testing. This approach, however, is problematic or impractical for use with many wildlife species. Increasingly, in vitro diagnostic tests, including gamma interferon (IFN-gamma)-based assays, are replacing or complementing skin testing of cattle and humans. Analogous assays are unavailable for most wildlife because of a lack of species-specific immunological reagents. This report describes the development and validation of a whole-blood assay to quantify antigen-specific IFN-gamma mRNA expression by quantitative real-time reverse transcription-PCR. Oligonucleotide primers and probes were designed and tested for reactivity towards several susceptible species of interest with respect to tuberculosis infection. The assay was subsequently optimized to quantify the IFN-gamma mRNA expression in elk and red deer (Cervus elaphus) and was evaluated for its ability to detect mycobacterial antigen-specific responses of experimentally tuberculosis-infected animals. The assay was a simple, rapid, and sensitive measure of antigen-specific CMI. The IFN-gamma mRNA responses correlated well with IFN-gamma protein production and showed performance in determining an animal's infection status superior to that of either lymphocyte proliferation or IFN-gamma protein enzyme-linked immunosorbent assay methods. An additional advantage is the ease with which the assay can be modified to reliably quantify IFN-gamma expression by using consensus sequences of closely related species or of other species for which IFN-gamma sequence information is available. PMID:17942606

  12. Reverse transcription loop-mediated isothermal amplification assays for rapid identification of eastern and western strains of bluetongue virus in India.

    PubMed

    Maan, S; Maan, N S; Batra, K; Kumar, A; Gupta, A; Rao, Panduranga P; Hemadri, Divakar; Reddy, Yella Narasimha; Guimera, M; Belaganahalli, M N; Mertens, P P C

    2016-08-01

    Bluetongue virus (BTV) infects all ruminants, including cattle, goats and camelids, causing bluetongue disease (BT) that is often severe in naïve deer and sheep. Reverse-transcription-loop-mediated-isothermal-amplification (RT-LAMP) assays were developed to detect eastern or western topotype of BTV strains circulating in India. Each assay uses four primers recognizing six distinct sequences of BTV genome-segment 1 (Seg-1). The eastern (e)RT-LAMP and western (w)RT-LAMP assay detected BTV RNA in all positive isolates that were tested (n=52, including Indian BTV-1, -2, -3, -5, -9, -10, -16, -21 -23, and -24 strains) with high specificity and efficiency. The analytical sensitivity of the RT-LAMP assays is comparable to real-time RT-PCR, but higher than conventional RT-PCR. The accelerated eRT-LAMP and wRT-LAMP assays generated detectable levels of amplified DNA, down to 0.216 fg of BTV RNA template or 108 fg of BTV RNA template within 60-90min respectively. The assays gave negative results with RNA from foot-and-mouth-disease virus (FMDV), peste des petits ruminants virus (PPRV), or DNA from Capripox viruses and Orf virus (n=10), all of which can cause clinical signs similar to BT. Both RT-LAMP assays did not show any cross-reaction among themselves. The assays are rapid, easy to perform, could be adapted as a 'penside' test making them suitable for 'front-line' diagnosis, helping to identify and contain field outbreaks of BTV. PMID:27054888

  13. Development of three triplex real-time reverse transcription PCR assays for the qualitative molecular typing of the nine serotypes of African horse sickness virus.

    PubMed

    Weyer, Camilla T; Joone, Christopher; Lourens, Carina W; Monyai, Mpho S; Koekemoer, Otto; Grewar, John D; van Schalkwyk, Antoinette; Majiwa, Phelix O A; MacLachlan, N James; Guthrie, Alan J

    2015-10-01

    Blood samples collected as part of routine diagnostic investigations from South African horses with clinical signs suggestive of African horse sickness (AHS) were subjected to analysis with an AHS virus (AHSV) group specific reverse transcription quantitative polymerase chain reaction (AHSV RT-qPCR) assay and virus isolation (VI) with subsequent serotyping by plaque inhibition (PI) assays using AHSV serotype-specific antisera. Blood samples that tested positive by AHSV RT-qPCR were then selected for analysis using AHSV type specific RT-qPCR (AHSV TS RT-qPCR) assays. The TS RT-qPCR assays were evaluated using both historic stocks of the South African reference strains of each of the 9 AHSV serotypes, as well as recently derived stocks of these same viruses. Of the 503 horse blood samples tested, 156 were positive by both AHSV RT-qPCR and VI assays, whereas 135 samples that were VI negative were positive by AHSV RT-qPCR assay. The virus isolates made from the various blood samples included all 9 AHSV serotypes, and there was 100% agreement between the results of conventional serotyping of individual virus isolates by PI assay and AHSV TS RT-qPCR typing results. Results of the current study confirm that the AHSV TS RT-qPCR assays for the identification of individual AHSV serotypes are applicable and practicable and therefore are potentially highly useful and appropriate for virus typing in AHS outbreak situations in endemic or sporadic incursion areas, which can be crucial in determining appropriate and timely vaccination and control strategies. PMID:26232526

  14. Development and Evaluation of a Real-Time Reverse Transcription-PCR Assay for Quantification of Gamma Interferon mRNA To Diagnose Tuberculosis in Multiple Animal Species▿

    PubMed Central

    Harrington, Noel P.; Surujballi, Om P.; Waters, W. Ray; Prescott, John F.

    2007-01-01

    Tuberculosis of free-ranging and captive wildlife, including species implicated in the maintenance and transmission of Mycobacterium bovis, is a difficult disease to diagnose and control. Historically, diagnosis of tuberculosis has relied largely upon assays of cell-mediated immunity (CMI), such as tuberculin skin testing. This approach, however, is problematic or impractical for use with many wildlife species. Increasingly, in vitro diagnostic tests, including gamma interferon (IFN-γ)-based assays, are replacing or complementing skin testing of cattle and humans. Analogous assays are unavailable for most wildlife because of a lack of species-specific immunological reagents. This report describes the development and validation of a whole-blood assay to quantify antigen-specific IFN-γ mRNA expression by quantitative real-time reverse transcription-PCR. Oligonucleotide primers and probes were designed and tested for reactivity towards several susceptible species of interest with respect to tuberculosis infection. The assay was subsequently optimized to quantify the IFN-γ mRNA expression in elk and red deer (Cervus elaphus) and was evaluated for its ability to detect mycobacterial antigen-specific responses of experimentally tuberculosis-infected animals. The assay was a simple, rapid, and sensitive measure of antigen-specific CMI. The IFN-γ mRNA responses correlated well with IFN-γ protein production and showed performance in determining an animal's infection status superior to that of either lymphocyte proliferation or IFN-γ protein enzyme-linked immunosorbent assay methods. An additional advantage is the ease with which the assay can be modified to reliably quantify IFN-γ expression by using consensus sequences of closely related species or of other species for which IFN-γ sequence information is available. PMID:17942606

  15. Improving fold activation of small transcription activating RNAs (STARs) with rational RNA engineering strategies.

    PubMed

    Meyer, Sarai; Chappell, James; Sankar, Sitara; Chew, Rebecca; Lucks, Julius B

    2016-01-01

    Regulatory RNAs have become integral components of the synthetic biology and bioengineering toolbox for controlling gene expression. We recently expanded this toolbox by creating small transcription activating RNAs (STARs) that act by disrupting the formation of a target transcriptional terminator hairpin placed upstream of a gene. While STARs are a promising addition to the repertoire of RNA regulators, much work remains to be done to optimize the fold activation of these systems. Here we apply rational RNA engineering strategies to improve the fold activation of two STAR regulators. We demonstrate that a combination of promoter strength tuning and multiple RNA engineering strategies can improve fold activation from 5.4-fold to 13.4-fold for a STAR regulator derived from the pbuE riboswitch terminator. We then validate the generality of our approach and show that these same strategies improve fold activation from 2.1-fold to 14.6-fold for an unrelated STAR regulator, opening the door to creating a range of additional STARs to use in a broad array of biotechnologies. We also establish that the optimizations preserve the orthogonality of these STARs between themselves and a set of RNA transcriptional repressors, enabling these optimized STARs to be used in sophisticated circuits. PMID:26134708

  16. Hepatitis C virus nonstructural region 5A protein is a potent transcriptional activator.

    PubMed Central

    Kato, N; Lan, K H; Ono-Nita, S K; Shiratori, Y; Omata, M

    1997-01-01

    The hepatitis C virus (HCV) nonstructural region 5A (NS5A) protein, without its 146 amino-terminal amino acids and fused to the DNA-binding domain of GAL4, strongly activates transcription in yeast and human hepatoma cells. Transcriptional activation by the HCV NS5A protein may play a role in viral replication and hepatocarcinogenesis. PMID:9343247

  17. PU.1 can participate in an active enhancer complex without its transcriptional activation domain

    PubMed Central

    Pongubala, Jagan M. R.; Atchison, Michael L.

    1997-01-01

    The transcription factor PU.1 is necessary for the development of multiple hematopoietic lineages and contributes to the activity of the immunoglobulin κ 3′ enhancer. A variety of proteins bind to the 3′ enhancer (PU.1, PIP, ATF1, CREM, c-Fos, c-Jun, and E2A), but the mechanism of 3′-enhancer activity and the proteins necessary for its activity are presently unclear. We show here that PU.1 participates with other transcription factors in forming a higher-order complex with 3′-enhancer DNA sequences. Each protein is necessary for formation of this complex. Individually, transcription factors that bind to the 3′ enhancer do not appreciably stimulate transcription in a cell type in which the 3′ enhancer is normally silent (NIH 3T3). However, mixture of multiple transcription factors (PU.1, PIP, c-Fos, and c-Jun) can greatly activate the enhancer. PU.1 is necessary for maximal enhancer activity, but mutants of PU.1 that lack the transcriptional activation domain are nearly as efficient at stimulating enhancer activity as the wild-type PU.1 protein. PU.1 apparently can activate transcription by playing an architectural role in interactions with other transcription factors. PMID:8990172

  18. A modified reverse one-hybrid screen identifies transcriptional activation in Phyochrome-Interacting Factor 3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional activation domains (TAD) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput...

  19. Electrochemical Assay for the Signal-on Detection of Human DNA Methyltransferase Activity

    PubMed Central

    Muren, Natalie B.; Barton, Jacqueline K.

    2013-01-01

    Strategies to detect human DNA methyltransferases are needed, given that aberrant methylation by these enzymes is associated with cancer initiation and progression. Here we describe a non-radioactive, antibody-free, electrochemical assay in which methyltransferase activity on DNA-modified electrodes confers protection from restriction for signal-on detection. We implement this assay with a multiplexed chip platform and show robust detection of both bacterial (SssI) and human (Dnmt1) methyltransferase activity. Essential to work with human methyltransferases, our unique assay design allows activity measurements on both unmethylated and hemimethylated DNA substrates. We validate this assay by comparison with a conventional radioactive method. The advantages of electrochemistry over radioactivity and fluorescence make this assay an accessible and promising new approach for the sensitive, label-free detection of human methyltransferase activity. PMID:24164112

  20. Dynamic Transcription Factor Activity Profiles Reveal Key Regulatory Interactions During Megakaryocytic and Erythroid Differentiation

    PubMed Central

    Duncan, Mark T.; Shin, Seungjin; Wu, Jia J.; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M.; Shea, Lonnie D.

    2014-01-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  1. Dynamic transcription factor activity profiles reveal key regulatory interactions during megakaryocytic and erythroid differentiation.

    PubMed

    Duncan, Mark T; Shin, Seungjin; Wu, Jia J; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M; Shea, Lonnie D

    2014-10-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  2. Freeze-dried activated substrate for factor VIII assays.

    PubMed

    Margolis, J

    1987-01-01

    Factor VIII-deficient plasma (natural or artificial) mixed with kaolin and phospholipid can be lyophilized to provide ready-to-use substrate which is stable for months at 4 degrees C and usable after many weeks at room temperature. Factor VIII assays are much simplified and more reproducible using this reagent and can be quantified with the aid of a programmable calculator according to the equation (formula; see text) as % of standard and X, S and B are clotting times of test, standard and blank samples respectively. The slope of the log/log function (k) is approximately--6.5. PMID:3111909

  3. Maximal stimulation of meiotic recombination by a yeast transcription factor requires the transcription activation domain and a DNA-binding domain.

    PubMed Central

    Kirkpatrick, D T; Fan, Q; Petes, T D

    1999-01-01

    The DNA sequences located upstream of the yeast HIS4 represent a very strong meiotic recombination hotspot. Although the activity of this hotspot requires the transcription activator Rap1p, the level of HIS4 transcription is not directly related to the level of recombination. We find that the recombination-stimulating activity of Rap1p requires the transcription activation domain of the protein. We show that a hybrid protein with the Gal4p DNA-binding domain and the Rap1p activation domain can stimulate recombination in a strain in which Gal4p-binding sites are inserted upstream of HIS4. In addition, we find recombination hotspot activity associated with the Gal4p DNA-binding sites that is independent of known transcription factors. We suggest that yeast cells have two types of recombination hotspots, alpha (transcription factor dependent) and beta (transcription factor independent). PMID:10224246

  4. New role for Kruppel-like factor 14 as a transcriptional activator involved in the generation of signaling lipids.

    PubMed

    de Assuncao, Thiago M; Lomberk, Gwen; Cao, Sheng; Yaqoob, Usman; Mathison, Angela; Simonetto, Douglas A; Huebert, Robert C; Urrutia, Raul A; Shah, Vijay H

    2014-05-30

    Sphingosine kinase 1 (SK1) is an FGF-inducible gene responsible for generation of sphingosine-1-phosphate, a critical lipid signaling molecule implicated in diverse endothelial cell functions. In this study, we identified SK1 as a target of the canonical FGF2/FGF receptor 1 activation pathway in endothelial cells and sought to identify novel transcriptional pathways that mediate lipid signaling. Studies using the 1.9-kb SK1 promoter and deletion mutants revealed that basal and FGF2-stimulated promoter activity occurred through two GC-rich regions located within 633 bp of the transcription start site. Screening for GC-rich binding transcription factors that could activate this site demonstrated that KLF14, a gene implicated in obesity and the metabolic syndrome, binds to this region. Congruently, overexpression of KLF14 increased basal and FGF2-stimulated SK1 promoter activity by 3-fold, and this effect was abrogated after mutation of the GC-rich sites. In addition, KLF14 siRNA transfection decreased SK1 mRNA and protein levels by 3-fold. Congruently, SK1 mRNA and protein levels were decreased in livers from KLF14 knock-out mice. Combined, luciferase, gel shift, and chromatin immunoprecipitation assays showed that KLF14 couples to p300 to increase the levels of histone marks associated with transcriptional activation (H4K8ac and H3K14ac), while decreasing repressive marks (H3K9me3 and H3K27me3). Collectively, the results demonstrate a novel mechanism whereby SK1 lipid signaling is regulated by epigenetic modifications conferred by KLF14 and p300. Thus, this is the first description of the activity and mechanisms underlying the function of KLF14 as an activator protein and novel regulator of lipid signaling. PMID:24759103

  5. New Role for Kruppel-like Factor 14 as a Transcriptional Activator Involved in the Generation of Signaling Lipids*

    PubMed Central

    de Assuncao, Thiago M.; Lomberk, Gwen; Cao, Sheng; Yaqoob, Usman; Mathison, Angela; Simonetto, Douglas A.; Huebert, Robert C.; Urrutia, Raul A.; Shah, Vijay H.

    2014-01-01

    Sphingosine kinase 1 (SK1) is an FGF-inducible gene responsible for generation of sphingosine-1-phosphate, a critical lipid signaling molecule implicated in diverse endothelial cell functions. In this study, we identified SK1 as a target of the canonical FGF2/FGF receptor 1 activation pathway in endothelial cells and sought to identify novel transcriptional pathways that mediate lipid signaling. Studies using the 1.9-kb SK1 promoter and deletion mutants revealed that basal and FGF2-stimulated promoter activity occurred through two GC-rich regions located within 633 bp of the transcription start site. Screening for GC-rich binding transcription factors that could activate this site demonstrated that KLF14, a gene implicated in obesity and the metabolic syndrome, binds to this region. Congruently, overexpression of KLF14 increased basal and FGF2-stimulated SK1 promoter activity by 3-fold, and this effect was abrogated after mutation of the GC-rich sites. In addition, KLF14 siRNA transfection decreased SK1 mRNA and protein levels by 3-fold. Congruently, SK1 mRNA and protein levels were decreased in livers from KLF14 knock-out mice. Combined, luciferase, gel shift, and chromatin immunoprecipitation assays showed that KLF14 couples to p300 to increase the levels of histone marks associated with transcriptional activation (H4K8ac and H3K14ac), while decreasing repressive marks (H3K9me3 and H3K27me3). Collectively, the results demonstrate a novel mechanism whereby SK1 lipid signaling is regulated by epigenetic modifications conferred by KLF14 and p300. Thus, this is the first description of the activity and mechanisms underlying the function of KLF14 as an activator protein and novel regulator of lipid signaling. PMID:24759103

  6. In Vitro Assay to Measure Phosphatidylethanolamine Methyltransferase Activity.

    PubMed

    Zufferey, Rachel

    2016-01-01

    Phosphatidylethanolamine methyltransferases are biosynthetic enzymes that catalyze the transfer of one or more methyl group(s) from S-adenosyl-L-methionine onto phosphatidylethanolamine, monomethyl-phosphatidylethanolamine, or dimethyl-phosphatidylethanolamine to give either monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine or phosphatidylcholine. These enzymes are ubiquitous in animal cells, fungi, and are also found in approximately 10% of bacteria. They fulfill various important functions in cell physiology beyond their direct role in lipid metabolism such as in insulin resistance, diabetes, atherosclerosis, cell growth, or virulence. The present manuscript reports on a simple cell-free enzymatic assay that measures the transfer of tritiated methyl group(s) from S-[Methyl-(3)H]adenosyl-L-methionine onto phosphatidylethanolamine using whole cell extracts as an enzyme source. The resulting methylated forms of phosphatidylethanolamine are hydrophobic and thus, can be separated from water soluble S-[Methyl-(3)H]adenosyl-L-methionine by organic extraction. This assay can potentially be applied to any other cell types and used to test inhibitors/drugs specific to a phosphatidylethanolamine methyltransferase of interest without the need to purify the enzyme. PMID:26780155

  7. In Vitro Assay to Measure Phosphatidylethanolamine Methyltransferase Activity

    PubMed Central

    Zufferey, Rachel

    2016-01-01

    Phosphatidylethanolamine methyltransferases are biosynthetic enzymes that catalyze the transfer of one or more methyl group(s) from S-adenosyl-L-methionine onto phosphatidylethanolamine, monomethyl-phosphatidylethanolamine, or dimethyl-phosphatidylethanolamine to give either monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine or phosphatidylcholine. These enzymes are ubiquitous in animal cells, fungi, and are also found in approximately 10% of bacteria. They fulfill various important functions in cell physiology beyond their direct role in lipid metabolism such as in insulin resistance, diabetes, atherosclerosis, cell growth, or virulence. The present manuscript reports on a simple cell-free enzymatic assay that measures the transfer of tritiated methyl group(s) from S-[Methyl-3H]adenosyl-L-methionine onto phosphatidylethanolamine using whole cell extracts as an enzyme source. The resulting methylated forms of phosphatidylethanolamine are hydrophobic and thus, can be separated from water soluble S-[Methyl-3H]adenosyl-L-methionine by organic extraction. This assay can potentially be applied to any other cell types and used to test inhibitors/drugs specific to a phosphatidylethanolamine methyltransferase of interest without the need to purify the enzyme. PMID:26780155

  8. A two-tube multiplex reverse transcription PCR assay for simultaneous detection of viral and bacterial pathogens of infectious diarrhea.

    PubMed

    Wang, Ji; Xu, Ziqian; Niu, Peihua; Zhang, Chen; Zhang, Jingyun; Guan, Li; Kan, Biao; Duan, Zhaojun; Ma, Xuejun

    2014-01-01

    Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1), and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2). The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20-200 copies for a single virus and 10(2)-10(3) CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus. PMID:24711998

  9. Prediction of Pathway Activation by Xenobiotic-Responsive Transcription Factors in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobioticresponsive transcription factors (TF). Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening. Starting with a large compendium of Affymet...

  10. The Nuclear Matrix Protein, NRP/B, Acts as a Transcriptional Repressor of E2F-mediated Transcriptional Activity

    PubMed Central

    Choi, Jina; Yang, Eun Sung; Cha, Kiweon; Whang, John; Choi, Woo-Jung; Avraham, Shalom; Kim, Tae-Aug

    2014-01-01

    Background: NRP/B, a family member of the BTB/Kelch repeat proteins, is implicated in neuronal and cancer development, as well as the regulation of oxidative stress responses in breast and brain cancer. Our previous studies indicate that the NRP/B-BTB/POZ domain is involved in the dimerization of NRP/B and in a complex formation with the tumor suppressor, retinoblastoma protein. Although much evidence supports the potential role of NRP/B as a tumor suppressor, the molecular mechanisms of NRP/B action on E2F transcription factors have not been elucidated. Methods: Three-dimensional modeling of NRP/B was used to generate point mutations in the BTB/Kelch domains. Tet-on inducible NRP/B expression was established. The NRP/B deficient breast cancer cell line, MDA-MB-231, was generated using lentiviral shNRP/B to evaluate the effect of NRP/B on cell proliferation, invasion and migration. Immunoprecipitation was performed to verify the interaction of NRP/B with E2F and histone deacetylase (HDAC-1), and the expression level of NRP/B protein was analyzed by Western blot analysis. Changes in cell cycle were determined by flow cytometry. Transcriptional activities of E2F transcription factors were measured by chloramphenicol acetyltransferase (CAT) activity. Results: Ectopic overexpression of NRP/B demonstrated that the NRP/B-BTB/POZ domain plays a critical role in E2F-mediated transcriptional activity. Point mutations within the BTB/POZ domain restored E2-promoter activity inhibited by NRP/B. Loss of NRP/B enhanced the proliferation and migration of breast cancer cells. Endogenous NRP/B interacted with E2F and HDAC1. Treatement with an HDAC inhibitor, trichostatin A (TSA), abolished the NRP/B-mediated suppression of E2-promoter activity. Gain or loss of NRP/B in HeLa cells confirmed the transcriptional repressive capability of NRP/B on the E2F target genes, Cyclin E and HsORC (Homo sapiens Origin Recognition Complex). Conclusions: The present study shows that NRP/B acts as a

  11. A sensitive assay for the biosynthesis and secretion of MANF using NanoLuc activity.

    PubMed

    Norisada, Junpei; Hirata, Yoko; Amaya, Fumimasa; Kiuchi, Kazutoshi; Oh-hashi, Kentaro

    2014-07-11

    Mesencephalic astrocyte-derived neurotrophic factor (MANF) has been reported to prevent neuronal cell death caused by certain stimuli. Accordingly, the molecular features of MANF have been intensively investigated since the reporting of its cytoprotective actions. In addition to the characterization of the transcriptional regulation of MANF under pathophysiological conditions, it is important to understand its intracellular transport and secretion after translation. In this study, we developed a convenient and quantitative assay to evaluate the post-translational regulation of MANF using NanoLuc, a highly active and small luciferase. We inserted NanoLuc after the putative signal peptide sequence (SP) of MANF to construct NanoLuc-tagged MANF (SP-NL-MANF). Similar to wild-type (wt) MANF, SP-NL-MANF was secreted from transiently transfected HEK293 cells in a time-dependent manner. The overexpression of mutant Sar1 or wild-type GRP78, which has been reported to decrease wt MANF secretion, also attenuated the secretion of SP-NL-MANF. Using INS-1 cells stably expressing SP-NL-MANF, we found that the biosynthesis and secretion of SP-NL-MANF can be evaluated quantitatively using only a small number of cells. We further investigated the effects of several stimuli responsible for the expression of ER stress-induced genes on the secretion of SP-NL-MANF from INS-1 cells. Treatment with thapsigargin and high potassium significantly increased NanoLuc activity in the culture medium, but serum withdrawal dramatically down-regulated luciferase activity both inside and outside of the cells. Collectively, these results demonstrate that our method for measuring NanoLuc-tagged MANF as a secretory factor is highly sensitive and convenient not only for characterizing post-translational regulation but also for screening useful compounds that may be used to treat ER stress-related diseases such as neurodegenerative disease, ischemia and diabetes. PMID:24845376

  12. NF-κB Transcriptional Activity Is Modulated by FK506-binding Proteins FKBP51 and FKBP52

    PubMed Central

    Erlejman, Alejandra G.; De Leo, Sonia A.; Mazaira, Gisela I.; Molinari, Alejandro M.; Camisay, María Fernanda; Fontana, Vanina; Cox, Marc B.; Piwien-Pilipuk, Graciela; Galigniana, Mario D.

    2014-01-01

    Hsp90 binding immunophilins FKBP51 and FKBP52 modulate steroid receptor trafficking and hormone-dependent biological responses. With the purpose to expand this model to other nuclear factors that are also subject to nuclear-cytoplasmic shuttling, we analyzed whether these immunophilins modulate NF-κB signaling. It is demonstrated that FKBP51 impairs both the nuclear translocation rate of NF-κB and its transcriptional activity. The inhibitory action of FKBP51 requires neither the peptidylprolyl-isomerase activity of the immunophilin nor its association with Hsp90. The TPR domain of FKBP51 is essential. On the other hand, FKBP52 favors the nuclear retention time of RelA, its association to a DNA consensus binding sequence, and NF-κB transcriptional activity, the latter effect being strongly dependent on the peptidylprolyl-isomerase activity and also on the TPR domain of FKBP52, but its interaction with Hsp90 is not required. In unstimulated cells, FKBP51 forms endogenous complexes with cytoplasmic RelA. Upon cell stimulation with phorbol ester, the NF-κB soluble complex exchanges FKBP51 for FKBP52, and the NF-κB biological effect is triggered. Importantly, FKBP52 is functionally recruited to the promoter region of NF-κB target genes, whereas FKBP51 is released. Competition assays demonstrated that both immunophilins antagonize one another, and binding assays with purified proteins suggest that the association of RelA and immunophilins could be direct. These observations suggest that the biological action of NF-κB in different cell types could be positively regulated by a high FKBP52/FKBP51 expression ratio by favoring NF-κB nuclear retention, recruitment to the promoter regions of target genes, and transcriptional activity. PMID:25104352

  13. Active transcription and essential role of RNA polymerase II at the centromere during mitosis

    PubMed Central

    Chan, F. Lyn; Marshall, Owen J.; Saffery, Richard; Won Kim, Bo; Earle, Elizabeth; Choo, K. H. Andy; Wong, Lee H.

    2012-01-01

    Transcription of the centromeric regions has been reported to occur in G1 and S phase in different species. Here, we investigate whether transcription also occurs and plays a functional role at the mammalian centromere during mitosis. We show the presence of actively transcribing RNA polymerase II (RNAPII) and its associated transcription factors, coupled with the production of centromere satellite transcripts at the mitotic kinetochore. Specific inhibition of RNAPII activity during mitosis leads to a decrease in centromeric α-satellite transcription and a concomitant increase in anaphase-lagging cells, with the lagging chromosomes showing reduced centromere protein C binding. These findings demonstrate an essential role of RNAPII in the transcription of α-satellite DNA, binding of centromere protein C, and the proper functioning of the mitotic kinetochore. PMID:22308327

  14. Design of Multiplexed Detection Assays for Identification of Avian Influenza A Virus Subtypes Pathogenic to Humans by SmartCycler Real-Time Reverse Transcription-PCR ▿

    PubMed Central

    Wang, Wei; Ren, Peijun; Mardi, Sek; Hou, Lili; Tsai, Cheguo; Chan, Kwok Hung; Cheng, Peter; Sheng, Jun; Buchy, Philippe; Sun, Bing; Toyoda, Tetsuya; Lim, Wilina; Peiris, J. S. Malik; Zhou, Paul; Deubel, Vincent

    2009-01-01

    Influenza A virus (IAV) epidemics are the result of human-to-human or poultry-to-human transmission. Tracking seasonal outbreaks of IAV and other avian influenza virus (AIV) subtypes that can infect humans, aquatic and migratory birds, poultry, and pigs is essential for epidemiological surveillance and outbreak alerts. In this study, we performed four real-time reverse transcription-PCR (rRT-PCR) assays for identification of the IAV M and hemagglutinin (HA) genes from six known AIVs infecting pigs, birds, and humans. IAV M1 gene-positive samples tested by single-step rRT-PCR and a fluorogenic Sybr green I detection system were further processed for H5 subtype identification by using two-primer-set multiplex and Sybr green I rRT-PCR assays. H5 subtype-negative samples were then tested with either a TaqMan assay for subtypes H1 and H3 or a TaqMan assay for subtypes H2, H7, and H9 and a beacon multiplex rRT-PCR identification assay. The four-tube strategy was able to detect 10 RNA copies of the HA genes of subtypes H1, H2, H3, H5, and H7 and 100 RNA copies of the HA gene of subtype H9. At least six H5 clades of H5N1 viruses isolated in Southeast Asia and China were detected by that test. Using rRT-PCR assays for the M1 and HA genes in 202 nasopharyngeal swab specimens from children with acute respiratory infections, we identified a total of 39 samples positive for the IAV M1 gene and subtypes H1 and H3. When performed with a portable SmartCycler instrument, the assays offer an efficient, flexible, and reliable platform for investigations of IAV and AIV in remote hospitals and in the field. PMID:18971359

  15. EGF activates TTP expression by activation of ELK-1 and EGR-1 transcription factors

    PubMed Central

    2012-01-01

    Background Tristetraprolin (TTP) is a key mediator of processes such as inflammation resolution, the inhibition of autoimmunity and in cancer. It carries out this role by the binding and degradation of mRNA transcripts, thereby decreasing their half-life. Transcripts modulated by TTP encode proteins such as cytokines, pro-inflammatory agents and immediate-early response proteins. TTP can also modulate neoplastic phenotypes in many cancers. TTP is induced and functionally regulated by a spectrum of both pro- and anti-inflammatory cytokines, mitogens and drugs in a MAPK-dependent manner. So far the contribution of p38 MAPK to the regulation of TTP expression and function has been best described. Results Our results demonstrate the induction of the gene coding TTP (ZFP36) by EGF through the ERK1/2-dependent pathway and implicates the transcription factor ELK-1 in this process. We show that ELK-1 regulates ZFP36 expression by two mechanisms: by binding the ZFP36 promoter directly through ETS-binding site (+ 883 to +905 bp) and by inducing expression of EGR-1, which in turn increases ZFP36 expression through sequences located between -111 and -103 bp. Conclusions EGF activates TTP expression via ELK-1 and EGR-1 transcription factors. PMID:22433566

  16. The nuclear factor SPBP contains different functional domains and stimulates the activity of various transcriptional activators.

    PubMed

    Rekdal, C; Sjøttem, E; Johansen, T

    2000-12-22

    SPBP (stromelysin-1 platelet-derived growth factor-responsive element binding protein) was originally cloned from a cDNA expression library by virtue of its ability to bind to a platelet-derived growth factor-responsive element in the human stromelysin-1 promoter. A 937-amino acid-long protein was deduced from a 3995-nucleotide murine cDNA sequence. By analyses of both human and murine cDNAs, we now show that SPBP is twice as large as originally found. The human SPBP gene contains six exons and is located on chromosome 22q13.1-13.3. Two isoforms differing in their C termini are expressed due to alternative splicing. PCR analyses of multitissue cDNA panels showed that SPBP is expressed in most tissues except for ovary and prostate. Functional mapping revealed that SPBP is a nuclear, multidomain protein containing an N-terminal region with transactivating ability, a novel type of DNA-binding domain containing an AT hook motif, and a bipartite nuclear localization signal as well as a C-terminal zinc finger domain. This type of zinc finger domain is also found in the trithorax family of chromatin-based transcriptional regulator proteins. Using cotransfection experiments, we find that SPBP enhances the transcriptional activity of various transcription factors such as c-Jun, Ets1, Sp1, and Pax6. Hence, SPBP seems to act as a transcriptional coactivator. PMID:10995766

  17. Transcriptional activation upon pheromone stimulation mediated by a small domain of Saccharomyces cerevisiae Ste12p.

    PubMed Central

    Pi, H; Chien, C T; Fields, S

    1997-01-01

    In the yeast Saccharomyces cerevisiae, Ste12p induces transcription of pheromone-responsive genes by binding to a DNA sequence designated the pheromone response element. We generated a series of hybrid proteins of Ste12p with the DNA-binding and activation domains of the transcriptional activator Gal4p to define a pheromone induction domain of Ste12p sufficient to mediate pheromone-induced transcription by these hybrid proteins. A minimal pheromone induction domain, delineated as residues 301 to 335 of Ste12p, is dependent on the pheromone mitogen-activated protein (MAP) kinase pathway for induction activity. Mutation of the three serine and threonine residues within the minimal pheromone induction domain did not affect transcriptional induction, indicating that the activity of this domain is not directly regulated by MAP kinase phosphorylation. By contrast, mutation of the two tyrosines or their preceding acidic residues led to a high level of transcriptional activity in the absence of pheromone and consequently to the loss of pheromone induction. This constitutively high activity was not affected by mutations in the MAP kinase cascade, suggesting that the function of the pheromone induction domain is normally repressed in the absence of pheromone. By two-hybrid analysis, this minimal domain interacts with two negative regulators, Dig1p and Dig2p (also designated Rst1p and Rst2p), and the interaction is abolished by mutation of the tyrosines. The pheromone induction domain itself has weak and inducible transcriptional activity, and its ability to potentiate transcription depends on the activity of an adjacent activation domain. These results suggest that the pheromone induction domain of Ste12p mediates transcriptional induction via a two-step process: the relief of repression and synergistic transcriptional activation with another activation domain. PMID:9343403

  18. Antiviral activity of a Rac GEF inhibitor characterized with a sensitive HIV/SIV fusion assay

    SciTech Connect

    Pontow, Suzanne; Harmon, Brooke; Campbell, Nancy; Ratner, Lee

    2007-11-10

    A virus-dependent fusion assay was utilized to examine the activity of a panel of HIV-1, -2, and SIV isolates of distinct coreceptor phenotypes. This assay allowed identification of entry inhibitors, and characterization of an antagonist of a Rac guanine nucleotide exchange factor, as an inhibitor of HIV-mediated fusion.

  19. Multiple steps in the regulation of transcription-factor level and activity.

    PubMed Central

    Calkhoven, C F; Ab, G

    1996-01-01

    This review focuses on the regulation of transcription factors, many of which are DNA-binding proteins that recognize cis-regulatory elements of target genes and are the most direct regulators of gene transcription. Transcription factors serve as integration centres of the different signal-transduction pathways affecting a given gene. It is obvious that the regulation of these regulators themselves is of crucial importance for differential gene expression during development and in terminally differentiated cells. Transcription factors can be regulated at two, principally different, levels, namely concentration and activity, each of which can be modulated in a variety of ways. The concentrations of transcription factors, as of intracellular proteins in general, may be regulated at any of the steps leading from DNA to protein, including transcription, RNA processing, mRNA degradation and translation. The activity of a transcription factor is often regulated by (de) phosphorylation, which may affect different functions, e.g. nuclear localization DNA binding and trans-activation. Ligand binding is another mode of transcription-factor activation. It is typical for the large super-family of nuclear hormone receptors. Heterodimerization between transcription factors adds another dimension to the regulatory diversity and signal integration. Finally, non-DNA-binding (accessory) factors may mediate a diverse range of functions, e.g. serving as a bridge between the transcription factor and the basal transcription machinery, stabilizing the DNA-binding complex or changing the specificity of the target sequence recognition. The present review presents an overview of different modes of transcription-factor regulation, each illustrated by typical examples. PMID:8713055

  20. Reversible LSD1 inhibition interferes with global EWS/ETS transcriptional activity and impedes Ewing sarcoma tumor growth

    PubMed Central

    Sankar, Savita; Theisen, Emily R.; Bearss, Jared; Mulvihill, Timothy; Hoffman, Laura M.; Sorna, Venkataswamy; Beckerle, Mary C.; Sharma, Sunil; Lessnick, Stephen L.

    2014-01-01

    Purpose Ewing sarcoma is a pediatric bone tumor which absolutely relies on the transcriptional activity of the EWS/ETS family of fusion oncoproteins. While the most common fusion, EWS/FLI, utilizes lysine-specific demethylase 1 (LSD1) to repress critical tumor suppressors, small molecule blockade of LSD1 has not yet been thoroughly explored as a therapeutic approach for Ewing sarcoma. We therefore evaluated the translational potential of potent and specific LSD1 inhibition with HCI2509 on the transcriptional program of both EWS/FLI and EWS/ERG as well as the downstream oncogenic phenotypes driven by EWS/ETS fusions in both in vitro and in vivo models of Ewing sarcoma. Experimental Design RNA-seq was used to compare the transcriptional profiles of EWS/FLI, EWS/ERG, and treatment with HCI-2509 in both EWS/FLI and EWS/ERG containing cell lines. We then evaluated morphological phenotypes of treated cells with immunofluorescence. The induction of apoptosis was evaluated using caspase 3/7 activation and TUNEL staining. Colony forming assays were used to test oncogenic transformation and xenograft studies with patient-derived cell lines were used to evaluate the effects of HCI-2509 on tumorigenesis. Results HCI2509 caused a dramatic reversal of both the up- and down-regulated transcriptional profiles of EWS/FLI and EWS/ERG accompanied by the induction of apoptosis, and disruption of morphological and oncogenic phenotypes modulated by EWS/FLI. Importantly, HCI2509 displayed single-agent efficacy in multiple xenograft models. Conclusions These data support epigenetic modulation with HCI2509 as a therapeutic strategy for Ewing sarcoma, and highlight a critical dual role for LSD1 in the oncogenic transcriptional activity of EWS/ETS proteins. PMID:24963049

  1. Molecular cloning of Elk-3, a new member of the Ets family expressed during mouse embryogenesis and analysis of its transcriptional repression activity.

    PubMed

    Nozaki, M; Onishi, Y; Kanno, N; Ono, Y; Fujimura, Y

    1996-10-01

    We isolated a cDNA clone, Elk-3, that encodes a novel Ets transcription factor from 16-day mouse embryos. The deduced amino acid sequence of the protein was homologous to human ELK-1 and SAP-1. This protein, ELK-1, and SAP-1 shared some unique structural properties such as an Ets DNA-binding site in the amino-terminal region, a serum response factor interacting domain and phosphorylation sites of serine or threonine residues in the carboxy-terminal region. Northern blotting weakly revealed that two transcripts of 4 and 2.1 kb are expressed in the adult ovary and lung and a 2.1-kb transcript predominated in 8- to 14-day embryos. We assayed the transcriptional activities of Elk-3 protein on the cytokeratin EndoA enhancer containing Ets binding sites in endodermal cells. Elk-3 protein strongly repressed enhancer activity but did not affect the activity of the basal promoter in the absence of the enhancer. Furthermore, Elk-3 can suppress the activity of Ets-2 as the transcriptional activator on the EndoA enhancer. These data suggested that the Elk-3 gene product plays a role in transcriptional regulation during embryogenesis. PMID:8892757

  2. Distance and Helical Phase Dependence of Synergistic Transcription Activation in cis-Regulatory Module

    PubMed Central

    Huang, Qilai; Gong, Chenguang; Li, Jiahuang; Zhuo, Zhu; Chen, Yuan; Wang, Jin; Hua, Zi-Chun

    2012-01-01

    Deciphering of the spatial and stereospecific constraints on synergistic transcription activation mediated between activators bound to cis-regulatory elements is important for understanding gene regulation and remains largely unknown. It has been commonly believed that two activators will activate transcription most effectively when they are bound on the same face of DNA double helix and within a boundary distance from the transcription initiation complex attached to the TATA box. In this work, we studied the spatial and stereospecific constraints on activation by multiple copies of bound model activators using a series of engineered relative distances and stereospecific orientations. We observed that multiple copies of the activators GAL4-VP16 and ZEBRA bound to engineered promoters activated transcription more effectively when bound on opposite faces of the DNA double helix. This phenomenon was not affected by the spatial relationship between the proximal activator and initiation complex. To explain these results, we proposed the novel concentration field model, which posits the effective concentration of bound activators, and therefore the transcription activation potential, is affected by their stereospecific positioning. These results could be used to understand synergistic transcription activation anew and to aid the development of predictive models for the identification of cis-regulatory elements. PMID:22299056

  3. Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor

    SciTech Connect

    Kroes, R.A. Northwestern Univ., Evanston, IL ); Abravaya, K.; Morimoto, R.I. ); Seidenfeld, J. )

    1991-06-01

    Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or {beta}-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes.

  4. Transcriptional trans activators of human and simian foamy viruses contain a small, highly conserved activation domain.

    PubMed Central

    Garrett, E D; He, F; Bogerd, H P; Cullen, B R

    1993-01-01

    The Bel-1 protein of human foamy virus is a potent transcriptional trans activator of its homologous long terminal repeat promoter element. Here, we demonstrate that Bel-1 can also efficiently activate gene expression when targeted to a heterologous promoter by fusion to the DNA-binding motif of the yeast GAL4 protein. Analysis of a series of deletion mutants of Bel-1 generated in this hybrid protein context suggests the presence of a single transcription activation domain that is fully contained within a discrete, approximately 30-amino-acid segment located proximal to the Bel-1 carboxy terminus. Although this short motif can be shown to function effectively in eukaryotic cells of mammalian, avian, and fungal origin, it does not bear any evident sequence homology to the known classes of eukaryotic activation domain. However, this Bel-1 activation domain was found to be fully conserved, in terms of both biological activity and location, in the distantly related Taf trans activator of simian foamy virus type 1. Images PMID:8411385

  5. Anti-activator ExsD Forms a 1:1 Complex with ExsA to Inhibit Transcription of Type III Secretion Operons*

    PubMed Central

    Thibault, Julie; Faudry, Eric; Ebel, Christine; Attree, Ina; Elsen, Sylvie

    2009-01-01

    The ExsA protein is a Pseudomonas aeruginosa transcriptional regulator of the AraC/XylS family that is responsible for activating the type III secretion system operons upon host cell contact. Its activity is known to be controlled in vivo through interaction with its negative regulator ExsD. Using a heterologous expression system, we demonstrated that ExsD is sufficient to inhibit the transcriptional activity of ExsA. Gel shift assays with ExsA- and ExsD-containing cytosolic extracts revealed that ExsD does not block DNA target sites but affects the DNA binding activity of the transcriptional activator. The ExsA-ExsD complex was purified after coproduction of the two partners in Escherichia coli. Size exclusion chromatography and ultracentrifugation analysis revealed a homogeneous complex with a 1:1 ratio. When in interaction with ExsD, ExsA is not able to bind to its specific target any longer, as evidenced by gel shift assays. Size exclusion chromatography further showed a partial dissociation of the complex in the presence of a specific DNA sequence. A model of the molecular inhibitory role of ExsD toward ExsA is proposed, in which, under noninducing conditions, the anti-activator ExsD sequesters ExsA and hinders its binding to DNA sites, preventing the transcription of type III secretion genes. PMID:19369699

  6. Transcriptional activation of RNA polymerase III-dependent genes by the human T-cell leukemia virus type 1 tax protein.

    PubMed Central

    Gottesfeld, J M; Johnson, D L; Nyborg, J K

    1996-01-01

    The human T-cell leukemia virus-encoded tax protein is a potent activator of many viral and cellular genes transcribed by RNA polymerase II. We find that both chromatin and cell extracts derived from human T-cell leukemia virus type 1-infected human T lymphocytes support higher levels of 5S rRNA and tRNA gene transcription than chromatin or extracts from uninfected T lymphocytes. The viral protein Tax was likely responsible for this higher level of class II gene transcription, as purified Tax was found to stimulate both genes when added to the uninfected cell extract or in reconstituted systems. Both limiting-component transcription assays and DNA binding assays identified the class III gene transcription factor TFIIIB as the principle target of Tax activity. Surprisingly, we find that Tax increases the effective concentration of active TFIIIB molecules. These data suggest that Tax stimulates RNA polymerase III-dependent gene expression by accelerating the rate and/or extent of transcription initiation complex assembly. PMID:8657153

  7. Transcriptional Activity of Erythroid Kruppel-like Factor (EKLF/KLF1) Modulated by PIAS3 (Protein Inhibitor of Activated STAT3)*

    PubMed Central

    Siatecka, Miroslawa; Soni, Shefali; Planutis, Antanas; Bieker, James J.

    2015-01-01

    Erythroid Kruppel-like factor (EKLF or KLF1) is a transcription factor crucial for red cell development that is directly involved in regulation of a large number of erythroid genes. EKLF serves mostly as an activator of expression of these genes; however, it can act also as a repressor. Here, we present evidence that EKLF interacts with proteins from the PIAS (protein inhibitor of activated STAT) family that convey repressive activity to EKLF in the absence of sumoylation. Our studies identify PIAS3 as a transcriptional corepressor of EKLF for at least a subset of its target genes during erythropoiesis (e.g. β-globin, α-hemoglobin stabilizing protein). We demonstrate an interaction between EKLF and PIAS proteins confirmed by in vivo coimmunoprecipitation assays with both exogenous and endogenous proteins. We identified an LXXLL signature motif located near the N terminus of PIAS proteins that, although not involved in the EKLF-PIAS3 interaction, is required for the transrepression activity. Knockdown of endogenous PIAS3 accelerates differentiation of both murine erythroleukemia cells, as well as fetal liver cells, whereas an increase in PIAS3 levels inhibits this increase. Using chromatin immunoprecipitation assays, we show that PIAS3 preferentially occupies the β-globin promoter in undifferentiated murine erythroleukemia cells. Together these results demonstrate that an interaction between EKLF and PIAS3 provides a novel mode of regulation of EKLF activity in the absence of sumolylation and furthermore shows an important involvement of PIAS proteins in erythropoiesis. PMID:25713074

  8. Down syndrome critical region 2 protein inhibits the transcriptional activity of peroxisome proliferator-activated receptor {beta} in HEK293 cells

    SciTech Connect

    Song, Hae Jin; Park, Joongkyu; Seo, Su Ryeon; Kim, Jongsun; Paik, Seung R.; Chung, Kwang Chul

    2008-11-21

    Down syndrome is mainly caused by a trisomy of chromosome 21. The Down syndrome critical region 2 (DSCR2) gene is located within a part of chromosome 21, the Down syndrome critical region (DSCR). To investigate the function of DSCR2, we sought to identify DSCR2-interacting proteins using yeast two-hybrid assays. A human fetal brain cDNA library was screened, and DSCR2 was found to interact with a member of the nuclear receptor superfamily, peroxisome proliferator-activated receptor {beta}, (PPAR{beta}). A co-immunoprecipitation assay demonstrated that DSCR2 physically interacts with PPAR{beta} in mammalian HEK293 cells. DSCR2 also inhibited the ligand-induced transcriptional activity of PPAR{beta}. Furthermore, PPAR{beta} also decreased the solubility of DSCR2, which increased levels of insoluble DSCR2.

  9. The cellular bromodomain protein Brd4 has multiple functions in E2-mediated papillomavirus transcription activation.

    PubMed

    Helfer, Christine M; Yan, Junpeng; You, Jianxin

    2014-08-01

    The cellular bromodomain protein Brd4 functions in multiple processes of the papillomavirus life cycle, including viral replication, genome maintenance, and gene transcription through its interaction with the viral protein, E2. However, the mechanisms by which E2 and Brd4 activate viral transcription are still not completely understood. In this study, we show that recruitment of positive transcription elongation factor b (P-TEFb), a functional interaction partner of Brd4 in transcription activation, is important for E2's transcription activation activity. Furthermore, chromatin immunoprecipitation (ChIP) analyses demonstrate that P-TEFb is recruited to the actual papillomavirus episomes. We also show that E2's interaction with cellular chromatin through Brd4 correlates with its papillomavirus transcription activation function since JQ1(+), a bromodomain inhibitor that efficiently dissociates E2-Brd4 complexes from chromatin, potently reduces papillomavirus transcription. Our study identifies a specific function of Brd4 in papillomavirus gene transcription and highlights the potential use of bromodomain inhibitors as a method to disrupt the human papillomavirus (HPV) life cycle. PMID:25140737

  10. Indirubin derivatives alter DNA binding activity of the transcription factor NF-Y and inhibit MDR1 gene promoter.

    PubMed

    Tanaka, Toru; Ohashi, Sachiyo; Saito, Hiroaki; Higuchi, Takashi; Tabata, Keiichi; Kosuge, Yasuhiro; Suzuki, Takashi; Miyairi, Shinichi; Kobayashi, Shunsuke

    2014-10-15

    Indirubin derivatives exert antitumor activity. However, their effects on the expression of multidrug resistance gene 1 (MDR1) have not been investigated. Here we found three derivatives that inhibit the MDR1 gene promoter. To investigate the effects of indirubins on the DNA binding of NF-Y, a major MDR1 gene transcription factor that recognizes an inverted CCAAT element in the promoter, gel mobility shift assay was performed using the element as a probe with nuclear extracts from NG108-15, MCF7, HepG2, C2C12, and SK-N-SH cells. Among 17 compounds, 5-methoxyindirubin inhibited the DNA binding of NF-Y significantly, whereas indirubin-3'-oxime and 7-methoxyindirubin 3'-oxime increased the binding considerably. After evaluating a suitable concentration of each compound for transcription analysis using living tumor cells, we performed a reporter gene assay using a reporter DNA plasmid containing EGFP cDNA fused to the MDR1 gene promoter region. Indirubin-3'-oxime exerted a significant inhibitory effect on the MDR1 promoter activity in MCF7 and HepG2 cells, and 5-methoxyindirubin inhibited the activity only in MCF7 cells; 7-methoxyindirubin 3'-oxime suppressed the activity in all of the cell lines. We further confirmed that the compounds reduced endogenous MDR1 transcription without any inhibitory effect on NF-Y expression. Moreover, each compound increased the doxorubicin sensitivity of MCF7 cells. These results indicate that each indirubin derivative acts on the DNA binding of NF-Y and represses the MDR1 gene promoter with tumor cell-type specificity. PMID:25066113

  11. Heterogeneous nuclear ribonucleoprotein K and nucleolin as transcriptional activators of the vascular endothelial growth factor promoter through interaction with secondary DNA structures

    PubMed Central

    Uribe, Diana J.; Guo, Kexiao; Shin, Yoon-Joo; Sun, Daekyu

    2011-01-01

    The human vascular endothelial growth factor (VEGF) promoter contains a polypurine/polypyrimidine (pPu/pPy) tract that is known to play a critical role in its transcriptional regulation. This pPu/pPy tract undergoes a conformational transition between B-DNA, single stranded DNA and atypical secondary DNA structures such as G-quadruplexes and i-motifs. We studied the interaction of the cytosine-rich (C-rich) and guanine-rich (G-rich) strands of this tract with transcription factors heterogeneous nuclear ribonucleoprotein (hnRNP) K and nucleolin, respectively, both in vitro and in vivo and their potential role in the transcriptional control of VEGF. Using chromatin immunoprecipitation (ChIP) assay for our in vivo studies and electrophoretic mobility shift assay (EMSA) for our in vitro studies, we demonstrated that both nucleolin and hnRNP K bind selectively to the G- and C-rich sequences, respectively, in the pPu/pPy tract of the VEGF promoter. The small interfering RNA (siRNA)-mediated silencing of either nucleolin or hnRNP K resulted in the down-regulation of basal VEGF gene, suggesting that they act as activators of VEGF transcription. Taken together, the identification of transcription factors that can recognize and bind to atypical DNA structures within the pPu/pPy tract will provide new insight into mechanisms of transcriptional regulation of the VEGF gene. PMID:21466159

  12. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.

    PubMed

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-04-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  13. Interlaboratory comparison of four in vitro assays for assessing androgenic and antiandrogenic activity of environmental chemicals.

    PubMed Central

    Körner, Wolfgang; Vinggaard, Anne Marie; Térouanne, Béatrice; Ma, Risheng; Wieloch, Carise; Schlumpf, Margret; Sultan, Charles; Soto, Ana M

    2004-01-01

    We evaluated and compared four in vitro assays to detect androgen agonists and antagonists in an international interlaboratory study. Laboratory 1 used a cell proliferation assay (assay 1) with human mammary carcinoma cells stably transfected with human androgen receptor. The other laboratories used reporter gene assays, two based on stably transfected human prostate carcinoma cells (assay 2) or human mammary carcinoma cells (assay 4), and the third based on transient transfection of Chinese hamster ovary cells (assay 3). Four laboratories received four coded compounds and two controls: two steroidal androgens, two antiandrogens, an androgenic control, 5alpha-dihydrotestosterone (DHT), and an antiandrogenic control, bicalutamide (ICI 176,334). All laboratories correctly detected the androgenic activity of 4-androsten-3,17-dione and 17alpha-methyltestosterone. For both compounds, the calculated androgenic potencies relative to the positive control (RAPs) remained within one order of magnitude. However, laboratory 3 calculated a 50-fold higher RAP for 4-androsten-3,17-dione. All assays detected and quantified the antiandrogenic effect of vinclozolin [median inhibitory concentration (IC50) values ranging from 1.1 times symbol 10(-7) M to 4.7 times symbol 10(-7) M]. In assays 2 and 3, vinclozolin showed partial androgenic activity at the highest concentrations tested. For vinclozolin, calculated antiandrogenic potencies relative to bicalutamide (RAAPs) differed no more than a factor of 10, and IC50 values matched those of bicalutamide. Similarly, we found antiandrogenic activity for tris-(4-chlorophenyl)methanol. RAAP values were between 0.086 and 0.37. Three assays showed cytotoxicity for this compound at or above 1 times symbol 10(-5) M. In summary, all assays proved sensitive screening tools to detect and quantify androgen receptor-mediated androgenic and antiandrogenic effects of these chemicals accurately, with coefficients of variation between 8 and 90%. PMID

  14. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts

    PubMed Central

    Pandian, Ganesh N.; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D.; Sugiyama, Hiroshi

    2014-01-01

    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation. PMID:24457603

  15. POSSIBLE ERRORS IN ASSAY FOR B-GLYCOSIDASE ACTIVITY

    EPA Science Inventory

    Because intestinal B-glycosidase enzymes activate the toxicity and/or carcinogenicity of many environmental chemicals, accurate analysis of their activities is toxicologically important. owever, previous work in this lab indicated that widespread use of the glycosides of p-nitrop...

  16. Disk Diffusion Assay to Assess the Antimicrobial Activity of Marine Algal Extracts.

    PubMed

    Desbois, Andrew P; Smith, Valerie J

    2015-01-01

    Marine algae are a relatively untapped source of bioactive natural products, including those with antimicrobial activities. The ability to assess the antimicrobial activity of cell extracts derived from algal cultures is vital to identifying species that may produce useful novel antibiotics. One assay that is used widely for this purpose is the disk diffusion assay due to its simplicity, rapidity, and low cost. Moreover, this assay gives output data that are easy to interpret and can be used to screen many samples at once irrespective of the solvent used during preparation. In this chapter, a step-by-step protocol for performing a disk diffusion assay is described. The assay is particularly well suited to testing algal cell extracts and fractions resulting from separation through bioassay-guided approaches. PMID:26108520

  17. Imaging techniques for assaying lymphocyte activation in action

    PubMed Central

    Balagopalan, Lakshmi; Sherman, Eilon; Barr, Valarie A.; Samelson, Lawrence E.

    2012-01-01

    Imaging techniques have greatly improved our understanding of lymphocyte activation. Technical advances in spatial and temporal resolution and new labelling tools have enabled researchers to directly observe the activation process. Consequently, research using imaging approaches to study lymphocyte activation has expanded, providing an unprecedented level of cellular and molecular detail in the field. As a result, certain models of lymphocyte activation have been verified, others have been revised and yet others have been replaced with new concepts. In this article, we review the current imaging techniques that are used to assess lymphocyte activation in different contexts, from whole animals to single molecules, and discuss the advantages and potential limitations of these methods. PMID:21179118

  18. Regulation of selected genome loci using de novo-engineered transcription activator-like effector (TALE)-type transcription factors

    PubMed Central

    Morbitzer, Robert; Römer, Patrick; Boch, Jens; Lahaye, Thomas

    2010-01-01

    Proteins that can be tailored to bind desired DNA sequences are key tools for molecular biology. Previous studies suggested that DNA-binding specificity of transcription activator-like effectors (TALEs) from the bacterial genus Xanthomonas is defined by repeat-variable diresidues (RVDs) of tandem-arranged 34/35-amino acid repeat units. We have studied chimeras of two TALEs differing in RVDs and non-RVDs and found that, in contrast to the critical contributions by RVDs, non-RVDs had no major effect on the DNA-binding specificity of the chimeras. This finding suggests that one needs only to modify the RVDs to generate designer TALEs (dTALEs) to activate transcription of user-defined target genes. We used the scaffold of the TALE AvrBs3 and changed its RVDs to match either the tomato Bs4, the Arabidopsis EGL3, or the Arabidopsis KNAT1 promoter. All three dTALEs transcriptionally activated the desired promoters in a sequence-specific manner as mutations within the targeted DNA sequences abolished promoter activation. This study is unique in showing that chromosomal loci can be targeted specifically by dTALEs. We also engineered two AvrBs3 derivatives with four additional repeat units activating specifically either the pepper Bs3 or UPA20 promoter. Because AvrBs3 activates both promoters, our data show that addition of repeat units facilitates TALE-specificity fine-tuning. Finally, we demonstrate that the RVD NK mediates specific interaction with G nucleotides that thus far could not be targeted specifically by any known RVD type. In summary, our data demonstrate that the TALE scaffold can be tailored to target user-defined DNA sequences in whole genomes. PMID:21106758

  19. Rapid Simultaneous Detection of Enterovirus and Parechovirus RNAs in Clinical Samples by One-Step Real-Time Reverse Transcription-PCR Assay

    PubMed Central

    Bennett, Susan; Harvala, Heli; Witteveldt, Jeroen; McWilliam Leitch, E. Carol; McLeish, Nigel; Templeton, Kate; Gunson, Rory; Carman, William F.; Simmonds, Peter

    2011-01-01

    Enteroviruses (EVs) are recognized as the major etiological agent in meningitis in children and young adults. The use of molecular techniques, such as PCR, has substantially improved the sensitivity of enterovirus detection compared to that of virus culture methods. PCR-based methods also can detect a much wider range of EV variants, including those within species A, as well as human parechoviruses (HPeVs) that often grow poorly in vitro and which previously have been underdiagnosed by traditional methods. To exploit these developments, we developed a real-time one-step reverse transcription-PCR (RT-PCR) for the rapid and sensitive detection of EV and HPeV in clinical specimens. Two commercially available RT-PCR kits were used (method I, Platinum one-step kit; method II, Express qPCR one-step kit) with primers and probes targeting the EV and HPeV 5′-untranslated regions (5′UTR). Amplification dynamics (threshold cycle [CT]values and efficiencies) of absolutely quantified full-length RNA transcripts representative of EV species A to D and HPeV were similar, demonstrating the effectiveness of both assays across the range of currently described human EV and HPeV variants. Probit analysis of multiple endpoint replicates demonstrated comparable sensitivities of the assays for EV and HPeV (method I, approximately 10 copies per reaction for both targets; method II, 20 copies per reaction). CT values were highly reproducible on repeat testing of positive controls within assays and between assay runs. Considering the sample turnaround time of less than 3 h, the multiplexed one-step RT-PCR method provides rapid diagnostic testing for EV and HPeV in cases of suspected central nervous system infections in a clinically relevant time frame. PMID:21593263

  20. Development of a Real-Time, TaqMan Reverse Transcription-PCR Assay for Detection and Differentiation of Lyssavirus Genotypes 1, 5, and 6

    PubMed Central

    Wakeley, P. R.; Johnson, N.; McElhinney, L. M.; Marston, D.; Sawyer, J.; Fooks, A. R.

    2005-01-01

    Several reverse transcription-PCR (RT-PCR) methods have been reported for the detection of rabies and rabies-related viruses. These methods invariably involve multiple transfers of nucleic acids between different tubes, with the risk of contamination leading to the production of false-positive results. Here we describe a single, closed-tube, nonnested RT-PCR with TaqMan technology that distinguishes between classical rabies virus (genotype 1) and European bat lyssaviruses 1 and 2 (genotypes 5 and 6) in real time. The TaqMan assay is rapid, sensitive, and specific and allows for the genotyping of unknown isolates concomitant with the RT-PCR. The assay can be applied quantitatively and the use of an internal control enables the quality of the isolated template to be assessed. Despite sequence heterogeneity in the N gene between the different genotypes, a universal forward and reverse primer set has been designed, allowing for the simplification of previously described assays. We propose that within a geographically constrained area, this assay will be a useful tool for the detection and differentiation of members of the Lyssavirus genus. PMID:15956398

  1. A method for simultaneous detection and identification of Brazilian dog- and vampire bat-related rabies virus by reverse transcription loop-mediated isothermal amplification assay.

    PubMed

    Saitou, Yasumasa; Kobayashi, Yuki; Hirano, Shinji; Mochizuki, Nobuyuki; Itou, Takuya; Ito, Fumio H; Sakai, Takeo

    2010-09-01

    At present, the sporadic occurrence of human rabies in Brazil can be attributed primarily to dog- and vampire bat-related rabies viruses. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) was employed as a simultaneous detection method for both rabies field variants within 60 min. Vampire bat-related rabies viruses could be distinguished from dog variants by digesting amplicons of the RT-LAMP reaction using the restriction enzyme AlwI. Amplification and digestion could both be completed within 120 min after RNA extraction. In addition, the RT-LAMP assay also detected rabies virus in isolates from Brazilian frugivorous bats and Ugandan dog, bovine and goat samples. In contrast, there were false negative results from several Brazilian insectivorous bats and all of Chinese dog, pig, and bovine samples using the RT-LAMP assay. This study showed that the RT-LAMP assay is effective for the rapid detection of rabies virus isolates from the primary reservoir in Brazil. Further improvements are necessary so that the RT-LAMP assay can be employed for the universal detection of genetic variants of rabies virus in the field. PMID:20403387

  2. HSP90 inhibitors enhance differentiation and MITF (microphthalmia transcription factor) activity in osteoclast progenitors.

    PubMed

    van der Kraan, A Gabrielle J; Chai, Ryan C C; Singh, Preetinder P; Lang, Benjamin J; Xu, Jiake; Gillespie, Matthew T; Price, John T; Quinn, Julian M W

    2013-04-15

    The HSP90 (heat-shock protein 90) inhibitor 17-AAG (17-allylamino-demethoxygeldanamycin) increases osteoclast formation both in vitro and in vivo, an action that can enhance cancer invasion and growth in the bone microenvironment. The cellular mechanisms through which 17-AAG exerts this action are not understood. Thus we sought to clarify the actions of 17-AAG on osteoclasts and determine whether other HSP90 inhibitors had similar properties. We determined that 17-AAG and the structurally unrelated HSP90 inhibitors CCT018159 and NVP-AUY922 dose-dependently increased RANKL [receptor activator of NF-κB (nuclear factor κB) ligand]-stimulated osteoclastogenesis in mouse bone marrow and pre-osteoclastic RAW264.7 cell cultures. Moreover, 17-AAG also enhanced RANKL- and TNF (tumour necrosis factor)-elicited osteoclastogenesis, but did not affect RANKL-induced osteoclast survival, suggesting that only differentiation mechanisms are targeted. 17-AAG affected the later stages of progenitor maturation (after 3 days of incubation), whereas the osteoclast formation enhancer TGFβ (transforming growth factor β) acted prior to this, suggesting different mechanisms of action. In studies of RANKL-elicited intracellular signalling, 17-AAG treatment did not increase c-Fos or NFAT (nuclear factor of activated T-cells) c1 protein levels nor did 17-AAG increase activity in luciferase-based NF-κB- and NFAT-response assays. In contrast, 17-AAG treatment (and RANKL treatment) increased both MITF (microphthalmia-associated transcription factor) protein levels and MITF-dependent vATPase-d2 (V-type proton ATPase subunit d2) gene promoter activity. These results indicate that HSP90 inhibitors enhance osteoclast differentiation in an NFATc1-independent manner that involves elevated MITF levels and activity. PMID:23379601

  3. Inhibition of human insulin gene transcription by peroxisome proliferator-activated receptor γ and thiazolidinedione oral antidiabetic drugs

    PubMed Central

    Schinner, S; Krätzner, R; Baun, D; Dickel, C; Blume, R; Oetjen, E

    2009-01-01

    Background and purpose: The transcription factor peroxisome proliferator-activated receptor γ (PPARγ) is essential for glucose homeostasis. PPARγ ligands reducing insulin levels in vivo are used as drugs to treat type 2 diabetes mellitus. Genes regulated by PPARγ have been found in several tissues including insulin-producing pancreatic islet β-cells. However, the role of PPARγ at the insulin gene was unknown. Therefore, the effect of PPARγ and PPARγ ligands like rosiglitazone on insulin gene transcription was investigated. Experimental approach: Reporter gene assays were used in the β-cell line HIT and in primary mature pancreatic islets of transgenic mice. Mapping studies and internal mutations were carried out to locate PPARγ-responsive promoter regions. Key results: Rosiglitazone caused a PPARγ-dependent inhibition of insulin gene transcription in a β-cell line. This inhibition was concentration-dependent and had an EC50 similar to that for the activation of a reporter gene under the control of multimerized PPAR binding sites. Also in normal primary pancreatic islets of transgenic mice, known to express high levels of PPARγ, rosiglitazone inhibited glucose-stimulated insulin gene transcription. Transactivation and mapping experiments suggest that, in contrast to the rat glucagon gene, the inhibition of the human insulin gene promoter by PPARγ/rosiglitazone does not depend on promoter-bound Pax6 and is attributable to the proximal insulin gene promoter region around the transcription start site from −56 to +18. Conclusions and implications: The human insulin gene represents a novel PPARγ target that may contribute to the action of thiazolidinediones in type 2 diabetes mellitus. PMID:19338578

  4. Synergistic cooperation of MDM2 and E2F1 contributes to TAp73 transcriptional activity

    SciTech Connect

    Kasim, Vivi; Huang, Can; Zhang, Jing; Jia, Huizhen; Wang, Yunxia; Yang, Li; Miyagishi, Makoto; Wu, Shourong

    2014-07-04

    Highlights: • MDM2 is a novel positive regulator of TAp73 transcriptional activity. • MDM2 colocalizes together and physically interacts with E2F1. • Synergistic cooperation of MDM2 and E2F1 is crucial for TAp73 transcription. • MDM2 regulates TAp73 transcriptional activity in a p53-independent manner. - Abstract: TAp73, a structural homologue of p53, plays an important role in tumorigenesis. E2F1 had been reported as a transcriptional regulator of TAp73, however, the detailed mechanism remains to be elucidated. Here we reported that MDM2-silencing reduced the activities of the TAp73 promoters and the endogenous TAp73 expression level significantly; while MDM2 overexpression upregulated them. We further revealed that the regulation of TAp73 transcriptional activity occurs as a synergistic effect of MDM2 and E2F1, most probably through their physical interaction in the nuclei. Furthermore, we also suggested that MDM2 might be involved in DNA damage-induced TAp73 transcriptional activity. Finally, we elucidated that MDM2-silencing reduced the proliferation rate of colon carcinoma cells regardless of the p53 status. Our data show a synergistic effect of MDM2 and E2F1 on TAp73 transcriptional activity, suggesting a novel regulation pathway of TAp73.

  5. An improvement of Barter's method for assaying plasma cholesterol ester transfer activity: experimental and clinical applications.

    PubMed

    Harvengt, C; Desager, J P; Mailleux, P; Heller, F R

    1989-01-01

    The use of a discontinuous density gradient and of a vertical rotor to separate plasma lipoproteins are modifications of Barter's described method for assaying cholesteryl ester transfer activity (CETA) in plasma. The original feature of our approach is the fast preparation of the labeled substrate by a physiologic-like process, which renders the assay easy and suitable for measurement of this activity in both man and animals. PMID:2730951

  6. A novel 96-well gel-based assay for determining antifungal activity against filamentous fungi.

    PubMed

    Troskie, Anscha Mari; Vlok, Nicolas Maré; Rautenbach, Marina

    2012-12-01

    In recent years the global rise in antibiotic resistance and environmental consciousness lead to a renewed fervour to find and develop novel antibiotics, including antifungals. However, the influence of the environment on antifungal activity is often disregarded and many in vitro assays may cause the activity of certain antifungals to be overestimated or underestimated. The general antifungal test assays that are economically accessible to the majority of scientists primarily rely on visual examination or on spectrophotometric analysis. The effect of certain morphogenic antifungals, which may lead to hyperbranching of filamentous fungi, unfortunately renders these methods unreliable. To minimise the difficulties experienced as a result of hyperbranching, we developed a straightforward, economical 96-well gel-based method, independent of spectrophotometric analysis, for highly repeatable determination of antifungal activity. For the calculation of inhibition parameters, this method relies on the visualisation of assay results by digitisation. The antifungal activity results from our novel micro-gel dilution assay are comparable to that of the micro-broth dilution assay used as standard reference test of The Clinical and Laboratory Standard Institute. Furthermore, our economical assay is multifunctional as it permits microscopic analysis of the preserved assay results, as well as rendering highly reliable data. PMID:23089670

  7. A new formula to calculate activity of superoxide dismutase in indirect assays.

    PubMed

    Zhang, Chen; Bruins, Marieke E; Yang, Zhi-Qiang; Liu, Shu-Tao; Rao, Ping-Fan

    2016-06-15

    To calculate superoxide dismutase (SOD) activity rapidly and accurately by indirect SOD assays, a formula based on the ratio of the catalytic speed of SOD to the reaction speed of the indicator with superoxide anion was deduced. The accuracy of this formula was compared with the conventional formula based on inhibition in five indirect SOD assays. The new formula was validated in nearly the entire SOD activity range, whereas the conventional formula was validated only during inhibition of 40-60%. This formula might also be used for the assays of other enzymes. PMID:27033009

  8. A Bioluminescence Assay System for Imaging Metal Cationic Activities in Urban Aerosols.

    PubMed

    Kim, Sung-Bae; Naganawa, Ryuichi; Murata, Shingo; Nakayama, Takayoshi; Miller, Simon; Senda, Toshiya

    2016-01-01

    A bioluminescence-based assay system was fabricated for an efficient determination of the activities of air pollutants. The following four components were integrated into this assay system: (1) an 8-channel assay platform uniquely designed for simultaneously sensing multiple optical samples, (2) single-chain probes illuminating toxic chemicals or heavy metal cations from air pollutants, (3) a microfluidic system for circulating medium mimicking the human body, and (4) the software manimulating the above system. In the protocol, we briefly introduce how to integrate the components into the system and the application to the illumination of the metal cationic activities in air pollutants. PMID:27424913

  9. HMGA proteins as modulators of chromatin structure during transcriptional activation

    PubMed Central

    Ozturk, Nihan; Singh, Indrabahadur; Mehta, Aditi; Braun, Thomas; Barreto, Guillermo

    2013-01-01

    High mobility group (HMG) proteins are the most abundant non-histone chromatin associated proteins. HMG proteins bind to DNA and nucleosome and alter the structure of chromatin locally and globally. Accessibility to DNA within chromatin is a central factor that affects DNA-dependent nuclear processes, such as transcription, replication, recombination, and repair. HMG proteins associate with different multi-protein complexes to regulate these processes by mediating accessibility to DNA. HMG proteins can be subdivided into three families: HMGA, HMGB, and HMGN. In this review, we will focus on recent advances in understanding the function of HMGA family members, specifically their role in gene transcription regulation during development and cancer. PMID:25364713

  10. Chromatin dynamics associated with HIV-1 Tat activated transcription

    PubMed Central

    Easley, Rebecca; Van Duyne, Rachel; Coley, Will; Guendel, Irene; Dadgar, Sherry; Kehn-Hall, Kylene; Kashanchi, Fatah

    2009-01-01

    Summary Chromatin remodeling is an essential event for HIV-1 transcription. Over the last two decades this field of research has come to the forefront, as silencing of the HIV-1 provirus through chromatin modifications has been linked to latency. Here, we focus on chromatin remodeling, especially in relation to the transactivator Tat, and review the most important and newly emerging studies that investigate remodeling mechanisms. We begin by discussing covalent modifications that can alter chromatin structure including acetylation, deacetylation, and methylation, as well as topics addressing the interplay between chromatin remodeling and splicing. Next, we focus on complexes that use the energy of ATP to remove or secure nucleosomes and can additionally act to control HIV-1 transcription. Finally, we cover recent literature on viral microRNAs which have been shown to alter chromatin structure by inducing methylation or even by remodeling nucleosomes. PMID:19716452

  11. A Homogeneous Cell-Based Assay for Measurement of Endogenous PON1 Activity

    PubMed Central

    Ahmad, Syed; Carter, Jade J.; Scott, John E.

    2010-01-01

    PON1 is a high density lipoprotein-associated enzyme that plays an important role in organophosphate detoxification and prevention of atherosclerosis. Thus, there is significant interest in identifying nutritional and pharmacological enhancers of PON1 activity. In order to identify such compounds, we developed a rapid homogeneous assay to detect endogenous cell-associated PON1 activity. PON1 activity was measured by the simple addition of fluorigenic PON1 substrate DEPFMU to live Huh7 cells in media and monitoring change in fluorescence. A specific PON1 inhibitor, 2-hydroxyquinoline, was used to confirm that the observed activity was due to PON1. The assay was optimized and characterized with regard to time course, substrate and sodium chloride concentration, number of cells and tolerance to DMSO and serum. Aspirin, quercetin and simvastatin are compounds reported to increase PON1 expression. Consistent with the literature and western blot data, these compounds enhanced PON1 activity in this assay with comparable efficacies and potencies. A known toxic compound did not increase assay signal. This assay method also detected PON1 activity in normal hepatocytes. Thus, a novel, homogenous assay for detection of endogenous PON1 expression has been developed and is amenable to high throughput screening for the identification of small molecules that enhance PON1 expression. PMID:20096260

  12. Thyroid hormone receptor inhibits hepatoma cell migration through transcriptional activation of Dickkopf 4

    SciTech Connect

    Chi, Hsiang-Cheng; Liao, Chen-Hsin; Huang, Ya-Hui; Wu, Sheng-Ming; Tsai, Chung-Ying; Liao, Chia-Jung; Tseng, Yi-Hsin; Lin, Yang-Hsiang; Chen, Cheng-Yi; Chung, I-Hsiao; Wu, Tzu-I; Chen, Wei-Jan; Lin, Kwang-Huei

    2013-09-13

    Highlights: •T{sub 3} affects DKK4 mRNA and protein expression in HepG2-TR cells. •Regulation of DKK4 by T{sub 3} is at transcriptional level. •DKK4 overexpression suppresses hepatoma cell metastasis. -- Abstract: Triiodothyronine (T{sub 3}) is a potent form of thyroid hormone mediates several physiological processes including cellular growth, development, and differentiation via binding to the nuclear thyroid hormone receptor (TR). Recent studies have demonstrated critical roles of T{sub 3}/TR in tumor progression. Moreover, long-term hypothyroidism appears to be associated with the incidence of human hepatocellular carcinoma (HCC), independent of other major HCC risk factors. Dickkopf (DKK) 4, a secreted protein that antagonizes the canonical Wnt signaling pathway, is induced by T{sub 3} at both mRNA and protein levels in HCC cell lines. However, the mechanism underlying T{sub 3}-mediated regulation of DKK4 remains unknown. In the present study, the 5′ promoter region of DKK4 was serially deleted, and the reporter assay performed to localize the T{sub 3} response element (TRE). Consequently, we identified an atypical direct repeat TRE between nucleotides −1645 and −1629 conferring T{sub 3} responsiveness to the DKK4 gene. This region was further validated using chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assay (EMSA). Stable DKK4 overexpression in SK-Hep-1 cells suppressed cell invasion and metastatic potential, both in vivo andin vitro, via reduction of matrix metalloproteinase-2 (MMP-2) expression. Our findings collectively suggest that DKK4 upregulated by T{sub 3}/TR antagonizes the Wnt signal pathway to suppress tumor cell progression, thus providing new insights into the molecular mechanism underlying thyroid hormone activity in HCC.

  13. Effect of mimetic CDK9 inhibitors on HIV-1 activated transcription

    PubMed Central

    Van Duyne, Rachel; Guendel, Irene; Jaworski, Elizabeth; Sampey, Gavin; Klase, Zachary; Chen, Hao; Zeng, Chen; Kovalskyy, Dmytro; el Kouni, Mahmoud H.; Lepene, Benjamin; Patanarut, Alexis; Nekhai, Sergei; Price, David H.; Kashanchi, Fatah

    2013-01-01

    Potent antiretroviral therapy (ART) has transformed HIV-1 infection into a chronic manageable disease; however drug resistance remains a common problem that limits the effectiveness and clinical benefits of this type of treatment. The discovery of viral reservoirs in the body, in which HIV-1 may persist, has helped to explain why therapeutic eradication of HIV-1 has proved so difficult. In the current study we utilized a combination of structure based analysis of Cyclin/CDK complexes with our previously published Tat peptide derivatives. We modeled the Tat peptide inhibitors with CDKs and found a particular pocket which showed the most stable binding site (Cavity 1) using in silico analysis. Furthermore, we were able to find peptide mimetics that bound to similar regions using in silico searches of a chemical library, followed by cell based biological assays. Using these methods we obtained the first generation mimetic drugs and tested these compounds on HIV-1 LTR activated transcription. Using biological assays followed by similar in silico analysis to find a 2nd generation drugs resembling the original mimetic, we found the new targets of Cavity 1 and Cavity 2 regions on CDK9. We examined the 2nd generation mimetic against various viral isolates, and observed a generalized suppression of most HIV-1 isolates. Finally, the drug inhibited viral replication in humanized mouse models of Rag2-/-γc-/- with no toxicity to the animals at tested concentrations. Our results suggest that it may be possible to model peptide inhibitors into available crystal structures and further find drug mimetics using in silico analysis. PMID:23247501

  14. Regulation of WT1 by phosphorylation: inhibition of DNA binding, alteration of transcriptional activity and cellular translocation.

    PubMed Central

    Ye, Y; Raychaudhuri, B; Gurney, A; Campbell, C E; Williams, B R

    1996-01-01

    Phosphorylation is one of the major post-translational mechanisms by which the activity of transcription factors is regulated. We have investigated the role of phosphorylation in the regulation of nucleic acid binding activity and the nuclear translocation of WT1. Two recombinant WT1 proteins containing the DNA binding domain with or without a three amino acid (KTS) insertion (WT1ZF + KTS and WT1ZF - KTS) were strongly phosphorylated by protein kinase A (PKA) and protein kinase C (PKC) in vitro. Both PKA and PKC phosphorylation inhibited the ability of WT1ZF + KTS or WT1ZF - KTS to bind to a sequence derived from the WT1 promoter region in gel mobility shift assays. The binding of WT1ZF - KTS to an EGR1 consensus binding site was also inhibited by prior PKA and PKC phosphorylation. We also demonstrate the RNA binding activity of WT1, but this was not altered by phosphorylation. PKA activation by dibutyryl cAMP in WT1-transfected cells resulted in the reversal of WT1 suppression of a reporter construct. Although WT1 protein is predominantly localized to the nucleus, this expression pattern is altered upon PKA activation, resulting in the cytoplasmic retention of WT1. Accordingly, phosphorylation may play a role in modulating the transcriptional regulatory activity of WT1 through interference with nuclear translocation, as well as by inhibition of WT1 DNA binding. Images PMID:8896454

  15. Functional analysis of differences in transcriptional activity conferred by genetic variants in the 5' flanking region of the IL12RB2 gene.

    PubMed

    Kato-Kogoe, Nahoko; Ohyama, Hideki; Okano, Soichiro; Yamanegi, Koji; Yamada, Naoko; Hata, Masaki; Nishiura, Hiroshi; Abiko, Yoshimitsu; Terada, Nobuyuki; Nakasho, Keiji

    2016-01-01

    Interleukin 12 receptor β chain (IL12RB2) is a crucial regulatory factor involved in cell-mediated immune responses, and genetic variants of the gene encoding IL12RB2 are associated with susceptibility to various immune-related diseases. We previously demonstrated that haplotypes with single nucleotide polymorphisms (SNPs) in the 5' flanking region of IL12RB2, including -1035A>G (rs3762315) and -1023A>G (rs3762316), affect the expression of IL12RB2, thereby altering susceptibility to leprosy and periodontal diseases. In the present study, we identified transcription factors associated with the haplotype-specific transcriptional activity of IL12RB2 in T cells and NK cells. The -1023G polymorphism was found to create a consensus binding site for the transcription factor activating protein (AP)-1, and enzyme-linked immunosorbent assay (ELISA)-based binding assays showed that these SNPs enhanced AP-1 binding to this region. In reporter assays, suppression of JunB expression using siRNA eliminated differences in the -1035G/-1023G and -1035A/-1023A regions containing IL12RB2 promoter activity in Jurkat T cells and NK3.3 cells. These results suggested that the -1035/-1023 polymorphisms created differential binding affinities for JunB that could lead to differential IL12RB2 expression. Moreover, the -1035G and -1035A alleles formed binding sites for GATA-3 and myocyte enhancer factor-2 (MEF-2), respectively. Our data indicated that in addition to JunB, the SNP at -1035/-1023 influenced GATA-3 and MEF-2 binding affinity, potentially altering IL12RB2 transcriptional activity. These findings confirm the effects of rs3762315 and rs3762316 on IL12RB2 transcription. These genetic variants may alter cellular activation of T cells and NK cells and modify cell-mediated immune responses. PMID:26552659

  16. On the way of revealing coactivator complexes cross-talk during transcriptional activation.

    PubMed

    Krasnov, Aleksey N; Mazina, Marina Yu; Nikolenko, Julia V; Vorobyeva, Nadezhda E

    2016-01-01

    Transcriptional activation is a complex, multistage process implemented by hundreds of proteins. Many transcriptional proteins are organized into coactivator complexes, which participate in transcription regulation at numerous genes and are a driver of this process. The molecular action mechanisms of coactivator complexes remain largely understudied. Relevant publications usually deal with the involvement of these complexes in the entire process of transcription, and only a few studies are aimed to elucidate their functions at its particular stages. This review summarizes available information on the participation of key coactivator complexes in transcriptional activation. The timing of coactivator complex binding/removal has been used for restructuring previously described information about the transcriptional process. Several major stages of transcriptional activation have been distinguished based on the presence of covalent histone modifications and general transcriptional factors, and the recruitment and/or removal phases have been determined for each coactivator included in analysis. Recruitment of Mediator, SWItch/Sucrose Non-Fermentable and NUcleosome Remodeling Factor complexes during transcription activation has been investigated thoroughly; CHD and INOsitol auxotrophy 80 families are less well studied. In most cases, the molecular mechanisms responsible for the removal of certain coactivator complexes after the termination of their functions at the promoters are still not understood. On the basis of the summarized information, we propose a scheme that illustrates the involvement of coactivator complexes in different stages of the transcription activation process. This scheme may help to gain a deeper insight into the molecular mechanism of functioning of coactivator complexes, find novel participants of the process, and reveal novel structural or functional connections between different coactivators. PMID:26913181

  17. ZIP4 Regulates Pancreatic Cancer Cell Growth by Activating IL-6/STAT3 Pathway via Zinc Finger Transcription Factor CREB

    PubMed Central

    Zhang, Yuqing; Bharadwaj, Uddalak; Logsdon, Craig D.; Chen, Changyi; Yao, Qizhi; Li, Min

    2010-01-01

    Purpose Recent studies indicate a strong correlation of zinc transporter ZIP4 and pancreatic cancer progression; however, the underlying mechanisms are unclear. We have recently found that ZIP4 is overexpressed in pancreatic cancer. In this study, we investigated the signaling pathway through which ZIP4 regulates pancreatic cancer growth. Experimental Design The expression of cyclin D1, IL-6, and STAT3 in pancreatic cancer xenografts and cells were examined by real time PCR, Bio-Plex cytokine assay, and Western blot, respectively. The activity of CREB is examined by a promoter activity assay. Results Cyclin D1 was significantly increased in the ZIP4 overexpressing MIA PaCa-2 cells (MIA-ZIP4)-injected orthotopic xenografts and was downregulated in the ZIP4 silenced ASPC-1 (ASPC-shZIP4) group. The phosphorylation of signal transducer and activator of transcription 3 (STAT3), an upstream activator of cyclin D1, was increased in MIA-ZIP4 cells, and decreased in ASPC-shZIP4 cells. IL-6, a known upstream activator for STAT3, was also found to be significantly increased in the MIA-ZIP4 cells and xenografts, and decreased in the ASPC-shZIP4 group. Overexpression of ZIP4 led to a 75% increase of IL-6 promoter activity, and caused increased phosphorylation of cAMP response element binding protein (CREB). Conclusions Our study suggest that ZIP4 overexpression causes increased IL-6 transcription via CREB, which in turn activates STAT3, and leads to increased cyclin D1 expression, resulting in increased cell proliferation and tumor progression in pancreatic cancer. These results elucidated a novel pathway in ZIP4-mediated pancreatic cancer growth, and suggest new therapeutic targets including ZIP4, IL-6, and STAT3 in pancreatic cancer treatment. PMID:20160059

  18. Apple EIN3 BINDING F-box 1 inhibits the activity of three apple EIN3-like transcription factors

    PubMed Central

    Tacken, Emma J.; Ireland, Hilary S.; Wang, Yen-Yi; Putterill, Jo; Schaffer, Robert J.

    2012-01-01

    Background and aims Fruit ripening in Malus× domestica (apple) is controlled by ethylene. Work in model species has shown that following the detection of ethylene, the ETHYLENE INSENSITIVE 3 (EIN3) transcription factor is stabilized, leading to an increase in transcript accumulation of ethylene-responsive genes, such as POLYGALACTURONASE1 (PG1). In the absence of ethylene, the EIN3 BINDING F-box (EBF) proteins rapidly degrade EIN3 via the ubiquitination/SCF (Skp, Cullin, F-Box) proteasome pathway. In this study, we aim to identify and characterize the apple EBF genes, and test their activity against apple EIN3-like proteins (EILs). Methodology The apple genome sequence was mined for EBF-like genes. The expression of EBF-like genes was measured during fruit development. Using a transient assay in Nicotiana benthamiana leaves, the activity of three apple EILs was tested against the PG1 promoter, with and without ethylene and EBF1. Principal results Four EBF-like genes in apple were identified and grouped into two sub-clades. Sub-clade I genes had constant expression over fruit development while sub-clade II genes increased in expression at ripening. EBF1 was shown to reduce the transactivation of the apple PG1 promoter by the EIL1, EIL2 and EIL3 transcription factors in the presence of ethylene. Conclusions The apple EBF1 gene identified here is likely to be a functionally conserved EBF orthologue, modulating EIL activity in apples. The activity of EBF1 suggests that it is not specific to a single EIL, instead acting as a global regulator of apple EIL transcription factors. PMID:23585922

  19. Manganese peroxidase gene transcription in Phanerochaete chrysosporium: Activation by manganese

    SciTech Connect

    Brown, J.A.; Alic, M. Gold, M.H. )

    1991-07-01

    The expression of manganese peroxidase in nitrogen-limited cultures of Phanerochaete chrysosporium is dependent on Mn, and initial work suggested that Mn regulates transcription of the mnp gene. In this study, using Northern (RNA) blot analysis of kinetic, dose-response, and inhibitor experiments, the authors demonstrate unequivocally that Mn regulates mnp gene transcription. The amount of mnp mRNA in cells of 4-day-old nitrogen-limited cultures is a direct function of the concentration of Mn in the culture medium up to a maximum of 180 {mu}M. Addition of Mn to nitrogen-limited Mn-deficient secondary metabolic (4-, 5-, and 6-day-old) cultures results in the appearance of mnp mRNA within 40 min. The appearance of this message is completely inhibited by the RNA synthesis inhibitor dactinomycin but not by the protein synthesis inhibitor cycloheximide. Furthermore, the amount of mnp mRNA produced is a direct function of the concentration of added Mn. In contrast, addition of Mn to low-nitrogen Mn-deficient 2- or 3-day-old cultures does not result in the appearance of mnp mRNA. Manganese peroxidase protein is detected by specific immunoprecipitation of the in vitro translation products of poly(A) RNA isolated from Mn-supplemented (but nor from Mn-deficient) cells. All of these results demonstrate that Mn, the substrate for the enzyme, regulates mnp gene transcription via a growth-stage-specific and concentration-dependent mechanism.

  20. TAR RNA decoys inhibit tat-activated HIV-1 transcription after preinitiation complex formation.

    PubMed Central

    Bohjanen, P R; Liu, Y; Garcia-Blanco, M A

    1997-01-01

    The ability of the HIV-1 Tat protein to trans -activate HIV-1 transcription in vitro is specifically inhibited by a circular TAR RNA decoy. This inhibition is not overcome by adding an excess of Tat to the reaction but is partially overcome by adding Tat in combination with nuclear extract, suggesting that TAR RNA might function by interacting with a complex containing Tat and cellular factor(s). A cell-free transcription system involving immobilized DNA templates was used to further define the factor(s) that interact with TAR RNA. Preinitiation complexes formed in the presence or absence of Tat were purified on immobilized templates containing the HIV-1 promoter. After washing, nucleotides and radiolabelled UTP were added and transcription was measured. The presence of Tat during preinitiation complex formation resulted in an increase in the level of full-length HIV-1 transcripts. This Tat-activated increase in HIV-1 transcription was not inhibited by circular TAR decoys added during preinitiation complex formation but was inhibited by circular TAR decoys subsequently added during the transcription reaction. These results suggest that TAR decoys inhibit Tat-activated HIV-1 transcription after preinitiation complex formation, perhaps by interacting with components of transcription complexes. PMID:9358155

  1. The yeast Hot1 transcription factor is critical for activating a single target gene, STL1

    PubMed Central

    Bai, Chen; Tesker, Masha; Engelberg, David

    2015-01-01

    Transcription factors are commonly activated by signal transduction cascades and induce expression of many genes. They therefore play critical roles in determining the cell's fate. The yeast Hog1 MAP kinase pathway is believed to control the transcription of hundreds of genes via several transcription factors. To identify the bona fide target genes of Hog1, we inducibly expressed the spontaneously active variant Hog1D170A+F318L in cells lacking the Hog1 activator Pbs2. This system allowed monitoring the effects of Hog1 by itself. Expression of Hog1D170A+F318L in pbs2∆ cells imposed induction of just 105 and suppression of only 26 transcripts by at least twofold. We looked for the Hog1-responsive element within the promoter of the most highly induced gene, STL1 (88-fold). A novel Hog1 responsive element (HoRE) was identified and shown to be the direct target of the transcription factor Hot1. Unexpectedly, we could not find this HoRE in any other yeast promoter. In addition, the only gene whose expression was abolished in hot1∆ cells was STL1. Thus Hot1 is essential for transcription of just one gene, STL1. Hot1 may represent a class of transcription factors that are essential for transcription of a very few genes or even just one. PMID:25904326

  2. Grass carp (Ctenopharyngodon idella) ATF6 (activating transcription factor 6) modulates the transcriptional level of GRP78 and GRP94 in CIK cells.

    PubMed

    Wang, Xiangqin; Zhang, Tao; Mao, Huiling; Mi, Yichuan; Zhong, Bin; Wei, Lili; Liu, Xiancheng; Hu, Chengyu

    2016-05-01

    ATF transcription factors are stress proteins containing alkaline area-leucine zipper and play an important role in endoplasmic reticulum stress. ATF6 is a protective protein which regulates the adaptation of cells to ER stress by modulating the transcription of UPR (Unfolded Protein Response) target genes, including GRP78 and GRP94. In the present study, a grass carp (Ctenopharyngodon idella) ATF6 full-length cDNA (named CiATF6, KT279356) has been cloned and identified. CiATF6 is 4176 bp in length, comprising 159 nucleotides of 5'-untranslated sequence, a 1947 nucleotides open reading frame and 2170 nucleotides of 3'-untranslated sequences. The largest open reading frame of CiATF6 translates into 648 aa with a typical DNA binding domain (BRLZ domain) and shares significant homology to the known ATF6 counterparts. Phylogenetic reconstruction confirmed its closer evolutionary relationship with other fish counterparts, especially with Zebrafish ATF6. RT-PCR showed that CiATF6 was ubiquitously expressed and significantly up-regulated after stimulation with thermal stress in all tested grass carp tissues. In order to know more about the role of CiATF6 in ER stress, recombinant CiATF6N with His-tag was over-expressed in Rosetta Escherichia coli, and the expressed protein was purified by affinity chromatography with Ni-NTA His-Bind Resin. In vitro, gel mobility shift assays were employed to analyze the interaction of CiATF6 protein with the promoters of grass carp GRP78 and GRP94, respectively. The result has shown that CiATF6 could bind to these promoters with high affinity by means of its BRLZ mainly. To further study the transcriptional regulatory mechanism of CiATF6, Dual-luciferase reporter assays were applied. Recombinant plasmids of pGL3-GRP78P and pGL3-CiGRP94P were constructed and transiently co-transfected with pcDNA3.1-CiATF6 (pcDN3.1-CiATF6-nBRLZ, respectively) into C. idella kidney (CIK) cells. The result has shown that CiATF6 could activate CiGRP78 and

  3. GW8510 Increases Insulin Expression in Pancreatic Alpha Cells through Activation of p53 Transcriptional Activity

    PubMed Central

    Fomina-Yadlin, Dina; Kubicek, Stefan; Vetere, Amedeo; He, Kaihui Hu; Schreiber, Stuart L.; Wagner, Bridget K.

    2012-01-01

    Background Expression of insulin in terminally differentiated non-beta cell types in the pancreas could be important to treating type-1 diabetes. Previous findings led us to hypothesize involvement of kinase inhibition in induction of insulin expression in pancreatic alpha cells. Methodology/Principal Findings Alpha (αTC1.6) cells and human islets were treated with GW8510 and other small-molecule inhibitors for up to 5 days. Alpha cells were assessed for gene- and protein-expression levels, cell-cycle status, promoter occupancy status by chromatin immunoprecipitation (ChIP), and p53-dependent transcriptional activity. GW8510, a putative CDK2 inhibitor, up-regulated insulin expression in mouse alpha cells and enhanced insulin secretion in dissociated human islets. Gene-expression profiling and gene-set enrichment analysis of GW8510-treated alpha cells suggested up-regulation of the p53 pathway. Accordingly, the compound increased p53 transcriptional activity and expression levels of p53 transcriptional targets. A predicted p53 response element in the promoter region of the mouse Ins2 gene was verified by chromatin immunoprecipitation (ChIP). Further, inhibition of Jun N-terminal kinase (JNK) and p38 kinase activities suppressed insulin induction by GW8510. Conclusions/Significance The induction of Ins2 by GW8510 occurred through p53 in a JNK- and p38-dependent manner. These results implicate p53 activity in modulation of Ins2 expression levels in pancreatic alpha cells, and point to a potential approach toward using small molecules to generate insulin in an alternative cell type. PMID:22242153

  4. Peroxisome proliferator-activated receptor alpha, PPARα, directly regulates transcription of cytochrome P450 CYP2C8

    PubMed Central

    Thomas, Maria; Winter, Stefan; Klumpp, Britta; Turpeinen, Miia; Klein, Kathrin; Schwab, Matthias; Zanger, Ulrich M.

    2015-01-01

    The cytochrome P450, CYP2C8, metabolizes more than 60 clinically used drugs as well as endogenous substances including retinoic acid and arachidonic acid. However, predictive factors for interindividual variability in the efficacy and toxicity of CYP2C8 drug substrates are essentially lacking. Recently we demonstrated that peroxisome proliferator-activated receptor alpha (PPARα), a nuclear receptor primarily involved in control of lipid and energy homeostasis directly regulates the transcription of CYP3A4. Here we investigated the potential regulation of CYP2C8 by PPARα. Two linked intronic SNPs in PPARα (rs4253728, rs4823613) previously associated with hepatic CYP3A4 status showed significant association with CYP2C8 protein level in human liver samples (N = 150). Furthermore, siRNA-mediated knock-down of PPARα in HepaRG human hepatocyte cells resulted in up to ∼60 and ∼50% downregulation of CYP2C8 mRNA and activity, while treatment with the PPARα agonist WY14,643 lead to an induction by >150 and >100%, respectively. Using chromatin immunoprecipitation scanning assay we identified a specific upstream gene region that is occupied in vivo by PPARα. Electromobility shift assay demonstrated direct binding of PPARα to a DR-1 motif located at positions –2762/–2775 bp upstream of the CYP2C8 transcription start site. We further validated the functional activity of this element using luciferase reporter gene assays in HuH7 cells. Moreover, based on our previous studies we demonstrated that WNT/β-catenin acts as a functional inhibitor of PPARα-mediated inducibility of CYP2C8 expression. In conclusion, our data suggest direct involvement of PPARα in both constitutive and inducible regulation of CYP2C8 expression in human liver, which is further modulated by WNT/β-catenin pathway. PPARA gene polymorphism could have a modest influence on CYP2C8 phenotype. PMID:26582990

  5. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  6. Crl Activates Transcription Initiation of RpoS-Regulated Genes Involved in the Multicellular Behavior of Salmonella enterica Serovar Typhimurium

    PubMed Central

    Robbe-Saule, Véronique; Jaumouillé, Valentin; Prévost, Marie-Christine; Guadagnini, Stéphanie; Talhouarne, Christelle; Mathout, Hayette; Kolb, Annie; Norel, Françoise

    2006-01-01

    In Salmonella enterica serovar Typhimurium, the stationary-phase sigma factor σS (RpoS) is required for virulence, stress resistance, biofilm formation, and development of the rdar morphotype. This morphotype is a multicellular behavior characterized by expression of the adhesive extracellular matrix components cellulose and curli fimbriae. The Crl protein of Escherichia coli interacts with σS and activates expression of σS-regulated genes, such as the csgBAC operon encoding the subunit of the curli proteins, by an unknown mechanism. Here, we showed using in vivo and in vitro experiments that the Crl protein of Salmonella serovar Typhimurium is required for development of a typical rdar morphotype and for maximal expression of the csgD, csgB, adrA, and bcsA genes, which are involved in curli and cellulose biosynthesis. In vitro transcription assays and potassium permanganate reactivity experiments with purified His6-Crl showed that Crl directly activated σS-dependent transcription initiation at the csgD and adrA promoters. We observed no effect of Crl on σ70-dependent transcription. Crl protein levels increased during the late exponential and stationary growth phases in Luria-Beratani medium without NaCl at 28°C. We obtained complementation of the crl mutation by increasing σS levels. This suggests that Crl has a major physiological impact at low concentrations of σS. PMID:16707690

  7. The active site of RNA polymerase II participates in transcript cleavage within arrested ternary complexes.

    PubMed Central

    Rudd, M D; Izban, M G; Luse, D S

    1994-01-01

    RNA polymerase II may become arrested during transcript elongation, in which case the ternary complex remains intact but further RNA synthesis is blocked. To relieve arrest, the nascent transcript must be cleaved from the 3' end. RNAs of 7-17 nt are liberated and transcription continues from the newly exposed 3' end. Factor SII increases elongation efficiency by strongly stimulating the transcript cleavage reaction. We show here that arrest relief can also occur by the addition of pyrophosphate. This generates the same set of cleavage products as factor SII, but the fragments produced with pyrophosphate have 5'-triphosphate termini. Thus, the active site of RNA polymerase II, in the presence of pyrophosphate, appears to be capable of cleaving phosphodiester linkages as far as 17 nt upstream of the original site of polymerization, leaving the ternary complex intact and transcriptionally active. Images PMID:8058756

  8. Characteristics of Antisense Transcript Promoters and the Regulation of Their Activity

    PubMed Central

    Lin, Shudai; Zhang, Li; Luo, Wen; Zhang, Xiquan

    2015-01-01

    Recently, an increasing number of studies on natural antisense transcripts have been reported, especially regarding their classification, temporal and spatial expression patterns, regulatory functions and mechanisms. It is well established that natural antisense transcripts are produced from the strand opposite to the strand encoding a protein. Despite the pivotal roles of natural antisense transcripts in regulating the expression of target genes, the transcriptional mechanisms initiated by antisense promoters (ASPs) remain unknown. To date, nearly all of the studies conducted on this topic have focused on the ASP of a single gene of interest, whereas no study has systematically analyzed the locations of ASPs in the genome, ASP activity, or factors influencing this activity. This review focuses on elaborating on and summarizing the characteristics of ASPs to extend our knowledge about the mechanisms of antisense transcript initiation. PMID:26703594

  9. Biomechanical Signals Suppress TAK1 Activation to Inhibit NF-κB Transcriptional Activation in Fibrochondrocytes

    PubMed Central

    Madhavan, Shashi; Anghelina, Mirela; Sjostrom, Danen; Dossumbekova, Anar; Guttridge, Denis C.; Agarwal, Sudha

    2016-01-01

    Exercise/joint mobilization is therapeutic for inflammatory joint diseases like rheumatoid and osteoarthritis, but the mechanisms underlying its actions remain poorly understood. We report that biomechanical signals at low/physiological magnitudes are potent inhibitors of inflammation induced by diverse proinflammatory activators like IL-1β, TNF-α, and lipopolysaccharides, in fibrochondrocytes. These signals exert their anti-inflammatory effects by inhibiting phosphorylation of TAK1, a critical point where signals generated by IL-1β, TNF-α, and LPS converge to initiate NF-κB signaling cascade and proinflammatory gene induction. Additionally, biomechanical signals inhibit multiple steps in the IL-1β-induced proinflammatory cascade downstream of IκB kinase activation to regulate IκBα and IκBβ degradation and synthesis, and promote IκBα shuttling to export nuclear NF-κB and terminate its transcriptional activity. The findings demonstrate that biomechanical forces are but another important signal that uses NF-κB pathway to regulate inflammation by switching the molecular activation of discrete molecules involved in proinflammatory gene transcription. PMID:17947700

  10. Polarographic assay based on hydrogen peroxide scavenging in determination of antioxidant activity of strong alcohol beverages.

    PubMed

    Gorjanović, Stanislava Z; Novaković, Miroslav M; Vukosavljević, Predrag V; Pastor, Ferenc T; Tesević, Vele V; Suznjević, Desanka Z

    2010-07-28

    Total antioxidant (AO) activity of strong alcohol beverages such as wine and plum brandies, whiskeys, herbal and sweet fruit liqueurs have been assessed using a polarographic assay based on hydrogen peroxide scavenging (HPS). Rank of order of total AO activity, expressed as percentage of decrease of anodic oxidation current of hydrogen peroxide, was found analogous with total phenolic content estimated by Folin-Ciocalteau (FC) assay and radical scavenging capacity against the stable free radical 1,1-diphenyl-2-picrylhydrazyl (DPPH). Application of the assay for surveying of a quarter century long maturation of plum brandy in oak barrel was demonstrated. In addition, influence of different storage conditions on preservation of AO activity of some herbal liqueurs was surveyed. Wide area of application of this simple, fast, low cost and reliable assay in analysis and quality monitoring of various strong alcohol beverages was confirmed. PMID:20604507

  11. MalT, the regulatory protein of the Escherichia coli maltose system, is an ATP-dependent transcriptional activator.

    PubMed

    Richet, E; Raibaud, O

    1989-03-01

    We show that MalT, the transcriptional activator of the Escherichia coli maltose regulon, specifically binds ATP and dATP with a high affinity (Kd = 0.4 microM) and exhibits a weak ATPase activity. Using an abortive initiation assay, we further show that activation of open complex formation by MalT depends on the presence of ATP in addition to that of maltotriose, the inducer of the maltose system. Similar experiments in which ATP was replaced by ADP or AMP-PNP, a non-hydrolysable analogue of ATP, demonstrate that this reaction does not require ATP hydrolysis. As revealed by DNase I footprinting, both ATP and maltotriose are required for the binding of the MalT protein to the mal promoter DNA. PMID:2524384

  12. A novel PRD I and TG binding activity involved in virus-induced transcription of IFN-A genes.

    PubMed Central

    Génin, P; Bragança, J; Darracq, N; Doly, J; Civas, A

    1995-01-01

    Comparative analysis of the inducible elements of the mouse interferon A4 and A11 gene promoters (IE-A4 and IE-A11) by transient transfection experiments, DNase 1 footprinting and electrophoretic mobility shift assays resulted in identification of a virus-induced binding activity suggested to be involved in NDV-induced activation of transcription of these genes. The virus-induced factor, termed VIF, is activated early by contact of virions with cells. It specifically recognizes the PRD I-like domain shared by both inducible elements, as well as the TG-like domain of IE-A4. This factor, distinct from the IRF-1, IRF-2 and the alpha F1 binding proteins and presenting a different affinity pattern from that of the TG protein, is proposed as a candidate for IFN-type I gene regulation. Images PMID:8559665

  13. Sertad1 encodes a novel transcriptional co-activator of SMAD1 in mouse embryonic hearts

    SciTech Connect

    Peng, Yin; Zhao, Shaomin; Song, Langying; Wang, Manyuan; Jiao, Kai

    2013-11-29

    Highlights: •SERTAD1 interacts with SMAD1. •Sertad1 is expressed in mouse embryonic hearts. •SERTAD1 is localized in both cytoplasm and nucleus of cardiomyocytes. •SERTAD1 enhances expression of BMP target cardiogenic genes as a SMAD1 co-activator. -- Abstract: Despite considerable advances in surgical repairing procedures, congenital heart diseases (CHDs) remain the leading noninfectious cause of infant morbidity and mortality. Understanding the molecular/genetic mechanisms underlying normal cardiogenesis will provide essential information for the development of novel diagnostic and therapeutic strategies against CHDs. BMP signaling plays complex roles in multiple cardiogenic processes in mammals. SMAD1 is a canonical nuclear mediator of BMP signaling, the activity of which is critically regulated through its interaction partners. We screened a mouse embryonic heart yeast two-hybrid library using Smad1 as bait and identified SERTAD1 as a novel interaction partner of SMAD1. SERTAD1 contains multiple potential functional domains, including two partially overlapping transactivation domains at the C terminus. The SERTAD1-SMAD1 interaction in vitro and in mammalian cells was further confirmed through biochemical assays. The expression of Sertad1 in developing hearts was demonstrated using RT-PCR, western blotting and in situ hybridization analyses. We also showed that SERTAD1 was localized in both the cytoplasm and nucleus of immortalized cardiomyocytes and primary embryonic cardiomyocyte cultures. The overexpression of SERTAD1 in cardiomyocytes not only enhanced the activity of two BMP reporters in a dose-dependent manner but also increased the expression of several known BMP/SMAD regulatory targets. Therefore, these data suggest that SERTAD1 acts as a SMAD1 transcriptional co-activator to promote the expression of BMP target genes during mouse cardiogenesis.

  14. Absolute mRNA quantification using the polymerase chain reaction (PCR). A novel approach by a PCR aided transcript titration assay (PATTY).

    PubMed Central

    Becker-André, M; Hahlbrock, K

    1989-01-01

    The polymerase chain reaction (PCR) is used as part of a new approach to the absolute quantification of mRNA. We describe a PCR aided transcript titration assay (PATTY) which is based on the co-amplification of an in vitro generated transcript differing by a single base exchange from the target mRNA. Identical portions of a total RNA sample are "spiked" with different amounts of this mutated standard RNA, converted to cDNA and amplified by PCR. Because the base exchange creates a novel restriction endonuclease site, the ratio of co-amplified DNA derived from target mRNA to amplified DNA derived from standard RNA can be determined after restriction endonuclease digestion and separation by gel electrophoresis. This method gives accurate results within 24 hours and is useful especially for the quantification of either low-abundance mRNA or more abundant mRNA present in very small amounts of total RNA. The low-abundance mRNA encoding 4-coumarate:CoA ligase (4CL) in cultured potato cells (Solanum tuberosum L.) was measured in a case study. About 100 molecules per assay could be accurately detected by the new method. Images PMID:2479917

  15. Identification of transglutaminase 2 kinase substrates using a novel on-chip activity assay.

    PubMed

    Jung, Se-Hui; Kong, Deok-Hoon; Jeon, Hye-Yoon; Ji, Su-Hyun; Han, Eun-Taek; Park, Won Sun; Hong, Seok-Ho; Kim, Min-Soo; Kim, Young-Myeong; Ha, Kwon-Soo

    2016-08-15

    Transglutaminase 2 (TG2) is an enzyme that plays a critical role in a wide variety of cellular processes through its multifunctional activities. TG2 kinase has emerged as an important regulator of apoptosis, as well as of chromatin structure and function. However, systematic investigation of TG2 kinase substrates is limited due to a lack of a suitable TG2 kinase activity assays. Thus, we developed a novel on-chip TG2 kinase activity assay for quantitative determination of TG2 kinase activity and for screening TG2 kinase substrate proteins in a high-throughput manner. Quantitative TG2 kinase activity was determined by selective detection of substrate protein phosphorylation on the surface of well-type amine arrays. The limit of detection (LOD) of this assay was 4.34μg/ml. We successfully applied this new activity assay to the kinetic analysis of 27 TG2-related proteins for TG2 kinase activity in a high-throughput manner and determined Michaelis-Menten constants (Km) of these proteins. We used the Km values and cellular locations of the TG2-related proteins to construct a substrate affinity map for TG2 kinase. Therefore, this on-chip TG2 kinase activity assay has a strong potential for the systematic investigation of substrate proteins and will be helpful for studying new physiological functions. PMID:27040940

  16. NF-κB transcriptional activity is modulated by FK506-binding proteins FKBP51 and FKBP52: a role for peptidyl-prolyl isomerase activity.

    PubMed

    Erlejman, Alejandra G; De Leo, Sonia A; Mazaira, Gisela I; Molinari, Alejandro M; Camisay, María Fernanda; Fontana, Vanina; Cox, Marc B; Piwien-Pilipuk, Graciela; Galigniana, Mario D

    2014-09-19

    Hsp90 binding immunophilins FKBP51 and FKBP52 modulate steroid receptor trafficking and hormone-dependent biological responses. With the purpose to expand this model to other nuclear factors that are also subject to nuclear-cytoplasmic shuttling, we analyzed whether these immunophilins modulate NF-κB signaling. It is demonstrated that FKBP51 impairs both the nuclear translocation rate of NF-κB and its transcriptional activity. The inhibitory action of FKBP51 requires neither the peptidylprolyl-isomerase activity of the immunophilin nor its association with Hsp90. The TPR domain of FKBP51 is essential. On the other hand, FKBP52 favors the nuclear retention time of RelA, its association to a DNA consensus binding sequence, and NF-κB transcriptional activity, the latter effect being strongly dependent on the peptidylprolyl-isomerase activity and also on the TPR domain of FKBP52, but its interaction with Hsp90 is not required. In unstimulated cells, FKBP51 forms endogenous complexes with cytoplasmic RelA. Upon cell stimulation with phorbol ester, the NF-κB soluble complex exchanges FKBP51 for FKBP52, and the NF-κB biological effect is triggered. Importantly, FKBP52 is functionally recruited to the promoter region of NF-κB target genes, whereas FKBP51 is released. Competition assays demonstrated that both immunophilins antagonize one another, and binding assays with purified proteins suggest that the association of RelA and immunophilins could be direct. These observations suggest that the biological action of NF-κB in different cell types could be positively regulated by a high FKBP52/FKBP51 expression ratio by favoring NF-κB nuclear retention, recruitment to the promoter regions of target genes, and transcriptional activity. PMID:25104352

  17. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  18. Assay of Flippase Activity in Proteoliposomes Using Fluorescent Lipid Derivatives.

    PubMed

    Marek, Magdalena; Günther-Pomorski, Thomas

    2016-01-01

    Specific membrane proteins, termed lipid flippases, play a central role in facilitating the movement of lipids across cellular membranes. In this protocol, we describe the reconstitution of ATP-driven lipid flippases in liposomes and the analysis of their in vitro flippase activity based on the use of fluorescent lipid derivatives. Working with purified and reconstituted systems provides a well-defined experimental setup and allows to directly characterize these membrane proteins at the molecular level. PMID:26695033

  19. MK5 activates Rag transcription via Foxo1 in developing B cells

    PubMed Central

    Chow, Kwan T.; Timblin, Greg A.; McWhirter, Sarah M.

    2013-01-01

    Foxo1 is a critical, direct regulator of Rag (recombination activating gene) transcription during B cell development and is thus essential for the generation of a diverse repertoire of antigen receptors. Although Foxo1 regulation has been widely studied in many cell types, pathways regulating Foxo1 in B cells have not been fully elucidated. By screening a panel of Foxo1 mutants, we identified serine 215 on Foxo1 as a novel phosphorylation site that is essential for the activation of Rag transcription. Mutation of S215 strongly attenuated transactivation of Rag but did not affect most other Foxo1 target genes. We show that MK5, a MAPK-activated protein kinase, is a previously unidentified upstream regulator of Foxo1. MK5 was necessary and sufficient to activate Rag transcription in transformed and primary pro–B cells. Together, our experiments show that MK5 positively regulates Rag transcription via phosphorylation of Foxo1 in developing B cells. PMID:23878308

  20. Two distinct domains of Flo8 activator mediates its role in transcriptional activation and the physical interaction with Mss11.

    PubMed

    Kim, Hye Young; Lee, Sung Bae; Kang, Hyen Sam; Oh, Goo Taeg; Kim, TaeSoo

    2014-06-27

    Flo8 is a transcriptional activator essential for the inducible expression of a set of target genes such as STA1, FLO11, and FLO1 encoding an extracellular glucoamylase and two cell surface proteins, respectively. However, the molecular mechanism of Flo8-mediated transcriptional activation remains largely elusive. By generating serial deletion constructs, we revealed here that a novel transcriptional activation domain on its extreme C-terminal region plays a crucial role in activating transcription. On the other hand, the N-terminal LisH motif of Flo8 appears to be required for its physical interaction with another transcriptional activator, Mss11, for their cooperative transcriptional regulation of the shared targets. Additionally, GST pull-down experiments uncovered that Flo8 and Mss11 can directly form either a heterodimer or a homodimer capable of binding to DNA, and we also showed that this formed complex of two activators interacts functionally and physically with the Swi/Snf complex. Collectively, our findings provide valuable clues for understanding the molecular mechanism of Flo8-mediated transcriptional control of multiple targets. PMID:24813990

  1. Cooperative DNA binding of the bovine papillomavirus E2 transcriptional activator is antagonized by truncated E2 polypeptides.

    PubMed Central

    Monini, P; Blitz, I L; Cassai, E

    1993-01-01

    Cooperative DNA binding of the bovine papillomavirus type 1 (BPV-1) E2 transcriptional activator (E2-TA) is thought to play a role in the transcriptional synergism of multiple E2-responsive DNA elements (J. Ham, N. Dostatni, J.-M. Gauthier, and M. Yaniv, Trends Biochem. Sci. 16:440-444, 1991). Binding-equilibrium considerations show that such involvement is unlikely, thereby suggesting that the E2-TA cooperative capacity may have evolved to play other, different roles. The role of cooperative interactions in the antagonistic activity of BPV-1-positive and BPV-1-negative E2 regulatory proteins was investigated by an in vitro quantitative gel shift assay. Viral repressor E2-TR, a truncated peptide encompassing the activator DNA-binding domain, possesses a small but measurable cooperative capacity. Furthermore, the minimal E2 DNA-binding domain interacts with the activator in a positive, heterocooperative manner. As a result, the in vitro competition of full-length and truncated E2 peptides appears to be (macroscopically) noncooperative. This heterocooperative effect is probably dominant in latently infected G0-G1 cells, in which repressor E2-TR is 10- to 20-fold more abundant than the activator. The data are discussed considering the possible role of homo- and heterocooperative DNA binding in E2-conditional gene expression. Images PMID:8394466

  2. Evaluation of commercially available and in-house reverse transcription-PCR assays for detection of hepatitis G virus or GB virus C.

    PubMed Central

    Forns, X; Tan, D; Alter, H J; Purcell, R H; Bukh, J

    1997-01-01

    Serum samples from 96 Spanish hemodialysis patients, as well as serial dilutions of RNA extracted from a reference strain of hepatitis G virus (HGV), were tested for HGV or GB virus C (GBV-C) RNA. Two different reverse transcription (RT)-PCR-based methods of detection were compared for the ability to detect RNA extracted from the samples: an RT-nested PCR assay with primers derived from the 5' noncoding region (5'NC) or nonstructural region 3 (NS3) sequences and a commercially available RT-PCR assay with primers derived from the 5'NC or NS5A sequences. When RT-nested PCR was performed on 10-fold serial dilutions of RNA from the HGV reference strain, the last positive dilution was 10(-7) to 10(-8). With the commercial RT-PCR assay, the last positive dilution was 10(-6) to 10(-7). When equal amounts of RNA extracted from serum samples from 96 hemodialysis patients were tested for HGV or GBV-C RNA, 25 patients (26%) were positive by the RT-nested PCR. However, only 21 (84%) of these 25 positive patients were positive for HGV or GBV-C by the commercial RT-PCR assay. Analysis of the 5'NC and NS3 sequences amplified by RT-nested PCR demonstrated that all but two positive patients had unique HGV or GBV-C sequences. In summary, RT-nested PCR and a commercially available RT-PCR assay for HGV or GBV-C gave concordant results for 96% of the patients tested. PMID:9316941

  3. A simplified assay for the quantification of circulating activated protein C.

    PubMed

    Martos, Laura; Bonanad, Santiago; Ramón, Luis A; Cid, Ana-Rosa; Bonet, Elena; Corral, Javier; Miralles, Manuel; España, Francisco; Navarro, Silvia; Medina, Pilar

    2016-08-01

    Available assays for circulating levels of activated protein C (APC) are either time-consuming or difficult to use in a routine laboratory, or have a detection limit above normal levels. We have developed a simplified assay that measures both the in vivo free APC and the in vivo APC complexed to PC inhibitor (PCI). We measured APC levels, with both assays, in 339 plasma samples, 165 from patients with venous thromboembolism (VTE) and 174 from healthy individuals. The mean APC level in the 339 samples was 0.038±0.010 nM, using a previous assay that measures only the in vivo APC level, and 0.041±0.010 nM with the present new assay. The coefficient of correlation between assays was r=0.954 (P<0.001). The mean APC level in VTE patients was 0.034±0.009 nM (previous assay) and 0.037±0.009 nM (new assay), significantly lower than those in controls (P<0.001). In both groups there was a significant correlation between the levels obtained by the two assays (P<0.001). These results show that both assays are equivalent, and confirm that the APC level is lower in VTE patients than in healthy individuals. Therefore, the new simplified assay, which measures the sum of circulating free APC and APC complexed to PCI, may be used to estimate the level of circulating APC, and will allow its use in routine laboratories. PMID:27262823

  4. EGR1 Functions as a Potent Repressor of MEF2 Transcriptional Activity

    PubMed Central

    Cooper, Olivia; Kontor, Akuah; Nocco, Sarah E.; Naya, Francisco J.

    2015-01-01

    The myocyte enhancer factor 2 (MEF2) transcription factor requires interactions with co-factors for precise regulation of its target genes. Our lab previously reported that the mammalian MEF2A isoform regulates the cardiomyocyte costamere, a critical muscle-specific focal adhesion complex involved in contractility, through its transcriptional control of genes encoding proteins localized to this cytoskeletal structure. To further dissect the transcriptional mechanisms of costamere gene regulation and identify potential co-regulators of MEF2A, a bioinformatics analysis of transcription factor binding sites was performed using the proximal promoter regions of selected costamere genes. One of these predicted sites belongs to the early growth response (EGR) transcription factor family. The EGR1 isoform has been shown to be involved in a number of pathways in cardiovascular homeostasis and disease, making it an intriguing candidate MEF2 coregulator to further characterize. Here, we demonstrate that EGR1 interacts with MEF2A and is a potent and specific repressor of MEF2 transcriptional activity. Furthermore, we show that costamere gene expression in cardiomyocytes is dependent on EGR1 transcriptional activity. This study identifies a mechanism by which MEF2 activity can be modulated to ensure that costamere gene expression is maintained at levels commensurate with cardiomyocyte contractile activity. PMID:26011708

  5. Ubiquitin ligase activity of TFIIH and the transcriptional response to DNA damage.

    PubMed

    Takagi, Yuichiro; Masuda, Claudio A; Chang, Wei-Hau; Komori, Hirofumi; Wang, Dong; Hunter, Tony; Joazeiro, Claudio A P; Kornberg, Roger D

    2005-04-15

    Core transcription factor (TF) IIH purified from yeast possesses an E3 ubiquitin (Ub) ligase activity, which resides, at least in part, in a RING finger (RNF) domain of the Ssl1 subunit. Yeast strains mutated in the Ssl1 RNF domain are sensitive to ultraviolet (UV) light and to methyl methanesulfonate (MMS). This increased sensitivity to DNA-damaging agents does not reflect a deficiency in nucleotide excision repair. Rather, it correlates with reduced transcriptional induction of genes involved in DNA repair, suggesting that the E3 Ub ligase activity of TFIIH mediates the transcriptional response to DNA damage. PMID:15837426

  6. FLOWERING BHLH transcriptional activators control expression of the photoperiodic flowering regulator CONSTANS in Arabidopsis

    PubMed Central

    Ito, Shogo; Song, Young Hun; Josephson-Day, Anna R.; Miller, Ryan J.; Breton, Ghislain; Olmstead, Richard G.; Imaizumi, Takato

    2012-01-01

    Many plants monitor day-length changes throughout the year and use the information to precisely regulate the timing of seasonal flowering for maximum reproductive success. In Arabidopsis thaliana, transcriptional regulation of the CONSTANS (CO) gene and posttranslational regulation of CO protein are crucial mechanisms for proper day-length measurement in photoperiodic flowering. Currently, the CYCLING DOF FACTOR proteins are the only transcription factors known to directly regulate CO gene expression, and the mechanisms that directly activate CO transcription have remained unknown. Here we report the identification of four CO transcriptional activators, named FLOWERING BHLH 1 (FBH1), FBH2, FBH3, and FBH4. All FBH proteins are related basic helix–loop–helix-type transcription factors that preferentially bind to the E-box cis-elements in the CO promoter. Overexpression of all FBH genes drastically elevated CO levels and caused early flowering regardless of photoperiod, whereas CO levels were reduced in the fbh quadruple mutants. In addition, FBH1 is expressed in the vascular tissue and bound near the transcription start site of the CO promoter in vivo. Furthermore, FBH homologs in poplar and rice induced CO expression in Arabidopsis. These results indicate that FBH proteins positively regulate CO transcription for photoperiodic flowering and that this mechanism may be conserved in diverse plant species. Our results suggest that the diurnal CO expression pattern is generated by a concert of redundant functions of positive and negative transcriptional regulators. PMID:22334645

  7. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen

    2016-01-01

    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  8. The transcriptional regulator SsuR activates expression of the Corynebacterium glutamicum sulphonate utilization genes in the absence of sulphate.

    PubMed

    Koch, Daniel J; Rückert, Christian; Albersmeier, Andreas; Hüser, Andrea T; Tauch, Andreas; Pühler, Alfred; Kalinowski, Jörn

    2005-10-01

    In a recent study, the putative regulatory gene cg0012 was shown to belong to the regulon of McbR, a global transcriptional regulator of sulphur metabolism in Corynebacterium glutamicum ATCC 13032. A deletion of cg0012, now designated ssuR (sulphonate sulphur utilization regulator), led to the mutant strain C. glutamicum DK100, which was shown to be blocked in the utilization of sulphonates as sulphur sources. According to DNA microarray hybridizations, transcription of the ssu and seu genes, encoding the sulphonate utilization system of C. glutamicum, was considerably decreased in C. glutamicum DK100 when compared with the wild-type strain. Electrophoretic mobility shift assays with purified SsuR protein demonstrated that the upstream regions of ssuI, seuABC, ssuD2 and ssuD1CBA contain SsuR binding sites. A nucleotide sequence alignment of the four DNA fragments containing the SsuR binding sites revealed a common 21 bp motif consisting of T-, GC- and A-rich domains. Mapping of the transcriptional start sites in front of ssuI, seuABC, ssuD2 and ssuD1CBA indicated that the SsuR binding sites are located directly upstream of identified promoter sequences and that the ssu genes are expressed by leaderless transcripts. Binding of the SsuR protein to its operator was shown to be diminished in vitro by the effector substance sulphate and its direct assimilation products adenosine 5'-phosphosulphate, sulphite and sulphide. Real-time reverse transcription polymerase chain reaction experiments verified that the expression of the ssu and seu genes was also repressed in vivo by the presence of sulphate or sulphite. Therefore, the regulatory protein SsuR activates the expression of the ssu and seu genes in C. glutamicum in the absence of the preferred sulphur source sulphate. PMID:16194234

  9. The phzA2-G2 Transcript Exhibits Direct RsmA-Mediated Activation in Pseudomonas aeruginosa M18

    PubMed Central

    Ren, Bin; Shen, Huifeng; Lu, Zhi John; Liu, Haiming; Xu, Yuquan

    2014-01-01

    In bacteria, RNA-binding proteins of the RsmA/CsrA family act as post-transcriptional regulators that modulate translation initiation at target transcripts. The Pseudomonas aeruginosa genome contains two phenazine biosynthetic (phz) gene clusters, phzA1-G1 (phz1) and phzA2-G2 (phz2), each of which is responsible for phenazine-1-carboxylic acid (PCA) biosynthesis. In the present study, we show that RsmA exhibits differential gene regulation on two phz clusters in P. aeruginosa M18 at the post-transcriptional level. Based on the sequence analysis, four GGA motifs, the potential RsmA binding sites, are found on the 5′-untranslated region (UTR) of the phz2 transcript. Studies with a series of lacZ reporter fusions, and gel mobility shift assays suggest that the third GGA motif (S3), located 21 nucleotides upstream of the Shine-Dalgarno (SD) sequence, is involved in direct RsmA-mediated activation of phz2 expression. We therefore propose a novel model in which the binding of RsmA to the target S3 results in the destabilization of the stem-loop structure and the enhancement of ribosome access. This model could be fully supported by RNA structure prediction, free energy calculations, and nucleotide replacement studies. In contrast, various RsmA-mediated translation repression mechanisms have been identified in which RsmA binds near the SD sequence of target transcripts, thereby blocking ribosome access. Similarly, RsmA is shown to negatively regulate phz1 expression. Our new findings suggest that the differential regulation exerted by RsmA on the two phz clusters may confer an advantage to P. aeruginosa over other pseudomonads containing only a single phz cluster in their genomes. PMID:24586939

  10. Transcription of two classes of rat growth hormone gene-associated repetitive DNA: differences in activity and effects of tandem repeat structure.

    PubMed Central

    Gutierrez-Hartmann, A; Lieberburg, I; Gardner, D; Baxter, J D; Cathala, G G

    1984-01-01

    The rat growth hormone (rGH) gene contains two classes of repetitive DNA arranged as clusters within intron B and the 3' flanking region. The major family is equivalent to the CHO type 2 DNA. The second ("truncated repeat", TR) is a truncated version of the first and occurs in certain neural-specific transcripts and genes ("identifier" elements, ID). Here we report, using the HeLa cell-free transcription assay, that RNA polymerase III (Pol III) efficiently initiates at internal promoters within a tandem array of rGH gene repetitive DNA monomers and results in a novel organization of overlapping Class III transcription units. Transcription competition studies revealed that the rat type 2 structures share Pol III transcription factors with a tRNA gene, a human Alu repeat, and a mutant VA1 gene. Also, the rGH type 2 but not the TR DNA efficiently promotes Pol III initiation, yet other TR members, which differ only in flanking DNA, are transcribed. Thus, the rGH gene is strikingly enriched with 10 repetitive DNA monomers; multimeric type 2 elements are actively transcribed; rGH-TR sequences are expressed only as part of larger transcripts promoted by type 2 DNA; and, type 2 DNA uses tRNA gene transcription factors. These studies show that flanking sequences, promoter organization and factor competition may all affect rat repetitive DNA expression. Images PMID:6091058

  11. Biochemical Analysis of Distinct Activation Functions in p300 That Enhance Transcription Initiation with Chromatin Templates

    PubMed Central

    Kraus, W. Lee; Manning, E. Tory; Kadonaga, James T.

    1999-01-01

    To investigate the mechanisms of transcriptional enhancement by the p300 coactivator, we analyzed wild-type and mutant versions of p300 with a chromatin transcription system in vitro. Estrogen receptor, NF-κB p65 plus Sp1, and Gal4-VP16 were used as different sequence-specific activators. The CH3 domain (or E1A-binding region) was found to be essential for the function of each of the activators tested. The bromodomain was also observed to be generally important for p300 coactivator activity, though to a lesser extent than the CH3 domain/E1A-binding region. The acetyltransferase activity and the C-terminal region (containing the steroid receptor coactivator/p160-binding region and the glutamine-rich region) were each found to be important for activation by estrogen receptor but not for that by Gal4-VP16. The N-terminal region of p300, which had been previously found to interact with nuclear hormone receptors, was not seen to be required for any of the activators, including estrogen receptor. Single-round transcription experiments revealed that the functionally important subregions of p300 contribute to its ability to promote the assembly of transcription initiation complexes. In addition, the acetyltransferase activity of p300 was observed to be distinct from the broadly essential activation function of the CH3 domain/E1A-binding region. These results indicate that specific regions of p300 possess distinct activation functions that are differentially required to enhance the assembly of transcription initiation complexes. Interestingly, with the estrogen receptor, four distinct regions of p300 each have an essential role in the transcription activation process. These data exemplify a situation in which a network of multiple activation functions is required to achieve gene transcription. PMID:10567538

  12. Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

    PubMed Central

    Chen, Lu; Ooi, Soon-Keat; Conaway, Joan W.; Conaway, Ronald C.

    2014-01-01

    Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes. PMID:25407555

  13. Transcriptional activation by p53 of the human type IV collagenase (gelatinase A or matrix metalloproteinase 2) promoter.

    PubMed Central

    Bian, J; Sun, Y

    1997-01-01

    p53, a tumor suppressor and a transcription factor, has been shown to transcriptionally activate the expression of a number of important genes involved in the regulation of cell growth, DNA damage, angiogenesis, and apoptosis. In a computer search for other potential p53 target genes, we identified a perfect p53 binding site in the promoter of the human type IV collagenase (also called 72-kDa gelatinase or matrix metalloproteinase 2 [MMP-2]) gene. This p53 binding site was found to specifically bind to p53 protein in a gel shift assay. Transcription assays with luciferase reporters driven by the promoter or enhancer of the type IV collagenase gene revealed that (i) activation of the promoter activity is p53 binding site dependent in p53-positive cells but not in p53-negative cells and (ii) wild-type p53, but not p53 mutants commonly found in human cancers, transactivates luciferase expression driven by the type IV collagenase promoter as well as by a p53 site-containing enhancer element in the promoter. Significantly, expression of the endogenous type IV collagenase is also under the control of p53. Treatment of U2-OS cells, a wild-type p53-containing osteogenic sarcoma line, with a common p53 inducer, etoposide, induced p53 DNA binding and transactivation activities in a time-dependent manner. Induction of type IV collagenase expression followed the p53 activation pattern. No induction of type IV collagenase expression can be detected under the same experimental conditions in p53-negative Saos-2 cells. All these in vitro and in vivo assays strongly suggest that the type IV collagenase gene is a p53 target gene and that its expression is subject to p53 regulation. Our finding links p53 to a member of the MMP genes, a family of genes implicated in trophoblast implantation, wound healing, angiogenesis, arthritis, and tumor cell invasion. p53 may regulate these processes by upregulating expression of type IV collagenase. PMID:9343394

  14. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    NASA Astrophysics Data System (ADS)

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong

    2014-04-01

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P < 0.05). A luciferase assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P < 0.05). An over-expression assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  15. Mapping neural circuits with activity-dependent nuclear import of a transcription factor.

    PubMed

    Masuyama, Kaoru; Zhang, Yi; Rao, Yi; Wang, Jing W

    2012-03-01

    Abstract: Nuclear factor of activated T cells (NFAT) is a calcium-responsive transcription factor. We describe here an NFAT-based neural tracing method-CaLexA (calcium-dependent nuclear import of LexA)-for labeling active neurons in behaving animals. In this system, sustained neural activity induces nuclear import of the chimeric transcription factor LexA-VP16-NFAT, which in turn drives green fluorescent protein (GFP) reporter expression only in active neurons. We tested this system in Drosophila and found that volatile sex pheromones excite specific neurons in the olfactory circuit. Furthermore, complex courtship behavior associated with multi-modal sensory inputs activated neurons in the ventral nerve cord. This method harnessing the mechanism of activity-dependent nuclear import of a transcription factor can be used to identify active neurons in specific neuronal population in behaving animals. PMID:22236090

  16. Nonradioactive GTP binding assay to monitor activation of g protein-coupled receptors.

    PubMed

    Frang, Heini; Mukkala, Veli-Matti;