Sample records for bact lactis aerogenes

  1. BACT analysis under the Clean Air Act's PCD program

    SciTech Connect

    Simms, P.; Walke, J. [National Resources Development Council, Washington, DC (United States)

    2006-11-15

    Before a company may build a new major industrial source of air pollution, or make modifications to an existing major source in the USA it must apply for and receive a Clean Air Act (CAA) Prevention of Significant Deterioration (PSD) permit. State environmental agencies typically issue such permits, either under state law or by exercising delegated authority to implement the federal PSD program. To fully comply with the CAA, the emissions limits identified as BACT must incorporate consideration of more than just add-on emissions control technology, they must also reflect appropriate considerations of fuel quality (e.g. low-sulfur coal) and process changes (e.g. advanced combustion techniques) as a means of controlling emissions, and must consider the other environmental and public welfare benefits of the identified emissions control options. Several states including New Mexico and Illinois have already determined that innovated technologies, such as Integrated Gasification Combined Cycle (IGCC), must be considered in connection with the BACT analysis for new coal-fired power plants. Even the notion that BACT is categorically limited in scope to the general type of facility proposed is contrary to EPA precedent. For example, the Environmental Appeals Board (EAB) has explained that permitting authorities retain the discretion under the definition of BACT to require dramatically different facility designs (e.g. a natural gas plant instead of a coal-fired power plant). The best advice for any permit applicant is to include in the BACT analysis a careful and honest examination of better performing alternative processes and/or innovative combustion techniques and to aggressively pursue such options wherever feasible. 17 refs.

  2. Differentiation of Enterobacter aerogenes from Klebsiellae by Deoxyribonucleic Acid Reassociation

    Microsoft Academic Search

    DON J. BRENNER; A. G. STEIGERWALT; G. R. FANNING

    1972-01-01

    Polynucleotide sequence relatedness tests were carried out to determine the extent of deoxyribonucleic acid (DNA) divergence among species of Klebsiella and Enterobacter aerogenes strains. Labeled, denatured DNA fragments from K. pneumoniae type 2 and E. aerogenes 1627-66 were each incubated with an excess of unlabeled DNA fragments from Klebsielia species and strains of E. aerogenes. Reassociated DNA duplexes were separated

  3. mar Operon Involved in Multidrug Resistance of Enterobacter aerogenes

    Microsoft Academic Search

    Renaud Chollet; Claude Bollet; Jacqueline Chevalier; M. Mallea; J.-M. Pages; Anne Davin-Regli

    2002-01-01

    We determined the sequence of the entire marRAB operon in Enterobacter aerogenes. It is functionally and structurally analogous to the Escherichia coli operon. The overexpression of E. aerogenes MarA induces a multidrug resistance phenotype in a susceptible strain, demonstrated by a noticeable resistance to various antibiotics, a decrease in immunodetected porins, and active efflux of norfloxacin.

  4. Metabolism of Gentiobiose in Aerobacter aerogenes

    PubMed Central

    Palmer, Richard E.; Anderson, Richard L.

    1972-01-01

    Cleavage of gentiobiose in cell extracts of gentiobiose-grown Aerobacter aerogenes was dependent on the presence of adenosine 5?-triphosphate (ATP). The enzymes that participate in the overall reaction were shown to be a ?-glucoside kinase, which catalyzes the phosphorylation of gentiobiose with ATP to form gentiobiose monophosphate [6-O-phosphoryl-?-d-glucopyranosyl-(1 ? 6)-d-glucose], and a phospho-?-glucosidase, which catalyzes the hydrolytic cleavage of gentiobiose monophosphate to form equimolar amounts of d-glucose and d-glucose 6-phosphate. Although the ?-glucoside kinase was previously shown to catalyze the phosphorylation of many ?-glucosides that serve as growth substrates (i.e., gentiobiose, cellobiose, cellobiitol, salicin, arbutin, methyl ?-d-glucoside, and phenyl ?-d-glucoside), mutant analysis and induction studies indicate that it functions only in the metabolism of gentiobiose, cellobiose, and cellobiitol. PMID:4640505

  5. Amino acid utilization by Aerobacter aerogenes and Escherichia coli

    E-print Network

    Herrera, Rodolfo Eduardo

    1938-01-01

    A considerable amount of work has been done on the growth of A. aerogenes and E. coli in synthetic media, but little work has been undertaken on the utilization by these organisms of amino acids as comparative sources of ...

  6. Effects of Formate on Fermentative Hydrogen Production by Enterobacter aerogenes

    Microsoft Academic Search

    Tatsuo Kurokawa; Shigeharu Tanisho

    2005-01-01

    This paper describes the effects of formate on fermentative hydrogen production by Enterobacter aerogenes by way of batch culture. When 20 mM formate was added to pH 6.3 and pH 5.8 E. aerogenes glucose cultures (formate culture) at the beginning of cultivation, hydrogen evolution through both glucose consumption and decomposition of the extrinsic formate occurred together, while hydrogen evolution occurred

  7. TEM Derivative-Producing Enterobacter aerogenes Strains: Dissemination of a Prevalent Clone

    Microsoft Academic Search

    P. Dumarche; C. De Champs; D. Sirot; C. Chanal; R. Bonnet; J. Sirot

    2002-01-01

    TEM-24 (CAZ-6) extended-spectrum -lactamase (ESBL) was detected in 1988 in Clermont-Ferrand, France, in Klebsiella pneumoniae (blaTEM-24) and Enterobacter aerogenes (blaTEM-24b), and since 1994, a TEM- 24-producing E. aerogenes clonal strain has been observed elsewhere in the country. To determine if the spread of this clonal strain was restricted to TEM-24-producing E. aerogenes strains, 84 E. aerogenes strains (non- TEM\\/SHV-producing strains,

  8. Natural immune systems protect animals from dangerous foreign pathogens, including bacte-

    E-print Network

    Garlan, David

    Natural immune systems protect animals from dangerous foreign pathogens, including bacte- ria computer immune systems with some of the important properties of natural immune systems, including are less well known. The immune system provides a persuasive example of how they might be implemented

  9. BactQuant: An enhanced broad-coverage bacterial quantitative real-time PCR assay

    PubMed Central

    2012-01-01

    Background Bacterial load quantification is a critical component of bacterial community analysis, but a culture-independent method capable of detecting and quantifying diverse bacteria is needed. Based on our analysis of a diverse collection of 16?S rRNA gene sequences, we designed a broad-coverage quantitative real-time PCR (qPCR) assay—BactQuant—for quantifying 16?S rRNA gene copy number and estimating bacterial load. We further utilized in silico evaluation to complement laboratory-based qPCR characterization to validate BactQuant. Methods The aligned core set of 4,938 16?S rRNA gene sequences in the Greengenes database were analyzed for assay design. Cloned plasmid standards were generated and quantified using a qPCR-based approach. Coverage analysis was performed computationally using >670,000 sequences and further evaluated following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. Results A bacterial TaqMan® qPCR assay targeting a 466?bp region in V3-V4 was designed. Coverage analysis showed that 91% of the phyla, 96% of the genera, and >80% of the 89,537 species analyzed contained at least one perfect sequence match to the BactQuant assay. Of the 106 bacterial species evaluated, amplification efficiencies ranged from 81 to 120%, with r2-value of >0.99, including species with sequence mismatches. Inter- and intra-run coefficient of variance was <3% and <16% for Ct and copy number, respectively. Conclusions The BactQuant assay offers significantly broader coverage than a previously reported universal bacterial quantification assay BactQuant in vitro performance was better than the in silico predictions. PMID:22510143

  10. Single-cell protein from methanol with Enterobacter aerogenes

    SciTech Connect

    Gnan, S.O.; Abodreheba, A.O.

    1987-02-20

    An identified Enterobacter aerogenes utilizing methanol as a sole carbon source was studied for the optimization of biomass production and the reduction of its nucleic acid content. Results indicated that the highest yield and conversion were obtained at 0.5% methanol. The addition of seawater as a source of trace elements has an adverse effect. However, the addition of urea as source of nitrogen enhanced the growth of E. aerogenes. Heat shock at 60 degrees C for one minute followed by incubation at 50 degrees C for 2 hours caused 72.6% reduction in the nucleic acid. 12 references.

  11. Imipenem and expression of multidrug efflux pump in Enterobacter aerogenes

    Microsoft Academic Search

    Charléric Bornet; Renaud Chollet; Monique Malléa; Jacqueline Chevalier; Anne Davin-Regli; Jean-Marie Pagès; Claude Bollet

    2003-01-01

    Imipenem is often used to treat intensive care unit patients infected by Enterobacter aerogenes, but it is leading to an increasing number of antibiotic resistant strains. Clinical isolates and imipenem resistant variants presented a high level of resistance to ?-lactam antibiotic group and to chemically unrelated drugs. We report here that imipenem selects strains which contain active efflux pumps ejecting

  12. Carbapenem Resistance in Enterobacter aerogenes is due to Lipopolysaccharide Alterations

    Microsoft Academic Search

    Hermann Leying; Wolfgang Cullmann; Wolfgang Dick

    1991-01-01

    The extensive characterization of 2 clinical Enterobacter aerogenes isolates resistant to all ?-lactam antibiotics including imipenem revealed that imipenem resistance could not be attributed to overproduction of the chromosomal ?-lactamase; moreover, it was lost after subcultivation and can be thus considered as unstable. The comparison of sensitive and resistant clones revealed that the ?-lactamase in the resistant clones was less

  13. Inhibitors of antibiotic efflux pump in resistant Enterobacter aerogenes strains

    Microsoft Academic Search

    Monique Malléa; Jacqueline Chevalier; Annie Eyraud; Jean-Marie Pagès

    2002-01-01

    Enterobacter aerogenes, a nosocomial pathogen, is frequently exhibiting multidrug resistance mechanisms associated with a change in membrane permeability. In clinical isolates, active efflux plays a prominent role in antibiotic resistance. We report here the effect of three unrelated compounds that are able to restore a noticeable antibiotic susceptibility to resistant strains. The targeting of various parameters which contribute to the

  14. Chloramphenicol and expression of multidrug efflux pump in Enterobacter aerogenes

    Microsoft Academic Search

    Didier Ghisalberti; Muriel Masi; Jean-Marie Pagès; Jacqueline Chevalier

    2005-01-01

    Chloramphenicol has been reported to act as an inducer of the multidrug resistance in Escherichia coli. A resistant variant able to grow on plates containing 64?g\\/ml chloramphenicol was obtained from the Enterobacter aerogenes ATCC 13048-type strain. Chloramphenicol resistance was due to an active efflux of this antibiotic and it was associated with resistance to fluoroquinolones and tetracycline, but not to

  15. Exploring the Genome of Cheese Starter Lactic Acid Bacterium Lactococcus lactis subsp. lactis CECT 4433.

    PubMed

    Tschoeke, Diogo Antonio; Moreira, Ana Paula B; Chimetto Tonon, Luciane A; de Mesquita, Milene Miranda A; Gregoracci, Gustavo B; Gomez-Gil, Bruno; Valle, Rogério; Thompson, Cristiane C; Thompson, Fabiano L

    2014-01-01

    Here, we present the draft genome sequences of Lactococcus lactis subsp. lactis CECT 4433, a cheese fermentation starter strain. The genome provides further insight into the genomic plasticity, biocomplexity (including gene strain specifics), and evolution of these genera. PMID:25395632

  16. Exploring the Genome of Cheese Starter Lactic Acid Bacterium Lactococcus lactis subsp. lactis CECT 4433

    PubMed Central

    Tschoeke, Diogo Antonio; Moreira, Ana Paula B.; Chimetto Tonon, Luciane A.; de Mesquita, Milene Miranda A.; Gregoracci, Gustavo B.; Gomez-Gil, Bruno; Valle, Rogério; Thompson, Cristiane C.

    2014-01-01

    Here, we present the draft genome sequences of Lactococcus lactis subsp. lactis CECT 4433, a cheese fermentation starter strain. The genome provides further insight into the genomic plasticity, biocomplexity (including gene strain specifics), and evolution of these genera. PMID:25395632

  17. Lactococcus lactis subsp. lactis infection in waterfowl: first confirmation in animals.

    PubMed Central

    Goyache, J.; Vela, A. I.; Gibello, A.; Blanco, M. M.; Briones, V.; González, S.; Téllez, S.; Ballesteros, C.; Domínguez, L.; Fernández-Garayzábal, J. F.

    2001-01-01

    We report the first description, confirmed by bacteriologic and molecular (polymerase chain reaction and pulsed-field gel electrophoresis) analysis, of an infection in animals caused by Lactococcus lactis subsp. lactis, affecting waterfowl. PMID:11747704

  18. Genome Sequence of Lactococcus lactis subsp. lactis NCDO 2118, a GABA-Producing Strain

    PubMed Central

    Oliveira, Letícia C.; Saraiva, Tessália D. L.; Soares, Siomar C.; Ramos, Rommel T. J.; Sá, Pablo H. C. G.; Carneiro, Adriana R.; Miranda, Fábio; Freire, Matheus; Renan, Wendel; Júnior, Alberto F. O.; Santos, Anderson R.; Pinto, Anne C.; Souza, Bianca M.; Castro, Camila P.; Diniz, Carlos A. A.; Rocha, Clarissa S.; Mariano, Diego C. B.; de Aguiar, Edgar L.; Folador, Edson L.; Barbosa, Eudes G. V.; Aburjaile, Flavia F.; Gonçalves, Lucas A.; Guimarães, Luís C.; Azevedo, Marcela; Agresti, Pamela C. M.; Silva, Renata F.; Tiwari, Sandeep; Almeida, Sintia S.; Hassan, Syed S.; Pereira, Vanessa B.; Abreu, Vinicius A. C.; Pereira, Ulisses P.; Dorella, Fernanda A.; Carvalho, Alex F.; Pereira, Felipe L.; Leal, Carlos A. G.; Figueiredo, Henrique C. P.; Silva, Artur; Miyoshi, Anderson

    2014-01-01

    Lactococcus lactis subsp. lactis NCDO 2118 is a nondairy lactic acid bacterium, a xylose fermenter, and a gamma-aminobutyric acid (GABA) producer isolated from frozen peas. Here, we report the complete genome sequence of L. lactis NCDO 2118, a strain with probiotic potential activity. PMID:25278529

  19. Isolation and characterization of an alginate lyase from Klebsiella aerogenes

    Microsoft Academic Search

    B. Lange; J. Wingender; U. K. Winkler

    1989-01-01

    The bacterium Klebsiella aerogenes (type 25) produced an inducible alginate lyase, whose major activity was located intracellularly during all growth phases. The enzyme was purified from the soluble fraction of sonicated cells by ammonium sulfate precipitation, anion- and cation-exchange chromatography and gel filtration. The apparent molecular weight of purified alginate lyase of 28,000 determined by gel filtration and of 31,600

  20. Thermodynamic study and optimization of hydrogen production by Enterobacter aerogenes

    Microsoft Academic Search

    B. Fabiano; P. Perego

    2002-01-01

    This paper investigates the influence of pH and temperature on hydrogen bioproduction by Enterobacter aerogenes (NCIMB 10102) utilizing starch hydrolysate as substrate. An optimum pH range corresponding to 6.1–6.6 is the main evidence of batch runs carried out at different pHs. An optimum value of temperature corresponding to 40°C is experimentally determined by means of batch fermentation runs carried out

  1. Enterobacter aerogenes Needle Stick Leads to Improved Biological Management System

    SciTech Connect

    Johanson, Richard E.

    2004-08-01

    A laboratory worker who received a needle stick from a contaminated needle while working with a culture containing Enterobactor aerogenes developed a laboratory acquired infection. Although this organism has been shown to cause community and nosocomial infections, there have been no documented cases of a laboratory acquired infections. Lessons learned from the event led to corrective actions which included modification of lab procedures, development of a biological inventory tracking and risk identification system and the establishment of an effective biological safety program.

  2. Biological Conversion of Glycerol to Ethanol by Enterobacter aerogenes

    NASA Astrophysics Data System (ADS)

    Nwachukwu, Raymond E. S.

    In a search to turn the economically and environmentally non-valuable "waste" streams of biodiesel production into a profitable byproduct, a mutant strain of Enterobacter aerogenes ATCC 13048 was developed by six-tube subculturing technique. This technique is based on the principle of adaptive evolution, and involved subculturing the bacterium in a tryptic soy broth without dextrose (TSB) containing specific glycerol and ethanol concentration for six consecutive times. Then, the six consecutive subculturing was repeated in a fresh TSB of higher glycerol and ethanol concentrations. A new mutant strain, E. aerogenes S012, which could withstand a combination of 200 g/l glycerol and 30 g/l ethanol concentrations, was developed. The wild and mutant strains were used for the fermentation of pure (P-) and recovered (R-) glycerol. Taguchi and full factorial methods of design of experiments were used to screen and optimize the important process factors that influence the microbial production of ethanol. A statistically sound regression model was used to establish the mathematical relationship between the process variables and ethanol production. Temperature of 38°C, agitation speed of 200 rpm, pH of 6.3-6.6, and microaerobic condition were the optimum process conditions. Different pretreatment methods to recover glycerol from the crude glycerol and the subsequent fermentation method showed that direct acidification using 85% H3PO4 was the best. The R-glycerol contained 51% pure glycerol and 21% methanol. The wild strain, E. aerogenes ATCC 13048, produced only 12 g/l and 12.8 g/l ethanol from 20 g/l P- and R-glycerol respectively, and could not utilize higher glycerol concentrations. The mutant, E. aerogenes S012, produced ethanol amount and yield of 43 g/l and 1.12 mol/mol-glycerol from P-glycerol, respectively within 96 h. It also produced ethanol amount and yield of 26.8 g/l and 1.07 mol/mol-glycerol, respectively, from R-glycerol within the same duration. In a fermentation to estimate hydrogen production using a respirometer, the hydrogen yield and volumetric rate of 1.06 mol/mol-glycerol and 217 ml/l/h, respectively were obtained from 6% P-glycerol in 72 h by E. aerogenes S012. The result was higher from R-glycerol, which produced hydrogen yield and productivity of 1.83 mol/mol-glycerol and 326 ml/l/h, respectively.

  3. Respiration capacity and consequences in Lactococcus lactis

    Microsoft Academic Search

    Philippe Gaudu; Karin Vido; Bénédicte Cesselin; Saulius Kulakauskas; Josselyne Tremblay; Lahcen Rezaïki; Gilles Lamberet; Sophie Sourice; Patrick Duwat; Alexandra Gruss

    2002-01-01

    We recently reported that the well-studied fermenting bacterium Lactococcus lactis could grow via a respirative metabolism in the presence of oxygen when a heme source is present. Respiration induces profound changes in L. lactis metabolism, and improvement of oxygen tolerance and long-term survival. Compared to usual fermentation conditions, biomass is approximately doubled by the end of growth, acid production is

  4. Functionality of Sortase A in Lactococcus lactis?

    PubMed Central

    Dieye, Yakhya; Oxaran, Virginie; Ledue-Clier, Florence; Alkhalaf, Walid; Buist, Girbe; Juillard, Vincent; Lee, Chang Won; Piard, Jean-Christophe

    2010-01-01

    Lactococcus lactis IL1403 harbors a putative sortase A (SrtA) and 11 putative sortase substrates that carry the canonical LPXTG signature of such substrates. We report here on the functionality of SrtA to anchor five LPXTG substrates to the cell wall, thus suggesting that SrtA is the housekeeping sortase in L. lactis IL1403. PMID:20851967

  5. Regulation of hydrogen production by Enterobacter aerogenes by external NADH and NAD +

    Microsoft Academic Search

    Chong Zhang; Kun Ma; Xin-Hui Xing

    2009-01-01

    Experiments involving the addition of external nicotinamide adenine dinucleotide, reduced form (NADH) or nicotinamide adenine dinucleotide (NAD+) have been designed to examine how the hydrogen in Enterobacter aerogenes is liberated by NADH or NAD+. The addition of external NADH or NAD+ was found to regulate hydrogen production by E. aerogenes in resting cells, batch cultures, and chemostat cultures. Particularly in chemostat

  6. Molecular Epidemiological Study of Nosocomial Enterobacter aerogenes Isolates in a Belgian Hospital

    Microsoft Academic Search

    SHEIKH JALALUDDIN; JEANNE-MARIE DEVASTER; ROBERT SCHEEN; MICHELE GERARD; JEAN-PAUL BUTZLER

    1998-01-01

    In 1995, the rate of isolation of Enterobacter aerogenes in the Saint-Pierre University Hospital in Brussels, Belgium, was higher than that in the preceding years. A total of 45 nosocomial E. aerogenes strains were collected from 33 patients of different units during that year, and they were isolated from 19 respiratory specimens, 13 pus specimens, 7 blood specimens, 4 urinary

  7. Hyaluronic acid production by recombinant Lactococcus lactis

    Microsoft Academic Search

    Liang-Jung Chien; Cheng-Kang Lee

    2007-01-01

    Microbial hyaluronic acid (HA), commonly produced by pathogenic Streptococcus, was made possible to be produced by a generally recognized as safe Lactococcus lactis by coexpressing HA synthase and uridine diphosphate–glucose dehydrogenase (UDP-GlcDH) of Streptococcus equi subsp. zooepidemicus in a nisin-controlled expression (NICE) system. With scarce expressed HA synthase alone, the constructed recombinant L. lactis (LL-NA) strain could produce HA with

  8. Possible role of membrane proteins in mercury resistance of Enterobacter aerogenes

    Microsoft Academic Search

    Hidemitsu S Pan-Hou; Masayo Nishimoto; Nobumasa Imura

    1981-01-01

    Mercury resistance shown by a strain of Enterobacter aerogenes was found to be determined by a plasmid. The resistance appeared to be not due to enzymatic volatilization of mercury, but due to the alteration in cellular permeability to mercury.

  9. Resistance to imipenem, cefepime, and cefpirome associated with mutation in Omp36 osmoporin of Enterobacter aerogenes

    Microsoft Academic Search

    Aurélie Thiolas; Charléric Bornet; Anne Davin-Régli; Jean-Marie Pagès; Claude Bollet

    2004-01-01

    Enterobacter aerogenes develops increased multidrug resistance via a functional alteration of outer-membrane permeability associated with a decrease in porin function. We have sequenced the gene coding the major porin of Enterobacter aerogenes, omp36. The sequence shows a high similarity with the Klebsiella pneumoniae ompK36 gene and is closely related to the enterobacterial OmpC family. Sequence analysis of several Omp36 issued

  10. Enhanced hydrogen production in altered mixed acid fermentation of glucose by Enterobacter aerogenes

    Microsoft Academic Search

    Mahyudin Abdul Rachman; Yoshinori Furutani; Yutaka Nakashimada; Toshihide Kakizono; Naomichi Nishio

    1997-01-01

    Hydrogen (H2) production by mutants of Enterobacter aerogenes HU-101, a strain isolated and characterized in our laboratory, was found to be enhanced compared with that of HU-101 due to blockage of production of other metabolites. The mutants were isolated by the allyl alcohol (AA) and\\/or proton suicide method. Among the AA resistant mutants isolated after NTG treatment of E. aerogenes

  11. A model for multiproduct-inhibited growth of Enterobacter aerogenes in 2,3-butanediol fermentation

    Microsoft Academic Search

    An-Ping Zeng; Wolf-Dieter Deckwer

    1991-01-01

    Ethanol is identified as a strongly inhibitory metabolite in addition to acetic acid and 2,3-butanediol in 2,3-butanediol production by Enterobacter aerogenes. A model is proposed to describe the multiproduct-inhibited growth of E. aerogenes in 2,3-butanediol fermentation. The model is verified with data from anaerobic and microaerobic continuous culture. On the basis of this model the difference in biomass production and

  12. Plasmid-Mediated Resistance to Expanded-Spectrum Cephalosporins among Enterobacter aerogenes Strains

    Microsoft Academic Search

    JOHANN D. D. PITOUT; KENNETH S. THOMSON; NANCY D. HANSON; ANTON F. EHRHARDT; PHILIP COUDRON; CHRISTINE C. SANDERS

    1998-01-01

    Resistance to expanded-spectrum cephalosporins commonly develops in Enterobacter aerogenes during ther- apy due to selection of mutants producing high levels of the chromosomal Bush group 1 b-lactamase. Recently, resistant strains producing plasmid-mediated extended-spectrum b-lactamases (ESBLs) have been isolated as well. A study was designed to investigate ESBL production among 31 clinical isolates of E. aerogenes from Richmond, Va., with decreased

  13. RamA Is an Alternate Activator of the Multidrug Resistance Cascade in Enterobacter aerogenes

    Microsoft Academic Search

    Renaud Chollet; Jacqueline Chevalier; Claude Bollet; Jean-Marie Pages; Anne Davin-Regli

    2004-01-01

    Multidrug resistance (MDR) in Enterobacter aerogenes can be mediated by induction of MarA, which is triggered by certain antibiotics and phenolic compounds. In this study, we identified the gene encoding RamA, a 113-amino-acid regulatory protein belonging to the AraC-XylS transcriptional activator family, in the Enterobacter aerogenes ATCC 13048 type strain and in a clinical multiresistant isolate. Overexpression of RamA induced

  14. Inhibitors of Antibiotic Efflux in Resistant Enterobacter aerogenes and Klebsiella pneumoniae Strains

    PubMed Central

    Chevalier, Jacqueline; Bredin, Jérôme; Mahamoud, Abdallah; Malléa, Monique; Barbe, Jacques; Pagès, Jean-Marie

    2004-01-01

    In Enterobacter aerogenes and Klebsiella pneumoniae, efflux provides efficient extrusion of antibiotics and contributes to the multidrug resistance phenotype. One of the alkoxyquinoline derivatives studied here, 2,8-dimethyl-4-(2?-pyrrolidinoethyl)-oxyquinoline, restores noticeable drug susceptibility to resistant clinical strains. Analyses of energy-dependent chloramphenicol efflux indicate that this compound inhibits the efflux pump mechanism and improves the activity of structurally unrelated antibiotics on multidrug-resistant E. aerogenes and K. pneumoniae isolates. PMID:14982806

  15. Genome Sequence of the Lactic Acid Bacterium Lactococcus lactis subsp. lactis TOMSC161, Isolated from a Nonscalded Curd Pressed Cheese

    PubMed Central

    Velly, H.; Abraham, A.-L.; Loux, V.; Delacroix-Buchet, A.; Fonseca, F.; Bouix, M.

    2014-01-01

    Lactococcus lactis is a lactic acid bacterium used in the production of many fermented foods, such as dairy products. Here, we report the genome sequence of L. lactis subsp. lactis TOMSC161, isolated from nonscalded curd pressed cheese. This genome sequence provides information in relation to dairy environment adaptation. PMID:25377704

  16. Draft Genome Sequence of Lactococcus lactis subsp. lactis JCM 5805T, a Strain That Induces Plasmacytoid Dendritic Cell Activation.

    PubMed

    Fujii, Toshio; Tomita, Yasuyuki; Ikushima, Shigehito; Horie, Akira; Fujiwara, Daisuke

    2015-01-01

    Lactococcus lactis subsp. lactis JCM 5805(T) is a dairy lactic acid bacterium that induces plasmacytoid dendritic cell (pDC) activation. Here, we report the 2.55-Mb draft genome and annotation of Lactococcus lactis JCM 5805(T). This genome information will provide further insights into the mechanisms underlying the immunomodulatory function of this strain. PMID:25792049

  17. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Characterization of the bacteriocin

    PubMed Central

    Furtado, Danielle N.; Todorov, Svetoslav D.; Landgraf, Mariza; Destro, Maria T.; Franco, Bernadette D.G.M.

    2014-01-01

    Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi) was isolated from goat milk, and studied for its antimicrobial activity. The bacteriocin presented a broad spectrum of activity, was sensitive to proteolytic enzymes, resistant to heat and pH extremes, and not affected by the presence of SDS, Tween 20, Tween 80, EDTA or NaCl. Bacteriocin production was dependent on the components of the culture media, especially nitrogen source and salts. When tested by PCR, the bacteriocin gene presented 100% homology to nisin Z gene. These properties indicate that this L. lactis subsp. lactis DF4Mi can be used for enhancement of dairy foods safety and quality. PMID:25763065

  18. Growth and Energy Generation by Lactococcus lactis subsp. lactis biovar diacetylactis during Citrate Metabolism

    PubMed Central

    Hugenholtz, Jeroen; Perdon, Leo; Abee, Tjakko

    1993-01-01

    Growth of Lactococcus lactis subsp. lactis biovar diacetylactis was observed on media with citrate as the only energy source. At pH 5.6, steady state was achieved in a chemostat on a citrate-containing medium in the absence of a carbohydrate. Under these conditions, pyruvate, acetate, and some acetoin and butanediol were the main fermentation products. This indicated that energy was conserved in L. lactis subsp. lactis biovar diacetylactis during citrate metabolism and presumably during the conversion of citrate into pyruvate. The presumed energy-conserving step, decarboxylation of oxaloacetate, was studied in detail. Oxaloacetate decarboxylase was purified to homogeneity and characterized. The enzyme has a native molecular mass of approximately 300 kDa and consists of three subunits of 52, 34, and 12 kDa. The enzyme is apparently not sodium dependent and does not contain a biotin moiety, and it seems to be different from the energy-generating oxaloacetate decarboxylase from Klebsiella pneumoniae. Energy-depleted L. lactis subsp. lactis biovar diacetylactis cells generated a membrane potential and a pH gradient immediately upon addition of citrate, whereas ATP formation was slow and limited. In contrast, lactose energization resulted in rapid ATP formation and gradual generation of a proton motive force. These data were confirmed during studies on amino acid uptake. ?-Aminoisobutyrate uptake was rapid but glutamate uptake was slow in citrate-energized cells, whereas lactose-energized cells showed the reverse tendency. These data suggest that, in L. lactis subsp. lactis bv. diacetylactis, a proton motive force could be generated during citrate metabolism as a result of electrogenic citrate uptake or citrate/product exchange together with proton consumption by the intracellular oxaloacetate decarboxylase. Images PMID:16349120

  19. Complete Genome Sequence of Lactococcus lactis subsp. lactis KLDS4.0325

    PubMed Central

    Yang, Xiaochun; Wang, Yutang

    2013-01-01

    We report the complete genome sequence of Lactococcus lactis subsp. lactis KLDS4.0325, a probiotic bacterium isolated from homemade koumiss in Xinjiang, China. We have determined the complete genome sequence of strain KLDS4.0325, which consists of a chromosome and three plasmids and reveals genes that are likely to be involved in dairy fermentation and that have probiotic qualities. PMID:24285665

  20. Phosphatase synthesis in Klebsiella (aerobacter) aerogenes growing in continuous culture.

    PubMed

    Bolton, P G; Dean, A C

    1972-03-01

    1. Phosphatase synthesis was studied in Klebsiella aerogenes grown in a wide range of continuous-culture systems. 2. Maximum acid phosphatase synthesis was associated with nutrient-limited, particularly carbohydrate-limited, growth at a relatively low rate, glucose-limited cells exhibiting the highest activity. Compared with glucose as the carbon-limiting growth material, other sugars not only altered the activity but also changed the pH-activity profile of the enzyme(s). 3. The affinity of the acid phosphatase in glucose-limited cells towards p-nitrophenyl phosphate (K(m) 0.25-0.43mm) was similar to that of staphylococcal acid phosphatase but was ten times greater than that of the Escherichia coli enzyme. 4. PO(4) (3-)-limitation derepressed alkaline phosphatase synthesis but the amounts of activity were largely independent of the carbon source used for growth. 5. The enzymes were further differentiated by the effect of adding inhibitors (F(-), PO(4) (3-)) and sugars to the reaction mixture during the assays. In particular, it was shown that adding glucose, but not other sugars, stimulated the rate of hydrolysis of p-nitrophenyl phosphate by the acid phosphatase in carbohydrate-limited cells at low pH values (<4.6) but inhibited it at high pH values (>4.6). Alkaline phosphatase activity was unaffected. 6. The function of phosphatases in general is discussed and possible mechanisms for the glucose effect are outlined. PMID:4342213

  1. Methionine-to-Cysteine Recycling in Klebsiella aerogenes

    PubMed Central

    Seiflein, Thomas A.; Lawrence, Jeffrey G.

    2001-01-01

    In the enteric bacteria Escherichia coli and Salmonella enterica, sulfate is reduced to sulfide and assimilated into the amino acid cysteine; in turn, cysteine provides the sulfur atom for other sulfur-bearing molecules in the cell, including methionine. These organisms cannot use methionine as a sole source of sulfur. Here we report that this constraint is not shared by many other enteric bacteria, which can use either cysteine or methionine as the sole source of sulfur. The enteric bacterium Klebsiella aerogenes appears to use at least two pathways to allow the reduced sulfur of methionine to be recycled into cysteine. In addition, the ability to recycle methionine on solid media, where cys mutants cannot use methionine as a sulfur source, appears to be different from that in liquid media, where they can. One pathway likely uses a cystathionine intermediate to convert homocysteine to cysteine and is induced under conditions of sulfur starvation, which is likely sensed by low levels of the sulfate reduction intermediate adenosine-5?-phosphosulfate. The CysB regulatory proteins appear to control activation of this pathway. A second pathway may use a methanesulfonate intermediate to convert methionine-derived methanethiol to sulfite. While the transsulfurylation pathway may be directed to recovery of methionine, the methanethiol pathway likely represents a general salvage mechanism for recovery of alkane sulfide and alkane sulfonates. Therefore, the relatively distinct biosyntheses of cysteine and methionine in E. coli and Salmonella appear to be more intertwined in Klebsiella. PMID:11114934

  2. An efficient ribitol-specific dehydrogenase from Enterobacter aerogenes.

    PubMed

    Singh, Ranjitha; Singh, Raushan; Kim, In-Won; Sigdel, Sujan; Kalia, Vipin C; Kang, Yun Chan; Lee, Jung-Kul

    2015-05-01

    An NAD(+)-dependent ribitol dehydrogenase from Enterobacter aerogenes KCTC 2190 (EaRDH) was cloned and successfully expressed in Escherichia coli. The complete 729-bp gene was amplified, cloned, expressed, and subsequently purified in an active soluble form using nickel affinity chromatography. The enzyme had an optimal pH and temperature of 11.0 and 45°C, respectively. Among various polyols, EaRDH exhibited activity only toward ribitol, with Km, Vmax, and kcat/Km values of 10.3mM, 185Umg(-1), and 30.9s(-1)mM(-1), respectively. The enzyme showed strong preference for NAD(+) and displayed no detectable activity with NADP(+). Homology modeling and sequence analysis of EaRDH, along with its biochemical properties, confirmed that EaRDH belongs to the family of NAD(+)-dependent ribitol dehydrogenases, a member of short-chain dehydrogenase/reductase (SCOR) family. EaRDH showed the highest activity and unique substrate specificity among all known RDHs. Homology modeling and docking analysis shed light on the molecular basis of its unusually high activity and substrate specificity. PMID:25837508

  3. The AcrAB-TolC Efflux Pump Contributes to Multidrug Resistance in the Nosocomial Pathogen Enterobacter aerogenes

    Microsoft Academic Search

    Elizabeth Pradel; Jean-Marie Pages

    2002-01-01

    For the last decade, Enterobacter aerogenes, a commensal gram-negative bacterium of human intestinal flora, has been rapidly emerging as an important nosocomial pathogen (14, 18). Of concern is the increasing frequency of E. aerogenes isolates that are resistant to antibiotics and antiseptics (3). Several types of systems have evolved in gram-negative bac- teria to pump deleterious molecules out of the

  4. Antimicrobial potential of immobilized Lactococcus lactis subsp. lactis ATCC 11454 against selected bacteria.

    PubMed

    Millette, M; Smoragiewicz, W; Lacroix, M

    2004-06-01

    Immobilization of living cells of lactic acid bacteria could be an alternative or complementary method of immobilizing organic acids and bacteriocins and inhibit undesirable bacteria in foods. This study evaluated the inhibition potential of immobilized Lactococcus lactis subsp. lactis ATCC 11454 on selected bacteria by a modified method of the agar spot test. L. lactis was immobilized in calcium alginate (1 to 2%)-whey protein concentrate (0 and 1%) beads. The antimicrobial potential of immobilized L. lactis was evaluated in microbiological media against pathogenic bacteria (Escherichia coli, Salmonella, and Staphylococcus aureus) or Pseudomonas putida, a natural meat contaminant, and against seven gram-positive bacteria used as indicator strains. Results obtained in this study indicated that immobilized L. lactis inhibited the growth of S. aureus, Enterococcus faecalis, Enterococcus faecium, Lactobacillus curvatus, Lactobacillus sakei, Kocuria varians, and Pediococcus acidilactici. Only 4 h of incubation at 35 degrees C resulted in a clear inhibition zone around the beads that increased with time. With the addition of 10 mM of a chelating agent (EDTA) to the media, results showed growth inhibition of E. coli; however, P. putida and Salmonella Typhi were unaffected by this treatment. These results indicate that immobilized lactic acid bacteria strains can be successfully used to produce nisin and inhibit bacterial growth in semisolid synthetic media. PMID:15222547

  5. Novel Antibacterial Activity of Lactococcus Lactis Subspecies Lactis Z11 Isolated from Zabady

    PubMed Central

    Enan, Gamal; Abdel-Shafi, Seham; Ouda, Sahar; Negm, Sally

    2013-01-01

    The purpose of this study was to select and characterize a probiotic bacterium with distinctive antimicrobial activities. In this respect, Lactococcus lactis subspecies lactis Z11 (L. lactis Z11) isolated from Zabady (Arabian yoghurt) inhibited other strains of lactic acid bacteria and some food-born pathogens including Listeria monocytogenes, Bacillus cereus and staphylococcus aureus. The inhibitory activity of cell free supernatant (CFS) of L. lactis Z11 isolated from zabady was lost by proteolytic enzymes, heat resistant. Consequently, the active substance(s) of CFS was characterized as a bacteriocin. This bacteriocin has been shown to consist of protein but has no lipidic or glucidic moieties in its active molecule. Its activity was stable in the pH range 2.0 to 7.0 and was not affected by organic solvents. The L. lactis Z11 bacteriocin was produced in CFS throughout the mide to the late exponential phase of growth of the producer organism and maximum bacteriocin production was obtained at initial pH 6.5 at incubation temperature of about 30°C. PMID:24151453

  6. The non-oxidative decarboxylation of p -hydroxybenzoic acid, gentisic acid, protocatechuic acid and gallic acid by Klebsiella aerogenes (Aerobacter aerogenes)

    Microsoft Academic Search

    D. J. W. Grant; J. C. Patel

    1969-01-01

    Klebsiella aerogenes adapted to a chemically-defined mineral salts medium with glucose orp-hydroxybenzoate as sole source of carbon and energy possessed constitutive decarboxylases for gentisate (2,5-dihydroxybenzoate), protocatechuate (3,4-dihydroxybenzoate) and gallate (3,4,5-trihydroxybenzoate) whose pH optima were respectively 5.9, 5.6 and 5.8. A decarboxylase for PHB was induced by PHB in both growing and resting cells; the induction was delayed or inhibited by

  7. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Evaluation of the probiotic potential

    PubMed Central

    Furtado, Danielle N.; Todorov, Svetoslav D.; Landgraf, Mariza; Destro, Maria T.; Franco, Bernadette D.G.M.

    2014-01-01

    Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi) was isolated from goat milk, and studied for its probiotic potential. Lc. lactis DF4Mi was resistant to acidic pH and oxbile, presented co-aggregation with Listeria monocytogenes, and was not affected by several drugs from different generic groups, being sensitive to most tested antibiotics. These properties indicate that this Lc. lactis strain can be used for enhancement of dairy foods safety and quality, in combination with potential probiotic properties. PMID:25477942

  8. Enhanced Human Lysozyme Production by Kluyveromyces lactis

    Microsoft Academic Search

    Eric Lu Huang; Ali Demirci

    2009-01-01

    An attempt to enhance recombinant human lysozyme production by Kluyveromyces lactis K7 was performed in this study. In this study, the production of recombinant human lysozyme was investigated using shake\\u000a flasks and bioreactor under different cultivation conditions. It was demonstrated that 25 °C could enhance human lysozyme\\u000a production when compared with other temperatures tested. This study also demonstrated that higher biomass

  9. In Vivo Modification of Porin Activity Conferring Antibiotic Resistance to Enterobacter aerogenes

    Microsoft Academic Search

    Jacqueline Chevalier; Jean-Marie Pagès; Monique Malléa

    1999-01-01

    Cephalosporins are widely used in chemotherapy of bacterial infections and resistance mechanisms seriously impair their antibacterial activity. Several resistant strains of Enterobacter aerogenes, a frequently isolated nosocomial pathogen, were analyzed. One isolate exhibited a strong modification of the porin antigenic pattern, especially with an immunological probe directed against an epitope located inside the pore lumen. A strong decrease of cefepime

  10. Hydrogen production by immobilized cells of aciduric Enterobacter aerogenes strain HO39

    Microsoft Academic Search

    Haruhiko Yokoi; Tadafumi Tokushige; Jun Hirose; Sachio Hayashi; Yoshiyuki Takasaki

    1997-01-01

    Cell immobilization of Enterobacter aerogenes strain HO-39 in agar gel or on porous glass beads was effective for hydrogen production in batch cultures of cells immobilized by the entrapment and adsorption methods. Stirring of the culture was indispensable for effective hydrogen production using cells immobilized in agar gel. However, relatively good hydrogen-production performance was obtained with cells immobilized on porous

  11. Porin alteration and active efflux: two in vivo drug resistance strategies used by Enterobacter aerogenes

    Microsoft Academic Search

    Monique Mallea; Jacqueline Chevalier; Charleric Bornet; Annie Eyraud; Anne Davin-Regli; Claude Bollet; Jean-Marie Pages

    1998-01-01

    Entembacter aemgenes is among the five most frequently isolated nosocomial pathogens in France, and this bacterium also shows increasing multidrug resistance. In this study, various E. aerogenes strains isolated from hospital units were characterized for their outer-membrane proteins, antibiotic susceptibilities (inhibition diameters and MICs) and resistance mechanisms associated with modification of envelope permeability (porin alteration and active efflux). Diminished outer-membrane

  12. Optimization of key process variables for enhanced hydrogen production by Enterobacter aerogenes using statistical methods

    Microsoft Academic Search

    Ji Hye Jo; Dae Sung Lee; Donghee Park; Woo-Seok Choe; Jong Moon Park

    2008-01-01

    The individual and mutual effects of glucose concentration, temperature and pH on the hydrogen production by Enterobacter aerogenes were investigated in a batch system. A Box–Behnken design and response surface methodology (RSM) were employed to determine the optimum condition for enhanced hydrogen production. The hydrogen production rate was investigated by simultaneously changing the three independent variables, which all had significant

  13. Hydrogen production of Enterobacter aerogenes altered by extracellular and intracellular redox states

    Microsoft Academic Search

    Y. Nakashimada; M. A. Rachman; T. Kakizono; N. Nishio

    2002-01-01

    Enterobacter aerogenes HU-101, tested for its hydrogen production in batch cultures on various substrates, produced the highest amount of hydrogen when the substrate was glycerol. The yield of hydrogen is a function of the degree to which the substrates are reduced. To examine the effect of intracellular redox state on hydrogen yield, glucose-limiting chemostat cultures were carried out at various

  14. Repeated cadmium biosorption by regenerated Enterobacter aerogenes biofilm attached to activated carbon

    Microsoft Academic Search

    J. A. Scott; A. M. Karanjkar

    1992-01-01

    Summary The bacteriumEnterobacter aerogenes has been used to develop a biofilm over activated carbon for biosorption from various strength cadmium solutions (25–500ppm). High bacterial resistance to metal poisoning allowed biofilm regeneration to raise the net loading of cadmium over the carbon by repeated biosorption runs.

  15. Molecular characterization of the nisin resistance region of Lactococcus lactis subsp. lactis biovar diacetylactis DRC3.

    PubMed Central

    Froseth, B R; McKay, L L

    1991-01-01

    The nisin resistance determinant of Lactococcus lactis subsp. lactis biovar diacetylactis DRC3 was localized onto a 1.3-kb EcoRI-NdeI fragment by subcloning and interrupting the NdeI site by cloning random NdeI fragments into it; the nisin resistance determinant was then sequenced. The nucleotide sequence revealed a large open reading frame containing 318 codons. Putative transcription and translation signal sequences were located directly upstream from the initiation codon. Immediately downstream of the termination codon was a palindromic region resembling a rho-independent termination sequence. This 957-nucleotide open reading frame and its associated transcription and translation signal sequences were cloned into plasmid-free L. lactis subsp. lactis LM0230 and conferred an MIC of 160 IU of nisin per ml. This level of nisin resistance is equivalent to that of the initial nisin-resistant subclone, pFM011, used for further subcloning in this study. The inferred amino acid sequence would result in a protein with a molecular mass of 35,035 Da. This value was in agreement with the molecular mass of a protein detected after in vitro transcription and translation of DNA encoding the nisin resistance gene, nsr. This protein contained a hydrophobic region at the N terminus that was predicted to be membrane associated but did not contain a typical signal sequence cleavage site. No significant homology was detected when the DNA sequence of the nsr gene and the amino acid sequence of its putative product were compared with other available sequences. When subjected to Southern hybridization, a 1.2-kb DraI fragment encoding the nsr gene did not hybridize with the genomic DNA of the nisin-producing strain L. lactis subsp. lactis 11454. Images PMID:1903915

  16. Production and secretion of heterologous proteins by Lactococcus lactis

    Microsoft Academic Search

    Asseldonk van M

    1994-01-01

    Lactococcus lactis strains have been used for centuries in food fermentation, now appreciated as traditional biotechnology. They have been applied in the cheesemaking process and for the manufacturing of other dairy products. Years of experience with these lactic acid bacteria have led to a profound understanding of the microbiological and technological aspects of L.lactis. Recent progress in the genetics of

  17. Multivitamin production in Lactococcus lactis using metabolic engineering

    Microsoft Academic Search

    Wilbert Sybesma; Catherine Burgess; Marjo Starrenburg; Douwe van Sinderen; Jeroen Hugenholtza

    2004-01-01

    The dairy starter bacterium Lactococcus lactis has the potential to synthesize both folate (vitamin B11) and riboflavin (vitamin B2). By directed mutagenesis followed by selection and metabolic engineering we have modified two complicated biosynthetic pathways in L. lactis resulting in simultaneous overproduction of both folate and riboflavin: Following exposure to the riboflavin analogue roseoflavin we have isolated a spontaneous mutant

  18. Influence of the carbon source on nisin production in Lactococcus lactis subsp. lactis batch fermentations

    Microsoft Academic Search

    LUC DE VUYST; ERICK J. VANDAMME

    1992-01-01

    Nisin production by Lactucmcus lrrctis subsp. lactis NIZO 22186 was studied in batch fermentation using a complex medium. Nisin production showed primary metabolite kinetics: nisin biosynthesis took place during the active growth phase and completely stopped when cells entered the stationary phase. A stringent correlation could be observed between the expression of the prenisin gene (nisA) and the synthesis of

  19. Dual role of alpha-acetolactate decarboxylase in Lactococcus lactis subsp. lactis.

    PubMed Central

    Goupil-Feuillerat, N; Cocaign-Bousquet, M; Godon, J J; Ehrlich, S D; Renault, P

    1997-01-01

    The alpha-acetolactate decarboxylase gene aldB is clustered with the genes for the branched-chain amino acids (BCAA) in Lactococcus lactis subsp. lactis. It can be transcribed with BCAA genes under isoleucine regulation or independently of BCAA synthesis under the control of its own promoter. The product of aldB is responsible for leucine sensibility under valine starvation. In the presence of more than 10 microM leucine, the alpha-acetolactate produced by the biosynthetic acetohydroxy acid synthase IlvBN is transformed to acetoin by AldB and, consequently, is not available for valine synthesis. AldB is also involved in acetoin formation in the 2,3-butanediol pathway, initiated by the catabolic acetolactate synthase, AlsS. The differences in the genetic organization, the expression, and the kinetics parameters of these enzymes between L. lactis and Klebsiella terrigena, Bacillus subtilis, or Leuconostoc oenos suggest that this pathway plays a different role in the metabolism in these bacteria. Thus, the alpha-acetolactate decarboxylase from L. lactis plays a dual role in the cell: (i) as key regulator of valine and leucine biosynthesis, by controlling the acetolactate flux by a shift to catabolism; and (ii) as an enzyme catalyzing the second step of the 2,3-butanediol pathway. PMID:9335274

  20. Detection and Viability of Lactococcus lactis throughout Cheese Ripening

    PubMed Central

    Cocolin, Luca

    2014-01-01

    Recent evidences highlighted the presence of Lactococcus lactis during late cheese ripening. For this reason, the role of this microorganism, well known as dairy starter, should be reconsidered throughout cheese manufacturing and ripening. Thus, the main objective of this study was to develop a RT-qPCR protocol for the detection, quantification and determination of the viability of L. lactis in ripened cheese samples by direct analysis of microbial nucleic acids. Standard curves were constructed for the specific quantification of L. lactis in cheese matrices and good results in terms of selectivity, correlation coefficient and efficiency were obtained. Thirty-three ripened cheeses were analyzed and, on the basis of RNA analysis, twelve samples showed 106 to 108 CFU of L. lactis per gram of product, thirteen from 103 to 105 CFU/g, and in eight cheeses, L. lactis was not detected. Traditional plating on M17 medium led to loads ranging from 105 to 109 CFU/g, including the cheese samples where no L. lactis was found by RT-qPCR. From these cheeses, none of the colonies isolated on M17 medium was identified as L. lactis species. These data could be interpreted as a lack of selectivity of M17 medium where colony growth is not always related to lactococcal species. At the same time, the absence or low abundance of L. lactis isolates on M17 medium from cheese where L. lactis was detected by RT-qPCR support the hypothesis that L. lactis starter populations are mainly present in viable but not culturable state during ripening and, for this reason, culture-dependent methods have to be supplemented with direct analysis of cheese. PMID:25503474

  1. Production of adenine arabinoside by gel-entrapped cells of Enterobacter aerogenes in water-organic cosolvent system

    Microsoft Academic Search

    Kenzo Yokozekil; Shigeru Yamanaka; Takashi Utagawa; Koichi Takinami; Yoshio Hirose; Atsuo Tanaka; Kenji Sonomoto; Saburo Fukui

    1982-01-01

    Gel-entrapped whole cells of Enterobacter aerogenes, which has a transglycosylation activity, were used to produce adenine arabinoside from uracil arabinoside and adenine, in an appropriate water-organic cosolvent system. Cells of E. aerogenes entrapped with a hydrophilic photo-crosslinkable resin prepolymer, ENT-4000, or a urethane prepolymer, PU-6, had a high and stable transglycosylation activity. To improve the poor solubility in water of

  2. [Evaluation of aerogenic occupational health risk for workers engaged into periclase-carbon refractories production].

    PubMed

    Drugova, O G; Rosly?, O F

    2014-01-01

    The work is aimed to evaluate aerogenic occupational health risk for workers engaged into preparation and formation of technologic mass in periclase-carbon refractories production, using organic binding agent according to criteria R 2.2.2006-05 and R 2.2.1716-03. Occupational dust is a complicated chemical mixture containing manganum oxide, phenol, formaldehyde, aerosols containing silicon, benzpyrene (if "Carbores" binding agent used). Hygienic evaluation revealed occupational health risk due to occupational dust at workplaces of runners operator, press operator, batching feeder, crane operator. Aerogenic occupational risk at workplace of grinder operator is assessed as negligibly small (tolerable). Experimental and epidemiologic studies prove probable (proof category 1B) occupational risk of respiratory disease at the studied production. PMID:25282807

  3. Nucleotide Sequence of the Chromosomal ampC Gene of Enterobacter aerogenes

    Microsoft Academic Search

    KAREN E. PRESTON; CHRISTOPHER C. A. RADOMSKI; RICHARD A. VENEZIA

    2000-01-01

    The AmpC b-lactamase gene and a small portion of the regulatory ampR sequence of Enterobacter aerogenes 97B were cloned and sequenced. The b-lactamase had an isoelectric point of 8 and conferred cephalosporin and cephamycin resistance on the host. The sequence of the cloned gene is most closely related to those of the ampC genes of E. cloacae and C. freundii.

  4. 2,3Butanediol production by Enterobacter aerogenes in continuous culture: role of oxygen supply

    Microsoft Academic Search

    An-Ping Zeng; Hanno Biebl; Wolf-Dieter Deckwer

    1990-01-01

    The influence of oxygen on growth and production of 2,3-butanediol and acetoin by Enterobacter aerogenes was studied in continuous culture. At all dilution rates (D) studied cell mass increased steadily with increasing oxygen uptake rate (OUR), hence the micro-aerobic cultivation was energy-limited. The biomass yield on oxygen increased with D which suggests that cells need more energy for maintenance functions

  5. Characteristics of hydrogen production by aciduric Enterobacter aerogenes strain HO39

    Microsoft Academic Search

    Haruhiko Yokoi; Takanobu Ohkawara; Jun Hirose; Satio Hayashi; Yoshiyuki Takasaki

    1995-01-01

    An aciduric facultative anaerobe with a hydrogen-producing ability was isolated and identified as Enterobacter aerogenes strain HO-39. The bacterium was able to grow at acidic pH of 3.3 aerobically and at 4.0 anaerobically. Although the optimum pH for hydrogen production was 6.0 to 7.0, hydrogen could be produced at acidic pH of 4.0. The optimum temperature for hydrogen production and

  6. Rapid detection of a gfp-marked Enterobacter aerogenes under anaerobic conditions by aerobic fluorescence recovery

    Microsoft Academic Search

    Chong Zhang; Xin-Hui Xing; Kai Lou

    2005-01-01

    A gfp- and kanamycin-resistance gene-containing plasmid pUCGK was successfully constructed and transformed into Enterobacter aerogenes to develop a rapid GFP-based method for quantifying the bacterial concentration under anaerobic conditions for production of biohydrogen. Since the use of GFP as a molecular reporter is restricted by its requirement for oxygen in the development of the fluorophore, fluorescence detection for the fluorescent

  7. H2 production from starch by a mixed culture of Clostridium butyricum and Enterobacter aerogenes

    Microsoft Academic Search

    Haruhiko Yokoi; Tadafumi Tokushige; Jun Hirose; Sachio Hayashi; Yoshiyuki Takasaki

    1998-01-01

    A mixed continuous culture of Clostridium butyricum and Enterobacter aerogenes removed O2 in a reactor and produced H2 from starch with yield of more than 2 mol H2\\/mol glucose without any reducing agents in the medium. Co-immobilized cells of the bacteria on porous glass beads evolved H2 from starch at 1.3 l\\/l.h, with H2 yield of 2.6 mol H2\\/ mol

  8. Fluorescence monitoring during cultivation of Enterobacter aerogenes at different oxygen levels

    Microsoft Academic Search

    J. Mukherjee; C. Lindemann; T. Scheper

    1999-01-01

    On-line monitoring of NAD(P)H fluorescence and 2D fluorescence spectroscopy was performed with Enterobacter aerogenes, a bacterium sensitive to oxygen availability. The organism was grown in a reactor under low and high dissolved oxygen concentrations\\u000a and circulated through a bypass attached to the reactor. Under low dissolved oxygen concentration in the reactor, NAD(P)H\\u000a fluorescence in the reactor and the bypass showed

  9. Enterobacter aerogenes OmpX, a cation-selective channel mar- and osmo-regulated

    Microsoft Academic Search

    Myrielle Dupont; Emmanuelle Dé; Renaud Chollet; Jacqueline Chevalier; Jean-Marie Pagès

    2004-01-01

    The ompX gene of Enterobacter aerogenes was cloned. Its overexpression induced a decrease in the major porin Omp36 production and consequently a ?-lactam resistance was noted. Purified outer membrane protein X (OmpX) was reconstituted into artificial membranes and formed ion channels with a conductance of 20 pS in 1 M NaCl and a cationic selectivity. Both MarA expression and high

  10. Studies on nutritional and oxygen requirements for production of L-asparaginase by Enterobacter aerogenes

    Microsoft Academic Search

    J. Mukherjee; S. Majumdar; T. Scheper

    2000-01-01

    The carbon and nitrogen sources most suitable for L-asparaginase production by Enterobacter aerogenes were selected and their concentrations optimized in shake-flask cultures. Sodium citrate (1.0%) and diammonium hydrogen phosphate\\u000a (0.16%) proved to be the best sources of carbon and nitrogen, respectively. Nitrogen catabolite repression of enzyme formation\\u000a was absent in this bacterium. Cultivation in a reactor showed that the dissolved

  11. A novel bioflocculant produced by Enterobacter aerogenes and its use in defecating the trona suspension

    Microsoft Academic Search

    Wen-Yu Lu; Tong Zhang; Dong-Yan Zhang; Cai-Hong Li; Jian-Ping Wen; Lian-Xiang Du

    2005-01-01

    In this paper, a bioflocculant-producing bacterium, named W-23, was isolated from soil and identified as Enterobacter aerogenes. The bioflocculant (named WF-1) produced by W-23 was an acidic polysaccharide composed mainly of uronic acid (13.2%), pyruvic acid (7.4%) and acetic acid (1.6%). The three components sugars of WF-1 were glucose, fructose and manose, and the molar ratio was 10.3:5.4:1 for glucose:fructose:manose.

  12. Production of l-asparaginase in Enterobacter aerogenes expressing Vitreoscilla hemoglobin for efficient oxygen uptake

    Microsoft Academic Search

    H. Geckil; S. Gencer

    2004-01-01

    This study is the first utilizing Vitreoscilla hemoglobin in a heterologous bacterium, Enterobacter aerogenes, to determine the effect of such a highly efficient oxygen-uptake system on the production of l-asparaginase, an enzyme that has attracted considerable attention due to its anti-tumor activity. Here, we show that the Vitreoscilla hemoglobin expressing strain has from 10-fold to more than two orders of

  13. Rewiring Lactococcus lactis for ethanol production.

    PubMed

    Solem, Christian; Dehli, Tore; Jensen, Peter Ruhdal

    2013-04-01

    Lactic acid bacteria (LAB) are known for their high tolerance toward organic acids and alcohols (R. S. Gold, M. M. Meagher, R. Hutkins, and T. Conway, J. Ind. Microbiol. 10:45-54, 1992) and could potentially serve as platform organisms for production of these compounds. In this study, we attempted to redirect the metabolism of LAB model organism Lactococcus lactis toward ethanol production. Codon-optimized Zymomonas mobilis pyruvate decarboxylase (PDC) was introduced and expressed from synthetic promoters in different strain backgrounds. In the wild-type L. lactis strain MG1363 growing on glucose, only small amounts of ethanol were obtained after introducing PDC, probably due to a low native alcohol dehydrogenase activity. When the same strains were grown on maltose, ethanol was the major product and lesser amounts of lactate, formate, and acetate were formed. Inactivating the lactate dehydrogenase genes ldhX, ldhB, and ldh and introducing codon-optimized Z. mobilis alcohol dehydrogenase (ADHB) in addition to PDC resulted in high-yield ethanol formation when strains were grown on glucose, with only minor amounts of by-products formed. Finally, a strain with ethanol as the sole observed fermentation product was obtained by further inactivating the phosphotransacetylase (PTA) and the native alcohol dehydrogenase (ADHE). PMID:23377945

  14. Ornithine transport and exchange in Streptococcus lactis

    SciTech Connect

    Thompson, J.

    1987-09-01

    Resting cells of Streptococcus lactis 133 appeared to accumulate (/sup 14/C)ornithine to a high concentration in the absence of an exogenous energy source. However, analysis of intracellular amino acid pool constituents and results of transport experiments revealed that the accumulation of ornithine represented a homoexchange between extracellular (/sup 14/C)ornithine and unlabeled ornithine in the cell. The energy-independent exchange of ornithine was not inhibited by proton-conducting uncouplers or by metabolic inhibitors. Intracellular (/sup 14/C)ornithine was retained by resting cells after suspension in a buffered medium. However, addition of unlabeled ornithine to the suspension elicited rapid exit of labeled amino acid. The initial rate of exist of (/sup 14/C)ornithine was dependent on the concentration of unlabeled ornithine in the medium, but this accelerative exchange diffusion process caused no net loss of amino acid. By contrast, the presence of a fermentable energy source caused a rapid expulsion of and new decrease in the concentration of intracellular ornithine. Kinetic analyses of amino acid transport demonstrated competitive inhibition between lysine and ornithine, and data obtained by two-dimensional thin-layer chromatography established the heteroexchange of these basic amino acids. The effects of amino acids and of ornithine analogs on both entry and exit of (/sup 14/C)ornithine have been examined. The data suggest that common carrier mediates the entry and exchange of lysine, arginine, and ornithine in cells of S. lactis.

  15. Polymicrobial Peritonitis with Lactococcus lactis in a Peritoneal Dialysis Patient

    PubMed Central

    Lee, Jun Yong; Seo, Min Young; Yang, Jihyun; Kim, Kitae; Chang, Hyojeong; Kim, Sun Chul; Kim, Myung-Gyu; Cho, Wonyong; Kim, Hyoung Kyu

    2014-01-01

    Lactococcus lactis (L. lactis) is an important gram-positive bacterium in dairy products. It is a rare cause of opportunistic infections with only four cases of Lactococcus peritoneal dialysis (PD) peritonitis reported in the literature. In Korea, L. lactis infection was first reported in a liver abscess patient in 2010; however, PD peritonitis with Lactococcus has not been reported in Korea. Recently, we experienced a case of Lactococcus-associated polymicrobial PD peritonitis. The patient was initially managed with broad-coverage antibiotics; however, owing to a poor response, the PD catheter was removed and the patient was switched to hemodialysis. We discuss this case and review the literature. PMID:25229019

  16. Inactivation of Enterobacter aerogenes in reconstituted skim milk by high- and low-frequency ultrasound.

    PubMed

    Gao, Shengpu; Hemar, Yacine; Lewis, Gillian D; Ashokkumar, Muthupandian

    2014-11-01

    The inactivation of Enterobacter aerogenes in skim milk using low-frequency (20kHz) and high-frequency (850kHz) ultrasonication was investigated. It was found that low-frequency acoustic cavitation resulted in lethal damage to E. aerogenes. The bacteria were more sensitive to ultrasound in water than in reconstituted skim milk having different protein concentrations. However, high-frequency ultrasound was not able to inactivate E. aerogenes in milk even when powers as high as 50W for 60min were used. This study also showed that high-frequency ultrasonication had no influence on the viscosity and particle size of skim milk, whereas low-frequency ultrasonication resulted in the decrease in viscosity and particle size of milk. The decrease in particle size is believed to be due to the breakup of the fat globules, and possibly to the cleavage of the ?-casein present at the surface of the casein micelles. Whey proteins were also found to be slightly affected by low-frequency ultrasound, with the amounts of ?-lactalbumin and ?-lactoglobulin slightly decreasing. PMID:24394387

  17. Partial purification and characterization of a novel histidine decarboxylase from Enterobacter aerogenes DL-1.

    PubMed

    Zou, Yu; Hu, Wenzhong; Jiang, Aili; Tian, Mixia

    2015-08-18

    Histidine decarboxylase (HDC) from Enterobacter aerogenes DL-1 was purified in a three-step procedure involving ammonium sulfate precipitation, Sephadex G-100, and DEAE-Sepharose column chromatography. The partially purified enzyme showed a single protein band of 52.4 kD on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The optimum pH for HDC activity was 6.5, and the enzyme was stable between pH 4 and 8. Enterobacter aerogenes HDC had optimal activity at 40°C and retained most of its activity between 4 and 50°C. HDC activity was reduced in the presence of numerous tested compounds. Particularly with SDS, it significantly (p < 0.01) inhibited enzyme activity. Conversely, Ca(2+) and Mn(2+) showed prominent activation effects (p < 0.01) with activity increasing to 117.20% and 123.42%, respectively. The Lineweaver-Burk plot showed that K m and V max values of the enzyme for L-histidine were 0.21 mM and 71.39 µmol/min, respectively. In comparison with most HDCs from other microorganisms and animals, HDC from E. aerogenes DL-1 displayed higher affinity and greater reaction velocity toward L-histidine. PMID:25036745

  18. Parameter Estimation of Actuators for Benchmark Active Control Technology (BACT) Wind Tunnel Model with Analysis of Wear and Aerodynamic Loading Effects

    NASA Technical Reports Server (NTRS)

    Waszak, Martin R.; Fung, Jimmy

    1998-01-01

    This report describes the development of transfer function models for the trailing-edge and upper and lower spoiler actuators of the Benchmark Active Control Technology (BACT) wind tunnel model for application to control system analysis and design. A simple nonlinear least-squares parameter estimation approach is applied to determine transfer function parameters from frequency response data. Unconstrained quasi-Newton minimization of weighted frequency response error was employed to estimate the transfer function parameters. An analysis of the behavior of the actuators over time to assess the effects of wear and aerodynamic load by using the transfer function models is also presented. The frequency responses indicate consistent actuator behavior throughout the wind tunnel test and only slight degradation in effectiveness due to aerodynamic hinge loading. The resulting actuator models have been used in design, analysis, and simulation of controllers for the BACT to successfully suppress flutter over a wide range of conditions.

  19. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...enzyme preparation is derived from the nonpathogenic and nontoxicogenic bacterium Lactococcus lactis (previously named Streptococcus lactis ). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC 3.4.11.1)...

  20. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...enzyme preparation is derived from the nonpathogenic and nontoxicogenic bacterium Lactococcus lactis (previously named Streptococcus lactis ). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC 3.4.11.1)...

  1. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...enzyme preparation is derived from the nonpathogenic and nontoxicogenic bacterium Lactococcus lactis (previously named Streptococcus lactis ). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC 3.4.11.1)...

  2. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...enzyme preparation is derived from the nonpathogenic and nontoxicogenic bacterium Lactococcus lactis (previously named Streptococcus lactis ). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC 3.4.11.1)...

  3. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...enzyme preparation is derived from the nonpathogenic and nontoxicogenic bacterium Lactococcus lactis (previously named Streptococcus lactis ). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC 3.4.11.1)...

  4. Essential oils affect populations of some rumen bacteria in vitro as revealed by microarray (RumenBactArray) analysis

    PubMed Central

    Patra, Amlan K.; Yu, Zhongtang

    2015-01-01

    In a previous study origanum oil (ORO), garlic oil (GAO), and peppermint oil (PEO) were shown to effectively lower methane production, decrease abundance of methanogens, and change abundances of several bacterial populations important to feed digestion in vitro. In this study, the impact of these essential oils (EOs, at 0.50 g/L) on the rumen bacterial community composition and population was further examined using the recently developed RumenBactArray. Species richness (expressed as number of operational taxonomic units, OTUs) in the phylum Firmicutes, especially those in the class Clostridia, was decreased by ORO and GAO, but increased by PEO, while that in the phylum Bacteroidetes was increased by ORO and PEO. Species richness in the genus Butyrivibrio was lowered by all the EOs. Increases of Bacteroidetes OTUs mainly resulted from increases of Prevotella OTUs. Overall, 67 individual OTUs showed significant differences (P ? 0.05) in relative abundance across the EO treatments. The predominant OTUs affected by EOs were diverse, including those related to Syntrophococcus sucromutans, Succiniclasticum ruminis, and Lachnobacterium bovis, and those classified to Prevotella, Clostridium, Roseburia, Pseudobutyrivibrio, Lachnospiraceae, Ruminococcaceae, Prevotellaceae, Bacteroidales, and Clostridiales. In total, 60 OTUs were found significantly (P ? 0.05) correlated with feed degradability, ammonia concentration, and molar percentage of volatile fatty acids. Taken together, this study demonstrated extensive impact of EOs on rumen bacterial communities in an EO type-dependent manner, especially those in the predominant families Prevotellaceae, Lachnospiraceae, and Ruminococcaceae. The information from this study may aid in understanding the effect of EOs on feed digestion and fermentation by rumen bacteria.

  5. Stability and activity of an Enterobacter aerogenes-specific bacteriophage under simulated gastro-intestinal conditions

    Microsoft Academic Search

    K. Verthé; S. Possemiers; N. Boon; M. Vaneechoutte; W. Verstraete

    2004-01-01

    A bacteriophage, designated UZ1 and showing lytic activity against a\\u000a clinically important strain (BE1) of Enterobacter aerogenes was isolated\\u000a from hospital sewage. The stability and lytic activity against this\\u000a strain under simulated gastro-intestinal conditions was evaluated. After\\u000a addition of bacteriophage UZ1 to a liquid feed at gastric pH 2, the\\u000a phage was immediately inactivated and could not be recovered. However,

  6. Hydrogen peroxide-producing NADH oxidase (nox-1) from Lactococcus lactis

    E-print Network

    Hydrogen peroxide-producing NADH oxidase (nox-1) from Lactococcus lactis Rongrong Jiang and Andreas applied the sequence comparison-based approach to develop a novel hydrogen peroxide-forming NADH oxidase (nox-1) from Lactococcus lactis (L. lactis) that reduces oxygen to hydrogen peroxide. The nox-1 gene

  7. Protein secretion in Lactococcus lactis : an efficient way to increase the overall heterologous protein production

    Microsoft Academic Search

    Yves Le Loir; Vasco Azevedo; Sergio C Oliveira; Daniela A Freitas; Anderson Miyoshi; Luis G Bermúdez-Humarán; Sébastien Nouaille; Luciana A Ribeiro; Sophie Leclercq; Jane E Gabriel; Maricê N Oliveira; Cathy Charlier; Michel Gautier; Philippe Langella

    2005-01-01

    Lactococcus lactis, the model lactic acid bacterium (LAB), is a food grade and well-characterized Gram positive bacterium. It is a good candidate for heterologous protein delivery in foodstuff or in the digestive tract. L. lactis can also be used as a protein producer in fermentor. Many heterologous proteins have already been produced in L. lactis but only few reports allow

  8. Impact of osmotic stress on protein diffusion in Lactococcus lactis.

    PubMed

    Mika, Jacek T; Schavemaker, Paul E; Krasnikov, Victor; Poolman, Bert

    2014-11-01

    We measured translational diffusion of proteins in the cytoplasm and plasma membrane of the Gram-positive bacterium Lactococcus lactis and probed the effect of osmotic upshift. For cells in standard growth medium the diffusion coefficients for cytosolic proteins (27 and 582?kDa) and 12-transmembrane helix membrane proteins are similar to those in Escherichia coli. The translational diffusion of GFP in L. lactis drops by two orders of magnitude when the medium osmolality is increased by ??1.9 Osm, and the decrease in mobility is partly reversed in the presence of osmoprotectants. We find a large spread in diffusion coefficients over the full population of cells but a smaller spread if only sister cells are compared. While in general the diffusion coefficients we measure under normal osmotic conditions in L. lactis are similar to those reported in E. coli, the decrease in translational diffusion upon osmotic challenge in L. lactis is smaller than in E. coli. An even more striking difference is that in L. lactis the GFP diffusion coefficient drops much more rapidly with volume than in E. coli. We discuss these findings in the light of differences in turgor, cell volume, crowding and cytoplasmic structure of Gram-positive and Gram-negative bacteria. PMID:25244659

  9. Hospital clonal dissemination of Enterobacter aerogenes producing carbapenemase KPC-2 in a Chinese teaching hospital.

    PubMed

    Qin, Xiaohua; Yang, Yang; Hu, Fupin; Zhu, Demei

    2014-02-01

    Carbapenems are first-line agents for the treatment of serious nosocomial infections caused by multidrug-resistant Enterobacteriaceae. However, resistance to carbapenems has increased dramatically among Enterobacteriaceae in our hospital. In this study, we report clonal dissemination caused by carbapenem-resistant Enterobacter aerogenes (CREA). In 2011, CREA was identified from 12 patients admitted to the neurosurgical ward. All 12 clinical isolates were non-susceptible to cefotaxime, ceftazidime, cefoxitin, ertapenem, imipenem or meropenem. All isolates carried the gene encoding Klebsiella pneumoniae carbapenemase-2 (KPC-2), except for the isolate E4. However, a remarkably lower expression level of the porin OmpF was detected in the non-KPC-2-producing isolate E4 on SDS-PAGE compared with the carbapenem-susceptible isolate. Epidemiological and molecular investigations showed that a single E. aerogenes strain (PFGE type A), including seven KPC-2-producing clinical isolates, was primarily responsible for the first isolation and subsequent dissemination. In a case-control study, we identified risk factors for infection/colonization with CREA. Mechanical ventilation, the changing of sickbeds and previous use of broad-spectrum antibiotics were identified as potential risk factors. Our findings suggest that further studies should focus on judicious use of available antibiotics, implementation of active antibiotic resistance surveillance and strict implementation of infection-control measures to avoid the rapid spread or clonal dissemination caused by carbapenem-resistant Enterobacteriaceae in healthcare facilities. PMID:24273320

  10. Study of the role of anaerobic metabolism in succinate production by Enterobacter aerogenes.

    PubMed

    Tajima, Yoshinori; Kaida, Kenichi; Hayakawa, Atsushi; Fukui, Keita; Nishio, Yousuke; Hashiguchi, Kenichi; Fudou, Ryosuke; Matsui, Kazuhiko; Usuda, Yoshihiro; Sode, Koji

    2014-09-01

    Succinate is a core biochemical building block; optimizing succinate production from biomass by microbial fermentation is a focus of basic and applied biotechnology research. Lowering pH in anaerobic succinate fermentation culture is a cost-effective and environmentally friendly approach to reducing the use of sub-raw materials such as alkali, which are needed for neutralization. To evaluate the potential of bacteria-based succinate fermentation under weak acidic (pH <6.2) and anaerobic conditions, we characterized the anaerobic metabolism of Enterobacter aerogenes AJ110637, which rapidly assimilates glucose at pH 5.0. Based on the profile of anaerobic products, we constructed single-gene knockout mutants to eliminate the main anaerobic metabolic pathways involved in NADH re-oxidation. These single-gene knockout studies showed that the ethanol synthesis pathway serves as the dominant NADH re-oxidation pathway in this organism. To generate a metabolically engineered strain for succinate production, we eliminated ethanol formation and introduced a heterogeneous carboxylation enzyme, yielding E. aerogenes strain ?adhE/PCK. The strain produced succinate from glucose with a 60.5% yield (grams of succinate produced per gram of glucose consumed) at pH <6.2 and anaerobic conditions. Thus, we showed the potential of bacteria-based succinate fermentation under weak acidic conditions. PMID:24962116

  11. Genome-wide metabolic (re-) annotation of Kluyveromyces lactis

    PubMed Central

    2012-01-01

    Background Even before having its genome sequence published in 2004, Kluyveromyces lactis had long been considered a model organism for studies in genetics and physiology. Research on Kluyveromyces lactis is quite advanced and this yeast species is one of the few with which it is possible to perform formal genetic analysis. Nevertheless, until now, no complete metabolic functional annotation has been performed to the proteins encoded in the Kluyveromyces lactis genome. Results In this work, a new metabolic genome-wide functional re-annotation of the proteins encoded in the Kluyveromyces lactis genome was performed, resulting in the annotation of 1759 genes with metabolic functions, and the development of a methodology supported by merlin (software developed in-house). The new annotation includes novelties, such as the assignment of transporter superfamily numbers to genes identified as transporter proteins. Thus, the genes annotated with metabolic functions could be exclusively enzymatic (1410 genes), transporter proteins encoding genes (301 genes) or have both metabolic activities (48 genes). The new annotation produced by this work largely surpassed the Kluyveromyces lactis currently available annotations. A comparison with KEGG’s annotation revealed a match with 844 (~90%) of the genes annotated by KEGG, while adding 850 new gene annotations. Moreover, there are 32 genes with annotations different from KEGG. Conclusions The methodology developed throughout this work can be used to re-annotate any yeast or, with a little tweak of the reference organism, the proteins encoded in any sequenced genome. The new annotation provided by this study offers basic knowledge which might be useful for the scientific community working on this model yeast, because new functions have been identified for the so-called metabolic genes. Furthermore, it served as the basis for the reconstruction of a compartmentalized, genome-scale metabolic model of Kluyveromyces lactis, which is currently being finished. PMID:23025710

  12. Heritable and Non-heritable Loss of Ability by Aerobacter aerogenes to Grow Adaptively on Single Carbon Sources

    Microsoft Academic Search

    A. W. RAVIN

    1952-01-01

    SUMMARY : Mutants of Aerobacter aerogenes incapable of utilizing citrate (C - ) were discovered in glucose cultures by a modification of the mutant-concentrating penicillin technique. These C- mutants utilize glucose as efficiently as does the wild-type (C + ), despite their inability to utilize a wide range of other metabolites as carbon sources for growth, including compounds that would

  13. Modification of Outer Membrane Protein Profile and Evidence Suggesting an Active Drug Pump in Enterobacter aerogenes Clinical Strains

    Microsoft Academic Search

    Stephane Gayet; Renaud Chollet; Gerard Molle; Jean-Marie Pages

    2003-01-01

    Two clinical strains of Enterobacter aerogenes that exhibited phenotypes of multiresistance to -lactam antibiotics, fluoroquinolones, chloramphenicol, tetracycline, and kanamycin were investigated. Both strains showed a porin pattern different from that of a susceptible strain, with a drastic reduction in the amount of the major porin but with an apparently conserved normal structure (size and immunogenicity), together with overproduction of two

  14. Isolation of Lactococcus lactis subsp. cremoris from nature by colony hybridization with rRNA probes.

    PubMed Central

    Salama, M S; Sandine, W E; Giovannoni, S J

    1993-01-01

    Lactococcus lactis subsp. cremoris is widely used in the manufacture of fermented milk products. Despite numerous attempts, efforts to isolate new strains by traditional plating and identification methods have not been successful. Previously, we described oligonucleotide probes for 16S rRNAs which could be used to discriminate L. lactis subsp. cremoris from related strains. These probes were used in colony hybridization experiments to screen large numbers of colonies obtained from enrichment cultures. A total of 170 strains of L. lactis were isolated from six milk samples, two colostrum samples, and one corn sample by using oligonucleotide probe 212RLa specific for the species L. lactis. Fifty-nine of these isolates also hybridized to L. lactis subsp. cremoris-specific probe 68RCa, and 26 of the strains which hybridized to the L. lactis subsp. cremoris-specific probe had the L. lactis subsp. cremoris phenotype. Images PMID:7506898

  15. Expression of the Arxula adeninivorans glucoamylase gene in Kluyveromyces lactis.

    PubMed

    Bui, D M; Kunze, I; Horstmann, C; Schmidt, T; Breunig, K D; Kunze, G

    1996-03-01

    The glucoamylase gene of the yeast Arxula adeninivorans was expressed in Kluyveromyces lactis by using the GAP promoter from Saccharomyces cerevisiae and a multicopy plasmid vector. The transformants secreted 90.1% of the synthesized glucoamylase into the culture medium. The secreted glucoamylase activities are about 20 times higher in comparison to those of Saccharomyces cerevisiae transformants using the same promoter. Secreted glucoamylase possesses identical N-terminal amino acid sequences to those secreted by A. adeninivorans showing that cleavage of the N-terminal signal peptide takes place at the same site. Biochemical characteristics of glucoamylase expressed by K. lactis and A. adeninivorans are very similar. PMID:8920185

  16. Production and crystallization of ?-phosphoglucomutase from Lactococcus lactis.

    PubMed

    Nogly, Przemyslaw; Castro, Rute; de Rosa, Matteo; Neves, Ana Rute; Santos, Helena; Archer, Margarida

    2012-09-01

    ?-Phosphoglucomutase (?-PGM) is an enzyme that is essential for the growth of Lactococcus lactis. The enzyme links bacterial anabolism with sugar utilization through glycolysis by catalyzing the reversible interconversion of glucose 6-phosphate and ?-glucose 1-phosphate. The gene encoding ?-PGM was cloned and overexpressed in L. lactis. The purified protein was functionally active and was crystallized with ammonium sulfate as a precipitant using vapour-diffusion and seeding techniques. Optimized crystals diffracted to 1.5 Å resolution at a synchrotron source. PMID:22949208

  17. Acanthamoeba castellanii of the T4 genotype is a potential environmental host for Enterobacter aerogenes and Aeromonas hydrophila

    PubMed Central

    2013-01-01

    Background Acanthamoeba can interact with a wide range of microorganisms such as viruses, algae, yeasts, protists and bacteria including Legionella pneumophila, Pseudomonas aeruginosa, Vibrio cholerae, Helicobacter pylori, Listeria monocytogenes, Mycobacterium spp., and Escherichia coli. In this capacity, Acanthamoeba has been suggested as a vector in the transmission of bacterial pathogens to the susceptible hosts. Methods Here, we used a keratitis isolate of A. castellanii of the T4 genotype and studied its interactions with two bacterial genera which have not been tested before, Enterobacter aerogenes, and Aeromonas hydrophila, as well as E. coli. Assays were performed to determine bacterial association with and invasion of A. castellanii. Additionally, bacterial survival intracellular of A. castellanii trophozoites as well as cysts was determined. Results All three bacterial isolates tested, associated, invaded, and survived inside A. castellanii trophozoites as well as A. castellanii cysts. However, E. aerogenes and E. coli exhibited significantly reduced association with and invasion of A. castellanii as compared with A. hydrophila (P?aerogenes (3.96?±?0.7 bacteria:amoeba ratio) and E. coli (5.85?±?1.1 bacteria:amoeba ratio). A. hydrophila, E. coli, and E. aerogenes remained viable during the encystment process and exhibited higher levels of recovery from mature cysts (14.13?±?0.89 A. hydrophila:amoeba ratio, 10.13?±?1.17 E. aerogenes:amoeba ratio, and 11.95?±?0.7 E. coli:amoeba ratio). Conclusions A. hydrophila and E. aerogenes also joined the ranks of other bacteria that could benefit from A. castellanii. Because cysts can be airborne, these findings suggest that Acanthamoeba is a potential vector in the transmission of A. hydrophila and E. aerogenes to susceptible hosts. PMID:23742105

  18. Cloning of usp45, a gene encoding a secreted protein from Lactococcus lactis subsp. lactis MG1363.

    PubMed

    van Asseldonk, M; Rutten, G; Oteman, M; Siezen, R J; de Vos, W M; Simons, G

    1990-10-30

    We have cloned usp45, a gene encoding an extracellular secretory protein of Lactococcus lactis subsp. lactis strain MG1363. Unidentified secreted 45-kDa protein (Usp45) is secreted by every mesophilic L. lactis strain we tested so far and it is chromosomally encoded. The nucleotide sequence of the usp45 gene revealed an open reading frame of 1383 bp encoding a protein of 461 amino acids (aa), composed of a 27-aa signal peptide and a mature protein initiated at Asp28. The gene contains a consensus promoter sequence and a weak ribosome-binding site; the latter is rather uncommon for Gram-positive bacteria. Expression studies in Escherichia coli showed efficient synthesis and secretion of the protein. Usp45 has an unusual aa composition and distribution, and it is predicted to be structurally homologous with P54 of Enterococcus faecium. Up to now, no biological activity could be postulated for this secreted protein. PMID:2123812

  19. Secretion of biologically active murine interleukin-2 by Lactococcus lactis subsp. lactis.

    PubMed

    Steidler, L; Wells, J M; Raeymaekers, A; Vandekerckhove, J; Fiers, W; Remaut, E

    1995-04-01

    Secretion of functional recombinant murine interleukin-2 (mIL2) by Lactococcus lactis was achieved by fusion of the sequence encoding mature mIL2 to the secretion signal leader of the lactococcal usp45 gene placed under transcriptional control of the phage T7 promoter-T7 RNA polymerase expression system. The recombinant mature mIL2 was one of only a few proteins which accumulated in the growth medium. Sequence analysis revealed correct processing at the first amino acid of the mature protein. A T-cell proliferation assay showed that the recombinant protein has the same specific biological activity as mIL2 obtained from a natural source. PMID:7747977

  20. Efficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis.

    PubMed Central

    Langella, P; Le Loir, Y; Ehrlich, S D; Gruss, A

    1993-01-01

    pIP501 is a streptococcal conjugative plasmid which can be transmitted among numerous gram-positive strains. To identify a minimal mobilization (mob) locus of pIP501, DNA fragments of pIP501 were cloned into nonconjugative target plasmids and tested for mobilization by pIP501. We show that nonmobilizable plasmids containing a specific fragment of pIP501 are transmitted at high frequencies between Lactococcus lactis subsp. lactis strains if transfer (tra) functions are provided in trans by a pIP501 derivative. Independent transfer of the mobilized plasmid was observed in up to 44% of transconjugants. A 2.2-kb segment containing mob was sequenced. This DNA segment is characterized by three palindromes (palI, palII, and palIII) and a 202-amino-acid open reading frame (ORFX) of unknown function. The smallest DNA fragment conferring high frequency mobilization was localized to a 1.0-kb region (extending from pIP501 coordinates 3.60 to 4.60 on the 30.2-kb map) which contains palI (delta G = -27 kcal/mol [ca. -110,000 J/mol]). A 26-bp sequence identical to palI is present on pIP501, upstream of the plasmid copy control region. Further homologies with the palI sequence are also found with the related Enterococcus faecalis conjugative plasmid pAM beta 1. The region containing mob maps outside the previously described segment mediating pIP501 conjugation. Our results with recA strains indicate that the mob site is a hot spot for cointegrate formation. Images PMID:8376328

  1. [9-(Adenylyl)alkylcobalamins as inhibitors of adenosylcobalamin-dependent glycerol dehydratase from Aerobacter aerogenes].

    PubMed

    Iakusheva, M I; Poznanskaia, A A; Pospelova, T A; Rudakova, I P; Iurkevich, A M

    1977-11-01

    The behavior of two coenzyme analogs, [(5-aden-9-yl)methoxyethyl] cob (III) alamin and [(5-aden-9-yl)pentyl] cob (III) alamin modified at the nucleoside ligand sugar moiety was studied in the system of adenosyl-cobalamin-dependent glycerol dehydratase from Aerobacter aerogenes. It was shown that neither of the analogs possesses coenzyme properties and that both are strong competitive inhibitors for adenosylcobalamin (AdoCbl). The affinity of the two analogs for the apoenzyme is higher than that of AdoCbl. The data obtained are indicative of the essential role of the ribofuranoside fragment of AdoCbl in the manifestation of the coenzyme activity. The apoenzyme interaction with the analogs under study is discussed in terms of the Dreiding stereomodels for AdoCbl and its analogs. PMID:588639

  2. Polygalacturonase Production by Calcium Alginate Immobilized Enterobacter aerogenes NBO2 Cells.

    PubMed

    Darah, I; Nisha, M; Lim, Sheh-Hong

    2015-03-01

    Bacterial cells of Enterobacter aerogenes NBO2 were entrapped in calcium alginate beads in order to enhance polygalacturonase production compared to free cells. The optimized condition of 5 % (w/v) sodium alginate concentration, agitation speed of 250 rpm, and 15 beads of calcium alginate with inoculum size of 4 % (v/v; 5.4?×?10(7) cells/ml) produced 23.48 U/mL of polygalacturonase compared to free cells of 18.54 U/ml. There was about 26.6 % increment in polygalaturonase production. However, in this study, there was 296.6 % of increment in polygalacturonase production after improvement parameters compared to before improvement parameters of calcium alginate bead immobilization cells (5.92 U/ml). This research has indicated that optimized physical parameters of calcium alginate bead immobilization cells have significantly enhanced the production of polygalacturonase. PMID:25547814

  3. Lactose-mediated carbon catabolite repression of putrescine production in dairy Lactococcus lactis is strain dependent.

    PubMed

    Del Rio, Beatriz; Ladero, Victor; Redruello, Begoña; Linares, Daniel M; Fernández, Maria; Martín, Maria Cruz; Alvarez, Miguel A

    2015-06-01

    Lactococcus lactis is the lactic acid bacterial (LAB) species most widely used as a primary starter in the dairy industry. However, several strains of L. lactis produce the biogenic amine putrescine via the agmatine deiminase (AGDI) pathway. We previously reported the putrescine biosynthesis pathway in L. lactis subsp. cremoris GE2-14 to be regulated by carbon catabolic repression (CCR) via glucose but not lactose (Linares et al., 2013). The present study shows that both these sugars repress putrescine biosynthesis in L. lactis subsp. lactis T3/33, a strain isolated from a Spanish artisanal cheese. Furthermore, we demonstrated that both glucose and lactose repressed the transcriptional activity of the aguBDAC catabolic genes of the AGDI route. Finally, a screening performed in putrescine-producing dairy L. lactis strains determined that putrescine biosynthesis was repressed by lactose in all the L. lactis subsp. lactis strains tested, but in only one L. lactis subsp. cremoris strain. Given the obvious importance of the lactose-repression in cheese putrescine accumulation, it is advisable to consider the diversity of L. lactis in this sense and characterize consequently the starter cultures to select the safest strains. PMID:25791004

  4. Biosensing and bioremediation of Cr(VI) by cell free extract of Enterobacter aerogenes T2.

    PubMed

    Panda, Jigisha; Sarkar, Priyabrata

    2014-01-01

    Hexavalent chromium or Cr(VI) enters the environment through several anthropogenic activities and it is highly toxic and carcinogenic. Hence it is required to be detected and remediated from the environment. In this study, low-cost and environment-friendly methods of biosensing and bioremediation of Cr(VI) have been proposed. Crude cell free extract (CFE) of previously isolated Enterobacter aerogenes T2 (GU265554; NII 1111) was prepared and exploited to develop a stable biosensor for direct estimation of Cr(VI) in waste water, by using three electrodes via cyclic voltammetry. For bioremediation studies, a homogeneous solution of commercially available sodium alginate and CFE was added dropwise in a continuously stirred calcium chloride solution. Biologically modified calcium alginate beads were produced and these were further utilized for bioremediation studies. The proposed sensor showed linear response in the range of 10-40 ?g L(-1) Cr(VI) and the limit of detection was found to be 6.6 ?g L(-1) Cr(VI). No interference was observed in presence of metal ions, e.g., lead, cadmium, arsenic, tin etc., except for insignificant interference with molybdenum and manganese. In bioremediation studies, modified calcium alginate beads showed encouraging removal rate 900 mg Cr(VI)/m(3) water per day with a removal efficiency of 90%, much above than reported in literature. The proposed sensing system could be a viable alternative to costly measurement procedures. Calcium alginate beads, modified with CFE of E. aerogenes, could be used in bioremediation of Cr(VI) since it could work in real conditions with extraordinarily high capacity. PMID:24410691

  5. Vitreoscilla hemoglobin expressing Enterobacter aerogenes and Pseudomonas aeruginosa respond differently to carbon catabolite and oxygen repression for production of l-asparaginase, an enzyme used in cancer therapy

    Microsoft Academic Search

    Hikmet Geckil; Salih Gencer; Mirac Uckun

    2004-01-01

    The production of antileukemic enzyme l-asparaginase in two distinctly related bacteria, Enterobacter aerogenes, Pseudomonas aeruginosa, and in their recombinants expressing the Vitresocilla hemoglobin (VHb) has been studied. Both bacteria showed a substantially different degree of carbon catabolite repression of the enzyme production. E. aerogenes grown under catabolite repression had more than 20-fold lower l-asparaginase activity than the controls. This figure

  6. Selection during Cefepime Treatment of a New Cephalosporinase Variant with Extended-Spectrum Resistance to Cefepime in an Enterobacter aerogenes Clinical Isolate

    Microsoft Academic Search

    G. Barnaud; Y. Benzerara; J. Gravisse; L. Raskine; M. J. Sanson-Le Pors; R. Labia; G. Arlet

    2004-01-01

    Enterobacter aerogenes resistant to cefepime (MIC, 32 g\\/ml) was isolated from a patient treated with cefepime for an infection caused by a strain of E. aerogenes overproducing its AmpC -lactamase (MIC of cefepime, 0.5 g\\/ml). The AmpC -lactamase of the resistant strain had an L-293-P amino acid substitution and a high kcat\\/Km ratio for cefepime. Both of these modifications were

  7. The AcrAB-TolC Pump Is Involved in Macrolide Resistance but Not in Telithromycin Efflux in Enterobacter aerogenes and Escherichia coli

    Microsoft Academic Search

    Renaud Chollet; Jacqueline Chevalier; A. Bryskier; J.-M. Pages

    2004-01-01

    The role of the AcrAB-TolC pump in macrolide and ketolide susceptibility in Escherichia coli and Enterobacter aerogenes was studied. Efflux pump inhibitor restored erythromycin, clarithromycin, and telithromycin sus- ceptibilities to multidrug-resistant isolates. No modification of telithromycin accumulation was detected in E. aerogenes acrAB or tolC derivatives compared to that in the parental strain. Two independent efflux pumps, inhibited by phenylalanine

  8. KPC-2 carbapenemase and DHA-1 AmpC determinants carried on the same plasmid in Enterobacter aerogenes.

    PubMed

    Kuai, Shougang; Shao, Haifeng; Huang, Lihua; Pei, Hao; Lu, Zhonghua; Wang, Weiping; Liu, Jun

    2014-03-01

    This study was conducted to analyse the presence of a plasmid-mediated carbapenem resistance mechanism in a clinical Enterobacter aerogenes isolate from a patient from Jiangsu province, People's Republic of China. PCR and sequencing confirmed that the isolate harboured Klebsiella pneumoniae carbapenemase (KPC)-2, DHA-1 and TEM-1 ?-lactamase genes. Both the KPC-2 and DHA-1 genes were transferred to Escherichia coli C600 by transconjugation, and Southern blotting confirmed that these two genes were located on the same plasmid, which was of approximately 56 kb in size. The Enterobacter aerogenes isolate was resistant to carbapenems and other tested antimicrobial agents. The Escherichia coli transconjugant showed reduced susceptibility but not resistance to carbapenems and other ?-lactams, indicating the presence of another, possibly permeability-related, resistance mechanism in the clinical isolate. PMID:24173427

  9. Generation of Dipeptidyl Peptidase-IV-Inhibiting Peptides from ?-Lactoglobulin Secreted by Lactococcus lactis

    PubMed Central

    Shigemori, Suguru; Oshiro, Kazushi; Wang, Pengfei; Yamamoto, Yoshinari; Wang, Yeqin; Sato, Takashi; Uyeno, Yutaka; Shimosato, Takeshi

    2014-01-01

    Previous studies showed that hydrolysates of ?-lactoglobulin (BLG) prepared using gastrointestinal proteases strongly inhibit dipeptidyl peptidase-IV (DPP-IV) activity in vitro. In this study, we developed a BLG-secreting Lactococcus lactis strain as a delivery vehicle and in situ expression system. Interestingly, trypsin-digested recombinant BLG from L. lactis inhibited DPP-IV activity, suggesting that BLG-secreting L. lactis may be useful in the treatment of type 2 diabetes mellitus. PMID:25157356

  10. Biological containment of genetically modified Lactococcus lactis for intestinal delivery of human interleukin 10

    Microsoft Academic Search

    Sabine Neirynck; Nathalie Huyghebaert; Veerle Snoeck; An Vermeire; Bruno Goddeeris; Eric Cox; Jean Paul Remon; Erik Remaut; Lothar Steidler

    2003-01-01

    Genetically modified Lactococcus lactis secreting interleukin 10 provides a therapeutic approach for inflammatory bowel disease. However, the release of such genetically modified organisms through clinical use raises safety concerns. In an effort to address this problem, we replaced the thymidylate synthase gene thyA of L. lactis with a synthetic human IL10 gene. This thyA?hIL10+L. lactis strain produced human IL-10 (hIL-10),

  11. Cloning in Streptococcus lactis of plasmid-mediated UV resistance and effect on prophage stability

    SciTech Connect

    Chopin, M.C.; Chopin, A.; Rouault, A.; Simon, D.

    1986-02-01

    Plasmid pIL7 (33 kilobases) from Streptococcus lactis enhances UV resistance and prophage stability. A 5.4-kilobase pIL7 fragment carrying genes coding for both characters was cloned into S. lactis, using plasmid pHV1301 as the cloning vector. The recombinant plasmid was subsequently transferred to three other S. lactis strains by transformation or protoplast fusion. Cloned genes were expressed in all tested strains.

  12. Characterization of a Wild, Novel Nisin A-Producing Lactococcus Strain with an L. lactis subsp. cremoris Genotype and an L. lactis subsp. lactis Phenotype, Isolated from Greek Raw Milk

    PubMed Central

    Parapouli, Maria; Delbès-Paus, Céline; Kakouri, Athanasia; Koukkou, Anna-Irini; Montel, Marie-Christine

    2013-01-01

    Several molecular taxonomic studies have revealed that many natural (wild) Lactococcus lactis strains of dairy origin which are phenotypically representative of the L. lactis subspecies lactis cluster genotypically within subspecies cremoris and vice versa. Recently, we isolated two wild nisin-producing (Nis+) L. lactis strains, M78 and M104, of the lactis phenotype from Greek raw milk (J. Samelis, A. Lianou, A. Kakouri, C. Delbès, I. Rogelj, B. B. Matijašic, and M. C. Montel, J. Food Prot. 72:783–790, 2009); strain M78 possess a novel nisin A sequence (GenBank accession number HM219853). In this study, the actual subspecies identity of M78 and M104 isolates was elucidated, using 16S rRNA and acmA (encoding lactococcal N-acetylmuramidase) gene and histidine biosynthesis operon polymorphisms and 16S rRNA and ldh (encoding lactate dehydrogenase) gene phylogenies. Except the acmA gene analysis, molecular tools revealed that isolates M78 and M104 clustered with strains of the cremoris genotype, including the LMG 6897T strain, while they were distant from strains of the lactis genotype, including the LMG 6890T strain. The two wild isolates had identical repetitive sequence-based PCR (rep-PCR), randomly amplified polymorphic DNA (RAPD), plasmid, and whole-cell protein profiles and shared high 16S rRNA (99.9%) and ldh (100%) gene sequence homologies. In contrast, they exhibited identical sugar fermentation and enzymatic patterns which were similar to those of the subspecies lactis LMG 6890T strain. To our knowledge, this is the first complete identification report on a wild L. lactis subsp. cremoris genotype of the lactis phenotype which is capable of nisin A production and, thus, has strong potential for use as a novel dairy starter and/or protective culture. PMID:23542625

  13. Draft Genome Sequence of Enterobacter aerogenes, a DDE-Degrading and Plant Growth-Promoting Strain Isolated from Cucurbita pepo.

    PubMed

    Eevers, Nele; Van Hamme, Jonathan D; Bottos, Eric M; Weyens, Nele; Vangronsveld, Jaco

    2015-01-01

    We report here the draft genome of Enterobacter aerogenes, a Gram-negative bacterium of the Enterobacteriaceae isolated from Cucurbita pepo root tissue. This bacterium shows 2,2-bis(p-chlorophenyl)-1,1-dichloroethylene (DDE)-degrading potential and plant growth-promoting capacity. An analysis of its 4.5-Mb draft genome will enhance the understanding of DDE degradation pathways and phytoremediation applications for DDE-contaminated soils. PMID:25883299

  14. Isolation of Enterobacter aerogenes susceptible to beta-lactam antibiotics despite high level beta-lactamase production

    Microsoft Academic Search

    M. A. Mellencamp; J. S. Roccaforte; L. C. Preheim; C. C. Sanders; C. A. Anene; M. J. Bittner

    1990-01-01

    This report describes a patient with nosocomial meningitis from whom four distinct isolates ofEnterobacter aerogenes were recovered over a complicated course of chemotherapy. The initial isolate was susceptible to expanded spectrum ?-lactams despite constitutive production of high levels of ?-lactamase. Resistant isolates recovered during antibiotic therapy had lost a 42,000 outer membrane protein. These data suggest that b-lactam susceptibility in

  15. Co-fermentation of carbon sources by Enterobacter aerogenes ATCC 29007 to enhance the production of bioethanol.

    PubMed

    Thapa, Laxmi Prasad; Lee, Sang Jun; Yang, Xiao Guang; Yoo, Hah Young; Kim, Sung Bong; Park, Chulhwan; Kim, Seung Wook

    2014-06-01

    We investigated the enhancement of bioethanol production in Enterobacter aerogenes ATCC 29007 by co-fermentation of carbon sources such as glycerol, glucose, galactose, sucrose, fructose, xylose, starch, mannitol and citric acid. Biofuel production increases with increasing growth rate of microorganisms; that is why we investigated the optimal growth rate of E. aerogenes ATCC 29007, using mixtures of different carbon sources with glycerol. E. aerogenes ATCC 29007 was incubated in media containing each carbon source and glycerol; growth rate and bioethanol production improved in all cases compared to those in medium containing glycerol alone. The growth rate and bioethanol production were highest with mannitol. Fermentation was carried out at 37 °C for 18 h, pH 7, using 50 mL defined production medium in 100 mL serum bottles at 200 rpm. Bioethanol production under optimized conditions in medium containing 16 g/L mannitol and 20 g/L glycerol increased sixfold (32.10 g/L) than that containing glycerol alone (5.23 g/L) as the carbon source in anaerobic conditions. Similarly, bioethanol production using free cells in continuous co-fermentation also improved (27.28 g/L) when 90.37 % of 16 g/L mannitol and 67.15 % of 20 g/L glycerol were used. Although naturally existing or engineered microorganisms can ferment mixed sugars sequentially, the preferential utilization of glucose to non-glucose sugars often results in lower overall yield and productivity of ethanol. Here, we present new findings in E. aerogenes ATCC 29007 that can be used to improve bioethanol production by simultaneous co-fermentation of glycerol and mannitol. PMID:24185706

  16. Successive Emergence of Extended-Spectrum  -Lactamase-Producing and Carbapenemase-Producing Enterobacter aerogenes Isolates in a University Hospital

    Microsoft Academic Search

    M. Biendo; B. Canarelli; D. Thomas; F. Rousseau; F. Hamdad; C. Adjide; G. Laurans; F. Eb

    2008-01-01

    Sixty-two clinical isolates of Enterobacter aerogenes resistant to expanded-spectrum cephalosporins were collected between July 2003 and May 2005. Among these isolates, 23 (37.1%) were imipenem (IPM) susceptible, and 39 (62.9%) were IPM insusceptible, of which 89.7% (35\\/39) were resistant and 10.3% (4\\/39) were inter- mediate. Isolate genotypes were compared by pulsed-field gel electrophoresis. Of 62 isolates, 48 belonged to epidemic

  17. Detection of Extended-Spectrum b-Lactamases in Clinical Isolates of Enterobacter cloacae and Enterobacter aerogenes

    Microsoft Academic Search

    EVA TZELEPI; PANAGIOTA GIAKKOUPI; DANAI SOFIANOU; VENETA LOUKOVA; ANASTASSIA KEMEROGLOU; ATHANASSIOS TSAKRIS

    2000-01-01

    The aim of the present study was to investigate the frequency of extended-spectrum b-lactamases (ESBLs) in a consecutive collection of clinical isolates of Enterobacter spp. The abilities of various screening methods to detect ESBLs in enterobacters were simultaneously tested. Among the 68 consecutive isolates (56 Enterobacter cloacae and 12 Enterobacter aerogenes isolates) that were analyzed for b-lactamase content, 21 (25

  18. 2,3Butanediol production by Enterobacter aerogenes : selection of the optimal conditions and application to food industry residues

    Microsoft Academic Search

    P. Perego; A. Converti; A. Del Borghi; P. Canepa

    2000-01-01

    Optimum values of temperature, pH, and starting substrate concentration are experimentally determined for 2,3-butanediol production by Enterobacter aerogenes through three set of batch fermentations of synthetic glucose solutions. The results of tests carried out at variable temperature show an optimum of 39 °C and are used to estimate, for both fermentation and thermal inactivation, the activation enthalpies (7.19 and 23.6

  19. A xylose-inducible expression system for Lactococcus lactis.

    PubMed

    Miyoshi, Anderson; Jamet, Emmanuel; Commissaire, Jacqueline; Renault, Pierre; Langella, Philippe; Azevedo, Vasco

    2004-10-15

    A new controlled production system to target heterologous proteins to cytoplasm or extracellular medium is described for Lactococcus lactis NCDO2118. It is based on the use of a xylose-inducible lactococcal promoter, P(xylT). The capacities of this system to produce cytoplasmic and secreted proteins were tested using the Staphylococcus aureus nuclease gene (nuc) fused or not to the lactococcal Usp45 signal peptide. Xylose-inducible nuc expression is tightly controlled and resulted in high-level and long-term protein production, and correct targeting either to the cytoplasm or to the extracellular medium. Furthermore, this expression system is versatile and can be switched on or off easily by adding either xylose or glucose, respectively. These results confirm the potential of this expression system as an alternative and useful tool for the production of proteins of interest in L. lactis. PMID:15476967

  20. Secretion of biologically active porcine interleukin-2 by Lactococcus lactis.

    PubMed

    Avall-Jääskeläinen, Silja; Palva, Airi

    2006-06-15

    In this study, secretion of two functional recombinant porcine interleukin-2 (rIL-2) proteins by Lactococcus lactis was studied. Two secretion cassettes were constructed in which the secretion was achieved by gene fusion between the lactococcal usp45 secretion signal, a synthetic propeptide and the sequence encoding the mature IL-2. In addition, one of the two secretion cassettes contained the H-domains of L. lactis PrtP. Both of the constructed recombinant IL-2 proteins were found to be secreted in the same quantities, approximately 0.5mg/l. According to a cell proliferative assay using CTLL-2 cell line the specific biological activities of both purified rIL-2 proteins were found to be of similar levels. PMID:16549279

  1. Secretion of biologically active murine interleukin-10 by Lactococcus lactis.

    PubMed

    Schotte; Steidler; Vandekerckhove; Remaut

    2000-12-01

    We investigated the ability of Lactococcus lactis to secrete biologically active, murine interleukin-10 (mIL-10). mIL-10 was synthesized as a fusion protein, consisting of the mature part of the eukaryotic protein fused to the secretion signal of the lactococcal Usp45 protein. The secreted protein was analyzed by PAGE, ELISA and bioassay.We show that L. lactis can efficiently secrete biologically active, murine IL-10. Determination of the N-terminal amino acid sequence confirmed correct processing of the fusion polypeptide by the lactococcal signal peptidase. The amount of mIL-10, accumulating in the medium, could be increased by a factor of ten by growing the cells in an optimized medium, buffered at near-neutral pH. Under these conditions, up to 30 mg of mIL-10 was obtained from a 10-litre fermentation. PMID:11118583

  2. Improvement of human interferon alpha secretion by Lactococcus lactis.

    PubMed

    Zhang, Qiuxiang; Zhong, Jin; Liang, Xiaobo; Liu, Wenjun; Huan, Liandong

    2010-09-01

    To improve the secretion and expression of human interferon alpha 2b (IFN) in Lactococcus lactis, a synthetic pro-peptide, LEISSTCDA (LEISS), was fused to the N-terminus of IFN. This gave a higher secretion efficiency (12% vs. 5%) and yield (approximately 2.8-fold) of IFN. The signal peptide, SP(SlpA) (SlpA, an S-layer protein of Lactobacillus brevis), was also tested to secrete IFN instead of SP(Usp45) (Usp45, the main secreted protein in L. lactis). This gave increased IFN secretion (approximately 3-fold) but lower total production. All the recombinant IFN had appropriate bioactivities in an antiviral assay. PMID:20431909

  3. Transcriptional Regulation of Fatty Acid Biosynthesis in Lactococcus lactis

    PubMed Central

    Eckhardt, Tom H.; Skotnicka, Dorota; Kok, Jan

    2013-01-01

    Here we study the influence of the putative fatty acid biosynthesis (FAB) regulator FabT (originally called RmaG [Llmg_1788]) on gene transcription in Lactococcus lactis MG1363. A strain with a knockout mutation of the putative regulator was constructed, and its transcriptome was compared to that of the wild-type strain. Almost all FAB genes were significantly upregulated in the knockout. Using electrophoretic mobility shift assays (EMSAs) and DNase I footprinting, the binding motif of the regulator and the binding locations in the genome were characterized. Fatty acid composition analysis revealed that a strain lacking FabT contained significantly more saturated acyl chains in its phospholipids. This observation demonstrates that the vital pathway of FAB in L. lactis is regulated by the repressor FabT. PMID:23275247

  4. Expression of the Arxula adeninivorans glucoamylase gene in Kluyveromyces lactis

    Microsoft Academic Search

    D. M. Bui; I. Kunze; C. Horstmann; T. Schmidt; K. D. Breunig; G. Kunze

    1996-01-01

    The glucoamylase gene of the yeast Arxula adeninivorans was expressed in Kluyveromyces lactis by using the GAP promoter from Saccharomyces cerevisiae and a multicopy plasmid vector. The transformants secreted 90.1% of the synthesized glucoamylase into the culture medium.\\u000a The secreted glucoamylase activities are about 20 times higher in comparison to those of Saccharomyces cerevisiae transformants using the same promoter. Secreted

  5. Insertional Mutagenesis To Generate Lantibiotic Resistance in Lactococcus lactis?

    PubMed Central

    Guinane, Caitriona M.; Cotter, Paul D.; Lawton, Elaine M.; Hill, Colin; Ross, R. Paul

    2007-01-01

    While the potential emergence of food spoilage and pathogenic bacteria with resistance to lantibiotics is a concern, the creation of derivatives of starter cultures and adjuncts that can grow in the presence of these antimicrobials may have applications in food fermentations. Here a bank of Lactococcus lactis IL1403 mutants was created and screened, and a number of novel genetic loci involved in lantibiotic resistance were identified. PMID:17526796

  6. Mobile CRISPR/Cas-Mediated Bacteriophage Resistance in Lactococcus lactis

    PubMed Central

    Millen, Anne M.; Horvath, Philippe; Boyaval, Patrick; Romero, Dennis A.

    2012-01-01

    Lactococcus lactis is a biotechnological workhorse for food fermentations and potentially therapeutic products and is therefore widely consumed by humans. It is predominantly used as a starter microbe for fermented dairy products, and specialized strains have adapted from a plant environment through reductive evolution and horizontal gene transfer as evidenced by the association of adventitious traits with mobile elements. Specifically, L. lactis has armed itself with a myriad of plasmid-encoded bacteriophage defensive systems to protect against viral predation. This known arsenal had not included CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins), which forms a remarkable microbial immunity system against invading DNA. Although CRISPR/Cas systems are common in the genomes of closely related lactic acid bacteria (LAB), none was identified within the eight published lactococcal genomes. Furthermore, a PCR-based search of the common LAB CRISPR/Cas systems (Types I and II) in 383 industrial L. lactis strains proved unsuccessful. Here we describe a novel, Type III, self-transmissible, plasmid-encoded, phage-interfering CRISPR/Cas discovered in L. lactis. The native CRISPR spacers confer resistance based on sequence identity to corresponding lactococcal phage. The interference is directed at phages problematic to the dairy industry, indicative of a responsive system. Moreover, targeting could be modified by engineering the spacer content. The 62.8-kb plasmid was shown to be conjugally transferrable to various strains. Its mobility should facilitate dissemination within microbial communities and provide a readily applicable system to naturally introduce CRISPR/Cas to industrially relevant strains for enhanced phage resistance and prevention against acquisition of undesirable genes. PMID:23240053

  7. Expanding the recombinant protein quality in Lactococcus lactis.

    PubMed

    Cano-Garrido, Olivia; Rueda, Fabian L; Sànchez-García, Laura; Ruiz-Ávila, Luis; Bosser, Ramon; Villaverde, Antonio; García-Fruitós, Elena

    2014-12-01

    Background Escherichia coli has been a main host for the production of recombinant proteins of biomedical interest, but conformational stress responses impose severe bottlenecks that impair the production of soluble, proteolytically stable versions of many protein species. In this context, emerging Generally Recognized As Safe (GRAS) bacterial hosts provide alternatives as cell factories for recombinant protein production, in which limitations associated to the use of Gram-negative microorganisms might result minimized. Among them, Lactic Acid Bacteria and specially Lactococcus lactis are Gram-positive GRAS organisms in which recombinant protein solubility is generically higher and downstream facilitated, when compared to E. coli. However, deep analyses of recombinant protein quality in this system are still required to completely evaluate its performance and potential for improvement.ResultsWe have explored here the conformational quality (through specific fluorescence emission) and solubility of an aggregation-prone GFP variant (VP1GFP) produced in L. lactis. In this context, our results show that parameters such as production time, culture conditions and growth temperature have a dramatic impact not only on protein yield, but also on protein solubility and conformational quality, that are particularly favored under fermentative metabolism.ConclusionsMetabolic regime and cultivation temperature greatly influence solubility and conformational quality of an aggregation-prone protein in L. lactis. Specifically, the present study proves that anaerobic growth is the optimal condition for recombinant protein production purposes. Besides, growth temperature plays an important role regulating both protein solubility and conformational quality. Additionally, our results also prove the great versatility for the manipulation of this bacterial system regarding the improvement of functionality, yield and quality of recombinant proteins in this species. These findings not only confirm L. lactis as an excellent producer of recombinant proteins but also reveal room for significant improvement by the exploitation of external protein quality modulators. PMID:25471301

  8. Production of Functionalized Biopolyester Granules by Recombinant Lactococcus lactis? †

    PubMed Central

    Mifune, Jun; Grage, Katrin; Rehm, Bernd H. A.

    2009-01-01

    Many bacteria are naturally capable of accumulating biopolyesters composed of 3-hydroxy fatty acids as intracellular inclusions, which serve as storage granules. Recently, these inclusions have been considered as nano-/microbeads with surface-attached proteins, which can be engineered to display various protein-based functions that are suitable for biotechnological and biomedical applications. In this study, the food-grade, generally-regarded-as-safe gram-positive organism Lactococcus lactis was engineered to recombinantly produce the biopolyester poly(3-hydroxybutyrate) and the respective intracellular inclusions. The codon-optimized polyhydroxybutyrate biosynthesis operon phaCAB from Cupriavidus necator was expressed using the nisin-controlled gene expression system. Recombinant L. lactis accumulated up to 6% (wt/wt) poly(3-hydroxybutyrate) of cellular dry weight. Poly(3-hydroxybutyrate) granules were isolated and analyzed with respect to bound proteins using biochemical methods and with respect to shape/size using transmission electron microscopy. The immunoglobulin G (IgG) binding ZZ domain of Staphylococcus aureus protein A was chosen as an exemplary functionality to be displayed at the granule surface by fusing it to the N terminus of the granule-associated poly(3-hydroxybutyrate) synthase. The presence of the fusion protein at the surface of isolated granules was confirmed by peptide fingerprinting using matrix-assisted laser desorption ionization-time of flight (mass spectrometry). The functionality of the ZZ domain-displaying granules was demonstrated by enzyme-linked immunosorbent assay and IgG affinity purification. In both assays, the ZZ beads from recombinant L. lactis performed at least equally to ZZ beads from Escherichia coli. Overall, in this study it was shown that recombinant L. lactis can be used to manufacture endotoxin-free poly(3-hydroxybutyrate) beads with surface functionalities that are suitable for biomedical applications. PMID:19465535

  9. Production of functionalized biopolyester granules by recombinant Lactococcus lactis.

    PubMed

    Mifune, Jun; Grage, Katrin; Rehm, Bernd H A

    2009-07-01

    Many bacteria are naturally capable of accumulating biopolyesters composed of 3-hydroxy fatty acids as intracellular inclusions, which serve as storage granules. Recently, these inclusions have been considered as nano-/microbeads with surface-attached proteins, which can be engineered to display various protein-based functions that are suitable for biotechnological and biomedical applications. In this study, the food-grade, generally-regarded-as-safe gram-positive organism Lactococcus lactis was engineered to recombinantly produce the biopolyester poly(3-hydroxybutyrate) and the respective intracellular inclusions. The codon-optimized polyhydroxybutyrate biosynthesis operon phaCAB from Cupriavidus necator was expressed using the nisin-controlled gene expression system. Recombinant L. lactis accumulated up to 6% (wt/wt) poly(3-hydroxybutyrate) of cellular dry weight. Poly(3-hydroxybutyrate) granules were isolated and analyzed with respect to bound proteins using biochemical methods and with respect to shape/size using transmission electron microscopy. The immunoglobulin G (IgG) binding ZZ domain of Staphylococcus aureus protein A was chosen as an exemplary functionality to be displayed at the granule surface by fusing it to the N terminus of the granule-associated poly(3-hydroxybutyrate) synthase. The presence of the fusion protein at the surface of isolated granules was confirmed by peptide fingerprinting using matrix-assisted laser desorption ionization-time of flight (mass spectrometry). The functionality of the ZZ domain-displaying granules was demonstrated by enzyme-linked immunosorbent assay and IgG affinity purification. In both assays, the ZZ beads from recombinant L. lactis performed at least equally to ZZ beads from Escherichia coli. Overall, in this study it was shown that recombinant L. lactis can be used to manufacture endotoxin-free poly(3-hydroxybutyrate) beads with surface functionalities that are suitable for biomedical applications. PMID:19465535

  10. Exploration of sulfur metabolism in the yeast Kluyveromyces lactis

    Microsoft Academic Search

    Agnès Hébert; Marie-Pierre Forquin-Gomez; Aurélie Roux; Julie Aubert; Christophe Junot; Valentin Loux; Jean-François Heilier; Pascal Bonnarme; Jean-Marie Beckerich; Sophie Landaud

    Hemiascomycetes are separated by considerable evolutionary distances and, as a consequence, the mechanisms involved in sulfur\\u000a metabolism in the extensively studied yeast, Saccharomyces cerevisiae, could be different from those of other species of the phylum. This is the first time that a global view of sulfur metabolism\\u000a is reported in the biotechnological yeast Kluyveromyces lactis. We used combined approaches based

  11. Production of Dehydroamino Acid-Containing Peptides by Lactococcus lactis?

    PubMed Central

    Rink, Rick; Wierenga, Jenny; Kuipers, Anneke; Kluskens, Leon D.; Driessen, Arnold J. M.; Kuipers, Oscar P.; Moll, Gert N.

    2007-01-01

    Nisin is a pentacyclic peptide antibiotic produced by some Lactococcus lactis strains. Nisin contains dehydroresidues and thioether rings that are posttranslationally introduced by a membrane-associated enzyme complex, composed of a serine and threonine dehydratase NisB and the cyclase NisC. In addition, the transporter NisT is necessary for export of the modified peptide. We studied the potential of L. lactis expressing NisB and NisT to produce peptides whose serines and threonines are dehydrated. L. lactis containing the nisBT genes and a plasmid coding for a specific leader peptide fusion construct efficiently produced peptides with a series of non-naturally occurring multiple flanking dehydrobutyrines. We demonstrated NisB-mediated dehydration of serines and threonines in a C-terminal nisin(1-14) extension of nisin, which implies that also residues more distant from the leader peptide than those occurring in prenisin or any other lantibiotic can be modified. Furthermore, the feasibility and efficiency of generating a library of peptides containing dehydroresidues were demonstrated. In view of the particular shape and reactivity of dehydroamino acids, such a library provides a novel source for screening for peptides with desired biological and physicochemical properties. PMID:17261515

  12. Production of dehydroamino acid-containing peptides by Lactococcus lactis.

    PubMed

    Rink, Rick; Wierenga, Jenny; Kuipers, Anneke; Kluskens, Leon D; Driessen, Arnold J M; Kuipers, Oscar P; Moll, Gert N

    2007-03-01

    Nisin is a pentacyclic peptide antibiotic produced by some Lactococcus lactis strains. Nisin contains dehydroresidues and thioether rings that are posttranslationally introduced by a membrane-associated enzyme complex, composed of a serine and threonine dehydratase NisB and the cyclase NisC. In addition, the transporter NisT is necessary for export of the modified peptide. We studied the potential of L. lactis expressing NisB and NisT to produce peptides whose serines and threonines are dehydrated. L. lactis containing the nisBT genes and a plasmid coding for a specific leader peptide fusion construct efficiently produced peptides with a series of non-naturally occurring multiple flanking dehydrobutyrines. We demonstrated NisB-mediated dehydration of serines and threonines in a C-terminal nisin(1-14) extension of nisin, which implies that also residues more distant from the leader peptide than those occurring in prenisin or any other lantibiotic can be modified. Furthermore, the feasibility and efficiency of generating a library of peptides containing dehydroresidues were demonstrated. In view of the particular shape and reactivity of dehydroamino acids, such a library provides a novel source for screening for peptides with desired biological and physicochemical properties. PMID:17261515

  13. Nisin-controlled extracellular production of apidaecin in Lactococcus lactis.

    PubMed

    Zhou, Xu-Xia; Wang, Yan-bo; Pan, Yuan-jiang; Li, Wei-fen

    2008-04-01

    Apidaecins are heat-stable, nonhelical antibacterial peptides isolated from lymph fluid of the honeybee (Apis mellifera). These peptides are active against a wide range of gram-negative bacteria and they are the most prominent components of the honeybee humoral defense against microbial invasion. In the present study, one isoform of apidaecin, apidaecin Ho, was expressed extracellularly in the food-grade bacterium Lactococcus lactis. Results showed that expression driven by the lactococcal nisA promoter and Usp45 signal peptide resulted in efficient secretion of apidaecin in L. lactis subsp. cremoris NZ9000. Recombinant apidaecin was purified by gel filtration and semipreparative RP-HPLC, and about 10 mg active recombinant apidaecin was obtained from 1,000 ml culture. This is the first report on the nisin-controlled extracellular production of active apidaecin in L. lacits. The expression and delivery of apidaecin in the food-grade L. lactis may provide a clue to facilitate the widespread application of apidaecin in the control and prevention of gram-negative bacteria infections of human and animals. PMID:18286279

  14. Lactococcus lactis subsp. lactis infection in Bester sturgeon, a cultured hybrid of Huso huso × Acipenser ruthenus, in Taiwan.

    PubMed

    Chen, Ming-Hui; Hung, Shao-Wen; Shyu, Ching-Lin; Lin, Cheng-Chung; Liu, Pan-Chen; Chang, Chen-Hsuan; Shia, Wei-Yau; Cheng, Ching-Fu; Lin, Shiun-Long; Tu, Ching-Yu; Lin, Yu-Hsing; Wang, Way-Shyan

    2012-10-01

    Approximately 5300 hybrid sturgeons with an average body weight of 600-800 g were farmed in 3 round tankers measuring 3m in diameter each containing 28,000 L of aerated groundwater. According to the owner's description, the diseased fish had anorexia, pale body color, and reddish spots on the abdomen. The morbidity and lethality rates in this outbreak were about 70% (3706/5300) and 100% (3706/3706), respectively. The clinical examination revealed enteritis, enlarged abdomen, and rapid respiration rate. The gross findings revealed a volume of about 4 mL of ascites. The histopathological examination showed multiple massive, hemorrhagic or coagulative necrotic foci in the liver and spleen. Furthermore, there was diffuse infiltration of glycogen in hepatic cells, and a few polymorphonuclear and mononuclear leucocytes were observed surrounding the spleen. Some bacterial clumps were noted around the necrotic foci. We also observed that there was moderate to severe, acute, multifocal, coagulative necrosis in the renal parenchyma, with some necrotic foci present beneath the margin of the kidney. Additionally, multifocal, coagulative necrosis was found in the pancreas. Results of microbiologic examinations, including biochemical characteristics, PCR amplification of 16S rRNA gene, sequencing and comparison, and phylogenetic analysis, revealed the pathogen of this infection was Lactococcus lactis subsp. lactis, and based on the results of an antimicrobial agent sensitivity test the bacterium was only sensitive to ampicillin and florfenicol. Additionally, results of in vivo experimental infections in hybrid tilapia showed that 1×10(8) and 1×10(9) CFU/mL of our isolate caused death in all fish and LD(50) values ranged from 10(2) to 10(5) CFU/mL. To the best of the authors' knowledge, this is the first reported case of Lactococcus lactis subsp. lactis infection in hybrid sturgeon. PMID:22098776

  15. Optimization of cultural conditions for conversion of glycerol to ethanol by Enterobacter aerogenes S012

    PubMed Central

    2013-01-01

    The aim of this research is to optimize the cultural conditions for the conversion of glycerol to ethanol by Enterobacter aerogenes S012. Taguchi method was used to screen the cultural conditions based on their signal to noise ratio (SN). Temperature (°C), agitation speed (rpm) and time (h) were found to have the highest influence on both glycerol utilization and ethanol production by the organism while pH had the lowest. Full factorial design, statistical analysis, and regression model equation were used to optimize the selected cultural parameters for maximum ethanol production. The result showed that fermentation at 38°C and 200 rpm for 48 h would be ideal for the bacteria to produce maximum amount of ethanol from glycerol. At these optimum conditions, ethanol production, yield and productivity were 25.4 g/l, 0.53 g/l/h, and 1.12 mol/mol-glycerol, repectively. Ethanol production increased to 26.5 g/l while yield and productivity decreased to 1.04 mol/mol-glycerol and 0.37 g/l/h, respectively, after 72 h. Analysis of the fermentation products was performed using HPLC, while anaerobic condition was created by purging the fermentation vessel with nitrogen gas. PMID:23388539

  16. Laminin 5 expression protects against anoikis at aerogenous spread and lepidic growth of human lung adenocarcinoma.

    PubMed

    Kodama, Keiji; Ishii, Gen'ichiro; Miyamoto, Shin'ichi; Goya, Masato; Zhang, Shi-Chuan; Sangai, Takafumi; Yoshikawa, Takeshi; Hasebe, Takahiro; Hitomi, Yoshiaki; Izumi, Keisuke; Ochiai, Atsushi

    2005-10-10

    Adenocarcinoma of the lung is characterized by frequent aerogenous spread (AE) and advancement along the alveolar wall (BAC growth). To elucidate the mechanism of AE metastasis and BAC growth in human lung adenocarcinoma, we established an in vivo orthotopic animal model and an in vitro culture. Investigation of expression levels of integrins, laminins and Type IV collagens, which are the major regulating molecules for cell attachment and anoikis was carried out and a clear correlation between the expression level of laminin 5 (LN5) and the BAC growth was observed using an orthotopic animal model. Introduction of LN5 cDNA to A549 cells increased anoikis resistance in an expression dependent manner. Cells with LN5 overexpression resisted with anoikis after treatment with PI3K-Akt and ERK inhibitors. The amount of phosphorylated focal adhesion kinase (FAK) was also higher in LN5 overexpressing cells. Major tyrosine residues of the EGF receptor at 1068, 1086 and 1173, except at 1148, remained phosphorylated only in the LN5 overexpressing cells even without EGF stimulation, that indicates the ligand independent activation of EGF receptor. BAC growth ratio and AE was confirmed to be significantly correlated with LN5 expression in surgically resected human lung adenocarcinomas by immunohistochemistry. Our results indicate that the activation of the EGF receptor by overexpressing LN5-integrin-FAK signaling pathway may play a crucial role in BAC growth and AE metastasis in human lung adenocarcinoma. PMID:15856467

  17. Improved Production of Heterologous Proteins by a Glucose Repression-Defective Mutant of Kluyveromyces lactis

    Microsoft Academic Search

    Claudia Donnini; Francesca Farina; Barbara Neglia; Maria Concetta Compagno; Daniela Uccelletti; Paola Goffrini; Claudio Palleschi

    2004-01-01

    The secreted production of heterologous proteins in Kluyveromyces lactis was studied. A glucoamylase (GAA) from the yeast Arxula adeninivorans was used as a reporter protein for the study of the secretion efficiencies of several wild-type and mutant strains of K. lactis. The expression of the reporter protein was placed under the control of the strong promoter of the glyceraldehyde-3-phosphate dehydrogenase

  18. Riboflavin Production in Lactococcus lactis: Potential for In Situ Production of Vitamin-Enriched Foods

    Microsoft Academic Search

    Catherine Burgess; Mary O'Connell-Motherway; Wilbert Sybesma; Jeroen Hugenholtz; Douwe van Sinderen

    2004-01-01

    This study describes the genetic analysis of the riboflavin (vitamin B2) biosynthetic (rib) operon in the lactic acid bacterium Lactococcus lactis subsp. cremoris strain NZ9000. Functional analysis of the genes of the L. lactis rib operon was performed by using complementation studies, as well as by deletion analysis. In addition, gene-specific genetic engineering was used to examine which genes of

  19. A17, the First Sequenced Strain of Lactococcus lactis subsp. cremoris with Potential Immunomodulatory Functions

    PubMed Central

    Yang, Chih-Hsien; Wu, Chien-Chen; Cheng, Wei-Shen; Chung, Ming-Chuan

    2015-01-01

    Lactococcus lactis subsp. cremoris A17, isolated from Taiwan fermented cabbage, is the first sequenced strain of L. lactis subsp. cremoris with immunomodulatory activity and antiallergic functions. The resulting A17 draft genome contains 2,679,936 bp and indicates that A17 is a potential exopolysaccharide-producing strain without any known virulence gene. PMID:25676767

  20. Increasing the heme-dependent respiratory efficiency of Lactococcus lactis by inhibition of lactate dehydrogenase.

    PubMed

    Arioli, Stefania; Zambelli, Daniele; Guglielmetti, Simone; De Noni, Ivano; Pedersen, Martin B; Pedersen, Per Dedenroth; Dal Bello, Fabio; Mora, Diego

    2013-01-01

    The discovery of heme-induced respiration in Lactococcus lactis has radically improved the industrial processes used for the biomass production of this species. Here, we show that inhibition of the lactate dehydrogenase activity of L. lactis during growth under respiration-permissive conditions can stimulate aerobic respiration, thereby increasing not only growth efficiency but also the robustness of this organism. PMID:23064338

  1. Complete genome sequence of Lactococcus lactis S0, an efficient producer of nisin.

    PubMed

    Zhao, Fangyuan; Ma, Hongchu; Lu, Ying; Teng, Kunling; Kang, Xusheng; Wang, Fangfang; Yang, Xiaopan; Zhong, Jin

    2015-03-20

    Lactococcus lactis S0 is a nisin Z-producing strain isolated from milk, and the nisin production of the strain can reach 4000IU/ml under fermenting condition. Here, we present the complete genome sequence of L. lactis S0 which includes a single circular chromosome. PMID:25660422

  2. Reduced Lysis upon Growth of Lactococcus lactis on Galactose Is a Consequence of Decreased Binding of the Autolysin AcmA

    Microsoft Academic Search

    Anton Steen; Girbe Buist; Naomi E. Kramer; Ruud Jalving; Germaine F. J. D. Benus; Gerard Venema; Oscar P. Kuipers; Jan Kok

    2008-01-01

    When Lactococcus lactis subsp. lactis IL1403 or L. lactis subsp. cremoris MG1363 is grown in a medium with galactose as the carbon source, the culture lyses to a lesser extent in stationary phase than when the bacteria are grown in a medium containing glucose. Expression of AcmA, the major autolysin of L. lactis, is not influenced by the carbon source.

  3. Short communication: Genotypic and phenotypic identification of environmental streptococci and association of Lactococcus lactis ssp. lactis with intramammary infections among different dairy farms.

    PubMed

    Werner, B; Moroni, P; Gioia, G; Lavín-Alconero, L; Yousaf, A; Charter, M E; Carter, B Moslock; Bennett, J; Nydam, D V; Welcome, F; Schukken, Y H

    2014-11-01

    Lactococcus species are counted among a large and closely related group of environmental streptococci and streptococci-like bacteria that include bovine mastitis pathogenic Streptococcus, Enterococcus, and Aerococcus species. Phenotypic and biochemical identification methods can be inaccurate and unreliable for species within this group, particularly for Lactococcus spp. As a result, the incidence of Lactococcus spp. on the farm may have been historically underreported and consequently little is known about the clinical importance of this genus as a mastitis pathogen. We used molecular genetic identification methods to accurately differentiate 60 environmental streptococci and streptococci-like bacteria isolated from cows with high somatic cell count and chronic intramammary infection (IMI; >2 somatic cell scores above 4) among 5 geographically distinct farms in New York and Minnesota that exhibited an observed increase in IMI. These isolates were phenotypically identified as Streptococcus uberis and Streptococcus spp. Genetic methods identified 42 isolates (70%) as Lactococcus lactis ssp. lactis, including all 10 isolates originally phenotypically identified as Streptococcus uberis. Antibiotic inhibition testing of all Lc. lactis ssp. lactis showed that 7 isolates were resistant to tetracycline. In the present study, a predominance of Lc. lactis ssp. lactis was identified in association with chronic, clinical bovine IMI among all 5 farms and characterized antimicrobial resistance for treatment therapies. Routine use by mastitis testing labs of molecular identification methods for environmental streptococci and streptococci-like bacteria can further define the role and prevalence of Lc. lactis ssp. lactis in association with bovine IMI and may lead to more targeted therapies. PMID:25242419

  4. Diacetyl and ?-Acetolactate Overproduction by Lactococcus lactis subsp. lactis Biovar Diacetylactis Mutants That Are Deficient in ?-Acetolactate Decarboxylase and Have a Low Lactate Dehydrogenase Activity

    PubMed Central

    Monnet, Christophe; Aymes, Frédéric; Corrieu, Georges

    2000-01-01

    Lactococcus lactis subsp. lactis biovar diacetylactis strains are utilized in several industrial processes for producing the flavoring compound diacetyl or its precursor ?-acetolactate. Using random mutagenesis with nitrosoguanidine, we selected mutants that were deficient in ?-acetolactate decarboxylase and had low lactate dehydrogenase activity. The mutants produced large amounts of ?-acetolactate in anaerobic milk cultures but not in aerobic cultures, except when the medium was supplemented with catalase, yeast extract, or hemoglobin. PMID:11097941

  5. [Isolation and characterization of a plasmid pTS50, which encodes nisin resistance determinant in Lactococcus lactis TS1640].

    PubMed

    Tang, S; Chen, X; Yang, W; Chen, M; Huan, L

    2001-10-01

    Three nisin-resistant Lactococcus lactis strains were screened from 197 samples of fresh milk on a selective medium (M17) supplemented with nisin, lactose and bromocresol purple, and were confirmed to have the nisin resistance determinant (nsr) by PCR amplification. Physiological and biochemical tests as well as Lactococcus lactis specific 16S rDNA sequence analysis revealed that the three strains all belong to Lactococcus lactis subsp. lactis. A large plasmid, pTS50, was identified in L. lactis subsp. lactis TS1640 which encodes resistance to nisin following electroporation of the total plasmids DNA into L. lactis MG1363. The molecular weight of plasmid pTS50 was estimated to be 47 kb by restriction analysis of BamHI, EcoRI, HindIII, NcoI, PstI and nsr was localized on a 1.9 kb EcoRI fragment by Southern hybridization. PMID:12552799

  6. Molecular epidemiology of an outbreak of multidrug-resistant Enterobacter aerogenes infections and in vivo emergence of imipenem resistance.

    PubMed Central

    De Gheldre, Y; Maes, N; Rost, F; De Ryck, R; Clevenbergh, P; Vincent, J L; Struelens, M J

    1997-01-01

    Molecular typing was used to investigate an outbreak of infection caused by multidrug-resistant Enterobacter aerogenes (MREA) susceptible only to gentamicin and imipenem in an intensive care unit (ICU). Over a 9-month period, ciprofloxacin-resistant E. aerogenes isolates were isolated from 34 patients, or 4.1% of ICU admissions, compared with a baseline rate of 0.1% in the previous period (P < 0.001). Infection developed in 15 (44%) patients. In vivo emergence of imipenem resistance (MIC, 32 micrograms/ml) of organisms causing deep-seated infection was observed in two (13%) of these patients following prolonged therapy with imipenem and gentamicin. Arbitrarily primed PCR (AP-PCR) analysis with ERIC1R and ERIC2 primers and pulsed-field gel electrophoresis (PFGE) analysis of XbaI macrorestriction patterns concordantly showed that outbreak-associated MREA isolates were clonally related and distinct from epidemiologically unrelated strains. AP-PCR and PFGE showed discrimination indices of 0.88 and 0.98, respectively. Space-time clustering of cases within units suggests that the epidemic-related MREA isolates were transmitted on the hands of the health care personnel. A case-control study and repeated environmental culture surveys failed to identify a common source or procedure associated with transmission. In spite of the early implementation of isolation measures, the incidence of MREA colonization remained stable until all colonized patients were discharged. This study confirms the usefulness of AP-PCR and PFGE analyses for the epidemiological study of E. aerogenes and underscores the difficulty of controlling the spread of multiresistant clones of this organism in the ICU setting. The emergence of imipenem resistance represents a threat because virtually no therapeutic option is available for such strains. PMID:8968898

  7. Rapid Fluorescence Assessment of the Viability of Stressed Lactococcus lactis

    PubMed Central

    Bunthof, Christine J.; van den Braak, Sabina; Breeuwer, Pieter; Rombouts, Frank M.; Abee, Tjakko

    1999-01-01

    The aim of this study was to establish the use of the fluorescent probes carboxyfluorescein (cF) and propidium iodide (PI) for rapid assessment of viability, using Lactococcus lactis subsp. lactis ML3 exposed to different stress treatments. The cF labeling indicated the reproductive capacity of mixtures of nontreated cells and cells killed at 70°C very well. However, after treatment up to 60°C the fraction of cF-labeled cells remained high, whereas the survival decreased for cells treated at above 50°C and was completely lost for those treated at 60°C. In an extended series of experiments, cell suspensions were exposed to heating, freezing, low pH, or bile salts, after which the colony counts, acidification capacity, glycolytic activity, PI exclusion, cF labeling, and cF efflux were measured and compared. The acidification capacity corresponded with the number of CFU. The glycolytic activity, which is an indicator of vitality, was more sensitive to the stress conditions than the reproduction, acidification, and fluorescence parameters. The cF labeling depended on membrane integrity, as was confirmed by PI exclusion. The fraction of cF-labeled cells was not a general indicator of reproduction or acidification, nor was PI exclusion or cF labeling capacity (the internal cF concentration). When the cells were labeled by cF, a subsequent lactose-energized efflux assay was needed for decisive viability assessment. This novel assay proved to be a good and rapid indicator of the reproduction and acidification capacities of stressed L. lactis and has potential for physiological research and dairy applications related to lactic acid bacteria. PMID:10427066

  8. Engineering signal peptides for enhanced protein secretion from Lactococcus lactis.

    PubMed

    Ng, Daphne T W; Sarkar, Casim A

    2013-01-01

    Lactococcus lactis is an attractive vehicle for biotechnological production of proteins and clinical delivery of therapeutics. In many such applications using this host, it is desirable to maximize secretion of recombinant proteins into the extracellular space, which is typically achieved by using the native signal peptide from a major secreted lactococcal protein, Usp45. In order to further increase protein secretion from L. lactis, inherent limitations of the Usp45 signal peptide (Usp45sp) must be elucidated. Here, we performed extensive mutagenesis on Usp45sp to probe the effects of both the mRNA sequence (silent mutations) and the peptide sequence (amino acid substitutions) on secretion. We screened signal peptides based on their resulting secretion levels of Staphylococcus aureus nuclease and further evaluated them for secretion of Bacillus subtilis ?-amylase. Silent mutations alone gave an increase of up to 16% in the secretion of ?-amylase through a mechanism consistent with relaxed mRNA folding around the ribosome binding site and enhanced translation. Targeted amino acid mutagenesis in Usp45sp, combined with additional silent mutations from the best clone in the initial screen, yielded an increase of up to 51% in maximum secretion of ?-amylase while maintaining secretion at lower induction levels. The best sequence from our screen preserves the tripartite structure of the native signal peptide but increases the positive charge of the n-region. Our study presents the first example of an engineered L. lactis signal peptide with a higher secretion yield than Usp45sp and, more generally, provides strategies for further enhancing protein secretion in bacterial hosts. PMID:23124224

  9. Engineering Signal Peptides for Enhanced Protein Secretion from Lactococcus lactis

    PubMed Central

    Ng, Daphne T. W.

    2013-01-01

    Lactococcus lactis is an attractive vehicle for biotechnological production of proteins and clinical delivery of therapeutics. In many such applications using this host, it is desirable to maximize secretion of recombinant proteins into the extracellular space, which is typically achieved by using the native signal peptide from a major secreted lactococcal protein, Usp45. In order to further increase protein secretion from L. lactis, inherent limitations of the Usp45 signal peptide (Usp45sp) must be elucidated. Here, we performed extensive mutagenesis on Usp45sp to probe the effects of both the mRNA sequence (silent mutations) and the peptide sequence (amino acid substitutions) on secretion. We screened signal peptides based on their resulting secretion levels of Staphylococcus aureus nuclease and further evaluated them for secretion of Bacillus subtilis ?-amylase. Silent mutations alone gave an increase of up to 16% in the secretion of ?-amylase through a mechanism consistent with relaxed mRNA folding around the ribosome binding site and enhanced translation. Targeted amino acid mutagenesis in Usp45sp, combined with additional silent mutations from the best clone in the initial screen, yielded an increase of up to 51% in maximum secretion of ?-amylase while maintaining secretion at lower induction levels. The best sequence from our screen preserves the tripartite structure of the native signal peptide but increases the positive charge of the n-region. Our study presents the first example of an engineered L. lactis signal peptide with a higher secretion yield than Usp45sp and, more generally, provides strategies for further enhancing protein secretion in bacterial hosts. PMID:23124224

  10. Engineering Trehalose Synthesis in Lactococcus lactis for Improved Stress Tolerance ? †

    PubMed Central

    Carvalho, Ana Lúcia; Cardoso, Filipa S.; Bohn, Andreas; Neves, Ana Rute; Santos, Helena

    2011-01-01

    Trehalose accumulation is a common cell defense strategy against a variety of stressful conditions. In particular, our team detected high levels of trehalose in Propionibacterium freudenreichii in response to acid stress, a result that led to the idea that endowing Lactococcus lactis with the capacity to synthesize trehalose could improve the acid tolerance of this organism. To this end, we took advantage of the endogenous genes involved in the trehalose catabolic pathway of L. lactis, i.e., trePP and pgmB, encoding trehalose 6-phosphate phosphorylase and ?-phosphoglucomutase, respectively, which enabled the synthesis of trehalose 6-phosphate. Given that L. lactis lacks trehalose 6-phosphate phosphatase, the respective gene, otsB, from the food-grade organism P. freudenreichii was used to provide the required activity. The trehalose yield was approximately 15% in resting cells and in mid-exponential-phase cells grown without pH control. The intracellular concentration of trehalose reached maximal values of approximately 170 mM, but at least 67% of the trehalose produced was found in the growth medium. The viability of mutant and control strains was examined after exposure to heat, cold or acid shock, and freeze-drying. The trehalose-producing strains showed improved tolerance (5- to 10-fold-higher survivability) to acid (pH 3) and cold shock (4°C); there was also a strong improvement in cell survival in response to heat shock (45°C), and no protection was rendered against dehydration. The insight provided by this work may help the design of food-grade strains optimized for the dairy industry as well as for oral drug delivery. PMID:21515730

  11. CTP Limitation Increases Expression of CTP Synthase in Lactococcus lactis

    PubMed Central

    Jørgensen, Casper Møller; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which ?-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein syntheses are inhibited. Expression of pyrG responds only to the cellular level of CTP, since expression of pyrG has no correlation to alterations in UTP, GTP, and ATP pool sizes. In the untranslated pyrG leader sequence a potential terminator structure can be identified, and this structure is required for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent on the CTP concentration through an attenuator mechanism. At normal CTP concentrations a terminator is preferentially formed in the pyrG leader, thereby reducing expression of CTP synthase. At low CTP concentrations the RNA polymerase pauses at a stretch of C residues in the pyrG leader, thereby allowing an antiterminator to form and transcription to proceed. This model therefore does not include any trans-acting protein for sensing the CTP concentration as previously proposed for Bacillus subtilis. PMID:14594829

  12. Haloplanus aerogenes sp. nov., an extremely halophilic archaeon from a marine solar saltern.

    PubMed

    Cui, Heng-Lin; Gao, Xia; Yang, Xin; Xu, Xue-Wei

    2011-04-01

    Halophilic archaeal strain TBN37(T) was isolated from Taibei marine solar saltern near Lianyungang city of Jiangsu province, China. Cells were pleomorphic, flat and contained gas vesicles. Cells of strain TBN37(T) stained Gram-negative and the colonies were pink-pigmented. The strain was able to grow at 25-50 °C (optimum, 37-40 °C), with 1.4-5.1 M NaCl (optimum, 2.1 M NaCl), with 0-1.0 M MgCl(2) (optimum, 0.01 M MgCl(2)) and at pH 6.0-9.0 (optimum, pH 7.5). Cells lysed in distilled water and the minimal NaCl concentration to prevent cell lysis was 8?% (w/v). The major polar lipids of strain TBN37(T) were phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, phosphatidylglycerol sulfate and one major glycolipid chromatographically identical to sulfated mannosyl glucosyl diether (S-DGD-1). On the basis of 16S rRNA gene sequence analysis, strain TBN37(T) was closely related to Haloplanus natans and Haloplanus vescus, with the same similarity of 97.4?%. The DNA G+C content of strain TBN37(T) is 64.1 mol%. DNA-DNA hybridization values between strain TBN37(T) and Haloplanus natans JCM 14081(T) and between strain TBN37(T) and Haloplanus vescus RO5-8(T) were 37.6?% and 42.1?%, respectively. It was concluded that strain TBN37(T) represents a novel species of the genus Haloplanus, for which the name Haloplanus aerogenes sp. nov. is proposed. The type strain is TBN37(T) (?=?CGMCC 1.10124(T) ?=?JCM 16430(T)). PMID:20511466

  13. Purification and some properties of a novel maltohexaose-producing exo-amylase from Aerobacter aerogenes.

    PubMed

    Kainuma, K; Wako, K; Kobayashi, S; Nogami, A; Suzuki, S

    1975-12-18

    Maltohexaose producing amylase (EC 3.2.1.-) is the fourth known exo-amylase, the three previously known being glucoamylase, beta-amylase and Pseudomonas stutzeri maltotetraose producing amylase. The enzyme after release from Aerobacter aerogenes cells by 0.1% sodium lauryl sulfate extraction was purified by ammonium sulfate precipitation, DEAE-Sephadex column chromatography and Sephadex G-100 gel filtration to 80-fold of the original sodium lauryl sulfate extract activity, It gave a single band on disc electrophoresis, and the molecular weight by gel filtration was 54 000. This amylase showed maximal activity at 50 degrees C and pH 6.80. The pH stability range was relatively wide, the enzyme retaining more than 90% of its initial activity in the range of 6.50-9.0. 80% of the activity was retained after 15 min at 50 degrees C. This enzyme produced maltohexaose from starch, amylose and amylopectin by exo-attack, but did not act on alpha- or beta-cyclodextrin, pullulan or maltohexaitol. Also the enzyme acted on beta-limit dextrins of amylopectin and glycogen to form branched oligosaccharides. The unusual reaction of this enzyme on beta-limit dextrin is discussed from the standpoint of the stereochemistry of 1,4-alpha- and 1,6-alpha-glucosidic bonds. This is the anomalous amylase for which it is recognized that 1,6-alpha-glucosidic linkages in the substrates can mimic the effect of 1,4-alpha-bonds, as previously observed in pseudo-priming reactions of E. coli phosphorylase. PMID:1094

  14. Functional expression of plant membrane proteins in Lactococcus lactis.

    PubMed

    Boutigny, Sylvain; Sautron, Emeline; Frelet-Barrand, Annie; Moyet, Lucas; Salvi, Daniel; Rolland, Norbert; Seigneurin-Berny, Daphné

    2015-01-01

    The study of most membrane proteins remains challenging due to their hydrophobicity and their low natural abundance in cells. Lactococcus lactis, a Gram-positive lactic bacterium, has been traditionally used in food fermentations and is nowadays widely used in biotechnology for large-scale production of heterologous proteins. This system has been successfully used for the production of prokaryotic and eukaryotic membrane proteins. The purpose of this chapter is to provide detailed protocols for (1) the expression of plant peripheral or intrinsic membrane proteins and then for (2) their solubilization, from Lactococcus membranes, for further purification steps and biochemical characterization. PMID:25447863

  15. Staphylococcus aureus virulence and metabolism are dramatically affected by Lactococcus lactis in cheese matrix.

    PubMed

    Cretenet, Marina; Nouaille, Sébastien; Thouin, Jennifer; Rault, Lucie; Stenz, Ludwig; François, Patrice; Hennekinne, Jacques-Antoine; Piot, Michel; Maillard, Marie Bernadette; Fauquant, Jacques; Loubière, Pascal; Loir, Yves Le; Even, Sergine

    2011-06-01

    In complex environments such as cheeses, the lack of relevant information on the physiology and virulence expression of pathogenic bacteria and the impact of endogenous microbiota has hindered progress in risk assessment and control. Here, we investigated the behaviour of Staphylococcus aureus, a major foodborne pathogen, in a cheese matrix, either alone or in the presence of Lactococcus lactis, as a dominant species of cheese ecosystems. The dynamics of S. aureus was explored in situ by coupling a microbiological and, for the first time, a transcriptomic approach. Lactococcus lactis affected the carbohydrate and nitrogen metabolisms and the stress response of S. aureus by acidifying, proteolysing and decreasing the redox potential of the cheese matrix. Enterotoxin expression was positively or negatively modulated by both L. lactis and the cheese matrix itself, depending on the enterotoxin type. Among the main enterotoxins involved in staphylococcal food poisoning, sea expression was slightly favoured in the presence of L. lactis, whereas a strong repression of sec4 was observed in cheese matrix, even in the absence of L. lactis, and correlated with a reduced saeRS expression. Remarkably, the agr system was downregulated by the presence of L. lactis, in part because of the decrease in pH. This study highlights the intimate link between environment, metabolism and virulence, as illustrated by the influence of the cheese matrix context, including the presence of L. lactis, on two major virulence regulators, the agr system and saeRS. PMID:23761280

  16. Genetically Modified Lactococcus lactis for Delivery of Human Interleukin-10 to Dendritic Cells

    PubMed Central

    Huibregtse, Inge L.; Zaat, Sebatian A.; Kapsenberg, Martien L.; Sartori da Silva, Maria A.; Peppelenbosch, Maikel P.; van Deventer, Sander J. H.; Braat, Henri

    2012-01-01

    Interleukin-10 (IL-10) plays an indispensable role in mucosal tolerance by programming dendritic cells (DCs) to induce suppressor Th-cells. We have tested the modulating effect of L. lactis secreting human IL-10 (L.??lactisIL-10) on DC function in vitro. Monocyte-derived DC incubated with L.??lactisIL-10 induced effector Th-cells that markedly suppressed the proliferation of allogenic Th-cells as compared to L. lactis. This suppressive effect was only seen when DC showed increased CD83 and CD86 expression. Furthermore, enhanced production of IL-10 was measured in both L.??lactisIL-10-derived DC and Th-cells compared to L. lactis-derived DC and Th-cells. Neutralizing IL-10 during DC-Th-cell interaction and coculturing L.??lactisIL-10-derived suppressor Th-cells with allogenic Th-cells in a transwell system prevented the induction of suppressor Th-cells. Only 130?pg/mL of bacterial-derived IL-10 and 40 times more exogenously added recombinant human IL-10 were needed during DC priming for the generation of suppressor Th-cells. The spatially restricted delivery of IL-10 by food-grade bacteria is a promising strategy to induce suppressor Th-cells in vivo and to treat inflammatory diseases. PMID:21811497

  17. Diversity Analysis of Dairy and Nondairy Lactococcus lactis Isolates, Using a Novel Multilocus Sequence Analysis Scheme and (GTG)5-PCR Fingerprinting?

    PubMed Central

    Rademaker, Jan L. W.; Herbet, Hélène; Starrenburg, Marjo J. C.; Naser, Sabri M.; Gevers, Dirk; Kelly, William J.; Hugenholtz, Jeroen; Swings, Jean; van Hylckama Vlieg, Johan E. T.

    2007-01-01

    The diversity of a collection of 102 lactococcus isolates including 91 Lactococcus lactis isolates of dairy and nondairy origin was explored using partial small subunit rRNA gene sequence analysis and limited phenotypic analyses. A subset of 89 strains of L. lactis subsp. cremoris and L. lactis subsp. lactis isolates was further analyzed by (GTG)5-PCR fingerprinting and a novel multilocus sequence analysis (MLSA) scheme. Two major genomic lineages within L. lactis were found. The L. lactis subsp. cremoris type-strain-like genotype lineage included both L. lactis subsp. cremoris and L. lactis subsp. lactis isolates. The other major lineage, with a L. lactis subsp. lactis type-strain-like genotype, comprised L. lactis subsp. lactis isolates only. A novel third genomic lineage represented two L. lactis subsp. lactis isolates of nondairy origin. The genomic lineages deviate from the subspecific classification of L. lactis that is based on a few phenotypic traits only. MLSA of six partial genes (atpA, encoding ATP synthase alpha subunit; pheS, encoding phenylalanine tRNA synthetase; rpoA, encoding RNA polymerase alpha chain; bcaT, encoding branched chain amino acid aminotransferase; pepN, encoding aminopeptidase N; and pepX, encoding X-prolyl dipeptidyl peptidase) revealed 363 polymorphic sites (total length, 1,970 bases) among 89 L. lactis subsp. cremoris and L. lactis subsp. lactis isolates with unique sequence types for most isolates. This allowed high-resolution cluster analysis in which dairy isolates form subclusters of limited diversity within the genomic lineages. The pheS DNA sequence analysis yielded two genetic groups dissimilar to the other genotyping analysis-based lineages, indicating a disparate acquisition route for this gene. PMID:17890345

  18. Transcriptional analysis of oligosaccharide utilization by Bifidobacterium lactis Bl-04

    PubMed Central

    2013-01-01

    Background Probiotic bifidobacteria in combination with prebiotic carbohydrates have documented positive effects on human health regarding gastrointestinal disorders and improved immunity, however the selective routes of uptake remain unknown for most candidate prebiotics. The differential transcriptomes of Bifidobacterium animalis subsp. lactis Bl-04, induced by 11 potential prebiotic oligosaccharides were analyzed to identify the genetic loci involved in the uptake and catabolism of ?- and ?-linked hexoses, and ?-xylosides. Results The overall transcriptome was modulated dependent on the type of glycoside (galactosides, glucosides or xylosides) utilized. Carbohydrate transporters of the major facilitator superfamily (induced by gentiobiose and ?-galacto-oligosaccharides (GOS)) and ATP-binding cassette (ABC) transporters (upregulated by cellobiose, GOS, isomaltose, maltotriose, melibiose, panose, raffinose, stachyose, xylobiose and ?-xylo-oligosaccharides) were differentially upregulated, together with glycoside hydrolases from families 1, 2, 13, 36, 42, 43 and 77. Sequence analysis of the identified solute-binding proteins that determine the specificity of ABC transporters revealed similarities in the breadth and selectivity of prebiotic utilization by bifidobacteria. Conclusion This study identified the differential gene expression for utilization of potential prebiotics highlighting the extensive capabilities of Bifidobacterium lactis Bl-04 to utilize oligosaccharides. Results provide insights into the ability of this probiotic microbe to utilize indigestible carbohydrates in the human gastrointestinal tract. PMID:23663691

  19. Functional Expression of an Orchid Fragrance Gene in Lactococcus lactis

    PubMed Central

    Song, Adelene Ai Lian; Abdullah, Janna O.; Abdullah, Mohd Puad; Shafee, Norazizah; Rahim, Raha A.

    2012-01-01

    Vanda Mimi Palmer (VMP), an orchid hybrid of Vanda tesselata and Vanda Tan Chay Yan is a highly scented tropical orchid which blooms all year round. Previous studies revealed that VMP produces a variety of isoprenoid volatiles during daylight. Isoprenoids are well known to contribute significantly to the scent of most fragrant plants. They are a large group of secondary metabolites which may possess valuable characteristics such as flavor, fragrance and toxicity and are produced via two pathways, the mevalonate (MVA) pathway or/and the 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway. In this study, a sesquiterpene synthase gene denoted VMPSTS, previously isolated from a floral cDNA library of VMP was cloned and expressed in Lactococcus lactis to characterize the functionality of the protein. L. lactis, a food grade bacterium which utilizes the mevalonate pathway for isoprenoid production was found to be a suitable host for the characterization of plant terpene synthases. Through recombinant expression of VMPSTS, it was revealed that VMPSTS produced multiple sesquiterpenes and germacrene D dominates its profile. PMID:22408409

  20. Nutritional requirements and media development for Lactococcus lactis IL1403.

    PubMed

    Aller, Kadri; Adamberg, Kaarel; Timarova, Veronica; Seiman, Andrus; Feštšenko, Darja; Vilu, Raivo

    2014-07-01

    Lactic acid bacteria are extensively used in food technology and for the production of various compounds, but they are fastidious in nutrient requirements. In order to elucidate the role of each component precisely, defined multicomponent media are required. This study focuses on determining nutrient auxotrophies and minimizing media components (amino acids, vitamins, metal ions, buffers and additional compounds) for the cultivation of Lactococcus lactis subsp. lactis IL1403, using microtitre plates and test tubes. It was shown that glutamine and asparagine were the most important media components for achieving higher biomass yields while the branched-chain amino acids were necessary to increase specific growth rate. The amino acid and glucose ratio was reduced to achieve minimal residual concentration of amino acids in the medium after the growth of cells, whereas the specific growth rate and biomass yield of cells were not considerably affected. As the percentage of each consumed amino acid compared to initial amount is larger than measurement error, these optimized media are important for achieving more precise data about amino acid utilization and metabolism. PMID:24626960

  1. The Response of Lactococcus lactis to Membrane Protein Production

    PubMed Central

    Geertsma, Eric R.; Fusetti, Fabrizia; Permentier, Hjalmar P.; Kuipers, Oscar P.; Kok, Jan; Poolman, Bert

    2011-01-01

    Background The biogenesis of membrane proteins is more complex than that of water-soluble proteins, and recombinant expression of membrane proteins in functional form and in amounts high enough for structural and functional studies is often problematic. To better engineer cells towards efficient protein production, we set out to understand and compare the cellular consequences of the overproduction of both classes of proteins in Lactococcus lactis, employing a combined proteomics and transcriptomics approach. Methodology and Findings Highly overproduced and poorly expressed membrane proteins both resulted in severe growth defects, whereas amplified levels of a soluble substrate receptor had no effect. In addition, membrane protein overproduction evoked a general stress response (upregulation of various chaperones and proteases), which is probably due to accumulation of misfolded protein. Notably, upon the expression of membrane proteins a cell envelope stress response, controlled by the two-component regulatory CesSR system, was observed. Conclusions The physiological response of L. lactis to the overproduction of several membrane proteins was determined and compared to that of a soluble protein, thus offering better understanding of the bottlenecks related to membrane protein production and valuable knowledge for subsequent strain engineering. PMID:21904605

  2. Biohydrogen and polyhydroxyalkanoate co-production by Enterobacter aerogenes and Rhodobacter sphaeroides from Calophyllum inophyllum oil cake.

    PubMed

    Arumugam, A; Sandhya, M; Ponnusami, V

    2014-07-01

    The feasibility of coupled biohydrogen and polyhydroxyalkanoate production by Enterobacter aerogenes and Rhodobacter sphaeroides using Calophyllum inophyllum oil cake was studied under dark and photo fermentation conditions. The utilization of a non-edible acidic oil cake (C. inophyllum), and exploitation of a modified minimal salt media led to reduction in the cost of media. Cost of fermentation is reduced by implementation of alternate dark-photo fermentative periods and through the use of a co-culture consisting of a dark fermentative (E. aerogenes) and a photo fermentative (R. sphaeroides) bacterium. The biohydrogen and polyhydroxyalkanoate produced were 7.95 L H2/L media and 10.73 g/L media, respectively, under alternate dark and photo fermentation and were 3.23 L H2/L media and 5.6g/L media, respectively under complete dark fermentation. The characteristics of the oil cake and alternate dark (16 h) and photo (8h) fermentative conditions were found to be supportive in producing high biohydrogen and polyhydroxyalkanoate (PHA) yield. PMID:24859207

  3. Purification and properties of pyridoxal-5'-phosphate-dependent histidine decarboxylases from Klebsiella planticola and Enterobacter aerogenes.

    PubMed Central

    Guirard, B M; Snell, E E

    1987-01-01

    Histidine decarboxylases from Klebsiella planticola and Enterobacter aerogenes were purified to homogeneity and compared with the histidine decarboxylase from Morganella morganii. All three enzymes required pyridoxal 5'-phosphate as a coenzyme, showed optimal activity at pH 6.5, decarboxylated only histidine among the amino acids derived from protein, and were tetramers or dimers of identical subunits. Amino-terminal sequences of the three enzymes showed up to 81% homology through residue 33, but the enzymes differed sufficiently in amino acid composition and sequence so that no cross-reaction occurred between the K. planticola or E. aerogenes enzymes and antibodies to the decarboxylase from M. morganii. All three enzymes were inhibited by carbonyl reagents; by amino-, carboxyl-, and some methyl-substituted histidines; and by alpha-fluoromethylhistidine. These decarboxylases, all from gram-negative organisms, differed greatly in subunit structure, biogenesis, and other properties from the pyruvoyl-dependent histidine decarboxylases from gram-positive organisms described previously. Images PMID:3114230

  4. An evaluation and partial characterization of a bacteriocin produced by Lactococcus lactis subsp lactis ST1 isolated from goat milk

    PubMed Central

    Taheri, Parinaz; Samadi², Nasrin; Ehsani, Mohammad Reza; Khoshayand, Mohammad Reza; Jamalifar, Hossein

    2012-01-01

    A bacteriocin-like inhibitory substance producing Lactococcus lactis subsp lactis strain, ST1, isolated from goat milk of Iranian origin and with broad spectrum of activity and desirable technical properties was used for evaluating some futures of bacteriocin inhibitory activity. Cell growth and bacteriocin production studies were carried out in MRS medium incubated statically under uncontrolled pH condition. The antibacterial activity presented a primary metabolite pattern and showed a rapid decrease at the stationary phase. Microaerobiosis and capnophily growth conditions resulted in higher bacteriocin production while aerobiosis showed negative effect on both cell growth and bacteriocin production. Bacteriocin production, on the other hand, was favored in MRS broth (pH; 6.5) inoculated with 0.1 ml l-1 fresh culture when incubation was carried out at 30 °C. This indicated that the conditions resulted in higher levels of growth were frequently favoring bacteriocin production by ST1 as well. Decrease in activity, at the stationary growth phase, was much pronounced in favored growth condition. Nutrient depletion, deferent effect of low pH on bacteriocin production and/or protein degradation seemed more responsible for this phenomenon. The study also provided further data on new method for bacteriocin release from the cell wall of producer. It was clearly shown that both heating and ultrasound shock for 5 min at pH 2 could increase bacteriocin activity significantly. The release was more pronounced in the presence of 0.5% Tween80. PMID:24031976

  5. Study of the Citrate Metabolism of Lactococcus lactis subsp. lactis Biovar Diacetylactis by Means of 13C Nuclear Magnetic Resonance

    PubMed Central

    Verhue, Walter M.; Tjan, Frans S. B.

    1991-01-01

    The metabolic fate of citrate and pyruvate in four strains of Lactococcus lactis subsp. lactis biovar diacetylactis has been studied by means of 13C nuclear magnetic resonance, using as a substrate either [3-13C]pyruvic acid or custom-synthesized citric acid that is 13C labeled either at carbons 2 and 4 or at carbon 3. The fermentations were carried out batchwise in modified M17 broth. For the actual conversions of the 13C-labeled substrates, cells at the end of their logarithmic growth phase were used to minimize the conversion to lactic acid. A mass balance of the main citric acid metabolites was obtained; the four strains produced from 50 to 70% (on a molar basis) lactic acid from either citrate or pyruvate. The remaining 50 to 30% was converted mainly to either ?-acetolactic acid (for one strain) or acetoin (for the other three strains). One of the strains produced an exceptionally high concentration of the diacetyl precursor ?-acetolactic acid. Another strain (SDC6) also produced ?-acetolactic acid, but this was decarboxylated to acetoin at a high rate. The 13C nuclear magnetic resonance method confirmed that the biosynthesis of ?-acetolactic acid occurs via condensation of pyruvate and “active” acetaldehyde. Diacetyl was not found as a direct metabolite of citrate or pyruvate metabolism. PMID:16348592

  6. Use of carbon and energy balances in the study of the anaerobic metabolism of Enterobacter aerogenes at variable starting glucose concentrations

    Microsoft Academic Search

    A. Converti; P. Perego

    2002-01-01

    The anaerobic metabolism of Enterobacter aerogenes was studied in batch culture at increasing initial glucose levels (9.0So -1). The ultimate concentrations of fermentation products were utilized to check a metabolic flux analysis based on simple carbon mass and energy balances that promise to be suitable for the study of different fermentation processes, either under aerobic or anaerobic conditions. The stoichiometric

  7. 21 CFR 184.1388 - Lactase enzyme preparation from Kluyveromyces lactis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...derived from the nonpathogenic, nontoxicogenic yeast Kluyveromyces lactis (previously named...glucose and galactose. It is prepared from yeast that has been grown in a pure culture fermentation and by using materials that are...

  8. 21 CFR 184.1388 - Lactase enzyme preparation from Kluyveromyces lactis.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...derived from the nonpathogenic, nontoxicogenic yeast Kluyveromyces lactis (previously named...glucose and galactose. It is prepared from yeast that has been grown in a pure culture fermentation and by using materials that are...

  9. 21 CFR 184.1388 - Lactase enzyme preparation from Kluyveromyces lactis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...derived from the nonpathogenic, nontoxicogenic yeast Kluyveromyces lactis (previously named...glucose and galactose. It is prepared from yeast that has been grown in a pure culture fermentation and by using materials that are...

  10. 21 CFR 184.1388 - Lactase enzyme preparation from Kluyveromyces lactis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...derived from the nonpathogenic, nontoxicogenic yeast Kluyveromyces lactis (previously named...glucose and galactose. It is prepared from yeast that has been grown in a pure culture fermentation and by using materials that are...

  11. 21 CFR 184.1388 - Lactase enzyme preparation from Kluyveromyces lactis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...derived from the nonpathogenic, nontoxicogenic yeast Kluyveromyces lactis (previously named...glucose and galactose. It is prepared from yeast that has been grown in a pure culture fermentation and by using materials that are...

  12. Lactococcus lactis metabolism and gene expression during growth on plant tissues.

    PubMed

    Golomb, Benjamin L; Marco, Maria L

    2015-01-01

    Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484

  13. Enhanced secretion of biologically active murine interleukin-12 by Lactococcus lactis.

    PubMed

    Fernandez, Antonio; Horn, Nikki; Wegmann, Udo; Nicoletti, Claudio; Gasson, Michael J; Narbad, Arjan

    2009-02-01

    The novel signal peptide SLPmod was used for the secretion of murine interleukin-12 (mIL-12) by Lactococcus lactis. A >4-fold increase in secretion was observed when SLPmod was used instead of the Usp45-derived secretion signal. Oral delivery of this cytokine using the autoinducible host L. lactis FI5876 utilizing SLPmod resulted in a significant increase in mIL-12 plasma levels in mice. PMID:19060166

  14. Inactivation of the ybdD Gene in Lactococcus lactis Increases the Amounts of Exported Proteins

    PubMed Central

    Morello, E.; Nouaille, S.; Cortes-Perez, N. G.; Blugeon, S.; Medina, L. F. C.; Azevedo, V.; Gratadoux, J. J.; Bermúdez-Humarán, L. G.; Le Loir, Y.

    2012-01-01

    Random insertional mutagenesis performed on a Lactococcus lactis reporter strain led us to identify L. lactis ybdD as a protein-overproducing mutant. In different expression contexts, the ybdD mutant shows increased levels of exported proteins and therefore constitutes a new and attractive heterologous protein production host. This study also highlights the importance of unknown regulatory processes that play a role during protein secretion. PMID:22843524

  15. Enhanced Secretion of Biologically Active Murine Interleukin-12 by Lactococcus lactis?

    PubMed Central

    Fernandez, Antonio; Horn, Nikki; Wegmann, Udo; Nicoletti, Claudio; Gasson, Michael J.; Narbad, Arjan

    2009-01-01

    The novel signal peptide SLPmod was used for the secretion of murine interleukin-12 (mIL-12) by Lactococcus lactis. A >4-fold increase in secretion was observed when SLPmod was used instead of the Usp45-derived secretion signal. Oral delivery of this cytokine using the autoinducible host L. lactis FI5876 utilizing SLPmod resulted in a significant increase in mIL-12 plasma levels in mice. PMID:19060166

  16. Generation of a membrane potential by Lactococcus lactis through aerobic electron transport

    Microsoft Academic Search

    R. J. W. Brooijmans; B. Poolman; G. K. Schuurman-Wolters; W. M. de Vos; J. Hugenholtz

    2007-01-01

    Lactococcus lactis, a facultative anaerobic lactic acid bacterium, is known to have an increased growth yield when grown aerobically in the presence of heme. We have now established the presence of a functional, proton motive force-generating electron transfer chain (ETC) in L. lactis under these conditions. Proton motive force generation in whole cells was measured using a fluorescent probe (3',3'-dipropylthiadicarbocyanine),

  17. Lactococcus lactis displayed neuraminidase confers cross protective immunity against influenza A viruses in mice.

    PubMed

    Lei, Han; Peng, Xiaojue; Zhao, Daxian; Ouyang, Jiexiu; Jiao, Huifeng; Shu, Handing; Ge, Xinqi

    2015-02-01

    Influenza A viruses pose a serious threat to public health. Current influenza A vaccines predominantly focus on hemagglutinin (HA) and show strain-specific protection. Neuraminidase (NA) is much less studied in the context of humoral immunity against influenza A viruses. The purpose of this study is to evaluate the cross protective immunity of NA presented on Lactococcus lactis (L.lactis) surface against homologous and heterologous influenza A viruses in the mouse model. L.lactis/pNZ8110-pgsA-NA was constructed in which pgsA was used as an anchor protein. Mice vaccinated orally with L.lactis/pNZ8110-pgsA-NA could elicit significant NA-specific serum IgG and mucosa IgA antibodies, as well as neuraminidase inhibition (NI) titers. Importantly, L.lactis/pNZ8110-pgsA-NA provided 80% protection against H5N1, 60% protection against H3N2 and H1N1, respectively. These findings suggest that recombinant L.lactis/pNZ110-pgsA-NA in the absence of adjuvant via oral administration can be served as an effective vaccine candidate against diverse strains of influenza A viruses. PMID:25546254

  18. Genetic Evidence for a Defective Xylan Degradation Pathway in Lactococcus lactis

    PubMed Central

    Erlandson, Karn A.; Delamarre, Soazig C.; Batt, Carl A.

    2001-01-01

    Genetic and biochemical evidence for a defective xylan degradation pathway was found linked to the xylose operon in three lactococcal strains, Lactococcus lactis 210, L. lactis IO-1, and L. lactis NRRL B-4449. Immediately downstream of the xylulose kinase gene (xylB) (K. A. Erlandson, J.-H. Park, W. El Khal, H.-H. Kao, P. Basaran, S. Brydges, and C. A. Batt, Appl. Environ. Microbiol. 66:3974–3980, 1999) are two open reading frames encoding a mutarotase (xylM) and a xyloside transporter (xynT) and a partial open reading frame encoding a ?-xylosidase (xynB). These are functions previously unreported for lactococci or lactobacilli. The mutarotase activity of the putative xylM gene product was confirmed by overexpression of the L. lactis enzyme in Escherichia coli and purification of recombinant XylM. We hypothesize that the mutarotase links xylan degradation to xylose metabolism due to the anomeric preference of xylose isomerase. In addition, Northern hybridization experiments suggested that the xylM and xynTB genes are cotranscribed with the xylRAB genes, responsible for xylose metabolism. Although none of the three strains appeared to metabolize xylan or xylobiose, they exhibited xylosidase activity, and L. lactis IO-1 and L. lactis NRRL B-4449 had functional mutarotases. PMID:11282589

  19. Variations in bile tolerance among Lactococcus lactis strains derived from different sources.

    PubMed

    Takanashi, Shihori; Miura, Ai; Abe, Koko; Uchida, Junya; Itoi, Shiro; Sugita, Haruo

    2014-07-01

    Lactococcus lactis subsp. lactis has been isolated from the intestines of marine fish and is a candidate probiotic for aquaculture. In order to use the bacterium as a probiotic, properties such as bile tolerance need to be assessed. Here, we compared bile tolerance in L. lactis strains derived from different sources. Three L. lactis subsp. lactis strains from marine fish (MFL), freshwater fish (FFL), and cheese starter (CSL) were used along with an Lactococcus lactis subsp. cremoris strain from cheese starter (CSC). The four strains were grown under various culture conditions: deMan-Rogosa-Sharpe (MRS) broth containing bile salts/acids, MRS agar containing oxgall, and phosphate-buffered saline (PBS) containing fish bile. Survival/growth of the strains in the presence of sodium cholate and sodium deoxycholate varied in the order MFL, CSL > CSC > FFL; in the presence of sodium taurocholate, the order was MFL > CSL > CSC > FFL. In liquid media containing various concentrations of oxgall, survival of the strains was observed in the order MFL > CSL > FFL and CSC. The survival of MFL was not affected by bile collected from the goldfish (Carassius auratus subsp. auratus) or the puffer fish (Takifugu niphobles), although the other strains showed significant inhibition of growth. It is a novel and beneficial finding that MFL has the highest resistance to bile acid. PMID:24395331

  20. Antigenicity and Immunogenicity of Rotavirus VP6 Protein Expressed on the Surface of Lactococcus lactis

    PubMed Central

    Esteban, L. E.; Temprana, C. F.; Argüelles, M. H.; Glikmann, G.; Castello, A. A.

    2013-01-01

    Group A rotaviruses are the major etiologic agents of acute gastroenteritis worldwide in children and young animals. Among its structural proteins, VP6 is the most immunogenic and is highly conserved within this group. Lactococcus lactis is a food-grade, Gram-positive, and nonpathogenic lactic acid bacteria that has already been explored as a mucosal delivery system of heterologous antigens. In this work, the nisin-controlled expression system was used to display the VP6 protein at the cell surface of L. lactis. Conditions for optimal gene expression were established by testing different nisin concentrations, cell density at induction, and incubation times after induction. Cytoplasmic and cell wall protein extracts were analyzed by Western blot and surface expression was confirmed by flow cytometry. Both analysis provided evidence that VP6 was efficiently expressed and displayed on the cell surface of L. lactis. Furthermore, the humoral response of mice immunized with recombinant L. lactis was evaluated and the displayed recombinant VP6 protein proved to be immunogenic. In conclusion, this is the first report of displaying VP6 protein on the surface of L. lactis to induce a specific immune response against rotavirus. These results provide the basis for further evaluation of this VP6-displaying L. lactis as a mucosal delivery vector in a mouse model of rotavirus infection. PMID:23984337

  1. Nasal Immunization with Lactococcus lactis Expressing the Pneumococcal Protective Protein A Induces Protective Immunity in Mice?

    PubMed Central

    Medina, Marcela; Villena, Julio; Vintiñi, Elisa; Hebert, Elvira María; Raya, Raúl; Alvarez, Susana

    2008-01-01

    Nisin-controlled gene expression was used to develop a recombinant strain of Lactococcus lactis that is able to express the pneumococcal protective protein A (PppA) on its surface. Immunodetection assays confirmed that after the induction with nisin, the PppA antigen was predictably and efficiently displayed on the cell surface of the recombinant strain, which was termed L. lactis PppA. The production of mucosal and systemically specific antibodies in adult and young mice was evaluated after mice were nasally immunized with L. lactis PppA. Immunoglobulin M (IgM), IgG, and IgA anti-PppA antibodies were detected in the serum and bronchoalveolar lavage fluid of adult and young mice, which showed that PppA expressed in L. lactis was able to induce a strong mucosal and systemic immune response. Challenge survival experiments demonstrated that immunization with L. lactis PppA was able to increase resistance to systemic and respiratory infection with different pneumococcal serotypes, and passive immunization assays of naïve young mice demonstrated a direct correlation between anti-PppA antibodies and protection. The results presented in this study demonstrate three major characteristics of the effectiveness of nasal immunization with PppA expressed as a protein anchored to the cell wall of L. lactis: it elicited cross-protective immunity against different pneumococcal serotypes, it afforded protection against both systemic and respiratory challenges, and it induced protective immunity in mice of different ages. PMID:18390997

  2. [Expression in Lactococcus lactis of catalytically active phenylalanine ammonia-lyase from parsley].

    PubMed

    Xiang, H; Liu, J; Hu, W; Zhu, J; Zhu, Z

    1999-06-01

    The phenylalanine ammonia-lyase (PAL) cDNA of parsley (Petroselinum crispum) was subcloned into constitutive expression vector pMG36e downstream of the P32 promoter. The resulting plasmid pMG36ePAL was introduced into Lactococcus lactis subsp. lactis MG1363 by electroporation. The recombinant strain showed its PAL activity conversing the L-phenylalanine in the culture medium into trans-cinnamic acid. A new secretory vector pXHS was constructed by recombination of pMG36e with a Lactococcal usp45 secretion leader coding sequence and a translational coupling sequence. Then the pXHSPAL was constructed and used for expression of PAL in L. lactis, the PAL activity was also detectable. The L. lactis dnaJ promoter sequence was cloned and used to construct a heat inducible vector pXHJ. PAL cDNA was cloned into pXHJ and the L. lactis IL1403 was transformed with the recombinant plasmid pXHJPAL. After a heat shock from 30 degrees C to 37 degrees C, the PAL activity of the pXHJPAL strain could increase approximately onefold. The prospect of using these engineering L. lactis strains for PKU therapy was also discussed. PMID:12555534

  3. Disruption of the OCH1 and MNN1 genes decrease N-glycosylation on glycoprotein expressed in Kluyveromyces lactis

    Microsoft Academic Search

    Bo Liu; Xin Gong; Shaohong Chang; Yili Yang; Miao Song; Demin Duan; Lina Wang; Qingjun Ma; Jun Wu

    2009-01-01

    Glycoproteins secreted by the yeast Kluyveromyces lactis are usually modified by the addition at asparagines-linked glycosylation sites of heterogeneous mannan residues. The secreted glycoproteins in K. lactis that become hypermannosylated will bear a non-human glycosylation pattern and can adversely affect the half-life, tissue distribution and immunogenicity of a therapeutic protein. Here, we describe engineering a K. lactis strain to produce

  4. Heterologous gene expression of bovine plasmin in Lactococcus lactis.

    PubMed

    Arnau, J; Hjerl-Hansen, E; Israelsen, H

    1997-09-01

    Heterologous production of bovine plasmin was studied in the industrially relevant bacterium Lactococcus lactis. Two sets of lactococcal gene expression signals were coupled to the region of the plasmin gene coding for the serine protease domain. When the promoter region of the prtP gene was used, plasmin was detected mainly intracellularly in strain BPL25 by Western blot hybridization. The intracellular presence of plasmin led to physiological stress. Expression of the plasmin gene driven by the promoter and complete signal sequence of the lactococcal usp45 gene resulted in efficient plasmin secretion in strain BPL420. Cell lysis was observed in strains producing plasmin fragments including the catalytic domain, but not in control strains, which only produced a non-catalytic region of plasmin. The plasmin produced was shown to be biologically active. PMID:9352676

  5. Dechlorination of 1,1,1-Trichloro-2,2-bis(p-chlorophenyl)ethane by Aerobacter aerogenes

    PubMed Central

    Wedemeyer, Gary

    1967-01-01

    Whole cells or cell-free extracts of Aerobacter aerogenes catalyze the degradation of 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane (DDT) in vitro to at least seven metabolites: 1,1-dichloro-2,2-bis(p-chlorophenyl)ethylene (DDE); 1,1-dichloro-2,2-bis(p-chlorophenyl)ethane (DDD); 1-chloro-2,2-bis(p-chlorophenyl)ethylene (DDMU); 1-chloro-2,2-bis(p-chlorophenyl)ethane (DDMS); unsym-bis(p-chlorophenyl)ethylene (DDNU); 2,2-bis(p-chlorophenyl)acetate (DDA); and 4,4?-dichlorobenzophenone (DBP). The use of metabolic inhibitors together with pH and temperature studies indicated that discrete enzymes are involved. By use of the technique of sequential analysis, the metabolic pathway was shown to be: DDT ? DDD ?DDMU ?DDMS ? DDNU ? DDA ? DBP, or DDT ? DDE. Dechlorination was marginally enhanced by light-activated flavin mononucleotide. PMID:6035049

  6. Characterization of a bacteriocin produced by Lactococcus lactis subsp. lactis CRL 1584 isolated from a Lithobates catesbeianus hatchery.

    PubMed

    Pasteris, Sergio E; Vera Pingitore, Esteban; Ale, Cesar E; Nader-Macías, María E Fatima

    2014-03-01

    Lactococcus lactis CRL 1584 isolated from a Lithobates catesbeianus hatchery inhibits the growth of Citrobacter freundii (a bullfrog pathogen) and Listeria monocytogenes by a synergistic effect between lactic acid, hydrogen peroxide and a bacteriocin-like molecule. The chemical characterization of the bacteriocin in cell-free supernatants indicates that it has a proteinaceous nature. Hexadecane and ethyl acetate did not modify the bacteriocin activity, while 10 and 20 % (v/v) chloroform decreased the activity by 29 and 43 %, respectively. The antimicrobial peptide was heat stable since 85 % of residual activity was detected when neutralized supernatants were heated at 80 °C for 30 min. Moreover, no bacteriocin inactivation was observed when supernatants were kept at -20 °C for 3 months. The synthesis of the bacteriocin was associated with bacterial growth, highest production (2,100 AU/ml) being detected at the end of the exponential growth phase. At pH ranges of 5-6.5 and 5.0-5.5 the inhibitory molecule was stable when stored for 2 days at 4 and 25 °C, respectively. Moreover, it had a bactericidal effect on L. monocytogenes and the ultrastructural studies of pathogenic cells revealed clumping of the cytoplasmic material, increased periplasmic space and cell wall modifications. The deduced amino acid sequence of the bacteriocin was identical to nisin Z and the genetic determinants for its production are harbored in the chromosome. These results, described for the first time in L. lactis from a bullfrog hatchery, will increase knowledge of the bacteriocin under study with a view to its potential inclusion in probiotics for raniculture or biopreservatives. PMID:24150985

  7. Comparison of sequences from the malB regions of Salmonella typhimurium and Enterobacter aerogenes with Escherichia coli K12: A potential new regulatory site in the interoperonic region

    Microsoft Academic Search

    Michael K. Dahl; Eric Francoz; William Saurin; Winfried Boos; Michael D. Manson; Maurice Hofnung

    1989-01-01

    The malE and malK genes from Salmonella typhimurium, and the MalEFG operon and a portion of malK from Enterobacter aerogenes were cloned and sequenced. Plasmid-borne malE genes from both species and the malF and malG genes from E. aerogenes were expressed normally in Escherichia coli, and their products function in maltose transport. This shows that the malB products from the

  8. Comparative In Vitro Activities of Ciprofloxacin, Clinafloxacin, Gatifloxacin, Levofloxacin, Moxifloxacin, and Trovafloxacin against Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, and Enterobacter aerogenes Clinical Isolates with Alterations in GyrA and ParC Proteins

    Microsoft Academic Search

    SYLVAIN BRISSE; DANA MILATOVIC; AD C. FLUIT; JAN VERHOEF; NELE MARTIN; SYBILLE SCHEURING; KARL KOHRER; FRANZ-JOSEF SCHMITZ

    1999-01-01

    The in vitro activities of ciprofloxacin, clinafloxacin, gatifloxacin, levofloxacin, moxifloxacin, and trovafloxa- cin were tested against 72 ciprofloxacin-resistant and 28 ciprofloxacin-susceptible isolates of Klebsiella pneu- moniae, Klebsiella oxytoca, Enterobacter cloacae, and Enterobacter aerogenes. Irrespective of the alterations in GyrA and ParC proteins, clinafloxacin exhibited greater activity than all other fluoroquinolones tested against K. pneumoniae and E. aerogenes.

  9. Simultaneous loss of N5-(carboxyethyl)ornithine synthase, nisin production, and sucrose-fermenting ability by Lactococcus lactis K1.

    PubMed Central

    Donkersloot, J A; Thompson, J

    1990-01-01

    A spontaneous derivative of Lactococcus lactis subsp. lactis K1 (formerly Streptococcus lactis K1) lacking N5-(carboxyethyl)ornithine synthase (EC 1.5.1.24) was isolated. This mutant had also lost the abilities to ferment sucrose and to produce the antibiotic nisin. Hybridization studies indicate that these linked traits are encoded on the chromosome of L. lactis K1 and that they may be located on a conjugative transposon. Images PMID:2163399

  10. Lactose metabolism in Streptococcus lactis: studies with a mutant lacking glucokinase and mannose-phosphotransferase activities

    SciTech Connect

    Thompson, J.; Chassy, B.M.; Egan, W.

    1985-04-01

    A mutant of Streptococcus lactis 133 has been isolated that lacks both glucokinase and phosphoenolpyruvate-dependent mannose- phosphotransferase (mannose-PTS) activities. The double mutant S. lactis 133 mannose-PTSd GK- is unable to utilize either exogenously supplied or intracellularly generated glucose for growth. Fluorographic analyses of metabolites formed during the metabolism of (/sup 14/C)lactose labeled specifically in the glucose or galactosyl moiety established that the cells were unable to phosphorylate intracellular glucose. However, cells of S. lactis 133 mannose-PTSd GK- readily metabolized intracellular glucose 6-phosphate, and the growth rates and cell yield of the mutant and parental strains on sucrose were the same. During growth on lactose, S. lactis 133 mannose-PTSd GK- fermented only the galactose moiety of the disaccharide, and 1 mol of glucose was generated per mol of lactose consumed. For an equivalent concentration of lactose, the cell yield of the mutant was 50% that of the wild type. The specific rate of lactose utilization by growing cells of S. lactis 133 mannose-PTSd GK- was ca. 50% greater than that of the wild type, but the cell doubling times were 70 and 47 min, respectively. High-resolution /sup 31/P nuclear magnetic resonance studies of lactose transport by starved cells of S. lactis 133 and S. lactis 133 mannose-PTSd GK- showed that the latter cells contained elevated lactose-PTS activity. Throughout exponential growth on lactose, the mutant maintained an intracellular steady-state glucose concentration of 100 mM.

  11. Interaction between the genomes of Lactococcus lactis and phages of the P335 species

    PubMed Central

    Kelly, William J.; Altermann, Eric; Lambie, Suzanne C.; Leahy, Sinead C.

    2013-01-01

    Phages of the P335 species infect Lactococcus lactis and have been particularly studied because of their association with strains of L. lactis subsp. cremoris used as dairy starter cultures. Unlike other lactococcal phages, those of the P335 species may have a temperate or lytic lifestyle, and are believed to originate from the starter cultures themselves. We have sequenced the genome of L. lactis subsp. cremoris KW2 isolated from fermented corn and found that it contains an integrated P335 species prophage. This 41 kb prophage (? KW2) has a mosaic structure with functional modules that are highly similar to several other phages of the P335 species associated with dairy starter cultures. Comparison of the genomes of 26 phages of the P335 species, with either a lytic or temperate lifestyle, shows that they can be divided into three groups and that the morphogenesis gene region is the most conserved. Analysis of these phage genomes in conjunction with the genomes of several L. lactis strains shows that prophage insertion is site specific and occurs at seven different chromosomal locations. Exactly how induced or lytic phages of the P335 species interact with carbohydrate cell surface receptors in the host cell envelope remains to be determined. Genes for the biosynthesis of a variable cell surface polysaccharide and for lipoteichoic acids (LTAs) are found in L. lactis and are the main candidates for phage receptors, as the genes for other cell surface carbohydrates have been lost from dairy starter strains. Overall, phages of the P335 species appear to have had only a minor role in the adaptation of L. lactis subsp. cremoris strains to the dairy environment, and instead they appear to be an integral part of the L. lactis chromosome. There remains a great deal to be discovered about their role, and their contribution to the evolution of the bacterial genome. PMID:24009606

  12. Different effects of two newly-isolated probiotic Lactobacillus plantarum 15HN and Lactococcus lactis subsp. Lactis 44Lac strains from traditional dairy products on cancer cell lines.

    PubMed

    Haghshenas, Babak; Abdullah, Norhafizah; Nami, Yousef; Radiah, Dayang; Rosli, Rozita; Khosroushahi, Ahmad Yari

    2014-12-01

    Lactobacillus and Lactococcus strains isolated from food products can be introduced as probiotics because of their health-promoting characteristics and non-pathogenic nature. This study aims to perform the isolation, molecular identification, and probiotic characterization of Lactobacillus and Lactococcus strains from traditional Iranian dairy products. Primary probiotic assessments indicated high tolerance to low pH and high bile salt conditions, high anti-pathogenic activities, and susceptibility to high consumption antibiotics, thus proving that both strains possess probiotic potential. Cytotoxicity assessments were used to analyze the effects of the secreted metabolite on different cancer cell lines, including HT29, AGS, MCF-7, and HeLa, as well as a normal human cell line (HUVEC). Results showed acceptable cytotoxic properties for secreted metabolites (40 ?g/ml dry weight) of Lactococcus lactis subsp. Lactis 44Lac. Such performance was similar to that of Taxol against all of the treated cancer cell lines; however, the strain exhibited no toxicity on the normal cell line. Cytotoxic assessments through flow cytometry and fluorescent microscopy demonstrated that apoptosis is the main cytotoxic mechanism for secreted metabolites of L. lactis subsp. Lactis 44Lac. By contrast, the effects of protease-treated metabolites on the AGS cell line verified the protein nature of anti-cancer metabolites. However, precise characterizations and in vitro/in vivo investigations on purified proteins should be conducted before these metabolites are introduced as potential anti-cancer therapeutics. PMID:25168457

  13. Bifidobacterium animalis subsp. lactis decreases urinary oxalate excretion in a mouse model of primary hyperoxaluria.

    PubMed

    Klimesova, Klara; Whittamore, Jonathan M; Hatch, Marguerite

    2015-04-01

    Hyperoxaluria significantly increases the risk of calcium oxalate kidney stone formation. Since several bacteria have been shown to metabolize oxalate in vitro, including probiotic bifidobacteria, we focused on the efficiency and possible mechanisms by which bifidobacteria can influence oxalate handling in vivo, especially in the intestines, and compared these results with the reported effects of Oxalobacter formigenes. Bifidobacterium animalis subsp. lactis DSM 10140 and B. adolescentis ATCC 15703 were administered to wild-type (WT) mice and to mice deficient in the hepatic enzyme alanine-glyoxylate aminotransferase (Agxt (-/-) , a mouse model of Primary Hyperoxaluria) that were fed an oxalate-supplemented diet. The administration of B. animalis subsp. lactis led to a significant decrease in urinary oxalate excretion in WT and Agxt (-/-) mice when compared to treatment with B. adolescentis. Detection of B. animalis subsp. lactis in feces revealed that 3 weeks after oral gavage with the bacteria 64 % of WT mice, but only 37 % of Agxt (-/-) mice were colonized. Examining intestinal oxalate fluxes showed there were no significant changes to net oxalate secretion in colonized animals and were therefore not associated with the changes in urinary oxalate excretion. These results indicate that colonization with B. animalis subsp. lactis decreased urinary oxalate excretion by degrading dietary oxalate thus limiting its absorption across the intestine but it did not promote enteric oxalate excretion as reported for O. formigenes. Preventive or therapeutic administration of B. animalis subsp. lactis appears to have some potential to beneficially influence dietary hyperoxaluria in mice. PMID:25269440

  14. Nisin Production by a Mixed-Culture System Consisting of Lactococcus lactis and Kluyveromyces marxianus

    PubMed Central

    Shimizu, Hiroshi; Mizuguchi, Taiji; Tanaka, Eiji; Shioya, Suteaki

    1999-01-01

    To control the pH during antimicrobial peptide (nisin) production by a lactic acid bacterium, Lactococcus lactis subsp. lactis (ATCC11454), a novel method involving neither addition of alkali nor a separation system such as a ceramic membrane filter and electrodialyzer was developed. A mixed culture of L. lactis and Kluyveromyces marxianus, which was isolated from kefir grains, was utilized in the developed system. The interaction between lactate production by L. lactis and its assimilation by K. marxianus was used to control the pH. To utilize the interaction of these microorganisms to maintain high-level production of nisin, the kinetics of growth of, and production of lactate, acetate, and nisin by, L. lactis were investigated. The kinetics of growth of and lactic acid consumption by K. marxianus were also investigated. Because the pH of the medium could be controlled by the lactate consumption of K. marxianus and the specific lactate consumption rate of K. marxianus could be controlled by changing the dissolved oxygen (DO) concentration, a cascade pH controller coupled with DO control was developed. As a result, the pH was kept constant because the lactate level was kept low and nisin accumulated in the medium to a high level compared with that attained using other pH control strategies, such as with processes lacking pH control and those in which pH is controlled by addition of alkali. PMID:10388714

  15. Lactococcus lactis?YfiA is necessary and sufficient for ribosome dimerization.

    PubMed

    Puri, Pranav; Eckhardt, Thomas H; Franken, Linda E; Fusetti, Fabrizia; Stuart, Marc C A; Boekema, Egbert J; Kuipers, Oscar P; Kok, Jan; Poolman, Bert

    2014-01-01

    Dimerization and inactivation of ribosomes in Escherichia coli is a two-step process that involves the binding of ribosome modulation factor (RMF) and hibernation promotion factor (HPF). Lactococcus lactis?MG1363 expresses a protein, YfiA(L) (l) , which associates with ribosomes in the stationary phase of growth and is responsible for dimerization of ribosomes. We show that full-length YfiA(L) (l) is necessary and sufficient for ribosome dimerization in L.?lactis but also functions heterologously in vitro with E.?coli ribosomes. Deletion of the yfiA gene has no effect on the growth rate but diminishes the survival of L.?lactis under energy-starving conditions. The N-terminal domain of YfiA(L) (l) is homologous to HPF from E.?coli, whereas the C-terminal domain has no counterpart in E.?coli. By assembling ribosome dimers in vitro, we could dissect the roles of the N- and C-terminal domains of YfiA(L) (l) . It is concluded that the dimerization and inactivation of ribosomes in L.?lactis and E.?coli differ in several cellular and molecular aspects. In addition, two-dimensional maps of dimeric ribosomes from L.?lactis obtained by single particle electron microscopy show a marked structural difference in monomer association in comparison to the ribosome dimers in E.?coli. PMID:24279750

  16. Intranasal immunization of recombinant Lactococcus lactis induces protection against H5N1 virus in ferrets.

    PubMed

    Lei, Han; Peng, Xiaojue; Ouyang, Jiexiu; Zhao, Daxian; Jiao, Huifeng; Shu, Handing; Ge, Xinqi

    2015-01-22

    The increasing outbreaks of highly pathogenic avian influenza A (HPAI) H5N1 viruses in birds and human bring out an urgent need to develop a safe and effective vaccine to control and prevent H5N1 infection. Lactococcus lactis (L. lactis) based vaccine platform is a promising approach for mucosal H5N1 vaccine development. Intranasal immunization is the potential to induce mucosal immune response which is associated with protective immunity. To develop a safe and effective mucosal vaccine against HAPI H5N1, we extended our previous study by evaluating the immunogenicity of L. lactis-psA-HA1 in the absence of adjuvant via intranasal route in the ferret model. Ferrets administered intranasally with L. lactis-pgsA-HA1 could elicit robust humoral and mucosal immune responses, as well as significant HI titers. Importantly, ferrets were completely protected from H5N1 virus challenge. These findings suggest that L. lactis-pgsA-HA1 can be considered an alternative mucosal vaccine during A/H5N1 pandemic. PMID:25445345

  17. Metabolic engineering of Lactococcus lactis influence of the overproduction of lipase enzyme.

    PubMed

    Raftari, Mohammad; Ghafourian, Sobhan; Bakar, Fatimah Abu

    2013-11-01

    The dairy industry uses lipase extensively for hydrolysis of milk fat. Lipase is used in the modification of the fatty acid chain length, to enhance the flavours of various chesses. Therefore finding the unlimited source of lipase is a concern of dairy industry. Due to the importance of lipase, this study was an attempt to express the lipase from Burkholderia cepacia in Lactococcus lactis. To achieve this, a gene associated with lipase transport was amplified and subcloned in inducible pNZ8148 vector, and subsequently transformed into Lc. lactis NZ9000. The enzyme assay as well as SDS-PAGE and western blotting were carried out to analysis the recombinant lipase expression. Nucleotide sequencing of the DNA insert from the clone revealed that the lipase activity corresponded to an open reading frame consisting of 1092 bp coding for a 37·5-kDa size protein. Blue colour colonies on nile blue sulphate agar and sharp band on 37·5-kD size on SDS-PAGE and western blotting results confirm the successful expression of lipase by Lc. lactis. The protein assay also showed high expression, approximately 152·2 ?g/ml.h, of lipase by recombinant Lc. lactis. The results indicate that Lc. lactis has high potential to overproduce the recombinant lipase which can be used commercially for industrially purposes. PMID:24063299

  18. Protein secretion in Lactococcus lactis : an efficient way to increase the overall heterologous protein production

    PubMed Central

    Le Loir, Yves; Azevedo, Vasco; Oliveira, Sergio C; Freitas, Daniela A; Miyoshi, Anderson; Bermúdez-Humarán, Luis G; Nouaille, Sébastien; Ribeiro, Luciana A; Leclercq, Sophie; Gabriel, Jane E; Guimaraes, Valeria D; Oliveira, Maricê N; Charlier, Cathy; Gautier, Michel; Langella, Philippe

    2005-01-01

    Lactococcus lactis, the model lactic acid bacterium (LAB), is a food grade and well-characterized Gram positive bacterium. It is a good candidate for heterologous protein delivery in foodstuff or in the digestive tract. L. lactis can also be used as a protein producer in fermentor. Many heterologous proteins have already been produced in L. lactis but only few reports allow comparing production yields for a given protein either produced intracellularly or secreted in the medium. Here, we review several works evaluating the influence of the localization on the production yields of several heterologous proteins produced in L. lactis. The questions of size limits, conformation, and proteolysis are addressed and discussed with regard to protein yields. These data show that i) secretion is preferable to cytoplasmic production; ii) secretion enhancement (by signal peptide and propeptide optimization) results in increased production yield; iii) protein conformation rather than protein size can impair secretion and thus alter production yields; and iv) fusion of a stable protein can stabilize labile proteins. The role of intracellular proteolysis on heterologous cytoplasmic proteins and precursors is discussed. The new challenges now are the development of food grade systems and the identification and optimization of host factors affecting heterologous protein production not only in L. lactis, but also in other LAB species. PMID:15631634

  19. Multi-stress resistance in Lactococcus lactis is actually escape from purine-induced stress sensitivity.

    PubMed

    Ryssel, Mia; Hviid, Anne-Mette Meisner; Dawish, Mohamed S; Haaber, Jakob; Hammer, Karin; Martinussen, Jan; Kilstrup, Mogens

    2014-11-01

    Multi-stress resistance is a widely documented and fascinating phenotype of lactococci where single mutations, preferentially in genes involved in nucleotide metabolism and phosphate uptake, result in elevated tolerance to multiple stresses simultaneously. In this report, we have analysed the metabolic basis behind this multi-stress-resistance phenotype in Lactococcus lactis subsp. cremoris MG1363 using acid stress as a model of multi-stress resistance. Surprisingly, we found that L. lactis MG1363 is fully resistant to pH 3.0 in the chemically defined SA medium, contrary to its sensitivity in the rich and complex M17 medium. When salvage of purines and subsequent conversion to GTP was permitted in various genetic backgrounds of L. lactis MG1363, the cells became sensitive to acid stress, indicating that an excess of guanine nucleotides induces stress sensitivity. The addition of phosphate to the acid-stress medium increased the stress sensitivity of L. lactis MG1363. It is also shown that high intracellular guanine nucleotide pools confer increased sensitivity to high temperatures, thus showing that it is indeed a multi-stress phenotype. Our analysis suggests that an increased level of guanine nucleotides is formed as a result of an improved conversion of guanosine in the salvage pathway. Based upon our findings, we suggest that L. lactis MG1363 is naturally multi-stress resistant in habitats devoid of any purine source. However, any exogenous purine that results in increased guanine nucleotide pools renders the bacterium sensitive to environmental stresses. PMID:25143058

  20. Bioproduction of a novel sugar 1-deoxy- l-fructose by Enterobacter aerogenes IK7; isomerization of a 6-deoxyhexose to a 1-deoxyhexose

    Microsoft Academic Search

    Pushpakiran Gullapalli; Takayuki Shiji; Devendar Rao; Akihide Yoshihara; Kenji Morimoto; Goro Takata; George W. J. Fleet; Ken Izumori

    2007-01-01

    1-Deoxy-l-fructose, a very rare monosaccharide, was produced by hydrogenation of 6-deoxy-l-mannose (l-rhamnose)—the only cheaply available deoxy sugar—to 1-deoxy-l-mannitol (l-rhamnitol) followed by oxidation with Enterobacter aerogenes IK7. The entire procedure was conducted in water and shows the power of green environmentally friendly chemistry combined with biotechnology in the preparation of new monosaccharides with potential for novel bioactive properties or alternative foodstuffs;

  1. Carbapenem Resistance in a Clinical Isolate of Enterobacter aerogenes Is Associated with Decreased Expression of OmpF and OmpC Porin Analogs

    Microsoft Academic Search

    Hesna Yigit; Gregory J. Anderson; James W. Biddle; Christine D. Steward; J. Kamile Rasheed; Lourdes L. Valera; John E. McGowan; F. C. Tenover

    2002-01-01

    We investigated the mechanism of imipenem resistance in Enterobacter aerogenes strain 810, a clinical isolate from the United States for which the imipenem MIC was 16 g\\/ml and the meropenem MIC was 8 g\\/ml. An imipenem-susceptible revertant, strain 810-REV, was obtained after multiple passages of the strain on non- selective media. For the revertant, the imipenem MIC was <1 g\\/ml

  2. Short-chain organic acids produced on glucose, lactose, and citrate media by Enterococcus faecalis, Lactobacillus casei, and Enterobacter aerogenes strains

    Microsoft Academic Search

    D. Urdaneta; D. Raffe; A. Ferrer; B. Sulbarán de Ferrer; L. Cabrera; M. Pérez

    1995-01-01

    Three strains of Enterococcus faecalis, three of Lactobacillus casei and two of Enterobacter aerogenes, isolated from commercial Palmita-type cheese were cultured in peptone-yeast extract broth with glucose (PYG), lactose (PYL), or citrate (PYC) added as the main carbon sources. The short-chain volatile and non-volatile organic acids were extracted and their concentration determined by GC with a FID detector. The identity

  3. Effect of pH and acetic acid on growth and 2,3-butanediol production of Enterobacter aerogenes in continuous culture

    Microsoft Academic Search

    An-Ping Zeng; Hanno Biebl; Wolf-Dieter Deckwer

    1990-01-01

    The effect of pH and acetic acid on growth and 2,3-butanediol production of Enterobacter aerogenes from glucose was investigated in a microaerobic continuous culture. At a dilution rate of 0.20 h-1 and a fixed oxygen uptake rate (OUR) of 31.5 mmol l-1 h-1 the biomass concentration increased with pH ranging from 5.0 to 7.0, while the specific ATP requirement of

  4. Coexistence of SHV-4- and TEM24-Producing Enterobacter aerogenes Strains before a Large Outbreak of TEM24-Producing Strains in a French Hospital

    Microsoft Academic Search

    H. Mammeri; G. Laurans; M. Eveillard; S. Castelain; F. Eb

    2001-01-01

    In 1996, a monitoring program was initiated at the teaching hospital of Amiens, France, and carried out for 3 years. All extended-spectrum b-lactamase (ESBL)-producing Enterobacter aerogenes isolates recovered from clinical specimens were collected for investigation of their epidemiological relatedness by pulsed-field gel electrophoresis and enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) and determination of the type of ESBL harbored by isoelectric

  5. Draft Genome Assemblies of Enterobacter aerogenes CDC 6003-71, Enterobacter cloacae CDC 442-68, and Pantoea agglomerans UA 0804-01

    PubMed Central

    Minogue, T. D.; Daligault, H. E.; Davenport, K. W.; Bishop-Lilly, K. A.; Bruce, D. C.; Chain, P. S.; Coyne, S. R.; Chertkov, O.; Freitas, T.; Frey, K. G.; Jaissle, J.; Koroleva, G. I.; Ladner, J. T.; Palacios, G. F.; Redden, C. L.; Xu, Y.

    2014-01-01

    The Enterobacteriaceae are environmental and enteric microbes. We sequenced the genomes of two Enterobacter reference strains, E. aerogenes CDC 6003-71 and E. cloacae CDC 442-68, as well as one near neighbor used as an exclusionary reference for diagnostics, Pantoea agglomerans CDC UA0804-01. The genome sizes range from 4.72 to 5.55 Mbp and have G+C contents from 54.6 to 55.1%. PMID:25342683

  6. Hydrogen production with high yield and high evolution rate by self-flocculated cells of Enterobacter aerogenes in a packed-bed reactor

    Microsoft Academic Search

    M. A. Rachman; Y. Nakashimada; T. Kakizono; N. Nishio

    1998-01-01

    Continuous hydrogen gas evolution by self-flocculated cells of Enterobacter aerogenes, a natural isolate HU-101 and its mutant AY-2, was performed in a packed-bed reactor under glucose-limiting conditions in\\u000a a minimal medium. The flocs that formed during the continuous culture were retained even when the dilution rate was increased\\u000a to 0.9?h?1. The H2 production rate increased linearly with increases in the

  7. Treatment of a meningitis due to an Enterobacter aerogenes producing a derepressed cephalosporinase and a klebsiella pneumoniae producing an extended-spectrum ?-lactamase

    Microsoft Academic Search

    C. de Champs; D. Sirot; M. Chanal; J. Sirot; D. Guelon; D. Joyon

    1991-01-01

    Summary A case of nosocomial meningitis due to aKlebsiella pneumoniae producing a CAZ-5 extendedspectrum ß-lactamase and anEnterobacter aerogenes producing a derepressed cephalosporinase is reported. The intrathecal catheter incriminated was removed and a treatment with ceftazidime (4 g\\/24 h) and amikacin (1.5 g\\/24 h) was started. After 24 h ceftazidime was replaced by imipenem (2 then 4 g\\/24 h). This treatment

  8. Reactor comparison and scale-up for the microaerobic production of 2,3-butanediol by Enterobacter aerogenes at constant oxygen transfer rate

    Microsoft Academic Search

    T.-G. Byun; A.-P. Zeng; W.-D. Deckwer

    1994-01-01

    Stirred tank (STR), bubble column (BCR) and airlift (ALR) bioreactors of 0.05 and 1.5 m3 total volume were compared for the production of 2,3-butanediol using Enterobacter aerogenes under microaerobic conditions. Batch fermentations were carried out at constant oxygen transfer rate (OTR=35 mmol\\/lh). At 0.05 m3 scale, the STR reactor achieved much higher biomass and product concentrations than the BCR and

  9. Draft Genome Assemblies of Enterobacter aerogenes CDC 6003-71, Enterobacter cloacae CDC 442-68, and Pantoea agglomerans UA 0804-01.

    PubMed

    Minogue, T D; Daligault, H E; Davenport, K W; Bishop-Lilly, K A; Bruce, D C; Chain, P S; Coyne, S R; Chertkov, O; Freitas, T; Frey, K G; Jaissle, J; Koroleva, G I; Ladner, J T; Palacios, G F; Redden, C L; Xu, Y; Johnson, S L

    2014-01-01

    The Enterobacteriaceae are environmental and enteric microbes. We sequenced the genomes of two Enterobacter reference strains, E. aerogenes CDC 6003-71 and E. cloacae CDC 442-68, as well as one near neighbor used as an exclusionary reference for diagnostics, Pantoea agglomerans CDC UA0804-01. The genome sizes range from 4.72 to 5.55 Mbp and have G+C contents from 54.6 to 55.1%. PMID:25342683

  10. Fermentation shifts and metabolic reactivity during anaerobic carbon-limited growth of Klebsiella aerogenes NCTC 418 on fructose, gluconate, mannitol and pyruvate

    Microsoft Academic Search

    H. Streekstra; E. T. Buurman; C. W. G. Hoitink; M. J. Teixeira de Mattos; O. M. Neijssel; D. W. Tempest

    1987-01-01

    Klebsiella aerogenes NCTC 418 was grown in chemostat culture under carbon limitation, with fructose, mannitol, gluconate or pyruvate as the growth-limiting substrates, respectively. It was found that under these conditions the carbon sources were fermented with maximal stoichiometry of ATP generation. The YATP values (g cells per mol ATP generated net) were similar for mannitol- and fructose-limited cultures, but gluconate-limited

  11. Integrated evaluation of aerogenic pollution by air-transported heavy metals (Pb, Cd, Ni, Zn, Mn and Cu) in the analysis of the main deposit media.

    PubMed

    Baltr?nait?, Edita; Baltr?nas, Pranas; Lietuvninkas, Arvydas; Serevi?ien?, Vaida; Zuokait?, Egl?

    2014-01-01

    The composition of the ambient air is constantly changing; therefore, the monitoring of ambient air quality to detect the changes caused by aerogenic pollutants makes the essential part of general environmental monitoring. To achieve more effective improvement of the ambient air quality, the Directive 2008/50/EC on 'Ambient Air Quality and Cleaner Air for Europe' was adopted by the European Parliament and the European Council. It informed the public and enterprises about a negative effect of pollution on humans, animals and plants, as well as about the need for monitoring aerogenic pollutants not only at the continuous monitoring stations but also by using indicator methods, i.e. by analysing natural deposit media. The problem of determining the relationship between the accumulation level of pollutants by a deposit medium and the level of air pollution and its risks is constantly growing in importance. The paper presents a comprehensive analysis of the response of the main four deposit media, i.e. snow cover, soil, pine bark and epigeic mosses, to the long-term pollution by aerogenic pollutants which can be observed in the area of oil refinery influence. Based on the quantitative expressions of the amounts of the accumulated pollutants in the deposit media, the territory of the oil refinery investigated in this paper has been referred to the areas of mild or moderate pollution. PMID:23933956

  12. Evolution of Lactococcus lactis Phages within a Cheese Factory?

    PubMed Central

    Rousseau, Geneviève M.; Moineau, Sylvain

    2009-01-01

    We have sequenced the double-stranded DNA genomes of six lactococcal phages (SL4, CB13, CB14, CB19, CB20, and GR7) from the 936 group that were isolated over a 9-year period from whey samples obtained from a Canadian cheese factory. These six phages infected the same two industrial Lactococcus lactis strains out of 30 tested. The CB14 and GR7 genomes were found to be 100% identical even though they were isolated 14 months apart, indicating that a phage can survive in a cheese plant for more than a year. The other four genomes were related but notably different. The length of the genomes varied from 28,144 to 32,182 bp, and they coded for 51 to 55 open reading frames. All five genomes possessed a 3? overhang cos site that was 11 nucleotides long. Several structural proteins were also identified by nano-high-performance liquid chromatography-tandem mass spectrometry, confirming bioinformatic analyses. Comparative analyses suggested that the most recently isolated phages (CB19 and CB20) were derived, in part, from older phage isolates (CB13 and CB14/GR7). The organization of the five distinct genomes was similar to the previously sequenced lactococcal phage genomes of the 936 group, and from these sequences, a core genome was determined for lactococcal phages of the 936 group. PMID:19542338

  13. Expression of bioactive porcine interferon-gamma by recombinant Lactococcus lactis.

    PubMed

    Rupa, Prithy; Monedero, Vicente; Wilkie, Bruce N

    2008-05-25

    Lactococcus lactis is an immunomodulator and candidate live mucosal delivery vehicle for vaccine antigens and for biologically active molecules, including immunoregulatory cytokines such as interferon-gamma (IFN-gamma). To provide a tool for investigating downregulation of allergic predisposition of pigs to experimental food allergy, porcine IFN-gamma was cloned and expressed as a fusion protein with the usp45 secretion signal. Immunoblot analysis with polyclonal anti-pIFN-gamma-antibody demonstrated that the recombinant porcine IFN-gamma (rpIFN-gamma) protein was expressed in the L. lactis transformants as a secreted product. Activity of rpIFN-gamma was confirmed by ability to upregulate class II major histocompatibility complex (MHC) on cells of the porcine monocytic cell line 3D4/31. The L. lactis producing biologically active rpIFN-gamma will be used to investigate its possible ability to modulate the allergic immune response phenotype of pigs. PMID:18164876

  14. Bifidobacterium animalis subsp. lactis ATCC 27673 Is a Genomically Unique Strain within Its Conserved Subspecies

    PubMed Central

    Loquasto, Joseph R.; Barrangou, Rodolphe; Dudley, Edward G.; Stahl, Buffy; Chen, Chun

    2013-01-01

    Many strains of Bifidobacterium animalis subsp. lactis are considered health-promoting probiotic microorganisms and are commonly formulated into fermented dairy foods. Analyses of previously sequenced genomes of B. animalis subsp. lactis have revealed little genetic diversity, suggesting that it is a monomorphic subspecies. However, during a multilocus sequence typing survey of Bifidobacterium, it was revealed that B. animalis subsp. lactis ATCC 27673 gave a profile distinct from that of the other strains of the subspecies. As part of an ongoing study designed to understand the genetic diversity of this subspecies, the genome of this strain was sequenced and compared to other sequenced genomes of B. animalis subsp. lactis and B. animalis subsp. animalis. The complete genome of ATCC 27673 was 1,963,012 bp, contained 1,616 genes and 4 rRNA operons, and had a G+C content of 61.55%. Comparative analyses revealed that the genome of ATCC 27673 contained six distinct genomic islands encoding 83 open reading frames not found in other strains of the same subspecies. In four islands, either phage or mobile genetic elements were identified. In island 6, a novel clustered regularly interspaced short palindromic repeat (CRISPR) locus which contained 81 unique spacers was identified. This type I-E CRISPR-cas system differs from the type I-C systems previously identified in this subspecies, representing the first identification of a different system in B. animalis subsp. lactis. This study revealed that ATCC 27673 is a strain of B. animalis subsp. lactis with novel genetic content and suggests that the lack of genetic variability observed is likely due to the repeated sequencing of a limited number of widely distributed commercial strains. PMID:23995933

  15. Mycotoxin production by isolates of Fusarium lactis from greenhouse sweet pepper (Capsicum annuum).

    PubMed

    Yang, Y; Bouras, N; Yang, J; Howard, R J; Strelkov, S E

    2011-12-01

    Internal fruit rot, caused by Fusarium lactis, is an important disease of sweet pepper (Capsicum annuum) in Canadian greenhouses. Production of the mycotoxins fumonisin B? (FB?), moniliformin (MON) and beauvericin (BEA) by F. lactis (17 isolates) and the related species F. proliferatum (three isolates) and F. verticillioides (one isolate), which are also associated with internal fruit rot, was evaluated on rice medium. All 21 isolates examined were found to produce BEA, at concentrations ranging from 13.28 to 1674.60 ppm, while 13 of 17 F. lactis isolates and two of three F. proliferatum isolates produced MON (0.23 to 181.85 ppm). Only one isolate of F. lactis produced detectable levels of FB? in culture, whereas all three F. proliferatum isolates and the F. verticilloides isolate produced this mycotoxin (0.28 to 314 ppm). Production of FB?, MON and BEA was also evaluated in inoculated pepper fruits showing mild or severe symptoms of infection. FB? could be detected in both lightly and heavily diseased fruit tissue after inoculation with F. lactis, F. proliferatum or F. verticilloides, at concentrations ranging from 0.61 to 8.04 ppm. BEA was also detected in lightly and heavily diseased fruit tissue inoculated with F. lactis, as well as in heavily diseased tissue inoculated with F. proliferatum (3.00 to 19.43 ppm), but not in tissue inoculated with F. verticilloides. MON was detected in all tissues inoculated with F. proliferatum or F. verticilloides, and in heavily diseased tissue inoculated with F. lactis (0.03 to 0.27 ppm). The three mycotoxins were also found in naturally infected sweet pepper fruits exhibiting symptoms of internal fruit rot and collected from a commercial greenhouse. The production of MON, BEA and FB? alone or in combination by isolates of F. lactis suggests that development of internal fruit rot of sweet pepper is an important food safety concern, and that every effort should be made to cull infected fruit before it makes it to market. PMID:21903288

  16. Secretion of biologically active interferon-gamma inducible protein-10 (IP-10) by Lactococcus lactis

    PubMed Central

    Villatoro-Hernandez, Julio; Loera-Arias, Maria J; Gamez-Escobedo, Anali; Franco-Molina, Moises; Gomez-Gutierrez, Jorge G; Rodriguez-Rocha, Humberto; Gutierrez-Puente, Yolanda; Saucedo-Cardenas, Odila; Valdes-Flores, Jesus; Montes-de-Oca-Luna, Roberto

    2008-01-01

    Background Chemokines are a large group of chemotactic cytokines that regulate and direct migration of leukocytes, activate inflammatory responses, and are involved in many other functions including regulation of tumor development. Interferon-gamma inducible-protein-10 (IP-10) is a member of the C-X-C subfamily of the chemokine family of cytokines. IP-10 specifically chemoattracts activated T lymphocytes, monocytes, and NK cells. IP-10 has been described also as a modulator of other antitumor cytokines. These properties make IP-10 a novel therapeutic molecule for the treatment of chronic and infectious diseases. Currently there are no suitable live biological systems to produce and secrete IP-10. Lactococcus lactis has been well-characterized over the years as a safe microorganism to produce heterologous proteins and to be used as a safe, live vaccine to deliver antigens and cytokines of interest. Here we report a recombinant strain of L. lactis genetically modified to produce and secrete biologically active IP-10. Results The IP-10 coding region was isolated from human cDNA and cloned into an L. lactis expression plasmid under the regulation of the pNis promoter. By fusion to the usp45 secretion signal, IP-10 was addressed out of the cell. Western blot analysis demonstrated that recombinant strains of L. lactis secrete IP-10 into the culture medium. Neither degradation nor incomplete forms of IP-10 were detected in the cell or supernatant fractions of L. lactis. In addition, we demonstrated that the NICE (nisin-controlled gene expression) system was able to express IP-10 "de novo" even two hours after nisin removal. This human IP-10 protein secreted by L. lactis was biological active as demonstrated by Chemotaxis assay over human CD3+T lymphocytes. Conclusion Expression and secretion of mature IP-10 was efficiently achieved by L. lactis forming an effective system to produce IP-10. This recombinant IP-10 is biologically active as demonstrated by its ability to chemoattract human CD3+ T lymphocytes. This strain of recombinant L. lactis represents a potentially useful tool to be used as a live vaccine in vivo. PMID:18662403

  17. Effect of Ca2+ ions on plasmid transformation of Streptococcus lactis protoplasts.

    PubMed

    von Wright, A; Taimisto, A M; Sivelä, S

    1985-10-01

    The effects of Mg2+ and Ca2+ ions on the efficiency of the plasmid transformation of lysozyme-treated Streptococcus lactis protoplasts were compared. A 33-megadalton plasmid, pLP712, coding for lactose fermentation and a 6.5-megadalton plasmid, pGB301, coding for erythromycin and chloramphenicol resistance were used as model plasmids, and S. lactis MG1614 was the recipient. Replacing Mg2+ with Ca2+ in the transformation buffer was found to increase transformant frequency more than 10-fold with both plasmids. PMID:3936417

  18. Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

    PubMed Central

    Osuna, R; Schwacha, A; Bender, R A

    1994-01-01

    Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator. Images PMID:8071231

  19. Host-pathogen interactions in specific pathogen-free chickens following aerogenous infection with Chlamydia psittaci and Chlamydia abortus.

    PubMed

    Kalmar, Isabelle; Berndt, Angela; Yin, Lizi; Chiers, Koen; Sachse, Konrad; Vanrompay, Daisy

    2015-03-15

    Although Chlamydia (C.) psittaci infections are recognized as an important factor causing economic losses and impairing animal welfare in poultry production, the specific mechanisms leading to severe clinical outcomes are poorly understood. In the present study, we comparatively investigated pathology and host immune response, as well as systemic dissemination and expression of essential chlamydial genes in the course of experimental aerogeneous infection with C. psittaci and the closely related C. abortus, respectively, in specific pathogen-free chicks. Clinical signs appeared sooner and were more severe in the C. psittaci-infected group. Compared to C. abortus infection, more intense systemic dissemination of C. psittaci correlated with higher and faster infiltration of immune cells, as well as more macroscopic lesions and epithelial pathology, such as hyperplasia and erosion. In thoracic air sac tissue, mRNA expression of immunologically relevant factors, such as IFN-?, IL-1?, IL-6, IL-17, IL-22, LITAF and iNOS was significantly stronger up-regulated in C. psittaci- than in C. abortus-infected birds between 3 and 14 days post-infection. Likewise, transcription rates of the chlamydial genes groEL, cpaf and ftsW were consistently higher in C. psittaci during the acute phase. These findings illustrate that the stronger replication of C. psittaci in its natural host also evoked a more intense immune response than in the case of C. abortus infection. PMID:25638671

  20. Construction of a Bacteriophage-Resistant Derivative of Lactococcus lactis subsp. lactis 425A by Using the Conjugal Plasmid pNP40

    PubMed Central

    Harrington, Aidan; Hill, Colin

    1991-01-01

    Lactococcus lactis subsp. lactis 425A is an atypical strain which excretes a high concentration of ?-acetolactate when grown in milk. The conjugative lactococcal plasmid pNP40, which encodes phage and nisin resistance, was introduced to strain 425A by conjugation, using resistance to phage and nisin as a selection. No phage-nisin resistance mutants were encountered. Transconjugants display complete resistance at both 21 and 39°C to those phage previously identified as lytic for 425A. Transconjugants lose their resistance characteristics when spontaneously cured of pNP40. The commercially important property of 425A—production of high levels of ?-acetolactic acid—is unaffected by the presence of pNP40. Images PMID:16348595

  1. Use of a Genetically Enhanced, Pediocin-Producing Starter Culture, Lactococcus lactis subsp. lactis MM217, To Control Listeria monocytogenes in Cheddar Cheese

    PubMed Central

    Buyong, Nurliza; Kok, Jan; Luchansky, John B.

    1998-01-01

    Cheddar cheese was prepared with Lactococcus lactis subsp. lactis MM217, a starter culture which contains pMC117 coding for pediocin PA-1. About 75 liters of pasteurized milk (containing ca. 3.6% fat) was inoculated with strain MM217 (ca. 106 CFU per ml) and a mixture of three Listeria monocytogenes strains (ca. 103 CFU per ml). The viability of the pathogen and the activity of pediocin in the cheese were monitored at appropriate intervals throughout the manufacturing process and during ripening at 8°C for 6 months. In control cheese made with the isogenic, non-pediocin-producing starter culture L. lactis subsp. lactis MM210, the counts of the pathogen increased to about 107 CFU per g after 2 weeks of ripening and then gradually decreased to about 103 CFU per g after 6 months. In the experimental cheese made with strain MM217, the counts of L. monocytogenes decreased to 102 CFU per g within 1 week of ripening and then decreased to about 10 CFU per g within 3 months. The average titer of pediocin in the experimental cheese decreased from approximately 64,000 arbitrary units (AU) per g after 1 day to 2,000 AU per g after 6 months. No pediocin activity (<200 AU per g) was detected in the control cheese. Also, the presence of pMC117 in strain MM217 did not alter the cheese-making quality of the starter culture, as the rates of acid production, the pH values, and the levels of moisture, NaCl, and fat of the control cheese and the experimental cheese were similar. Our data revealed that pediocin-producing starter cultures have significant potential for protecting natural cheese against L. monocytogenes. PMID:9835572

  2. Cyclopropanation of unsaturated fatty acids and membrane rigidification improve the freeze-drying resistance of Lactococcus lactis subsp. lactis TOMSC161.

    PubMed

    Velly, H; Bouix, M; Passot, S; Penicaud, C; Beinsteiner, H; Ghorbal, S; Lieben, P; Fonseca, F

    2015-01-01

    This work aimed at characterizing the biochemical and biophysical properties of the membrane of Lactococcus lactis TOMSC161 cells during fermentation at different temperatures, in relation to their freeze-drying and storage resistance. Cells were cultivated at two different temperatures (22 and 30 °C) and were harvested at different growth phases (from the middle exponential phase to the late stationary phase). Bacterial membranes were characterized by determining the fatty acid composition, the lipid phase transition, and the membrane fluidity. Cultivability and acidification activity losses of L. lactis were quantified after freezing, drying, and 3 months of storage. The direct measurement of membrane fluidity by fluorescence anisotropy was linked to lipid composition, and it was established that the cyclopropanation of unsaturated fatty acids with concomitant membrane rigidification during growth led to an increase in the freeze-drying and storage resistance of L. lactis. As expected, cultivating cells at a lower fermentation temperature than the optimum growth temperature induced a homeoviscous adaptation that was demonstrated by a lowered lipid phase transition temperature but that was not related to any improvement in freeze-drying resistance. L. lactis TOMSC161 was therefore able to develop a combined biochemical and biophysical response at the membrane level during fermentation. The ratio of cyclic fatty acids to unsaturated fatty acids (CFA/UFA) appeared to be the most relevant parameter associated with membrane rigidification and cell resistance to freeze-drying and storage. This study increased our knowledge about the physiological mechanisms that explain the resistance of lactic acid bacteria (LAB) to freeze-drying and storage stresses and demonstrated the relevance of complementary methods of membrane characterization. PMID:25343977

  3. Immunization against Leishmania major Infection Using LACK- and IL-12-Expressing Lactococcus lactis Induces Delay in Footpad Swelling

    PubMed Central

    Hugentobler, Felix; Yam, Karen K.; Gillard, Joshua; Mahbuba, Raya; Olivier, Martin; Cousineau, Benoit

    2012-01-01

    Background Leishmania is a mammalian parasite affecting over 12 million individuals worldwide. Current treatments are expensive, cause severe side effects, and emerging drug resistance has been reported. Vaccination is the most cost-effective means to control infectious disease but currently there is no vaccine available against Leishmaniasis. Lactococcus lactis is a non-pathogenic, non-colonizing Gram-positive lactic acid bacterium commonly used in the dairy industry. Recently, L. lactis was used to express biologically active molecules including vaccine antigens and cytokines. Methodology/Principal findings We report the generation of L. lactis strains expressing the protective Leishmania antigen, LACK, in the cytoplasm, secreted or anchored to the bacterial cell wall. L. lactis was also engineered to secrete biologically active single chain mouse IL-12. Subcutaneous immunization with live L. lactis expressing LACK anchored to the cell wall and L. lactis secreting IL-12 significantly delayed footpad swelling in Leishmania major infected BALB/c mice. The delay in footpad swelling correlated with a significant reduction of parasite burden in immunized animals compared to control groups. Immunization with these two L. lactis strains induced antigen-specific multifunctional TH1 CD4+ and CD8+ T cells and a systemic LACK-specific TH1 immune response. Further, protection in immunized animals correlated with a Leishmania-specific TH1 immune response post-challenge. L. lactis secreting mouse IL-12 was essential for directing immune responses to LACK towards a protective TH1 response. Conclusions/Significance This report demonstrates the use of L. lactis as a live vaccine against L. major infection in BALB/c mice. The strains generated in this study provide the basis for the development of an inexpensive and safe vaccine against the human parasite Leishmania. PMID:22348031

  4. How physiological and cultural conditions influence heterologous protein production in Kluyveromyces lactis

    Microsoft Academic Search

    Annamaria Merico; Daniele Capitanio; Ileana Vigentini; Bianca Maria Ranzi; Concetta Compagno

    2004-01-01

    The optimization and scale-up of a specific protein production process have to take into account cultural conditions as well as cell physiology of growth and influence of foreign protein expression on host cell metabolism. Growth on cheap substrates, efficient secretion ability and a weaker tendency to hypermannosilate proteins than S. cerevisiae, make K. lactis an excellent and well-accepted host for

  5. Complete Genome Sequence of Lactococcus lactis Strain AI06, an Endophyte of the Amazonian Açaí Palm

    PubMed Central

    de Oliveira, Viviane Matoso; de Almeida Pina, André Vicioli; Pérez-Chaparro, Paula Juliana; de Almeida, Lara Mendes; de Vasconcelos, Janaina Mota; de Oliveira, Layanna Freitas; da Silva, Daisy Elaine Andrade; Rogez, Hervé Louis Ghislain; Cretenet, Marina; Mamizuka, Elsa Masae; Nunes, Marcio Roberto Teixeira

    2014-01-01

    We report the genome, in a single chromosome, of Lactococcus lactis strain AI06, isolated from the mesocarp of the açaí fruit (Euterpe oleracea) in eastern Amazonia, Brazil. This strain is an endophyte of the açaí palm and also a component of the microbiota of the edible food product. PMID:25414513

  6. Deletion of the PDR16 gene influences the plasma membrane properties of the yeast Kluyveromyces lactis.

    PubMed

    Toth Hervay, Nora; Goffa, Eduard; Svrbicka, Alexandra; Simova, Zuzana; Griac, Peter; Jancikova, Iva; Gaskova, Dana; Morvova, Marcela; Sikurova, Libusa; Gbelska, Yvetta

    2015-04-01

    The plasma membrane is the first line of cell defense against changes in external environment, thus its integrity and functionality are of utmost importance. The plasma membrane properties depend on both its protein and lipid composition. The PDR16 gene is involved in the control of Kluyveromyces lactis susceptibility to drugs and alkali metal cations. It encodes the homologue of the major K. lactis phosphatidylinositol transfer protein Sec14p. Sec14p participates in protein secretion, regulation of lipid synthesis, and turnover in vivo. We report here that the plasma membrane of the Klpdr16? mutant is hyperpolarized and its fluidity is lower than that of the parental strain. In addition, protoplasts prepared from the Klpdr16? cells display decreased stability when subjected to hypo-osmotic conditions. These changes in membrane properties lead to an accumulation of radiolabeled fluconazole and lithium cations inside mutant cells. Our results point to the fact that the PDR16 gene of K. lactis (KlPDR16) influences the plasma membrane properties in K. lactis that lead to subsequent changes in susceptibility to a broad range of xenobiotics. PMID:25742422

  7. Complete Genome Sequence of Lactococcus lactis Strain AI06, an Endophyte of the Amazonian Açaí Palm.

    PubMed

    McCulloch, John Anthony; de Oliveira, Viviane Matoso; de Almeida Pina, André Vicioli; Pérez-Chaparro, Paula Juliana; de Almeida, Lara Mendes; de Vasconcelos, Janaina Mota; de Oliveira, Layanna Freitas; da Silva, Daisy Elaine Andrade; Rogez, Hervé Louis Ghislain; Cretenet, Marina; Mamizuka, Elsa Masae; Nunes, Marcio Roberto Teixeira

    2014-01-01

    We report the genome, in a single chromosome, of Lactococcus lactis strain AI06, isolated from the mesocarp of the açaí fruit (Euterpe oleracea) in eastern Amazonia, Brazil. This strain is an endophyte of the açaí palm and also a component of the microbiota of the edible food product. PMID:25414513

  8. Diversity in Robustness of Lactococcus lactis Strains during Heat Stress, Oxidative Stress, and Spray Drying Stress

    PubMed Central

    Dijkstra, Annereinou R.; Setyawati, Meily C.; Bayjanov, Jumamurat R.; Alkema, Wynand; van Hijum, Sacha A. F. T.; Hugenholtz, Jeroen

    2014-01-01

    In this study we tested 39 Lactococcus lactis strains isolated from diverse habitats for their robustness under heat and oxidative stress, demonstrating high diversity in survival (up to 4 log units). Strains with an L. lactis subsp. lactis phenotype generally displayed more-robust phenotypes than strains with an L. lactis subsp. cremoris phenotype, whereas the habitat from which the strains had been isolated did not appear to influence stress survival. Comparison of the stress survival phenotypes with already available comparative genomic data sets revealed that the absence or presence of specific genes, including genes encoding a GntR family transcriptional regulator, a manganese ABC transporter permease, a cellobiose phosphotransferase system (PTS) component, the FtsY protein, and hypothetical proteins, was associated with heat or oxidative stress survival. Finally, 14 selected strains also displayed diversity in survival after spray drying, ranging from 20% survival for the most robust strains, which appears acceptable for industrial application, to 0.1% survival for the least-tolerant strains. The high and low levels of survival upon spray drying correlated clearly with the combined robustness under heat and oxidative stress. These results demonstrate the relevance of screening culture collections for robustness under heat and oxidative stress on top of the typical screening for acidifying and flavor-forming properties. PMID:24212574

  9. The cmbT gene encodes a novel major facilitator multidrug resistance transporter in Lactococcus lactis.

    PubMed

    Filipic, Brankica; Golic, Natasa; Jovcic, Branko; Tolinacki, Maja; Bay, Denice C; Turner, Raymond J; Antic-Stankovic, Jelena; Kojic, Milan; Topisirovic, Ljubisa

    2013-01-01

    Functional characterization of the multidrug resistance CmbT transporter was performed in Lactococcus lactis. The cmbT gene is predicted to encode an efflux protein homologous to the multidrug resistance major facilitator superfamily. The cmbT gene (1377 bp) was cloned and overexpressed in L. lactis NZ9000. Results from cell growth studies revealed that the CmbT protein has an effect on host cell resistance to lincomycin, cholate, sulbactam, ethidium bromide, Hoechst 33342, sulfadiazine, streptomycin, rifampicin, puromycin and sulfametoxazole. Moreover, in vivo transport assays showed that overexpressed CmbT-mediated extrusion of ethidium bromide and Hoechst 33342 was higher than in the control L. lactis NZ9000 strain. CmbT-mediated extrusion of Hoechst 33342 was inhibited by the ionophores nigericin and valinomycin known to dissipate proton motive force. This indicates that CmbT-mediated extrusion is based on a drug-proton antiport mechanism. Taking together results obtained in this study, it can be concluded that CmbT is a novel major facilitator multidrug resistance transporter candidate in L. lactis, with a possible signaling role in sulfur metabolism. PMID:22985829

  10. Standardized Assay Medium To Measure Lactococcus lactis Enzyme Activities while Mimicking Intracellular Conditions

    PubMed Central

    Goel, Anisha; Santos, Filipe; de Vos, Willem M.; Teusink, Bas

    2012-01-01

    Knowledge of how the activity of enzymes is affected under in vivo conditions is essential for analyzing their regulation and constructing models that yield an integrated understanding of cell behavior. Current kinetic parameters for Lactococcus lactis are scattered through different studies and performed under different assay conditions. Furthermore, assay conditions often diverge from conditions prevailing in the intracellular environment. To establish uniform assay conditions that resemble intracellular conditions, we analyzed the intracellular composition of anaerobic glucose-limited chemostat cultures of L. lactis subsp. cremoris MG 1363. Based on this, we designed a new assay medium for enzyme activity measurements of growing cells of L. lactis, mimicking as closely as practically possible its intracellular environment. Procedures were optimized to be carried out in 96-well plates, and the reproducibility and dynamic range were checked for all enzyme activity measurements. The effects of freezing and the carryover of ammonium sulfate from the addition of coupling enzymes were also established. Activities of all 10 glycolytic and 4 fermentative enzymes were measured. Remarkably, most in vivo-like activities were lower than previously published data. Yet, the ratios of Vmax over measured in vivo fluxes were above 1. With this work, we have developed and extensively validated standard protocols for enzyme activity measurements for L. lactis. PMID:22020503

  11. Aerobic growth thermograms of Streptococcus lactis obtained with a complex medium containing glucose.

    PubMed Central

    Monk, P R

    1978-01-01

    With different culturing methods both simple and complex thermograms were obtained with Streptococcus lactis grown aerobically in a complex medium containing growth-limiting concentrations of glucose. The thermogram profiles have been interpreted in relation to growth rate, glucose degradation, and molar growth yields calculated for different time intervals during growth. PMID:98515

  12. The Plasmid Complement of Lactococcus lactis UC509.9 Encodes Multiple Bacteriophage Resistance Systems

    PubMed Central

    Ainsworth, Stuart; Mahony, Jennifer

    2014-01-01

    Lactococcus lactis subsp. cremoris strains are used globally for the production of fermented dairy products, particularly hard cheeses. Believed to be of plant origin, L. lactis strains that are used as starter cultures have undergone extensive adaptation to the dairy environment, partially through the acquisition of extrachromosomal DNA in the form of plasmids that specify technologically important phenotypic traits. Here, we present a detailed analysis of the eight plasmids of L. lactis UC509.9, an Irish dairy starter strain. Key industrial phenotypes were mapped, and genes that are typically associated with lactococcal plasmids were identified. Four distinct, plasmid-borne bacteriophage resistance systems were identified, including two abortive infection systems, AbiB and AbiD1, thereby supporting the observed phage resistance of L. lactis UC509.9. AbiB escape mutants were generated for phage sk1, which were found to carry mutations in orf6, which encodes the major capsid protein of this phage. PMID:24814781

  13. Effects of Lactococcus lactis on Composition of Intestinal Microbiota: Role of Nisin

    PubMed Central

    Bernbom, Nete; Licht, Tine Rask; Brogren, Carl-Henrik; Jelle, Birthe; Johansen, Anette H.; Badiola, Iker; Vogensen, Finn K.; Nørrung, Birgit

    2006-01-01

    This study examined the ability of (i) pure nisin, (ii) nisin-producing Lactococcus lactis strain CHCC5826, and (iii) the non-nisin-producing L. lactis strain CHCH2862 to affect the composition of the intestinal microbiota of human flora-associated rats. The presence of both the nisin-producing and the non-nisin-producing L. lactis strains significantly increased the number of Bifidobacterium cells in fecal samples during the first 8 days but decreased the number of enterococci/streptococci in duodenum, ileum, cecum, and colon samples as detected by selective cultivation. No significant changes in the rat fecal microbiota were observed after dosage with nisin. Pearson cluster analysis of denaturing gradient gel electrophoresis profiles of the 16S rRNA genes present in the fecal microbial population revealed that the microbiota of animals dosed with either of the two L. lactis strains were different from that of control animals dosed with saline. However, profiles of the microbiota from animals dosed with nisin did not differ from the controls. The concentrations of nisin estimated by competitive enzyme-linked immunosorbent assay (ELISA) were approximately 10-fold higher in the small intestine and 200-fold higher in feces than the corresponding concentrations estimated by a biological assay. This indicates that nisin was degraded or inactivated in the gastrointestinal tract, since fragments of this bacteriocin are detected by ELISA while an intact molecule is needed to retain biological activity. PMID:16391049

  14. Respiration Capacity of the Fermenting Bacterium Lactococcus lactis and Its Positive Effects on Growth and Survival†

    PubMed Central

    Duwat, Patrick; Sourice, Sophie; Cesselin, Bénédicte; Lamberet, Gilles; Vido, Karin; Gaudu, Philippe; Le Loir, Yves; Violet, Florent; Loubière, Pascal; Gruss, Alexandra

    2001-01-01

    Oxygen is a major determinant of both survival and mortality of aerobic organisms. For the facultative anaerobe Lactococcus lactis, oxygen has negative effects on both growth and survival. We show here that oxygen can be beneficial to L. lactis if heme is present during aerated growth. The growth period is extended and long-term survival is markedly improved compared to results obtained under the usual fermentation conditions. We considered that improved growth and survival could be due to the capacity of L. lactis to undergo respiration. To test this idea, we confirmed that the metabolic behavior of lactococci in the presence of oxygen and hemin is consistent with respiration and is most pronounced late in growth. We then used a genetic approach to show the following. (i) The cydA gene, encoding cytochrome d oxidase, is required for respiration and plays a direct role in oxygen utilization. cydA expression is induced late in growth under respiration conditions. (ii) The hemZ gene, encoding ferrochelatase, which converts protoporphyrin IX to heme, is needed for respiration if the precursor, rather than the final heme product, is present in the medium. Surprisingly, survival improved by respiration is observed in a superoxide dismutase-deficient strain, a result which emphasizes the physiological differences between fermenting and respiring lactococci. These studies confirm respiratory metabolism in L. lactis and suggest that this organism may be better adapted to respiration than to traditional fermentative metabolism. PMID:11443085

  15. Exopolysaccharides produced by Lactococcus lactis: from genetic engineering to improved rheological properties?

    Microsoft Academic Search

    Michiel Kleerebezem; Richard van Kranenburg; Remco Tuinier; Ingeborg C. Boels; Pieternella Zoon; Ellen Looijesteijn; Jeroen Hugenholtz; Willem M. de Vos

    1999-01-01

    Over the last years, important advances have been made in the study of the production of exopolysaccharides (EPS) by several lactic acid bacteria, including Lactococcus lactis. From different EPS-producing lactococcal strains the specific eps gene clusters have been characterised. They contain eps genes, which are involved in EPS repeating unit synthesis, export, polymerisation, and chain length determination. The function of

  16. Low-redundancy sequencing of the entire Lactococcus lactis IL1403 genome.

    PubMed

    Bolotin, A; Mauger, S; Malarme, K; Ehrlich, S D; Sorokin, A

    1999-01-01

    Lactococcus lactis is an AT-rich gram positive bacterium phylogenetically close to the genus Streptococcus. Various strains of L. lactis are used in dairy industry as starters for cheese making. L. lactis is also one of the well characterized laboratory microorganisms, widely used for studies on physiology of lactic acid bacteria. We describe here a low redundancy sequence of the genome of the strain L. lactis IL1403. The strategy which we followed to determine the sequence consists of two main steps. First, a limited number of plasmids and lambda-phages that carry random segments of the genome were sequenced. Second, sequences of the inserts were used for production of novel sequencing templates by applying Multiplex Long Accurate PCR protocols. Using of these PCR products allowed to determine the sequence of the entire 2.35 Mb genome with a very low redundancy, close to 2. The error rate of the sequence is estimated to be below 1%. The correctness of the sequence assembly was confirmed by PCR amplification of the entire L. lactis IL1403 genome, using a set of 266 oligonucleotides. Anotation of the sequence was undertaken by using automatic gene prediction computer tools. This allowed to identify 1495 protein-encoding genes, to locate them on the genome map and to classify their functions on the basis of homology to known proteins. The function of about 700 genes expected to encode proteins that lack homologs in data bases cannot be reliably predicted in this way. The approach which we used eliminates high redundancy sequencing and mapping efforts, needed to obtain detailed and comprehensive genetic and physical maps of a bacterium. Availability of detailed genetic and physical maps of the L. lactis IL1403 genome provides many entries to study metabolism and physiology of bacteria from this group. The presence of 42 copies of five different IS elements in the IL1403 genome confirms the importance of these elements for genetic exchange in Lactococci. These include two previously unknown elements, present at seven and fifteen copies and designated IS1077 and IS983, respectively. Five potential or rudimentary prophages were identified in the genome by detecting clusters of phage-related genes. The metabolic and regulatory potential of L. lactis was evaluated by inspecting gene sets classified into different functional categories. L. lactis has the genetic potential to synthesise 20 standard amino acids, purine and pyrimidine nucleotides and at least four cofactors. Some of these metabolites, which are usually present in chemically defined media, can probably be omitted. About twenty compounds can be used by L. lactis as a sole carbon source. Some 83 regulators were revealed, indicating a regulatory potential close to that of Haemophilus influenzae, a bacterium with a similar genome size. Unexpectedly, L. lactis has a complete set of late competence genes, which may have concerted transcriptional regulation and unleadered polycistronic mRNAs. These findings open new possibilities for developing genetic tools, useful for studies of gene regulation in AT-rich gram positive bacteria and for engineering of new strains for the diary industry. PMID:10532372

  17. Exopolysaccharide Expression in Lactococcus lactis subsp. cremoris Ropy352: Evidence for Novel Gene Organization?

    PubMed Central

    Knoshaug, Eric P.; Ahlgren, Jeff A.; Trempy, Janine E.

    2007-01-01

    Lactococcus lactis subsp. cremoris Ropy352 produces two distinct heteropolysaccharides, phenotypically described as ropy and mucoid, when cultured in nonfat milk. One exopolysaccharide precipitated with 50% ethanol as a series of elongated threads and was composed of glucose and galactose in a molar ratio of 3:2. The second exopolysaccharide precipitated with 75% ethanol as a fine flocculant and consisted of galactose, glucose, and mannose with a molar ratio of 67:21:12. A mutant strain, L. lactis subsp. cremoris EK240, lacking the ropy phenotype did not produce the exopolysaccharide that precipitated with 50% ethanol; however, it produced the exopolysaccharide that precipitated with 75% ethanol, indicating that the former exopolysaccharide is essential for the ropy phenotype. Cultures of L. lactis subsp. cremoris Ropy352 in 10% nonfat milk reached a viscosity of 25 Pa-s after 24 h, while those of the nonropy L. lactis subsp. cremoris EK240 mutant did not change. A mutation abolishing ropy exopolysaccharide expression mapped to a region on a plasmid containing two open reading frames, epsM and epsN, encoding novel glycosyltransferases bordered by ISS1 elements oriented in the same direction. Sequencing of this plasmid revealed two other regions involved in exopolysaccharide expression, an operon located between partial IS981 and IS982 elements, and an independent gene, epsU. Two and possibly three of these regions are involved in L. lactis subsp. cremoris Ropy352 exopolysaccharide expression and are arranged in a novel fashion different from that of typical lactococcal exopolysaccharide loci, and this provides genetic evidence for exopolysaccharide gene reorganization and evolution in Lactococcus. PMID:17122391

  18. Sugar Utilization and Acid Production by Free and Entrapped Cells of Streptococcus salivarius subsp. thermophilus, Lactobacillus delbrueckii subsp. bulgaricus, and Lactococcus lactis subsp. lactis in a Whey Permeate Medium

    PubMed Central

    Audet, Pascal; Paquin, Celine; Lacroix, Christophe

    1989-01-01

    Cells of Streptococcus salivarius subsp. thermophilus and Lactococcus lactis subsp. lactis entrapped in k-carrageenan-locust bean gum gel performed similarly to free cells in the conversion of lactose to lactic acid. Bead diameter influenced the fermentation rate. Cells entrapped in smaller beads (0.5 to 1.0 mm) showed higher release rates, higher lactose, glucose, and formic acid utilization, higher galactose accumulation, and higher lactic acid production than did cells entrapped in larger beads (1.0 to 2.0 mm). Values for smaller beads were comparable with those for free cells. Immobilization affected the fermentation rate of lactic acid bacteria, especially Lactobacillus delbrueckii subsp. bulgaricus. Entrapped cells of L. delbrueckii subsp. bulgaricus demonstrated a lower lactic acid production than did free cells in batch fermentation. The kinetics of the production of formic and pyruvic acids by L. lactis subsp. lactis and S. salivarius subsp. thermophilus are presented. PMID:16347822

  19. Promoter and signal sequence from filamentous fungus can drive recombinant protein production in the yeast Kluyveromyces lactis.

    PubMed

    Madhavan, Aravind; Sukumaran, Rajeev K

    2014-08-01

    Cross-recognition of promoters from filamentous fungi in yeast can have important consequences towards developing fungal expression systems, especially for the rapid evaluation of their efficacy. A truncated 510bp inducible Trichoderma reesei cellobiohydrolase I (cbh1) promoter was tested for the expression of green fluorescent protein (GFP) in Kluyveromyces lactis after disrupting its native ?-galactosidase (lac4) promoter. The efficiency of the CBH1 secretion signal was also evaluated by fusing it to the lac4 promoter of the yeast, which significantly increased the secretion of recombinant protein in K. lactis compared to the native ?-mating factor secretion signal. The fungal promoter is demonstrated to have potential to drive heterologous protein production in K. lactis; and the small sized T. reesei cbh1 secretion signal can mediate the protein secretion in K. lactis with high efficiency. PMID:24661814

  20. Application of comet assay for the assessment of DNA damage caused by chemical genotoxins in the dairy yeast Kluyveromyces lactis.

    PubMed

    Staneva, Dessislava; Peycheva, Ekaterina; Georgieva, Milena; Efremov, Toni; Miloshev, George

    2013-01-01

    Kluyveromyces lactis, also known as dairy yeast, has numerous applications in scientific research and practice. It has been approved as a GRAS (Generally Recognized As Safe) organism, a probiotic, a biotechnological producer of important enzymes at industrial scale and a bioremediator of waste water from the dairy industry. Despite these important practical applications the sensitivity of this organism to genotoxic substances has not yet been assessed. In order to evaluate the response of K. lactis cells to genotoxic agents we have applied several compounds with well-known cyto- and genotoxic activity. The method of comet assay (CA) widely used for the assessment of DNA damages is presented here with new special modifications appropriate for K. lactis cells. The comparison of the response of K. lactis to genotoxins with that of Saccharomyces cerevisiae showed that both yeasts, although considered close relatives, exhibit species-specific sensitivity toward the genotoxins examined. PMID:22914887

  1. Effects of eliminating pyruvate node pathways and of coexpression of heterogeneous carboxylation enzymes on succinate production by Enterobacter aerogenes.

    PubMed

    Tajima, Yoshinori; Yamamoto, Yoko; Fukui, Keita; Nishio, Yousuke; Hashiguchi, Kenichi; Usuda, Yoshihiro; Sode, Koji

    2015-02-01

    Lowering the pH in bacterium-based succinate fermentation is considered a feasible approach to reduce total production costs. Newly isolated Enterobacter aerogenes strain AJ110637, a rapid carbon source assimilator under weakly acidic (pH 5.0) conditions, was selected as a platform for succinate production. Our previous work showed that the ?adhE/PCK strain, developed from AJ110637 with inactivated ethanol dehydrogenase and introduced Actinobacillus succinogenes phosphoenolpyruvate carboxykinase (PCK), generated succinate as a major product of anaerobic mixed-acid fermentation from glucose under weakly acidic conditions (pH <6.2). To further improve the production of succinate by the ?adhE/PCK strain, metabolically engineered strains were designed based on the elimination of pathways that produced undesirable products and the introduction of two carboxylation pathways from phosphoenolpyruvate and pyruvate to oxaloacetate. The highest production of succinate was observed with strain ES04/PCK+PYC, which had inactivated ethanol, lactate, acetate, and 2,3-butanediol pathways and coexpressed PCK and Corynebacterium glutamicum pyruvate carboxylase (PYC). This strain produced succinate from glucose with over 70% yield (gram per gram) without any measurable formation of ethanol, lactate, or 2,3-butanediol under weakly acidic conditions. The impact of lowering the pH from 7.0 to 5.5 on succinate production in this strain was evaluated under pH-controlled batch culture conditions and showed that the lower pH decreased the succinate titer but increased its yield. These findings can be applied to identify additional engineering targets to increase succinate production. PMID:25416770

  2. Quantifying the Effect of Hand Wash Duration, Soap Use, Ground Beef Debris, and Drying Methods on the Removal of Enterobacter aerogenes on Hands.

    PubMed

    Jensen, Dane A; Danyluk, Michelle D; Harris, Linda J; Schaffner, Donald W

    2015-04-01

    Hand washing is recognized as a crucial step in preventing foodborne disease transmission by mitigating crosscontamination among hands, surfaces, and foods. This research was undertaken to establish the importance of several keys factors (soap, soil, time, and drying method) in reducing microorganisms during hand washing. A nonpathogenic nalidixic acid-resistant Enterobacter aerogenes surrogate for Salmonella was used to assess the efficacy of using soap or no soap for 5 or 20 s on hands with or without ground beef debris and drying with paper towel or air. Each experiment consisted of 20 replicates, each from a different individual with ?6 log CFU/ml E. aerogenes on their hands. A reduction of 1.0 ± 0.4 and 1.7 ± 0.8 log CFU of E. aerogenes was observed for a 5-s wash with no soap and a 20-s wash with soap, respectively. When there was no debris on the hands, there was no significant difference between washing with and without soap for 20 s (P > 0.05). Likewise, there was no significant difference in the reductions achieved when washing without soap, whether or not debris was on the hands (P > 0.05). A significantly greater reduction (P < 0.05) in E. aerogenes (0.5 log CFU greater reduction) was observed with soap when there was ground beef debris on the hands. The greatest difference (1.1 log CFU greater average reduction) in effectiveness occurred when ground beef debris was on the hands and a 20-s wash with water was compared with a 20-s wash with soap. Significantly greater (P < 0.05) reductions were observed with paper towel drying compared with air (0.5 log CFU greater reductions). Used paper towels may contain high bacterial levels (>4.0 log CFU per towel) when hands are highly contaminated. Our results support future quantitative microbial risk assessments needed to effectively manage risks of foodborne illness in which food workers' hands are a primary cause. PMID:25836392

  3. Prevalence and diversity of qnr alleles in AmpC-producing Enterobacter cloacae, Enterobacter aerogenes, Citrobacter freundii and Serratia marcescens: a multicentre study from Korea

    Microsoft Academic Search

    Yeon-Joon Park; Jin Kyung Yu; Seungok Lee; Eun-Jee Oh; Gun-Jo Woo

    2007-01-01

    Methods: A total of 644 consecutive, non-duplicate isolates of Enterobacter cloacae (186), Enterobacter aerogenes (154), Citrobacter freundii (138) and Serratia marcescens (166) were examined. We performed antimicrobial susceptibility testing and PCR for qnr determinants (qnrA, qnrB and qnrS), extended-spectrum b-lactamase (ESBL) (blaTEM, blaSHV and blaCTX-M), orf513, orf1005 and blaDHA-1. To differentiate qnr subtypes, restriction enzyme analysis and sequencing was performed.

  4. Mdt(A), a New Efflux Protein Conferring Multiple Antibiotic Resistance in Lactococcus lactis and Escherichia coli

    Microsoft Academic Search

    VINCENT PERRETEN; FRANZISKA V. SCHWARZ; MICHAEL TEUBER; STUART B. LEVY

    2001-01-01

    The mdt(A) gene, previously designated mef214, from Lactococcus lactis subsp. lactis plasmid pK214 encodes a protein (Mdt(A) (multiple drug transporter)) with 12 putative transmembrane segments (TMS) that contain typical motifs conserved among the efflux proteins of the major facilitator superfamily. However, it also has two C-motifs (conserved in the fifth TMS of the antiporters) and a putative ATP-binding site. Expression

  5. KlPMR1 inactivation and calcium addition enhance secretion of non-hyperglycosylated heterologous proteins in Kluyveromyces lactis

    Microsoft Academic Search

    D. Uccelletti; F. Farina; P. Mancini; C. Palleschi

    2004-01-01

    The Kluyveromyces lactis KlPMR1 gene is the functional homologue of Saccharomyces cerevisiae PMR1 which encodes a Ca2+-ATPase localized in the Golgi apparatus. We studied the effects of KlPMR1 inactivation on the glycosylation and secretion of native and heterologous proteins in K. lactis. We used acid phosphatase, recombinant human serum albumin and ?-glucoamylase from Arxula adeninivorans as reporter proteins. The Klpmr1?

  6. Plasmid Complements ofStreptococcus lactis NCDO 712and Other Lactic Streptococci After Protoplast-Induced Curing

    Microsoft Academic Search

    MICHAELJ. GASSON

    traits inStreptococcus lactis subsp. diacetylactis strains. Theloss offive different plasmids, including small multicopy molecules, wasreadily detected inStreptococcus lactis 712byscreening lysates ofrandom protoplast regenerants onagarose gels. Inthisstrain sequential rounds of protoplast regeneration wereused toproduce aplasmid-free strain andderivatives carrying onlysingle molecules fromtheplasmid complement. During these experiments a33-megadalton plasmid, pLP712, wasfound toencode genesfor lactose andprotein utilization. Onlythis plasmid wasrequired fornormal growth andacid production

  7. Effect of heat shock or cold shock treatment on the resistance of lactococcus lactis to freezing and lyophilization

    PubMed

    Broadbent; Lin

    1999-08-01

    This study investigated the effect of heat shock or cold shock treatment on the resistance of commercial Lactococcus lactis ssp. lactis and L. lactis ssp. cremoris cheese starter bacteria to freezing and freeze-drying. The ability to withstand freezing at -60 degrees C for 24 h was variable among lactococci, but could be significantly (P < 0.05) improved in most strains by a 25-min heat shock at 42 degrees C (L. lactis ssp. lactis) or 39 degrees C (L. lactis ssp. cremoris) or by a 2-h cold shock at 10 degrees C. In addition, stress treatments that improved lactococcal cryotolerance significantly (P < 0.05) enhanced the resistance of most strains to lyophilization. Greater resistance to freezing or lyophilization was not detected when stress treatments were performed in broth that contained erythromycin, which indicated that stress-induced proteins were required for cell protection. Membrane fatty acid analysis of stress-treated cells suggested that enhanced resistance to freezing and lyophilization may be related to changes in cell membrane lipid composition. Heat-shocked cells had a higher 19:0 cyclopropane fatty acid content than control cells, and cold-shocked cells contained a lower ratio of saturated to unsaturated fatty acids. Other factors must also be involved in cell protection, however, because similar changes in membrane lipid composition were detected in strains whose resistance to freezing and lyophilization was not improved by heat or cold shock treatment. Copyright 1999 Academic Press. PMID:10458904

  8. Protective effects of oral immunization with live Lactococcus lactis expressing Eimeria tenella 3-1E protein.

    PubMed

    Ma, Dexing; Gao, Mingyang; Dalloul, Rami A; Ge, Junwei; Ma, Chunli; Li, Jie

    2013-12-01

    The codon-optimized Eimeria tenella 3-1E gene was introduced into the lactic acid bacterial vector pTX8048 to construct plasmid pTX8048-3-1E. The plasmid pTX8048-3-1E was transformed into Lactococcus lactis NZ9000 by electroporation to create the strain of L. lactis pTX8048-3-1E. The expression of objective protein was verified by Western blot. The live bacteria L. lactis pTX8048-3-1E were administered orally, and an animal challenge experiment was carried out to evaluate the protective efficacy. The results indicated the strain of L. lactis pTX8048-3-1E was constructed successfully. Oral immunization to specific pathogen-free (SPF) chickens with L. lactis pTX8048-3-1E provided partial protection against homologous challenge including significant increased oocyst decrease ratio, reduced average lesion score in cecum, and improved body weight gain compared to control bacteria L. lactis pTX8048. These results demonstrate the use of Lactococcus as live vector for delivery of Eimeria antigen is feasible and promising method to control coccidiosis in poultry. PMID:24037539

  9. Genetic diversity and mycotoxin production of Fusarium lactis species complex isolates from sweet pepper.

    PubMed

    Van Poucke, Kris; Monbaliu, Sofie; Munaut, Françoise; Heungens, Kurt; De Saeger, Sarah; Van Hove, François

    2012-02-01

    An internal fruit rot disease of sweet peppers was first detected in Belgium in 2003. Research conducted mostly in Canada indicates that this disease is primarily caused by Fusarium lactis Pirotta. Ninety-eight Fusarium isolates obtained from diseased sweet peppers from Belgium, as well as from other countries (Canada, the Netherlands and the United Kingdom) were identified by sequencing the translation elongation factor 1? (EF). Of these 98 isolates, 13 were identified as F. oxysporum Schltdl., nine as F. proliferatum (Matsush.) Nirenberg and two belonged to clade 3 of the F. solani species complex. Of the 74 remaining isolates, the EF sequence showed 97% to 98% similarity to F. lactis. Of these isolates, the ?-tubulin (TUB), calmodulin (CAM) and the second largest subunit of RNA polymerase II (RPB2) genes were also sequenced. Analysis of the combined sequences revealed that the 74 isolates share nine combined sequences that correspond to nine multilocus sequence types (STs), while the F. lactis neotype strain and one other strain, both isolated from figs, form a separate ST. Together, these 10 STs represent a monophyletic F. lactis species complex (FLASC). An unusually high level of genetic diversity was observed between (groups of) these STs. Two of them (ST5 and ST6) fulfilled the criteria for species recognition based on genealogical exclusivity and together represent a new monophyletic species lineage (FLASC-1). The seven other STs, together with the F. lactis neotype ST, form a paraphyletic species lineage in the African clade of the Gibberella fujikuroi species complex (GFSC). From each of the 10 STs, the mycotoxin production was assessed using a multi-mycotoxin liquid chromatography mass spectrometry method. Out of the 27 analyzed mycotoxins, beauvericin and fumonisins were detected in sweet pepper tissue and in maize kernels. The 10 STs clearly differed in the amount of mycotoxin produced, but there was only limited congruence between the production profile and the phylogenetic analysis. Furthermore, the morphological characterization (based on mycelial growth rate and the length of macroconidia) showed distinct differences between the 10 STs, but again there was limited congruence with the phylogenetic results. In conclusion, the data presented in this study demonstrate that 75% of the isolates obtained from sweet pepper with internal fruit rot belong to a F. lactis species complex (FLASC), including a new FLASC-1 monophyletic species, and that the members of this complex display great genetic and phenotypic diversity. PMID:22098923

  10. Secretion and properties of a hybrid Kluyveromyces lactis-Aspergillus niger ?-galactosidase

    PubMed Central

    Rodríguez, Ángel Pereira; Leiro, Rafael Fernández; Trillo, M Cristina; Cerdán, M Esperanza; Siso, M Isabel González; Becerra, Manuel

    2006-01-01

    Background The ?-galactosidase from Kluyveromyces lactis is a protein of outstanding biotechnological interest in the food industry and milk whey reutilization. However, due to its intracellular nature, its industrial production is limited by the high cost associated to extraction and downstream processing. The yeast-system is an attractive method for producing many heterologous proteins. The addition of a secretory signal in the recombinant protein is the method of choice to sort it out of the cell, although biotechnological success is not guaranteed. The cell wall acting as a molecular sieve to large molecules, culture conditions and structural determinants present in the protein, all have a decisive role in the overall process. Protein engineering, combining domains of related proteins, is an alternative to take into account when the task is difficult. In this work, we have constructed and analyzed two hybrid proteins from the ?-galactosidase of K. lactis, intracellular, and its Aspergillus niger homologue that is extracellular. In both, a heterologous signal peptide for secretion was also included at the N-terminus of the recombinant proteins. One of the hybrid proteins obtained has interesting properties for its biotechnological utilization. Results The highest levels of intracellular and extracellular ?-galactosidase were obtained when the segment corresponding to the five domain of K. lactis ?-galactosidase was replaced by the corresponding five domain of the A. niger ?-galactosidase. Taking into account that this replacement may affect other parameters related to the activity or the stability of the hybrid protein, a thoroughly study was performed. Both pH (6.5) and temperature (40°C) for optimum activity differ from values obtained with the native proteins. The stability was higher than the corresponding to the ?-galactosidase of K. lactis and, unlike this, the activity of the hybrid protein was increased by the presence of Ni2+. The affinity for synthetic (ONPG) or natural (lactose) substrates was higher in the hybrid than in the native K. lactis ?-galactosidase. Finally, a structural-model of the hybrid protein was obtained by homology modelling and the experimentally determined properties of the protein were discussed in relation to it. Conclusion A hybrid protein between K. lactis and A. niger ?-galactosidases was constructed that increases the yield of the protein released to the growth medium. Modifications introduced in the construction, besides to improve secretion, conferred to the protein biochemical characteristics of biotechnological interest. PMID:17176477

  11. A comparative study on phosphotransferase activity of acid phosphatases from Raoultella planticola and Enterobacter aerogenes on nucleosides, sugars, and related compounds.

    PubMed

    Médici, Rosario; Garaycoechea, Juan I; Valino, Ana L; Pereira, Claudio A; Lewkowicz, Elizabeth S; Iribarren, Adolfo M

    2014-04-01

    Natural and modified nucleoside-5'-monophosphates and their precursors are valuable compounds widely used in biochemical studies. Bacterial nonspecific acid phosphatases (NSAPs) are a group of enzymes involved in the hydrolysis of phosphoester bonds, and some of them exhibit phosphotransferase activity. NSAP containing Enterobacter aerogenes and Raoultella planticola whole cells were evaluated in the phosphorylation of a wide range of nucleosides and nucleoside precursors using pyrophosphate as phosphate donor. To increase the productivity of the process, we developed two genetically modified strains of Escherichia coli which overexpressed NSAPs of E. aerogenes and R. planticola. These new recombinant microorganisms (E. coli BL21 pET22b-phoEa and E. coli BL21 pET22b-phoRp) showed higher activity than the corresponding wild-type strains. Reductions in the reaction times from 21 h to 60 min, from 4 h to 15 min, and from 24 h to 40 min in cases of dihydroxyacetone, inosine, and fludarabine, respectively, were obtained. PMID:23995227

  12. Contribution of the CesR-regulated genes llmg0169 and llmg2164-2163 to Lactococcus lactis fitness.

    PubMed

    Roces, Clara; Campelo, Ana B; Veiga, Patrick; Pinto, João P C; Rodríguez, Ana; Martínez, Beatriz

    2009-08-15

    Lactococcus lactis is one of the main components of the starter cultures used in cheese manufacture. As starter, L. lactis must tolerate harsh conditions encountered either during their production in bulk quantities or during dairy products processing. To face these hostile conditions, bacteria monitor the environment and respond by modifying gene expression appropriately. Previous transcriptomic studies showed that the two component system CesSR is the main pathway that triggers the cell envelope stress response in L. lactis treated with lactococcin 972 (Lcn972), a cell wall synthesis inhibiting bacteriocin. Among the CesR-regulated genes, llmg0169 and the operon llmg2164-2163, encoding proteins of unknown function, are among the highest up-regulated genes after activation of CesSR. In this study, we have assessed the contribution of these genes to the survival of L. lactis to different technologically-relevant stresses. Overexpressing and knock-out mutants of the genes were generated and their viability to low pH, heat, freeze-drying, presence of NaCl, cell wall antimicrobials and lytic phages attack was compared to the wild type strain. The genes llmg0169 and llmg2164-2163 contributed differently to L. lactis fitness. L. lactis Deltallmg0169 was very sensitive to heat treatment while L. lactis Deltallmg2164 was more sensitive to NaCl. Absence of both genes also compromised viability at low pH. On the contrary, higher expression levels of llmg0169 and llmg2164-2163, up to 26- and 14-fold increase determined by qRT-PCR, respectively, did not enhance L. lactis survival in any of the above stressful conditions (heat, pH and NaCl) or after freeze-drying. All the mutants displayed a similar phage susceptibility profile. Overexpression of llmg2164-2163 seemed to specifically protect L. lactis against the bacteriocin Lcn972 but not against other cell wall active antimicrobials. Based on our phenotypic analysis, the investigated genes are required to mount a proper response to guarantee survival of L. lactis under technologically-relevant stresses and their functionality could be a useful marker to select robust dairy starters. PMID:19559493

  13. Isotopic labeling of heterologous proteins in the yeast Pichia pastoris and Kluyveromyces lactis.

    PubMed

    Sugiki, Toshihiko; Ichikawa, Osamu; Miyazawa-Onami, Mayumi; Shimada, Ichio; Takahashi, Hideo

    2012-01-01

    Several protein expression systems are available for the preparation of stable isotope-labeled recombinant proteins for NMR studies. Yeast expression systems have several advantages over prokaryotic systems, such as the widely used Escherichia coli expression system. Protein expression using the methylotrophic yeast Pichia pastoris is commonly employed for the preparation of isotope-labeled proteins. Recently, the hemiascomycete yeast Kluyveromyces lactis expression system was reported as being useful for preparing proteins for NMR studies. Since each yeast expression system has different features, their applications have increased in number. In this chapter, we describe procedures for the efficient production of uniformly isotope-labeled proteins using the P. pastoris and the K. lactis yeast expression systems. PMID:22167666

  14. Identification and characterization of the insertion element IS1070 from Leuconostoc lactis NZ6009.

    PubMed

    Vaughan, E E; de Vos, W M

    1995-03-21

    A novel insertion sequence, designated IS1070, was identified on the lactose plasmid of Leuconostoc lactis NZ6009 by nucleotide sequence analysis. The 1027-bp sequence contains partially matched (24 of 28 bp) inverted repeats and has one long open reading frame. The deduced 305-amino-acid sequence demonstrated homology to transposases of IS30 from Escherichia coli, IS4351 from Bacteroides fragilis, IS1086 from Alcaligenes eutrophus, IS1161 from Streptococcus salivarius, ISAS2 from Aeromonas salmonicida and a putative protein encoded by ORF3 of virus SpV1-R8A2 B from Spiroplasma citri. At least fifteen IS1070-like sequences were detected in the genome of the parent Lc. lactis strain and five of these were situated on plasmids. Analysis of the direct repeats of two of these copies with that of IS1070 revealed differences in the target duplication lengths. PMID:7698675

  15. Defined bacterial culture development for methane generation from lactose. [Streptococcus lactis; Clostridium formicoaceticum; Methanococcus mazei

    SciTech Connect

    Yang, S.T.; Tang, I.C.; Okos, M.R.

    1988-06-20

    The defined microbial cultures for methane generation from lactose were investigated. A mixed culture consisting of homolactic (Streptococcus lactis), homoacetic (Clostridium formicoaceticum), and acetate-utilizing methanogenic (Methanococcus mazei) bacteria was used to convert lactose and whey permeate to methane at mesophilic temperatures (35-37/sup 0/C) and a pH around 7.0. Lactose was first converted to lactic acid by S. lactis, then to acetic acid by C. formicoaceticum, and finally to methane and CO/sub 2/ by M. mazei. About 5.3 mol methane were obtained from each mole of lactose consumed, and the conversion of acetate to methane was the rate-limiting step for this mixed-culture fermentation.

  16. Function of Nisin and Nisin-like Basic Proteins in the Growth Cycle of Streptococcus lactis

    Microsoft Academic Search

    A. Hurst

    1967-01-01

    BACTERIAL synthesis of polypeptide antibiotics occurs during the exponential phase or early stationary phase of growth1. The compounds synthesized vary in molecular weight from about 350 to 14,000 (ref. 2); nisin, produced by Streptococcus lactis, has a molecular weight estimated at 7,000 (ref. 3). This brings nisin into the class of small proteins rather than polypeptides because insulin, for example,

  17. Inducible Amplification of Gene Copy Number and Heterologous Protein Production in the Yeast Kluyveromyces lactis

    Microsoft Academic Search

    GIOVANNI B. MORLINO; LORENZA TIZZANI; REINHARD FLEER; LAURA FRONTALI; MICHELE M. BIANCHI

    1999-01-01

    Heterologous protein production can be doubled by increasing the copy number of the corresponding heterologous gene. We constructed a host-vector system in the yeast Kluyveromyces lactis that was able to induce copy number amplification of pKD1 plasmid-based vectors upon expression of an integrated copy of the plasmid recombinase gene. We increased the production and secretion of two heterologous proteins, glucoamy-

  18. Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis

    PubMed Central

    2013-01-01

    Background Glycolic acid is a C2 hydroxy acid that is a widely used chemical compound. It can be polymerised to produce biodegradable polymers with excellent gas barrier properties. Currently, glycolic acid is produced in a chemical process using fossil resources and toxic chemicals. Biotechnological production of glycolic acid using renewable resources is a desirable alternative. Results The yeasts Saccharomyces cerevisiae and Kluyveromyces lactis are suitable organisms for glycolic acid production since they are acid tolerant and can grow in the presence of up to 50 g l-1 glycolic acid. We engineered S. cerevisiae and K. lactis for glycolic acid production using the reactions of the glyoxylate cycle to produce glyoxylic acid and then reducing it to glycolic acid. The expression of a high affinity glyoxylate reductase alone already led to glycolic acid production. The production was further improved by deleting genes encoding malate synthase and the cytosolic form of isocitrate dehydrogenase. The engineered S. cerevisiae strain produced up to about 1 g l-1 of glycolic acid in a medium containing d-xylose and ethanol. Similar modifications in K. lactis resulted in a much higher glycolic acid titer. In a bioreactor cultivation with d-xylose and ethanol up to 15 g l-1 of glycolic acid was obtained. Conclusions This is the first demonstration of engineering yeast to produce glycolic acid. Prior to this work glycolic acid production through the glyoxylate cycle has only been reported in bacteria. The benefit of a yeast host is the possibility for glycolic acid production also at low pH, which was demonstrated in flask cultivations. Production of glycolic acid was first shown in S. cerevisiae. To test whether a Crabtree negative yeast would be better suited for glycolic acid production we engineered K. lactis in the same way and demonstrated it to be a better host for glycolic acid production. PMID:24053654

  19. Characterization of the Lactococcus lactis lactose genes and regulation of their expression

    Microsoft Academic Search

    Rooijen van R. J

    1993-01-01

    An important trait of the lactic acid bacterium Lactococcus lactis , that is used in industrial dairy fermentations, is the conversion of lactose into lactic acid. The enzymatic steps involved in the breakdown of lactose, that is transported into the cell via a phosphoenolpyruvate-dependent lactose phosphotransferase system (PEP-PTS lac<\\/SUP>), have been well established (Fig. 1). However, except for the molecular

  20. PpiA, a Surface PPIase of the Cyclophilin Family in Lactococcus lactis

    PubMed Central

    Trémillon, Nicolas; Morello, Eric; Llull, Daniel; Mazmouz, Rabia; Gratadoux, Jean-Jacques; Guillot, Alain; Chapot-Chartier, Marie-Pierre; Monlezun, Laura; Solé, Véronique; Ginisty, Hervé; Poquet, Isabelle

    2012-01-01

    Background Protein folding in the envelope is a crucial limiting step of protein export and secretion. In order to better understand this process in Lactococcus lactis, a lactic acid bacterium, genes encoding putative exported folding factors like Peptidyl Prolyl Isomerases (PPIases) were searched for in lactococcal genomes. Results In L. lactis, a new putative membrane PPIase of the cyclophilin subfamily, PpiA, was identified and characterized. ppiA gene was found to be constitutively expressed under normal and stress (heat shock, H2O2) conditions. Under normal conditions, PpiA protein was synthesized and released from intact cells by an exogenously added protease, showing that it was exposed at the cell surface. No obvious phenotype could be associated to a ppiA mutant strain under several laboratory conditions including stress conditions, except a very low sensitivity to H2O2. Induction of a ppiA copy provided in trans had no effect i) on the thermosensitivity of an mutant strain deficient for the lactococcal surface protease HtrA and ii) on the secretion and stability on four exported proteins (a highly degraded hybrid protein and three heterologous secreted proteins) in an otherwise wild-type strain background. However, a recombinant soluble form of PpiA that had been produced and secreted in L. lactis and purified from a culture supernatant displayed both PPIase and chaperone activities. Conclusions Although L. lactis PpiA, a protein produced and exposed at the cell surface under normal conditions, displayed a very moderate role in vivo, it was found, as a recombinant soluble form, to be endowed with folding activities in vitro. PMID:22442694

  1. Characterization of the Highly Autolytic Lactococcus lactis subsp. cremoris Strains CO and 2250

    PubMed Central

    Riepe, H. R.; Pillidge, C. J.; Gopal, P. K.; Mckay, L. L.

    1997-01-01

    Two highly autolytic Lactococcus lactis subsp. cremoris strains (CO and 2250) were selected and analyzed for their autolytic properties. Both strains showed maximum lysis when grown in M17 broth containing a limiting concentration of glucose (0.4 to 0.5%) as the carbohydrate source. Lysis did not vary greatly with pH or temperature but was reduced when strains were grown on lactose or galactose. Growth in M17 containing excess glucose (1%) prevented autolysis, although rapid lysis of L. lactis subsp. cremoris CO did occur in the presence of 1% glucose if sodium fluoride (an inhibitor of glycolysis) was added to the medium. Maximum cell lysis in a buffer system was observed early in the stationary phase, and for CO, two pH optima were observed for log-phase and stationary-phase cells (6.5 and 8.5, respectively). Autolysins were extracted from the cell wall fraction of each strain by using either 4% sodium dodecyl sulfate (SDS), 6 M guanidine hydrochloride, or 4 M lithium chloride, and their activities were analyzed by renaturing SDS-polyacrylamide gel electrophoresis on gels containing Micrococcus luteus or L. lactis subsp. cremoris CO cells as the substrate. More than one lytic band was observed on each substrate, with the major band having an apparent molecular mass of 48 kDa for CO. Each lytic band was present throughout growth and lysis. These results suggest that at least two different autolytic enzymes are present in the autolytic L. lactis subsp. cremoris strains. The presence of the lactococcal cell wall hydrolase gene, acmA (G. Buist, J. Kok, K. J. Leenhouts, M. Dabrowska, G. Venema, and A. J. Haandrikman, J. Bacteriol. 177:1554-1563, 1995), in strains 2250 and CO was confirmed by Southern hybridization. Analysis of an acmA deletion mutant of 2250 confirmed that the gene was involved in cell separation and had a role in cell lysis. PMID:16535702

  2. Production of a Particulate Hepatitis C Vaccine Candidate by an Engineered Lactococcus lactis Strain?

    PubMed Central

    Parlane, Natalie A.; Grage, Katrin; Lee, Jason W.; Buddle, Bryce M.; Denis, Michel; Rehm, Bernd H. A.

    2011-01-01

    Vaccine delivery systems based on display of antigens on bioengineered bacterial polyester inclusions can stimulate cellular immune responses. The food-grade Gram-positive bacterium Lactococcus lactis was engineered to produce spherical polyhydroxybutyrate (PHB) inclusions which abundantly displayed the hepatitis C virus core (HCc) antigen. In mice, the immune response induced by this antigen delivery system was compared to that induced by vaccination with HCc antigen displayed on PHB beads produced in Escherichia coli, to PHB beads without antigen produced in L. lactis or E. coli, or directly to the recombinant HCc protein. Vaccination site lesions were minimal in all mice vaccinated with HCc PHB beads or recombinant protein, all mixed in the oil-in-water adjuvant Emulsigen, while vaccination with the recombinant protein in complete Freund's adjuvant produced a marked inflammatory reaction at the vaccination site. Vaccination with the PHB beads produced in L. lactis and displaying HCc antigen produced antigen-specific cellular immune responses with significant release of gamma interferon (IFN-?) and interleukin-17A (IL-17A) from splenocyte cultures and no significant antigen-specific serum antibody, while the PHB beads displaying HCc but produced in E. coli released IFN-? and IL-17A as well as the proinflammatory cytokines tumor necrosis factor alpha (TNF-?) and IL-6 and low levels of IgG2c antibody. In contrast, recombinant HCc antigen in Emulsigen produced a diverse cytokine response and a strong IgG1 antibody response. Overall it was shown that L. lactis can be used to produce immunogenic PHB beads displaying viral antigens, making the beads suitable for vaccination against viral infections. PMID:21984246

  3. Cloning, Expression, and Functional Characterization of Secondary Amino Acid Transporters of Lactococcus lactis

    PubMed Central

    Trip, Hein; Mulder, Niels L.

    2013-01-01

    Fourteen genes encoding putative secondary amino acid transporters were identified in the genomes of Lactococcus lactis subsp. cremoris strains MG1363 and SK11 and L. lactis subsp. lactis strains IL1403 and KF147, 12 of which were common to all four strains. Amino acid uptake in L. lactis cells overexpressing the genes revealed transporters specific for histidine, lysine, arginine, agmatine, putrescine, aromatic amino acids, acidic amino acids, serine, and branched-chain amino acids. Substrate specificities were demonstrated by inhibition profiles determined in the presence of excesses of the other amino acids. Four knockout mutants, lacking the lysine transporter LysP, the histidine transporter HisP (formerly LysQ), the acidic amino acid transporter AcaP (YlcA), or the aromatic amino acid transporter FywP (YsjA), were constructed. The LysP, HisP, and FywP deletion mutants showed drastically decreased rates of uptake of the corresponding substrates at low concentrations. The same was observed for the AcaP mutant with aspartate but not with glutamate. In rich M17 medium, the deletion of none of the transporters affected growth. In contrast, the deletion of the HisP, AcaP, and FywP transporters did affect growth in a defined medium with free amino acids as the sole amino acid source. HisP was essential at low histidine concentrations, and AcaP was essential in the absence of glutamine. FywP appeared to play a role in retaining intracellularly synthesized aromatic amino acids when these were not added to the medium. Finally, HisP, AcaP, and FywP did not play a role in the excretion of accumulated histidine, glutamate, or phenylalanine, respectively, indicating the involvement of other transporters. PMID:23144255

  4. Production of kefir like product from mixed cultures of Saccharomyces cerevisiae, Streptococcus cremoris and Streptococcus lactis

    Microsoft Academic Search

    Pongpakorn Kaewprasert; Naiyatat Poosaran

    Various ratios of Streptococcus cremoris to Streptococcus lactis, 0.5 : 1.5, 1 : 1 and 1.5 : 0.5% were added to milk supplemented with 5% (w\\/v) sucrose. Fermentation temperature was kept constant at 30oC. For the first 15 h of fermentation, the milk was fermented by 5% (v\\/v) Saccharomyces cerevisiae, followed by lactic acid bacteria. The total fermentation time was

  5. Proteinase overproduction in Lactococcus lactis strains: regulation and effect on growth and acidification in milk.

    PubMed Central

    Bruinenberg, P G; Vos, P; De Vos, W M

    1992-01-01

    Multicopy plasmids that contained the complete of 3'-deleted forms of the proteinase (prtP) gene of Lactococcus lactis subsp. cremoris SK11 under the control of different promoters were constructed and introduced into Prt- lactococcal strains. The production and location of the SK11 proteinase was determined in different hosts grown in industrial and laboratory media. In spite of the 10-fold-higher copy number of the prt genes, no overproduction of proteinase was observed in strain SK1128, a Prt- derivative of L. lactis subsp. cremoris SK112. In contrast, an approximately threefold overproduction of the cell envelope-located or fully secreted proteinase was found in strain MG1820 compared with that of its parental strain L. lactis subsp. lactis SH4109. In all strains proteinase production appeared to be regulated by the medium composition. Highest proteinase production of the SK11 derivatives was found in milk, in contrast to derivatives of SH4109 that produced most proteinase in whey permeate medium. Analysis of single strains with different levels of proteinase production or mixed cultures containing various ratios of Prt+ and Prt- cells indicated that the amount of proteinase produced per cell or culture determines the specific growth rate in milk. Overproduction of cell envelope-located or secreted proteinase in strain MG1820 resulted in a 20%-higher specific growth and acidification rate in milk compared with that in the wild-type strain SH4109. These results indicate that the growth of lactococci in milk is limited by the caseinolytic activity of the proteinase. Images PMID:1539995

  6. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin.

    PubMed Central

    de Ruyter, P G; Kuipers, O P; de Vos, W M

    1996-01-01

    The kinetics, control, and efficiency of nisin-induced expression directed by the nisA promoter region were studied in Lactococcus lactis with transcriptional and translational fusions to the gusA reporter genes. In the nisin-producing L. lactis strain NZ9700, the specific beta-glucuronidase activity increased very rapidly after mid-exponential growth until the maximum level at the start of the stationary phase was reached. Expression of the gusA gene was also studied in L. lactis NZ9800, an NZ9700 derivative carrying a deletion in the structural nisA gene that abolishes nisin production, and in L. lactis NZ3900, an MG1363 derivative containing the regulatory nisRK genes integrated in the chromosome. In both strains, beta-glucuronidase activity was linearly dependent on the amount of nisin added to the medium. Without nisin, no beta-glucuronidase production was observed. To optimize translation initiation, an expression vector was constructed by fusing the gusA gene translationally to the start codon of the nisA gene. Use of the translational fusion vector yielded up to six times more beta-glucuronidase activity than the transcriptional fusion vector in these strains after induction by nisin. In this way, gene expression can be achieved in a dynamic range of more than 1,000-fold. The beta-glucuronidase activity was found to be up to 25-fold higher in extracts of strain NZ3900 than in extracts of strain NZ9800. This translational fusion vector was used for high-level production of aminopeptidase N, up to 47% of the total intracellular protein. These results clearly illustrate the potential of the nisin-inducible expression system for overproduction of desired proteins. PMID:8837421

  7. Engineered Lactic Acid Bacterium Lactococcus lactis Capable of Binding Antibodies and Tumor Necrosis Factor Alpha? †

    PubMed Central

    Ravnikar, Matjaž; Štrukelj, Borut; Obermajer, Nataša; Lunder, Mojca; Berlec, Aleš

    2010-01-01

    We have optimized the display of the B domain of staphylococcal protein A on the surface of Lactococcus lactis. The maximum binding capacity was estimated at 0.146 ?g of antibody per 108 cells and was sustained at 86% after treatment with simulated gastric juice. A tumor necrosis factor alpha (TNF-?)-binding affibody was also displayed and bound TNF-?, which could be useful in the treatment of inflammatory bowel disease. PMID:20802083

  8. Signal peptide and propeptide optimization for heterologous protein secretion in Lactococcus lactis.

    PubMed

    Le Loir, Y; Nouaille, S; Commissaire, J; Brétigny, L; Gruss, A; Langella, P

    2001-09-01

    Lactic acid bacteria are food-grade microorganisms that are potentially good candidates for production of heterologous proteins of therapeutical or technological interest. We developed a model for heterologous protein secretion in Lactococcus lactis using the staphylococcal nuclease (Nuc). The effects on protein secretion of alterations in either (i) signal peptide or (ii) propeptide sequences were examined. (i) Replacement of the native Nuc signal peptide (SP(Nuc)) by that of L. lactis protein Usp45 (SP(Usp)) resulted in greatly improved secretion efficiency (SE). Pulse-chase experiments showed that Nuc secretion kinetics was better when directed by SP(Usp) than when directed by SP(Nuc). This SP(Usp) effect on Nuc secretion is not due to a better antifolding activity, since SP(Usp):Nuc precursor proteins display enzymatic activity in vitro, while SP(Nuc):Nuc precursor proteins do not. (ii) Deletion of the native Nuc propeptide dramatically reduces Nuc SE, regardless of which SP is used. We previously reported that a synthetic propeptide, LEISSTCDA, could efficiently replace the native Nuc propeptide to promote heterologous protein secretion in L. lactis (Y. Le Loir, A. Gruss, S. D. Ehrlich, and P. Langella, J. Bacteriol. 180:1895-1903, 1998). To determine whether the LEISSTCDA effect is due to its acidic residues, specific substitutions were introduced, resulting in neutral or basic propeptides. Effects of these two new propeptides and of a different acidic synthetic propeptide were tested. Acidic and neutral propeptides were equally effective in enhancing Nuc SE and also increased Nuc yields. In contrast, the basic propeptide strongly reduced both SE and the quantity of secreted Nuc. We have shown that the combination of the native SP(Usp) and a neutral or acidic synthetic propeptide leads to a significant improvement in SE and in the quantity of synthesized Nuc. These observations will be valuable in the production of heterologous proteins in L. lactis. PMID:11526014

  9. Glyceraldehyde3Phosphate Dehydrogenase Has No Control over Glycolytic Flux in Lactococcus lactis MG1363

    Microsoft Academic Search

    Christian Solem; Brian J. Koebmann; Peter R. Jensen

    2003-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has previously been suggested to have almost abso- lute control over the glycolytic flux in Lactococcus lactis (B. Poolman, B. Bosman, J. Kiers, and W. N. Konings, J. Bacteriol. 169:5887-5890, 1987). Those studies were based on inhibitor titrations with iodoacetate, which specifically inhibits GAPDH, and the data suggested that it should be possible to increase the glycolytic

  10. Genetic and biochemical characterization of the oligopeptide transport system of Lactococcus lactis.

    PubMed Central

    Tynkkynen, S; Buist, G; Kunji, E; Kok, J; Poolman, B; Venema, G; Haandrikman, A

    1993-01-01

    The nucleotide sequence of a chromosomal DNA fragment of Lactococcus lactis subsp. lactis SSL135, previously implicated in peptide utilization, has been determined. The genes oppDFBCA, encoding the oligopeptide transport system (Opp), and that encoding the endopeptidase PepO were located on this 8.9-kb DNA fragment. The oppDFBCA and pepO genes are probably organized in an operon. Analysis of the deduced amino acid sequences of the genes indicated that the oligopeptide transport system consists of two ATP-binding proteins OppD and OppF, two integral membrane proteins OppB and OppC, and a substrate-binding protein OppA. On the basis of the homology of OppF and OppD of L. lactis with other ABC (ATP-binding cassette) transporter proteins, the L. lactis Opp system can be classified as a member of this group. Two integration mutants, one defective in OppA and the other defective in PepO, were constructed. Growth of these mutants in a chemically defined medium with oligopeptides showed that the transport system, but not the endopeptidase, is essential for the utilization of peptides longer than three residues. Uptake of the pentapeptide Leu-enkephalin in glycolyzing lactococcal cells was followed by rapid hydrolysis of the peptide intracellularly. Importantly, extracellular hydrolysis of Leu-enkephalin is not observed. The OppA-deficient mutant was unable to transport Leu-enkephalin. Growth experiments with pasteurized milk revealed that transport of oligopeptides forms an essential part of the proteolytic system in lactococci. Images PMID:8244921

  11. Acetate Utilization in Lactococcus lactis Deficient in Lactate Dehydrogenase: a Rescue Pathway for Maintaining Redox Balance

    PubMed Central

    Hols, Pascal; Ramos, Ana; Hugenholtz, Jeroen; Delcour, Jean; de Vos, Willem M.; Santos, Helena; Kleerebezem, Michiel

    1999-01-01

    Acetate was shown to improve glucose fermentation in Lactococcus lactis deficient in lactate dehydrogenase. 13C and 1H nuclear magnetic resonance studies using [2-13C]glucose and [2-13C]acetate as substrates demonstrated that acetate was exclusively converted to ethanol. This novel pathway provides an alternative route for NAD+ regeneration in the absence of lactate dehydrogenase. PMID:10464231

  12. Mutagenesis of Klebsiella aerogenes UreG to Probe Nickel Binding and Interactions with Other Urease-Related Proteins†

    PubMed Central

    Boer, Jodi L.; Quiroz-Valenzuela, Soledad; Anderson, Kimberly L.; Hausinger, Robert P.

    2010-01-01

    UreG is a GTPase required for assembly of the nickel-containing active site of urease. Herein, a Strep-tagged Klebsiella aerogenes UreG (UreGStr) and selected site-directed variants of UreGStr were constructed for studying the in vivo effects on urease activation in recombinant Escherichia coli cells, characterizing properties of the purified proteins, and analysis of in vivo and in vitro protein-protein interactions. Whereas the Strep-tag had no effect on UreG’s ability to activate urease, enzyme activity was essentially abolished in the K20A, D49A, C72A, H74A, D80A, and S111A UreGStr variants, with diminished activity also noted with E25A, C28A, and S115A proteins. Lys20 and Asp49 are likely to function in binding/hydrolysis of GTP and binding of Mg, respectively. UreGStr binds one nickel or zinc ion per monomer (Kd = ~5 ?M for each metal ion) at a binding site that includes Cys72, as shown by a 12-fold increased Kd for nickel ions using C72A UreGStr and by a thiolate-to-nickel charge-transfer band that is absent in the mutant protein. Based on UreG homology to HypB, a GTPase needed for hydrogenase assembly, along with the mutation results, His74 is likely to be an additional metal ligand. In vivo pull-down assays revealed Asp80 as critical for stabilizing UreGStr interaction with the UreABC-UreDF complex. In vitro pull-down assays demonstrated UreG binding to UreE, with the interaction enhanced by nickel or zinc ions. The metallochaperone UreE is suggested to transfer its bound nickel to UreG in the UreABC-UreDFG complex, with the metal ion subsequently transferring to UreD, and then into the nascent active site of urease in a GTP-dependent process. PMID:20533838

  13. Improved Production of Heterologous Proteins by a Glucose Repression-Defective Mutant of Kluyveromyces lactis

    PubMed Central

    Donnini, Claudia; Farina, Francesca; Neglia, Barbara; Compagno, Maria Concetta; Uccelletti, Daniela; Goffrini, Paola; Palleschi, Claudio

    2004-01-01

    The secreted production of heterologous proteins in Kluyveromyces lactis was studied. A glucoamylase (GAA) from the yeast Arxula adeninivorans was used as a reporter protein for the study of the secretion efficiencies of several wild-type and mutant strains of K. lactis. The expression of the reporter protein was placed under the control of the strong promoter of the glyceraldehyde-3-phosphate dehydrogenase of Saccharomyces cerevisiae. Among the laboratory strains tested, strain JA6 was the best producer of GAA. Since this strain is known to be highly sensitive to glucose repression and since this is an undesired trait for biomass-oriented applications, we examined heterologous protein production by using glucose repression-defective mutants isolated from this strain. One of them, a mutant carrying a dgr151-1 mutation, showed a significantly improved capability of producing heterologous proteins such as GAA, human serum albumin, and human interleukin-1? compared to the parent strain. dgr151-1 is an allele of RAG5, the gene encoding the only hexokinase present in K. lactis (a homologue of S. cerevisiae HXK2). The mutation in this strain was mapped to nucleotide position +527, resulting in a change from glycine to aspartic acid within the highly conserved kinase domain. Cells carrying the dgr151-1 allele also showed a reduction in N- and O-glycosylation. Therefore, the dgr151 strain may be a promising host for the production of heterologous proteins, especially when the hyperglycosylation of recombinant proteins must be avoided. PMID:15128512

  14. Regulation of Acetate Kinase Isozymes and Its Importance for Mixed-Acid Fermentation in Lactococcus lactis

    PubMed Central

    Puri, Pranav; Goel, Anisha; Bochynska, Agnieszka

    2014-01-01

    Acetate kinase (ACK) converts acetyl phosphate to acetate along with the generation of ATP in the pathway for mixed-acid fermentation in Lactococcus lactis. The reverse reaction yields acetyl phosphate for assimilation purposes. Remarkably, L. lactis has two ACK isozymes, and the corresponding genes are present in an operon. We purified both enzymes (AckA1 and AckA2) from L. lactis MG1363 and determined their oligomeric state, specific activities, and allosteric regulation. Both proteins form homodimeric complexes, as shown by size exclusion chromatography and static light-scattering measurements. The turnover number of AckA1 is about an order of magnitude higher than that of AckA2 for the reaction in either direction. The Km values for acetyl phosphate, ATP, and ADP are similar for both enzymes. However, AckA2 has a higher affinity for acetate than does AckA1, suggesting an important role under acetate-limiting conditions despite the lower activity. Fructose-1,6-bisphosphate, glyceraldehyde-3-phosphate, and phospho-enol-pyruvate inhibit the activities of AckA1 and AckA2 to different extents. The allosteric regulation of AckA1 and AckA2 and the pool sizes of the glycolytic intermediates are consistent with a switch from homolactic to mixed-acid fermentation upon slowing of the growth rate. PMID:24464460

  15. Microencapsulation of Bifidobacterium animalis subsp. lactis and Lactobacillus acidophilus in cocoa butter using spray chilling technology.

    PubMed

    Pedroso, D L; Dogenski, M; Thomazini, M; Heinemann, R J B; Favaro-Trindade, C S

    2013-01-01

    In the present study, the cells of Bifidobacterium animalis subsp. lactis (BI-01) and Lactobacillus acidophilus (LAC-04) were encapsulated in cocoa butter using spray-chilling technology. Survival assays were conducted to evaluate the resistance of the probiotics to the spray-chilling process, their resistance to the simulated gastric and intestinal fluids (SGF and SIF), and their stability during 90 days of storage. The viability of the cells was not affected by microencapsulation. The free and encapsulated cells of B. animalis subsp. lactis were resistant to both SGF and SIF. The micro-encapsulated cells of L. acidophilus were more resistant to SGF and SIF than the free cells; the viability of the encapsulated cells was enhanced by 67%, while the free cells reached the detection limit of the method (10(3) CFU/g). The encapsulated probiotics were unstable when they were stored at 20 °C. The population of encapsulated L. acidophilus decreased drastically when they were stored at 7 °C; only 20% of cells were viable after 90 days of storage. The percentage of viable cells of the encapsulated B. animalis subsp.lactis, however, was 72% after the same period of storage. Promising results were obtained when the microparticles were stored at -18 °C; the freeze granted 90 days of shelf life to the encapsulated cells. These results suggest that the spray-chilling process using cocoa butter as carrier protects L. acidophilus from gastrointestinal fluids. However, the viability of the cells during storage must be improved. PMID:24516445

  16. Use of Lactococcus lactis to enrich sourdough bread with ?-aminobutyric acid.

    PubMed

    Bhanwar, Seema; Bamnia, Meenakshi; Ghosh, Moushumi; Ganguli, Abhijit

    2013-02-01

    Fried sourdough bread (bhatura) with an elevated amount of ?-aminobutyric acid (GABA) was produced using lactic acid bacteria (LAB). The LAB starter was screened and isolated from pickled yam showing highest GABA content and was identified as Lactococcus lactis subsp. lactis. The maximum GABA production in de Man Rogosa Sharpe (MRS) media supplemented with monosodium glutamate (MSG) was 110 mg/100 ml at pH 5, and 1-3% NaCl did not change the production of GABA significantly (p>0.05). When MSG was replaced with Vigna mungo in sourdough, the amount of GABA for bhatura was 226.22 mg/100 g representing about 10-fold increase. A sensory evaluation resulted as the overall general acceptability of bhatura to be 4.91 ± 0.03 on a five-point hedonic scale. Thus, the results indicated the potential of L. lactis as a LAB starter for the production of GABA-enriched bhatura. Although other physiological effects can be expected in the product, animal and clinical studies are mandatory prior to application of this food. PMID:22765269

  17. From field to fermentation: the origins of Lactococcus lactis and its domestication to the dairy environment.

    PubMed

    Cavanagh, Daniel; Fitzgerald, Gerald F; McAuliffe, Olivia

    2015-05-01

    Lactococcus lactis is an organism of substantial economic importance, used extensively in the production of fermented foods and widely held to have evolved from plant strains. The domestication of this organism to the milk environment is associated with genome reduction and gene decay, and the acquisition of specific genes involved in protein and lactose utilisation by horizontal gene transfer. In recent years, numerous studies have focused on uncovering the physiology and molecular biology of lactococcal strains from the wider environment for exploitation in the dairy industry. This in turn has facilitated comparative genome analysis of lactococci from different environments and provided insight into the natural phenotypic and genetic diversity of L. lactis. This diversity may be exploited in dairy fermentations to develop products with improved quality and sensory attributes. In this review, we discuss the classification of L. lactis and the problems that arise with phenotype/genotype designation. We also discuss the adaptation of non-dairy lactococci to milk, the traits associated with this adaptation and the potential application of non-dairy lactococci to dairy fermentations. PMID:25583337

  18. Genome-Wide Transcriptional Responses to Carbon Starvation in Nongrowing Lactococcus lactis.

    PubMed

    Ercan, Onur; Wels, Michiel; Smid, Eddy J; Kleerebezem, Michiel

    2015-04-01

    This paper describes the transcriptional adaptations of nongrowing, retentostat cultures of Lactococcus lactis to starvation. Near-zero-growth cultures (? = 0.0001 h(-1)) obtained by extended retentostat cultivation were exposed to starvation by termination of the medium supply for 24 h, followed by a recovery period of another 24 h by reinitiating the medium supply to the retentostat culture. During starvation, the viability of the culture was largely retained, and the expression of genes involved in transcription and translational machineries, cell division, and cell membrane energy metabolism was strongly repressed. Expression of these genes was largely recovered following the reinitiation of the medium supply. Starvation triggered the elevated expression of genes associated with synthesis of branched-chain amino acids, histidine, purine, and riboflavin. The expression of these biosynthesis genes was found to remain at an elevated level after reinitiation of the medium supply. In addition, starvation induced the complete gene set predicted to be involved in natural competence in L. lactis KF147, and the elevated expression of these genes was sustained during the subsequent recovery period, but our attempts to experimentally demonstrate natural transformation in these cells failed. Mining the starvation response gene set identified a conserved cis-acting element that resembles the lactococcal CodY motif in the upstream regions of genes associated with transcription and translational machineries, purine biosynthesis, and natural transformation in L. lactis, suggesting a role for CodY in the observed transcriptome adaptations to starvation in nongrowing cells. PMID:25636846

  19. Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system.

    PubMed

    Miro?czuk, Aleksandra M; Krasowska, Anna; Murzyn, Anna; P?achetka, Ma?gorzata; Lukaszewicz, Marcin

    2012-01-01

    In this work the subC gene from Bacillus licheniformis encoding subtilisin was cloned into the nisin-controlled expression (NICE) vectors (pNZ8048 and pNZ8148) with or without the signal peptide SP Usp45 directing extracellular secretion via Sec machinery. Extracellular protease production and activity was tested using Lactococcus lactis NZ9000 as host, which could be used for rennet production. The efficiency of protein production was tested using purified nisin and the supernatant of L. lactis NZ970 nisin producer. Similar results were obtained for 1 ng/ml nisin and 10 000 diluted supernatant. SP Usp45 signal peptide effectively directed extracellular localization of active and stable protease. SubC signal for extracellular localization in B. licheniformis, was also recognized by L. lactis Sec pathway, although with lower efficiency, as shown by a 3-fold lower protease activity in the medium. Protease production and activity was optimized using parameters such as induction time, nutrients (glucose, casitone) supplementation during growth or protease stabilization by calcium ions. The results were also verified in fed-batch bioreactor for further scale-up of the expression system. PMID:23961373

  20. Oxidative Stress at High Temperatures in Lactococcus lactis Due to an Insufficient Supply of Riboflavin

    PubMed Central

    Chen, Jun; Shen, Jing

    2013-01-01

    Lactococcus lactis MG1363 was found to be unable to grow at temperatures above 37°C in a defined medium without riboflavin, and the cause was identified to be dissolved oxygen introduced during preparation of the medium. At 30°C, growth was unaffected by dissolved oxygen and oxygen was consumed quickly. Raising the temperature to 37°C resulted in severe growth inhibition and only slow removal of dissolved oxygen. Under these conditions, an abnormally low intracellular ratio of [ATP] to [ADP] (1.4) was found (normally around 5), which indicates that the cells are energy limited. By adding riboflavin to the medium, it was possible to improve growth and oxygen consumption at 37°C, and this also normalized the [ATP]-to-[ADP] ratio. A codon-optimized redox-sensitive green fluorescent protein (GFP) was introduced into L. lactis and revealed a more oxidized cytoplasm at 37°C than at 30°C. These results indicate that L. lactis suffers from heat-induced oxidative stress at increased temperatures. A decrease in intracellular flavin adenine dinucleotide (FAD), which is derived from riboflavin, was observed with increasing growth temperature, but the presence of riboflavin made the decrease smaller. The drop was accompanied by a decrease in NADH oxidase and pyruvate dehydrogenase activities, both of which depend on FAD as a cofactor. By overexpressing the riboflavin transporter, it was possible to improve FAD biosynthesis, which resulted in increased NADH oxidase and pyruvate dehydrogenase activities and improved fitness at high temperatures in the presence of oxygen. PMID:23913422

  1. A bacteriocin gene cluster able to enhance plasmid maintenance in Lactococcus lactis

    PubMed Central

    2014-01-01

    Background Lactococcus lactis is widely used as a dairy starter and has been extensively studied. Based on the acquired knowledge on its physiology and metabolism, new applications have been envisaged and there is an increasing interest of using L. lactis as a cell factory. Plasmids constitute the main toolbox for L. lactis genetic engineering and most rely on antibiotic resistant markers for plasmid selection and maintenance. In this work, we have assessed the ability of the bacteriocin Lactococcin 972 (Lcn972) gene cluster to behave as a food-grade post-segregational killing system to stabilize recombinant plasmids in L. lactis in the absence of antibiotics. Lcn972 is a non-lantibiotic bacteriocin encoded by the 11-kbp plasmid pBL1 with a potent antimicrobial activity against Lactococcus. Results Attempts to clone the full lcn972 operon with its own promoter (P972), the structural gene lcn972 and the immunity genes orf2-orf3 in the unstable plasmid pIL252 failed and only plasmids with a mutated promoter were recovered. Alternatively, cloning under other constitutive promoters was approached and achieved, but bacteriocin production levels were lower than those provided by pBL1. Segregational stability studies revealed that the recombinant plasmids that yielded high bacteriocin titers were maintained for at least 200 generations without antibiotic selection. In the case of expression vectors such as pTRL1, the Lcn972 gene cluster also contributed to plasmid maintenance without compromising the production of the fluorescent mCherry protein. Furthermore, unstable Lcn972 recombinant plasmids became integrated into the chromosome through the activity of insertion sequences, supporting the notion that Lcn972 does apply a strong selective pressure against susceptible cells. Despite of it, the Lcn972 gene cluster was not enough to avoid the use of antibiotics to select plasmid-bearing cells right after transformation. Conclusions Inserting the Lcn972 cluster into segregational unstable plasmids prevents their lost by segregation and probable could be applied as an alternative to the use of antibiotics to support safer and more sustainable biotechnological applications of genetically engineered L. lactis. PMID:24886591

  2. Recombinant porcine epidermal growth factor-secreting Lactococcus lactis promotes the growth performance of early-weaned piglets

    PubMed Central

    2014-01-01

    Background Epidermal growth factor (EGF) is an important growth factor in regulation of cell proliferation, differentiation, survival and apoptosis. Studies showed that food-grade Lactococcus lactis (L. lactis) and NICE expression system have superior performance in exogenous protein expression. This study aimed to construct and express porcine EGF (pEGF), and use L. lactis as vehicle for producing and delivering pEGF. Furthermore, investigating biological activity of pEGF and exploring applications feasibility of combination effects of L. lactis and pEGF on early weaned piglets’ production. Results A recombinant Lactococcus lactis which produced and secreted pEGF at 1000 ng/ml in culture supernatant was generated. Secreted pEGF was a fully biologically active protein, as demonstrated by its capacity to stimulate L929 mouse fibroblast cell line proliferation in vitro. For in vivo study, forty piglets were randomly allocated to control, antibiotic control, empty vector-expressing L. lactis (LL-EV) and pEGF-secreting L. lactis (LL-pEGF). After 14 d of rearing, final body weight and average daily gain in LL-pEGF were greater (P < 0.05, 8.95 vs. 8.37 kg, 206.1 vs. 157.7 g/day, respectively) than those in control, but no significant differences between LL-pEGF, LL-EV and antibiotic control. Overall period average daily feed intake was higher in LL-pEGF, LL-EV and antibiotic control than in control (P < 0.05, 252.9, 255.6, 250.0, 207.3 g/day, respectively). No significant difference was observed on ADFI/ADG. LL-pEGF increased villous height in the duodenum, jejunum and ileum than in control and LL-EV (P < 0.05). Sucrase in the 3 intestinal segments, aminopeptidase A in the duodenum and Jejunum, aminopeptidase N and dipeptidase IV in the duodenum in LL-pEGF were higher than those in control (P < 0.05). Furthermore, Escherichia coli and Enterococcus counts decreased in the ileum and Lactobacillus increased in the ileum and cecum digesta in LL-pEGF compare with the control (P < 0.05). Lactobacillus increased in the cecum in LL-EV compared with control and antibiotic control (P < 0.05). Conclusion We have generated a recombinant Lactococcus lactis which produced and secreted fully biologically active porcine EGF. Oral administration of pEGF-secreting L. lactis had beneficial effects on intestinal health and performance of early-weaned piglets. PMID:25142032

  3. Protective Vaccination against Infectious Bursal Disease Virus with Whole Recombinant Kluyveromyces lactis Yeast Expressing the Viral VP2 Subunit

    PubMed Central

    Arnold, Marina; Durairaj, Vijay; Mundt, Egbert; Schulze, Katja; Breunig, Karin D.; Behrens, Sven-Erik

    2012-01-01

    Here we report on vaccination approaches against infectious bursal disease (IBD) of poultry that were performed with complete yeast of the species Kluyveromyces lactis (K. lactis). Employing a genetic system that enables the rapid production of stably transfected recombinant K. lactis, we generated yeast strains that expressed defined quantities of the virus capsid forming protein VP2 of infectious bursal disease virus (IBDV). Both, subcutaneous as well as oral vaccination regiments with the heat-inactivated but otherwise untreated yeast induced IBDV-neutralizing antibodies in mice and chickens. A full protection against a subsequent IBDV infection was achieved by subcutaneous inoculation of only milligram amounts of yeast per chicken. Oral vaccination also generated protection: while mortality was observed in control animals after virus challenge, none of the vaccinees died and ca. one-tenth were protected as indicated by the absence of lesions in the bursa of Fabricius. Recombinant K. lactis was thus indicated as a potent tool for the induction of a protective immune response by different applications. Subcutaneously applied K. lactis that expresses the IBDV VP2 was shown to function as an efficacious anti-IBD subunit vaccine. PMID:23024743

  4. Intranasal Immunization with Recombinant Lactococcus lactis Secreting Murine Interleukin-12 Enhances Antigen-Specific Th1 Cytokine Production

    PubMed Central

    Bermúdez-Humarán, Luis G.; Langella, Philippe; Cortes-Perez, Naima G.; Gruss, Alexandra; Tamez-Guerra, Reyes S.; Oliveira, Sergio C.; Cardenas, Odila Saucedo-; Montes de Oca-Luna, Roberto; Le Loir, Yves

    2003-01-01

    Interleukin-12 (IL-12), a heterodimeric cytokine, plays an important role in cellular immunity to several bacterial, viral, and parasitic infections and has adjuvant activity when it is codelivered with DNA vaccines. IL-12 has also been used with success in cancer immunotherapy treatments. However, systemic IL-12 therapy has been limited by high levels of toxicity. We describe here inducible expression and secretion of IL-12 in the food-grade lactic acid bacterium Lactococcus lactis. IL-12 was expressed as two separate polypeptides (p35-p40) or as a single recombinant polypeptide (scIL-12). The biological activity of IL-12 produced by the recombinant L. lactis strain was confirmed in vitro by its ability to induce gamma interferon (IFN-?) production by mouse splenocytes. Local administration of IL-12-producing strains at the intranasal mucosal surface resulted in IFN-? production in mice. The activity was greater with the single polypeptide scIL-12. An antigen-specific cellular response (i.e., secretion of Th1 cytokines, IL-2, and IFN-?) elicited by a recombinant L. lactis strain displaying a cell wall-anchored human papillomavirus type 16 E7 antigen was dramatically increased by coadministration with an L. lactis strain secreting IL-12 protein. Our data show that IL-12 is produced and secreted in an active form by L. lactis and that the strategy which we describe can be used to enhance an antigen-specific immune response and to stimulate local mucosal immunity. PMID:12654805

  5. Immobilization of nisin producer Lactococcus lactis strains to chitin with surface-displayed chitin-binding domain.

    PubMed

    Sim?ek, Ömer; Sabano?lu, Seba; Çon, Ahmet Hilmi; Karasu, Nihat; Akçelik, Mustafa; Saris, Per E J

    2013-05-01

    In this study, nisin producer Lactococcus lactis strains displaying cell surface chitin-binding domain (ChBD) and capable of immobilizing to chitin flakes were constructed. To obtain ChBD-based cell immobilization, Usp45 signal sequence with ChBD of chitinase A1 enzyme from Bacillus circulans was fused with different lengths of PrtP (153, 344, and 800 aa) or AcmA (242 aa) anchors derived from L. lactis. According to the whole cell ELISA analysis, ChBD was successfully expressed on the surface of L. lactis cells. Scanning electron microscope observations supported the conclusion of the binding analysis that L. lactis cells expressing the ChBD with long PrtP anchor (800 aa) did bind to chitin surfaces more efficiently than cells with the other ChBD anchors. The attained binding affinity of nisin producers for chitin flakes retained them in the fermentation during medium changes and enabled storage for sequential productions. Initial nisin production was stably maintained with many cycles. These results demonstrate that an efficient immobilization of L. lactis cells to chitin is possible for industrial scale repeated cycle or continuous nisin fermentation. PMID:23354445

  6. High-level resistance to oxidative stress in Lactococcus lactis conferred by Bacillus subtilis catalase KatE.

    PubMed

    Rochat, T; Miyoshi, A; Gratadoux, J J; Duwat, P; Sourice, S; Azevedo, V; Langella, P

    2005-09-01

    Lactococcus lactis, a lactic acid bacterium widely used for food fermentations, is often exposed to damaging stress conditions. In particular, oxidative stress leads to DNA, protein and membrane damages that can be lethal. As L. lactis has no catalase, the impact of production of the Bacillus subtilis haem catalase KatE on its oxidative stress resistance was tested. This cytoplasmic catalase was engineered for extracellular expression in L. lactis with an optimization strategy based on fusion to the nisin-inducible promoter and a lactococcal signal peptide (SP(Usp45)). The production of KatE by L. lactis conferred an 800-fold increase in survival after 1 h exposure to 4 mM hydrogen peroxide, and a 160-fold greater survival in long-term (3 days) survival of aerated cultures in a cydA mutant, which is unable to respire. The presence of KatE protected DNA from oxidative damage and limited its degradation after long-term aeration in a cydA/recA mutant, defective in DNA repair. L. lactis is thus able to produce active catalase that can provide efficient antioxidant activity. PMID:16151211

  7. Internalin-expressing Lactococcus lactis is able to invade small intestine of guinea pigs and deliver DNA into mammalian epithelial cells

    Microsoft Academic Search

    Valeria Dellaretti Guimarães; Jane Eyre Gabriel; François Lefèvre; Didier Cabanes; Alexandra Gruss; Pascale Cossart; Vasco Azevedo; Philippe Langella

    2005-01-01

    The use of the food-grade bacterium Lactococcus lactis as antigen delivery vehicle at the mucosal level is an attractive vaccination strategy intensively explored during the last decade. In this study, we developed L. lactis strains which could be used as a DNA delivery vector to combine both advantages of mucosal delivery and of DNA vaccination. To render lactococci capable of

  8. Genome-scale genotype-phenotype matching of two Lactococcus lactis isolates from plants identifies mechanisms of adaptation to the plant niche

    Microsoft Academic Search

    Roland J. Siezen; Marjo J. C. Starrenburg; Jos Boekhorst; Bernadet Renckens; Douwe Molenaar

    2008-01-01

    Lactococcus lactis is a primary constituent of many starter cultures used for the manufacturing of fermented dairy products, but the species also occurs in various nondairy niches such as (fermented) plant material. Three genome sequences of L. lactis dairy strains (IL-1403, SK11, and MG1363) are publicly available. An extensive molecular and phenotypic diversity analysis was now performed on two L.

  9. Study of the influence of yeast inoculum concentration (Yarrowia lipolytica and Kluyveromyces lactis) on blue cheese aroma development using microbiological models.

    PubMed

    Price, Elliott J; Linforth, Robert S T; Dodd, Christine E R; Phillips, Carol A; Hewson, Louise; Hort, Joanne; Gkatzionis, Konstantinos

    2014-02-15

    Yarrowia lipolytica and Kluyveromyces lactis occur as part of Stilton cheese microflora yet are not controlled during production. This study investigated the influence of their inoculum concentration on aroma production. Models of Y. lipolytica and K. lactis, with Penicillium roqueforti, were analysed using instrumental and sensory analysis. Different concentrations of Y. lipolytica produced important changes in the aroma profiles of microbiological models, analysed by solid-phase microextraction (SPME GC-MS). Sensory analysis with discrimination tests showed differences were detectable via human perception but did not concern the similarity to blue cheese odour. Increasing the inoculum concentration of K. lactis resulted in decreased variation between replicates. Partial least squares (PLS) regression on Flash profile data showed models inoculated with low concentrations of K. lactis exhibited blue cheese-related attributes, associated with increased ketone production. Results suggest that controlling the amount of Y. lipolytica and K. lactis during production offers potential to manipulate blue cheese aroma development. PMID:24128502

  10. Characterization of KPC-2-producing Escherichia coli, Citrobacter freundii, Enterobacter cloacae, Enterobacter aerogenes, and Klebsiella oxytoca isolates from a Chinese Hospital.

    PubMed

    Luo, Yanping; Yang, Jiyong; Ye, Liyan; Guo, Lin; Zhao, Qiang; Chen, Rong; Chen, Yong; Han, Xuelin; Zhao, Jingya; Tian, Shuguang; Han, Li

    2014-08-01

    Twelve nonduplicated KPC-2-producing enterobacterial isolates, including three Escherichia coli, two Citrobacter freundii, two Enterobacter cloacae, four Enterobacter aerogenes, and one Klebsiella oxytoca, were collected from various clinical samples within 18 months (March 2011 to September 2012). Two of the 12 patients died from infections caused by KPC-2-producing pathogens, while the rest of the patients with KPC-2-producing pathogens improved or were cured. The majority of the clinical isolates exhibited a high-level of resistance to oxyimino-cephalosporins and carbapenems, and possessed self-transferable bla(KPC-2)-carrying plasmids with sizes ranging from 20 to 120?kb. Most isolates carried bla(CTX-M) and plasmid-mediated quinolone resistance genes, while some isolates produced 16S rRNA methylases (ArmA or RmtB). The genetic environment of bla(KPC-2) of most clinical strains was consistent with the genetic structure surrounding bla(KPC-2) on the plasmid pKP048, which contains an integration structure of a Tn3-based transposon and partial Tn4401 segment. Inserted fragments (truncated bla(TEM)) were detected upstream of the bla(KPC-2) gene for two E. aerogenes strains. In conclusion, the enterobacterial isolates exhibited sporadic emergence and did not arise by clonal spread at our hospital. The outcome of infections caused by KPC-producing enterobacterial isolates and their mortality were closely associated with the baseline condition of patients. The spread of bla(KPC-2) gene between different enterobacterial species in China was mainly mediated by horizontal transfer of the Tn3-based transposons and not the bla(KPC-2)-carrying plasmids. PMID:24433026

  11. Genetically Engineered Lactococcus lactis Protect against House Dust Mite Allergy in a BALB/c Mouse Model

    PubMed Central

    Ai, Chunqing; Zhang, Qiuxiang; Ren, Chengcheng; Wang, Gang; Liu, Xiaoming; Tian, Fengwei; Zhao, Jianxin; Zhang, Hao; Chen, Yong Q.; Chen, Wei

    2014-01-01

    Background Mucosal vaccine based on lactic acid bacteria is an attractive concept for the prevention and treatment of allergic diseases, but their mechanisms of action in vivo are poorly understood. Therefore, we sought to investigate how recombinant major dust mite allergen Der p2-expressing Lactococcus lactis as a mucosal vaccine induced the immune tolerance against house dust mite allergy in a mouse model. Methods Three strains of recombinant L. lactis producing Der p2 in different cell components (extracellular, intracellular and cell wall) were firstly constructed. Their prophylactic potential was evaluated in a Der p2-sensitised mouse model, and immunomodulation properties at the cellular level were determined by measuring cytokine production in vitro. Results Der p2 expressed in the different recombinant L. lactis strains was recognized by a polyclonal anti-Der p2 antibody. Oral treatment with the recombinant L. lactis prior sensitization significantly prevented the development of airway inflammation in the Der p2-sensitized mice, as determined by the attenuation of inflammatory cells infiltration in the lung tissues and decrease of Th2 cytokines IL-4 and IL-5 levels in bronchoalveolar lavage. In addition, the serum allergen-specific IgE levels were significantly reduced, and the levels of IL-4 in the spleen and mesenteric lymph nodes cell cultures were also markedly decreased upon allergen stimulation in the mice fed with the recombinant L. lactis strains. These protective effects correlated with a significant up-regulation of regulatory T cells in the mesenteric lymph nodes. Conclusion Oral pretreatment with live recombinant L. lactis prevented the development of allergen-induced airway inflammation primarily by the induction of specific mucosal immune tolerance. PMID:25290938

  12. Anti-inflammatory effects of Lactococcus lactis NCDO 2118 during the remission period of chemically induced colitis

    PubMed Central

    2014-01-01

    Background Many probiotic bacteria have been described as promising tools for the treatment and prevention of inflammatory bowel diseases (IBDs). Most of these bacteria are lactic acid bacteria, which are part of the healthy human microbiota. However, little is known about the effects of transient bacteria present in normal diets, including Lactococcus lactis. Methods In the present study, we analysed the immunomodulatory effects of three L. lactis strains in vitro using intestinal epithelial cells. L. lactis NCDO 2118 was administered for 4 days to C57BL/6 mice during the remission period of colitis induced by dextran sodium sulphate (DSS). Results Only one strain, L. lactis NCDO 2118, was able to reduce IL-1?-induced IL-8 secretion in Caco-2 cells, suggesting a potential anti-inflammatory effect. Oral treatment using L. lactis NCDO 2118 resulted in a milder form of recurrent colitis than that observed in control diseased mice. This protective effect was not attributable to changes in secretory IgA (sIgA); however, NCDO 2118 administration was associated with an early increase in IL-6 production and sustained IL-10 production in colonic tissue. Mice fed L. lactis NCDO 2118 had an increased number of regulatory CD4+ T cells (Tregs) bearing surface TGF-? in its latent form (Latency-associated peptide-LAP) in the mesenteric lymph nodes and spleen. Conclusions Here, we identified a new probiotic strain with a potential role in the treatment of IBD, and we elucidated some of the mechanisms underlying its anti-inflammatory effect. PMID:25110521

  13. Improved production of heterologous proteins by a glucose repression-defective mutant of Kluyveromyces lactis.

    PubMed

    Donnini, Claudia; Farina, Francesca; Neglia, Barbara; Compagno, Maria Concetta; Uccelletti, Daniela; Goffrini, Paola; Palleschi, Claudio

    2004-05-01

    The secreted production of heterologous proteins in Kluyveromyces lactis was studied. A glucoamylase (GAA) from the yeast Arxula adeninivorans was used as a reporter protein for the study of the secretion efficiencies of several wild-type and mutant strains of K. lactis. The expression of the reporter protein was placed under the control of the strong promoter of the glyceraldehyde-3-phosphate dehydrogenase of Saccharomyces cerevisiae. Among the laboratory strains tested, strain JA6 was the best producer of GAA. Since this strain is known to be highly sensitive to glucose repression and since this is an undesired trait for biomass-oriented applications, we examined heterologous protein production by using glucose repression-defective mutants isolated from this strain. One of them, a mutant carrying a dgr151-1 mutation, showed a significantly improved capability of producing heterologous proteins such as GAA, human serum albumin, and human interleukin-1beta compared to the parent strain. dgr151-1 is an allele of RAG5, the gene encoding the only hexokinase present in K. lactis (a homologue of S. cerevisiae HXK2). The mutation in this strain was mapped to nucleotide position +527, resulting in a change from glycine to aspartic acid within the highly conserved kinase domain. Cells carrying the dgr151-1 allele also showed a reduction in N- and O-glycosylation. Therefore, the dgr151 strain may be a promising host for the production of heterologous proteins, especially when the hyperglycosylation of recombinant proteins must be avoided. PMID:15128512

  14. Specificity Mutants of the Binding Protein of the Oligopeptide Transport System of Lactococcus lactis

    PubMed Central

    Picon, Antonia; Kunji, Edmund R. S.; Lanfermeijer, Frank C.; Konings, Wil N.; Poolman, Bert

    2000-01-01

    The kinetic properties of wild-type and mutant oligopeptide binding proteins of Lactococcus lactis were determined. To observe the properties of the mutant proteins in vivo, the oppA gene was deleted from the chromosome of L. lactis to produce a strain that was totally defective in oligopeptide transport. Amplified expression of the oppA gene resulted in an 8- to 12-fold increase in OppA protein relative to the wild-type level. The amplified expression was paralleled by increased bradykinin binding activity, but had relatively little effect on the overall transport of bradykinin via Opp. Several site-directed mutants were constructed on the basis of a comparison of the primary sequences of OppA from Salmonella enterica serovar Typhimurium and L. lactis, taking into account the known structure of the serovar Typhimurium protein. Putative peptide binding-site residues were mutated. All the mutant OppA proteins exhibited a decreased binding affinity for the high-affinity peptide bradykinin. Except for OppA(D471R), the mutant OppA proteins displayed highly defective bradykinin uptake, whereas the transport of the low-affinity substrate KYGK was barely affected. Cells expressing OppA(D471R) had a similar Km for transport, whereas the Vmax was increased more than twofold as compared to the wild-type protein. The data are discussed in the light of a kinetic model and imply that the rate of transport is determined to a large extent by the donation of the peptide from the OppA protein to the translocator complex. PMID:10692365

  15. Characteristics and osmoregulatory roles of uptake systems for proline and glycine betaine in Lactococcus lactis.

    PubMed Central

    Molenaar, D; Hagting, A; Alkema, H; Driessen, A J; Konings, W N

    1993-01-01

    Lactococcus lactis subsp. lactis ML3 contains high pools of proline or betaine when grown under conditions of high osmotic strength. These pools are created by specific transport systems. A high-affinity uptake system for glycine betaine (betaine) with a Km of 1.5 microM is expressed constitutively. The activity of this system is not stimulated by high osmolarities of the growth or assay medium but varies strongly with the medium pH. A low-affinity proline uptake system (Km, > 5 mM) is expressed at high levels only in chemically defined medium (CDM) with high osmolarity. This transport system is also stimulated by high osmolarity. The expression of this proline uptake system is repressed in rich broth with low or high osmolarity and in CDM with low osmolarity. The accumulated proline can be exchanged for betaine. Proline uptake is also effectively inhibited by betaine (Ki of between 50 and 100 microM). The proline transport system therefore probably also transports betaine. The inhibition of proline transport by betaine results in low proline pools in cells grown in high-osmotic-strength, betaine-containing CDM. The energy and pH dependency and the influence of ionophores on the activity of both transport systems suggest that these systems are not proton motive force driven. At low osmolarities, proline uptake is low but significant. This low proline uptake is also inhibited by betaine, although to a lesser extent than in cells grown in high-osmotic-strength CDM. These data indicate that proline uptake in L. lactis is enzyme mediated and is not dependent on passive diffusion, as was previously believed. PMID:8366030

  16. 13C Nuclear Magnetic Resonance Studies of Citrate and Glucose Cometabolism by Lactococcus lactis

    PubMed Central

    Ramos, Ana; Jordan, Kieran N.; Cogan, Timothy M.; Santos, Helena

    1994-01-01

    13C nuclear magnetic resonance (13C-NMR) was used to investigate the metabolism of citrate plus glucose and pyruvate plus glucose by nongrowing cells of Lactococcus lactis subsp. lactis 19B under anaerobic conditions. The metabolism of citrate plus glucose during growth was also monitored directly by in vivo NMR. Although pyruvate is a common intermediate metabolite in the metabolic pathways of both citrate and glucose, the origin of the carbon atoms in the fermentation products was determined by using selectively labeled substrates, e.g., [2,4-13C]citrate, [3-13C]pyruvate, and [2-13C]glucose. The presence of an additional substrate caused a considerable stimulation in the rates of substrate utilization, and the pattern of end products was changed. Acetate plus acetoin and butanediol represented more than 80% (molar basis) of the end products of the metabolism of citrate (or pyruvate) alone, but when glucose was also added, 80% of the citrate (or pyruvate) was converted to lactate. This result can be explained by the activation of lactate dehydrogenase by fructose 1,6-bisphosphate, an intermediate in glucose metabolism. The effect of different concentrations of glucose on the metabolism of citrate by dilute cell suspensions was also probed by using analytical methods other than NMR. Pyruvate dehydrogenase (but not pyruvate formate-lyase) was active in the conversion of pyruvate to acetyl coenzyme A. ?-Acetolactate was detected as an intermediate metabolite of citrate or pyruvate metabolism, and the labeling pattern of the end products agrees with the ?-acetolactate pathway. It was demonstrated that the contribution of the acetyl coenzyme A pathway for the synthesis of diacetyl, should it exist, is lower than 10%. Evidence for the presence of internal carbon reserves in L. lactis is presented. PMID:16349269

  17. Optimization of fed-batch production of the model recombinant protein GFP in Lactococcus lactis.

    PubMed

    Oddone, Gian M; Lan, Christopher Q; Rawsthorne, Helen; Mills, David A; Block, David E

    2007-04-15

    Optimization of recombinant protein production using lactic acid bacteria (LAB) remains an important obstacle on the road to realizing LAB as oral vaccine delivery vehicles. Despite this, there have been few published investigations to explore the higher limits of LAB recombinant protein expression in fed-batch fermentations. In this study, results from response surface experiments suggested an optimal set of conditions for expression of green fluorescent protein (GFP), a model recombinant protein, in bench-scale, fed-batch Lactococcus lactis IL1403 fermentations. The 48 4-L fed-batch fermentations in this set of experiments, along with preliminary studies, investigated the effects of pH, temperature, hemin concentration, concentration of the nisin inducer per cell, and time of induction. Cell densities in this data set ranged from 2.9 to 7.4 g/L and maximum GFP expression per cell ranged from 0.1 to 4.4 relative fluorescence units (RFU)/g. The optimal 4-L, fed-batch fermentation process found here yields growth and protein expression values that dramatically improve upon results from traditional test tube and flask processes. Relative to the traditional process, the experimental optimum conditions yield 4.9 times the cell density, 1.6 times the protein per cell mass, and 8 times the total protein concentration. Unexpectedly, experiments also revealed that the compound hemin, known previously to improve growth and survival of Lactococcus lactis (L. lactis), negatively impacted recombinant protein production when added in concentrations from 5 to 20 microg/mL with this strain. The improvement in protein expression over traditional processes demonstrated here is an important step toward commercial development of LAB for oral delivery of recombinant vaccines and therapeutic proteins. PMID:17117427

  18. New Expression System Tightly Controlled by Zinc Availability in Lactococcus lactis

    PubMed Central

    Llull, D.; Poquet, I.

    2004-01-01

    Here we developed the new expression system PZn zitR, based on the regulatory signals (PZn promoter and zitR repressor) of the Lactococcus lactis zit operon, involved in Zn2+ high-affinity uptake and regulation. A PZn zitR-controlled expression vector was constructed, and expression regulation was studied with two reporter genes, uspnuc and lacLM; these genes encode, respectively, a protein derived from Staphylococcus aureus secreted nuclease and Leuconostoc mesenteroides cytoplasmic ?-galactosidase. Nuclease and ?-galactosidase activities of L. lactis MG1363 cells expressing either uspnuc or lacLM under the control of PZn zitR were evaluated on plates and quantified from liquid cultures as a function of divalent metal ion, particularly Zn2+, availability in the environment. Our results demonstrate that PZn zitR is highly inducible upon divalent cation starvation, obtained either through EDTA addition or during growth in chemically defined medium, and is strongly repressed in the presence of excess Zn2+. The efficiency of the PZn zitR expression system was compared to that of the well-known nisin-controlled expression (NICE) system with the same reporter genes cloned under either PZn zitR or PnisA nisRK control. lacLM induction levels reached with both systems were on the same order of magnitude, even though the NICE system is fivefold more efficient than the PZn zitR system. An even smaller difference or no difference was observed after 3 h of induction when nuclease was used as a reporter for Western blotting detection. PZn zitR proved to be a powerful expression system for L. lactis, as it is tightly controlled by the zinc concentration in the medium. PMID:15345426

  19. The structure and possible function of the glycolipid from Staphylococcus lactis I3

    PubMed Central

    Brundish, D. E.; Shaw, N.; Baddiley, J.

    1967-01-01

    1. The total lipid was extracted from Staphylococcus lactis I3 with chloroform–methanol mixtures and the glycolipid component was isolated by chromatography on silicic acid. 2. Saponification yielded a non-crystalline glycoside for which the structure O-?-d-glucopyranosyl-(1?6)-O-?-d-glucopyranosyl-(1?1)-d-glycerol has been established by chemical degradations and by comparison with synthetic material. 3. The role of the glycosyl diglycerides in bacterial membranes is discussed. ImagesFig. 1. PMID:5584025

  20. Expression and secretion of a thermostable bacterial xylanase in Kluyveromyces lactis.

    PubMed Central

    Walsh, D J; Bergquist, P L

    1997-01-01

    The xynA structural gene from the extremely thermophilic anaerobe Dictyoglomus thermophilum Rt46B.1 was fused in frame with the secretion signal of the Kluyveromyces lactis killer toxin in episomal expression vectors based on the Kluyveromyces plasmid pKD1. XynA was secreted predominantly as an unglycosylated 35-kDa protein which comprised up to 90% of the total extracellular proteins and reached a concentration of 130 micrograms/ml in shake-flask cultures grown under selective conditions. PMID:9251219

  1. How physiological and cultural conditions influence heterologous protein production in Kluyveromyces lactis.

    PubMed

    Merico, Annamaria; Capitanio, Daniele; Vigentini, Ileana; Ranzi, Bianca Maria; Compagno, Concetta

    2004-04-01

    The optimization and scale-up of a specific protein production process have to take into account cultural conditions as well as cell physiology of growth and influence of foreign protein expression on host cell metabolism. Growth on cheap substrates, efficient secretion ability and a weaker tendency to hypermannosilate proteins than S. cerevisiae, make K. lactis an excellent and well-accepted host for heterologous protein production, even for human use. A fairly good heterologous glucoamylase yield and the setting of the optimal conditions to produce it were obtained expressing the Arxula adeninivorans glucoamylase in a strain of K. lactis and its isogenic mutant, which seems to have higher secretion ability. We performed batch cultures of both strains to analyze the influence of different physiological and environmental parameters on glucoamylase production/secretion. Interestingly, the maintenance of pH in the range of neutrality causes the consumption of a larger amount of carbon source, a longer time of production and a better stability of the active form of the enzyme, thus increasing biomass and glucoamylase production. Furthermore, the enrichment of the culture medium adds up to the action of pH control, forcing the mutant production/secretion to higher levels. PMID:15063622

  2. Multilocus Sequence Typing Scheme for the Characterization of 936-Like Phages Infecting Lactococcus lactis

    PubMed Central

    Moisan, Maxim

    2012-01-01

    Lactococcus lactis phage infections are costly for the dairy industry because they can slow down the fermentation process and adversely impact product safety and quality. Although many strategies have been developed to better control phage populations, new virulent phages continue to emerge. Thus, it is beneficial to develop an efficient method for the routine identification of new phages within a dairy plant to rapidly adapt antiphage tactics. Here, we present a multilocus sequence typing (MLST) scheme for the characterization of the 936-like phages, the most prevalent phage group infecting L. lactis strains worldwide. The proposed MLST system targets the internal portion of five highly conserved genomic sequences belonging to the packaging, morphogenesis, and lysis modules. Our MLST scheme was used to analyze 100 phages with different restriction fragment length polymorphism (RFLP) patterns isolated from 11 different countries between 1971 and 2010. PCR products were obtained for all the phages analyzed, and sequence analysis highlighted the high discriminatory power of the MLST system, detecting 93 different sequence types. A conserved locus within the lys gene (coding for endolysin) was the most discriminative, with 65 distinct alleles. The locus within the mcp gene (major capsid protein) was the most conserved (54 distinct alleles). Phylogenetic analyses of the concatenated sequences exhibited a strong concordance of the clusters with the phage host range, indicating the clonal evolution of these phages. A public database has been set up for the proposed MLST system, and it can be accessed at http://pubmlst.org/bacteriophages/. PMID:22522686

  3. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri

    PubMed Central

    van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S.; Britton, Robert A.

    2012-01-01

    Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution. PMID:22750793

  4. Statistical investigation of Kluyveromyces lactis cells permeabilization with ethanol by response surface methodology

    PubMed Central

    de Faria, Janaína T.; Rocha, Pollyana F.; Converti, Attilio; Passos, Flávia M.L.; Minim, Luis A.; Sampaio, Fábio C.

    2013-01-01

    The aim of our study was to select the optimal operating conditions to permeabilize Kluyveromyces lactis cells using ethanol as a solvent as an alternative to cell disruption and extraction. Cell permeabilization was carried out by a non-mechanical method consisting of chemical treatment with ethanol, and the results were expressed as ?-galactosidase activity. Experiments were conducted under different conditions of ethanol concentration, treatment time and temperature according to a central composite rotatable design (CCRD), and the collected results were then worked out by response surface methodology (RSM). Cell permeabilization was improved by an increase in ethanol concentration and simultaneous decreases in the incubation temperature and treatment time. Such an approach allowed us to identify an optimal range of the independent variables within which the ?-galactosidase activity was optimized. A maximum permeabilization of 2,816 mmol L?1 oNP min?1 g?1 was obtained by treating cells with 75.0% v/v of ethanol at 20.0 °C for 15.0 min. The proposed methodology resulted to be effective and suited for K. lactis cells permeabilization at a lab-scale and promises to be of possible interest for future applications mainly in the food industry. PMID:24688494

  5. On the binding mechanism of the peptide receptor of the oligopeptide transport system of Lactococcus lactis

    PubMed Central

    Lanfermeijer, Frank C.; Detmers, Frank J.M.; Konings, Wil N.; Poolman, Bert

    2000-01-01

    Lactococcus lactis degrades exogenous proteins such as ?-casein to peptides of 4–30 amino acids, and uses these as nitrogen sources. The binding protein or receptor (OppALl) of the oligopeptide transport system (Opp) of L.lactis has the unique capacity to bind peptides from five up to at least 20 residues. To study the binding mechanism of OppALl, nonameric peptides were used in which the cysteine at position 1, 3, 4, 5, 6, 7 or 9 was selectively labeled with either bulky and non-fluorescent or bulky and fluorescent groups. Also, nonameric peptides with a non-natural residue, azatryptophan, at positions 3 or 7 were used. The fluorescence of azatryptophan reports on the polarity of the environment. The studies indicate that the binding protein encloses the first six amino acids of the peptide, whereas the remaining residues stick out and interact with the surface of the binding protein. The peptide binding mechanism of OppALl is discussed in relation to known three-dimensional structures of members of this class of proteins, and an adaptation of the general binding mechanism is proposed. PMID:10899119

  6. Effect of signal peptides on the secretion of ?-cyclodextrin glucanotransferase in Lactococcus lactis NZ9000.

    PubMed

    Subramaniam, Menaga; Baradaran, Ali; Rosli, Md Illias; Rosfarizan, Mohamad; Khatijah, Yusoff; Raha, Abdul Rahim

    2012-01-01

    Cyclodextrin glucanotransferase (CGTase) is an extracellular enzyme which catalyzes the formation of cyclodextrin from starch. The production of CGTase using lactic acid bacterium is an attractive alternative and safer strategy to produce CGTase. In this study, we report the construction of genetically modified Lactococcus lactis strains harboring plasmids that secrete the Bacillus sp. G1 ?-CGTase, with the aid of the signal peptides (SPs) SPK1, USP45 and native SP (NSP). Three constructed vectors, pNZ:NSP:CGT, pNZ:USP:CGT and pNZ:SPK1:CGT, were developed in this study. Each vector harbored a different SP fused to the CGTase. The formation of halo zones on starch plates indicated the production and secretion of ?-CGTase by the recombinants. The expression of this enzyme is shown by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and zymogram analysis. A band size of ?75 kDa corresponding to ?-CGTase is identified in the intracellular and the extracellular environments of the host after medium modification. The replacement of glucose by starch in the medium was shown to induce ?-CGTase production in L. lactis. Although ?-CGTase production is comparatively low in NZ:SPK1:CGT, the SP SPK1 was shown to have higher secretion efficiency compared to the other SPs used in this study. PMID:23295307

  7. Cloning, nucleotide sequence, and regulatory analysis of the Lactococcus lactis dnaJ gene.

    PubMed

    van Asseldonk, M; Simons, A; Visser, H; de Vos, W M; Simons, G

    1993-03-01

    The dnaJ gene of Lactococcus lactis was isolated from a genomic library of L. lactis NIZO R5 and cloned into pUC19. Nucleotide sequencing revealed an open reading frame of 1,137 bp in length, encoding a protein of 379 amino acids. The deduced amino acid sequence showed homology to the DnaJ proteins of Escherichia coli, Mycobacterium tuberculosis, Bacillus subtilis, and Clostridium acetobutylicum. The level of the dnaJ monocistronic mRNA increased approximately threefold after heat shock. The transcription initiation site of the dnaJ gene was determined and appeared to be preceded by a typical gram-positive vegetative promoter sequence (TTGCCA-17 bp-TAAAAT). Upstream of the promoter region, an inverted repeat is located that is identical to those detected upstream of heat shock genes of other gram-positive organisms. A transcriptional fusion between the dnaJ expression signals and a usp45-amyS secretion cassette caused a significant increase in alpha-amylase activity after heat shock induction. Deletion mutagenesis showed that the inverted repeat is involved in heat shock regulation of the dnaJ gene. The conservation of this palindromic sequence in gram-positive heat shock genes suggests a common regulatory pathway distinct from the system used in gram-negative bacteria. PMID:8449872

  8. The Carbohydrate Metabolism Signature of Lactococcus lactis Strain A12 Reveals Its Sourdough Ecosystem Origin

    PubMed Central

    Passerini, Delphine; Coddeville, Michèle; Le Bourgeois, Pascal; Loubière, Pascal; Ritzenthaler, Paul; Fontagné-Faucher, Catherine; Cocaign-Bousquet, Muriel

    2013-01-01

    Lactococcus lactis subsp. lactis strain A12 was isolated from sourdough. Combined genomic, transcriptomic, and phenotypic analyses were performed to understand its survival capacity in the complex sourdough ecosystem and its role in the microbial community. The genome sequence comparison of strain A12 with strain IL1403 (a derivative of an industrial dairy strain) revealed 78 strain-specific regions representing 23% of the total genome size. Most of the strain-specific genes were involved in carbohydrate metabolism and are potentially required for its persistence in sourdough. Phenotype microarray, growth tests, and analysis of glycoside hydrolase content showed that strain A12 fermented plant-derived carbohydrates, such as arabinose and ?-galactosides. Strain A12 exhibited specific growth rates on raffinose that were as high as they were on glucose and was able to release sucrose and galactose outside the cell, providing soluble carbohydrates for sourdough microflora. Transcriptomic analysis identified genes specifically induced during growth on raffinose and arabinose and reveals an alternative pathway for raffinose assimilation to that used by other lactococci. PMID:23872564

  9. Effectiveness of thermal treatments and biocides in the inactivation of Argentinian Lactococcus lactis phages.

    PubMed

    Suárez, Viviana B; Reinheimer, Jorge A

    2002-11-01

    The thermal and chemical resistance levels of four autochthonal bacteriophages of Lactococcus lactis subsp. lactis, isolated from cheese processes, was investigated. The times required to obtain 99% inactivation of phages (T99) at 63 and 72 degrees C in three suspension media (M17 broth, reconstituted commercial nonfat skim milk, and Tris magnesium gelatin buffer) were determined. Thermal resistance was dependent on the phage studied, and the results of this study demonstrate that pasteurization treatments used in dairy industries may leave viable viral particles in milk. It was possible to determine that M17 broth was generally the least protective medium, while phosphate buffer was the most protective one. Peracetic acid (0.15%, vol/vol) was the most effective viricidal agent, with exposures of 5 min being sufficient to inactivate high-titer phage suspensions (>10(6) PFU/ml). To achieve total inactivation (<10 PFU/ml) of viral suspensions, sodium hypochlorite was effective at 100 ppm for only two phages, while the other two phages needed concentrations of 200 and 300 ppm. Ethanol at concentrations of 100 and 75% proved to be very efficient in inactivating phages, but isopropanol was not effective against them. PMID:12430698

  10. Molecular Characterization of a Recombinant Manganese Superoxide Dismutase from Lactococcus lactis M4

    PubMed Central

    Chor Leow, Thean; Foo, Hooi Ling; Abdul Rahim, Raha

    2014-01-01

    A superoxide dismutase (SOD) gene of Lactococcus lactis M4 was cloned and expressed in a prokaryotic system. Sequence analysis revealed an open reading frame of 621 bp which codes for 206 amino acid residues. Expression of sodA under T7 promoter exhibited a specific activity of 4967?U/mg when induced with 1?mM of isopropyl-?-D-thiogalactopyranoside. The recombinant SOD was purified to homogeneity by immobilised metal affinity chromatography and Superose 12 gel filtration chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blot analyses of the recombinant SOD detected a molecular mass of approximately 27?kDa. However, the SOD was in dimer form as revealed by gel filtration chromatography. The purified recombinant enzyme had a pI of 4.5 and exhibited maximal activity at 25°C and pH 7.2. It was stable up to 45°C. The insensitivity of this lactococcal SOD to cyanide and hydrogen peroxide established that it was a MnSOD. Although it has 98% homology to SOD of L. lactis IL1403, this is the first elucidated structure of lactococcal SOD revealing active sites containing the catalytic manganese coordinated by four ligands (H-27, H-82, D-168, and H-172). PMID:24592392

  11. Functional display of a heterologous protein on the surface of Lactococcus lactis by means of the cell wall anchor of Staphylococcus aureus protein A.

    PubMed

    Steidler, L; Viaene, J; Fiers, W; Remaut, E

    1998-01-01

    In this study, we showed that the cell wall anchor of protein A from Staphylococcus aureus is functional in the food-grade organism Lactococcus lactis. A fusion protein composed of the lactococcal Usp45 secretion signal peptide, streptavidin monomer, and the S. aureus protein A anchor became covalently attached to the peptidoglycan when expressed in L. lactis. The streptavidin moiety of the fusion protein was functionally exposed at the cellular surface. L. lactis cells expressing the anchored fusion polypeptide could be specifically immobilized on a biotinylated alkaline phosphatase-coated polystyrene support. PMID:9435087

  12. Receptor binding domain of Escherichia coli F18 fimbrial adhesin FedF can be both efficiently secreted and surface displayed in a functional form in Lactococcus lactis.

    PubMed

    Lindholm, Agneta; Smeds, Andreas; Palva, Airi

    2004-04-01

    Adherence of F18 fimbrial Escherichia coli to porcine intestinal epithelial cells is mediated by the adhesin (FedF) of F18 fimbriae. In a previous study, we demonstrated the specificity of the amino acid residues between 60 and 109 as the receptor binding domain of FedF. In this study, different expression, secretion, and anchoring systems for the receptor binding domain of the FedF adhesin in Lactococcus lactis were evaluated. Two partially overlapping receptor binding domains (42 and 62 amino acid residues) were expressed as fusions with L. lactis subsp. cremoris protein PrtP for evaluation of secretion efficiency. To evaluate the cell surface display of these FedF-PrtP fusions, they were further combined with different lengths of PrtP spacers fused with either the L. lactis AcmA anchor or the PrtP cell wall binding domain. An HtrA-defective L. lactis NZ9000 mutant was constructed to determine its effect on the level of secreted or anchored fusion proteins. Recombinant L. lactis clones secreting the receptor binding domain of F18 fimbriae as a fusion with the H domains of L. lactis protein PrtP were first constructed by using two different signal peptides. FedF-PrtP fusions, directed by the signal sequence of L. brevis SlpA, were throughout found to be secreted at significantly higher quantities than corresponding fusions with the signal peptide of L. lactis Usp45. In the surface display systems tested, the L. lactis AcmA anchor performed significantly better, particularly in the L. lactis NZ9000DeltahtrA strain, compared to the L. lactis PrtP anchor region. Of the cell surface display constructs with the AcmA anchor, only those with the longest PrtP spacer regions resulted in efficient binding of recombinant L. lactis cells to porcine intestinal epithelial cells. These results confirmed that it is possible to efficiently produce the receptor binding domain of the F18 adhesin in a functionally active form in L. lactis. PMID:15066797

  13. Kluyveromyces lactis cells entrapped in Ca-alginate beads for the continuous production of a heterologous glucoamylase

    Microsoft Academic Search

    Elisabetta de Alteriis; Giovanni Silvestro; Massimo Poletto; Vittorio Romano; Daniele Capitanio; Concetta Compagno; Palma Parascandola

    2004-01-01

    Viable cells of Kluyveromyces lactis, transformed with the glucoamylase gene from Arxula adeninivorans, were entrapped in beads of Ca-alginate and employed on a lab scale in a continuous stirred and a fluidised bed reactor (FBR), both fed with a rich medium (YEP) containing lactose as carbon source. Experiments with freely suspended cells in batch and chemostat had demonstrated that glucoamylase

  14. Effect of autochthonous bacteriocin-producing Lactococcus lactis on bacterial population dynamics and growth of halotolerant bacteria in Brazilian charqui.

    PubMed

    Biscola, Vanessa; Abriouel, Hikmate; Todorov, Svetoslav Dimitrov; Capuano, Verena Sant'Anna Cabral; Gálvez, Antonio; Franco, Bernadette Dora Gombossy de Melo

    2014-12-01

    Charqui is a fermented, salted and sun-dried meat product, widely consumed in Brazil and exported to several countries. Growth of microorganisms in this product is unlikely due to reduced Aw, but halophilic and halotolerant bacteria may grow and cause spoilage. Charqui is a good source of lactic acid bacteria able to produce antimicrobial bacteriocins. In this study, an autochthonous bacteriocinogenic strain (Lactococcus lactis subsp. lactis 69), isolated from charqui, was added to the meat used for charqui manufacture and evaluated for its capability to prevent the growth of spoilage bacteria during storage up to 45 days. The influence of L. lactis 69 on the bacterial diversity during the manufacturing of the product was also studied, using denaturing gradient gel electrophoresis (DGGE). L. lactis 69 did not affect the counts and diversity of lactic acid bacteria during manufacturing and storage, but influenced negatively the populations of halotolerant microorganisms, reducing the spoilage potential. The majority of tested virulence genes was absent, evidencing the safety and potential technological application of this strain as an additional hurdle to inhibit undesirable microbial growth in this and similar fermented meat products. PMID:25084676

  15. Draft Genome Sequence of Bifidobacterium animalis subsp. lactis Strain CECT 8145, Able To Improve Metabolic Syndrome In Vivo

    PubMed Central

    Chenoll, E.; Codoñer, F. M.; Silva, A.; Martinez-Blanch, J. F.; Martorell, P.; Ramón, D.

    2014-01-01

    Bifidobacterium animalis subsp. lactis strain CECT 8145 is able to reduce body fat content and improve metabolic syndrome biomarkers. Here, we report the draft genome sequence of this strain, which may provide insights into its safety status and functional role. PMID:24675853

  16. Draft Genome Sequence of Bifidobacterium animalis subsp. lactis Strain CECT 8145, Able To Improve Metabolic Syndrome In Vivo.

    PubMed

    Chenoll, E; Codoñer, F M; Silva, A; Martinez-Blanch, J F; Martorell, P; Ramón, D; Genovés, S

    2014-01-01

    Bifidobacterium animalis subsp. lactis strain CECT 8145 is able to reduce body fat content and improve metabolic syndrome biomarkers. Here, we report the draft genome sequence of this strain, which may provide insights into its safety status and functional role. PMID:24675853

  17. Hsp65-producing Lactococcus lactis prevents experimental autoimmune encephalomyelitis in mice by inducing CD4+LAP+ regulatory T cells

    PubMed Central

    Rezende, Rafael M.; Oliveira, Rafael P.; Medeiros, Samara R.; Gomes-Santos, Ana C.; Alves, Andrea C.; Loli, Flávia G.; Guimarães, Mauro A.F.; Amaral, Sylvia S.; da Cunha, André P.; Weiner, Howard L.; Azevedo, Vasco; Miyoshi, Anderson; Faria, Ana M.C.

    2013-01-01

    Heat shock proteins (Hsps) participate in the cellular response to stress and they are hiperexpressed in inflammatory conditions. They are also known to play a major role in immune modulation, controlling, for instance, autoimmune responses. In this study, we showed that oral administration of a recombinant Lactococcus lactis strain that produces and releases LPS-free Hsp65 prevented the development of experimental autoimmune encephalomyelitis (EAE) in C57BL/6 mice. This was confirmed by the reduced inflammatory cell infiltrate and absence of injury signs in the spinal cord. The effect was associated with reduced IL-17 and increased IL-10 production in mesenteric lymph node and spleen cell cultures. Hsp65-producing-L. lactis-fed mice had a remarkable increase in the number of natural and inducible CD4+Foxp3+ regulatory T (Treg) cells and CD4+LAP+ (Latency-associated peptide) Tregs - which express the membrane-bound TGF-? - in spleen, inguinal and mesenteric lymph nodes as well as in spinal cord. Moreover, many Tregs co-expressed Foxp3 and LAP. In vivo depletion of LAP+ cells abrogated the effect of Hsp65-producing L. lactis in EAE prevention and worsened disease in medium-fed mice. Thus, Hsp65-L.lactis seems to boost this critical regulatory circuit involved in controlling EAE development in mice. PMID:22939403

  18. Nucleic Acids Research, 1993, Vol. 21, No. 9 2247-2248 The nucleosome repeat length of Kluyveromyces lactis is

    E-print Network

    of Kluyveromyces lactis is 16 bp longer than that of Saccharomyces cerevisiae Joris J.Heus, Ben J, Saccharomyces cerevisiae and Schizosaccharomycespombe, and up to 100 bp in sperm of several invertebratae (1, 2 nuclease, which cleaves preferentially between nucleosomes (6). S.cerevisiae and Spombe are reported

  19. Assessing the effects of exposure to environmental stress on some functional properties of Bifidobacterium animalis ssp. lactis.

    PubMed

    Amund, O D; Ouoba, L I I; Sutherland, J P; Ghoddusi, H B

    2014-12-01

    This study assessed the effects of exposing a strain of Bifidobacterium animalis ssp. lactis to acid, bile and osmotic stresses on antagonistic properties, biofilm formation and antibiotic susceptibility/resistance profile. Exposure to each stress factor appeared to have no significant effect on the antagonism against Escherichia coli NCTC 12900 and Salmonella enterica serovar Enteritidis PT4. No suppression in biofilm formation due to exposure to stress was observed. Bile and osmotic stresses resulted in significantly higher biofilm formation. Expression of an exopolysaccharide synthesis gene, gtf 01207, was significantly higher when the B. animalis ssp. lactis strain was exposed to osmotic stress. Susceptibility of the B. animalis ssp. lactis strain to chloramphenicol, erythromycin, ampicillin and vancomycin, and resistance to tetracycline remained unchanged when exposed to each stress. The expression of a tetracycline resistance gene, tet(W), was significantly higher when exposed to each stress. These results may suggest that the potential for the B. animalis ssp. lactis strain to provide probiotic benefit, after exposure to the stressful conditions of the gastrointestinal tract, remains intact. PMID:25097108

  20. Interaction of Bifidobacterium animalis subspecies lactis (Bb 12) and Salmonella typhimurium in continuous-flow chemostatic culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A commercially available probiotic, Bifidobacterium animalis subspecies lactis (Bb12) was adapted to and maintained in a continuous-flow chemostat culture. We evaluated the growth characteristics and interactive effects of Bb12 and a porcine-derived Salmonella typhimurium (St) when cultivated singly...

  1. Oral Vaccination with the Porcine Rotavirus VP4 Outer Capsid Protein Expressed by Lactococcus lactis Induces Specific Antibody Production

    PubMed Central

    Li, Yi-jing; Ma, Guang-peng; Li, Gui-wei; Qiao, Xin-yuan; Ge, Jun-wei; Tang, Li-jie; Liu, Min; Liu, Li-wei

    2010-01-01

    The objective of this study to design a delivery system resistant to the gastrointestinal environment for oral vaccine against porcine rotavirus. Lactococcus lactis NZ9000 was transformed with segments of vP4 of the porcine rotavirus inserted into the pNZ8112 surface-expression vector, and a recombinant L. lactis expressing VP4 protein was constructed. An approximately 27?kDa VP4 protein was confirmed by SDS-PAGE , Western blot and immunostaining analysis. BALB/c mice were immunized orally with VP4-expression recombinant L. lactis and cellular, mucosal and systemic humoral immune responses were examined. Specific anti-VP4 secretory IgA and IgG were found in feces, ophthalmic and vaginal washes and in serum. The induced antibodies demonstrated neutralizing effects on porcine rotavirus infection on MA104 cells. Our findings suggest that oral immunization with VP4-expressing L. lactis induced both specific local and systemic humoral and cellular immune responses in mice. PMID:20625406

  2. Nisin-Controlled Extracellular Production of Interleukin-2 in Lactococcus lactis Strains, without the Requirement for a Signal Peptide Sequence?

    PubMed Central

    Fernández, Antonio; Rodríguez, Juan M.; Bongaerts, Roy J.; Gasson, Michael J.; Horn, Nikki

    2007-01-01

    Secretion of the cytokine interleukin-2 (IL-2) was investigated in Lactococcus lactis using the secretory machinery of the bacteriocin lactococcin A. Surprisingly, the lcnCD transport genes were not essential for mouse IL-2 secretion. Furthermore, expression of a mature mouse IL-2 gene resulted in interleukin secretion without the requirement for a leader sequence. PMID:17905884

  3. Lactococcus lactis Gene yjgB Encodes a ?-d-Glutaminyl-l-Lysyl- Endopeptidase Which Hydrolyzes Peptidoglycan? †

    PubMed Central

    Redko, Yulia; Courtin, Pascal; Mézange, Christine; Huard, Carine; Chapot-Chartier, Marie-Pierre

    2007-01-01

    YjgB is one of five peptidoglycan hydrolases previously identified in Lactococcus lactis. Analysis of its amino acid sequence revealed that YjgB contains an NlpC/P60 domain, whereas no specific cell wall binding domain or motif could be identified. The NlpC/P60 family is characterized by three conserved residues, a cysteine, a histidine, and a polar residue. In agreement with the presence of a Cys residue in the catalytic site of YjgB, its enzymatic activity was enhanced in the presence of dithiothreitol. Peptidoglycan-hydrolyzing activity of YjgB was detected in growing cells of an L. lactis strain overexpressing YjgB, as revealed by the presence of disaccharide (DS)-dipeptide in the muropeptide composition of the overexpressing strain. YjgB hydrolyzes the peptide chains of L. lactis muropeptides between ?-d-Gln and l-Lys residues. Its hydrolytic activity was detected on DSs with tetra- and pentapeptide chains, whereas hydrolytic activity was very low on DS-tripeptides. Thus, we demonstrated that YjgB is an endopeptidase which cleaves ?-d-Gln-l-Lys bonds in peptide chains of L. lactis peptidoglycan. PMID:17644633

  4. Influence of lipoteichoic acid D-alanylation on protein secretion in Lactococcus lactis as revealed by random mutagenesis.

    PubMed

    Nouaille, S; Commissaire, J; Gratadoux, J J; Ravn, P; Bolotin, A; Gruss, A; Le Loir, Y; Langella, P

    2004-03-01

    Lactococcus lactis, a food-grade nonpathogenic lactic acid bacterium, is a good candidate for the production of heterologous proteins of therapeutic interest. We examined host factors that affect secretion of heterologous proteins in L. lactis. Random insertional mutagenesis was performed with L. lactis strain MG1363 carrying a staphylococcal nuclease (Nuc) reporter cassette in its chromosome. This cassette encodes a fusion protein between the signal peptide of the Usp45 lactococcal protein and the mature moiety of a truncated form of Nuc (NucT). The Nuc secretion efficiency (secreted NucT versus total NucT) from this construct is low in L. lactis (approximately 40%). Twenty mutants affected in NucT production and/or in secretion capacity were selected and identified. In these mutants, several independent insertions mapped in the dltA gene (involved in D-alanine transfer in lipoteichoic acids) and resulted in a NucT secretion defect. Characterization of the dltA mutant phenotype with respect to NucT secretion revealed that it is involved in a late secretion stage by causing mature NucT entrapment at the cell surface. PMID:15006784

  5. Imbalance of leucine flux in Lactococcus lactis and its use for the isolation of diacetyl-overproducing strains.

    PubMed Central

    Goupil, N; Corthier, G; Ehrlich, S D; Renault, P

    1996-01-01

    Diacetyl is a by-product of pyruvate metabolism in Lactococcus lactis, where pyruvate is first converted to alpha-acetolactate, which is slowly decarboxylated to diacetyl in the presence of oxygen. L. lactis usually converts alpha-acetolactate to acetoin enzymatically, by alpha-acetolactate decarboxylase encoded by the aldB gene. We took advantage of the fact that this enzyme also has a central role in the regulation of branched-chain amino acids, to select spontaneous aldB mutants in an unbalanced concentration of leucine versus those of valine and isoleucine in the medium. Industrial dairy strains of L. lactis subsp. lactis biovar diacetylactis containing point mutations and deletions of aldB were isolated and characterized. Their growth in milk was not affected, but they rapidly accumulated a large amount of alpha-acetolactate instead of acetoin from citrate in milk. Under aerated condition, strains devoid of AldB produced about 10 times more diacetyl than did the parental strains. PMID:8779600

  6. Potential probiotic Bifidobacterium animalis ssp. lactis 420 prevents weight gain and glucose intolerance in diet-induced obese mice.

    PubMed

    Stenman, L K; Waget, A; Garret, C; Klopp, P; Burcelin, R; Lahtinen, S

    2014-12-01

    Alterations of the gut microbiota and mucosal barrier are linked with metabolic diseases. Our aim was to investigate the potential benefit of the potential probiotic Bifidobacterium animalis ssp. lactis 420 in reducing high-fat diet-induced body weight gain and diabetes in mice. In the obesity model, C57Bl/6J mice were fed a high-fat diet (60 energy %) for 12 weeks, and gavaged daily with B. lactis 420 (109 cfu) or vehicle. In the diabetes model, mice were fed a high-fat, ketogenic diet (72 energy % fat) for 4 weeks, with a 6-week subsequent treatment with B. lactis 420 (108-1010 cfu/day) or vehicle, after which they were analysed for body composition. We also analysed glucose tolerance, plasma lipopolysaccharide and target tissue inflammation using only one of the B. lactis 420 groups (109 cfu/day). Intestinal bacterial translocation and adhesion were analysed in a separate experiment using an Escherichia coli gavage. Body fat mass was increased in both obese (10.7 ± 0.8 g (mean ± standard error of mean) vs. 1.86 ± 0.21 g, P<0.001) and diabetic mice (3.01 ± 0.4 g vs. 1.14 ± 0.15 g, P<0.001) compared to healthy controls. Treatment with B. lactis 420 significantly decreased fat mass in obese (7.83 ± 0.67 g, P=0.007 compared to obese with vehicle) and diabetic mice (1.89 ± 0.16 g, P=0.02 for highest dose). This was reflected as reduced weight gain and improved glucose tolerance. Furthermore, B. lactis 420 decreased plasma lipopolysaccharide levels (P<0.001), liver inflammation (P=0.04), and E. coli adhesion in the distal gut (P<0.05). In conclusion, B. lactis 420 reduces fat mass and glucose intolerance in both obese and diabetic mice. Reduced intestinal mucosal adherence and plasma lipopolysaccharide suggest a mechanism related to reduced translocation of gut microbes. PMID:25062610

  7. Multilocus sequence typing of Lactococcus lactis from naturally fermented milk foods in ethnic minority areas of China.

    PubMed

    Xu, Haiyan; Sun, Zhihong; Liu, Wenjun; Yu, Jie; Song, Yuqin; Lv, Qiang; Zhang, Jiachao; Shao, Yuyu; Menghe, Bilige; Zhang, Heping

    2014-05-01

    To determine the genetic diversity and phylogenetic relationships among Lactococcus lactis isolates, 197 strains isolated from naturally homemade yogurt in 9 ethnic minority areas of 6 provinces of China were subjected to multilocus sequence typing (MLST). The MLST analysis was performed using internal fragment sequences of 12 housekeeping genes (carB, clpX, dnaA, groEL, murC, murE, pepN, pepX, pyrG, recA, rpoB, and pheS). Six (dnaA) to 8 (murC) different alleles were detected for these genes, which ranged from 33.62 (clpX) to 41.95% (recA) GC (guanine-cytosine) content. The nucleotide diversity (?) ranged from 0.00362 (murE) to 0.08439 (carB). Despite this limited allelic diversity, the allele combinations of each strain revealed 72 different sequence types, which denoted significant genotypic diversity. The dN/dS ratios (where dS is the number of synonymous substitutions per synonymous site, and dN is the number of nonsynonymous substitutions per nonsynonymous site) were lower than 1, suggesting potential negative selection for these genes. The standardized index of association of the alleles IA(S)=0.3038 supported the clonality of Lc. lactis, but the presence of network structure revealed by the split decomposition analysis of the concatenated sequence was strong evidence for intraspecies recombination. Therefore, this suggests that recombination contributed to the evolution of Lc. lactis. A minimum spanning tree analysis of the 197 isolates identified 14 clonal complexes and 23 singletons. Phylogenetic trees were constructed based on the sequence types, using the minimum evolution algorithm, and on the concatenated sequence (6,192 bp), using the unweighted pair-group method with arithmetic mean, and these trees indicated that the evolution of our Lc. lactis population was correlated with geographic origin. Taken together, our results demonstrated that MLST could provide a better understanding of Lc. lactis genome evolution, as well as useful information for future studies on global Lc. lactis structure and genetic evolution, which will lay the foundation for screening Lc. lactis as starter cultures in fermented dairy products. PMID:24612812

  8. 1 JUNE 2006 Bact to basics

    E-print Network

    Lovley, Derek

    -celled critters must gather energy and find a way to use it. But could bacteria help get us out of the vise that that has clamped humanity between energy shortages and global warming? Two new developments give a glimmer... Alternative Medicine: Some Stuff Works! Natural Gas Shortage Alternative Medicine Extra: 2005: Hottest year

  9. Oral immunization with Lactococcus lactis secreting attenuated recombinant staphylococcal enterotoxin B induces a protective immune response in a murine model

    PubMed Central

    2013-01-01

    Background Staphylococcus aureus is unrestrictedly found in humans and in animal species that maintain thermal homeostasis. Inadequate cleaning of processing equipment or inappropriate handling can contaminate processed food and cause severe food poisoning. Staphylococcal enterotoxin B (SEB), a potent superantigenic exotoxin, is produced by 50% of clinical isolates of S. aureus and is associated with massive food poisoning and with the induction of toxic shock syndrome. Results A gene sequence encoding a recombinant SEB (rSEB), devoid of superantigenic activity, was successfully cloned and expressed in a cytoplasmic or a secreted form in the food-grade lactic acid bacterium Lactococcus lactis. The recombinant protein detected in the cytoplasm or in the culture medium exhibited the expected molecular mass and was recognized by a SEB-polyclonal antibody. Oral immunization with the recombinant L. lactis strains induced a protective immune response in a murine model of S. aureus infection. Immunized mice survived intraperitoneal challenge with an S. aureus SEB-producer strain. Counts of S. aureus in the spleen of rSEB-immunized mice were significantly reduced. The rSEB-immunized mice showed significant titers of anti-SEB IgA and IgG in stools and serum, respectively. Both recombinant L. lactis strains were able to elicit cellular or systemic immune responses in mice, with no significant difference if rSEB was produced in its cytoplasmic or secreted form. However, recombinant L. lactis expressing the cytoplasmic rSEB increased the survival rate of the challenged mice by 43%. Conclusions These findings show the vaccine efficacy of L. lactis carrying an attenuated SEB, in a murine model, following lethal S. aureus challenge. PMID:23561053

  10. Oral Administration of Lactococcus lactis Subsp. lactis JCM5805 Enhances Lung Immune Response Resulting in Protection from Murine Parainfluenza Virus Infection

    PubMed Central

    Jounai, Kenta; Sugimura, Tetsu; Ohshio, Konomi; Fujiwara, Daisuke

    2015-01-01

    When activated by viral infection, plasmacytoid dendritic cells (pDCs) play a primary role in the immune response through secretion of IFN-?. Lactococcus lactis subsp. lactis JCM5805 (JCM5805) is a strain of lactic acid bacteria (LAB) that activates murine and human pDCs to express type I and type III interferons (IFNs). JCM5805 has also been shown to activate pDCs via a Toll-like receptor 9 (TLR9) dependent pathway. In this study, we investigated the anti-viral effects of oral administration of JCM5805 using a mouse model of murine parainfluenza virus (mPIV1) infection. JCM5805-fed mice showed a drastic improvement in survival rate, prevention of weight loss, and reduction in lung histopathology scores compared to control mice. We further examined the mechanism of anti-viral effects elicited by JCM5805 administration using naive mice. Microscopic observations showed that JCM5805 was incorporated into CD11c+ immune cells in Peyer’s patches (PP) and PP pDCs were significantly activated and the expression levels of IFNs were significantly increased. Interestingly, nevertheless resident pDCs at lung were not activated and expressions levels of IFNs at whole lung tissue were not influenced, the expressions of anti-viral factors induced by IFNs, such as Isg15, Oasl2, and Viperin, at lung were up-regulated in JCM5805-fed mice compared to control mice. Therefore expressed IFNs from intestine might be delivered to lung and IFN stimulated genes might be induced. Furthermore, elevated expressions of type I IFNs from lung lymphocytes were observed in response to mPIV1 ex vivo stimulation in JCM5805-fed mice compared to control. This might be due to increased ratio of pDCs located in lung were significantly increased in JCM5805 group. Taken together, a specific LAB strain might be able to affect anti-viral immunological profile in lung via activation of intestinal pDC leading to enhanced anti-viral phenotype in vivo. PMID:25746923

  11. Oral Administration of Lactococcus lactis Subsp. lactis JCM5805 Enhances Lung Immune Response Resulting in Protection from Murine Parainfluenza Virus Infection.

    PubMed

    Jounai, Kenta; Sugimura, Tetsu; Ohshio, Konomi; Fujiwara, Daisuke

    2015-01-01

    When activated by viral infection, plasmacytoid dendritic cells (pDCs) play a primary role in the immune response through secretion of IFN-?. Lactococcus lactis subsp. lactis JCM5805 (JCM5805) is a strain of lactic acid bacteria (LAB) that activates murine and human pDCs to express type I and type III interferons (IFNs). JCM5805 has also been shown to activate pDCs via a Toll-like receptor 9 (TLR9) dependent pathway. In this study, we investigated the anti-viral effects of oral administration of JCM5805 using a mouse model of murine parainfluenza virus (mPIV1) infection. JCM5805-fed mice showed a drastic improvement in survival rate, prevention of weight loss, and reduction in lung histopathology scores compared to control mice. We further examined the mechanism of anti-viral effects elicited by JCM5805 administration using naive mice. Microscopic observations showed that JCM5805 was incorporated into CD11c+ immune cells in Peyer's patches (PP) and PP pDCs were significantly activated and the expression levels of IFNs were significantly increased. Interestingly, nevertheless resident pDCs at lung were not activated and expressions levels of IFNs at whole lung tissue were not influenced, the expressions of anti-viral factors induced by IFNs, such as Isg15, Oasl2, and Viperin, at lung were up-regulated in JCM5805-fed mice compared to control mice. Therefore expressed IFNs from intestine might be delivered to lung and IFN stimulated genes might be induced. Furthermore, elevated expressions of type I IFNs from lung lymphocytes were observed in response to mPIV1 ex vivo stimulation in JCM5805-fed mice compared to control. This might be due to increased ratio of pDCs located in lung were significantly increased in JCM5805 group. Taken together, a specific LAB strain might be able to affect anti-viral immunological profile in lung via activation of intestinal pDC leading to enhanced anti-viral phenotype in vivo. PMID:25746923

  12. Physiology, metabolism Carbamoyl-phosphate synthetases (CPS)

    E-print Network

    Boyer, Edmond

    , Enterococcus faecalis, Lactococcus lactis and Lactobacillus delbrueckii ssp. lactis). Only L. plantarum les 4 bactéries lactiques étudiées (Lactobacillus plantarum, Enterococcus faecalis, Lactococcus lactis and E. faecalis is encoded by genes within the pyr operon, and genes dispersed within the chromosome

  13. Cloning of the Lactococcus lactis adhE Gene, Encoding a Multifunctional Alcohol Dehydrogenase, by Complementation of a Fermentative Mutant of Escherichia coli

    PubMed Central

    Arnau, José; Jørgensen, Flemming; Madsen, Søren M.; Vrang, Astrid; Israelsen, Hans

    1998-01-01

    The Lactococcus lactis adhE gene, which encodes a multifunctional alcohol dehydrogenase, has been cloned and characterized. A DNA fragment encoding the putative alcohol dehydrogenase domain of the AdhE protein was cloned by screening an L. lactis genomic library in a fermentative mutant of Escherichia coli and selecting for the ability to grow anaerobically. Further analysis of the clone obtained allowed the cloning of the entire adhE gene sequence. Analysis of adhE expression in L. lactis during anaerobiosis showed induction at the transcriptional level, especially in medium containing glucose. Constructed mutant strains produced reduced amounts of ethanol under anaerobic conditions. With the L. lactis gene as a probe, adhE homologs were found in other industrially relevant lactic acid bacteria. PMID:9620952

  14. Characterization of KlGRR1 and SMS1 Genes, Two New Elements of the Glucose Signaling Pathway of Kluyveromyces lactis

    Microsoft Academic Search

    Martina Hnatova; Micheline Wesolowski-Louvel; G. Dieppois; J. Deffaud; M. Lemaire

    2008-01-01

    The expression of the major glucose transporter gene, RAG1, is induced by glucose in Kluyveromyces lactis. This regulation involves several pathways, including one that is similar to Snf3\\/Rgt2-ScRgt1 in Saccharomyces cerevisiae. We have identified missing key components of the K. lactis glucose signaling pathway by comparison to the same pathway of S. cerevisiae. We characterized a new mutation, rag19, which

  15. Variable Bacteriocin Production in the Commercial Starter Lactococcus lactis DPC4275 Is Linked to the Formation of the Cointegrate Plasmid pMRC02

    Microsoft Academic Search

    Maeve Trotter; Olivia E. McAuliffe; Gerald F. Fitzgerald; Colin Hill; R. Paul Ross; Aidan Coffey

    2004-01-01

    Lactococcus lactis DPC4275 is a bacteriocin-producing transconjugant of the industrial starter strain DPC4268. Strain DPC4275 was generated through conjugal transfer by mating DPC4268 with L. lactis MG1363 containing the 60-kb plasmid pMRC01, which encodes the genetic determinants for the lantibiotic lacticin 3147 and for a phage resistance mechanism of the abortive infection type. The many significant applications of this strain

  16. Malonate-bound structure of the glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) and characterization of the native Fe[superscript 2+] metal-ion preference

    SciTech Connect

    Jackson, Colin J.; Hadler, Kieran S.; Carr, Paul D.; Oakley, Aaron J.; Yip, Sylvia; Schenk, Gerhard; Ollis, David L. (Queensland); (ANU)

    2011-09-28

    The structure of a malonate-bound form of the glycerophosphodiesterase from Enterobacter aerogenes, GpdQ, has been refined at a resolution of 2.2 {angstrom} to a final R factor of 17.1%. The structure was originally solved to 2.9 {angstrom} resolution using SAD phases from Zn{sup 2+} metal ions introduced into the active site of the apoenzyme [Jackson et al. (2007), J. Mol. Biol. 367, 1047-1062]. However, the 2.9 {angstrom} resolution was insufficient to discern significant details of the architecture of the binuclear metal centre that constitutes the active site. Furthermore, kinetic analysis revealed that the enzyme lost a significant amount of activity in the presence of Zn2+, suggesting that it is unlikely to be a catalytically relevant metal ion. In this communication, a higher resolution structure of GpdQ is presented in which malonate is visibly coordinated in the active site and analysis of the native metal-ion preference is presented using atomic absorption spectroscopy and anomalous scattering. Catalytic implications of the structure and its Fe{sup 2+} metal-ion preference are discussed.

  17. Malonate-bound structure of the glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) and characterization of the native Fe[supscript 2+] metal-ion preference

    SciTech Connect

    Jackson, Colin J.; Hadler, Kieran S.; Carr, Paul D.; Oakley, Aaron J.; Yip, Sylvia; Schenk, Gerhard; Ollis, David L. (Queensland); (ANU)

    2010-09-20

    The structure of a malonate-bound form of the glycerophosphodiesterase from Enterobacter aerogenes, GpdQ, has been refined at a resolution of 2.2 {angstrom} to a final R factor of 17.1%. The structure was originally solved to 2.9 {angstrom} resolution using SAD phases from Zn{sup 2+} metal ions introduced into the active site of the apoenzyme [Jackson et al. (2007), J. Mol. Biol. 367, 1047-1062]. However, the 2.9 {angstrom} resolution was insufficient to discern significant details of the architecture of the binuclear metal centre that constitutes the active site. Furthermore, kinetic analysis revealed that the enzyme lost a significant amount of activity in the presence of Zn{sup 2+}, suggesting that it is unlikely to be a catalytically relevant metal ion. In this communication, a higher resolution structure of GpdQ is presented in which malonate is visibly coordinated in the active site and analysis of the native metal-ion preference is presented using atomic absorption spectroscopy and anomalous scattering. Catalytic implications of the structure and its Fe{sup 2+} metal-ion preference are discussed.

  18. Malonate-bound structure of the glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) and characterization of the native Fe2+ metal-ion preference

    PubMed Central

    Jackson, Colin J.; Hadler, Kieran S.; Carr, Paul D.; Oakley, Aaron J.; Yip, Sylvia; Schenk, Gerhard; Ollis, David L.

    2008-01-01

    The structure of a malonate-bound form of the glycerophosphodiesterase from Enterobacter aerogenes, GpdQ, has been refined at a resolution of 2.2?Å to a final R factor of 17.1%. The structure was originally solved to 2.9?Å resolution using SAD phases from Zn2+ metal ions introduced into the active site of the apoenzyme [Jackson et al. (2007 ?), J. Mol. Biol. 367, 1047–1062]. However, the 2.9?Å resolution was insufficient to discern significant details of the architecture of the binuclear metal centre that constitutes the active site. Furthermore, kinetic analysis revealed that the enzyme lost a significant amount of activity in the presence of Zn2+, suggesting that it is unlikely to be a catalytically relevant metal ion. In this communication, a higher resolution structure of GpdQ is presented in which malonate is visibly coordinated in the active site and analysis of the native metal-ion preference is presented using atomic absorption spectroscopy and anomalous scattering. Catalytic implications of the structure and its Fe2+ metal-ion preference are discussed. PMID:18678932

  19. Analysis of a Soluble (UreD:UreF:UreG)2 Accessory Protein Complex and Its Interactions with Klebsiella aerogenes Urease by Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Farrugia, Mark A.; Han, Linjie; Zhong, Yueyang; Boer, Jodi L.; Ruotolo, Brandon T.; Hausinger, Robert P.

    2013-09-01

    Maturation of the nickel-containing urease of Klebsiella aerogenes is facilitated by the UreD, UreF, and UreG accessory proteins along with the UreE metallo-chaperone. A fusion of the maltose binding protein and UreD (MBP-UreD) was co-isolated with UreF and UreG in a soluble complex possessing a (MBP-UreD:UreF:UreG)2 quaternary structure. Within this complex a UreF:UreF interaction was identified by chemical cross-linking of the amino termini of its two UreF protomers, as shown by mass spectrometry of tryptic peptides. A pre-activation complex was formed by the interaction of (MBP-UreD:UreF:UreG)2 and urease. Mass spectrometry of intact protein species revealed a pathway for synthesis of the urease pre-activation complex in which individual hetero-trimer units of the (MBP-UreD:UreF:UreG)2 complex bind to urease. Together, these data provide important new insights into the structures of protein complexes associated with urease activation.

  20. Reduced Lysis upon Growth of Lactococcus lactis on Galactose Is a Consequence of Decreased Binding of the Autolysin AcmA?

    PubMed Central

    Steen, Anton; Buist, Girbe; Kramer, Naomi E.; Jalving, Ruud; Benus, Germaine F. J. D.; Venema, Gerard; Kuipers, Oscar P.; Kok, Jan

    2008-01-01

    When Lactococcus lactis subsp. lactis IL1403 or L. lactis subsp. cremoris MG1363 is grown in a medium with galactose as the carbon source, the culture lyses to a lesser extent in stationary phase than when the bacteria are grown in a medium containing glucose. Expression of AcmA, the major autolysin of L. lactis, is not influenced by the carbon source. Binding studies with a fusion protein consisting of the MSA2 protein of Plasmodium falciparum and the C-terminal peptidoglycan-binding domain of AcmA revealed that cell walls of cells from both subspecies grown on galactose bind less AcmA than cell walls of cells grown on glucose. Cells grown on glucose or galactose and treated with trichloroacetic acid prior to AcmA binding bind similar amounts of AcmA. Analysis of the composition of the lipoteichoic acids (LTAs) of L. lactis IL1403 cells grown on glucose or galactose showed that the LTA composition is influenced by the carbon source: cells grown on galactose contain LTA with less galactose than cells grown on glucose. In conclusion, growth of L. lactis on galactose changes the LTA composition in the cell wall in such a way that less AcmA is able to bind to the peptidoglycan, resulting in a decrease in autolysis. PMID:18539791

  1. Effects of Intranasal Administration of a Leptin-Secreting Lactococcus lactis Recombinant on Food Intake, Body Weight, and Immune Response of Mice?

    PubMed Central

    Bermúdez-Humarán, Luis G.; Nouaille, Sébastien; Zilberfarb, Vladimir; Corthier, Gérard; Gruss, Alexandra; Langella, Philippe; Issad, Tarik

    2007-01-01

    Leptin is an adipocyte-derived pleiotropic hormone that modulates a large number of physiological functions, including control of body weight and regulation of the immune system. In this work, we show that a recombinant strain of the food-grade lactic acid bacterium Lactococcus lactis (LL-lep) can produce and efficiently secrete human leptin. The secreted leptin is a fully biologically active hormone, as demonstrated by its capacity to stimulate a STAT3 reporter gene in HEK293 cells transfected with the Ob-Rb leptin receptor. The immunomodulatory activity of leptin-secreting L. lactis was evaluated in vivo by coexpression with the human papillomavirus type 16 E7 protein. In C57BL/6 mice immunized intranasally with a recombinant L. lactis strain coproducing leptin and E7 antigen, the adaptive immune response was significantly higher than in mice immunized with recombinant L. lactis producing only E7 antigen, demonstrating adjuvanticity of leptin. We then analyzed the effects of intranasally administered LL-lep in obese ob/ob mice. We observed that daily administration of LL-lep to these mice significantly reduced body weight gain and food intake. These results demonstrate that leptin can be produced and secreted in an active form by L. lactis and that leptin-producing L. lactis regulates in vivo antigen-specific immune responses, as well as body weight and food consumption. PMID:17601816

  2. Inducible Amplification of Gene Copy Number and Heterologous Protein Production in the Yeast Kluyveromyces lactis

    PubMed Central

    Morlino, Giovanni B.; Tizzani, Lorenza; Fleer, Reinhard; Frontali, Laura; Bianchi, Michele M.

    1999-01-01

    Heterologous protein production can be doubled by increasing the copy number of the corresponding heterologous gene. We constructed a host-vector system in the yeast Kluyveromyces lactis that was able to induce copy number amplification of pKD1 plasmid-based vectors upon expression of an integrated copy of the plasmid recombinase gene. We increased the production and secretion of two heterologous proteins, glucoamylase from the yeast Arxula adeninivorans and mammalian interleukin-1?, following gene dosage amplification when the heterologous genes were carried by pKD1-based vectors. The choice of the promoters for expression of the integrated recombinase gene and of the episomal heterologous genes are critical for the mitotic stability of the host-vector system. PMID:10543790

  3. Inducible amplification of gene copy number and heterologous protein production in the yeast Kluyveromyces lactis.

    PubMed

    Morlino, G B; Tizzani, L; Fleer, R; Frontali, L; Bianchi, M M

    1999-11-01

    Heterologous protein production can be doubled by increasing the copy number of the corresponding heterologous gene. We constructed a host-vector system in the yeast Kluyveromyces lactis that was able to induce copy number amplification of pKD1 plasmid-based vectors upon expression of an integrated copy of the plasmid recombinase gene. We increased the production and secretion of two heterologous proteins, glucoamylase from the yeast Arxula adeninivorans and mammalian interleukin-1beta, following gene dosage amplification when the heterologous genes were carried by pKD1-based vectors. The choice of the promoters for expression of the integrated recombinase gene and of the episomal heterologous genes are critical for the mitotic stability of the host-vector system. PMID:10543790

  4. Natural sweetening of food products by engineering Lactococcus lactis for glucose production.

    PubMed

    Pool, Wietske A; Neves, Ana Rute; Kok, Jan; Santos, Helena; Kuipers, Oscar P

    2006-09-01

    We show that sweetening of food products by natural fermentation can be achieved by a combined metabolic engineering and transcriptome analysis approach. A Lactococcus lactis ssp. cremoris strain was constructed in which glucose metabolism was completely disrupted by deletion of the genes coding for glucokinase (glk), EII(man/glc) (ptnABCD), and the newly discovered glucose-PTS EII(cel) (ptcBAC). After introducing the lactose metabolic genes, the deletion strain could solely ferment the galactose moiety of lactose, while the glucose moiety accumulated extracellularly. Additionally, less lactose remained in the medium after fermentation. The resulting strain can be used for in situ production of glucose, circumventing the need to add sweeteners as additional ingredients to dairy products. Moreover, the enhanced removal of lactose achieved by this strain could be very useful in the manufacture of products for lactose intolerant individuals. PMID:16844396

  5. Molecular Insights on the Recognition of a Lactococcus lactis Cell Wall Pellicle by the Phage 1358 Receptor Binding Protein

    PubMed Central

    Farenc, Carine; Spinelli, Silvia; Vinogradov, Evgeny; Tremblay, Denise; Blangy, Stéphanie; Sadovskaya, Irina

    2014-01-01

    ABSTRACT The Gram-positive bacterium Lactococcus lactis is used for the production of cheeses and other fermented dairy products. Accidental infection of L. lactis cells by virulent lactococcal tailed phages is one of the major risks of fermentation failures in industrial dairy factories. Lactococcal phage 1358 possesses a host range limited to a few L. lactis strains and strong genomic similarities to Listeria phages. We report here the X-ray structures of phage 1358 receptor binding protein (RBP) in complex with monosaccharides. Each monomer of its trimeric RBP is formed of two domains: a “shoulder” domain linking the RBP to the rest of the phage and a jelly roll fold “head/host recognition” domain. This domain harbors a saccharide binding crevice located in the middle of a monomer. Crystal structures identified two sites at the RBP surface, ?8 ? from each other, one accommodating a GlcNAc monosaccharide and the other accommodating a GlcNAc or a glucose 1-phosphate (Glc1P) monosaccharide. GlcNAc and GlcNAc1P are components of the polysaccharide pellicle that we identified at the cell surface of L. lactis SMQ-388, the host of phage 1358. We therefore modeled a galactofuranose (Galf) sugar bridging the two GlcNAc saccharides, suggesting that the trisaccharidic motif GlcNAc-Galf-GlcNAc (or Glc1P) might be common to receptors of genetically distinct lactococcal phages p2, TP091-1, and 1358. Strain specificity might therefore be elicited by steric clashes induced by the remaining components of the pellicle hexasaccharide. Taken together, these results provide a first insight into the molecular mechanism of host receptor recognition by lactococcal phages. IMPORTANCE Siphophages infecting the Gram-positive bacterium Lactococcus lactis are sources of milk fermentation failures in the dairy industry. We report here the structure of the pellicle polysaccharide from L. lactis SMQ-388, the specific host strain of phage 1358. We determined the X-ray structures of the lytic lactococcal phage 1358 receptor binding protein (RBP) in complex with monosaccharides. The positions and nature of monosaccharides bound to the RBP are in agreement with the pellicle structure and suggest a general binding mode of lactococcal phages to their pellicle saccharidic receptor. PMID:24719416

  6. Biosynthesis and stereochemical configuration of N5-(1-carboxyethyl)ornithine. An unusual amino acid produced by Streptococcus lactis

    SciTech Connect

    Miller, S.P.; Thompson, J.

    1987-11-25

    In a recent communication we described the purification and characterization of N5-(1-carboxyethyl)ornithine from cells of Streptococcus lactis 133. This unusual amino acid has not previously been found in nature. Radiotracer experiments presented here reveal that exogenous (/sup 14/C)ornithine serves as the precursor for biosynthesis of (/sup 14/C)arginine, (/sup 14/C)N5-(1-carboxyethyl)ornithine, and (/sup 14/C)N5-acetylornithine by cells of S. lactis K1 during growth in a defined medium lacking arginine. In the absence of both arginine and ornithine, cells of S. lactis K1 can also generate intracellular (/sup 14/C)N5-(1-carboxyethyl)ornithine from exogenous (/sup 14/C)glutamic acid. Previously we showed that the properties of N5-(1-carboxyethyl)ornithine prepared from S. lactis were identical to one of the two diastereomers (2S, 7S) or (2S, 7R) present in a synthetic preparation of (2S, 7RS)-N5-(1-carboxyethyl)ornithine. The two diastereomers have now been unambiguously synthesized by an Abderhalden-Haase condensation between (2S)-N2-t-butoxycarbonyl-ornithine and the chiral (2S)-, and (2R)-bromopropionates. By /sup 13/C-NMR spectroscopy it has been established that the preparation from S. lactis is exclusively (2S, 7S)-N5-(1-carboxyethyl)ornithine. has been demonstrated in a cell-free extract of S. lactis 133. The requirements for ornithine, pyruvic acid, and NAD(P)H suggest that biosynthesis of N5-(1-carboxyethyl)ornithine occurs via a reductive condensation mechanism. A general survey revealed that N5-(1-carboxyethyl)ornithine was produced only by certain strains of Group N streptococci. These findings may indicate a plasmid locus for the gene(s) encoding the enzyme(s) for N5-(1-carboxyethyl)ornithine biosynthesis.

  7. SOD1, a New Kluyveromyces lactis Helper Gene for Heterologous Protein Secretion?

    PubMed Central

    Raimondi, S.; Zanni, E.; Talora, C.; Rossi, M.; Palleschi, C.; Uccelletti, D.

    2008-01-01

    Bottlenecks in protein expression and secretion often limit the development of industrial processes. By manipulating chaperone and foldase levels, improvements in yeast secretion were found for a number of proteins. Recently, sustained endoplasmic reticulum stress, occurring due to recombinant protein production, was reported to cause oxidative stress in yeast. Saccharomyces cerevisiae cells are able to trigger an adaptive response to oxidative-stress conditions, resulting in the upregulation of both primary and secondary antioxidant defenses. SOD1 encodes for a superoxide dismutase that catalyzes the dismutation of superoxide anions (O2?) into oxygen and hydrogen peroxide. It is a Cu2+/Zn2+ metalloenzyme and represents an important antioxidant defense in nearly all aerobic and aerotolerant organisms. We found that overexpression of the Kluyveromyces lactis SOD1 (KlSOD1) gene was able to increase the production of two different heterologous proteins, human serum albumin (HSA) and glucoamylase from Arxula adeninivorans. In addition, KlSOD1 overexpression led to a significant decrease in the amount of reactive oxygen species (ROS) that originated during protein production. The yield of HSA also increased when K. lactis cells were grown in the presence of the antioxidant agent ascorbic acid and decreased when cells were challenged with menadione, a ROS generator compound. Moreover, we observed that, in high-osmolarity medium, cells overexpressing KlSOD1 showed higher growth rates than control cells. Our results thus further support the notion that the production of some heterologous proteins may be improved by manipulating genes involved in general stress responses. PMID:18836000

  8. SOD1, a new Kluyveromyces lactis helper gene for heterologous protein secretion.

    PubMed

    Raimondi, S; Zanni, E; Talora, C; Rossi, M; Palleschi, C; Uccelletti, D

    2008-12-01

    Bottlenecks in protein expression and secretion often limit the development of industrial processes. By manipulating chaperone and foldase levels, improvements in yeast secretion were found for a number of proteins. Recently, sustained endoplasmic reticulum stress, occurring due to recombinant protein production, was reported to cause oxidative stress in yeast. Saccharomyces cerevisiae cells are able to trigger an adaptive response to oxidative-stress conditions, resulting in the upregulation of both primary and secondary antioxidant defenses. SOD1 encodes for a superoxide dismutase that catalyzes the dismutation of superoxide anions (O(2)(-)) into oxygen and hydrogen peroxide. It is a Cu(2+)/Zn(2+) metalloenzyme and represents an important antioxidant defense in nearly all aerobic and aerotolerant organisms. We found that overexpression of the Kluyveromyces lactis SOD1 (KlSOD1) gene was able to increase the production of two different heterologous proteins, human serum albumin (HSA) and glucoamylase from Arxula adeninivorans. In addition, KlSOD1 overexpression led to a significant decrease in the amount of reactive oxygen species (ROS) that originated during protein production. The yield of HSA also increased when K. lactis cells were grown in the presence of the antioxidant agent ascorbic acid and decreased when cells were challenged with menadione, a ROS generator compound. Moreover, we observed that, in high-osmolarity medium, cells overexpressing KlSOD1 showed higher growth rates than control cells. Our results thus further support the notion that the production of some heterologous proteins may be improved by manipulating genes involved in general stress responses. PMID:18836000

  9. How recombinant swollenin from Kluyveromyces lactis affects cellulosic substrates and accelerates their hydrolysis

    PubMed Central

    2011-01-01

    Background In order to generate biofuels, insoluble cellulosic substrates are pretreated and subsequently hydrolyzed with cellulases. One way to pretreat cellulose in a safe and environmentally friendly manner is to apply, under mild conditions, non-hydrolyzing proteins such as swollenin - naturally produced in low yields by the fungus Trichoderma reesei. To yield sufficient swollenin for industrial applications, the first aim of this study is to present a new way of producing recombinant swollenin. The main objective is to show how swollenin quantitatively affects relevant physical properties of cellulosic substrates and how it affects subsequent hydrolysis. Results After expression in the yeast Kluyveromyces lactis, the resulting swollenin was purified. The adsorption parameters of the recombinant swollenin onto cellulose were quantified for the first time and were comparable to those of individual cellulases from T. reesei. Four different insoluble cellulosic substrates were then pretreated with swollenin. At first, it could be qualitatively shown by macroscopic evaluation and microscopy that swollenin caused deagglomeration of bigger cellulose agglomerates as well as dispersion of cellulose microfibrils (amorphogenesis). Afterwards, the effects of swollenin on cellulose particle size, maximum cellulase adsorption and cellulose crystallinity were quantified. The pretreatment with swollenin resulted in a significant decrease in particle size of the cellulosic substrates as well as in their crystallinity, thereby substantially increasing maximum cellulase adsorption onto these substrates. Subsequently, the pretreated cellulosic substrates were hydrolyzed with cellulases. Here, pretreatment of cellulosic substrates with swollenin, even in non-saturating concentrations, significantly accelerated the hydrolysis. By correlating particle size and crystallinity of the cellulosic substrates with initial hydrolysis rates, it could be shown that the swollenin-induced reduction in particle size and crystallinity resulted in high cellulose hydrolysis rates. Conclusions Recombinant swollenin can be easily produced with the robust yeast K. lactis. Moreover, swollenin induces deagglomeration of cellulose agglomerates as well as amorphogenesis (decrystallization). For the first time, this study quantifies and elucidates in detail how swollenin affects different cellulosic substrates and their hydrolysis. PMID:21943248

  10. Genetic and Physiological Responses of Bifidobacterium animalis subsp. lactis to Hydrogen Peroxide Stress

    PubMed Central

    Oberg, Taylor S.; Ward, Robert E.; Steele, James L.

    2013-01-01

    Consumer interest in probiotic bifidobacteria is increasing, but industry efforts to secure high cell viability in foods is undermined by these anaerobes' sensitivity to oxidative stress. To address this limitation, we investigated genetic and physiological responses of two fully sequenced Bifidobacterium animalis subsp. lactis strains, BL-04 and DSM 10140, to hydrogen peroxide (H2O2) stress. Although the genome sequences for these strains are highly clonal, prior work showed that they differ in both intrinsic and inducible H2O2 resistance. Transcriptome analysis of early-stationary-phase cells exposed to a sublethal H2O2 concentration detected significant (P < 0.05) changes in expression of 138 genes in strain BL-04 after 5 min and 27 genes after 20 min. Surprisingly, no significant changes in gene expression were detected in DSM 10140 at either time. Genomic data suggested that differences in H2O2 stress resistance might be due to a mutation in a BL-04 gene encoding long-chain fatty acid coenzyme A (CoA) ligase. To explore this possibility, membrane fatty acids were isolated and analyzed by gas chromatography-mass spectrometry (GC-MS). Results confirmed that the strains had significantly different lipid profiles: the BL-04 membrane contained higher percentages of C14:0 and C16:0 and lower percentages of C18:1n9. Alteration of the DSM 10140 membrane lipid composition using modified growth medium to more closely mimic that of BL-04 yielded cells that showed increased intrinsic resistance to lethal H2O2 challenge but did not display an inducible H2O2 stress response. The results show that deliberate stress induction or membrane lipid modification can be employed to significantly improve H2O2 resistance in B. animalis subsp. lactis strains. PMID:23772066

  11. Rerouting citrate metabolism in Lactococcus lactis to citrate-driven transamination.

    PubMed

    Pudlik, Agata M; Lolkema, Juke S

    2012-09-01

    Oxaloacetate is an intermediate of the citrate fermentation pathway that accumulates in the cytoplasm of Lactococcus lactis ILCitM(pFL3) at a high concentration due to the inactivation of oxaloacetate decarboxylase. An excess of toxic oxaloacetate is excreted into the medium in exchange for citrate by the citrate transporter CitP (A. M. Pudlik and J. S. Lolkema, J. Bacteriol. 193:4049-4056, 2011). In this study, transamination of amino acids with oxaloacetate as the keto donor is described as an additional mechanism to relieve toxic stress. Redirection of the citrate metabolic pathway into the transamination route in the presence of the branched-chain amino acids Ile, Leu, and Val; the aromatic amino acids Phe, Trp, and Tyr; and Met resulted in the formation of aspartate and the corresponding ?-keto acids. Cells grown in the presence of citrate showed 3.5 to 7 times higher transaminase activity in the cytoplasm than cells grown in the absence of citrate. The study demonstrates that transaminases of L. lactis accept oxaloacetate as a keto donor. A significant fraction of 2-keto-4-methylthiobutyrate formed from methionine by citrate-driven transamination in vivo was further metabolized, yielding the cheese aroma compounds 2-hydroxy-4-methylthiobutyrate and methyl-3-methylthiopropionate. Reducing equivalents required for the former compound were produced in the citrate fermentation pathway as NADH. Similarly, phenylpyruvate, the transamination product of phenylalanine, was reduced to phenyllactate, while the dehydrogenase activity was not observed for the branched-chain keto acids. Both ?-keto acids and ?-hydroxy acids are known substrates of CitP and may be excreted from the cell in exchange for citrate or oxaloacetate. PMID:22798354

  12. Lactococcus lactis as an adjuvant and delivery vehicle of antigens against pneumococcal respiratory infections

    PubMed Central

    Vintiñi, Elisa; Villena, Julio; Raya, Raul

    2010-01-01

    Most studies of Lactococcus lactis as delivery vehicles of pneumococcal antigens are focused on the effectiveness of mucosal recombinant vaccines against Streptococcus pneumoniae in animal models. At present, there are three types of pneumococcal vaccines: capsular polysaccharide pneumococcal vaccines (PPV), protein-polysaccharide conjugate pneumococcal vaccines (PCV) and protein-based pneumococcal vaccines (PBPV). Only PPV and PCV have been licensed. These vaccines, however, do not represent a definitive solution. Novel, safe and inexpensive vaccines are necessary, especially in developing countries. Probiotic microorganisms such as lactic acid bacteria (LAB) are an interesting alternative for their use as vehicles in pneumococcal vaccines due to their GRAS (Generally Recognized As Safe) status. Thus, the adjuvanticity of Lactococcus lactis by itself represents added value over the use of other bacteria, a question dealt with in this review. In addition, the expression of different pneumococcal antigens as well as the use of oral and nasal mucosal routes of administration of lactococcal vaccines is considered. The advantages of nasal live vaccines are evident; nonetheless, oral vaccines can be a good alternative when the adequate dose is used. Another point addressed here is the use of live versus inactivated vaccines. In this sense, few researchers have focused on inactivated strains to be used as vaccines against pneumoccoccus. The immunogenicity of live vaccines is better than the one afforded by inactivated ones; however, the probiotic-inactivated vaccine combination has improved this matter considerably. The progress made so far in the protective immune response induced by recombinant vaccines, the successful trials in animal models and the safety considerations of their application in humans suggest that the use of recombinant vaccines represents a good short-term option in the control of pneumococcal diseases. PMID:21326831

  13. Pilus Biogenesis in Lactococcus lactis: Molecular Characterization and Role in Aggregation and Biofilm Formation

    PubMed Central

    Oxaran, Virginie; Ledue-Clier, Florence; Dieye, Yakhya; Herry, Jean-Marie; Péchoux, Christine; Meylheuc, Thierry; Briandet, Romain; Juillard, Vincent; Piard, Jean-Christophe

    2012-01-01

    The genome of Lactococcus lactis strain IL1403 harbors a putative pilus biogenesis cluster consisting of a sortase C gene flanked by 3 LPxTG protein encoding genes (yhgD, yhgE, and yhhB), called here pil. However, pili were not detected under standard growth conditions. Over-expression of the pil operon resulted in production and display of pili on the surface of lactococci. Functional analysis of the pilus biogenesis machinery indicated that the pilus shaft is formed by oligomers of the YhgE pilin, that the pilus cap is formed by the YhgD pilin and that YhhB is the basal pilin allowing the tethering of the pilus fibers to the cell wall. Oligomerization of pilin subunits was catalyzed by sortase C while anchoring of pili to the cell wall was mediated by sortase A. Piliated L. lactis cells exhibited an auto-aggregation phenotype in liquid cultures, which was attributed to the polymerization of major pilin, YhgE. The piliated lactococci formed thicker, more aerial biofilms compared to those produced by non-piliated bacteria. This phenotype was attributed to oligomers of YhgE. This study provides the first dissection of the pilus biogenesis machinery in a non-pathogenic Gram-positive bacterium. Analysis of natural lactococci isolates from clinical and vegetal environments showed pili production under standard growth conditions. The identification of functional pili in lactococci suggests that the changes they promote in aggregation and biofilm formation may be important for the natural lifestyle as well as for applications in which these bacteria are used. PMID:23236417

  14. Effects of temperature and pH on the catalytic activity of the immobilized ?-galactosidase from Kluyveromyces lactis

    Microsoft Academic Search

    Quinn Z. K Zhou; Xiao Dong Chen

    2001-01-01

    A study of the cross-linking immobilization of ?-galactosidase from Kluyveromyces lactis on graphite surfaces is reported here. The cross-linking reagent was glutaraldehyde. Thermal deactivation of the immobilized enzyme at the temperatures from 35 to 55°C was investigated, and the deactivation rate was found to follow the Arrhenius law with the activation energy of about 200kJmol?1 for the deactivation of the

  15. Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis

    Microsoft Academic Search

    Dominique Swennen; Laurence Vernis; Jean-Marie Beckerich; Alain Fournier; Claude Gaillardin

    2002-01-01

    Yarrowia lipolytica and Kluyveromyces lactis secretion vectors were constructed and assessed for the expression of heterologous proteins. An anti- Ras single-chain antibody fragment (scFv) coding sequence was fused in-frame to different pre- or prepro-regions, or downstream from a reporter secretory gene (Arxula adeninivorans glucoamylase), separated by a Kex2 protease (Kex2p)-like processing sequence. Both organisms are able to secrete soluble scFv,

  16. Expression of a hepatitis A virus antigen in Lactococcus lactis and Escherichia coli and evaluation of its immunogenicity.

    PubMed

    Berlec, Aleš; Malovrh, Tadej; Zadravec, Petra; Steyer, Andrej; Ravnikar, Matjaž; Saboti?, Jerica; Poljšak-Prijatelj, Mateja; Štrukelj, Borut

    2013-05-01

    An epidemic shift in Hepatitis A virus (HAV) infection has been observed in recent years in rapidly developing countries, with increasing numbers of severe adult cases which has led to renewed interest in vaccination. Our approach in vaccine development uses recombinant expression of the highly immunogenic HAV antigen VP1-P2a in food-grade lactic acid bacterium Lactococcus lactis and in Escherichia coli. We used genetic constructs that enable nisin-controlled expression of the antigen in L. lactis in three different forms: (a) intracellularly, (b) on the bacterial surface and (c) on the bacterial surface fused with the fragment of the E. coli flagellin molecule that can act as a molecular adjuvant. Expression of the two surface forms of the antigen was achieved in L. lactis, and the resulting antigen-displaying bacteria were administered orally to mice. Half the animals in each of the two groups developed specific IgGs, with titers increasing over time and reaching 1:422 without flagellin and 1:320 with flagellin. A much higher titer 1:25,803 was observed with the parenterally administered antigen, which was purified from E. coli. With the latter, a significant mucosal IgA response was also observed. Despite significant titers, the IgGs elicited with oral or parenteral administration could not prevent HAV from infecting cells in a virus neutralization assay, suggesting that the antibodies cannot recognize viral surface epitopes. Nevertheless, orally administered HAV antigen expressed in L. lactis elicited significant systemic humoral immune response showing the feasibility for development of effective HAV vaccine for mucosal delivery. PMID:23371298

  17. Crystal Structure of the Receptor-Binding Protein Head Domain from Lactococcus lactis Phage bIL170

    Microsoft Academic Search

    Stefano Ricagno; Valerie Campanacci; Stephanie Blangy; Silvia Spinelli; Denise Tremblay; Sylvain Moineau; Mariella Tegoni; Christian Cambillau

    2006-01-01

    Lactococcus lactis, a gram-positive bacterium widely used by the dairy industry, is subject to lytic phage infections. In the first step of infection, phages recognize the host saccharidic receptor using their receptor binding protein (RBP). Here, we report the 2.30-Å-resolution crystal structure of the RBP head domain from phage bIL170. The structure of the head monomer is remarkably close to

  18. Disruption of the OCH1 and MNN1 genes decrease N-glycosylation on glycoprotein expressed in Kluyveromyces lactis.

    PubMed

    Liu, Bo; Gong, Xin; Chang, Shaohong; Yang, Yili; Song, Miao; Duan, Demin; Wang, Lina; Ma, Qingjun; Wu, Jun

    2009-08-20

    Glycoproteins secreted by the yeast Kluyveromyces lactis are usually modified by the addition at asparagines-linked glycosylation sites of heterogeneous mannan residues. The secreted glycoproteins in K. lactis that become hypermannosylated will bear a non-human glycosylation pattern and can adversely affect the half-life, tissue distribution and immunogenicity of a therapeutic protein. Here, we describe engineering a K. lactis strain to produce non-hypermannosylated glycoprotein, decreasing the outer-chain mannose residues of N-linked oligosaccharides. We investigated and developed the method of two-step homologous recombination to knockout the OCH1 gene, encoding alpha1,6-mannosyltransferase and MNN1 gene, which is homologue of Saccharomyces cerevisiae MNN1, encoding a putative alpha1,3-mannosyltransferase. We found the Kloch1 mutant strain has a defect in hyperglycosylation, inability in adding mannose to the core oligosaccharide. The N-linked oligosaccharides assembled on a secretory glycoprotein, HSA/GM-CSF in Kloch1 mutant, contained oligosaccharide Man(13-14)GlcNAc(2), and in Kloch1 mnn1 mutant, contained oligosaccharide Man(9-11)GlcNAc(2), whereas those in the wild-type strain, consisted of oligosaccharides with heterogeneous sizes, Man(>30)GlcNAc(2). Taken together, these results indicated that KlOch1p plays a key role in the outer-chain mannosylation of N-linked oligosaccharides in K. lactis. The KlMnn1p, was proved to be certain contribution to the outer hypermannosylation, most possibly encodes alpha1,3-mannosyltransferase. Therefore, the Kloch1 and Kloch1 mnn1 mutants can be used as a foundational host to produce glycoproteins lacking the outer-chain hypermannoses and further maybe applicable to be a promising system for yeast therapeutic protein production. PMID:19559061

  19. Identification of Candidate Carrier Proteins for Surface Display on Lactococcus lactis by Theoretical and Experimental Analyses of the Surface Proteome? †

    PubMed Central

    Berlec, Aleš; Zadravec, Petra; Jevnikar, Zala; Štrukelj, Borut

    2011-01-01

    Lactococcus lactis is a lactic acid bacterium of proven safety for use in human oral applications. For this purpose, surface display of recombinant proteins is important, and new approaches for it are being sought. Analysis of the bacterial surface proteome is essential in identifying new candidate carrier proteins for surface display. We have made two different predictions of surface-associated proteins of L. lactis MG1363 by using Augur and LocateP software, which yielded 666 and 648 proteins, respectively. Surface proteins of L. lactis NZ9000, a derivative of MG1363, were identified by using a proteomics approach. The surface proteins were cleaved from intact bacteria, and the resulting peptides were identified by mass spectrometry. The latter approach yielded 80 proteins, 34 of which were not predicted by either software. Of the 80 proteins, 7 were selected for further study. These were cloned in frame with a C-terminal hexahistidine tag and overexpressed in L. lactis NZ9000 using nisin-controlled expression. Proteins of correct molecular weight carrying a hexahistidine tag were detected. Their surface localization was confirmed with flow cytometry. Basic membrane protein A (BmpA) was exposed at the highest level. To test BmpA as a candidate carrier protein, the hexahistidine tag was replaced by the B domain of staphylococcal protein A in the genetic construct. The B domain was displayed on the surface with BmpA as a carrier. The advantage of covalent BmpA binding was demonstrated. BmpA was thus shown to be a suitable candidate for a carrier protein in lactococcal surface display. PMID:21183632

  20. A General Method for Selection of ?-Acetolactate Decarboxylase-Deficient Lactococcus lactis Mutants To Improve Diacetyl Formation

    PubMed Central

    Curic, Mirjana; Stuer-Lauridsen, Birgitte; Renault, Pierre; Nilsson, Dan

    1999-01-01

    The enzyme acetolactate decarboxylase (Ald) plays a key role in the regulation of the ?-acetolactate pool in both pyruvate catabolism and the biosynthesis of the branched-chain amino acids, isoleucine, leucine, and valine (ILV). This dual role of Ald, due to allosteric activation by leucine, was used as a strategy for the isolation of Ald-deficient mutants of Lactococcus lactis subsp. lactis biovar diacetylactis. Such mutants can be selected as leucine-resistant mutants in ILV- or IV-prototrophic strains. Most dairy lactococcus strains are auxotrophic for the three amino acids. Therefore, the plasmid pMC004 containing the ilv genes (encoding the enzymes involved in the biosynthesis of IV) of L. lactis NCDO2118 was constructed. Introduction of pMC004 into ILV-auxotrophic dairy strains resulted in an isoleucine-prototrophic phenotype. By plating the strains on a chemically defined medium supplemented with leucine but not valine and isoleucine, spontaneous leucine-resistant mutants were obtained. These mutants were screened by Western blotting with Ald-specific antibodies for the presence of Ald. Selected mutants lacking Ald were subsequently cured of pMC004. Except for a defect in the expression of Ald, the resulting strain, MC010, was identical to the wild-type strain, as shown by Southern blotting and DNA fingerprinting. The mutation resulting in the lack of Ald in MC010 occurred spontaneously, and the strain does not contain foreign DNA; thus, it can be regarded as food grade. Nevertheless, its application in dairy products depends on the regulation of genetically modified organisms. These results establish a strategy to select spontaneous Ald-deficient mutants from transformable L. lactis strains. PMID:10049884

  1. A Plasmodium falciparum GLURP–MSP3 chimeric protein; expression in Lactococcus lactis, immunogenicity and induction of biologically active antibodies

    Microsoft Academic Search

    Michael Theisen; Soe Soe; Katja Brunstedt; Frank Follmann; Lars Bredmose; Hans Israelsen; Søren M Madsen; Pierre Druilhe

    2004-01-01

    Plasmodium falciparum malaria is a major cause of morbidity and mortality worldwide. To evaluate the efficacy of a possible vaccine antigen against P. falciparum infection, a fusion protein, derived from P. falciparum Glutamate-rich protein (GLURP) genetically coupled to P. falciparum Merozoite surface protein 3 (MSP3) was produced in Lactococcus lactis as a secreted recombinant GLURP–MSP3 fusion protein. The hybrid protein

  2. The recombinant Lactococcus lactis oral vaccine induces protection against C. difficile spore challenge in a mouse model.

    PubMed

    Guo, Shanguang; Yan, Weiwei; McDonough, Sean P; Lin, Nengfeng; Wu, Katherine J; He, Hongxuan; Xiang, Hua; Yang, Maosheng; Moreira, Maira Aparecida S; Chang, Yung-Fu

    2015-03-24

    Clostridium difficile infection (CDI) causes nosocomial antibiotic-associated diarrhea and colitis in the developed world. Two potent cytotoxins, toxin A (TcdA) and toxin B (TcdB) are the virulence factors of this disease and can be a good vaccine candidate against CDI. In the present study, we genetically engineered Lactococcus lactis to express the nontoxic, recombinant fragments derived from TcdA and TcdB C-terminal receptor binding domains (Tcd-AC and Tcd-BC) as an oral vaccine candidate. The immunogenicity of the genetically engineered L. lactis oral vaccine delivery system (animal groups LAC and LBC or the combination of both, LACBC) was compared with the recombinant TcdA and TcdB C-terminal receptor binding domain proteins (animal groups PAC and PBC or the combination of both, PACBC), which were expressed and purified from E. coli. After the C. difficile challenge, the control groups received PBS or engineered L. lactis with empty vector, showed severe diarrhea symptoms and died within 2-3 days. However, both the oral vaccine and recombinant protein vaccine groups had significantly lower mortalities, body weight decreases and histopathologic lesions than the control sham-vaccine groups (p<0.05) except group LBC which only had a 31% survival rate after the challenge. The data of post infection survival showed that an average of 86% of animals survived in groups PAC and PACBC, 75% of animals survived in group LACBC, and 65% of animals survived in group LAC. All of the vaccinated animals produced higher titers of both IgG and IgA than the control groups (p<0.05), and the antibodies were able to neutralize the cytopathic effect of toxins in vitro. The results of this study indicate that there is a potential to use L. lactis as a delivery system to develop a cost effective oral vaccine against CDI. PMID:25698490

  3. Effect of Lactococcus garvieae, Lactococcus lactis and Enterococcus faecalis on the behaviour of Staphylococcus aureus in microfiltered milk

    Microsoft Academic Search

    J. Alomar; P. Loubiere; C. Delbes; S. Nouaille; M. C. Montel

    2008-01-01

    The effect of four strains of Lactococcus garvieae, three strains of Lactococcus lactis and one strain of Enterococcus faecalis on Staphylococcus aureus SA15 growth in microfiltered milk was evaluated. Lactococcus and Enterococcus strains were co-cultured with S. aureus in microfiltered milk and in medium buffered at pH 6.8. All Lactococcus and Enterococcus strains were able to inhibit S. aureus growth

  4. Unraveling the Role of Surface Mucus-Binding Protein and Pili in Muco-Adhesion of Lactococcus lactis

    PubMed Central

    Duviau, Marie-Pierre; Meyrand, Mickael; Guérardel, Yann; Castelain, Mickaël; Loubière, Pascal; Chapot-Chartier, Marie-Pierre; Dague, Etienne; Mercier-Bonin, Muriel

    2013-01-01

    Adhesion of bacteria to mucus may favor their persistence within the gut and their beneficial effects to the host. Interactions between pig gastric mucin (PGM) and a natural isolate of Lactococcus lactis (TIL448) were measured at the single-cell scale and under static conditions, using atomic force microscopy (AFM). In parallel, these interactions were monitored at the bacterial population level and under shear flow. AFM experiments with a L. lactis cell-probe and a PGM-coated surface revealed a high proportion of specific adhesive events (60%) and a low level of non-adhesive ones (2%). The strain muco-adhesive properties were confirmed by the weak detachment of bacteria from the PGM-coated surface under shear flow. In AFM, rupture events were detected at short (100?200 nm) and long distances (up to 600?800 nm). AFM measurements on pili and mucus-binding protein defective mutants demonstrated the comparable role played by these two surface proteinaceous components in adhesion to PGM under static conditions. Under shear flow, a more important contribution of the mucus-binding protein than the pili one was observed. Both methods differ by the way of probing the adhesion force, i.e. negative force contact vs. sedimentation and normal-to-substratum retraction vs. tangential detachment conditions, using AFM and flow chamber, respectively. AFM blocking assays with free PGM or O-glycan fractions purified from PGM demonstrated that neutral oligosaccharides played a major role in adhesion of L. lactis TIL448 to PGM. This study dissects L. lactis muco-adhesive phenotype, in relation with the nature of the bacterial surface determinants. PMID:24260308

  5. Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363?

    PubMed Central

    Zomer, Aldert L.; Buist, Girbe; Larsen, Rasmus; Kok, Jan; Kuipers, Oscar P.

    2007-01-01

    Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363?ccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric ?35 sequence at an average position of ?56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative ?35 and ?10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical ?10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism. PMID:17028270

  6. Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis.

    PubMed

    Swennen, Dominique; Paul, Marie-Françoise; Vernis, Laurence; Beckerich, Jean-Marie; Fournier, Alain; Gaillardin, Claude

    2002-01-01

    Yarrowia lipolytica and Kluyveromyces lactis secretion vectors were constructed and assessed for the expression of heterologous proteins. An anti-Ras single-chain antibody fragment (scFv) coding sequence was fused in-frame to different pre- or prepro-regions, or downstream from a reporter secretory gene (Arxula adeninivorans glucoamylase), separated by a Kex2 protease (Kex2p)-like processing sequence. Both organisms are able to secrete soluble scFv, with yields depending on the nature of the expression cassette, up to levels ranging from 10 to 20 mg l(-1). N-terminal sequence analysis of the purified scFv showed that fusions are correctly processed to the mature scFv by a signal peptidase or a Kex2p-type endoprotease present in Y. lipolytica and K. lactis. The scFv protein also retains the capacity to bind to a glutathioneS-transferase (GST)-Harvey-Ras(Val12) fusion, indicating that the antibody is functional. These results indicate that the yeasts Y. lipolytica and K. lactis have potential for industrial production of soluble and active scFv. PMID:11782497

  7. KlPMR1 inactivation and calcium addition enhance secretion of non-hyperglycosylated heterologous proteins in Kluyveromyces lactis.

    PubMed

    Uccelletti, D; Farina, F; Mancini, P; Palleschi, C

    2004-04-01

    The Kluyveromyces lactis KlPMR1 gene is the functional homologue of Saccharomyces cerevisiae PMR1 which encodes a Ca(2+)-ATPase localized in the Golgi apparatus. We studied the effects of KlPMR1 inactivation on the glycosylation and secretion of native and heterologous proteins in K. lactis. We used acid phosphatase, recombinant human serum albumin and alpha-glucoamylase from Arxula adeninivorans as reporter proteins. The Klpmr1Delta strain showed enhanced secretion of the heterologous proteins analyzed; the improved rHSA production did not result from enhanced transcription but rather involved increased translation and/or secretion efficiency. The growth rate of mutant cells resulted slower as compared to that of wild-type strain. The addition of 10mM calcium to the culture medium, however, not only completely relieved the growth defect of the mutant cells but also improved the rate of heterologous proteins production. Moreover, the addition of this ion in the culture medium of K. lactis did not suppress the glycosylation defects; this is an important difference with respect to S. cerevisiae where the glycosylation is partially restored by Ca(2+) addition. The Klpmr1Delta strain as a host offers thus an additional advantage for those cases requiring that the produced recombinant protein would not result hyperglycosylated. PMID:15063617

  8. Improved bioethanol production in an engineered Kluyveromyces lactis strain shifted from respiratory to fermentative metabolism by deletion of NDI1

    PubMed Central

    González-Siso, María Isabel; Touriño, Alba; Vizoso, Ángel; Pereira-Rodríguez, Ángel; Rodríguez-Belmonte, Esther; Becerra, Manuel; Cerdán, María Esperanza

    2015-01-01

    In this paper, we report the metabolic engineering of the respiratory yeast Kluyveromyces lactis by construction and characterization of a null mutant (?klndi1) in the single gene encoding a mitochondrial alternative internal dehydrogenase. Isolated mitochondria of the ?klndi1 mutant show unaffected rate of oxidation of exogenous NADH, but no oxidation of matrix NADH; this confirms that KlNdi1p is the only internal NADH dehydrogenase in K.?lactis mitochondria. Permeabilized cells of the ?klndi1 mutant do not show oxidation of matrix NADH, which suggests that shuttle systems to transfer the NADH from mitochondrial matrix to cytosol, for being oxidized by external dehydrogenases, are not functional. The ?klndi1 mutation decreases the chronological life span in absence of nutrients. The expression of KlNDI1 is increased by glutathione reductase depletion. The ?klndi1 mutation shifts the K.?lactis metabolism from respiratory to fermentative: the ?klndi1 strain shows reduced respiration rate and increased ethanol production from glucose, while it does not grow in non-fermentable carbon sources such as lactate. The biotechnological benefit of the ?klndi1 mutant for bioethanol production from waste cheese whey lactose was proved. PMID:25186243

  9. Efficient production of secreted staphylococcal antigens in a non-lysing and proteolytically reduced Lactococcus lactis strain.

    PubMed

    Neef, Jolanda; Koedijk, Danny G A M; Bosma, Tjibbe; van Dijl, Jan Maarten; Buist, Girbe

    2014-12-01

    Cell surface-exposed and secreted proteins are attractive targets for vaccination against pathogenic gram-positive bacteria. To obtain sufficient amounts of such antigens, efficient protein production platforms are needed. In this study, a pipeline for the production and purification of surface-exposed and secreted antigens of the gram-positive bacterial pathogen Staphylococcus aureus is presented. Cytoplasmic or extracellular production of S. aureus antigens was achieved using the Lactococcus lactis strain PA1001, which lacks the major extracellular protease HtrA and the autolysin AcmA to minimize proteolysis and cell lysis, respectively. For most tested S. aureus antigens, secretory production directed by the signal peptide of the major secreted protein Usp45 of L. lactis resulted in higher yields than intracellular production without a signal peptide. Additionally, secretory production of His-tagged antigens allowed their facile one-step purification from the growth medium by metal affinity chromatography. For three of the purified antigens, biological activity was confirmed through enzyme activity assays. We, furthermore, show that the present pipeline can be used to produce staphylococcal antigens with an N-terminal AVI-tag for site-specific labeling with biotin or a C-terminal cell wall-binding domain for cell surface display. We conclude that our L. lactis-based pipeline allows the efficient production of S. aureus antigens and their subsequent purification in one step. PMID:25176446

  10. Efficacy of a Lactococcus lactis ?pyrG vaccine delivery platform expressing chromosomally integrated hly from Listeria monocytogenes

    PubMed Central

    Bahey-El-Din, Mohammed; Casey, Pat G; Griffin, Brendan T

    2010-01-01

    Listeria monocytogenes is a significant food-borne pathogen and the causative agent of listeriosis, a disease which manifests as meningitis in immunocompromised adults or infection of the fetus and miscarriage in pregnant women. We have previously used Lactococcus lactis, a GRAS (Generally Regarded As Safe) organism, as a vaccine vector against listeriosis by engineering plasmid-mediated expression of the immunodominant antigen from L. monocytogenes, listeriolysin O (LLO). However, the environmental release of an engineered vaccine vector carrying a replicating plasmid during clinical usage may raise safety concerns. Here we describe the integration of the LLO gene (hly) into the L. lactis chromosome through homologous double crossover to allow stable expression, in order to avoid the use of antibiotic selection markers and to eliminate the requirement for a plasmid-based system. The approach was designed to simultaneously eliminate the pyrG gene encoding the CTP synthase which is responsible for converting UTP to CTP in a unique step in the de novo pyrimidine synthesis in L. lactis. This gene was targeted in order to restrict bacterial replication outside of the host (biological containment). The resulting cytidine auxotroph was able to secrete LLO constitutively and could elicit LLO91–99-specific CD8+ T lymphocytes in the murine infection model. Moreover, protection against lethal challenge with L. monocytogenes was accomplished after intraperitoneal (IP) vaccination with the constructed strain. The implications for the use of cytidine auxotropy in biological containment are discussed. PMID:21327128

  11. Improved ethanol tolerance of Saccharomyces cerevisiae in mixed cultures with Kluyveromyces lactis on high-sugar fermentation.

    PubMed

    Yamaoka, Chizuru; Kurita, Osamu; Kubo, Tomoko

    2014-12-01

    The influence of non-Saccharomyces yeast, Kluyveromyces lactis, on metabolite formation and the ethanol tolerance of Saccharomyces cerevisiae in mixed cultures was examined on synthetic minimal medium containing 20% glucose. In the late stage of fermentation after the complete death of K. lactis, S. cerevisiae in mixed cultures was more ethanol-tolerant than that in pure culture. The chronological life span of S. cerevisiae was shorter in pure culture than mixed cultures. The yeast cells of the late stationary phase both in pure and mixed cultures had a low buoyant density with no significant difference in the non-quiescence state between both cultures. In mixed cultures, the glycerol contents increased and the alanine contents decreased when compared with the pure culture of S. cerevisiae. The distinctive intracellular amino acid pool concerning its amino acid concentrations and its amino acid composition was observed in yeast cells with different ethanol tolerance in the death phase. Co-cultivation of K. lactis seems to prompt S. cerevisiae to be ethanol tolerant by forming opportune metabolites such as glycerol and alanine and/or changing the intracellular amino acid pool. PMID:24932883

  12. Live probiotic Bifidobacterium lactis bacteria inhibit the toxic effects induced by wheat gliadin in epithelial cell culture

    PubMed Central

    Lindfors, K; Blomqvist, T; Juuti-Uusitalo, K; Stenman, S; Venäläinen, J; Mäki, M; Kaukinen, K

    2008-01-01

    Wheat gliadin induces severe intestinal symptoms and small-bowel mucosal damage in coeliac disease patients. At present, the only effective treatment for the disease is a strict life-long gluten-free diet. In this study we investigated whether probiotics Lactobacillus fermentum or Bifidobacterium lactis can inhibit the toxic effects of gliadin in intestinal cell culture conditions. The ability of live probiotics to inhibit peptic-tryptic digested gliadin-induced damage to human colon cells Caco-2 was evaluated by measuring epithelial permeability by transepithelial resistance, actin cytoskeleton arrangements by the extent of membrane ruffling and expression of tight junctional protein ZO-1. B. lactis inhibited the gliadin-induced increase dose-dependently in epithelial permeability, higher concentrations completely abolishing the gliadin-induced decrease in transepithelial resistance. The same bacterial strain also inhibited the formation of membrane ruffles in Caco-2 cells induced by gliadin administration. Furthermore, it also protected the tight junctions of Caco-2 cells against the effects of gliadin, as evinced by the pattern of ZO-1 expression. We conclude thus that live B. lactis bacteria can counteract directly the harmful effects exerted by coeliac-toxic gliadin and would clearly warrant further studies of its potential as a novel dietary supplement in the treatment of coeliac disease. PMID:18422736

  13. Bioluminescence imaging study of spatial and temporal persistence of Lactobacillus plantarum and Lactococcus lactis in living mice.

    PubMed

    Daniel, Catherine; Poiret, Sabine; Dennin, Véronique; Boutillier, Denise; Pot, Bruno

    2013-02-01

    Lactic acid bacteria, especially lactobacilli, are common inhabitants of the gastrointestinal tract of mammals, for which they have received considerable attention due to their putative health-promoting properties. In this study, we describe the development and application of luciferase-expressing Lactobacillus plantarum and Lactococcus lactis strains for noninvasive in vivo monitoring in the digestive tract of mice. We report for the first time the functional in vitro expression in Lactobacillus plantarum NCIMB8826 and in Lactococcus lactis MG1363 of the click beetle luciferase (CBluc), as well as Gaussia and bacterial luciferases, using a combination of vectors, promoters, and codon-optimized genes. We demonstrate that a CBluc construction is the best-performing luciferase system for the noninvasive in vivo detection of lactic acid bacteria after oral administration. The persistence and viability of both strains was studied by bioluminescence imaging in anesthetized mice and in mouse feces. In vivo bioluminescence imaging confirmed that after a single or multiple oral administrations, L. lactis has shorter survival times in the mouse gastrointestinal tract than L. plantarum, and it also revealed the precise gut compartments where both strains persisted. The application of luciferase-labeled bacteria has significant potential to allow the in vivo and ex vivo study of the interactions of lactic acid bacteria with their mammalian host. PMID:23204409

  14. Characterization, Expression, and Mutation of the Lactococcus lactis galPMKTE Genes, Involved in Galactose Utilization via the Leloir Pathway

    PubMed Central

    Grossiord, Benoît P.; Luesink, Evert J.; Vaughan, Elaine E.; Arnaud, Alain; de Vos, Willem M.

    2003-01-01

    A cluster containing five similarly oriented genes involved in the metabolism of galactose via the Leloir pathway in Lactococcus lactis subsp. cremoris MG1363 was cloned and characterized. The order of the genes is galPMKTE, and these genes encode a galactose permease (GalP), an aldose 1-epimerase (GalM), a galactokinase (GalK), a hexose-1-phosphate uridylyltransferase (GalT), and a UDP-glucose 4-epimerase (GalE), respectively. This genetic organization reflects the order of the metabolic conversions during galactose utilization via the Leloir pathway. The functionality of the galP, galK, galT, and galE genes was shown by complementation studies performed with both Escherichia coli and L. lactis mutants. The GalP permease is a new member of the galactoside-pentose-hexuronide family of transporters. The capacity of GalP to transport galactose was demonstrated by using galP disruption mutant strains of L. lactis MG1363. A galK deletion was constructed by replacement recombination, and the mutant strain was not able to ferment galactose. Disruption of the galE gene resulted in a deficiency in cell separation along with the appearance of a long-chain phenotype when cells were grown on glucose as the sole carbon source. Recovery of the wild-type phenotype for the galE mutant was obtained either by genetic complementation or by addition of galactose to the growth medium. PMID:12533462

  15. Metabolic engineering of Lactococcus lactis: influence of the overproduction of alpha-acetolactate synthase in strains deficient in lactate dehydrogenase as a function of culture conditions.

    PubMed Central

    Platteeuw, C; Hugenholtz, J; Starrenburg, M; van Alen-Boerrigter, I; de Vos, W M

    1995-01-01

    The als gene for alpha-acetolactate synthase of Lactococcus lactis MG1363 was cloned on a multicopy plasmid under the control of the inducible L. lactis lacA promoter. More than a hundredfold overproduction of alpha-acetolactate synthase was obtained in L. lactis under inducing conditions as compared with that of the host strain, which contained a single chromosomal copy of the als gene. The effect of alpha-acetolactate synthase overproduction on the formation of end products in various L. lactis strains was studied under different fermentation conditions. Under aerobic conditions and with an initial pH of 6.0, overexpression of the als gene resulted in significant acetoin production that amounted to more than one-third of the pyruvate converted. However, the effect of the alpha-acetolactate synthase overproduction was even more pronounced in the lactate dehydrogenase-deficient strain L. lactis NZ2700. Anaerobic cultivation of this strain resulted in a doubling of the butanediol formation of up to 40% of the converted pyruvate. When cultivated aerobically at an initial pH of 6.8, overexpression of the als gene in L. lactis NZ2700 resulted in the conversion of more than 60% of the pyruvate into acetoin, while no butanediol was formed. Moreover, at an initial pH of 6.0, similar amounts of acetoin were obtained, but in addition approximately 20% of the pyruvate was converted into butanediol. These metabolic engineering studies indicate that more than 80% of the lactose can be converted via the activity of the overproduced alpha-acetolactate synthase in L. lactis. PMID:8526510

  16. The role of biotin and sodium in the decarboxylation of oxaloacetate by the membrane-bound oxaloacetate decarboxylase from Klebsiella aerogenes.

    PubMed

    Dimroth, P

    1982-01-01

    The biotin-containing oxaloacetate decarboxylase from Klebsiella aerogenes catalyzed the Na+-dependent decarboxylation of oxaloacetate to pyruvate and bicarbonate (or CO2) but not the reversal of this reaction, not even in the presence of an oxaloacetate trapping system. The enzyme catalyzed an avidin-sensitive isotopic exchange between [1-14C]pyruvate and oxaloacetate, which indicated the intermediate formation of a carboxybiotin enzyme. Sodium ions were not required for this partial reaction, but promoted the second partial reaction, the decarboxylation of the carboxybiotin enzyme, thus accounting for the Na+ requirement of the overall reaction. Therefore, the 14CO2-enzyme which was formed upon incubation of the decarboxylase with [4-15C]oxaloacetate, could only be isolated if Na+ ions were excluded. Preincubation of the decarboxylase with avidin also prevented its labelling with 14CO2. The isolated 14CO2-labelled oxaloacetate decarboxylase revealed the following properties. It was slowly decarboxylated at neutral pH and rapidly upon acidification. The 14CO2 residues of the 14CO2-enzyme could be transferred to pyruvate yielding [4-14C]oxaloacetate. In the presence of Na+ this 14CO2 transfer was repressed by the simultaneous decarboxylation of the 14CO2-enzyme. However, Na+ alone was insufficient as a cofactor for the decarboxylation of the isolated 14CO2-enzyme, since this required pyruvate in addition to Na+. It is therefore concluded that the decarboxylation of oxaloacetate proceeds over a CO2-enzyme--pyruvate complex and that free CO2-enzyme is an abortive reaction intermediate. The activation energy of the enzymic decarboxylation of oxaloacetate changed with temperature and was about 113 kJ below 11 degrees C, 60 kJ between 11 degrees C and 31 degrees C and 36 kJ between 31--45 degrees C. PMID:7037395

  17. A fuzzy logic-based model for the multistage high-pressure inactivation of Lactococcus lactis ssp. cremoris MG 1363.

    PubMed

    Kilimann, K V; Hartmann, C; Delgado, A; Vogel, R F; Gänzle, M G

    2005-01-15

    The high-pressure inactivation (200 to 600 MPa) of Lactococcus lactis ssp. cremoris MG 1363 suspended in milk buffer was investigated with both experimental and theoretical methods. The inactivation kinetics were characterised by the determination of the viable cell counts, cell counts of undamaged cells, LmrP activity, membrane integrity, and metabolic activity. Pressures between 200 and 600 MPa were applied, and pressure holding times were varied between 0 and 120 min. Experiments were carried out in milk buffer at pH values ranging between 4.0 and 6.5, and the effect of the addition of molar concentrations of NaCl and sucrose was furthermore determined. The inactivation curves of L. lactis, as characterised by viable cell counts, exhibited typical sigmoid asymmetric shapes. Generally, inactivation of the membrane transport system LmrP was the most sensitive indicator of pressure-induced sublethal injury. Furthermore, the metabolic activity was inactivated concomitant with or prior to the loss of viability. Membrane integrity was lost concomitant with or later than cell death. For example, treatments at 200 MPa for 60 min in milk buffer did not inactivate L. lactis, but fully inactivated LmrP activity and reduced the metabolic activity by 50%. The membrane integrity was unaffected. Thus, the assay systems chosen are suitable to dissect the multistep high-pressure inactivation of L. lactis ssp. cremoris MG 1363. A fuzzy logic model accounting for the specific knowledge on the multistep pressure inactivation and allowing the prediction of the quantities of sublethally damaged cells was formulated. Furthermore, the fuzzy model could be used to accurately predict pressure inactivation of L. lactis using conditions not taken into account in model generation. It consists of 160 rules accounting for several dependent and independent variables. The rules were generated automatically with fuzzy clustering methods and rule-oriented statistical analysis. The set is open for the integration of further knowledge-based rules. A very good overall agreement between measured and predicted values was obtained. Single, deviating results have been identified and can be explained to be measurement errors or model intrinsic deficiencies. PMID:15617804

  18. Proteomic and Functional Consequences of Hexokinase Deficiency in Glucose-repressible Kluyveromyces lactis

    PubMed Central

    Mates, Nadia; Kettner, Karina; Heidenreich, Falk; Pursche, Theresia; Migotti, Rebekka; Kahlert, Günther; Kuhlisch, Eberhard; Breunig, Karin D.; Schellenberger, Wolfgang; Dittmar, Gunnar; Hoflack, Bernard; Kriegel, Thomas M.

    2014-01-01

    The analysis of glucose signaling in the Crabtree-positive eukaryotic model organism Saccharomyces cerevisiae has disclosed a dual role of its hexokinase ScHxk2, which acts as a glycolytic enzyme and key signal transducer adapting central metabolism to glucose availability. In order to identify evolutionarily conserved characteristics of hexokinase structure and function, the cellular response of the Crabtree-negative yeast Kluyveromyces lactis to rag5 null mutation and concomitant deficiency of its unique hexokinase KlHxk1 was analyzed by means of difference gel electrophoresis. In total, 2,851 fluorescent spots containing different protein species were detected in the master gel representing all of the K. lactis proteins that were solubilized from glucose-grown KlHxk1 wild-type and mutant cells. Mass spectrometric peptide analysis identified 45 individual hexokinase-dependent proteins related to carbohydrate, short-chain fatty acid and tricarboxylic acid metabolism as well as to amino acid and protein turnover, but also to general stress response and chromatin remodeling, which occurred as a consequence of KlHxk1 deficiency at a minimum 3-fold enhanced or reduced level in the mutant proteome. In addition, three proteins exhibiting homology to 2-methylcitrate cycle enzymes of S. cerevisiae were detected at increased concentrations, suggesting a stimulation of pyruvate formation from amino acids and/or fatty acids. Experimental validation of the difference gel electrophoresis approach by post-lysis dimethyl labeling largely confirmed the abundance changes detected in the mutant proteome via the former method. Taking into consideration the high proportion of identified hexokinase-dependent proteins exhibiting increased proteomic levels, KlHxk1 is likely to have a repressive function in a multitude of metabolic pathways. The proteomic alterations detected in the mutant classify KlHxk1 as a multifunctional enzyme and support the view of evolutionary conservation of dual-role hexokinases even in organisms that are less specialized than S. cerevisiae in terms of glucose utilization. PMID:24434903

  19. Effect of a fermented milk containing Bifidobacterium lactis DN-173010 on Chinese constipated women

    PubMed Central

    Yang, Yue-Xin; He, Mei; Hu, Gang; Wei, Jie; Pages, Philippe; Yang, Xian-Hua; Bourdu-Naturel, Sophie

    2008-01-01

    AIM: To investigate the effect of a fermented milk containing Bifidobacterium lactis DN-173010 and yogurt strains (BIO®) on adult women with constipation in Beijing. METHODS: A total of 135 adult females with constipation were randomly allocated to consume for 2 wk either 100 g of the test fermented milk or 100 g of an acidified milk containing non-living bacteria (control). Stool frequency, defecation condition scores, stool consistency and food intake were recorded at baseline and after 1 and 2 wk in an intention-to-treat population of 126 subjects. In parallel, safety evaluation parameters were performed. RESULTS: At baseline, no differences were found between groups. Following consumption of test product, stool frequency was significantly increased after 1 wk (3.5 ± 1.5 vs 2.4 ± 0.6, P < 0.01) and 2 wk (4.1 ± 1.7 vs 2.4 ± 0.6, P < 0.01), vs baseline. Similarly, after 1 and 2 wk, of test product consumption, defecation condition (1.1 ± 0.9 vs 1.9 ± 1.2, P < 0.01 and 0.8 ± 1.0 vs 1.9 ± 1.2, P < 0.01, respectively) and stool consistency (1.0 ± 0.8 vs 1.5 ± 1.1, P < 0.01 and 0.6 ± 0.8 vs 1.5 ± 1.1, P < 0.01, respectively) were significantly improved. Compared with the control group, stool frequency was also significantly increased (3.5 ± 1.5 vs 2.5 ± 0.9, P < 0.01 and 4.1 ± 1.7 vs 2.6 ± 1.0, P < 0.01, respectively), and defecation condition (1.1 ± 0.9 vs 1.6 ± 1.1, P < 0.01 and 0.8 ± 1.0 vs 1.6 ± 1.1, P < 0.01, respectively) and stool consistency (1.0 ± 0.8 vs 1.4 ± 1.0, P < 0.05 and 0.6 ± 0.8 vs 1.3 ± 1.0, P < 0.01, respectively) significantly decreased after 1 and 2 wk of product consumption. During the same period, food intake did not change between the two groups, and safety parameters of the subjects were within normal ranges. CONCLUSION: This study suggests a beneficial effect of a fermented milk containing B. lactis DN-173010 on stool frequency, defecation condition and stool consistency in adult women with constipation constipated women after 1 and 2 wk of consumption. PMID:18985817

  20. Immunogenicity of oral vaccination with Lactococcus lactis derived vaccine candidate antigen (UreB) of Helicobacter pylori fused with the human interleukin 2 as adjuvant.

    PubMed

    Zhang, Hong-xin; Qiu, Yu-yu; Zhao, Ying-hui; Liu, Xin-ting; Liu, Ming; Yu, Ai-lian

    2014-02-01

    Helicobacter pylori (H. pylori) infection remains a significant global public health problem. Vaccine, especially edible vaccine, is considered to be effective in the management of H. pylori infections. By using recombinant technology, Lactococcus lactis (L. lactis) could serve as an antigen-delivering vehicle for the development of edible vaccine. The aim of this study was to produce edible UreB (urease B) vaccine derived from L. lactis against H. pylori. The UreB subunit is the most effective and common immunogen of all strains of H. pylori. The UreB was produced as a chimeric protein fused with IL-2 (human interleukin 2) as the mucosal adjuvant. Mucosal immunization of mice with recombinant L. lactis NZ9000 containing the UreB-IL-2 protein elicited more anti-UreB antibody that specifically bounded to the purified bacterial UreB protein and more cytokines such as IFN-?, IL-4, and IL-17, and had a lower H. pylori burden and urease activity than control mice. These results suggest that the recombinant L. lactis expressing UreB-IL-2 can be potentially used as an edible vaccine for controlling H. pylori infection. PMID:24036137

  1. Isolation and characterization of a nisin-like bacteriocin produced by a Lactococcus lactis strain isolated from charqui, a Brazilian fermented, salted and dried meat product.

    PubMed

    Biscola, V; Todorov, S D; Capuano, V S C; Abriouel, H; Gálvez, A; Franco, B D G M

    2013-03-01

    A Lactococcus lactis subsp. lactis strain (L. lactis 69) capable to produce a heat-stable bacteriocin was isolated from charqui, a Brazilian fermented, salted and sun-dried meat product. The bacteriocin inhibited, in vitro, Listeria monocytogenes, Staphylococcus aureus, several lactic acid bacteria isolated from foods and spoilage halotolerant bacteria isolated from charqui. The activity of the bacteriocin was not affected by pH (2.0-10.0), heating (100 °C), and chemical agents (1% w/v). Treatment of growing cells of L. monocytogenes ScottA with the cell-free supernatant of L. lactis 69 resulted in complete cell inactivation. L. lactis 69 harbored the gene for the production of a nisin-like bacteriocin, and the amino acid sequence of the active peptide was identical to sequences previously described for nisin Z. However, differences were observed regarding the leader peptide. Besides, the isolate was able to survive and produce bacteriocins in culture medium with NaCl content up to 20%, evidencing a potential application as an additional hurdle in the preservation of charqui. PMID:23273471

  2. Putrescine production via the agmatine deiminase pathway increases the growth of Lactococcus lactis and causes the alkalinization of the culture medium.

    PubMed

    del Rio, Beatriz; Linares, Daniel M; Ladero, Victor; Redruello, Begoña; Fernández, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2015-01-01

    Lactococcus lactis is the most important starter culture organism used in the dairy industry. Although L. lactis species have been awarded Qualified Presumption of Safety status by the European Food Safety Authority, and Generally Regarded as Safe status by the US Food and Drug Administration, some strains can produce the biogenic amine putrescine. One such strain is L. lactis subsp. cremoris CECT 8666 (formerly L. lactis subsp. cremoris GE2-14), which was isolated from Genestoso cheese. This strain catabolizes agmatine to putrescine via the agmatine deiminase (AGDI) pathway, which involves the production of ATP and two ammonium ions. The present work shows that the availability of agmatine and its metabolization to putrescine allows for greater bacterial growth (in a biphasic pattern) and causes the alkalinization of the culture medium in a dose-dependent manner. The construction of a mutant lacking the AGDI cluster (L. lactis CECT 8666 ?agdi) confirmed the latter's direct role in putrescine production, growth, and medium alkalinization. Alkalinization did not affect the putrescine production pattern and was not essential for increased bacterial growth. PMID:25341400

  3. Proteinase PrtP impairs lactococcin LcnB activity in Lactococcus lactis BGMN1-501: new insights into bacteriocin regulation

    PubMed Central

    Vukotic, Goran; Mirkovic, Nemanja; Jovcic, Branko; Miljkovic, Marija; Strahinic, Ivana; Fira, Djordje; Radulovic, Zorica; Kojic, Milan

    2015-01-01

    Proteinases and bacteriocins are of great importance to the dairy industry, but their interactions have not been studied so far. Lactococcus lactis subsp. lactis BGMN1-5 is a natural isolate from homemade semi-hard cheese which produces two bacteriocins (Lactococcin B and LsbB), as well as proteinase PrtP. A medium-dependent increase in the bacteriocin LcnB activity of L. lactis BGMN1-501, a derivate of L. lactis subsp. lactis BGMN1-5, was shown to be accompanied by a decrease in its promoter activity. A similar effect of media components on gene expression was reported for proteinase PrtP, whose gene is co-localized on the same plasmid as the lcnB gene. Thus, the PrtP-LcnB interplay was investigated. Single gene knockout mutants were constructed with disrupted prtP or lcnB genes. PrtP- mutants showed higher bacteriocin activity that had lost its growth medium dependence, which was in contrast to the original strain. When LcnB from this mutant was combined with proteinase from the LcnB- mutant in vitro, its activity was rendered to the original level, suggesting that proteinase reduces bacteriocin activity. We propose a new model of medium dependent expression of these genes with regard to the effects of their interaction in vivo. PMID:25713574

  4. Optimization of lactic acid production by immobilized Lactococcus lactis IO-1.

    PubMed

    Sirisansaneeyakul, Sarote; Luangpipat, Tiyaporn; Vanichsriratana, Wirat; Srinophakun, Thongchai; Chen, Henry Ho-Hsien; Chisti, Yusuf

    2007-05-01

    Production of lactic acid from glucose by immobilized cells of Lactococcus lactis IO-1 was investigated using cells that had been immobilized by either entrapment in beads of alginate or encapsulation in microcapsules of alginate membrane. The fermentation process was optimized in shake flasks using the Taguchi method and then further assessed in a production bioreactor. The bioreactor consisted of a packed bed of immobilized cells and its operation involved recycling of the broth through the bed. Both batch and continuous modes of operation of the reactor were investigated. Microencapsulation proved to be the better method of immobilization. For microencapsulated cells at immobilized cell concentration of 5.3 g l(-1), the optimal production medium had the following initial concentrations of nutrients (g l(-1)): glucose 45, yeast extract 10, beef extract 10, peptone 7.5 and calcium chloride 10 at an initial pH of 6.85. Under these conditions, at 37 degrees C, the volumetric productivity of lactic acid in shake flasks was 1.8 g l(-1) h(-1). Use of a packed bed of encapsulated cells with recycle of the broth through the bed, increased the volumetric productivity to 4.5 g l(-1) h(-1). The packed bed could be used in repeated batch runs to produce lactic acid. PMID:17318489

  5. Telomere Loops and Homologous Recombination-Dependent Telomeric Circles in a Kluyveromyces lactis Telomere Mutant Strain?

    PubMed Central

    Cesare, Anthony J.; Groff-Vindman, Cindy; Compton, Sarah A.; McEachern, Michael J.; Griffith, Jack D.

    2008-01-01

    The Kluyveromyces lactis ter1-16T strain contains mutant telomeres that are poorly bound by Rap1, resulting in a telomere-uncapping phenotype and significant elongation of the telomeric DNA. The elongated telomeres of ter1-16T allowed the isolation and examination of native yeast telomeric DNA by electron microscopy. In the telomeric DNA isolated from ter1-16T, looped molecules were observed with the physical characteristics of telomere loops (t-loops) previously described in mammalian and plant cells. ter1-16T cells were also found to contain free circular telomeric DNA molecules (t-circles) ranging up to the size of an entire telomere. When the ter1-16T uncapping phenotype was repressed by overexpression of RAP1 or recombination was inhibited by deletion of rad52, the isolated telomeric DNA contained significantly fewer t-loops and t-circles. These results suggest that disruption of Rap1 results in elevated recombination at telomeres, leading to increased strand invasion of the 3? overhang within t-loop junctions and resolution of the t-loop junctions into free t-circles. PMID:17967889

  6. ER stress induced by the OCH1 mutation triggers changes in lipid homeostasis in Kluyveromyces lactis.

    PubMed

    Zanni, Elena; Maulucci, Giuseppe; Pomata, Donatella; Buiarelli, Francesca; Krasnowska, Ewa K; Parasassi, Tiziana; De Spirito, Marco; Heipieper, Hermann J; Uccelletti, Daniela

    2015-01-01

    In Kluyveromyces lactis yeast, OCH1 encodes for the ?-1,6-mannosyltrasferase that adds the initial ?-1,6-mannose to the outer-chains of N-glycoproteins. Kloch1-1 mutant cells showed altered calcium homeostasis and endoplasmic reticulum (ER) stress. Since ER plays a major role in lipid biosynthesis and lipid droplet (LD) formation, herein the impact of Och1p depletion on lipid homeostasis was investigated. Transcriptional profiles of genes involved in biosynthesis of fatty acids, their amount and composition changed in mutant cells. An increased amount of ergosterol was determined in these cells. Enhanced transcription of genes involved in both synthesis and mobilization of LDs was also found in Kloch1-1 cells, accompanied by a reduced amount of LDs. We provide evidence that ER alterations, determined by protein misfolding as a result of reduced N-glycosylation, induced altered lipid homeostasis in Kloch1-1 cells. Chemical chaperone 4-phenyl butyrate (4-PBA) slightly alleviated the LD phenotype in cells depleted of Och1p. Remarkably, complete suppression of ER stress, via increased expression of plasma membrane calcium channel subunit Mid1, fully restored lipid homeostasis in mutant cells. To further reinforce this finding, low numbers of LDs were observed in wild type cells when ER stress was triggered by DTT treatment. PMID:25576775

  7. Optimization of signal peptide SP310 for heterologous protein production in Lactococcus lactis.

    PubMed

    Ravn, Peter; Arnau, José; Madsen, Søren M; Vrang, Astrid; Israelsen, Hans

    2003-08-01

    The authors have previously reported the identification of novel signal peptides (SPs) from Lactococcus lactis using transposon insertion. Of these, SP310 caused the highest level of secretion. However, the levels were lower than those obtained using the signal peptide from Usp45 (SPUSP), the major secreted lactococcal protein. In this study, site-directed mutagenesis of signal peptide SP310 was used to investigate the effect of amino acid alterations on lactococcal secretion and to improve secretion efficiency. Several mutated SPs caused higher secretion. This increase in secretion was due to modifications in the cleavage region. In fermenter experiments, the signal peptide SP310mut2 resulted in an extracellular Staphylococcus aureus nuclease (Nuc) yield which was 45 % higher than that with the natural SP310. Surprisingly, increasing the hydrophobicity of the hydrophobic core or increasing the number of positively charged amino acids in the N-terminal region of SP310 decreased secretion. High extracellular yields of Nuc resulted from more efficient secretion, as strains with less efficient SPs accumulated more intracellular SP-Nuc precursor. PMID:12904559

  8. Kinetics of lactose hydrolysis by beta-galactosidase of Kluyveromyces lactis immobilized on cotton fabric.

    PubMed

    Zhou, Quinn Zhengkun; Chen, Xiao Dong; Li, Xuemei

    2003-01-20

    A mathematic model for describing the Michaelis-Menten-type reaction kinetics with product competitive inhibition and side-reaction is proposed. A multiresponse nonlinear simulation program was employed to determine the coefficients of a four-parameter rate expression. The rate expression was compared with the conventional Michaelis-Menten reaction rate models with and without product inhibition. Experimental data were obtained using beta-galactosidase of Kluyveromyces lactis immobilized on cotton fabric in a batch system at a temperature of 37 degrees C and at various initial concentrations of dissolved lactose ranging from 3-12.5% (w/v). The reaction is followed by concentration changes with time in the tank. Samples were obtained after the outlet stream of the packed bed reactor is mixed in a well-stirred tank. High-performance liquid chromatography (HPLC) was applied to monitor the concentrations of all the sugars (reactants as well as products). The four-parameter rate model is featured with a term to describe the formation of trisaccharides, a side-reaction of the enzymatic hydrolysis. The proposed model simulates the process of lactose hydrolysis and the formation of glucose and galactose, giving better accuracy compared with the previous models. PMID:12451549

  9. Expression of heparan sulfate sulfotransferases in Kluyveromyces lactis and preparation of 3?-phosphoadenosine-5?-phosphosulfate

    PubMed Central

    Zhou, Xianxuan; Chandarajoti, Kasemsiri; Pham, Truong Quang; Liu, Renpeng; Liu, Jian

    2011-01-01

    Heparan sulfate (HS) belongs to a major class of glycans that perform central physiological functions. Heparin is a specialized form of HS and is a clinically used anticoagulant drug. Heparin is a natural product isolated from pig intestine. There is a strong demand to replace natural heparin with a synthetic counterpart. Although a chemoenzymatic approach has been employed to prepare synthetic heparin, the scale of the synthesis is limited by the availability of sulfotransferases and the cofactor, 3?-phosphoadenosine-5?-phosphosulfate (PAPS). Here, we present a novel method to produce secreted forms of sulfotransferases in the yeast cells, Kluyveromyces lactis. Five sulfotransferases including N-sulfotransferase, 2-O-sulfotransferase, 3-O-sulfotransferase 1 and 6-O-sulfotransferases 1 and 3 were expressed using this method. Unlike bacterial-expressed sulfotransferases, the yeast proteins can be directly used to modify polysaccharides without laborious purification. The yeast-expressed sulfotransferases also tend to have higher specific activity and thermostability. Furthermore, we demonstrated the possibility for the gram-scale synthesis of PAPS from adenosine 5'-triphosphate at only 1/5000th of the price purchased from a commercial source. Our results pave the way to conduct the enzymatic synthesis of heparin in large quantities. PMID:21224284

  10. Oral immunization with recombinant hepatitis E virus antigen displayed on the Lactococcus lactis surface enhances ORF2-specific mucosal and systemic immune responses in mice.

    PubMed

    Gao, Shenyang; Li, Dandan; Liu, Ying; Zha, Enhui; Zhou, Tiezhong; Yue, Xiqing

    2015-01-01

    Hepatitis E virus (HEV) as a recognized zoonotic pathogen has posed global burden on public health, which is exacerbated by lack of efficient vaccine. In this study, we constructed a recombinant (inaQ-ORF2 gene fusion) Lactococcus lactis (L. lactis) strain NZ3900 that expresses and displays the hepatitis E virus antigen ORF2 utilizing an ice uncleation protein-based anchor system. After oral vaccination of BALB/c mice, significantly higher levels of ORF2-specific mucosal IgA and serum IgG were detected and cellular immunity was also induced. These findings further support that L. lactis-based HEV antigen vaccines could be used for human and animal protection against infection. PMID:25445956

  11. Oral Administration of Recombinant Lactococcus lactis Expressing HSP65 and Tandemly Repeated P277 Reduces the Incidence of Type I Diabetes in Non-Obese Diabetic Mice

    PubMed Central

    Ma, Yanjun; Liu, Jingjing; Hou, Jing; Dong, Yuankai; Lu, Yong; Jin, Liang; Cao, Rongyue; Li, Taiming; Wu, Jie

    2014-01-01

    Diabetes mellitus type 1 (DM1) is an autoimmune disease that gradually destroys insulin-producing beta-cells. We have previously reported that mucosal administration of fusion protein of HSP65 with tandem repeats of P277 (HSP65-6P277) can reduce the onset of DM1 in non-obese diabetic (NOD) mice. To deliver large amounts of the fusion protein and to enhance long-term immune tolerance effects, in the present study, we investigated the efficacy of using orally administrated L. lactis expressing HSP65-6P277 to reduce the incidence of DM1 in NOD mice. L. lactis strain NZ9000 was engineered to express HSP65-6P277 either constitutively or by nisin induction. After immunization via gavage with the recombinant L. lactis strains to groups of 4-week old female NOD mice for 36 weeks, we observed that oral administration of recombinant L. Lactis resulted in the prevention of hyperglycemia, improved glucose tolerance and reduced insulitis. Immunologic analysis showed that treatment with recombinant L. lactis induced HSP65- and P277- specific T cell immuno-tolerance, as well as antigen-specific proliferation of splenocytes. The results revealed that the DM1-preventing function was in part caused by a reduction in the pro-inflammatory cytokine IFN-? and an increase in the anti-inflammatory cytokine IL-10. Orally administered recombinant L. lactis delivering HSP65-6P277 may be an effective therapeutic approach in preventing DM1. PMID:25157497

  12. The protective effect of recombinant Lactococcus lactis oral vaccine on a Clostridium difficile-infected animal model

    PubMed Central

    2013-01-01

    Background Oral immunization with vaccines may be an effective strategy for prevention of Clostridium difficile infection (CDI). However, application of previously developed vaccines for preventing CDI has been limited due to various reasons. Here, we developed a recombinant Lactococcus lactis oral vaccine and evaluated its effect on a C. difficile-infected animal model established in golden hamsters in attempt to provide an alternative strategy for CDI prevention. Methods Recombinant L. lactis vaccine was developed using the pTRKH2 plasmid, a high-copy-number Escherichia coli-L. shuttle vector: 1) L. lactis expressing secreted proteins was constructed with recombinant pTRKH2 (secreted-protein plasmid) carrying the Usp45 signal peptide (SPUsp45), nontoxic adjuvanted tetanus toxin fragment C (TETC), and 14 of the 38 C-terminal repeats (14CDTA) of nontoxic C. difficile toxin A (TcdA); and 2) L. lactis expressing secreted and membrane proteins was constructed with recombinant pTRKH2 (membrane-anchored plasmid) carrying SPUsp45, TETC, 14CDTA, and the cell wall-anchored sequence of protein M6 (cwaM6). Then, 32 male Syrian golden hamsters were randomly divided into 4 groups (n?=?8 each) for gavage of normal saline (blank control) and L. lactis carrying the empty shuttle vector, secreted-protein plasmid, and membrane-anchored plasmid, respectively. After 1-week gavage of clindamycin, the animals were administered with C. difficile spore suspension. General symptoms and intestinal pathological changes of the animals were examined by naked eye and microscopy, respectively. Protein levels of anti-TcdA IgG/IgA antibodies in intestinal tissue and fluid were analyzed by enzyme-linked immunosorbent assay (ELISA). A cell culture cytotoxicity neutralization assay was done by TcdA treatment with or without anti-TcdA serum pre-incubation or treatment. Apoptosis of intestinal epithelial cells was examined by flow cytometry (FL) assay. Expression of mucosal inflammatory cytokines in the animals was detected by polymer chain reaction (PCR) assay. Results After the C. difficile challenge, the animals of control group had severe diarrhea symptoms on day 1 and all died on day 4, indicating that the CDI animal model was established in hamster. Of the 3 immunization groups, secreted-protein and membrane-anchored plasmid groups had significantly lower mortalities, body weight decreases, and pathological scores, with higher survival rate/time than the empty plasmid group (P??0.05). The anti-TcdA serum of membrane-anchored plasmid group neutralized the cytotoxicity of 200 ng/ml TcdA with the best protective effect achieved by anti-TcdA serum pre-incubation. The incidences of TcdA-induced death and apoptosis of intestinal epithelial cells were significantly reduced by cell pre-incubation or treatment with anti-TcdA serum of membrane-anchored plasmid group (P?lactis live vaccine is effective for preventing CDI in the hamster model, thus providing an alternative for immunization of C. difficile-associated diseases. PMID:23865596

  13. Cloning, Production, and Functional Expression of the Bacteriocin Enterocin A, Produced by Enterococcus faecium T136, by the Yeasts Pichia pastoris, Kluyveromyces lactis, Hansenula polymorpha, and Arxula adeninivorans

    PubMed Central

    Borrero, Juan; Kunze, Gotthard; Jiménez, Juan J.; Böer, Erik; Gútiez, Loreto; Herranz, Carmen; Cintas, Luis M.

    2012-01-01

    The bacteriocin enterocin A (EntA) produced by Enterococcus faecium T136 has been successfully cloned and produced by the yeasts Pichia pastoris X-33EA, Kluyveromyces lactis GG799EA, Hansenula polymorpha KL8-1EA, and Arxula adeninivorans G1212EA. Moreover, P. pastoris X-33EA and K. lactis GG799EA produced EntA in larger amounts and with higher antimicrobial and specific antimicrobial activities than the EntA produced by E. faecium T136. PMID:22685156

  14. Cloning, production, and functional expression of the bacteriocin enterocin A, produced by Enterococcus faecium T136, by the yeasts Pichia pastoris, Kluyveromyces lactis, Hansenula polymorpha, and Arxula adeninivorans.

    PubMed

    Borrero, Juan; Kunze, Gotthard; Jiménez, Juan J; Böer, Erik; Gútiez, Loreto; Herranz, Carmen; Cintas, Luis M; Hernández, Pablo E

    2012-08-01

    The bacteriocin enterocin A (EntA) produced by Enterococcus faecium T136 has been successfully cloned and produced by the yeasts Pichia pastoris X-33EA, Kluyveromyces lactis GG799EA, Hansenula polymorpha KL8-1EA, and Arxula adeninivorans G1212EA. Moreover, P. pastoris X-33EA and K. lactis GG799EA produced EntA in larger amounts and with higher antimicrobial and specific antimicrobial activities than the EntA produced by E. faecium T136. PMID:22685156

  15. [Role of calcium-alginate gel as protection component of Bifidobacterium lactis BB 12 strain from aggressive agents of gastro-intestical tract].

    PubMed

    Pyvovarov, Ie P; Votselko, S K; Kondratiuk, N V; Neklesa, O P; Hrynchenko, O O

    2014-01-01

    The influence of aggressive agents of the gastro-intestinal tract on quantity of free and encapsulated cells of the probiotic preparation based on Bifidobacterium lactis BB 12 has been investigated. The physico-chemical characteristics of the main component of the protective shell of this probiotic preparation--calcium-alginate gel under the influence of aggressive agents of the gastro-intestinal tract have been studied. The results indicate the possibility of these capsules using as an acid-resistant transport forms of Bifidobacterium lactis BB 12. PMID:25000728

  16. Mortality and translocation assay to study the protective capacity of Bifidobacterium lactis INL1 against Salmonella Typhimurium infection in mice.

    PubMed

    Zacarías, M F; Reinheimer, J; Forzani, L; Grangette, C; Vinderola, G

    2014-12-01

    The mouse has been largely used for the study of the protective capacity of probiotics against intestinal infections caused by Salmonella. In this work we aimed at comparing the mortality and translocation assay for the study of the protective capacity of the human breast milk-derived strain Bifidobacterium animalis subsp. lactis INL1 on a model of gut infection by Salmonella enterica subsp. enterica serovar Typhimurium. Different doses of S. Typhimurium FUNED and B. animalis subsp. lactis INL 1 were administered to Balb/c mice in a mortality or a translocation assay. The survival of the control group in the mortality assay resulted to be variable along experiments, and then we preferred to use a translocation assay where the preventive administration of 109 cfu of bifidobacteria/mouse for 10 consecutive days significantly reduced the number of infected animals and the levels of translocation to liver and spleen, with enhanced secretory immunoglobulin A and interleukin 10 production in the small and large intestine, respectively. Ten days of B. animalis subsp. lactis strain INL1 administration to mice significantly reduced both the incidence and the severity of Salmonella infection in a mouse model of translocation. This work provided the first evidence that a translocation assay, compared to a mortality assay, could be more useful to study the protective capacity of probiotics against Salmonella infection, as more information can be obtained from mice and less suffering is conferred to animals due to the fact that the mortality assay is shorter than the latter. These facts are in line with the guidelines of animal research recently established by the National Centre for the Replacement, Refinement & Reduction of Animals in Research. PMID:24902954

  17. Recombinant expressions of sweet plant protein mabinlin II in Escherichia coli and food-grade Lactococcus lactis.

    PubMed

    Gu, Wenliang; Xia, Qiyu; Yao, Jing; Fu, Shaoping; Guo, Jianchun; Hu, Xinwen

    2015-04-01

    Sweet plant proteins, which are safe, natural, low-calorie sweeteners, may be suitable replacements for sugars in the food and beverage industries. Mabinlin II, a sweet plant protein, shows the most pronounced heat stability and acid resistance of any of the six known types of plant sweet proteins. However, mabinlin II is difficult to extract from the Capparis masaikai plant, which is itself becoming increasingly scarce. This limits the use of naturally acquired mabinlin II. In this study, recombinant mabinlin II proteins were expressed and purified in Escherichia coli and in food-grade Lactococcus lactis. Recombinant mabinlin II proteins MBL-BH (containing the B-chains of mabinlin II downstream fused with His-tag) and MBL-ABH (containing the A- and B-chains of mabinlin II downstream fused with His-tag) were expressed in E. coli in the form of inclusion bodies. They were then purified and renatured. The refolded MBL-BH was found to be 100 times sweeter than sucrose by weight, but it was not heat-stable. Refolded MBL-ABH was neither sweet nor heat-stable. Recombinant mabinlin II proteins were secreted and expressed intracellularly in food-grade L. lactis, in which the concentrated cell samples and culture medium samples were detected using enzyme-linked immunosorbent assay and Western blotting analysis with anti-mabinlin II polyclonal antibody. This study demonstrated that the single B chain of mabinlin II has a sweet taste. The recombinant mabinlin II proteins have been successfully expressed in food-grade L. lactis, which is a crucial step in the production of mabinlin II through microorganism expression systems. PMID:25649203

  18. NAD-dependent lactate dehydrogenase catalyses the first step in respiratory utilization of lactate by Lactococcus lactis?

    PubMed Central

    Zhao, Rui; Zheng, Sui; Duan, Cuicui; Liu, Fei; Yang, Lijie; Huo, Guicheng

    2013-01-01

    Lactococcus lactis can undergo respiration when hemin is added to an aerobic culture. The most distinctive feature of lactococcal respiration is that lactate could be consumed in the stationary phase concomitantly with the rapid accumulation of diacetyl and acetoin. However, the enzyme responsible for lactate utilization in this process has not yet been identified. As genes for fermentative NAD-dependent l-lactate dehydrogenase (l-nLDH) and potential electron transport chain (ETC)-related NAD-independent l-LDH (l-iLDH) exist in L. lactis, the activities of these enzymes were measured in this study using crude cell extracts prepared from respiratory and fermentation cultures. Further studies were conducted with purified preparations of recombinant LDH homologous proteins. The results showed that l-iLDH activity was hardly detected in both crude cell extracts and purified l-iLDH homologous protein while l-nLDH activity was very significant. This suggested that l-iLDHs were inactive in lactate utilization. The results of kinetic analyses and the effects of activator, inhibitor, substrate and product concentrations on the reaction equilibrium showed that l-nLDH was much more prone to catalyze the pyruvate reduction reaction but could reverse its role provided that the concentrations of NADH and pyruvate were extremely low while NAD and lactate were abundant. Metabolite analysis in respiratory culture revealed that the cellular status in the stationary phase was beneficial for l-nLDH to catalyze lactate oxidation. The factors accounting for the respiration- and stationary phase-dependent lactate utilization in L. lactis are discussed here. PMID:24251099

  19. Complete genome sequence of Bifidobacterium animalis subsp. lactis A6, a probiotic strain with high acid resistance ability.

    PubMed

    Sun, Erna; Zhao, Liang; Ren, Fazheng; Liu, Songling; Zhang, Ming; Guo, Huiyuan

    2015-04-20

    Bifidobacterium animalis subsp. lactis A6 (BAA6) (CGMCC No. 9273) was a probiotic strain isolated from the feces of a centenarian. Previous study showed that BAA6 had high acid resistance to low pH which is a critical factor influencing its healthy benefits. Elaborating the stress resistant mechanisms of bifidobacteria is important to extensively exploit this probiotic. Here, we reported the complete genome sequence of BAA6 that contains 1,958,651bp encoding 1622 CDSs, 16 rRNA genes, 52 tRNA genes. PMID:25707999

  20. Uptake of ?-Ketoglutarate by Citrate Transporter CitP Drives Transamination in Lactococcus lactis

    PubMed Central

    Pudlik, Agata M.

    2013-01-01

    Transamination is the first step in the conversion of amino acids into aroma compounds by lactic acid bacteria (LAB) used in food fermentations. The process is limited by the availability of ?-ketoglutarate, which is the best ?-keto donor for transaminases in LAB. Here, uptake of ?-ketoglutarate by the citrate transporter CitP is reported. Cells of Lactococcus lactis IL1403 expressing CitP showed significant levels of transamination activity in the presence of ?-ketoglutarate and one of the amino acids Ile, Leu, Val, Phe, or Met, while the same cells lacking CitP showed transamination activity only after permeabilization of the cell membrane. Moreover, the transamination activity of the cells followed the levels of CitP in a controlled expression system. The involvement of CitP in the uptake of the ?-keto donor was further demonstrated by the increased consumption rate in the presence of l-lactate, which drives CitP in the fast exchange mode of transport. Transamination is the only active pathway for the conversion of ?-ketoglutarate in IL1403; a stoichiometric conversion to glutamate and the corresponding ?-keto acid from the amino acids was observed. The transamination activity by both the cells and the cytoplasmic fraction showed a remarkably flat pH profile over the range from pH 5 to pH 8, especially with the branched-chain amino acids. Further metabolism of the produced ?-keto acids into ?-hydroxy acids and other flavor compounds required the coupling of transamination to glycolysis. The results suggest a much broader role of the citrate transporter CitP in LAB than citrate uptake in the citrate fermentation pathway alone. PMID:23204417

  1. High-Throughput Identification and Validation of In Situ-Expressed Genes of Lactococcus lactis?

    PubMed Central

    Bachmann, Herwig; Kleerebezem, Michiel; van Hylckama Vlieg, Johan E. T.

    2008-01-01

    Understanding the functional response of bacteria to their natural environment is one of the current challenges in microbiology. Over the past decades several techniques have been developed to study gene expression in complex natural habitats. Most of these methods, however, are laborious, and validation of results under in situ conditions is cumbersome. Here we report the improvement of the recombinase-based in vivo expression technology (R-IVET) by the implementation of two additional reporter genes. The first one is an ?-galactosidase gene (melA), which facilitates the rapid identification of in vivo-induced genes. Second, the bacterial luciferase genes (luxAB) are transcriptionally coupled to the resolvase gene, which allows rapid validation and characterization of in vivo-induced genes. The system is implemented and validated in the industrially important lactic acid bacterium Lactococcus lactis. We demonstrate the applicability of the advanced R-IVET system by the identification and validation of lactococcal promoter elements that are induced in minimal medium compared to the commonly used rich laboratory medium M17. R-IVET screening led to the identification of 19 promoters that predominantly control expression of genes involved in amino acid and nucleotide metabolism and in transport functions. Furthermore, the luciferase allows high-resolution transcription analysis and enabled the identification of complex medium constituents and specific molecules involved in promoter control. Rapid target validation exemplifies the high-throughput potential of the extended R-IVET system. The system can be applied to other bacterial species, provided that the reporter genes used are functional in the organism of interest. PMID:18539793

  2. The isolation of lactococcal promoters and their use in investigating bacterial luciferase synthesis in Lactococcus lactis.

    PubMed

    Waterfield, N R; Le Page, R W; Wilson, P W; Wells, J M

    1995-11-01

    18 different promoter elements, encompassing a 71-fold range of activity, were isolated from the chromosome of Lactococcus lactis (Ll) MG1363 and from an uncharacterised small isometric bacteriophage of Ll. The Vibrio fischeri (Vf) luciferase-encoding gene (lux) was used as a reporter in Ll, so that the promoters could be identified strictly on the basis of their activity in the homologous host. Sequence and primer extension analysis of six of the promoters has provided a new consensus sequence for the -35 and -10 hexanucleotide motifs present upstream from lactococcal transcription start points. When the nucleotide sequence of the most active promoter (P15) was compared with that of the highly expressed Ll usp45 gene, a novel 8-bp region of homology was identified which corresponded to the newly derived consensus -35 sequence element; this element may therefore be of general importance in Ll gene expression. The isolation of these promoters has also enabled us to investigate the characteristics of the Vf Lux activity in Ll under different physiological conditions using promoters of different strengths. Lux activity in Ll is critically dependent upon the phase of cell growth. Luminescence falls sharply in stationary phase, possibly due to a lack of FMNH2. In contrast to the kinetics of Lux function in Escherichia coli (Ec), Lux activity in Ll declines rapidly after addition of the substrate; the rate of decay is dependent both on the growth phase and on the strength of the promoter. It is apparent that the previously reported thermal instability of Lux is in fact a function of the host organism in which Lux is expressed.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7489923

  3. Prophylaxis of experimentally induced ovomucoid allergy in neonatal pigs using Lactococcus lactis.

    PubMed

    Rupa, P; Schmied, J; Wilkie, B N

    2011-03-15

    Probiotic Lactococcus lactis (LL) is immunomodulatory and may prevent allergy by biasing from type-2 to a type-1 immune response. We hypothesized that newborn pigs pre-treated orally with LL are protected against allergy to ovomucoid (Ovm). Pigs were assigned to two treatment groups. Piglets were pretreated orally on days of age 1-7, 10, 12, 14, 21, 28 and 35 with LL (n=30) or medium (control, n=32) and sensitized to Ovm by intraperitoneal injection together with cholera toxin on days 14, 21 and 35. Pigs were orally challenged with egg white (day 46) and assigned scores for allergic signs. Outcomes were measured as direct skin tests, serum antibody to Ovm [IgG (H+L); IgE; IgG(1) and IgG(2)] and cytokine production by mitogen-stimulated blood mononuclear cells (BMC). Clinical signs and skin test positivity were less frequent in the LL group (p ? 0.0001). Serum antibody associated with IgG (H and L), IgE, IgG(1) or IgG(2) was significantly increased on day 46 (post-sensitization) compared to day 14 (pre-sensitization) (p ? 0.0001). The LL-treated pigs had more IgE and IgG(2)-related antibody activity and lower IgG(1)/IgG(2) and IgE/IgG(2) ratios indicating a type-1 bias in immune response (p ? 0.05). Concentration of type-2 cytokines interleukin IL-4 and IL-10 were significantly lower in supernatants of stimulated BMC of LL-treated pigs (p ? 0.0001). Interferon-?, TGF-? and IL-13 were not detected in control or treated animals. Thus, oral treatment of neonatal pigs with LL significantly reduced subsequent frequency of allergy to Ovm associated with reduced type-2 immune response correlates hence supporting the "hygiene hypothesis" and potential use of LL as a neonatal immunoregulator. PMID:21134696

  4. Monte-Carlo Modeling of the Central Carbon Metabolism of Lactococcus lactis: Insights into Metabolic Regulation

    PubMed Central

    Murabito, Ettore; Verma, Malkhey; Bekker, Martijn; Bellomo, Domenico; Westerhoff, Hans V.; Teusink, Bas; Steuer, Ralf

    2014-01-01

    Metabolic pathways are complex dynamic systems whose response to perturbations and environmental challenges are governed by multiple interdependencies between enzyme properties, reactions rates, and substrate levels. Understanding the dynamics arising from such a network can be greatly enhanced by the construction of a computational model that embodies the properties of the respective system. Such models aim to incorporate mechanistic details of cellular interactions to mimic the temporal behavior of the biochemical reaction system and usually require substantial knowledge of kinetic parameters to allow meaningful conclusions. Several approaches have been suggested to overcome the severe data requirements of kinetic modeling, including the use of approximative kinetics and Monte-Carlo sampling of reaction parameters. In this work, we employ a probabilistic approach to study the response of a complex metabolic system, the central metabolism of the lactic acid bacterium Lactococcus lactis, subject to perturbations and brief periods of starvation. Supplementing existing methodologies, we show that it is possible to acquire a detailed understanding of the control properties of a corresponding metabolic pathway model that is directly based on experimental observations. In particular, we delineate the role of enzymatic regulation to maintain metabolic stability and metabolic recovery after periods of starvation. It is shown that the feedforward activation of the pyruvate kinase by fructose-1,6-bisphosphate qualitatively alters the bifurcation structure of the corresponding pathway model, indicating a crucial role of enzymatic regulation to prevent metabolic collapse for low external concentrations of glucose. We argue that similar probabilistic methodologies will help our understanding of dynamic properties of small-, medium- and large-scale metabolic networks models. PMID:25268481

  5. Biological characteristics and probiotic effect of Leuconostoc lactis strain isolated from the intestine of black porgy fish

    PubMed Central

    Zhang, Wei; Liu, Mingqi; Dai, Xianjun

    2013-01-01

    A strain of lactic acid bacteria, Leuconostoc lactis, was isolated from the intestinal tract of black porgy, Sparus macrocephalus, and identified by conventional biochemical characteristics and 16S rDNA gene sequence analysis. The isolated strain had the ability of bile tolerance and resistance to low pH, and survived well in the trypsinase and pepsin solution. But the highly concentrated dose of trypsinase and pepsin affect the viability of the isolated strain. The isolate was resistant to several antibiotics, including Cephalothin, Ceftriaxone, Imipenem and Tobramycin. The isolate could auto-aggregate itself and coaggregate with other bacteria in vitro. The autoaggregation percentage increased to 23.29% after 20 h of incubation. The percentage of coaggregation were respectively 31.21%, 29.44%, 10.74%, 16.49%, 24.36%, 24.41% and 20.99% for Vibrio parahaemolyticus, Listeria monocytogenes, Escherichia coli O157, Salmonella typhimurium, Shigella, Staphylococcus aureus and Proteusbacillus vulgaris after 20 h incubation of a mixed suspension. The supernatant of the strain inhibited the growth of several pathogens, such as V.parahaemolyticus, Vibrio harveyi, Vibrio alginolyticus, Staphylococcus aureus, Escherichia coli O157, Salmonella typhimurium, Bacillus subtilis, Proteusbacillus vulgaris and Shigella. These results indicated that the isolate, Leuconostoc lactis, might be an attractive candidate for perspectival strain for probiotics in marine aquaculture. PMID:24516418

  6. Evaporation induced self assembled microstructures of silica nanoparticles and Streptococcus lactis cells as sorbent for uranium (VI).

    PubMed

    Mishra, Archana; Melo, Jose Savio; Sen, Debasis; D'Souza, Stanislaus Francis

    2014-01-15

    An assembled microstructure of silica nanoparticles and Streptococcus lactis (S. lactis) cells has been synthesized by evaporation induced self assembly, with the objective of its application in bioremediation. Different morphologies have been realized by tuning the physico-chemical conditions of the assembly process. The potential of these microstructures in removal of uranium (VI) has been evaluated. Morphology dependent uptake has been demonstrated and maximum uptake was seen for the spray dried doughnut shaped microstructure (SDSM). For a fixed morphology, the variation in uptake varies with solution pH, contact time, temperature and initial uranium (VI) concentration. The U (VI) removal was significantly rapid, with more than 85 ± 2% of total uptake in 10 min. The maximum sorption capacity (qmax) of U (VI) at pH 5.0 and temperature 298 K was 169.5 mg/g using SDSM as sorbent. The kinetic data of adsorption of U (VI) are best described by a pseudo-second-order kinetic model. Calculated thermodynamic parameters reveal an endothermic and a spontaneous adsorption process. The present work opens up the possibility of a means for the functionalization of silica microstructures through the incorporation of micro-organism and the potential for the use of these functionalized materials for bioremediation. PMID:24231081

  7. Behavior and viability of spontaneous oxidative stress-resistant Lactococcus lactis mutants in experimental fermented milk processing.

    PubMed

    Oliveira, M N; Almeida, K E; Damin, M R; Rochat, T; Gratadoux, J-J; Miyoshi, A; Langella, P; Azevedo, V

    2009-01-01

    Previously, we isolated two strains of spontaneous oxidative (SpOx2 and SpOx3) stress mutants of Lactococcus lactis subsp cremoris. Herein, we compared these mutants to a parental wild-type strain (J60011) and a commercial starter in experimental fermented milk production. Total solid contents of milk and fermentation temperature both affected the acidification profile of the spontaneous oxidative stress-resistant L. lactis mutants during fermented milk production. Fermentation times to pH 4.7 ranged from 6.40 h (J60011) to 9.36 h (SpOx2); V(max) values were inversely proportional to fermentation time. Bacterial counts increased to above 8.50 log(10) cfu/mL. The counts of viable SpOx3 mutants were higher than those of the parental wild strain in all treatments. All fermented milk products showed post-fermentation acidification after 24 h of storage at 4 degrees C; they remained stable after one week of storage. PMID:19731206

  8. Plasmid linkage of the D-tagatose 6-phosphate pathway in Streptococcus lactis: effect on lactose and galactose metabolism.

    PubMed Central

    Crow, V L; Davey, G P; Pearce, L E; Thomas, T D

    1983-01-01

    The three enzymes of the D-tagatose 6-phosphate pathway (galactose 6-phosphate isomerase, D-tagatose 6-phosphate kinase, and tagatose 1,6-diphosphate aldolase) were absent in lactose-negative (Lac-) derivatives of Streptococcus lactis C10, H1, and 133 grown on galactose. The lactose phosphoenolpyruvate-dependent phosphotransferase system and phospho-beta-galactosidase activities were also absent in Lac- derivatives of strains H1 and 133 and were low (possibly absent) in C10 Lac-. In all three Lac- derivatives, low galactose phosphotransferase system activity was found. On galactose, Lac- derivatives grew more slowly (presumably using the Leloir pathway) than the wild-type strains and accumulated high intracellular concentrations of galactose 6-phosphate (up to 49 mM); no intracellular tagatose 1,6-diphosphate was detected. The data suggest that the Lac phenotype is plasmid linked in the three strains studied, with the evidence being more substantial for strain H1. A Lac- derivative of H1 contained a single plasmid (33 megadaltons) which was absent from the Lac- mutant. We suggest that the genes linked to the lactose plasmid in S. lactis are more numerous than previously envisaged, coding for all of the enzymes involved in lactose metabolism from initial transport to the formation of triose phosphates via the D-tagatose 6-phosphate pathway. Images PMID:6294064

  9. Location, characterization and expression of lytic enzyme-encoding gene, lytA, of Lactococcus lactis bacteriophage phi US3.

    PubMed

    Platteeuw, C; de Vos, W M

    1992-09-01

    Gene lytA, which encodes lytic enzyme (LytA), of the isometric Lactococcus lactis bacteriophage phi US3, was cloned and expressed in Escherichia coli. The lytA gene was located on the physical map of the phi US3 32-kb DNA that contains cohesive ends. Initial expression of lytA was detected by lysis of an overlay of cells of the phage-sensitive strain, L. lactis SK112. However, LytA appeared to have a broad spectrum and induced lysis in more than 30 different lactococcal strains. The nucleotide sequence of lytA showed a single open reading frame (ORF) of 774 bp encoding a protein of 258 amino acids (aa) with a calculated M(r) of 28,977. This is in agreement with the size of 29 kDa as determined for LytA produced in E. coli using a T7 expression system. The lytA gene is preceded by an ORF that may code for a hydrophobic peptide of 66 aa containing a putative secretion signal, and two putative transmembrane helices. The deduced aa sequence of the phage phi US3 LytA shows similarities to that of the autolysin of Streptococcus pneumoniae which is known to be an amidase. PMID:1355060

  10. Specific Identification and Targeted Characterization of Bifidobacterium lactis from Different Environmental Isolates by a Combined Multiplex-PCR Approach

    PubMed Central

    Ventura, Marco; Reniero, Roberto; Zink, Ralf

    2001-01-01

    The species Bifidobacterium lactis, with its main representative strain Bb12 (DSM 10140), is a yoghurt isolate used as a probiotic strain and is commercially applied in different types of yoghurts and infant formulas. In order to ensure the genetic identity and safety of this bacterial isolate, species- and strain-specific molecular tools for genetic fingerprinting must be available to identify isolated bifidobacteria or lactic acid bacteria from, e.g., various clinical environments of relevance in medical microbiology. Two opposing rRNA gene-targeted primers have been developed for specific detection of this microorganism by PCR. The specificity of this approach was evaluated and verified with DNA samples isolated from single and mixed cultures of bifidobacteria and lactobacilli (48 isolates, including the type strains of 29 Bifidobacterium and 9 Lactobacillus species). Furthermore, we performed a Multiplex-PCR using oligonucleotide primers targeting a specific region of the 16S rRNA gene for the genus Bifidobacterium and a conserved eubacterial 16S rDNA sequence. The specificity and sensitivity of this detection with a pure culture of B. lactis were, respectively, 100 bacteria/ml after 25 cycles of PCR and 1 to 10 bacteria/ml after a 50-cycle nested-PCR approach. PMID:11375192

  11. YtjE from Lactococcus lactis IL1403 Is a C-S Lyase with ?,?-Elimination Activity toward Methionine

    PubMed Central

    Martínez-Cuesta, M. Carmen; Peláez, Carmen; Eagles, John; Gasson, Michael J.; Requena, Teresa; Hanniffy, Sean B.

    2006-01-01

    Cheese microbiota and the enzymatic conversion of methionine to volatile sulfur compounds (VSCs) are important factors in flavor formation during cheese ripening and the foci in biotechnological approaches to flavor improvement. The product of ytjE of Lactococcus lactis IL1403, suggested to be a methionine-specific aminotransferase based on genome sequence analysis, was therefore investigated for its role in methionine catabolism. The ytjE gene from Lactococcus lactis IL1403 was cloned in Escherichia coli and overexpressed and purified as a recombinant protein. When tested, the YtjE protein did not exhibit a specific methionine aminotransferase activity. Instead, YtjE exhibited C-S lyase activity and shared homology with the MalY/PatC family of enzymes involved in the degradation of l-cysteine, l-cystine, and l-cystathionine. YtjE was also shown to exhibit ?,?-elimination activity toward l-methionine. In addition, gas chromatographic-mass spectrometry analysis showed that YtjE activity resulted in the formation of H2S from l-cysteine and methanethiol (and its oxidized derivatives dimethyl disulfide and dimethyl trisulfide) from l-methionine. Given their significance in cheese flavor development, VSC production by YtjE could offer an additional approach for the development of cultures with optimized aromatic properties. PMID:16820483

  12. Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae.

    PubMed

    Sequeiros, Cynthia; Garcés, Marisa E; Vallejo, Marisol; Marguet, Emilio R; Olivera, Nelda L

    2015-04-01

    Bacteriocin-producing Lactococcus lactis TW34 was isolated from marine fish. TW34 bacteriocin inhibited the growth of the fish pathogen Lactococcus garvieae at 5 AU/ml (minimum inhibitory concentration), whereas the minimum bactericidal concentration was 10 AU/ml. Addition of TW34 bacteriocin to L. garvieae cultures resulted in a decrease of six orders of magnitude of viable cells counts demonstrating a bactericidal mode of action. The direct detection of the bacteriocin activity by Tricine-SDS-PAGE showed an active peptide with a molecular mass ca. 4.5 kDa. The analysis by MALDI-TOF-MS detected a strong signal at m/z 2,351.2 that corresponded to the nisin leader peptide mass without the initiating methionine, whose sequence STKDFNLDLVSVSKKDSGASPR was confirmed by MS/MS. Sequence analysis of nisin structural gene confirmed that L. lactis TW34 was a nisin Z producer. This nisin Z-producing strain with probiotic properties might be considered as an alternative in the prevention of lactococcosis, a global disease in aquaculture systems. PMID:25549984

  13. Contribution of Lactococcus lactis Cell Envelope Proteinase Specificity to Peptide Accumulation and Bitterness in Reduced-Fat Cheddar Cheese†

    PubMed Central

    Broadbent, Jeffery R.; Barnes, Mary; Brennand, Charlotte; Strickland, Marie; Houck, Kristen; Johnson, Mark E.; Steele, James L.

    2002-01-01

    Bitterness is a flavor defect in Cheddar cheese that limits consumer acceptance, and specificity of the Lactococcus lactis extracellular proteinase (lactocepin) is widely believed to be a key factor in the development of bitter cheese. To better define the contribution of this enzyme to bitterness, we investigated peptide accumulation and bitterness in 50% reduced-fat Cheddar cheese manufactured with single isogenic strains of Lactococcus lactis as the only starter. Four isogens were developed for the study; one was lactocepin negative, and the others produced a lactocepin with group a, e, or h specificity. Analysis of cheese aqueous extracts by reversed-phase high-pressure liquid chromatography confirmed that accumulation of ?S1-casein (f 1-23)-derived peptides f 1-9, f 1-13, f 1-16, and f 1-17 in cheese was directly influenced by lactocepin specificity. Trained sensory panelists demonstrated that Cheddar cheese made with isogenic starters that produced group a, e, or h lactocepin was significantly more bitter than cheese made with a proteinase-negative isogen and that propensity for bitterness was highest in cells that produced group h lactocepin. These results confirm the role of starter proteinase in bitterness and suggest that the propensity of some industrial strains for production of the bitter flavor defect in cheese could be altered by proteinase gene exchange or gene replacement. PMID:11916696

  14. Ability of Lactococcus lactis To Export Viral Capsid Antigens: a Crucial Step for Development of Live Vaccines

    PubMed Central

    Dieye, Yakhya; Hoekman, Arjan J. W.; Clier, Florence; Juillard, Vincent; Boot, Hein J.; Piard, Jean-Christophe

    2003-01-01

    Thefood grade bacterium Lactococcus lactis is a potential vehicle for protein delivery in the gastrointestinal tract. As a model, we constructed lactococcal strains producing antigens of infectious bursal disease virus (IBDV). IBDV infects chickens and causes depletion of B-lymphoid cells in the bursa of Fabricius and subsequent immunosuppression, morbidity, or acute mortality. The two major IBDV antigens, i.e., VP2 and VP3, that form the viral capsid were expressed and targeted to the cytoplasm, the cell wall, or the extracellular compartment of L. lactis. Whereas VP3 was successfully targeted to the three compartments by the use of relevant expression and export vectors, VP2 was recalcitrant to export, thus confirming the difficulty of translocating naturally nonsecreted proteins across the bacterial membrane. This defect could be partly overcome by fusing VP2 to a naturally secreted protein (the staphylococcal nuclease Nuc) that carried VP2 through the membrane. Lactococcal strains producing Nuc-VP2 and VP3 in various bacterial compartments were administered orally to chickens. The chickens did not develop any detectable immune response against VP2 and VP3 but did exhibit an immune response against Nuc when Nuc-VP2 was anchored to the cell wall of lactococci. PMID:14660377

  15. The Riboflavin Transporter RibU in Lactococcus lactis: Molecular Characterization of Gene Expression and the Transport Mechanism

    PubMed Central

    Burgess, Catherine M.; Slotboom, Dirk Jan; Geertsma, Eric R.; Duurkens, Ria H.; Poolman, Bert; van Sinderen, Douwe

    2006-01-01

    This study describes the characterization of the riboflavin transport protein RibU in the lactic acid bacterium Lactococcus lactis subsp. cremoris NZ9000. RibU is predicted to contain five membrane-spanning segments and is a member of a novel transport protein family, not described in the Transport Classification Database. Transcriptional analysis revealed that ribU transcription is downregulated in response to riboflavin and flavin mononucleotide (FMN), presumably by means of the structurally conserved RFN (riboflavin) element located between the transcription start site and the start codon. An L. lactis strain carrying a mutated ribU gene exhibits altered transcriptional control of the riboflavin biosynthesis operon ribGBAH in response to riboflavin and FMN and does not consume riboflavin from its growth medium. Furthermore, it was shown that radiolabeled riboflavin is not taken up by the ribU mutant strain, in contrast to the wild-type strain, directly demonstrating the involvement of RibU in riboflavin uptake. FMN and the toxic riboflavin analogue roseoflavin were shown to inhibit riboflavin uptake and are likely to be RibU substrates. FMN transport by RibU is consistent with the observed transcriptional regulation of the ribGBAH operon by external FMN. The presented transport data are consistent with a uniport mechanism for riboflavin translocation and provide the first detailed molecular and functional analysis of a bacterial protein involved in riboflavin transport. PMID:16585736

  16. Identification and Molecular Characterization of the Chromosomal Exopolysaccharide Biosynthesis Gene Cluster from Lactococcus lactis subsp. cremoris SMQ-461

    PubMed Central

    Dabour, N.; LaPointe, G.

    2005-01-01

    The exopolysaccharide (EPS) capsule-forming strain SMQ-461 of Lactococcus lactis subsp. cremoris, isolated from raw milk, produces EPS with an apparent molecular mass of >1.6 × 106 Da. The EPS biosynthetic genes are located on the chromosome in a 13.2-kb region consisting of 15 open reading frames. This region is flanked by three IS1077-related tnp genes (L. lactis) at the 5? end and orfY, along with an IS981-related tnp gene, at the 3? end. The eps genes are organized in specific regions involved in regulation, chain length determination, biosynthesis of the repeat unit, polymerization, and export. Three (epsGIK) of the six predicted glycosyltransferase gene products showed low amino acid similarity with known glycosyltransferases. The structure of the repeat unit could thus be different from those known to date for Lactococcus. Reverse transcription-PCR analysis revealed that the eps locus is transcribed as a single mRNA. The function of the eps gene cluster was confirmed by disrupting the priming glycosyltransferase gene (epsD) in Lactococcus cremoris SMQ-461, generating non-EPS-producing reversible mutants. This is the first report of a chromosomal location for EPS genetic elements in Lactococcus cremoris, with novel glycosyltransferases not encountered before in lactic acid bacteria. PMID:16269783

  17. Enhanced secretion of heterologous proteins in Kluyveromyces lactis by overexpression of the GDP-mannose pyrophosphorylase, KlPsa1p.

    PubMed

    Uccelletti, Daniela; Staneva, Dessislava; Rufini, Silvia; Venkov, Pencho; Palleschi, Claudio

    2005-05-01

    GDP-mannose is the mannosyl donor for the glycosylation reactions and is synthesized by GDP-mannose pyrophosphorylase from GTP and d-mannose-1-phosphate; in Saccharomyces cerevisiae this enzyme is encoded by the PSA1/VIG9/SRB1 gene. We isolated the Kluyveromyces lactis KlPSA1 gene by complementing the osmotic growth defects of S. cerevisiae srb1/psa1 mutants. KlPsa1p displayed a high degree of similarity with other GDP-mannose pyrophosphorylases and was demonstrated to be the functional homologue of S. cerevisiae Psa1p. Phenotypic analysis of a K. lactis strain overexpressing the KlPSA1 gene revealed changes in the cell wall assembly. Increasing the KlPSA1 copy number restored the defects in O-glycosylation, but not those in N-glycosylation, that occur in K. lactis cells depleted for the hexokinase Rag5p. Overexpression of GDP-mannose pyrophosphorylase also enhanced heterologous protein secretion in K. lactis as assayed by using the recombinant human serum albumin and the glucoamylase from Arxula adeninivorans. PMID:15851102

  18. Acoustic Emission Signal of Lactococcus lactis before and after Inhibition with NaN3 and Infection with Bacteriophage c2

    PubMed Central

    Stencel, John M.; Hicks, Clair D.; Payne, Fred; Ozevin, Didem

    2013-01-01

    The detection of acoustic emission (AE) from Lactococcus lactis, ssp lactis is reported in which emission intensities are used to follow and define metabolic activity during growth in nutrient broths. Optical density (OD) data were also acquired during L. lactis growth at 32°C and provided insight into the timing of the AE signals relative to the lag, logarithmic, and stationary growth phases of the bacteria. The inclusion of a metabolic inhibitor, NaN3, into the nutrient broth eliminated bacteria metabolic activity according to the OD data, the absence of which was confirmed using AE data acquisition. The OD and AE data were also acquired before and after the addition of Bacteriophage c2 in L. lactis containing nutrient broths during the early or middle logarithmic phase; c2 phage m.o.i. (Multiplicity of infection) was varied to help differentiate whether the detected AE was from bacteria cells during lysis or from the c2 phage during genome injection into the cells. It is proposed that AE measurements using piezoelectric sensors are sensitive enough to detect bacteria at the amount near 104?cfu/mL, to provide real time data on bacteria metabolic activity and to dynamically monitor phage infection of cells. PMID:24349820

  19. Acoustic Emission Signal of Lactococcus lactis before and after Inhibition with NaN 3 and Infection with Bacteriophage c2.

    PubMed

    Ghosh, Debasish; Stencel, John M; Hicks, Clair D; Payne, Fred; Ozevin, Didem

    2013-01-01

    The detection of acoustic emission (AE) from Lactococcus lactis, ssp lactis is reported in which emission intensities are used to follow and define metabolic activity during growth in nutrient broths. Optical density (OD) data were also acquired during L. lactis growth at 32°C and provided insight into the timing of the AE signals relative to the lag, logarithmic, and stationary growth phases of the bacteria. The inclusion of a metabolic inhibitor, NaN3, into the nutrient broth eliminated bacteria metabolic activity according to the OD data, the absence of which was confirmed using AE data acquisition. The OD and AE data were also acquired before and after the addition of Bacteriophage c2 in L. lactis containing nutrient broths during the early or middle logarithmic phase; c2 phage m.o.i. (Multiplicity of infection) was varied to help differentiate whether the detected AE was from bacteria cells during lysis or from the c2 phage during genome injection into the cells. It is proposed that AE measurements using piezoelectric sensors are sensitive enough to detect bacteria at the amount near 10(4)?cfu/mL, to provide real time data on bacteria metabolic activity and to dynamically monitor phage infection of cells. PMID:24349820

  20. Lactic acid production from deproteinized whey by mixed cultures of free and coimmobilized Lactobacillus casei and Lactococcus lactis cells using fedbatch culture

    Microsoft Academic Search

    T. Roukas; P. Kotzekidou

    1998-01-01

    The production of lactic acid from deproteinized whey by mixed cultures of free and coimmobilized Lactobacillus casei and Lactococcus lactis cells in batch and fedbatch culture was investigated. Fedbatch culture proved to be a better fermentation system for the production of lactic acid than batch culture. The maximum lactic acid concentration (46 g l?1) in fedbatch culture was obtained with

  1. Effect of Bifidobacterium lactis on the Incidence of Nosocomial Infections in Very-Low-Birth-Weight Infants: A Randomized Controlled Trial

    Microsoft Academic Search

    W. A. Mihatsch; S. Vossbeck; B. Eikmanns; J. Hoegel; F. Pohlandt

    2010-01-01

    Background: Nosocomial infections endanger preterm infants. Objective: The aim of the present controlled randomized trial was to investigate whether Bifidobacterium lactis reduces the incidence of nosocomial infections in infants with very low birth weight (VLBW; <1,500 g) <30 weeks of gestation. Patients and Methods: In a randomized controlled trial, 183 VLBW infants <30 weeks of gestation were stratified according to

  2. Increase of stress resistance in Lactococcus lactis via a novel food-grade vector expressing a shsp gene from Streptococcus thermophilus.

    PubMed

    Tian, Hongtao; Tan, Jianxin; Zhang, Lifang; Gu, Xinxi; Xu, Wentao; Guo, Xinghua; Luo, Yunbo

    2012-07-01

    The effects of the expression of a small heat shock protein (shsp) gene from Streptococcus thermophilus on stress resistance in Lactococcus lactis under different environmental stresses were investigated in this study. pMG36e-shsp, an expression vector, was first constructed by inserting a shsp open reading frame (ORF) cloned from S. thermophilus strain St-QC into pMG36e. Then, a food-grade expression vector, pMG-shsp, was generated by deleting the erythromycin resistance gene from pMG36e-shsp. The transformation rate of pMG-shsp was comparable to that of pMG36e-shsp when each of these two vectors was introduced into L. lactis. These results demonstrated that the shsp ORF could successfully used as a food-grade selection marker in both pMG-shsp and pMG36e-shsp. Furthermore, the growth characteristics were almost the same between L. lactis ML23 transformants harboring pMG36e or pMG-shsp. The survival rate of L. lactis ML23 expressing the shsp ORF were increased to 0.032%, 0.006%, 0.0027%, 0.03%, and 0.16% under the following environmental stresses: heat, acid, ethanol, bile salt and H2O2, respectively. These results indicated that the expression of the shsp gene in the food-grade vector pMG-shsp conferred resistance to environmental stresses without affecting the growth characteristics of L. lactis ML23. PMID:24031940

  3. Caught in the act: the structure of phosphorylated beta-phosphoglucomutase from Lactococcus lactis.

    PubMed

    Lahiri, Sushmita D; Zhang, Guofeng; Dunaway-Mariano, Debra; Allen, Karen N

    2002-07-01

    Phosphoglucomutases catalyze the interconversion of D-glucose 1-phosphate and D-glucose 6-phosphate, a reaction central to energy metabolism in all cells and to the synthesis of cell wall polysaccharides in bacterial cells. Two classes of phosphoglucomutases (alpha-PGM and beta-PGM) are distinguished on the basis of their specificity for alpha- and beta-glucose-1-phosphate. beta-PGM is a member of the haloacid dehalogenase (HAD) superfamily, which includes the sarcoplasmic Ca(2+)-ATPase, phosphomannomutase, and phosphoserine phosphatase. beta-PGM is unusual among family members in that the common phosphoenzyme intermediate exists as a stable ground-state complex in this enzyme. Herein we report, for the first time, the three-dimensional structure of a beta-PGM and the first view of the true phosphoenzyme intermediate in the HAD superfamily. The crystal structure of the Mg(II) complex of phosphorylated beta-phosphoglucomutase (beta-PGM) from Lactococcus lactis has been determined to 2.3 A resolution by multiwavelength anomalous diffraction (MAD) phasing on selenomethionine, and refined to an R(cryst) = 0.24 and R(free) = 0.28. The active site of beta-PGM is located between the core and the cap domain and is freely solvent accessible. The residues within a 6 A radius of the phosphorylated Asp8 include Asp10, Thr16, Ser114, Lys145, Glu169, and Asp170. The cofactor Mg(2+) is liganded with octahedral coordination geometry by the carboxylate side chains of Asp8, Glu169, Asp170, and the backbone carbonyl oxygen of Asp10 along with one oxygen from the Asp8-phosphoryl group and one water ligand. The phosphate group of the phosphoaspartyl residue, Asp8, interacts with the side chains of Ser114 and Lys145. The absence of a base residue near the aspartyl phosphate group accounts for the persistence of the phosphorylated enzyme under physiological conditions. Substrate docking shows that glucose-6-P can bind to the active site of phosphorylated beta-PGM in such a way as to position the C(1)OH near the phosphoryl group of the phosphorylated Asp8 and the C(6) phosphoryl group near the carboxylate group of Asp10. This result suggests a novel two-base mechanism for phosphoryl group transfer in a phosphorylated sugar. PMID:12081483

  4. Immune response elicited by DNA vaccination using Lactococcus lactis is modified by the production of surface exposed pathogenic protein.

    PubMed

    Pontes, Daniela; Azevedo, Marcela; Innocentin, Silvia; Blugeon, Sébastien; Lefévre, François; Azevedo, Vasco; Miyoshi, Anderson; Courtin, Pascal; Chapot-Chartier, Marie-Pierre; Langella, Philippe; Chatel, Jean-Marc

    2014-01-01

    In this study, we compared immune responses elicited by DNA immunization using Lactococcus lactis or L. lactis expressing the Staphylococcus aureus invasin Fibronectin Binding Protein A (FnBPA) at its surface. Both strains carried pValac:BLG, a plasmid containing the cDNA of Beta-Lactoglobulin (BLG), and were designated LL-BLG and LL-FnBPA+ BLG respectively. A TH2 immune response characterized by the secretion of IL-4 and IL-5 in medium of BLG reactivated splenocytes was detected after either oral or intranasal administration of LL-FnBPA+ BLG. In contrast, intranasal administration of LL-BLG elicited a TH1 immune response. After BLG sensitization, mice previously intranasally administered with LL-BLG showed a significantly lower concentration of BLG-specific IgE than the mice non-administered. Altenatively administration of LL-FnBPA+ BLG didn't modify the BLG-specific IgE concentration obtained after sensitization, thus confirming the TH2 orientation of the immune response. To determine if the TH2-skewed immune response obtained with LL-FnBpA+ BLG was FnBPA-specific or not, mice received another L. lactis strain producing a mutated form of the Listeria monocytogenes invasin Internalin A intranasally, allowing thus the binding to murine E-cadherin, and containing pValac:BLG (LL-mInlA+ BLG). As with LL-FnBPA+ BLG, LL-mInlA+ BLG was not able to elicit a TH1 immune response. Furthermore, we observed that these difference were not due to the peptidoglycan composition of the cell wall as LL-FnBPA+ BLG, LL-mInlA+ BLG and LL-BLG strains shared a similar composition. DNA vaccination using LL-BLG elicited a pro-inflammatory TH1 immune response while using LL-FnBPA+ BLG or LL-mInlA+ BLG elicited an anti-inflammatory TH2 immune response. PMID:24465412

  5. Engineering the cell surface display of cohesins for assembly of cellulosome-inspired enzyme complexes on Lactococcus lactis

    PubMed Central

    2010-01-01

    Background The assembly and spatial organization of enzymes in naturally occurring multi-protein complexes is of paramount importance for the efficient degradation of complex polymers and biosynthesis of valuable products. The degradation of cellulose into fermentable sugars by Clostridium thermocellum is achieved by means of a multi-protein "cellulosome" complex. Assembled via dockerin-cohesin interactions, the cellulosome is associated with the cell surface during cellulose hydrolysis, forming ternary cellulose-enzyme-microbe complexes for enhanced activity and synergy. The assembly of recombinant cell surface displayed cellulosome-inspired complexes in surrogate microbes is highly desirable. The model organism Lactococcus lactis is of particular interest as it has been metabolically engineered to produce a variety of commodity chemicals including lactic acid and bioactive compounds, and can efficiently secrete an array of recombinant proteins and enzymes of varying sizes. Results Fragments of the scaffoldin protein CipA were functionally displayed on the cell surface of Lactococcus lactis. Scaffolds were engineered to contain a single cohesin module, two cohesin modules, one cohesin and a cellulose-binding module, or only a cellulose-binding module. Cell toxicity from over-expression of the proteins was circumvented by use of the nisA inducible promoter, and incorporation of the C-terminal anchor motif of the streptococcal M6 protein resulted in the successful surface-display of the scaffolds. The facilitated detection of successfully secreted scaffolds was achieved by fusion with the export-specific reporter staphylococcal nuclease (NucA). Scaffolds retained their ability to associate in vivo with an engineered hybrid reporter enzyme, E. coli ?-glucuronidase fused to the type 1 dockerin motif of the cellulosomal enzyme CelS. Surface-anchored complexes exhibited dual enzyme activities (nuclease and ?-glucuronidase), and were displayed with efficiencies approaching 104 complexes/cell. Conclusions We report the successful display of cellulosome-inspired recombinant complexes on the surface of Lactococcus lactis. Significant differences in display efficiency among constructs were observed and attributed to their structural characteristics including protein conformation and solubility, scaffold size, and the inclusion and exclusion of non-cohesin modules. The surface-display of functional scaffold proteins described here represents a key step in the development of recombinant microorganisms capable of carrying out a variety of metabolic processes including the direct conversion of cellulosic substrates into fuels and chemicals. PMID:20840763

  6. CTAB-mediated, single-step preparation of competent Escherichia coli, Bifidobacterium sp. and Kluyveromyces lactis cells

    PubMed Central

    Rajagopal, Kammara; Singh, Praveen Kumar; Kumar, Rajesh; Siddiqui, Kaneez Fatima

    2014-01-01

    An efficient and reproducible method for transformation depends on the competency of the organism. We have developed a simple method for the preparation of competent Escherichia coli, Kluyveromyces lactis, and Bifidobacterium sp. by using a buffer containing cetyl trimethyl ammonium bromide (CTAB) and permits efficient uptake of plasmid DNA and ligation-reaction products. Cells are harvested, washed, mixed with 1–10 ?g/ml CTAB, incubated, and followed by a buffer wash. For long-term storage of competent cells, bacteria may be frozen in 10% glycerol without the addition of other components. The transformation process is very simple; plasmid DNA and the cells are mixed and incubated for 5–60 min at 4 °C; no heat pulse is required, and the duration of incubation at 4 °C is not crucial. PMID:25606463

  7. Recombinant Lactococcus lactis can make the difference in antigen-specific immune tolerance induction, the Type 1 Diabetes case

    PubMed Central

    2014-01-01

    Especially in western civilizations, immune diseases that are driven by innocuous (auto- or allo-) antigens are gradually evolving to become pandemic threats. A particularly poignant example is type 1 diabetes, where young children are confronted with the perspective and consequences of total pancreatic ?-cell destruction. Along these disquieting observations we find ourselves equipped with impressively accumulating molecular immunological knowledge on the ins and outs of these pathologies. Often, however, it is difficult to translate this wealth into efficacious medicines. The molecular understanding, the concept of oral tolerance induction, the benefit of using recombinant Lactococcus lactis therein and recent openings towards their clinical use may well enable turning all colors to their appropriate fields on this Rubik's cube. PMID:25185797

  8. Benchmarking Various Green Fluorescent Protein Variants in Bacillus subtilis, Streptococcus pneumoniae, and Lactococcus lactis for Live Cell Imaging

    PubMed Central

    Overkamp, Wout; Beilharz, Katrin; Detert Oude Weme, Ruud; Solopova, Ana; Karsens, Harma; Kovács, Ákos T.; Kok, Jan

    2013-01-01

    Green fluorescent protein (GFP) offers efficient ways of visualizing promoter activity and protein localization in vivo, and many different variants are currently available to study bacterial cell biology. Which of these variants is best suited for a certain bacterial strain, goal, or experimental condition is not clear. Here, we have designed and constructed two “superfolder” GFPs with codon adaptation specifically for Bacillus subtilis and Streptococcus pneumoniae and have benchmarked them against five other previously available variants of GFP in B. subtilis, S. pneumoniae, and Lactococcus lactis, using promoter-gfp fusions. Surprisingly, the best-performing GFP under our experimental conditions in B. subtilis was the one codon optimized for S. pneumoniae and vice versa. The data and tools described in this study will be useful for cell biology studies in low-GC-rich Gram-positive bacteria. PMID:23956387

  9. Cell immobilization studies using a cellulose-binding domain fused to PrtP in Lactococcus lactis.

    PubMed

    Liu, Shanna; Kylä-Nikkilä, Kari; Saris, Per E J

    2011-01-01

    The cellulose-binding domain (CBD) of XylA was fused with PrtP, NisP and AcmA anchors derived from Lactococcus lactis under P45 promoter and Usp45 secretion signal. The fusion construct with the anchor PrtP (334 aa) was shown to exhibit the most efficient immobilization. The CBD-PrtP construct on the other hand was not efficiently attached to the cell wall and as such was found mainly in the supernatant. Results also showed that expression of the CBD-NisP anchor fusion led to a similar result. This raised the question if more efficient binding of the anchor to the cell wall by sortase could enhance the efficiency of cell immobilization to the cellulosic material. However, expressing sortase with the CBD-PrtP fusion did not improve the immobilization of the cells to cellulose.   PMID:21637005

  10. Use of the usp45 lactococcal secretion signal sequence to drive the secretion and functional expression of enterococcal bacteriocins in Lactococcus lactis.

    PubMed

    Borrero, Juan; Jiménez, Juan J; Gútiez, Loreto; Herranz, Carmen; Cintas, Luis M; Hernández, Pablo E

    2011-01-01

    Replacement of the signal peptide (SP) of the bacteriocins enterocin P (EntP) and hiracin JM79 (HirJM79), produced by Enterococcus faecium P13 and Enterococcus hirae DCH5, respectively, by the signal peptide of Usp45 (SP(usp45)), the major Sec-dependent protein secreted by Lactococcus lactis, permits the production, secretion, and functional expression of EntP and HirJM79 by L. lactis. Chimeric genes encoding the SP(usp45) fused to either mature EntP (entP), with or without the immunity gene (entiP) or to mature HirJM79 (hirJM79), with or without the immunity gene (hiriJM79), were cloned into the expression vector pMG36c, carrying the P(32) constitutive promoter, and into pNZ8048 under control of the inducible PnisA promoter. The production of EntP and HirJM79 by most of the L. lactis recombinant strains was 1.5- to 3.7-fold higher and up to 3.6-fold higher than by the E. faecium P13 and E. hirae DCH5 control strains, respectively. However, the specific antimicrobial activity of the recombinant EntP was 1.1- to 6.2-fold higher than that produced by E. faecium P13, while that of the HirJM79 was a 40% to an 89% of that produced by E. hirae DCH5. Chimeras of SP(usp45) fused to mature EntP or HirJM79 drive the production and secretion of these bacteriocins in L. lactis in the absence of specific immunity and secretion proteins. The supernatants of the recombinant L. lactis NZ9000 strains, producers of EntP, showed a much higher antimicrobial activity against Listeria spp. than that of the recombinant L. lactis NZ9000 derivatives, producers of HirJM79. PMID:20842358

  11. Effect of Fermentation Conditions on Growth of Streptococcus cremoris AM2 and Leuconostoc lactis CNRZ 1091 in Pure and Mixed Cultures

    PubMed Central

    Boquien, Clair-Yves; Corrieu, Georges; Desmazeaud, Michel J.

    1988-01-01

    Two strains of mesophilic lactic acid bacteria, Streptococcus cremoris AM2 and Leuconostoc lactis CNRZ 1091, were grown in pure and mixed cultures in the presence or absence of citrate (15 mM) and at controlled (pH 6.5) or uncontrolled pH. Microbial cell densities at the end of growth, maximum growth rates, the pH decrease of the medium resulting from growth, and the corresponding acidification rates were determined to establish comparisons. The control of pH in pure cultures had no effect on L. lactis CNRZ 1091 populations. The final populations of S. cremoris AM2, however, were at least five times higher than when the pH was not controlled (4 × 108 vs. 2 × 109 CFU · ml?1). The pH had no effect on the growth rate of either strain. That of S. cremoris AM2 (0.8 h?1) was about twice that of L. lactis CNRZ 1091. When the pH fell below 5, the growth of both strains decreased or stopped altogether. Citrate had no effect on S. cremoris AM2, while final populations of L. lactis CNRZ 1091 were two to three times higher (3 × 108 CFU · ml?1); it had no effect on the maximum growth rates of the two strains. Citrate attenuated the pH decrease of the medium and reduced the maximum acidification rate of the culture by 50%, due to the growth of S. cremoris AM2. Acidification due to L. lactis CNRZ 1091, however, was very slight. Regardless of the conditions of pH and citrate, the total bacterial population in mixed culture was lower (by 39%) than that of the sum of each pure culture. Mixed culture improved the maximum growth rate of L. lactis CNRZ 1091 (0.6 h?1) by 50%, while that of S. cremoris AM2 was unaffected. The acidification rate of the growth medium in mixed culture, affected by the presence of citrate, resulted from the development and activity of S. cremoris AM2. PMID:16347760

  12. Improved Acid Stress Survival of Lactococcus lactis Expressing the Histidine Decarboxylation Pathway of Streptococcus thermophilus CHCC1524*

    PubMed Central

    Trip, Hein; Mulder, Niels L.; Lolkema, Juke S.

    2012-01-01

    Degradative amino acid decarboxylation pathways in bacteria generate secondary metabolic energy and provide resistance against acid stress. The histidine decarboxylation pathway of Streptococcus thermophilus CHCC1524 was functionally expressed in the heterologous host Lactococcus lactis NZ9000, and the benefits of the newly acquired pathway for the host were analyzed. During growth in M17 medium in the pH range of 5–6.5, a small positive effect was observed on the biomass yield in batch culture, whereas no growth rate enhancement was evident. In contrast, a strong benefit for the engineered L. lactis strain was observed in acid stress survival. In the presence of histidine, the pathway enabled cells to survive at pH values as low as 3 for at least 2 h, conditions under which the host cells were rapidly dying. The flux through the histidine decarboxylation pathway in cells grown at physiological pH was under strict control of the electrochemical proton gradient (pmf) across the membrane. Ionophores that dissipated the membrane potential (??) and/or the pH gradient (?pH) strongly increased the flux, whereas the presence of glucose almost completely inhibited the flux. Control of the pmf over the flux was exerted by both ?? and ?pH and was distributed over the transporter HdcP and the decarboxylase HdcA. The control allowed for a synergistic effect between the histidine decarboxylation and glycolytic pathways in acid stress survival. In a narrow pH range around 2.5 the synergism resulted in a 10-fold higher survival rate. PMID:22351775

  13. A Starter Culture Rotation Strategy Incorporating Paired Restriction/ Modification and Abortive Infection Bacteriophage Defenses in a Single Lactococcus lactis Strain

    PubMed Central

    Durmaz, E.; Klaenhammer, T. R.

    1995-01-01

    Three derivatives of Lactococcus lactis subsp. lactis NCK203, each with a different pair of restriction/ modification (R/M) and abortive infection (Abi) phage defense systems, were constructed and then rotated in repeated cycles of a milk starter culture activity test (SAT). The rotation proceeded successfully through nine successive SATs in the presence of phage and whey containing phage from previous cycles. Lactococcus cultures were challenged with 2 small isometric-headed phages, (phi)31 and ul36, in one rotation series and with a composite of 10 industrial phages in another series. Two native lactococcal R(sup+)/M(sup+) plasmids, pTRK68 and pTRK11, and one recombinant plasmid, pTRK308, harboring a third distinct R/M system were incorporated into three NCK203 derivatives constructed separately for the rotation. The R(sup+)/M(sup+) NCK203 derivatives were transformed with high-copy-number plasmids encoding four Abi genes, abiA, abiC, per31, and per50. Various Abi and R/M combinations constructed in NCK203 were evaluated for their effects on cell growth, level of phage resistance, and retardation of phage development during repeated cycles of the SAT. The three NCK203 derivatives chosen for use in the SAT exhibited additive effects of the R/M and Abi phenotypes against sensitive phages. In such combinations, phage escaping restriction are prevented from completing their infective cycle by an abortive response that kills the host cell. The rotation series successfully controlled modified, recombinant, and mutant phages which were resistant to any one of the individual defense systems by presenting a different set of R/M and Abi defenses in the next test of the rotation. PMID:16534987

  14. Nisin-inducible secretion of a biologically active single-chain insulin analog by Lactococcus lactis NZ9000.

    PubMed

    Ng, Daphne T W; Sarkar, Casim A

    2011-08-01

    Oral delivery of insulin to diabetic patients is highly desirable because it would be non-invasive and more closely mimic normal physiology, but this route of administration typically results in low bioavailability due to low pH and enzymatic degradation along the gastrointestinal tract. To explore an alternative approach that may mitigate these obstacles and also facilitate local synthesis of new therapeutic protein molecules in the small intestine, we engineered the food-grade bacterium Lactococcus lactis (NZ9000) for nisin-inducible expression and secretion of a bioactive single-chain insulin (SCI) analog, SCI-57. We show that the addition of nisin during early-log phase has a modest inhibitory effect on cell growth but induction during mid-log phase has a negligible impact on proliferation, suggesting a tradeoff between cell growth rate and duration of induction. We find that a signal peptide such as usp45 is necessary for secretion of SCI-57 into the medium; furthermore, we demonstrate that this secreted SCI-57 is biologically active, as assessed by the ability of conditioned L. lactis medium to stimulate Akt signaling in differentiated 3T3-L1 adipocytes. Finally, we show that the biological activity of SCI-57 was enhanced by near-neutral or slightly alkaline pH during induction, which is comparable to the pH in the small intestine, and by removal of a C-terminal purification tag. This study demonstrates that food-grade bacteria can be engineered to secrete bioactive insulin analogs and opens up the possibility of oral insulin delivery using live microorganisms. PMID:21391210

  15. Detection of Bifidobacterium animalis subsp. lactis (Bb12) in the Intestine after Feeding of Sows and Their Piglets?

    PubMed Central

    Solano-Aguilar, Gloria; Dawson, Harry; Restrepo, Marta; Andrews, Kate; Vinyard, Bryan; Urban, Joseph F.

    2008-01-01

    A real-time PCR method has been developed to distinguish Bifidobacterium animalis subspecies in the gastrointestinal tracts of pigs. Identification of a highly conserved single-copy tuf gene encoding the elongation factor Tu involved in bacterial protein biosynthesis was used as a marker to differentiate homologous Bifidobacterium animalis subsp. lactis (strain Bb12) from Bifidobacterium animalis subsp. animalis, as well as Bifidobacterium suis, Bifidobacterium breve, Bifidobacterium longum, several species of Lactobacillus, and Enterococcus faecium. Real-time PCR detection of serially diluted DNA extracted from a pure culture of Bb12 was linear for bacterial numbers ranging from 10 to 10,000 tuf gene copies per PCR (r2 = 0.99). Relative differences in Bb12 bacterial numbers in pigs fed daily with Bb12 were determined after detection of Bb12 tuf gene copies in DNA extracted from the intestinal contents. Piglets treated with Bb12 immediately after birth maintained a high level of Bb12 in their large intestines with continuous daily administration of Bb12. Piglets born to Bb12-treated sows during the last third of their gestation and also treated with Bb12 at birth (T/T group) had a higher number of Bb12 organisms per gram of intestinal contents compared to placebo-treated piglets born to placebo-treated sows (C/C group), Bb12-treated sows (T/C group), or piglets born to placebo sows but treated with Bb12 immediately after birth (C/T group). In addition, there was a significant increase in gene expression for Toll-like receptor 9 (TLR9) in piglets from the T/T group, with no change in TLR2 and TLR4. These findings suggest that the tuf gene represents a specific and functional marker for detecting Bifidobacterium animalis subsp. lactis strain Bb12 within the microbiota of the intestine. PMID:18689506

  16. Lytic Infection of Lactococcus lactis by Bacteriophages Tuc2009 and c2 Triggers Alternative Transcriptional Host Responses

    PubMed Central

    Ainsworth, Stuart; Zomer, Aldert; Mahony, Jennifer

    2013-01-01

    Here we present an entire temporal transcriptional profile of Lactococcus lactis subsp. cremoris UC509.9 undergoing lytic infection with two distinct bacteriophages, Tuc2009 and c2. Furthermore, corresponding high-resolution whole-phage genome tiling arrays of both bacteriophages were performed throughout lytic infection. Whole-genome microarrays performed at various time points postinfection demonstrated a rather modest impact on host transcription. The majority of changes in the host transcriptome occur during late infection stages; few changes in host gene transcription occur during the immediate and early infection stages. Alterations in the L. lactis UC509.9 transcriptome during lytic infection appear to be phage specific, with relatively few differentially transcribed genes shared between cells infected with Tuc2009 and those infected with c2. Despite the apparent lack of a coordinated general phage response, three themes common to both infections were noted: alternative transcription of genes involved in catabolic flux and energy production, differential transcription of genes involved in cell wall modification, and differential transcription of genes involved in the conversion of ribonucleotides to deoxyribonucleotides. The transcriptional profiles of both bacteriophages during lytic infection generally correlated with the findings of previous studies and allowed the confirmation of previously predicted promoter sequences. In addition, the host transcriptional response to lysogenization with Tuc2009 was monitored along with tiling array analysis of Tuc2009 in the lysogenic state. Analysis identified 44 host genes with altered transcription during lysogeny, 36 of which displayed levels of transcription significantly reduced from those for uninfected cells. PMID:23728817

  17. The KlGpa1 Gene Encodes a G-Protein   Subunit That Is a Positive Control Element in the Mating Pathway of the Budding Yeast Kluyveromyces lactis

    Microsoft Academic Search

    ALMA L. SAVINON-TEJEDA; LAURA ONGAY-LARIOS; JULIAN VALDES-RODRIGUEZ; ROBERTO CORIA

    2001-01-01

    The cloning of the gene encoding the KlGpa1p subunit was achieved by standard PCR techniques and by screening a Kluyveromyces lactis genomic library using the PCR product as a probe. The full-length open reading frame spans 1,344 nucleotides including the stop codon. The deduced primary structure of the protein (447 amino acid residues) strongly resembles that of Gpa1p, the G-protein

  18. In vitro inhibition of Citrobacter freundii, a red-leg syndrome associated pathogen in raniculture, by indigenous Lactococcus lactis CRL 1584.

    PubMed

    Pasteris, Sergio E; Guidoli, Marcos G; Otero, María C; Bühler, Marta I; Nader-Macías, María E

    2011-08-01

    Red-leg syndrome (RLS) is one of the main infectious diseases that cause economic losses in Lithobates catesbeianus hatcheries, Citrobacter freundii being an etiological agent. Treatment or prevention with therapeutics or chemicals results in modifications of the indigenous microbiota, development of antibiotic resistance, presence of their residues in food and enhancement of production costs. Thus, probiotics could be used as an alternative therapy. Lactic acid bacteria are part of the indigenous microbiota of healthy frogs and can prevent pathogen colonization by different mechanisms, including the production of antagonistic substances. In this work, the evaluation and characterization of the inhibition of C. freundii CFb by Lactococcus lactis subsp. lactis CRL 1584, a potentially probiotic candidate, were carried out. This strain produced lactic acid, H(2)O(2) and bacteriocin in static and shaken conditions and inhibited pathogen growth in associative cultures, with an earlier inhibition under agitated conditions. The elimination of each of the antimicrobial metabolites partially abolished the inhibition of the pathogen, suggesting that the inhibitory effect could be attributed to a combined action of the three antagonistic molecules. Electron microphotographs revealed the damage caused by L. lactis CRL 1584 supernatants to C. freundii cells. The addition of pure lactic acid, H(2)O(2) and bacteriocin to the culture media showed that each metabolite caused different morphological modifications in C. freundii, in agreement with the effect on viable cell counts. The results support the possibility that L. lactis CRL 1584 might be considered as a probiotic to be used in the prevention of RLS in raniculture. PMID:21531092

  19. Gene cloning, functional expression and secretion of the Slayer protein SgsE from Geobacillus stearothermophilus NRS 2004\\/3a in Lactococcus lactis

    Microsoft Academic Search

    Andrea Scheberl; Marc Giry-Laterriere; Paul Messner; Christina Schäffer

    2005-01-01

    The ?93-kDa surface layer protein SgsE of Geobacillus stearothermophilus NRS 2004\\/3a forms a regular crystalline array providing a nanopatterned matrix for the future display of biologically relevant molecules. Lactococcus lactis NZ9000 was established as a safe expression host for the controlled targeted production of SgsE based on the broad host-range plasmid pNZ124Sph, into which the nisA promoter was introduced. SgsE

  20. Production and purification of staphylococcal nuclease in Lactococcus lactis using a new expression-secretion system and a pH-regulated mini-reactor

    PubMed Central

    2010-01-01

    Background Staphylococcal (or micrococcal) nuclease or thermonuclease (SNase or Nuc) is a naturally-secreted nucleic acid degrading enzyme that participates in Staphylococcus aureus spread in the infected host. Purified Nuc protein can be used as an exogenous reagent to clear cellular extracts and improve protein purification. Here, a recombinant form of Nuc was produced and secreted in a Gram-positive host, Lactococcus lactis, and purified from the culture medium. Results The gene segment corresponding to the S. aureus nuclease without its signal peptide was cloned in an expression-secretion vector. It was then fused to a lactococcal sequence encoding a signal peptide, and expressed under the control of a lactococcal promoter that is inducible by zinc starvation. An L. lactis subsp cremoris model strain (MG1363) transformed with the resulting plasmid was grown in either of two media (GM17v and CDM) that are free of animal compounds, allowing GMP (Good Manufacturing Practice) production. Induction conditions (concentration of the metal chelator EDTA and timing of addition) in small-scale pH-regulated fermentors were optimized using LacMF (Lactis Multi-Fermentor), a home-made parallel fermentation control system able to monitor 12 reactors simultaneously. Large amounts of recombinant Nuc (rNuc) were produced and secreted in both media, and rNuc was purified from GM17v medium in a single-step procedure. Conclusions In L. lactis, rNuc production and secretion were optimal after induction by 0.5 mM EDTA in small scale (200 mL) GM17v exponential phase cultures (at an OD600 of 2), leading to a maximal protein yield of 210 mg per L of culture medium. Purified rNuc was highly active, displaying a specific activity of 2000 U/mg. PMID:20492646

  1. Lytic Activity of LysH5 Endolysin Secreted by Lactococcus lactis Using the Secretion Signal Sequence of Bacteriocin Lcn972

    PubMed Central

    Rodríguez-Rubio, Lorena; Gutiérrez, Dolores; Martínez, Beatriz; Rodríguez, Ana

    2012-01-01

    Bacteriophage endolysins have an interesting potential as antimicrobials. The endolysin LysH5, encoded by Staphylococcus aureus phage vB_SauS-phi-IPLA88, was expressed and secreted in Lactococcus lactis using the signal peptide of bacteriocin lactococcin 972 and lactococcal constitutive and inducible promoters. Up to 80 U/mg of extracellular active endolysin was detected in culture supernatants, but most of the protein (up to 323 U/mg) remained in the cell extracts. PMID:22344638

  2. Production and targeting of the Brucella abortus antigen L7/L12 in Lactococcus lactis: a first step towards food-grade live vaccines against brucellosis.

    PubMed

    Ribeiro, Luciana A; Azevedo, Vasco; Le Loir, Yves; Oliveira, Sergio C; Dieye, Yakhya; Piard, Jean-Christophe; Gruss, Alexandra; Langella, Philippe

    2002-02-01

    Brucella abortus is a facultative intracellular gram-negative bacterial pathogen that infects humans and animals by entry mainly through the digestive tract. B. abortus causes abortion in pregnant cattle and undulant fever in humans. The immunogenic B. abortus ribosomal protein L7/L12 is a promising candidate antigen for the development of oral live vaccines against brucellosis, using food-grade lactic acid bacteria (LAB) as a carrier. The L7/L12 gene was expressed in Lactococcus lactis, the model LAB, under the nisin-inducible promoter. Using different signals, L7/L12 was produced in cytoplasmic, cell-wall-anchored, and secreted forms. Cytoplasmic production of L7/L12 gave a low yield, estimated at 0.5 mg/liter. Interestingly, a secretable form of this normally cytoplasmic protein via fusion with a signal peptide resulted in increased yield of L7/L12 to 3 mg/liter; secretion efficiency (SE) was 35%. A fusion between the mature moiety of the staphylococcal nuclease (Nuc) and L7/L12 further increased yield to 8 mg/liter. Fusion with a synthetic propeptide (LEISSTCDA) previously described as an enhancer for heterologous protein secretion in L. lactis (Y. Le Loir, A. Gruss, S. D. Ehrlich, and P. Langella, J. Bacteriol. 180:1895-1903, 1998) raised the yield to 8 mg/liter and SE to 50%. A surface-anchored L7/L12 form in L. lactis was obtained by fusing the cell wall anchor of Streptococcus pyogenes M6 protein to the C-terminal end of L7/L12. The fusions described allow the production and targeting of L7/L12 in three different locations in L. lactis. This is the first example of a B. abortus antigen produced in a food-grade bacterium and opens new perspectives for alternative vaccine strategies against brucellosis. PMID:11823235

  3. Inhibitory activity against the fish pathogen Lactococcus garvieae produced by Lactococcus lactis TW34, a lactic acid bacterium isolated from the intestinal tract of a Patagonian fish

    Microsoft Academic Search

    Cynthia Sequeiros; Marisol Vallejo; Emilio Rogelio Marguet; Nelda Lila Olivera

    2010-01-01

    After enrichment of Odontesthes platensis intestinal contents, 53 lactic acid bacteria (LAB) were isolated. From the four isolates that showed inhibitory activity\\u000a against Lactococcus garvieae 03\\/8460, strain TW34 was selected because it exerted the strongest inhibition. It also inhibited other Gram-positive bacteria,\\u000a but not Gram-negative fish pathogens. Phenotypic and 16S rDNA phylogenetic analyses showed that TW34 belongs to Lactococcus lactis.

  4. Heat Resistance and Salt Hypersensitivity in Lactococcus lactis Due to Spontaneous Mutation of llmg_1816 (gdpP) Induced by High-Temperature Growth

    PubMed Central

    Smith, William M.; Pham, Thi Huong; Lei, Lin; Dou, Junchao; Soomro, Aijaz H.; Beatson, Scott A.; Dykes, Gary A.

    2012-01-01

    During construction of several gene deletion mutants in Lactococcus lactis MG1363 which involved a high-temperature (37.5°C) incubation step, additional spontaneous mutations were observed which resulted in stable heat resistance and in some cases salt-hypersensitive phenotypes. Whole-genome sequencing of one strain which was both heat resistant and salt hypersensitive, followed by PCR and sequencing of four other mutants which shared these phenotypes, revealed independent mutations in llmg_1816 in all cases. This gene encodes a membrane-bound stress signaling protein of the GdpP family, members of which exhibit cyclic dimeric AMP (c-di-AMP)-specific phosphodiesterase activity. Mutations were predicted to lead to single amino acid substitutions or protein truncations. An independent llmg_1816 mutant (?1816), created using a suicide vector, also displayed heat resistance and salt hypersensitivity phenotypes which could be restored to wild-type levels following plasmid excision. L. lactis ?1816 also displayed improved growth in response to sublethal concentrations of penicillin G. High-temperature incubation of a wild-type industrial L. lactis strain also resulted in spontaneous mutation of llmg_1816 and heat-resistant and salt-hypersensitive phenotypes, suggesting that this is not a strain-specific phenomenon and that it is independent of a plasmid integration event. Acidification of milk by the llmg_1816-altered strain was inhibited by lower salt concentrations than the parent strain. This study demonstrates that spontaneous mutations can occur during high-temperature growth of L. lactis and that inactivation of llmg_1816 leads to temperature resistance and salt hypersensitivity. PMID:22923415

  5. Establishing the Yeast Kluyveromyces lactis as an Expression Host for Production of the Saposin-Like Domain of the Aspartic Protease Cirsin

    PubMed Central

    Curto, Pedro; Lufrano, Daniela; Pinto, Cátia; Custódio, Valéria; Gomes, Ana Catarina; Trejo, Sebastián A.; Bakás, Laura; Vairo-Cavalli, Sandra; Faro, Carlos

    2014-01-01

    Typical plant aspartic protease zymogens comprise a characteristic and plant-specific insert (PSI). PSI domains can interact with membranes, and a role as a defensive weapon against pathogens has been proposed. However, the potential of PSIs as antimicrobial agents has not been fully investigated and explored yet due to problems in producing sufficient amounts of these domains in bacteria. Here, we report the development of an expression platform for the production of the PSI domain of cirsin in the generally regarded as safe (GRAS) yeast Kluyveromyces lactis. We successfully generated K. lactis transformants expressing and secreting significant amounts of correctly processed and glycosylated PSI, as well as its nonglycosylated mutant. A purification protocol with protein yields of ?4.0 mg/liter was established for both wild-type and nonglycosylated PSIs, which represents the highest reported yield for a nontagged PSI domain. Subsequent bioactivity assays targeting phytopathogenic fungi indicated that the PSI of cirsin is produced in a biologically active form in K. lactis and provided clear evidence for its antifungal activity. This yeast expression system thereby emerges as a promising production platform for further exploring the biotechnological potential of these plant saposin-like proteins. PMID:24123748

  6. Immunoprotection against influenza H5N1 virus by oral administration of enteric-coated recombinant Lactococcus lactis mini-capsules.

    PubMed

    Lei, Han; Xu, Yuhong; Chen, Jian; Wei, Xiaohui; Lam, Dominic Man-Kit

    2010-11-25

    Edible vaccines that can be made widely available and easily administered could bring great benefit to the worldwide battle against pandemic viral infections. They can be used not only for the vaccination of humans and domesticated animals, but also for wild herds and live stock which are otherwise difficult to vaccinate. In this study, we report the development of an edible mini-capsule form of live, non-persisting, recombinant Lactococcus lactis (L. lactis) vaccine against the highly virulent influenza H5N1 strain. Recombinant L. lactis-based H5N1 HA antigen expression constructs were made and shown to be able to induce higher levels of HA-specific serum IgG and fecal IgA antibody production after oral administration. The vectors were then formulated into a mini-capsule dosage form and fed to mouse. Four doses of oral administration rendered complete protection of the mouse against lethal challenges of H5N1 virus. PMID:20850860

  7. Fermentation and aerobic metabolism of cellodextrins by yeasts. [Candida wickerhamii; C. guiliermondii; C. molischiana; Debaryomyces polymorphus; Pichia guilliermondii; Clavispora lusitaniae; Kluyveromyces lactis; Brettanomyces claussenii; Rhodotorula minuta; Dekkera intermedia

    SciTech Connect

    Freer, S.N. (Dept. of Agriculture, Peoria, IL (USA))

    1991-03-01

    The fermentation and aerobic metabolism of cellodextrins by 14 yeast species or strains was monitored. When grown aerobically, Candida wickerhamii, C. guilliermondii, and C. molischiana metabolized cellodextrins of degree of polymerization 3 to 6. C. wicherhamii and C. molischiana also fermented these substrates, while C. guilliermondii fermented only cellodextrins of degree of polymerization {<=} 3. Debaryomyces polymorphus, Pichia guilliermondii, Clavispora lusitaniae, and one of two strains of Kluyveromyces lactis metabolized glucose, cellobiose, and cellotriose when grown aerobically. These yeasts also fermented these substrates, except for K. lactis, which fermented only glucose and cellobiose. The remaining species/strains tested, K. lactis, Brettanomyces claussenii, Brettanomyces anomalus, Kluyveromyces dobzhanskii, Rhodotorula minuta, and Dekkera intermedia, both fermented and aerobically metabolized glucose and cellobiose. Crude enzyme preparations from all 14 yeast species or strains were tested for ability to hydrolyze cellotriose and cellotretose. Most of the yeasts produced an enzyme(s) capable of hydrolyzing cellotriose. However, with two exceptions, R. minuta and P. guilliermondii, only the yeasts that metabolized cellodextrins of degree of polymerization >3 produced an enzyme(s) that hydrolyzed cellotretose.

  8. Effect of yogurt containing polydextrose, Lactobacillus acidophilus NCFM and Bifidobacterium lactis HN019: a randomized, double-blind, controlled study in chronic constipation

    PubMed Central

    2014-01-01

    Background Constipation is a frequent complaint and the combination of a prebiotic and probiotics could have a potentially synergic effect on the intestinal transit. The present study therefore aims to investigate the combination of polydextrose (Litesse®), L. acidophilus NCFM® and B. lactis HN019 in a yogurt on intestinal transit in subjects who suffer from constipation. Methods Patients with constipation were randomly divided into two groups, Control Group (CG) and Treatment Group (TG), and had to eat 180 ml of unflavored yogurt every morning for 14 days. Those in the CG received only yogurt, while the TG received yogurt containing polydextrose, L. acidophilus NCFM® (ATCC 700396) and B. lactis HN019 (AGAL NM97/09513). Results Favourable clinical response was assessed since Agachan score had a significant reduction at the end of the study in both groups and tended to be better in the TG. The subjects in the treatment group also had a shorter transit time at the end of the intervention compared to the control group (p?=?0.01). Conclusion The product containing yogurt with polydextrose, B. lactis HN019 and L. acidophilus NCFM® significantly shortened colonic transit time after two weeks in the TG compared to CG and may be an option for treatment of constipation. PMID:25056655

  9. The SWI/SNF KlSnf2 subunit controls the glucose signaling pathway to coordinate glycolysis and glucose transport in Kluyveromyces lactis.

    PubMed

    Cotton, Pascale; Soulard, Alexandre; Wésolowski-Louvel, Micheline; Lemaire, Marc

    2012-11-01

    In Kluyveromyces lactis, the expression of the major glucose permease gene RAG1 is controlled by extracellular glucose through a signaling cascade similar to the Saccharomyces cerevisiae Snf3/Rgt2/Rgt1 pathway. We have identified a key component of the K. lactis glucose signaling pathway by characterizing a new mutation, rag20-1, which impairs the regulation of RAG1 and hexokinase RAG5 genes by glucose. Functional complementation of the rag20-1 mutation identified the KlSNF2 gene, which encodes a protein 59% identical to S. cerevisiae Snf2, the major subunit of the SWI/SNF chromatin remodeling complex. Reverse transcription-quantitative PCR and chromatin immunoprecipitation analyses confirmed that the KlSnf2 protein binds to RAG1 and RAG5 promoters and promotes the recruitment of the basic helix-loop-helix Sck1 activator. Besides this transcriptional effect, KlSnf2 is also implicated in the glucose signaling pathway by controlling Sms1 and KlRgt1 posttranscriptional modifications. When KlSnf2 is absent, Sms1 is not degraded in the presence of glucose, leading to constitutive RAG1 gene repression by KlRgt1. Our work points out the crucial role played by KlSnf2 in the regulation of glucose transport and metabolism in K. lactis, notably, by suggesting a link between chromatin remodeling and the glucose signaling pathway. PMID:23002104

  10. Co-evolution of segregation guide DNA motifs and the FtsK translocase in bacteria: identification of the atypical Lactococcus lactis KOPS motif.

    PubMed

    Nolivos, Sophie; Touzain, Fabrice; Pages, Carine; Coddeville, Michele; Rousseau, Philippe; El Karoui, Meriem; Le Bourgeois, Pascal; Cornet, François

    2012-07-01

    Bacteria use the global bipolarization of their chromosomes into replichores to control the dynamics and segregation of their genome during the cell cycle. This involves the control of protein activities by recognition of specific short DNA motifs whose orientation along the chromosome is highly skewed. The KOPS motifs act in chromosome segregation by orienting the activity of the FtsK DNA translocase towards the terminal replichore junction. KOPS motifs have been identified in ?-Proteobacteria and in Bacillus subtilis as closely related G-rich octamers. We have identified the KOPS motif of Lactococcus lactis, a model bacteria of the Streptococcaceae family harbouring a compact and low GC% genome. This motif, 5'-GAAGAAG-3, was predicted in silico using the occurrence and skew characteristics of known KOPS motifs. We show that it is specifically recognized by L. lactis FtsK in vitro and controls its activity in vivo. L. lactis KOPS is thus an A-rich heptamer motif. Our results show that KOPS-controlled chromosome segregation is conserved in Streptococcaceae but that KOPS may show important variation in sequence and length between bacterial families. This suggests that FtsK adapts to its host genome by selecting motifs with convenient occurrence frequencies and orientation skews to orient its activity. PMID:22373923

  11. Functional analysis of the Lactococcus lactis usp45 secretion signal in the secretion of a homologous proteinase and a heterologous alpha-amylase.

    PubMed

    van Asseldonk, M; de Vos, W M; Simons, G

    1993-09-01

    The ups45 gene encodes the major extracellular protein from Lactococcus lactis. The deduced sequence of the 27 residue leader peptide revealed the tripartite characteristics of a signal peptide. This leader peptide directed the efficient secretion of the homologous proteinase (PrtP) in L. lactis, indicating that the putative signal peptide of PrtP can be replaced by the 27 residue Usp45 leader peptide. In addition, the 27 residue leader peptide could be used to secrete the Bacillus stearothermophilus alpha-amylase, encoded by the amyS gene. Fusion of the usp45 promoter region and various parts of the leader sequence to an amyS gene devoid of its signal sequence, showed that in Escherichia coli the first 19, 20, and 27 residues of the Usp45 leader are able to direct alpha-amylase secretion. In L. lactis the shorter signal peptides did not result in secretion of alpha-amylase, providing experimental evidence for the hypothesis that gram-positive bacteria require a longer signal peptide for secretion than gram-negative organisms. PMID:8413193

  12. A food-grade expression/secretion vector for Lactococcus lactis that uses an alpha-galactosidase gene as a selection marker.

    PubMed

    Jeong, Do-Won; Lee, Jong-Hoon; Kim, Kyoung Heon; Lee, Hyong Joo

    2006-08-01

    A new food-grade expression/secretion vector for lactococci, pFMN30, was developed using an alpha-galactosidase gene (melA) of Lactobacillus plantarum as a selection marker. The 4.9-kb pFMN30 is a derivative of the lactococcal vector pMG36e containing a broad-host-range replicon of pWV01. In Lactococcus lactis, transformants carrying the vector were easily detectable by the appearance of a blue colony on a X-alpha-gal-containing medium and also by the growth on a medium containing melibiose as a sole carbon source. The expression/secretion vector was equipped with the controllable and strong nisA promoter. In addition, usp45 signal peptide was inserted for the efficient secretion of a foreign protein outside cells. The vector pFMN30 was used for the expression and secretion of alpha-amylase as a reporter gene, lacking a signal sequence derived from Bacillus licheniformis in L. lactis. These results show that the food-grade expression/secretion vector constructed in the present study could be used for the production of foreign proteins in L. lactis for the production food materials and also for the medicinal purposes. PMID:16943039

  13. Gene cloning, functional expression and secretion of the S-layer protein SgsE from Geobacillus stearothermophilus NRS 2004/3a in Lactococcus lactis.

    PubMed

    Novotny, René; Scheberl, Andrea; Giry-Laterriere, Marc; Messner, Paul; Schäffer, Christina

    2005-01-01

    The ~93-kDa surface layer protein SgsE of Geobacillus stearothermophilus NRS 2004/3a forms a regular crystalline array providing a nanopatterned matrix for the future display of biologically relevant molecules. Lactococcus lactis NZ9000 was established as a safe expression host for the controlled targeted production of SgsE based on the broad host-range plasmid pNZ124Sph, into which the nisA promoter was introduced. SgsE devoid of its signal peptide-encoding sequence was cloned into the new vector and purified from the cytoplasm at a yield of 220 mg l- of expression culture. Secretion constructs were based on the signal peptide of the Lactobacillus brevis SlpA protein or the L. lactis Usp45 protein, allowing isolation of 95 mg of secreted rSgsE l-1. N-terminal sequencing confirmed correct processing of SgsE in L. lactis NZ9000. The ability of rSgsE to self-assemble in suspension and to recrystallize on solid supports was demonstrated by electron and atomic force microscopy. PMID:15675069

  14. Evidence for an Additional Base-Pairing Element between the Telomeric Repeat and the Telomerase RNA Template in Kluyveromyces lactis and Other Yeasts?

    PubMed Central

    Wang, Zhi-Ru; Guo, Leilei; Chen, Lizhen; McEachern, Michael J.

    2009-01-01

    In all telomerases, the template region of the RNA subunit contains a region of telomere homology that is longer than the unit telomeric repeat. This allows a newly synthesized telomeric repeat to translocate back to the 3? end of the template prior to a second round of telomeric repeat synthesis. In the yeast Kluyveromyces lactis, the telomerase RNA (Ter1) template has 30 nucleotides of perfect homology to the 25-bp telomeric repeat. Here we provide strong evidence that three additional nucleotides at positions ?2 through ?4 present on the 3? side of the template form base-pairing interactions with telomeric DNA. Mutation of these bases can lead to opposite effects on telomere length depending on the sequence permutation of the template in a manner consistent with whether the mutation increases or decreases the base-pairing potential with the telomere. Additionally, mutations in the ?2 and ?3 positions that restore base-pairing potential can suppress corresponding sequence changes in the telomeric repeat. Finally, multiple other yeast species were found to also have telomerase RNAs that encode relatively long 7- to 10-nucleotide domains predicted to base pair, often with imperfect pairing, with telomeric DNA. We further demonstrate that K. lactis telomeric fragments produce banded patterns with a 25-bp periodicity. This indicates that K. lactis telomeres have preferred termination points within the 25-bp telomeric repeat. PMID:19687297

  15. Identification of Restriction-Modification Systems of Bifidobacterium animalis subsp. lactis CNCM I-2494 by SMRT Sequencing and Associated Methylome Analysis

    PubMed Central

    O?Connell Motherway, Mary; Watson, Debbie; Bottacini, Francesca; Clark, Tyson A.; Roberts, Richard J.; Korlach, Jonas; Garault, Peggy; Chervaux, Christian; van Hylckama Vlieg, Johan E. T.; Smokvina, Tamara; van Sinderen, Douwe

    2014-01-01

    Bifidobacterium animalis subsp. lactis CNCM I-2494 is a component of a commercialized fermented dairy product for which beneficial effects on health has been studied by clinical and preclinical trials. To date little is known about the molecular mechanisms that could explain the beneficial effects that bifidobacteria impart to the host. Restriction-modification (R-M) systems have been identified as key obstacles in the genetic accessibility of bifidobacteria, and circumventing these is a prerequisite to attaining a fundamental understanding of bifidobacterial attributes, including the genes that are responsible for health-promoting properties of this clinically and industrially important group of bacteria. The complete genome sequence of B. animalis subsp. lactis CNCM I-2494 is predicted to harbour the genetic determinants for two type II R-M systems, designated BanLI and BanLII. In order to investigate the functionality and specificity of these two putative R-M systems in B. animalis subsp. lactis CNCM I-2494, we employed PacBio SMRT sequencing with associated methylome analysis. In addition, the contribution of the identified R-M systems to the genetic accessibility of this strain was assessed. PMID:24743599

  16. Bifidobacterium lactis DSM 10140: Identification of the atp (atpBEFHAGDC) Operon and Analysis of Its Genetic Structure, Characteristics, and Phylogeny

    PubMed Central

    Ventura, Marco; Canchaya, Carlos; van Sinderen, Douwe; Fitzgerald, Gerald F.; Zink, Ralf

    2004-01-01

    The atp operon is highly conserved among eubacteria, and it has been considered a molecular marker as an alternative to the 16S rRNA gene. PCR primers were designed from the consensus sequences of the atpD gene to amplify partial atpD sequences from 12 Bifidobacterium species and nine Lactobacillus species. All PCR products were sequenced and aligned with other atpD sequences retrieved from public databases. Genes encoding the subunits of the F1F0-ATPase of Bifidobacterium lactis DSM 10140 (atpBEFHAGDC) were cloned and sequenced. The deduced amino acid sequences of these subunits showed significant homology with the sequences of other organisms. We identified specific sequence signatures for the genus Bifidobacterium and for the closely related taxa Bifidobacterium lactis and Bifidobacterium animalis and Lactobacillus gasseri and Lactobacillus johnsonii, which could provide an alternative to current methods for identification of lactic acid bacterial species. Northern blot analysis showed that there was a transcript at approximately 7.3 kb, which corresponded to the size of the atp operon, and a transcript at 4.5 kb, which corresponded to the atpC, atpD, atpG, and atpA genes. The transcription initiation sites of these two mRNAs were mapped by primer extension, and the results revealed no consensus promoter sequences. Phylogenetic analysis of the atpD genes demonstrated that the Lactobacillus atpD gene clustered with the genera Listeria, Lactococcus, Streptococcus, and Enterococcus and that the higher G+C content and highly biased codon usage with respect to the genome average support the hypothesis that there was probably horizontal gene transfer. The acid inducibility of the atp operon of B. lactis DSM 10140 was verified by slot blot hybridization by using RNA isolated from acid-treated cultures of B. lactis DSM 10140. The rapid increase in the level of atp operon transcripts upon exposure to low pH suggested that the ATPase complex of B. lactis DSM 10140 was regulated at the level of transcription and not at the enzyme assembly step. PMID:15128574

  17. Study on the mechanism of action of adenosylcobalamin-dependent glycerol dehydratase from Aerobacter aerogenes. I. Role of structural components of adenosylcobalamin the formation of the active site of glycerol dehydratase.

    PubMed

    Yakusheva, M I; Poznanskaya, A A; Pospelova, T A; Rudakova, I P; Yurkevich, A M; Yakovlev, V A

    1977-09-15

    A new method of partial chemical synthesis of adenosylcobalamin (Co alpha-[alpha-5,6-diemethylbenzimidazolyl)]-Co beta-adenosylcobamide, AdoCbl) analogs has been developed. A series of derivatives of AdoCbl modified in the nucleoside and nucleotide ligands and corrin macrocycle have been obtained. The interaction of AdoCl analogs with glycerol dehydratase (EC 4.2.1.30) from Aerobacter aerogenes has been investigated. It has been shown that the nucleoside ligand of AdoCbl provides no essential contribution to the binding of apoenzyme but the preservation of the exact structure of the 1-N and 2-C positions of adenine appears essential for the catalysis. The coordination bond between the Co and nucleotide ligand of AdoCl does not play a decisive role in glycerol dehydratase activity. To form the active site of the glycerol dehydrates, the nucleotide in the AdoCbl structure is essential since nucleotide elimination results in a 100-fold increase of Ki for the corresponding analog. In the binding of AdoCbl with apoenzyme, the main role belongs to the corrin macrocycle, in which the e-propionamide group is significant for binding with apoenzyme, but presumably not essential for catalysis. PMID:889845

  18. Phosphoenolpyruvate and 2-phosphoglycerate: endogenous energy source(s) for sugar accumulation by starved cells of Streptococcus lactis.

    PubMed Central

    Thompson, J; Thomas, T D

    1977-01-01

    In the absence of an exogenous energy source, galactose-grown cells of Streptococcus lactis ML3 rapidly accumulated thiomethyl-beta-D-galactopyranoside (TMG) and 2-deoxyglucose to intracellular concentrations of 40 to 50 mM. Starved cells maintained the capacity for TMG uptake for many hours, and accumulation of the beta-galactoside was insensitive to proton-conducting ionophores (tetrachlorosalicylanilide and carbonylcyanide-m-chlorophenyl hydrazone) and sulfydryl group reagents including iodoacetate and N-ethylmaleimide. Fluorimetric analysis of glycolytic intermediates in extracts prepared from starved cells revealed (a) high intracellular levels of phosphoenolpyruvate (13 mM; PEP) and 2-phosphoglycerate (approximately 39 mM; 2-PG), but an absence of other metabolites including glucose 6-phosphate, fructose 6-phosphate, fructose 1,6-diphosphate, and triosephosphates. The following criteria showed PEP (and 2-PG) to be the endogenous energy source for TMG accumulation by the phosphotransferase system: the intracellular concentrations of PEP and 2-PG decreased with concomitant uptake of TMG, and a close correlation was observed between maximum accumulation of the beta-galactoside and the total available concentration of the two intermediates; TMG accumulated as an anionic derivative, which after extraction and incubation with alkaline phosphatase (EC 3.1.3.1) formed the original analogue; fluoride inhibition of 2-phospho-D-glycerate hydrolyase (EC 4.2.1.11) prevented the conversion of 2-PG to PEP, and uptake of TMG by the starved cells was reduced by 80%; and the stoichiometric ratio [TMG] accumulated/[PEP] consumed was almost unity (0.93). In cells metabolizing glucose, all intermediates listed in (a) and (b) were found. Upon exhaustion of glucose from the medium, the metabolites in (b) were not longer detectable, while the intracellular concentrations of PEP and 2-PG increased to the levels previously observed in starved cells. The glycolytic intermediates in (b) are all in vitro heterotropic effectors of pyruvate kinase (adenosine 5'-triphosphate:pyruvate 2-O-phosphotransferase, EC 2.7.1.40) from S. lactis ML3. It is suggested that the capacity of starved cells to maintain high intracellular concentrations of PEP and 2-PG is a consequence of decreased in vivo activity of this key regulatory enzyme of glycolysis. Images PMID:122509

  19. The Mitochondrial Genome Integrity Gene, Mgi1, of Kluyveromyces Lactis Encodes the ?-Subunit of F(1)-Atpase

    PubMed Central

    Chen, X. J.; Clark-Walker, G. D.

    1996-01-01

    In a previous report, we found that mutations at the mitochondrial genome integrity locus, MGI1, can convert Kluyveromyces lactis into a petite-positive yeast. In this report, we describe the isolation of the MGI1 gene and show that it encodes the ?-subunit of the mitochondrial F(1)-ATPase. The site of mutation in four independently isolated mgi1 alleles is at Arg435, which has changed to Gly in three cases and Ile in the fourth isolate. Disruption of MGI1 does not lead to the production of mitochondrial genome deletion mutants, indicating that an assembled F(1) complex is needed for the ``gain-of-function'' phenotype found in mgi1 point mutants. The location of Arg435 in the ?-subunit, as deduced from the three-dimensional structure of the bovine F(1)-ATPase, together with mutational sites in the previously identified mgi2 and mgi5 alleles, suggests that interaction of the ?- and ?- (MGI2) subunits with the ?-subunit (MGI5) is likely to be affected by the mutations. PMID:8978033

  20. Kluyveromyces lactis cells entrapped in Ca-alginate beads for the continuous production of a heterologous glucoamylase.

    PubMed

    de Alteriis, Elisabetta; Silvestro, Giovanni; Poletto, Massimo; Romano, Vittorio; Capitanio, Daniele; Compagno, Concetta; Parascandola, Palma

    2004-04-01

    Viable cells of Kluyveromyces lactis, transformed with the glucoamylase gene from Arxula adeninivorans, were entrapped in beads of Ca-alginate and employed on a lab scale in a continuous stirred and a fluidised bed reactor (FBR), both fed with a rich medium (YEP) containing lactose as carbon source. Experiments with freely suspended cells in batch and chemostat had demonstrated that glucoamylase production was favoured in the presence of lactose and YEP medium. Employing controlled-sized beads having a 2.13 mm diameter, specific glucoamylase productivity was higher in the stirred reactor (CSTR) than in the FBR; in the latter a higher volumetric productivity was achieved, due to the lower void degree. The performance of the immobilised cell systems, in terms of specific glucoamylase productivity, was strongly affected by mass transfer limitations occurring throughout the gel due to the high molecular weight of the product. In the perspective to improve and scale-up the immobilised cell system proposed, a mathematical model, which takes into account substrate transfer limitations throughout the gel, has been developed. The effective lactose diffusivity was related to the bead reactive efficiency by means of the Thiele modulus. The regression of the model parameters on the experimental data of substrate consumption obtained both in the CSTR and in the FBR allowed to estimate lactose diffusivity and the kinetic parameters of the immobilised yeast. PMID:15063616

  1. Heterologous expression and purification of NisA, the precursor peptide of lantibiotic nisin from Lactococcus lactis.

    PubMed

    Karakas-Sen, Asuman; Narbad, A

    2012-06-01

    The lantibiotic nisin is a ribosomally synthesised and post-translationally modified antimicrobial peptide produced by strains of Lactococcus lactis, and used as safe and natural preservative in food industry. The nisA structural gene encodes ribosomally synthesised and biologically inactive a 57 amino acid precursor peptide (NisA) which undergoes several post-translational modifications. In this study, we report the expression of precursor nisin as a His6-tagged peptide in Escherichia coli and its purification using a nickel affinity column. The technique of spliced-overlap extension PCR was used to amplify the nisA gene and the T7 promoter region of pET-15b vector. This approach was used to introduce six histidine residues at the C-terminus of prenisin. The identity of the expressed peptide was confirmed by N-terminal sequencing. The expressed His-tagged prenisin was purified under denaturing conditions, and named as prenisin-His6. The purified prenisin-His6 was analyzed by SDS-PAGE, Western blotting and mass spectroscopy. These results showed that the nisin precursor peptide can be successfully produced using an E. coli expression system. PMID:22695527

  2. Substrate specificity of a galactose 6-phosphate isomerase from Lactococcus lactis that produces d-allose from d-psicose.

    PubMed

    Park, Ha-Young; Park, Chang-Su; Kim, Hye-Jung; Oh, Deok-Kun

    2007-10-15

    We purified recombinant galactose 6-phosphate isomerase (LacAB) from Lactococcus lactis using HiTrap Q HP and Phenyl-Sepharose columns. The purified LacAB had a final specific activity of 1.79units/mg to produce d-allose. The molecular mass of native galactose 6-phosphate isomerase was estimated at 135.5kDa using Sephacryl S-300 gel filtration, and the enzyme exists as a hetero-octamer of LacA and LacB subunits. The activity of galactose 6-phosphate isomerase was maximal at pH 7.0 and 30 degrees C, and enzyme activity was independent of metal ions. When 100g/L of d-psicose was used as the substrate, 25g/L of d-allose and 13g/L of d-altrose were simultaneously produced at pH 7.0 and 30 degrees C after 12h of incubation. The enzyme had broad specificity for various aldoses and ketoses. The interconversion of sugars with the same configuration except at the C2 position was driven by using a large amount of enzyme in extended reactions. The interconversion occurred via two isomerization reactions, i.e., the interconversion of d-allose<-->d-psicose<-->d-altrose, and d-allose to d-psicose reaction was faster than d-altrose to d-psicose reaction. PMID:17868944

  3. Reversal of autoimmune diabetes by restoration of antigen-specific tolerance using genetically modified Lactococcus lactis in mice

    PubMed Central

    Takiishi, Tatiana; Korf, Hannelie; Van Belle, Tom L.; Robert, Sofie; Grieco, Fabio A.; Caluwaerts, Silvia; Galleri, Letizia; Spagnuolo, Isabella; Steidler, Lothar; Van Huynegem, Karolien; Demetter, Pieter; Wasserfall, Clive; Atkinson, Mark A.; Dotta, Francesco; Rottiers, Pieter; Gysemans, Conny; Mathieu, Chantal

    2012-01-01

    Current interventions for arresting autoimmune diabetes have yet to strike the balance between sufficient efficacy, minimal side effects, and lack of generalized immunosuppression. Introduction of antigen via the gut represents an appealing method for induction of antigen-specific tolerance. Here, we developed a strategy for tolerance restoration using mucosal delivery in mice of biologically contained Lactococcus lactis genetically modified to secrete the whole proinsulin autoantigen along with the immunomodulatory cytokine IL-10. We show that combination therapy with low-dose systemic anti-CD3 stably reverted diabetes in NOD mice and increased frequencies of local Tregs, which not only accumulated in the pancreatic islets, but also suppressed immune response in an autoantigen-specific way. Cured mice remained responsive to disease-unrelated antigens, which argues against excessive immunosuppression. Application of this therapeutic tool achieved gut mucosal delivery of a diabetes-relevant autoantigen and a biologically active immunomodulatory cytokine, IL-10, and, when combined with a low dose of systemic anti-CD3, was well tolerated and induced autoantigen-specific long-term tolerance, allowing reversal of established autoimmune diabetes. Therefore, we believe this method could be an effective treatment strategy for type 1 diabetes in humans. PMID:22484814

  4. Medium-dependent regulation of proteinase gene expression in Lactococcus lactis: control of transcription initiation by specific dipeptides.

    PubMed Central

    Marugg, J D; Meijer, W; van Kranenburg, R; Laverman, P; Bruinenberg, P G; de Vos, W M

    1995-01-01

    Transcriptional gene fusions with the Escherichia coli beta-glucuronidase gene (gusA) were used to study the medium- and growth-dependent expression of the divergently transcribed genes involved in proteinase production (prtP and prtM) of Lactococcus lactis SK11. The results show that both the prtP and prtM genes are controlled at the transcriptional level by the peptide content of the medium and, to a lesser extent, by the growth rate. A more than 10-fold regulation in beta-glucuronidase activity was observed for both prtP and prtM promoters in batch and continuous cultures. The level of expression of the prtP and prtM promoters was high in whey permeate medium with relatively low concentrations of peptides, whereas at increased concentrations the expression of the promoters was repressed. The lowest level of expression was observed in peptide- and amino acid-rich laboratory media, such as glucose-M17 and MRS. The addition of specific dipeptides, such as leucylproline and prolylleucine, to the growth medium negatively affected the expression of the prtP-gusA fusions. The repression by dipeptides was not observed in mutants defective in the uptake of di-tripeptides, indicating that the internal concentration of dipeptides or derivatives is important in the regulation of proteinase production. PMID:7768792

  5. An alkali-thermostable xylanase from Bacillus pumilus functionally expressed in Kluyveromyces lactis and evaluation of its deinking efficiency.

    PubMed

    Thomas, Leya; Ushasree, Mrudula V; Pandey, Ashok

    2014-08-01

    This work aimed at studying the recombinant expression of an alkali- and thermo-stable xylanase from Bacillus pumilus in Kluyveromyces lactis and its use in deinking of civic paper waste. Efficient expression with a 3-fold increase in the activity than the native organism was achieved. An inducer concentration of 2.5% and medium pH of 9.0 was the best for enzyme expression. Purified enzyme showed an optimum activity at temperatures 50 and 60°C and pH 9.0 and 10.0, respectively. At pH 12.0, enzyme retained 74% and 26% activity after 2 and 3h of incubation, respectively. After incubation at 50 and 60°C for 1h, the enzyme showed 100% retention of activity, and remained active for 4h at 60°C retaining 23% residual activity. Partially purified recombinant enzyme showed higher deinking efficiency (273%) of laser print waste paper than crude xylanase from Bacillus and commercial acidic enzyme. This xylanase with superior stability characteristics could be a suitable candidate in paper and pulp industries. PMID:24709528

  6. Consumption of Bifidobacterium lactis LKM512 yogurt reduces gut mutagenicity by increasing gut polyamine contents in healthy adult subjects.

    PubMed

    Matsumoto, Mitsuharu; Benno, Yoshimi

    2004-12-21

    The possible role of probiotic metabolites on human health effects of probiotics has received little research attention. In this study, we investigated the effects of consumption of Bifidobacterium lactis LKM512-containing yogurt (LKM512 yogurt) on fecal probiotic metabolites (polyamines, lactate, and acetate) and mutagenicity in seven healthy adults (one male and six females; average age: 30.5 years). Each volunteer was provided with 100g/day of LKM512 yogurt or placebo for 2 weeks. Fecal polyamines and mutagenicity were measured by HPLC and the umu-test, respectively. Consumption of LKM512 yogurt increased fecal spermidine levels, but not fecal lactate and acetate contents. The mutagenicity level significantly reduced to 79.2% (10-91.1%) and 47.9% (0-86.8%) following consumption of LKM512 yogurt (P=0.0293) and placebo (P=0.0314), respectively. LKM512 yogurt consumption significantly reduced the mutagenicity level compared with consumption of a placebo (P=0.0489). These results suggest that increased gut spermidine level by LKM512 yogurt was responsible for the reduction of mutagenicity in the gut of healthy adults. We suggest that spermidine produced by LKM512 yogurt consumption contributes to host health as a bioantimutagenic factor; to our knowledge, these substances have not been previously reported as antimutagens from probiotics or fermented milk. PMID:15542102

  7. Kluyveromyces lactis and Saccharomyces cerevisiae, two potent deacidifying and volatile-sulphur-aroma-producing microorganisms of the cheese ecosystem.

    PubMed

    Kagkli, Dafni-Maria; Tâche, Roselyne; Cogan, Timothy M; Hill, Colin; Casaregola, Serge; Bonnarme, Pascal

    2006-11-01

    Cheese flavour is the result of complex biochemical transformations attributed to bacteria and yeasts grown on the curd of smear-ripened cheeses. Volatile sulphur compounds (VSCs) are responsible for the characteristic aromatic notes of several cheeses. In the present study, we have assessed the ability of Kluyveromyces lactis, Kluyveromyces marxianus and Saccharomyces cerevisiae strains, which are frequently isolated from smear-ripened cheeses, to grow and deacidify a cheese medium and generate VSCs resulting from L-methionine degradation. The Kluyveromyces strains produced a wider variety and higher amounts of VSCs than the S. cerevisiae ones. We have shown that the pathway is likely to be proceeding differently in these two yeast genera. The VSCs are mainly generated through the degradation of 4-methylthio-oxobutyric acid in the Kluyveromyces strains, in contrast to the S. cerevisiae ones which have higher L-methionine demethiolating activity, resulting in a direct conversion of L-methionine to methanethiol. The deacidification activity which is of major importance in the early stages of cheese-ripening was also compared in S. cerevisiae and Kluyveromyces strains. PMID:16847604

  8. Stoichiometry of proton movements coupled to ATP synthesis driven by a pH gradient in Streptococcus lactis

    SciTech Connect

    Maloney, P.C.; Hansen, F.C.

    1982-01-01

    An electrochemical potential difference for H+ was established across the plasma membrane of the anaerobe Streptococcus lactis by addition of sulfuric acid to cells suspended in potassium phosphate at pH 8 along with valinomycin or permeant anions. Subsequent acidification of the cell was measured by the distribution of salicyclic acid. A comparison between cells treated or untreated with the inhibitor N,N'-dicyclohexylcarbodiimide was used to reveal that portion of net proton entry attributable to a direct coupling between H+ inflow and synthesis of ATP catalyzed by the reversible proton-translocating ATPase of this microorganism. When the imposed electrochemical proton gradient was below 180-190 mV, proton entry was at the rate expected of passive flux, for both control cells and cells treated with the ATPase inhibitor, However, at higher driving force acidification of control cells was markedly accelerated, coincident with ATP synthesis, while acidification of cells treated with the inhibitor continued at the rate characteristic of passive inflow. This observed threshold (180-190 mV) was identified as the reversal potential for this H+ pump. Parallel measurements showed that the free energy of hydrolysis for ATP in these washed cells was 8.4 kcal/mole (370mV). The comparison between the reversal (threshold) potential and the free energy of hydrolysis for ATP indicates a stoichiometry of 2 H+/ATP for the coupling of proton movements to ATP formation in bacteria.

  9. PATHOLOGIE VGTALE Dynamique des populations fongiques et bact-

    E-print Network

    Paris-Sud XI, Université de

    mycorrhization of seedlings by Tiihei- melanosporlll11. The development of production in a truffle orchard of mycorrhized hazelnut trees, and bulk soil. No significant differences were encountered with saprophytic fungi

  10. Improvement of LysM-Mediated Surface Display of Designed Ankyrin Repeat Proteins (DARPins) in Recombinant and Nonrecombinant Strains of Lactococcus lactis and Lactobacillus Species.

    PubMed

    Zadravec, Petra; Štrukelj, Borut; Berlec, Aleš

    2015-03-15

    Safety and probiotic properties make lactic acid bacteria (LAB) attractive hosts for surface display of heterologous proteins. Protein display on nonrecombinant microorganisms is preferred for therapeutic and food applications due to regulatory requirements. We displayed two designed ankyrin repeat proteins (DARPins), each possessing affinity for the Fc region of human IgG, on the surface of Lactococcus lactis by fusing them to the Usp45 secretion signal and to the peptidoglycan-binding C terminus of AcmA, containing lysine motif (LysM) repeats. Growth medium containing a secreted fusion protein was used to test its heterologous binding to 10 strains of species of the genus Lactobacillus, using flow cytometry, whole-cell enzyme-linked immunosorbent assay (ELISA), and fluorescence microscopy. The fusion proteins bound to the surfaces of all lactobacilli; however, binding to the majority of bacteria was only 2- to 5-fold stronger than that of the control. Lactobacillus salivarius ATCC 11741 demonstrated exceptionally strong binding (32- to 55-fold higher than that of the control) and may therefore be an attractive host for nonrecombinant surface display. Genomic comparison of the species indicated the exopolysaccharides of Lb. salivarius as a possible reason for the difference. Additionally, a 15-fold concentration-dependent increase in nonrecombinant surface display on L. lactis was demonstrated by growing bacteria with sublethal concentrations of the antibiotics chloramphenicol and erythromycin. Nonrecombinant surface display on LAB, based on LysM repeats, was optimized by selecting Lactobacillus salivarius ATCC 11741 as the optimal host and by introducing antibiotics as additives for increasing surface display on L. lactis. Additionally, effective display of DARPins on the surfaces of nonrecombinant LAB has opened up several new therapeutic possibilities. PMID:25576617

  11. Polyphasic Screening, Homopolysaccharide Composition, and Viscoelastic Behavior of Wheat Sourdough from a Leuconostoc lactis and Lactobacillus curvatus Exopolysaccharide-Producing Starter Culture

    PubMed Central

    Palomba, Simona; Cavella, Silvana; Torrieri, Elena; Piccolo, Alessandro; Mazzei, Pierluigi; Blaiotta, Giuseppe; Ventorino, Valeria

    2012-01-01

    After isolation from different doughs and sourdoughs, 177 strains of lactic acid bacteria were screened at the phenotypic level for exopolysaccharide production on media containing different carbohydrate sources. Two exopolysaccharide-producing lactic acid bacteria (Lactobacillus curvatus 69B2 and Leuconostoc lactis 95A) were selected through quantitative analysis on solid media containing sucrose and yeast extract. The PCR detection of homopolysaccharide (gtf and lev) and heteropolysaccharide (epsA, epsB, epsD and epsE, and epsEFG) genes showed different distributions within species and strains of the lactic acid bacteria studied. Moreover, in some strains both homopolysaccharide and heteropolysaccharide genes were detected. Proton nuclear magnetic resonance spectra suggest that Lactobacillus curvatus 69B2 and Leuconostoc lactis 95A produced the same exopolysaccharide, which was constituted by a single repeating glucopyranosyl unit linked by an ?-(1?6) glycosidic bond in a dextran-type carbohydrate. Microbial growth, acidification, and viscoelastic properties of sourdoughs obtained by exopolysaccharide-producing and nonproducing lactic acid bacterial strains were evaluated. Sourdough obtained after 15 h at 30°C with exopolysaccharide-producing lactic acid bacteria reached higher total titratable acidity as well as elastic and dissipative modulus curves with respect to the starter not producing exopolysaccharide, but they showed similar levels of pH and microbial growth. On increasing the fermentation time, no difference in the viscoelastic properties of exopolysaccharide-producing and nonproducing samples was observed. This study suggests that dextran-producing Leuconostoc lactis 95A and Lactobacillus curvatus 69B2 can be employed to prepare sourdough, and this would be particularly useful to improve the quality of baked goods while avoiding the use of commercially available hydrocolloids as texturizing additives. PMID:22307283

  12. Recombinant interleukin 6 with M cell-targeting moiety produced in Lactococcus lactis IL1403 as a potent mucosal adjuvant for peroral immunization.

    PubMed

    Li, Hui-Shan; Piao, Da-Chuan; Jiang, Tao; Bok, Jin-Duck; Cho, Chong-Su; Lee, Yoon-Seok; Kang, Sang-Kee; Choi, Yun-Jaie

    2015-04-15

    Development and application of safe and effective mucosal adjuvants are important to improve immunization efficiency in oral vaccine. Here, we report a novel mucosal adjuvant, IL-6-CKS9, a recombinant cytokine generated by conjugating an M cell-targeting peptide (CKS9) with c-terminus of the murine interleukin 6 (IL-6), which facilitated enhancement of mucosal immune response. Lactococcus lactis IL1403, a food-grade strain of lactic acid bacteria (LAB) which is widely used in dairy industry, was used as a host cell to express and secrete the IL-6-CKS9 for a mucosal vaccine adjuvant. The recombinant L. lactis IL1403 secreting IL-6-CKS9 was orally administered with a model antigen protein, M-BmpB (Brachyspira membrane protein B conjugated with CKS9), to BALB/c mice for mucosal immunization. ELISA analyses showed consistent enhancement tendencies in induction of anti-M-BmpB antibody levels both with mucosal (IgA) and systemic (IgG) immune responses in IL-6-CKS9-LAB treated group compared with other groups tested by conducting two separated mice immunization assays. In addition, we characterized that the oral administration of model protein antigen with live LAB producing IL-6-CKS9 could induce both Th1 and Th2 type immune responses by analysis of the specific anti-BmpB IgG1 and IgG2a isotypes in the sera and also investigated possible oral tolerance in our vaccine strategy. Collectively, our results showed successful production and secretion of recombinant murine IL-6 with M cell-targeting moiety (IL-6-CKS9) from L. lactis IL1403 and demonstrated the live recombinant LAB producing IL-6-CKS9 could have a potential to be used as an efficient adjuvant for peroral vaccination. PMID:25738814

  13. NoxE NADH oxidase and the electron transport chain are responsible for the ability of Lactococcus lactis to decrease the redox potential of milk.

    PubMed

    Tachon, Sybille; Brandsma, Johannes Bernhard; Yvon, Mireille

    2010-03-01

    The redox potential plays a major role in the microbial and sensorial quality of fermented dairy products. The redox potential of milk (around 400 mV) is mainly due to the presence of oxygen and many other oxidizing compounds. Lactococcus lactis has a strong ability to decrease the redox potential of milk to a negative value (-220 mV), but the molecular mechanisms of milk reduction have never been addressed. In this study, we investigated the impact of inactivation of genes encoding NADH oxidases (noxE and ahpF) and components of the electron transport chain (ETC) (menC and noxAB) on the ability of L. lactis to decrease the redox potential of ultrahigh-temperature (UHT) skim milk during growth under aerobic and anaerobic conditions. Our results revealed that elimination of oxygen is required for milk reduction and that NoxE is mainly responsible for the rapid removal of oxygen from milk before the exponential growth phase. The ETC also contributes slightly to oxygen consumption, especially during the stationary growth phase. We also demonstrated that the ETC is responsible for the decrease in the milk redox potential from 300 mV to -220 mV when the oxygen concentration reaches zero or under anaerobic conditions. This suggests that the ETC is responsible for the reduction of oxidizing compounds other than oxygen. Moreover, we found great diversity in the reducing activities of natural L. lactis strains originating from the dairy environment. This diversity allows selection of specific strains that can be used to modulate the redox potential of fermented dairy products to optimize their microbial and sensorial qualities. PMID:20038695

  14. NoxE NADH Oxidase and the Electron Transport Chain Are Responsible for the Ability of Lactococcus lactis To Decrease the Redox Potential of Milk? †

    PubMed Central

    Tachon, Sybille; Brandsma, Johannes Bernhard; Yvon, Mireille

    2010-01-01

    The redox potential plays a major role in the microbial and sensorial quality of fermented dairy products. The redox potential of milk (around 400 mV) is mainly due to the presence of oxygen and many other oxidizing compounds. Lactococcus lactis has a strong ability to decrease the redox potential of milk to a negative value (?220 mV), but the molecular mechanisms of milk reduction have never been addressed. In this study, we investigated the impact of inactivation of genes encoding NADH oxidases (noxE and ahpF) and components of the electron transport chain (ETC) (menC and noxAB) on the ability of L. lactis to decrease the redox potential of ultrahigh-temperature (UHT) skim milk during growth under aerobic and anaerobic conditions. Our results revealed that elimination of oxygen is required for milk reduction and that NoxE is mainly responsible for the rapid removal of oxygen from milk before the exponential growth phase. The ETC also contributes slightly to oxygen consumption, especially during the stationary growth phase. We also demonstrated that the ETC is responsible for the decrease in the milk redox potential from 300 mV to ?220 mV when the oxygen concentration reaches zero or under anaerobic conditions. This suggests that the ETC is responsible for the reduction of oxidizing compounds other than oxygen. Moreover, we found great diversity in the reducing activities of natural L. lactis strains originating from the dairy environment. This diversity allows selection of specific strains that can be used to modulate the redox potential of fermented dairy products to optimize their microbial and sensorial qualities. PMID:20038695

  15. Enhanced secretion of heterologous proteins in Kluyveromyces lactis by overexpression of the GDP-mannose pyrophosphorylase, KlPsa1p

    Microsoft Academic Search

    Daniela Uccelletti; Dessislava Staneva; Silvia Rufini; Pencho Venkov; Claudio Palleschi

    2005-01-01

    GDP-mannose is the mannosyl donor for the glycosylation reactions and is synthesized by GDP-mannose pyrophosphorylase from GTP and d-mannose-1-phosphate; in Saccharomyces cerevisiae this enzyme is encoded by the PSA1\\/VIG9\\/SRB1 gene.We isolated the Kluyveromyces lactis KlPSA1 gene by complementing the osmotic growth defects of S. cerevisiae srb1\\/psa1 mutants. KlPsa1p displayed a high degree of similarity with other GDP-mannose pyrophosphorylases and was

  16. Induction of heat shock proteins DnaK, GroEL, and GroES by salt stress in Lactococcus lactis.

    PubMed Central

    Kilstrup, M; Jacobsen, S; Hammer, K; Vogensen, F K

    1997-01-01

    The bacterium Lactococcus lactis has become a model organism in studies of growth physiology and membrane transport, as a result of its simple fermentative metabolism. It is also used as a model for studying the importance of specific genes and functions during life in excess nutrients, by comparison of prototrophic wild-type strains and auxotrophic domesticated (dairy) strains. In a study of the capacity of domesticated strains to perform directed responses toward various stress conditions, we have analyzed the heat and salt stress response in the established L. lactis subsp. cremoris laboratory strain MG1363, which was originally derived from a dairy strain. After two-dimensional separation of proteins, the DnaK, GroEL, and GroES heat shock proteins, the HrcA (Orf1) heat shock repressor, and the glycolytic enzymes pyruvate kinase, glyceral-dehyde-3-phosphate dehydrogenase, and phosphoglycerate kinase were identified by a combination of Western blotting and direct N-terminal amino acid sequencing of proteins from the gels. Of 400 to 500 visible proteins, 17 were induced more than twofold during heat stress. Two classes of heat stress proteins were identified from their temporal induction pattern. The fast-induced proteins (including DnaK) showed an abruptly increased rate of synthesis during the first 10 min, declining to intermediate levels after 15 min. GroEL and GroES, which also belong to this group, maintained a high rate of synthesis after 15 min. The class of slowly induced proteins exhibited a gradual increase in the rate of synthesis after the onset of stress. Unlike other organisms, all salt stress-induced proteins in L. lactis were also subjected to heat stress induction. DnaK, GroEL, and GroES showed similar temporal patterns of induction during salt stress, resembling the timing during heat stress although at a lower induction level. These data indicate an overlap between the heat shock and salt stress responses in L. lactis. PMID:9143115

  17. Use of non-growing Lactococcus lactis cell suspensions for production of volatile metabolites with direct relevance for flavour formation during dairy fermentations.

    PubMed

    van de Bunt, Bert; Bron, Peter A; Sijtsma, Lolke; de Vos, Willem M; Hugenholtz, Jeroen

    2014-12-10

    Background Lactococcus lactis is a lactic acid bacterium that has been used for centuries in the production of a variety of cheeses, as these bacteria rapidly acidify milk and greatly contribute to the flavour of the fermentation end-products. After a short growth phase during cheese ripening L. lactis enters an extended non-growing state whilst still strongly contributing to amino acid-derived flavour formation. Here, a research approach is presented that allows investigation of strain- and amino acid-specific flavour formation during the non-growing state.ResultsNon-growing cells of five selected L. lactis strains were demonstrated to degrade amino acids into flavour compounds that are relevant in food fermentations and differs greatly from production of flavour compounds using growing cells. As observed earlier in other research set-ups and with other microorganisms, addition of NADH, ¿-ketoglutarate and pyridoxal-5-phosphate was demonstrated to be essential for optimal flavour formation, suggesting that intracellular pools of these substrates are too low for the significant production of the flavour compounds. Production of flavours during the non-growing phase strongly depends on the individual amino acids that were supplied, on the presence of other amino acids (mixtures versus single compounds), and on the strain used. Moreover, we observed that the plasmid-free model strains L. lactis MG1363 and IL1403 produce relatively low amounts of flavour components under the various conditions tested.ConclusionsBy using this simplified and rapid approach to study flavour formation by non-growing lactic acid bacteria, lengthy ripening periods are no longer required to assess the capacity of strains to produce flavours in the long, non-growing state of dairy fermentation. In addition, this method also provides insight into the conversion of single amino acids versus the conversion of a mixture of amino acids as produced during protein degradation. The generated results are complementary to earlier generated datasets using growing cells, allowing assessment of the full flavour forming potential of strains used as starter cultures in industrial food fermentation processes. PMID:25492249

  18. Influence of intracellular pH on light emission from a luxA/B derivative of Lactococcus lactis subsp. diacetylactis.

    PubMed

    Simpson, W J

    1993-01-01

    High levels of constitutive aldehyde-dependent light emission were obtained from nongrowing cells of Lactococcus lactis subsp. diacetylactis F712 transformed with IuxA/B when they were suspended in buffered solutions. Inductions of light emission was time-dependent and was not due to growth, synthesis of luciferase or stimulation of metabolism by fermentable carbohydrate. The major factor controlling light emission in such cells appears to be the intracellular pH value. Experiments with ionophores indicated that a transmembrane pH gradient was not essential for light emission. PMID:8493883

  19. Asinibacterium lactis gen. nov., sp. nov., a member of the family Chitinophagaceae, isolated from donkey (Equus asinus) milk.

    PubMed

    Lee, Dong-Geol; Park, Ji-Min; Kang, Heecheol; Hong, So-Young; Lee, Kyung Real; Chang, Hung-Bae; Trujillo, Martha E

    2013-09-01

    A novel bacterial strain, designated LCJ02(T), was isolated on R2A agar from donkey (Equus asinus) milk powder and subjected to a taxonomic study using a polyphasic approach. Strain LCJ02(T) showed a Gram-negative reaction, was non-motile, non-spore-forming and possessed rod-shaped cells and yellow-pigmented colonies. Phylogenetic analysis based on 16S rRNA gene sequences showed that the novel isolate formed a cluster with several uncultured bacterial clones and with cultured members of the genera Hydrotalea, Sediminibacterium and Lacibacter (family Chitinophagaceae, phylum Bacteroidetes). The gene sequence similarities with respect to the type strains of recognized species from the above genera and other phylogenetic neighbours ranged from 89.3 to 92.9%. The G+C content of the genomic DNA was 49.2 mol%, the only isoprenoid quinone was MK-7 and the major fatty acids were iso-C(15:0), iso-C(17:0) 3-OH, iso-C(15:1) G and summed feature 3 (C(16:1)?7c and/or iso-C(15:0) 2-OH). The major polar lipids of strain LCJ02(T) were phosphatidylethanolamine, two unidentified aminophospholipids, one unidentified aminolipid and five unidentified lipids. The results of physiological and biochemical tests allowed phenotypic differentiation of strain LCJ02(T) from its closest phylogenetic neighbours. On the basis of the evidence of this polyphasic study, isolate LCJ02(T) represents a novel genus and species in the family Chitinophagaceae for which the name Asinibacterium lactis gen. nov., sp. nov. is proposed. The type strain is LCJ02(T) (?=KCCM 90108(T)?=JCM 18484(T)). PMID:23435252

  20. Increased Biomass Yield of Lactococcus lactis by Reduced Overconsumption of Amino Acids and Increased Catalytic Activities of Enzymes

    PubMed Central

    Adamberg, Kaarel; Seiman, Andrus; Vilu, Raivo

    2012-01-01

    Steady state cultivation and multidimensional data analysis (metabolic fluxes, absolute proteome, and transcriptome) are used to identify parameters that control the increase in biomass yield of Lactococcus lactis from 0.10 to 0.12 C-mol C-mol?1 with an increase in specific growth rate by 5 times from 0.1 to 0.5 h?1. Reorganization of amino acid consumption was expressed by the inactivation of the arginine deiminase pathway at a specific growth rate of 0.35 h?1 followed by reduced over-consumption of pyruvate directed amino acids (asparagine, serine, threonine, alanine and cysteine) until almost all consumed amino acids were used only for protein synthesis at maximal specific growth rate. This balanced growth was characterized by a high glycolytic flux carrying up to 87% of the carbon flow and only amino acids that relate to nucleotide synthesis (glutamine, serine and asparagine) were consumed in higher amounts than required for cellular protein synthesis. Changes in the proteome were minor (mainly increase in the translation apparatus). Instead, the apparent catalytic activities of enzymes and ribosomes increased by 3.5 times (0.1 vs 0.5 h?1). The apparent catalytic activities of glycolytic enzymes and ribosomal proteins were seen to follow this regulation pattern while those of enzymes involved in nucleotide metabolism increased more than the specific growth rate (over 5.5 times). Nucleotide synthesis formed the most abundant biomonomer synthetic pathway in the cells with an expenditure of 6% from the total ATP required for biosynthesis. Due to the increase in apparent catalytic activity, ribosome translation was more efficient at higher growth rates as evidenced by a decrease of protein to mRNA ratios. All these effects resulted in a 30% decrease of calculated ATP spilling (0.1 vs 0.5 h?1). Our results show that bioprocesses can be made more efficient (using a balanced metabolism) by varying the growth conditions. PMID:23133574

  1. Combinatorial peptide libraries reveal the ligand-binding mechanism of the oligopeptide receptor OppA of Lactococcus lactis

    PubMed Central

    Detmers, Frank J. M.; Lanfermeijer, Frank C.; Abele, Rupert; Jack, Ralph W.; Tampé, Robert; Konings, Wil N.; Poolman, Bert

    2000-01-01

    The oligopeptide transport system (Opp) of Lactococcus lactis has the unique capacity to mediate the transport of peptides from 4 up to at least 18 residues. The substrate specificity of this binding protein-dependent ATP-binding cassette transporter is determined mainly by the receptor protein OppA. To study the specificity and ligand-binding mechanism of OppA, the following strategy was used: (i) OppA was purified and anchored via the lipid moiety to the surface of liposomes; (ii) the proteoliposomes were used in a rapid filtration-based binding assay with radiolabeled nonameric bradykinin as a reporter peptide; and (iii) combinatorial peptide libraries were used to determine the specificity and selectivity of OppA. The studies show that (i) OppA is able to bind peptides up to at least 35 residues, but there is a clear optimum in affinity for nonameric peptides; (ii) the specificity for nonameric peptides is not equally distributed over the whole peptide, because positions 4, 5, and 6 in the binding site are more selective; and (iii) the differences in affinity for given side chains is relatively small, but overall hydrophobic residues are favored—whereas glycine, proline, and negatively charged residues lower the binding affinity. The data indicate that not only the first six residues (enclosed by the protein) but also the C-terminal three residues interact in a nonopportunistic manner with (the surface of) OppA. This binding mechanism is different from the one generally accepted for receptors of ATP-binding cassette-transporter systems. PMID:11050157

  2. Experimental conditions affect the site of tetrazolium violet reduction in the electron transport chain of Lactococcus lactis.

    PubMed

    Tachon, Sybille; Michelon, Damien; Chambellon, Emilie; Cantonnet, Monique; Mezange, Christine; Henno, Lucy; Cachon, Rémy; Yvon, Mireille

    2009-09-01

    The reduction of tetrazolium salts to coloured formazans is often used as an indicator of cell metabolism during microbiology studies, although the reduction mechanisms have never clearly been established in bacteria. The objective of the present study was to identify the reduction mechanisms of tetrazolium violet (TV) in Lactococcus lactis using a mutagenesis approach, under two experimental conditions generally applied in microbiology: a plate test with growing cells, and a liquid test with non-growing (resting) cells. The results showed that in both tests, TV reduction resulted from electron transfer from an intracellular donor (mainly NADH) to TV via the electron transport chain (ETC), but the reduction sites in the ETC depended on experimental conditions. Using the plate test, menaquinones were essential for TV reduction and membrane NADH dehydrogenases (NoxA and/or NoxB) were partly involved in electron transfer to menaquinones. In this case, TV reduction mainly occurred outside the cells and in the outer part of the plasma membrane. During the liquid test, TV was directly reduced by NoxA and/or NoxB, probably in the inner part of the membrane, where NoxA and NoxB are localized. In this case, reduction was directly related to the intracellular NADH pool. Based on these findings, new applications for TV tests are proposed, such as NADH pool determination with the liquid test and the screening of mutants affected in menaquinone biosynthesis with the plate test. Preliminary results using other tetrazolium salts in the plate test showed that the reduction sites depended on the salt, suggesting that similar studies should be carried out with other tetrazolium salts so that the outcome of each test can be interpreted correctly. PMID:19520722

  3. Growth performance of early-weaned pigs is enhanced by feeding epidermal growth factor-expressing Lactococcus lactis fermentation product.

    PubMed

    Bedford, Andrea; Huynh, Evanna; Fu, Molei; Zhu, Cuilan; Wey, Doug; de Lange, Cornelis; Li, Julang

    2014-03-10

    We have previously generated epidermal growth factor expressing Lactococcus lactis (EGF-LL) using bioengineering approach, and shown that feeding newly-weaned piglets EGF-LL improves digestive function. To address concerns over the use of genetically modified organisms (GMO), the objective of the current study was to investigate the effect of feeding the EGF-LL fermentation product, after removal of the genetically modified EGF-LL, on growth performance and intestine development of newly-weaned piglets. One hundred and twenty newly-weaned piglets were fed ad libitum according to a 2-phase feeding program. Four pens were assigned to each of three treatments: (1) complete EGF-LL fermentation product (Ferm), (2) supernatant of EGF-LL fermentation product, after removal of EGF-LL (Supern), or (3) blank M17GE media (Control). EGF-LL or its fermented supernatant was administrated to piglets in the first 3 weeks post-weaning; their growth performance was monitored throughout treatment, and for the following week. Daily body weight gain (254.8g vs. 200.5g) and Gain:Feed (0.541kg/kg vs. 0.454kg/kg) of pigs on the Supern group were significantly improved compared to that of Control, although no difference was observed between the Ferm and Control pigs. Intestinal sucrase activity was increased in Supern- compared to Control group (166.3±62.1 vs. 81.4±56.5nmol glucose released/mg protein; P<0.05). The lack of growth response with Ferm pigs may be attributed to an overload of bacteria (daily dose included 4.56×10(10)CFU/kg BW/day EGF-LL). These results suggest that GMO-free EGF-LL fermentation product is effective in increasing growth performance of early-weaned piglets. PMID:24445174

  4. Acid-Inducible Transcription of the Operon Encoding the Citrate Lyase Complex of Lactococcus lactis Biovar diacetylactis CRL264

    PubMed Central

    Martín, Mauricio G.; Sender, Pablo D.; Peirú, Salvador; de Mendoza, Diego; Magni, Christian

    2004-01-01

    Although Lactococcus is one of the most extensively studied lactic acid bacteria and is the paradigm for biochemical studies of citrate metabolism, little information is available on the regulation of the citrate lyase complex. In order to fill this gap, we characterized the genes encoding the subunits of the citrate lyase of Lactococcus lactis CRL264, which are located on an 11.4-kb chromosomal DNA region. Nucleotide sequence analysis revealed a cluster of eight genes in a new type of genetic organization. The citM-citCDEFXG operon (cit operon) is transcribed as a single polycistronic mRNA of 8.6 kb. This operon carries a gene encoding a malic enzyme (CitM, a putative oxaloacetate decarboxylase), the structural genes coding for the citrate lyase subunits (citD, citE, and citF), and the accessory genes required for the synthesis of an active citrate lyase complex (citC, citX, and citG). We have found that the cit operon is induced by natural acidification of the medium during cell growth or by a shift to media buffered at acidic pHs. Between the citM and citC genes is a divergent open reading frame whose expression was also increased at acidic pH, which was designated citI. This inducible response to acid stress takes place at the transcriptional level and correlates with increased activity of citrate lyase. It is suggested that coordinated induction of the citrate transporter, CitP, and citrate lyase by acid stress provides a mechanism to make the cells (more) resistant to the inhibitory effects of the fermentation product (lactate) that accumulates under these conditions. PMID:15317769

  5. Intraspecific and interspecific interactions among proteins regulating exopolysaccharide synthesis in Streptococcus thermophilus, Streptococcus iniae, and Lactococcus lactis subsp. cremoris and the assessment of potential lateral gene transfer.

    PubMed

    Cefalo, Angela D; Broadbent, Jeffery R; Welker, Dennis L

    2011-12-01

    Using the yeast two-hybrid system, intraspecific protein interactions were detected in Streptococcus iniae and Lactococcus lactis subsp. cremoris between the transmembrane activation protein (CpsC and EpsA, respectively) and the protein tyrosine kinase (CpsD and EpsB, respectively), between two protein tyrosine kinases, and between the protein tyrosine kinase and the phosphotyrosine phosphatase (CpsB and EpsC, respectively). For each of these intraspecific interactions, interspecific interactions were also detected when one protein was from S. iniae and the other was from Streptococcus thermophilus . Interactions were also observed between two protein tyrosine kinases when one protein was from either of the Streptococcus species and the other from L. lactis subsp. cremoris. The results and sequence comparisons performed in this study support the conclusion that interactions among the components of the tyrosine kinase - phosphatase regulatory system are conserved in the order Lactobacillales and that interspecific genetic exchanges of the genes that encode these proteins have the potential to form functional recombinants. A better understanding of intraspecific and interspecific protein interactions involved in regulating exopolysaccharide biosynthesis may facilitate construction of improved strains for industrial uses as well as identification of factors needed to form functional regulatory complexes in naturally occurring recombinants. PMID:22107596

  6. Dispersive solid phase extraction combined with ion-pair ultra high-performance liquid chromatography tandem mass spectrometry for quantification of nucleotides in Lactococcus lactis.

    PubMed

    Magdenoska, Olivera; Martinussen, Jan; Thykaer, Jette; Nielsen, Kristian Fog

    2013-09-15

    Analysis of intracellular metabolites in bacteria is of utmost importance for systems biology and at the same time analytically challenging due to the large difference in concentrations, multiple negative charges, and high polarity of these compounds. To challenge this, a method based on dispersive solid phase extraction with charcoal and subsequent analysis with ion-pair liquid chromatography coupled with electrospray ionization tandem mass spectrometry was established for quantification of intracellular pools of the 28 most important nucleotides. The method can handle extracts where cells leak during the quenching. Using a Phenyl-Hexyl column and tributylamine as volatile ion-pair reagent, sufficient retention and separation was achieved for mono-, di-, and triphosphorylated nucleotides. Stable isotope labeled nucleotides were used as internal standards for some analytes. The method was validated by determination of the recovery, matrix effects, accuracy, linearity, and limit of detection based on spiking of medium blank as well as standard addition to quenched Lactococcus lactis samples. For standard addition experiments, the isotope-labeled standards needed to be added in similar or higher concentrations as the analytes. L. lactis samples had an energy charge of 0.97 ± 0.001 which was consistent with literature, whereas some differences were observed compared with legacy data based on ³³P labeling. PMID:23747533

  7. A Specific Mutation in the Promoter Region of the Silent cel Cluster Accounts for the Appearance of Lactose-Utilizing Lactococcus lactis MG1363

    PubMed Central

    Solopova, Ana; Bachmann, Herwig; Teusink, Bas; Kok, Jan; Neves, Ana Rute

    2012-01-01

    The Lactococcus lactis laboratory strain MG1363 has been described to be unable to utilize lactose. However, in a rich medium supplemented with lactose as the sole carbon source, it starts to grow after prolonged incubation periods. Transcriptome analyses showed that L. lactis MG1363 Lac+ cells expressed celB, encoding a putative cellobiose-specific phosphotransferase system (PTS) IIC component, which is normally silent in MG1363 Lac? cells. Nucleotide sequence analysis of the cel cluster of a Lac+ isolate revealed a change from one of the guanines to adenine in the promoter region. We showed here that one particular mutation, taking place at increased frequency, accounts for the lactose-utilizing phenotype occurring in MG1363 cultures. The G-to-A transition creates a ?10 element at an optimal distance from the ?35 element. Thus, a fully active promoter is created, allowing transcription of the otherwise cryptic cluster. Nuclear magnetic resonance (NMR) spectroscopy results show that MG1363 Lac+ uses a novel pathway of lactose utilization. PMID:22660716

  8. Identification of a Conserved Sequence in Flavoproteins Essential for the Correct Conformation and Activity of the NADH Oxidase NoxE of Lactococcus lactis ? †

    PubMed Central

    Tachon, Sybille; Chambellon, Emilie; Yvon, Mireille

    2011-01-01

    Water-forming NADH oxidases (encoded by noxE, nox2, or nox) are flavoproteins generally implicated in the aerobic survival of microaerophilic bacteria, such as lactic acid bacteria. However, some natural Lactococcus lactis strains produce an inactive NoxE. We examined the role of NoxE in the oxygen tolerance of L. lactis in the rich synthetic medium GM17. Inactivation of noxE suppressed 95% of NADH oxidase activity but only slightly affected aerobic growth, oxidative stress resistance, and NAD regeneration. However, noxE inactivation strongly impaired oxygen consumption and mixed-acid fermentation. We found that the A303T mutation is responsible for the loss of activity of a naturally occurring variant of NoxE. Replacement of A303 with T or G or of G307 with S or A by site-directed mutagenesis led to NoxE aggregation and the total loss of activity. We demonstrated that L299 is involved in NoxE activity, probably contributing to positioning flavin adenine dinucleotide (FAD) in the active site. These residues are part of the strongly conserved sequence LA(T)XXAXXXG included in an alpha helix that is present in other flavoprotein disulfide reductase (FDR) family flavoproteins that display very similar three-dimensional structures. PMID:21498647

  9. Identification of a conserved sequence in flavoproteins essential for the correct conformation and activity of the NADH oxidase NoxE of Lactococcus lactis.

    PubMed

    Tachon, Sybille; Chambellon, Emilie; Yvon, Mireille

    2011-06-01

    Water-forming NADH oxidases (encoded by noxE, nox2, or nox) are flavoproteins generally implicated in the aerobic survival of microaerophilic bacteria, such as lactic acid bacteria. However, some natural Lactococcus lactis strains produce an inactive NoxE. We examined the role of NoxE in the oxygen tolerance of L. lactis in the rich synthetic medium GM17. Inactivation of noxE suppressed 95% of NADH oxidase activity but only slightly affected aerobic growth, oxidative stress resistance, and NAD regeneration. However, noxE inactivation strongly impaired oxygen consumption and mixed-acid fermentation. We found that the A303T mutation is responsible for the loss of activity of a naturally occurring variant of NoxE. Replacement of A303 with T or G or of G307 with S or A by site-directed mutagenesis led to NoxE aggregation and the total loss of activity. We demonstrated that L299 is involved in NoxE activity, probably contributing to positioning flavin adenine dinucleotide (FAD) in the active site. These residues are part of the strongly conserved sequence LA(T)XXAXXXG included in an alpha helix that is present in other flavoprotein disulfide reductase (FDR) family flavoproteins that display very similar three-dimensional structures. PMID:21498647

  10. BIOFIOBACTERIUM LACTIS ENHANCES TOLL-LIKE RECEPTOR (TLR) PATHWAY GENE EXPRESSION LOCALLY IN THE COLON AND ENHANCES GLUCOSE UPTAKE IN THE SMALL INTESTINE OF PIGS INFECTED WITH PARASITIC NEMATODE ASCARIS SUM.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The addition of probiotic bacteria to the diet is proposed to enhance healthy responses to allergic and infectious diseases in pediatric populations, but quantitative data is often lacking. An experimental model was developed to inoculate neonatal pigs from birth with B. lactis (Bb12), detect relati...

  11. Metabolic and transcriptional analysis of acid stress in Lactococcus lactis, with a focus on the kinetics of lactic acid pools.

    PubMed

    Carvalho, Ana Lúcia; Turner, David L; Fonseca, Luís L; Solopova, Ana; Catarino, Teresa; Kuipers, Oscar P; Voit, Eberhard O; Neves, Ana Rute; Santos, Helena

    2013-01-01

    The effect of pH on the glucose metabolism of non-growing cells of L. lactis MG1363 was studied by in vivo NMR in the range 4.8 to 6.5. Immediate pH effects on glucose transporters and/or enzyme activities were distinguished from transcriptional/translational effects by using cells grown at the optimal pH of 6.5 or pre-adjusted to low pH by growth at 5.1. In cells grown at pH 5.1, glucose metabolism proceeds at a rate 35% higher than in non-adjusted cells at the same pH. Besides the upregulation of stress-related genes (such as dnaK and groEL), cells adjusted to low pH overexpressed H(+)-ATPase subunits as well as glycolytic genes. At sub-optimal pHs, the total intracellular pool of lactic acid reached approximately 500 mM in cells grown at optimal pH and about 700 mM in cells grown at pH 5.1. These high levels, together with good pH homeostasis (internal pH always above 6), imply intracellular accumulation of the ionized form of lactic acid (lactate anion), and the concomitant export of the equivalent protons. The average number, n, of protons exported with each lactate anion was determined directly from the kinetics of accumulation of intra- and extracellular lactic acid as monitored online by (13)C-NMR. In cells non-adjusted to low pH, n varies between 2 and 1 during glucose consumption, suggesting an inhibitory effect of intracellular lactate on proton export. We confirmed that extracellular lactate did not affect the lactate: proton stoichiometry. In adjusted cells, n was lower and varied less, indicating a different mix of lactic acid exporters less affected by the high level of intracellular lactate. A qualitative model for pH effects and acid stress adaptation is proposed on the basis of these results. PMID:23844205

  12. Backbone NMR resonance assignments of the nucleotide binding domain of the ABC multidrug transporter LmrA from Lactococcus lactis in its ADP-bound state.

    PubMed

    Hellmich, Ute A; Duchardt-Ferner, Elke; Glaubitz, Clemens; Wöhnert, Jens

    2012-04-01

    LmrA from Lactococcus lactis is a multidrug transporter and a member of the ATP binding cassette (ABC) transporter family. ABC transporters consist of a transmembrane domain (TMD) and a nucleotide binding domain (NBD). The NBD contains the highly conserved signature motifs of this transporter superfamily. In the case of LmrA, the TMD and the NBD are expressed as a single polypeptide. LmrA catalyzes the extrusion of hydrophobic compounds including antibiotics from the cell membrane at the expense of ATP hydrolysis. ATP binds to the NBD, where binding and hydrolysis induce conformational changes that lead to the extrusion of the substrate via the TMD. Here, we report the (1)H, (13)C and (15)N backbone chemical shift assignments of the isolated 263 amino acid containing NBD of LmrA in its ADP bound state. PMID:21786024

  13. Cloning and in silico characterization of two signal peptides from Pediococcus pentosaceus and their function for the secretion of heterologous protein in Lactococcus lactis.

    PubMed

    Baradaran, Ali; Sieo, Chin Chin; Foo, Hooi Ling; Illias, Rosli Md; Yusoff, Khatijah; Rahim, Raha Abdul

    2013-02-01

    Fifty signal peptides of Pediococcus pentosaceus were characterized by in silico analysis and, based on the physicochemical analysis, (two potential signal peptides Spk1 and Spk3 were identified). The coding sequences of SP were amplified and fused to the gene coding for green fluorescent protein (GFP) and cloned into Lactococcus lactis pNZ8048 and pMG36e vectors, respectively. Western blot analysis indicated that the GFP proteins were secreted using both heterologous SPs. ELISA showed that the secretion efficiency of GFP using Spk1 (0.64 ?g/ml) was similar to using Usp45 (0.62 ?g/ml) and Spk3 (0.58 ?g/ml). PMID:23076361

  14. Development of a Stress-Inducible Controlled Expression (SICE) system in Lactococcus lactis for the production and delivery of therapeutic molecules at mucosal surfaces.

    PubMed

    Benbouziane, Bouasria; Ribelles, Pedro; Aubry, Camille; Martin, Rebeca; Kharrat, Pascale; Riazi, Ali; Langella, Philippe; Bermúdez-Humarán, Luis G

    2013-10-20

    In recent years, recombinant lactic acid bacteria (LAB) have been successfully used as safe mucosal delivery vectors. Herein, we report on the development of a Stress-Inducible Controlled Expression (SICE) system in L. lactis for the production and delivery of proteins of health interest (both therapeutic and vaccine related) at mucosal surfaces. This system is episomal in nature and is composed of a vector carrying an expression cassette under the transcriptional control of a stress-inducible promoter. The functionality of the SICE system was validated in vivo using two different routes of administration: oral and intranasal, and in two different murine models of human pathologies: (i) a model of therapy against inflammatory bowel diseases (IBD) and (ii) a model of vaccination against human papillomavirus type-16 (HPV-16). PMID:23664884

  15. Prevention of Aerobic Spoilage of Maize Silage by a Genetically Modified Killer Yeast, Kluyveromyces lactis, Defective in the Ability To Grow on Lactic Acid

    PubMed Central

    Kitamoto, H. K.; Hasebe, A.; Ohmomo, S.; Suto, E. G.; Muraki, M.; Iimura, Y.

    1999-01-01

    In this study, we propose a new process of adding a genetically modified killer yeast to improve the aerobic stability of silage. Previously constructed Kluyveromyces lactis killer strain PCK27, defective in growth on lactic acid due to disruption of the gene coding for phosphoenolpyruvate carboxykinase, a key enzyme for gluconeogenesis, inhibited the growth of Pichia anomala inoculated as an aerobic spoilage yeast and prevented a rise in pH in a model of silage fermentation. This suppressive effect of PCK27 was not only due to growth competition but also due to the killer protein produced. From these results, we concluded that strain PCK27 can be used as an additive to prolong the aerobic stability of maize silage. In the laboratory-scale experiment of maize silage, the addition of a killer yeast changed the yeast flora and significantly reduced aerobic spoilage. PMID:10508111

  16. Exopolysaccharide Biosynthesis in Lactococcus lactis NIZO B40: Functional Analysis of the Glycosyltransferase Genes Involved in Synthesis of the Polysaccharide Backbone

    PubMed Central

    van Kranenburg, Richard; van Swam, Iris I.; Marugg, Joey D.; Kleerebezem, Michiel; de Vos, Willem M.

    1999-01-01

    We used homologous and heterologous expression of the glycosyltransferase genes of the Lactococcus lactis NIZO B40 eps gene cluster to determine the activity and substrate specificities of the encoded enzymes and established the order of assembly of the trisaccharide backbone of the exopolysaccharide repeating unit. EpsD links glucose-1-phosphate from UDP-glucose to a lipid carrier, EpsE and EpsF link glucose from UDP-glucose to lipid-linked glucose, and EpsG links galactose from UDP-galactose to lipid-linked cellobiose. Furthermore, EpsJ appeared to be involved in EPS biosynthesis as a galactosyl phosphotransferase or an enzyme which releases the backbone oligosaccharide from the lipid carrier. PMID:9864348

  17. Isolation of a bacteriocin-producing lactococcus lactis and application of its bacteriocin to manage spoilage bacteria in high-value marine fish under different storage temperatures.

    PubMed

    Sarika, A R; Lipton, A P; Aishwarya, M S; Dhivya, R S

    2012-07-01

    The bacteriocins of lactic acid bacteria have considerable potential for biopreservation. The Lactococcus lactis strain PSY2 (GenBank account no. JF703669) isolated from the surface of marine perch Perca flavescens produced antibacterial activity against pathogenic and spoilage-causing Gram-positive and Gram-negative bacteria viz. Arthrobacter sp., Acinetobacter sp., Bacillus subtilis, Escherichia coli, Listeria monocytogenes, Pseudomonas aeruginosa and Staphylococcus aureus and possessed broad inhibitory spectrum. The biopreservative efficacy of the bacteriocin PSY2 was evaluated using fillets of reef cod, Epinephelus diacanthus. The fillets (10 g) were sprayed with 2.0 ml of 1,600 AU/ml bacteriocin, wrapped and kept under different storage temperatures viz., 4, 0 and -18 °C. The biopreservative extended the shelf-life of fillets stored at 4 °C to >21 days as against <14 days observed in the untreated samples. The total count of spoilage bacteria was reduced by 2.5 logarithmic units in the treated sample during the 14th day of storage as against the control. Chemical analysis revealed a significant change (P?lactis PSY2 gave increased protection against spoilage bacteria and offers an alternative for the preservation of high-value sea foods. PMID:22555500

  18. Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP--implication for a new regulation mechanism in Lactococcus lactis.

    PubMed

    Cao, Rong; Zeidan, Ahmad A; Rådström, Peter; van Niel, Ed W J

    2010-04-01

    ATP and ADP inhibit, in varying degrees, several dehydrogenases of the central carbon metabolism of Lactococcus lactis ATCC 19435 in vitro, i.e. glyceraldehyde-3-phosphate dehydrogenase (GAPDH), lactate dehydrogenase (LDH) and alcohol dehydrogenase (ADH). Here we demonstrate mixed inhibition for GAPDH and competitive inhibition for LDH and ADH by adenine nucleotides in single inhibition studies. The nonlinear negative co-operativity was best modelled with Hill-type kinetics, showing greater flexibility than the usual parabolic inhibition equation. Because these natural inhibitors are present simultaneously in the cytoplasm, multiple inhibition kinetics was determined for each dehydrogenase. For ADH and LDH, the inhibitor combinations ATP plus NAD and ADP plus NAD are indifferent to each other. Model discrimination suggested that the weak allosteric inhibition of GAPDH had no relevance when multiple inhibitors are present. Interestingly, with ADH and GAPDH the combination of ATP and ADP exhibits lower dissociation constants than with either inhibitor alone. Moreover, the concerted inhibition of ADH and GAPDH, but not of LDH, shows synergy between the two nucleotides. Similar kinetics, but without synergies, were found for horse liver and yeast ADHs, indicating that dehydrogenases can be modulated by these nucleotides in a nonlinear manner in many organisms. The action of an elevated pool of ATP and ADP may effectively inactivate lactococcal ADH, but not GAPDH and LDH, providing leverage for the observed metabolic shift to homolactic acid formation in lactococcal resting cells on maltose. Therefore, we interpret these results as a regulation mechanism contributing to readjusting the flux of ATP production in L. lactis. PMID:20193044

  19. AcmD, a Homolog of the Major Autolysin AcmA of Lactococcus lactis, Binds to the Cell Wall and Contributes to Cell Separation and Autolysis

    PubMed Central

    Visweswaran, Ganesh Ram R.; Steen, Anton; Leenhouts, Kees; Szeliga, Monika; Ruban, Beata; Hesseling-Meinders, Anne; Dijkstra, Bauke W.; Kuipers, Oscar P.; Kok, Jan; Buist, Girbe

    2013-01-01

    Lactococcus lactis expresses the homologous glucosaminidases AcmB, AcmC, AcmA and AcmD. The latter two have three C-terminal LysM repeats for peptidoglycan binding. AcmD has much shorter intervening sequences separating the LysM repeats and a lower iso-electric point (4.3) than AcmA (10.3). Under standard laboratory conditions AcmD was mainly secreted into the culture supernatant. An L. lactis acmAacmD double mutant formed longer chains than the acmA single mutant, indicating that AcmD contributes to cell separation. This phenotype could be complemented by plasmid-encoded expression of AcmD in the double mutant. No clear difference in cellular lysis and protein secretion was observed between both mutants. Nevertheless, overexpression of AcmD resulted in increased autolysis when AcmA was present (as in the wild type strain) or when AcmA was added to the culture medium of an AcmA-minus strain. Possibly, AcmD is mainly active within the cell wall, at places where proper conditions are present for its binding and catalytic activity. Various fusion proteins carrying either the three LysM repeats of AcmA or AcmD were used to study and compare their cell wall binding characteristics. Whereas binding of the LysM domain of AcmA took place at pHs ranging from 4 to 8, LysM domain of AcmD seems to bind strongest at pH 4. PMID:23951292

  20. Induction of antigen-specific tolerance by oral administration of Lactococcus lactis delivered immunodominant DQ8-restricted Gliadin peptide in sensitized NOD AB° DQ8 transgenic mice

    PubMed Central

    Huibregtse, Inge L.; Marietta, Eric V.; Rashtak, Shadi; Koning, Frits; Rottiers, Pieter; David, Chella S.; van Deventer, Sander J.H.; Murray, Joseph A.

    2012-01-01

    Active delivery of recombinant autoantigens or allergens at the intestinal mucosa by genetically modified Lactococcus lactis (LL) provides a novel therapeutic approach for the induction of tolerance. Celiac disease is associated with either HLA-DQ2 or HLA-DQ8 restricted responses to specific antigenic epitopes of gliadin, and may be treated by induction of antigen-specific tolerance. We investigated whether oral administration of LL-delivered DQ8-specific gliadin epitope induces antigen-specific tolerance. L. lactis was engineered to secrete a deamidated DQ8 gliadin epitope (LL-eDQ8d) and the induction of antigen-specific tolerance was studied in NOD AB° DQ8 transgenic mice. Tolerance was assessed by delayed-type hypersensitivity reaction, cytokine measurements, eDQ8d-specific proliferation and regulatory T cell analysis. Oral administration of LL-eDQ8d induced suppression of local and systemic DQ8 restricted T-cell responses in NOD AB° DQ8 transgenic mice. Treatment resulted in an antigen-specific decrease of the proliferative capacity of inguinal lymph node cells and lamina propria cells. Production of IL-10 and TGF-? and a significant induction of Foxp3+ regulatory T-cells were associated with the eDQ8d-specific suppression induced by LL-eDQ8d. These data provide support for the development of effective therapeutic approaches for gluten-sensitive disorders using orally administered antigen-secreting LL. Such treatments may be effective even in the setting of established hypersensitivity. PMID:19635921