Science.gov

Sample records for bact lactis aerogenes

  1. Debunking BACT

    SciTech Connect

    Finto, K.; Harrison, C.; Lomax, S.

    2006-11-15

    The US Clean Air Act's provisions for the Prevention of Significant Deterioration (PSD) of air quality require a new major stationary source to obtain a preconstruction permit that specifies the Best Available Control Technology (BACT) for each regulated pollutant that may be emitted in amounts greater than major source thresholds. The PSD regulations also impose BACT requirements on modifications to existing major sources that result in significant net emissions increases. Rather than a specific technology, BACT is an achievable emissions limitation (or work practice) determined by the permitting authority on a case-by- case basis, taking into account available technologies and energy, environmental, and economic impacts. BACT determinations are generally made by a state environmental agency after an opportunity for public comment. Increasingly, advocacy groups are challenging BACT decisions in administrative and judicial proceedings. As a result, the permitting process has been substantially delayed, even for facilities that have agreed to install state-of-the-art emissions control technology. This article outlines the key statutory and regulatory elements of BACT, how to analyze alternative technologies and emissions limitations, and prepare an application for an appropriate and final BACT determination. It is based largely on the regulatory definition of BACT and recent Environmental Appeals Board (EAB) decisions. Case-by-case BACT analyses do not necessarily yield a single, objectively correct BACT determination. The permitting agency must exercise a high degree of technical judgment in any BACT analysis, particularly for coal-fired plants, which use a wide variety of coals, combustion techniques, and other site-specific factors. 12 refs.

  2. ?-Hole aerogen bonding interactions.

    PubMed

    Bauzá, Antonio; Frontera, Antonio

    2015-10-14

    In this manuscript we combine high level ab initio calculations (RI-MP2/aug-cc-pVTZ) and the analysis of several crystal structures to demonstrate the existence of ?-hole aerogen bonding interactions in Xe(iv) compounds. The ability of XeF4 and Xe(OMe)4 to interact with electron rich molecules is rationalized using several computational tools, including molecular electrostatic potential surfaces, energetic and geometric features of the complexes and "atoms in molecules" (AIM) and Natural Bond Orbital (NBO) analyses. We have found support for the ?-hole interaction involving the xenon atom from the solid state architecture of several X-ray structures retrieved from the crystal structural depot. Particularly, ?-hole aerogen bonding interactions are quite common in the solid state of Xe(IV) compounds. PMID:26252726

  3. Unusual Chromobacterium violaceum: aerogenic strains.

    PubMed Central

    Sivendra, R

    1976-01-01

    This is the first report of Chromobacterium violaceum strains that are aerogenic. Two pigmented strains of C. violaceum and their nonpigmented variants produced gas in glucose broth. Kliger iron agar, and triple sugar iron agar. They were similar morphologically and biochemically to other anaerogenic strains studied previously. PMID:1254704

  4. Aerogen Bonding Interaction: A New Supramolecular Force?

    PubMed

    Bauzá, Antonio; Frontera, Antonio

    2015-06-15

    We report evidence of the favorable noncovalent interaction between a covalently bonded atom of Group 18 (known as noble gases or aerogens) and a negative site, for example, a lone pair of a Lewis base or an anion. It involves a region of positive electrostatic potential (σ-hole), therefore it is a totally new and unexplored σ-hole-based interaction, namely aerogen bonding. We demonstrate for the first time the existence of σ-hole regions in aerogen derivatives by means of high-level ab initio calculations. In addition, several crystal structures retrieved from the Cambridge Structural Database (CSD) give reliability to the calculations. Energetically, aerogen bonds are comparable to hydrogen bonds and other σ-hole-based interactions but less directional. They are expected to be important in xenon chemistry. PMID:25950423

  5. Dechlorination of DDT by Aerobacter aerogenes

    USGS Publications Warehouse

    1966-01-01

    Dechlorination of DDT to DDD in higher animals requires the presence of molecular oxygen, but in microorganisms the presence of oxygen hinders dechlorination. In cell-free preparations of Aerobacter aerogenes, the use of selected metabolic inhibitors indicated that reduced Fe(II) cytochrome oxidase was responsible for DDT dechlorination. This finding may possibly explain. the persistence of DDT residues in soils and sediments.

  6. BACT Simulation User Guide (Version 7.0)

    NASA Technical Reports Server (NTRS)

    Waszak, Martin R.

    1997-01-01

    This report documents the structure and operation of a simulation model of the Benchmark Active Control Technology (BACT) Wind-Tunnel Model. The BACT system was designed, built, and tested at NASA Langley Research Center as part of the Benchmark Models Program and was developed to perform wind-tunnel experiments to obtain benchmark quality data to validate computational fluid dynamics and computational aeroelasticity codes, to verify the accuracy of current aeroservoelasticity design and analysis tools, and to provide an active controls testbed for evaluating new and innovative control algorithms for flutter suppression and gust load alleviation. The BACT system has been especially valuable as a control system testbed.

  7. Enhanced Utilization of Phosphonate and Phosphite by Klebsiella aerogenes

    PubMed Central

    Imazu, Kazuya; Tanaka, Shotaro; Kuroda, Akio; Anbe, Yuki; Kato, Junichi; Ohtake, Hisao

    1998-01-01

    Klebsiella aerogenes ATCC 9621 was able to utilize phosphonates (Pn), including aminoethylphosphonate, ethylphosphonate, methylphosphonate (MPn), and phosphonoacetate, and inorganic phosphite (Pt) as sole sources of phosphorus (P). The products of the phn gene cluster were absolutely required for Pn breakdown and Pt oxidation to inorganic phosphate (Pi) in this organism. To determine if K. aerogenes ATCC 9621 could be engineered to enhance the utilization of Pn and Pt, a multicopy plasmid, pBI05, which carried the entire phn gene cluster, was introduced into this strain. Despite the increased dosage of the phn genes, K. aerogenes ATCC 9621(pBI05) could utilize only up to 1.1-fold more Pn and Pt than did the control strain with the parent vector alone. These results suggested that Pi, which was generated from Pn and Pt, might limit further utilization of these P compounds. Consequently, to convert the resulting Pi to polyphosphate (polyP), the plasmid pKP28, which carried the K. aerogenes ppk gene (which encodes polyP kinase), was introduced into K. aerogenes ATCC 9621(pBI05). Overexpression of the ppk gene in K. aerogenes ATCC 9621(pBI05, pKP28) resulted in a 2.5-fold increase in Pt utilization over that of the control strain. This recombinant strain also accumulated approximately sixfold more P than did the control strain when the cells were grown with MPn as a sole source of P. PMID:9758795

  8. Partial hydrolysis of dieldrin by Aerobacter aerogenes

    USGS Publications Warehouse

    Wedemeyer, G.

    1968-01-01

    Although dieldrin (1,2,3 ,4,10,10-hexachloro- 6,7-epoxy-1 ,4 ,4a ,5 ,6 ,7 ,8, 8a-octahydro-1 ,4-endo, exo-5, 8-dimethanonaphthalene) metabolism by mammals (F. Korte and H. Arent, Life Sci. 4:2017, 1965) and insects (D. F. Heath and M. Vanderkar, Brit. J. Ind. Med. 21:269, 1964) has been reported, little is known about the degradation of this important pesticide by microorganisms. Korte et al. (Ann. Chem. Liebigs 656:135, 1962) and Chacko et al. (Science 154: 893, 1966) reported that a number of ubiquitous microorganisms were incapable of degrading dieldrin; however, more recently Matsumura and Boush (Science 156:959, 1967) isolated several species of Pseudomonas and Bacillus which could degrade dieldrin, from a number of soil samples having similar activity. They did not specifically attempt to identify the dieldrin metabolites formed, but they did suggest, on the basis of an identical RF value with an authentic control that 6,7-trans-dihydroxydihydroaldrin (aldrin diol) might be a major product. Work carried out concurrently in this laboratory has shown that another ubiquitous bacterium, Aerobacter aerogenes, converts dieldrin in vitro to a compound chromatographically

  9. BACT analysis under the Clean Air Act's PCD program

    SciTech Connect

    Simms, P.; Walke, J.

    2006-11-15

    Before a company may build a new major industrial source of air pollution, or make modifications to an existing major source in the USA it must apply for and receive a Clean Air Act (CAA) Prevention of Significant Deterioration (PSD) permit. State environmental agencies typically issue such permits, either under state law or by exercising delegated authority to implement the federal PSD program. To fully comply with the CAA, the emissions limits identified as BACT must incorporate consideration of more than just add-on emissions control technology, they must also reflect appropriate considerations of fuel quality (e.g. low-sulfur coal) and process changes (e.g. advanced combustion techniques) as a means of controlling emissions, and must consider the other environmental and public welfare benefits of the identified emissions control options. Several states including New Mexico and Illinois have already determined that innovated technologies, such as Integrated Gasification Combined Cycle (IGCC), must be considered in connection with the BACT analysis for new coal-fired power plants. Even the notion that BACT is categorically limited in scope to the general type of facility proposed is contrary to EPA precedent. For example, the Environmental Appeals Board (EAB) has explained that permitting authorities retain the discretion under the definition of BACT to require dramatically different facility designs (e.g. a natural gas plant instead of a coal-fired power plant). The best advice for any permit applicant is to include in the BACT analysis a careful and honest examination of better performing alternative processes and/or innovative combustion techniques and to aggressively pursue such options wherever feasible. 17 refs.

  10. Single-cell protein from methanol with Enterobacter aerogenes

    SciTech Connect

    Gnan, S.O.; Abodreheba, A.O.

    1987-02-20

    An identified Enterobacter aerogenes utilizing methanol as a sole carbon source was studied for the optimization of biomass production and the reduction of its nucleic acid content. Results indicated that the highest yield and conversion were obtained at 0.5% methanol. The addition of seawater as a source of trace elements has an adverse effect. However, the addition of urea as source of nitrogen enhanced the growth of E. aerogenes. Heat shock at 60 degrees C for one minute followed by incubation at 50 degrees C for 2 hours caused 72.6% reduction in the nucleic acid. 12 references.

  11. Characterization of bacteriocins from two Lactococcus lactis subsp. lactis isolates.

    PubMed

    Akçelik, Oya; Tükel, Cagla; Ozcengiz, Gülay; Akçelik, Mustafa

    2006-03-01

    In this study, bacteriocins from two Lactococcus lactis subsp. lactis isolates from raw milk samples in Turkey designated OC1 and OC2, respectively, were characterized and identified. The activity spectra of the bacteriocins were determined by using different indicator bacteria including Listeria, Bacillus and Staphylococcus spp. Bacteriocins were tested for their sensitivity to different enzymes, heat treatments and pH values. Loss of bacteriocin activities after alpha-amylase treatment suggested that they form aggregates with carbohydrates. Molecular masses of the purified bacteriocins were determined by SDS-PAGE. PCR amplification was carried out with specific primers for the detection of their structural genes. As a result of these studies, the two bacteriocins were characterized as nisin and lacticin 481, respectively. Examination of plasmid contents of the isolates and the results of plasmid curing and conjugation experiments showed that in L. lactis subsp. lactis OC1 strain the 39.7-kb plasmid is responsible for nisin production, lactose fermentation and proteolytic activity, whereas the 16.0-kb plasmid is responsible for lacticin 481 production and lactose fermentation in L. lactis subsp. lactis OC2 strain. PMID:16523441

  12. Cloning, Sequencing, and Expression of the Pyruvate Carboxylase Gene in Lactococcus lactis subsp. lactis C2†

    PubMed Central

    Wang, H.; O'Sullivan, D. J.; Baldwin, K. A.; McKay, L. L.

    2000-01-01

    A functional pyc gene was isolated from Lactococcus lactis subsp. lactis C2 and was found to complement a Pyc defect in L. lactis KB4. The deduced lactococcal Pyc protein was highly homologous to Pyc sequences of other bacteria. The pyc gene was also detected in Lactococcus lactis subsp. cremoris and L. lactis subsp. lactis bv. diacetylactis strains. PMID:10698798

  13. Benchmark Active Controls Technology (BACT) Wing CFD Results

    NASA Technical Reports Server (NTRS)

    Schuster, David M.; Bartels, Robert E.

    2000-01-01

    The Benchmark Active Controls Technology (BACT) wing test (see chapter 8E) provides data for the validation of aerodynamic, aeroelastic, and active aeroelastic control simulation codes. These data provide a rich database for development and validation of computational aeroelastic and aeroservoelastic methods. In this vein, high-level viscous CFD analyses of the BACT wing have been performed for a subset of the test conditions available in the dataset. The computations presented in this section investigate the aerodynamic characteristics of the rigid clean wing configuration as well as simulations of the wing with a static and oscillating aileron and spoiler deflection. Two computational aeroelasticity codes extensively used at NASA Langley Research Center are implemented in this simulation. They are the ENS3DAE and CFL3DAE computational aeroelasticity programs. Both of these methods solve the three-dimensional compressible Navier-Stokes equations for both rigid and flexible vehicles, but they use significantly different approaches to the solution 6f the aerodynamic equations of motion. Detailed descriptions of both methods are presented in the following section.

  14. Enterobacter aerogenes Needle Stick Leads to Improved Biological Management System

    SciTech Connect

    Johanson, Richard E.

    2004-08-01

    A laboratory worker who received a needle stick from a contaminated needle while working with a culture containing Enterobactor aerogenes developed a laboratory acquired infection. Although this organism has been shown to cause community and nosocomial infections, there have been no documented cases of a laboratory acquired infections. Lessons learned from the event led to corrective actions which included modification of lab procedures, development of a biological inventory tracking and risk identification system and the establishment of an effective biological safety program.

  15. Biological Conversion of Glycerol to Ethanol by Enterobacter aerogenes

    NASA Astrophysics Data System (ADS)

    Nwachukwu, Raymond E. S.

    In a search to turn the economically and environmentally non-valuable "waste" streams of biodiesel production into a profitable byproduct, a mutant strain of Enterobacter aerogenes ATCC 13048 was developed by six-tube subculturing technique. This technique is based on the principle of adaptive evolution, and involved subculturing the bacterium in a tryptic soy broth without dextrose (TSB) containing specific glycerol and ethanol concentration for six consecutive times. Then, the six consecutive subculturing was repeated in a fresh TSB of higher glycerol and ethanol concentrations. A new mutant strain, E. aerogenes S012, which could withstand a combination of 200 g/l glycerol and 30 g/l ethanol concentrations, was developed. The wild and mutant strains were used for the fermentation of pure (P-) and recovered (R-) glycerol. Taguchi and full factorial methods of design of experiments were used to screen and optimize the important process factors that influence the microbial production of ethanol. A statistically sound regression model was used to establish the mathematical relationship between the process variables and ethanol production. Temperature of 38°C, agitation speed of 200 rpm, pH of 6.3-6.6, and microaerobic condition were the optimum process conditions. Different pretreatment methods to recover glycerol from the crude glycerol and the subsequent fermentation method showed that direct acidification using 85% H3PO4 was the best. The R-glycerol contained 51% pure glycerol and 21% methanol. The wild strain, E. aerogenes ATCC 13048, produced only 12 g/l and 12.8 g/l ethanol from 20 g/l P- and R-glycerol respectively, and could not utilize higher glycerol concentrations. The mutant, E. aerogenes S012, produced ethanol amount and yield of 43 g/l and 1.12 mol/mol-glycerol from P-glycerol, respectively within 96 h. It also produced ethanol amount and yield of 26.8 g/l and 1.07 mol/mol-glycerol, respectively, from R-glycerol within the same duration. In a fermentation to estimate hydrogen production using a respirometer, the hydrogen yield and volumetric rate of 1.06 mol/mol-glycerol and 217 ml/l/h, respectively were obtained from 6% P-glycerol in 72 h by E. aerogenes S012. The result was higher from R-glycerol, which produced hydrogen yield and productivity of 1.83 mol/mol-glycerol and 326 ml/l/h, respectively.

  16. Bactériophages et phagothérapie: utilisation de virus naturels pour traiter les infections bactériennes

    PubMed Central

    Ravat, F.; Jault, P.; Gabard, J.

    2015-01-01

    Summary L’utilisation des bactériophages, prédateurs naturels des bactéries, est une technique pionnière efficace de lutte contre les infections bactériennes. Tombée dans l’oubli depuis un demi-siècle du coté occidental de l’ex-rideau de fer, elle fait toujours partie de l’arsenal thérapeutique des pays de l’ex-Europe de l’Est, au point de constituer une arme de choix dans la politique de santé publique de ces pays. l’émergence de bactéries multirésistantes et le risque de revenir à l’ère pré-antibiotique ont fait ressortir la phagothérapie de l’oubli injuste auquel elle avait été confinée. la biologie et la place du bactériophage dans la nature sont décrites ici. les tenants et les aboutissants de la phagothérapie et les conditions de son retour sur le devant de la scène sont explicitées. PMID:26668557

  17. Isolation and characterization of Lactococcus lactis subsp. lactis promoters.

    PubMed Central

    Koivula, T; Sibakov, M; Palva, I

    1991-01-01

    DNA fragments with promoter activity were isolated from the chromosome of Lactococcus lactis subsp. lactis. For the isolation, a promoter probe vector based on the cat gene was constructed, which allowed direct selection with chloramphenicol in Bacillus subtilis and L. lactis. Four of the putative promoters (P1, P2, P10, and P21) were analyzed further by sequencing, mapping of the 5' end of the mRNA, Northern (RNA blot) hybridization, and chloramphenicol acetyltransferase activity measurements. From these fragments, -10 and -35 regions resembling the consensus Escherichia coli sigma 70 and B. subtilis sigma 43 promoters were identified. Another set of promoters, together with a signal sequence, were also isolated from the same organism. These fragments promoted secretion of TEM beta-lactamase from L. lactis. When the two sets of promoters were compared, it was found that the ones isolated with the cat vector were more efficient (produced more mRNA). By changing the promoter part of the promoter-signal sequence fragment giving the best TEM beta-lactamase secretion into a more efficient one (P2), a 10-fold increase in enzyme production was obtained. Images PMID:1707605

  18. Citrate uptake in membrane vesicles of Klebsiella aerogenes.

    PubMed Central

    Johnson, C L; Cha, Y A; Stern, J R

    1975-01-01

    In whole cells of Klebsiella aerogenes grown anaerobically on citrate as sole carbon source, citrate uptake is followed by rapid catabolism of the substrate via the inducible citrate fermentation pathway. Membrane vesicles prepared from such cells take up citrate but do not catabolize it. Vesicles process d-lactate dehydrogenase and the Na+-requiring oxalacetate decarboxylase. Citrate is taken up in the presence of Na+, and other monovalent cations, such as NH4+, Rb+, Cs+, or K+, do not substitute for Na+. Li+ appears to act synergistically with Na+. Citrate uptake is inhibited by N-2, cyanide, azide, sulfhydryl reagents, dinitrophenol, fluorcitrate, and hydroxycitrate. PMID:1112775

  19. Robust Multivariable Flutter Suppression for the Benchmark Active Control Technology (BACT) Wind-Tunnel Model

    NASA Technical Reports Server (NTRS)

    Waszak, Martin R.

    1997-01-01

    The Benchmark Active Controls Technology (BACT) project is part of NASA Langley Research Center s Benchmark Models Program for studying transonic aeroelastic phenomena. In January of 1996 the BACT wind-tunnel model was used to successfully demonstrate the application of robust multivariable control design methods (H and -synthesis) to flutter suppression. This paper addresses the design and experimental evaluation of robust multivariable flutter suppression control laws with particular attention paid to the degree to which stability and performance robustness was achieved.

  20. Exploring the Genome of Cheese Starter Lactic Acid Bacterium Lactococcus lactis subsp. lactis CECT 4433

    PubMed Central

    Tschoeke, Diogo Antonio; Moreira, Ana Paula B.; Chimetto Tonon, Luciane A.; de Mesquita, Milene Miranda A.; Gregoracci, Gustavo B.; Gomez-Gil, Bruno; Valle, Rogério; Thompson, Cristiane C.

    2014-01-01

    Here, we present the draft genome sequences of Lactococcus lactis subsp. lactis CECT 4433, a cheese fermentation starter strain. The genome provides further insight into the genomic plasticity, biocomplexity (including gene strain specifics), and evolution of these genera. PMID:25395632

  1. [Bact-Alert system for hemocultures: evaluation of terminal subcultures].

    PubMed

    Soloaga, R; Carballo, P; Marcote, V; Merkier, K; Salcedo, V; Fernandez, A; Gutfraind, Z; Tokumoto, M; Galanternik, L; Nagel, C; Procopio, A

    2000-01-01

    Few laboratory microbiological procedures are as important as the isolation of microorganisms from blood. To evaluate the usefulness of the terminal subcultures, 5669 blood cultures giving negative results after 7 days of incubation in the Bact/Alert System (Organon Teknika) were studied. Bottles were distributed as follows: 1562 adult aerobic bottles, 119 adult anaerobic bottles, 3960 pediatric bottles and 28 FAN bottles. From 5669 blood cultures, 10 subcultures that yielded growth had not been detected by the system. These included 5 adult aerobic bottles and 5 pediatric bottles, 7 of these microorganisms were considered contaminants according to clinical data (2 Micrococcus spp, 1 staphylococci coagulase negative, 1 Burkholderia cepacia, 1 Peptoestreptococcus spp, 1 Corynebacterium spp, 1 Scedosporium spp) while the other 3 were considered true bacteremia (1 Pseudomonas aeruginosa, 1 Proteus mirabilis, 1 Streptococcus sanguis), although no one made any change in treatment on the basis of the previous isolation. Based on these results the routinary utilization of terminal subcultures is not advisable and should be used only for special cases or a second system of blood culture should be added according to clinical or epidemiological data. PMID:11149151

  2. Genome Sequence of Lactococcus lactis subsp. lactis NCDO 2118, a GABA-Producing Strain

    PubMed Central

    Oliveira, Letícia C.; Saraiva, Tessália D. L.; Soares, Siomar C.; Ramos, Rommel T. J.; Sá, Pablo H. C. G.; Carneiro, Adriana R.; Miranda, Fábio; Freire, Matheus; Renan, Wendel; Júnior, Alberto F. O.; Santos, Anderson R.; Pinto, Anne C.; Souza, Bianca M.; Castro, Camila P.; Diniz, Carlos A. A.; Rocha, Clarissa S.; Mariano, Diego C. B.; de Aguiar, Edgar L.; Folador, Edson L.; Barbosa, Eudes G. V.; Aburjaile, Flavia F.; Gonçalves, Lucas A.; Guimarães, Luís C.; Azevedo, Marcela; Agresti, Pamela C. M.; Silva, Renata F.; Tiwari, Sandeep; Almeida, Sintia S.; Hassan, Syed S.; Pereira, Vanessa B.; Abreu, Vinicius A. C.; Pereira, Ulisses P.; Dorella, Fernanda A.; Carvalho, Alex F.; Pereira, Felipe L.; Leal, Carlos A. G.; Figueiredo, Henrique C. P.; Silva, Artur; Miyoshi, Anderson

    2014-01-01

    Lactococcus lactis subsp. lactis NCDO 2118 is a nondairy lactic acid bacterium, a xylose fermenter, and a gamma-aminobutyric acid (GABA) producer isolated from frozen peas. Here, we report the complete genome sequence of L. lactis NCDO 2118, a strain with probiotic potential activity. PMID:25278529

  3. Xylooligosaccharide fermentation with Leuconostoc lactis.

    PubMed

    Ohara, Hitomi; Owaki, Michiko; Sonomoto, Kenji

    2006-05-01

    Strains of Leuconostoc lactis SHO-47 and Le. lactis SHO-54, producing the clinically useful enzyme NAD-specific 6-phosphoglucanate dehydrogenase, were cultivated with a hydrolyzed birch wood xylan as the unique carbon source to produce D-lactic acid for poly(D-lactic acid). In addition to the strains SHO-47 and SHO-54, Lactococcus lactis IO-1, well known as a good xylose-utilizing lactic acid bacterium, was used as a control to confirm the extent of hemicellulose hydrolysis. The fermentation time for lactic acid of strains SHO-47 and SHO-54 was 12 h, and produced respectively 2.3 and 2.2 g/l lactic acid from 8.5 g/l hydrolyzed xylan, whereas the fermentation time of strain IO-1 was 21 h, and produced 1.3 g/l lactic acid. Xylooligosaccharides from xylobiose to xylohexose were utilized more rapidly than xylose in the cultures of strains SHO-47 and SHO-54. However, xylose concentration increased temporarily and then decreased in the culture of strain IO-1. On the other hand, xylooligosaccharides larger than xyloheptaose were not utilized by these three strains. The xylosidase activities of SHO-47, SHO-54, and IO-1 were induced by xylose or a mixture of xylobiose and xylotriose. The xylosidases of these three strains were localized in their cytoplasm. PMID:16781471

  4. Microbiota of Minas cheese as influenced by the nisin producer Lactococcus lactis subsp. lactis GLc05.

    PubMed

    Perin, Luana Martins; Dal Bello, Barbara; Belviso, Simona; Zeppa, Giuseppe; de Carvalho, Antônio Fernandes; Cocolin, Luca; Nero, Luís Augusto

    2015-12-01

    Minas cheese is a popular dairy product in Brazil that is traditionally produced using raw or pasteurized cow milk. This study proposed an alternative production of Minas cheese using raw goat milk added of a nisin producer Lactococcus lactis subsp. lactis GLc05. An in situ investigation was carried on to evaluate the interactions between the L. lactis subsp. lactis GLc05 and the autochthonous microbiota of a Minas cheese during the ripening; production of biogenic amines (BAs) was assessed as a safety aspect. Minas cheese was produced in two treatments (A, by adding L. lactis subsp. lactis GLc05, and B, without adding this strain), in three independent repetitions (R1, R2, and R3). Culture dependent (direct plating) and independent (rep-PCR and PCR-DGGE) methods were employed to characterize the microbiota and to assess the possible interferences caused by L. lactis subsp. lactis GLc05. BA amounts were measured using HPLC. A significant decrease in coagulase-positive cocci was observed in the cheeses produced by adding L. lactis subsp. lactis GLc05 (cheese A). The rep-PCR and PCR-DGGE highlighted the differences in the microbiota of both cheeses, separating them into two different clusters. Lactococcus sp. was found as the main microorganism in both cheeses, and the microbiota of cheese A presented a higher number of species. High concentrations of tyramine were found in both cheeses and, at specific ripening times, the BA amounts in cheese B were significantly higher than in cheese A (p<0.05). The interaction of nisin producer L. lactis subsp. lactis GLc05 was demonstrated in situ, by demonstration of its influence in the complex microbiota naturally present in a raw goat milk cheese and by controlling the growth of coagulase-positive cocci. L. lactis subsp. lactis GLc05 influenced also the production of BA determining that their amounts in the cheeses were maintained at acceptable levels for human consumption. PMID:26310130

  5. An efficient ribitol-specific dehydrogenase from Enterobacter aerogenes.

    PubMed

    Singh, Ranjitha; Singh, Raushan; Kim, In-Won; Sigdel, Sujan; Kalia, Vipin C; Kang, Yun Chan; Lee, Jung-Kul

    2015-05-01

    An NAD(+)-dependent ribitol dehydrogenase from Enterobacter aerogenes KCTC 2190 (EaRDH) was cloned and successfully expressed in Escherichia coli. The complete 729-bp gene was amplified, cloned, expressed, and subsequently purified in an active soluble form using nickel affinity chromatography. The enzyme had an optimal pH and temperature of 11.0 and 45°C, respectively. Among various polyols, EaRDH exhibited activity only toward ribitol, with Km, Vmax, and kcat/Km values of 10.3mM, 185Umg(-1), and 30.9s(-1)mM(-1), respectively. The enzyme showed strong preference for NAD(+) and displayed no detectable activity with NADP(+). Homology modeling and sequence analysis of EaRDH, along with its biochemical properties, confirmed that EaRDH belongs to the family of NAD(+)-dependent ribitol dehydrogenases, a member of short-chain dehydrogenase/reductase (SCOR) family. EaRDH showed the highest activity and unique substrate specificity among all known RDHs. Homology modeling and docking analysis shed light on the molecular basis of its unusually high activity and substrate specificity. PMID:25837508

  6. Kluyveromyces lactis: An emerging tool in biotechnology.

    PubMed

    Spohner, Sebastian C; Schaum, Vivienne; Quitmann, Hendrich; Czermak, Peter

    2016-03-20

    Kluyveromyces lactis has emerged as one of the most important yeast species for research and industrial biotechnology. This Crabtree-negative species is suitable for the production of metabolites and heterologous proteins, and its ability to achieve high levels of protein secretion makes it an attractive alternative for industrial protein production. Since 1991, almost 100 recombinant proteins have been expressed in K. lactis, 20% of which have been produced in the last 2 years. This review provides an overview of the genetic modifications used to accomplish heterologous gene expression in K. lactis, as well as fermentation techniques, and recent examples of industrial proteins produced in this species. PMID:26912289

  7. [Finding of dairy yeasts Kluyveromyces lactis var. lactis in natural habitats].

    PubMed

    Naumov, G I; Naumova, E S; Glushakova, A M; Kachalkin, A V; Chernov, I Y

    2014-01-01

    Well-known yeasts Kluyveromyces lactis var. lactis, which are usually associated with dairy prod- ucts, were discovered in nature (in woodland park soil under Impatiens glandulifera Royle plants). Reliable identification of the yeasts was carried out using physiological criteria (lactose and maltose utilization) and molecular markers (nucleotide sequence of the 5.8S-ITS rDNA fragment, pulsed-field electrophoresis, and Southern hybridization of chromosomal DNA with the LAC4 probe). Ecology of KI. lactis var. lactis is discussed. PMID:25941717

  8. BactQuant: An enhanced broad-coverage bacterial quantitative real-time PCR assay

    PubMed Central

    2012-01-01

    Background Bacterial load quantification is a critical component of bacterial community analysis, but a culture-independent method capable of detecting and quantifying diverse bacteria is needed. Based on our analysis of a diverse collection of 16 S rRNA gene sequences, we designed a broad-coverage quantitative real-time PCR (qPCR) assay—BactQuant—for quantifying 16 S rRNA gene copy number and estimating bacterial load. We further utilized in silico evaluation to complement laboratory-based qPCR characterization to validate BactQuant. Methods The aligned core set of 4,938 16 S rRNA gene sequences in the Greengenes database were analyzed for assay design. Cloned plasmid standards were generated and quantified using a qPCR-based approach. Coverage analysis was performed computationally using >670,000 sequences and further evaluated following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. Results A bacterial TaqMan® qPCR assay targeting a 466 bp region in V3-V4 was designed. Coverage analysis showed that 91% of the phyla, 96% of the genera, and >80% of the 89,537 species analyzed contained at least one perfect sequence match to the BactQuant assay. Of the 106 bacterial species evaluated, amplification efficiencies ranged from 81 to 120%, with r2-value of >0.99, including species with sequence mismatches. Inter- and intra-run coefficient of variance was <3% and <16% for Ct and copy number, respectively. Conclusions The BactQuant assay offers significantly broader coverage than a previously reported universal bacterial quantification assay BactQuant in vitro performance was better than the in silico predictions. PMID:22510143

  9. Comparative Phenotypic and Molecular Genetic Profiling of Wild Lactococcus lactis subsp. lactis Strains of the L. lactis subsp. lactis and L. lactis subsp. cremoris Genotypes, Isolated from Starter-Free Cheeses Made of Raw Milk▿

    PubMed Central

    Fernández, Elena; Alegría, Ángel; Delgado, Susana; Martín, M. Cruz; Mayo, Baltasar

    2011-01-01

    Twenty Lactococcus lactis strains with an L. lactis subsp. lactis phenotype isolated from five traditional cheeses made of raw milk with no added starters belonging to the L. lactis subsp. lactis and L. lactis subsp. cremoris genotypes (lactis and cremoris genotypes, respectively; 10 strains each) were subjected to a series of phenotypic and genetic typing methods, with the aims of determining their phylogenetic relationships and suitability as starters. Pulsed-field gel electrophoresis (PFGE) analysis of intact genomes digested with SalI and SmaI proved that all strains were different except for three isolates of the cremoris genotype, which showed identical PFGE profiles. Multilocus sequence typing (MLST) analysis using internal sequences of seven loci (namely, atpA, rpoA, pheS, pepN, bcaT, pepX, and 16S rRNA gene) revealed considerable intergenotype nucleotide polymorphism, although deduced amino acid changes were scarce. Analysis of the MLST data for the present strains and others from other dairy and nondairy sources showed that all of them clustered into the cremoris or lactis genotype group, by using both independent and combined gene sequences. These two groups of strains also showed distinctive carbohydrate fermentation and enzyme activity profiles, with the strains in the cremoris group showing broader profiles. However, the profiles of resistance/susceptibility to 16 antibiotics were very similar, showing no atypical resistance, except for tetracycline resistance in three identical cremoris genotype isolates. The numbers and concentrations of volatile compounds produced in milk by the strains belonging to these two groups were clearly different, with the cremoris genotype strains producing higher concentrations of more branched-chain, derived compounds. Together, the present results support the idea that the lactis and cremoris genotypes of phenotypic Lactococcus lactis subsp. lactis actually represent true subspecies. Some strains of the two subspecies in this study appear to be good starter candidates. PMID:21666023

  10. Inorganic phosphate accumulation and cadmium detoxification in Klebsiella aerogenes NCTC 418 growing in continuous culture

    SciTech Connect

    Aiking, H.; Stijnman, A.; van Garderen, C.; van Heerikhuizen, H.; van Riet, J.

    1984-02-01

    Klebsiella aerogenes NCTC-418, growing in the presence of cadmium under glucose-, sulfate-, or phosphate-limited conditions in continuous culture, exhibits two different cadmium detoxifying mechanisms. In addition to sulfide formation, increased accumulation of P/sub i/ is demonstrated as a novel mechanism. Intracellular cadmium is always quantitatively counterbalanced by a concerted increase in both inorganic sulfide and P/sub i/ contents of the cells. This led to the conclusion that production of sulfide and accumulation of P/sub i/ are detoxification mechanisms present in K. aerogenes but that their relative importance is crucially dependent on the strain and the growth conditions employed.

  11. Draft Genome Sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a Citrate-Fermenting Strain.

    PubMed

    Zuljan, Federico; Espariz, Martín; Blancato, Victor S; Esteban, Luis; Alarcón, Sergio; Magni, Christian

    2016-01-01

    We report the draft genome sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a natural strain isolated from artisanal cheese from northwest Argentina. L. lactis subsp. lactis bv. diacetylactis is one of the most important microorganisms used as starter culture around the world. The CRL264 strain constitutes a model microorganism in the studies on the generation of aroma compounds (diacetyl, acetoin, and 2,3-butanediol) by lactic acid bacteria. Our genome analysis shows similar genetic organization to other available genomes of L. lactis bv. diacetylactis strains. PMID:26847906

  12. Draft Genome Sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a Citrate-Fermenting Strain

    PubMed Central

    Zuljan, Federico; Espariz, Martín; Blancato, Victor S.; Esteban, Luis; Alarcón, Sergio

    2016-01-01

    We report the draft genome sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a natural strain isolated from artisanal cheese from northwest Argentina. L. lactis subsp. lactis bv. diacetylactis is one of the most important microorganisms used as starter culture around the world. The CRL264 strain constitutes a model microorganism in the studies on the generation of aroma compounds (diacetyl, acetoin, and 2,3-butanediol) by lactic acid bacteria. Our genome analysis shows similar genetic organization to other available genomes of L. lactis bv. diacetylactis strains. PMID:26847906

  13. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Characterization of the bacteriocin

    PubMed Central

    Furtado, Danielle N.; Todorov, Svetoslav D.; Landgraf, Mariza; Destro, Maria T.; Franco, Bernadette D.G.M.

    2014-01-01

    Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi) was isolated from goat milk, and studied for its antimicrobial activity. The bacteriocin presented a broad spectrum of activity, was sensitive to proteolytic enzymes, resistant to heat and pH extremes, and not affected by the presence of SDS, Tween 20, Tween 80, EDTA or NaCl. Bacteriocin production was dependent on the components of the culture media, especially nitrogen source and salts. When tested by PCR, the bacteriocin gene presented 100% homology to nisin Z gene. These properties indicate that this L. lactis subsp. lactis DF4Mi can be used for enhancement of dairy foods safety and quality. PMID:25763065

  14. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: characterization of the bacteriocin.

    PubMed

    Furtado, Danielle N; Todorov, Svetoslav D; Landgraf, Mariza; Destro, Maria T; Franco, Bernadette D G M

    2014-01-01

    Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi) was isolated from goat milk, and studied for its antimicrobial activity. The bacteriocin presented a broad spectrum of activity, was sensitive to proteolytic enzymes, resistant to heat and pH extremes, and not affected by the presence of SDS, Tween 20, Tween 80, EDTA or NaCl. Bacteriocin production was dependent on the components of the culture media, especially nitrogen source and salts. When tested by PCR, the bacteriocin gene presented 100% homology to nisin Z gene. These properties indicate that this L. lactis subsp. lactis DF4Mi can be used for enhancement of dairy foods safety and quality. PMID:25763065

  15. Les biofilms bactériens : leur importance en santé animale et en santé publique

    PubMed Central

    Tremblay, Yannick D.N.; Hathroubi, Skander; Jacques, Mario

    2014-01-01

    Résumé Les biofilms bactériens sont des amas structurés de cellules bactériennes enrobés d’une matrice polymérique et attachés à une surface. Le biofilm protège les bactéries et leur permet de survivre dans des conditions environnementales hostiles. Les bactéries du biofilm peuvent résister à la réponse immunitaire de l’hôte et sont beaucoup plus résistantes aux antibiotiques et aux désinfectants que les cellules bactériennes planctoniques. La capacité de former un biofilm est maintenant reconnue comme une caractéristique propre à plusieurs microorganismes. La présence de biofilms lors d’infections demande donc de nouvelles méthodes de prévention, de diagnostic et de traitement. De même, la présence de biofilms sur des surfaces retrouvées à la ferme, à l’abattoir ou à l’usine de transformation affectera l’efficacité du protocole de désinfection. De façon surprenante, la formation de biofilms chez les bactéries pathogènes des animaux et les bactéries zoonotiques est un sujet relativement peu étudié. Ce bref compte rendu a pour objectif de sensibiliser les intervenants en santé animale à l’importance des biofilms. PMID:24688172

  16. Lactococcus lactis subsp. lactis JCM 5805 activates natural killer cells via dendritic cells.

    PubMed

    Suzuki, Hiroaki; Ohshio, Konomi; Fujiwara, Daisuke

    2016-04-01

    Lactococcus lactis subsp. lactis JCM 5805 (JCM5805) has been shown to stimulate plasmacytoid dendritic cells (pDC). Here, we investigated the effect of JCM5805 on NK cells. In vitro studies suggested that JCM5805 activated natural killer (NK) cells via dendritic cells including pDC. Furthermore, the oral administration of JCM5805 enhanced the cytotoxic activity of NK cells. PMID:26623718

  17. Best available control technology (BACT) of VOC for PU (polyurethane) synthetic leather surface coating industry in Taiwan

    SciTech Connect

    Shen, K.P.; Lai, C.C.; Lin, S.S.; Wu, H.H.; Huang, J.J.; Wang, Y.M.; Chen, H.W.

    1999-07-01

    In Taiwan, the polyurethane (PU) synthetic leather surface coating industry produced about 61,400 tons of volatile organic compound (VOC) emissions, accounting for 11 % of total stationary emissions of VOC. The industry is the largest VOC emission source in Taiwan. Major pollutants are dimethyl formamide (DMF), toluene, and methyl ethyl ketone (MEK). To obtain the best available control technology (BACT) of VOC emissions for the PU synthetic leather surface coating industry, this study followed the BACT guidelines of US EPA. For DMF, the BACT was the wet scrubbing technology for exhaust gas treatment, followed by a solvent recovery system. The change of coating methods or solvents, e.g., the use of water-base instead of organic-base solvents, was found to be the BACT for toluene and MEK. Through computer simulation, a wet scrubber with three in-series packing towers was found to be the most effective and economic for DMF. Based on the simulation, a full scale of plant was built and the test results were presented in this study. Results showed that 99% removal efficiency of DMF was achieved and the annual operation cost could be retrieved through the recovery of DMF solvent. The regulation for the industry established based on the BACT was also described in this study.

  18. Amphotericin B Resistance and Membrane Fluidity in Kluyveromyces lactis Strains

    PubMed Central

    Younsi, Mohamed; Ramanandraibe, Elise; Bonaly, Roger; Donner, Mireille; Coulon, Joël

    2000-01-01

    The membrane fluidity of reduced-amphotericin B (AmB)-sensitivity Kluyveromyces lactis mutant strain is higher than that of the wild-type K. lactis strain. After culture of the K. lactis and K. lactis mutant cells in the presence of subinhibitory doses of AmB (10 and 125 mg/liter, respectively), the plasma membranes of both yeast strains also showed a higher fluidity than did those of control cells. High membrane fluidity was associated with changes in the structural properties of the membranes. Culture of the K. lactis and K. lactis mutant cells in the presence of AmB induced changes in membrane lipid contents. In particular, phospholipid contents were increased in both strains treated with AmB, compared with their corresponding counterparts. As a result, the sterol/phospholipid ratio decreased. The relative proportion of monounsaturated fatty acids also increased after AmB treatment. The saturated fatty acid/monounsaturated fatty acid ratio decreased in K. lactis and K. lactis mutant cells treated with AmB but also in K. lactis mutant control cells compared to that in the K. lactis wild strain. These changes in lipid composition explain the higher fluidity, which could represent a process of metabolic resistance of the yeasts to AmB. PMID:10858353

  19. [Evaluation of aerogenic occupational health risk for workers engaged into periclase-carbon refractories production].

    PubMed

    Drugova, O G; Rosly?, O F

    2014-01-01

    The work is aimed to evaluate aerogenic occupational health risk for workers engaged into preparation and formation of technologic mass in periclase-carbon refractories production, using organic binding agent according to criteria R 2.2.2006-05 and R 2.2.1716-03. Occupational dust is a complicated chemical mixture containing manganum oxide, phenol, formaldehyde, aerosols containing silicon, benzpyrene (if "Carbores" binding agent used). Hygienic evaluation revealed occupational health risk due to occupational dust at workplaces of runners operator, press operator, batching feeder, crane operator. Aerogenic occupational risk at workplace of grinder operator is assessed as negligibly small (tolerable). Experimental and epidemiologic studies prove probable (proof category 1B) occupational risk of respiratory disease at the studied production. PMID:25282807

  20. Engineered Enterobacter aerogenes for efficient utilization of sugarcane molasses in 2,3-butanediol production.

    PubMed

    Jung, Moo-Young; Park, Bu-Soo; Lee, Jinwon; Oh, Min-Kyu

    2013-07-01

    Sugarcane molasses is considered to be a good carbon source for biorefinery due to its high sugar content and low price. Sucrose occupies more than half of the sugar in the molasses. Enterobacter aerogenes is a good host strain for 2,3-butanediol production, but its utilization of sucrose is not very efficient. To improve sucrose utilization in E. aerogenes, a sucrose regulator (ScrR) was disrupted from the genomic DNA. The deletion mutation increased the sucrose consumption rate significantly when sucrose or sugarcane molasses was used as a carbon source. The 2,3-butanediol production from sugarcane molasses by the mutant was enhanced by 60% in batch fermentation compared to that by the wild type strain. In fed-batch fermentation, 98.69 g/L of 2,3-butanediol production was achieved at 36 h. PMID:23644066

  1. Enhanced dark hydrogen fermentation by addition of ferric oxide nanoparticles using Enterobacter aerogenes.

    PubMed

    Lin, Richen; Cheng, Jun; Ding, Lingkan; Song, Wenlu; Liu, Min; Zhou, Junhu; Cen, Kefa

    2016-05-01

    Ferric oxide nanoparticles (FONPs) were used to facilitate dark hydrogen fermentation using Enterobacter aerogenes. The hydrogen yield of glucose increased from 164.5±2.29 to 192.4±1.14mL/g when FONPs concentration increased from 0 to 200mg/L. SEM images of E. aerogenes demonstrated the existence of bacterial nanowire among cells, suggesting FONPs served as electron conduits to enhance electron transfer. TEM showed cellular internalization of FONPs, indicating hydrogenase synthesis and activity was potentially promoted due to the released iron element. When further increasing FONPs concentration to 400mg/L, the hydrogen yield of glucose decreased to 147.2±2.54mL/g. Soluble metabolic products revealed FONPs enhanced acetate pathway of hydrogen production, but weakened ethanol pathway. This shift of metabolic pathways allowed more nicotinamide adenine dinucleotide for reducing proton to hydrogen. PMID:26890796

  2. Is Aerogen-? Interaction Capable of Initiating the Noncovalent Chemistry of Group 18?

    PubMed

    Miao, Junjian; Song, Bo; Gao, Yi

    2015-12-01

    The interactions between atoms of noble gases and ? systems are generally considered as van der Waals interaction, which have not attracted attention yet. Herein, we present high-level ab initio calculations to show the unexpected noncovalent interaction between a covalently bonded noble gas atom and a delocalized aromatic ? electron using XeO3 ?benzene as the prototype. The CCSD(T)/CBS reference data show its strength amounting to -10.2?kcal?mol(-1) , comparable to a typical H-bond or an anion-? interaction. The energy decomposition analysis reveals that the aerogen-? interaction is favored by the electrostatic interaction (27.7?%), the induction (13.4?%), and the dispersion (21.6?%). This interaction may prompt us to consider the noncovalent chemistry of aerogen derivatives in the near future. PMID:26282579

  3. Enhanced Aerogen-π Interaction by a Cation-π Force.

    PubMed

    Miao, Junjian; Song, Bo; Gao, Yi

    2016-02-01

    The interaction between a noble gas atom and an aromatic π-electron system, which mainly originates from the London dispersion force, is very weak and has not attracted enough attention yet. Herein, we reported a type of notably enhanced aerogen-π interaction between cation-π systems and noble gas atoms. The binding strength of a divalent cation-π system with a xenon atom is comparable to a moderate hydrogen bond (up to ca. 7 kcal mol(-1) ), whereas krypton and argon atoms produce slightly weaker interactions. Energy-decomposition analysis reveals that the induction interaction is responsible for the stabilization of divalent cation-π⋅Xe species besides the dispersion interaction. Our results might be helpful to increase the understanding of some unsolved mysteries of aerogens. PMID:26699400

  4. Complete genome sequence of Bifidobacterium animalis subsp. lactis BLC1.

    PubMed

    Bottacini, Francesca; Dal Bello, Fabio; Turroni, Francesca; Milani, Christian; Duranti, Sabrina; Foroni, Elena; Viappiani, Alice; Strati, Francesco; Mora, Diego; van Sinderen, Douwe; Ventura, Marco

    2011-11-01

    Bifidobacterium animalis subsp. lactis BLC1 is a probiotic bacterium that is widely exploited by food industries as the active ingredient of various functional foods. Here we report the complete genome sequence of B. animalis subsp. lactis BLC1, which is expected to provide insights into the biology of this health-promoting microorganism and improve our understanding of its phylogenetic relatedness with other members of the B. animalis subsp. lactis taxon. PMID:22038957

  5. Inactivation of Enterobacter aerogenes in reconstituted skim milk by high- and low-frequency ultrasound.

    PubMed

    Gao, Shengpu; Hemar, Yacine; Lewis, Gillian D; Ashokkumar, Muthupandian

    2014-11-01

    The inactivation of Enterobacter aerogenes in skim milk using low-frequency (20kHz) and high-frequency (850kHz) ultrasonication was investigated. It was found that low-frequency acoustic cavitation resulted in lethal damage to E. aerogenes. The bacteria were more sensitive to ultrasound in water than in reconstituted skim milk having different protein concentrations. However, high-frequency ultrasound was not able to inactivate E. aerogenes in milk even when powers as high as 50W for 60min were used. This study also showed that high-frequency ultrasonication had no influence on the viscosity and particle size of skim milk, whereas low-frequency ultrasonication resulted in the decrease in viscosity and particle size of milk. The decrease in particle size is believed to be due to the breakup of the fat globules, and possibly to the cleavage of the κ-casein present at the surface of the casein micelles. Whey proteins were also found to be slightly affected by low-frequency ultrasound, with the amounts of α-lactalbumin and β-lactoglobulin slightly decreasing. PMID:24394387

  6. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic treatment

    PubMed Central

    Davin-Regli, Anne; Pagès, Jean-Marie

    2015-01-01

    Enterobacter aerogenes and E. cloacae have been reported as important opportunistic and multiresistant bacterial pathogens for humans during the last three decades in hospital wards. These Gram-negative bacteria have been largely described during several outbreaks of hospital-acquired infections in Europe and particularly in France. The dissemination of Enterobacter sp. is associated with the presence of redundant regulatory cascades that efficiently control the membrane permeability ensuring the bacterial protection and the expression of detoxifying enzymes involved in antibiotic degradation/inactivation. In addition, these bacterial species are able to acquire numerous genetic mobile elements that strongly contribute to antibiotic resistance. Moreover, this particular fitness help them to colonize several environments and hosts and rapidly and efficiently adapt their metabolism and physiology to external conditions and environmental stresses. Enterobacter is a versatile bacterium able to promptly respond to the antibiotic treatment in the colonized patient. The balance of the prevalence, E. aerogenes versus E. cloacae, in the reported hospital infections during the last period, questions about the horizontal transmission of mobile elements containing antibiotic resistance genes, e.g., the efficacy of the exchange of resistance genes Klebsiella pneumoniae to Enterobacter sp. It is also important to mention the possible role of antibiotic use in the treatment of bacterial infectious diseases in this E. aerogenes/E. cloacae evolution. PMID:26042091

  7. Partial purification and characterization of a novel histidine decarboxylase from Enterobacter aerogenes DL-1.

    PubMed

    Zou, Yu; Hu, Wenzhong; Jiang, Aili; Tian, Mixia

    2015-08-18

    Histidine decarboxylase (HDC) from Enterobacter aerogenes DL-1 was purified in a three-step procedure involving ammonium sulfate precipitation, Sephadex G-100, and DEAE-Sepharose column chromatography. The partially purified enzyme showed a single protein band of 52.4 kD on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The optimum pH for HDC activity was 6.5, and the enzyme was stable between pH 4 and 8. Enterobacter aerogenes HDC had optimal activity at 40°C and retained most of its activity between 4 and 50°C. HDC activity was reduced in the presence of numerous tested compounds. Particularly with SDS, it significantly (p < 0.01) inhibited enzyme activity. Conversely, Ca(2+) and Mn(2+) showed prominent activation effects (p < 0.01) with activity increasing to 117.20% and 123.42%, respectively. The Lineweaver-Burk plot showed that K m and V max values of the enzyme for L-histidine were 0.21 mM and 71.39 µmol/min, respectively. In comparison with most HDCs from other microorganisms and animals, HDC from E. aerogenes DL-1 displayed higher affinity and greater reaction velocity toward L-histidine. PMID:25036745

  8. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic treatment.

    PubMed

    Davin-Regli, Anne; Pagès, Jean-Marie

    2015-01-01

    Enterobacter aerogenes and E. cloacae have been reported as important opportunistic and multiresistant bacterial pathogens for humans during the last three decades in hospital wards. These Gram-negative bacteria have been largely described during several outbreaks of hospital-acquired infections in Europe and particularly in France. The dissemination of Enterobacter sp. is associated with the presence of redundant regulatory cascades that efficiently control the membrane permeability ensuring the bacterial protection and the expression of detoxifying enzymes involved in antibiotic degradation/inactivation. In addition, these bacterial species are able to acquire numerous genetic mobile elements that strongly contribute to antibiotic resistance. Moreover, this particular fitness help them to colonize several environments and hosts and rapidly and efficiently adapt their metabolism and physiology to external conditions and environmental stresses. Enterobacter is a versatile bacterium able to promptly respond to the antibiotic treatment in the colonized patient. The balance of the prevalence, E. aerogenes versus E. cloacae, in the reported hospital infections during the last period, questions about the horizontal transmission of mobile elements containing antibiotic resistance genes, e.g., the efficacy of the exchange of resistance genes Klebsiella pneumoniae to Enterobacter sp. It is also important to mention the possible role of antibiotic use in the treatment of bacterial infectious diseases in this E. aerogenes/E. cloacae evolution. PMID:26042091

  9. Novel Antibacterial Activity of Lactococcus Lactis Subspecies Lactis Z11 Isolated from Zabady

    PubMed Central

    Enan, Gamal; Abdel-Shafi, Seham; Ouda, Sahar; Negm, Sally

    2013-01-01

    The purpose of this study was to select and characterize a probiotic bacterium with distinctive antimicrobial activities. In this respect, Lactococcus lactis subspecies lactis Z11 (L. lactis Z11) isolated from Zabady (Arabian yoghurt) inhibited other strains of lactic acid bacteria and some food-born pathogens including Listeria monocytogenes, Bacillus cereus and staphylococcus aureus. The inhibitory activity of cell free supernatant (CFS) of L. lactis Z11 isolated from zabady was lost by proteolytic enzymes, heat resistant. Consequently, the active substance(s) of CFS was characterized as a bacteriocin. This bacteriocin has been shown to consist of protein but has no lipidic or glucidic moieties in its active molecule. Its activity was stable in the pH range 2.0 to 7.0 and was not affected by organic solvents. The L. lactis Z11 bacteriocin was produced in CFS throughout the mide to the late exponential phase of growth of the producer organism and maximum bacteriocin production was obtained at initial pH 6.5 at incubation temperature of about 30°C. PMID:24151453

  10. Antimicrobial potential of immobilized Lactococcus lactis subsp. lactis ATCC 11454 against selected bacteria.

    PubMed

    Millette, M; Smoragiewicz, W; Lacroix, M

    2004-06-01

    Immobilization of living cells of lactic acid bacteria could be an alternative or complementary method of immobilizing organic acids and bacteriocins and inhibit undesirable bacteria in foods. This study evaluated the inhibition potential of immobilized Lactococcus lactis subsp. lactis ATCC 11454 on selected bacteria by a modified method of the agar spot test. L. lactis was immobilized in calcium alginate (1 to 2%)-whey protein concentrate (0 and 1%) beads. The antimicrobial potential of immobilized L. lactis was evaluated in microbiological media against pathogenic bacteria (Escherichia coli, Salmonella, and Staphylococcus aureus) or Pseudomonas putida, a natural meat contaminant, and against seven gram-positive bacteria used as indicator strains. Results obtained in this study indicated that immobilized L. lactis inhibited the growth of S. aureus, Enterococcus faecalis, Enterococcus faecium, Lactobacillus curvatus, Lactobacillus sakei, Kocuria varians, and Pediococcus acidilactici. Only 4 h of incubation at 35 degrees C resulted in a clear inhibition zone around the beads that increased with time. With the addition of 10 mM of a chelating agent (EDTA) to the media, results showed growth inhibition of E. coli; however, P. putida and Salmonella Typhi were unaffected by this treatment. These results indicate that immobilized lactic acid bacteria strains can be successfully used to produce nisin and inhibit bacterial growth in semisolid synthetic media. PMID:15222547

  11. Novel antibacterial activity of lactococcus lactis subspecies lactis z11 isolated from zabady.

    PubMed

    Enan, Gamal; Abdel-Shafi, Seham; Ouda, Sahar; Negm, Sally

    2013-09-01

    The purpose of this study was to select and characterize a probiotic bacterium with distinctive antimicrobial activities. In this respect, Lactococcus lactis subspecies lactis Z11 (L. lactis Z11) isolated from Zabady (Arabian yoghurt) inhibited other strains of lactic acid bacteria and some food-born pathogens including Listeria monocytogenes, Bacillus cereus and staphylococcus aureus. The inhibitory activity of cell free supernatant (CFS) of L. lactis Z11 isolated from zabady was lost by proteolytic enzymes, heat resistant. Consequently, the active substance(s) of CFS was characterized as a bacteriocin. This bacteriocin has been shown to consist of protein but has no lipidic or glucidic moieties in its active molecule. Its activity was stable in the pH range 2.0 to 7.0 and was not affected by organic solvents. The L. lactis Z11 bacteriocin was produced in CFS throughout the mide to the late exponential phase of growth of the producer organism and maximum bacteriocin production was obtained at initial pH 6.5 at incubation temperature of about 30°C. PMID:24151453

  12. BACT analysis: Are there cost effective air quality benefits from trees?

    SciTech Connect

    McPherson, E.G.; Simpson, J.R.; Scott, K.I.

    1996-12-31

    Trees absorb gaseous pollutants through leaf stomata and can bind or dissolve water soluble pollutants onto moist leaf surfaces. Tree canopies also intercept particulates and reduce local air temperatures. Urban trees may reduce ambient air ozone concentrations, either by direct absorption of ozone or other pollutants such as NO{sub 2}, or by reducing air temperatures, which reduces hydrocarbon emission and ozone formation rates. On the other hand, biogenic hydrocarbon emissions from trees may play a role in ozone formation. The role of trees in air quality has become coupled with concern over the costs and benefits of large-scale urban free planting programs. Air quality management districts provide pollution abatement credits to businesses and institutions by permitting the use of controls or processes, provided they are technically feasible and cost effective, based upon guidelines in Best Available Control Technology (BACT) manuals. Typically BACT analysis is applied to stationary sources, but the authors apply it here to determine if a large-scale urban tree planting can be a cost effective means to improve air quality.

  13. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: evaluation of the probiotic potential.

    PubMed

    Furtado, Danielle N; Todorov, Svetoslav D; Landgraf, Mariza; Destro, Maria T; Franco, Bernadette D G M

    2014-01-01

    Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi) was isolated from goat milk, and studied for its probiotic potential. Lc. lactis DF4Mi was resistant to acidic pH and oxbile, presented co-aggregation with Listeria monocytogenes, and was not affected by several drugs from different generic groups, being sensitive to most tested antibiotics. These properties indicate that this Lc. lactis strain can be used for enhancement of dairy foods safety and quality, in combination with potential probiotic properties. PMID:25477942

  14. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Evaluation of the probiotic potential

    PubMed Central

    Furtado, Danielle N.; Todorov, Svetoslav D.; Landgraf, Mariza; Destro, Maria T.; Franco, Bernadette D.G.M.

    2014-01-01

    Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi) was isolated from goat milk, and studied for its probiotic potential. Lc. lactis DF4Mi was resistant to acidic pH and oxbile, presented co-aggregation with Listeria monocytogenes, and was not affected by several drugs from different generic groups, being sensitive to most tested antibiotics. These properties indicate that this Lc. lactis strain can be used for enhancement of dairy foods safety and quality, in combination with potential probiotic properties. PMID:25477942

  15. Kefir-isolated Lactococcus lactis subsp. lactis inhibits the cytotoxic effect of Clostridium difficile in vitro.

    PubMed

    Bolla, Patricia Araceli; Carasi, Paula; Serradell, María de los Angeles; De Antoni, Graciela Liliana

    2013-02-01

    Kefir is a dairy product obtained by fermentation of milk with a complex microbial population and several health-promoting properties have been attributed to its consumption. In this work, we tested the ability of different kefir-isolated bacterial and yeast strains (Lactobacillus kefir, Lb. plantarum, Lactococcus lactis subps. lactis, Saccharomyces cerevisiae and Kluyveromyces marxianus) or a mixture of them (MM) to antagonise the cytopathic effect of toxins from Clostridium difficile (TcdA and TcdB). Cell detachment assays and F-actin network staining using Vero cell line were performed. Although incubation with microbial cells did not reduce the damage induced by C. difficile spent culture supernatant (SCS), Lc. lactis CIDCA 8221 and MM supernatants were able to inhibit the cytotoxicity of SCS to Vero cells. Fraction of Lc. lactis CIDCA 8221 supernatant containing components higher than 10 kDa were responsible for the inhibitory activity and heating of this fraction for 15 min at 100 °C completely abrogated this ability. By dot-blot assay with anti-TcdA or anti-TcdB antibodies, concentration of both toxins seems to be reduced in SCS treated with Lc. lactis CIDCA 8221 supernatant. However, protective effect was not affected by treatment with proteases or proteases-inhibitors tested. In conclusion, we demonstrated that kefir-isolated Lc. lactis CIDCA 8221 secreted heat-sensitive products able to protect eukaryotic cells from cytopathic effect of C. difficile toxins in vitro. Our findings provide new insights into the probiotic action of microorganisms isolated from kefir against virulence factors from intestinal pathogens. PMID:23217732

  16. A Deficiency in Aspartate Biosynthesis in Lactococcus lactis subsp. lactis C2 Causes Slow Milk Coagulation†

    PubMed Central

    Wang, Hua; Yu, Weizhu; Coolbear, Tim; O’Sullivan, Dan; McKay, Larry L.

    1998-01-01

    A mutant of fast milk-coagulating (Fmc+) Lactococcus lactis subsp. lactis C2, designated L. lactis KB4, was identified. Although possessing the known components essential for utilizing casein as a nitrogen source, which include functional proteinase (PrtP) activity and oligopeptide, di- and tripeptide, and amino acid transport systems, KB4 exhibited a slow milk coagulation (Fmc−) phenotype. When the amino acid requirements of L. lactis C2 were compared with those of KB4 by use of a chemically defined medium, it was found that KB4 was unable to grow in the absence of aspartic acid. This aspartic acid requirement could also be met by aspartate-containing peptides. The addition of aspartic acid to milk restored the Fmc+ phenotype of KB4. KB4 was found to be defective in pyruvate carboxylase and thus was deficient in the ability to form oxaloacetate and hence aspartic acid from pyruvate and carbon dioxide. The results suggest that when lactococci are propagated in milk, aspartate derived from casein is unable to meet fully the nutritional demands of the lactococci, and they become dependent upon aspartate biosynthesis. PMID:9572935

  17. Detection and Viability of Lactococcus lactis throughout Cheese Ripening

    PubMed Central

    Cocolin, Luca

    2014-01-01

    Recent evidences highlighted the presence of Lactococcus lactis during late cheese ripening. For this reason, the role of this microorganism, well known as dairy starter, should be reconsidered throughout cheese manufacturing and ripening. Thus, the main objective of this study was to develop a RT-qPCR protocol for the detection, quantification and determination of the viability of L. lactis in ripened cheese samples by direct analysis of microbial nucleic acids. Standard curves were constructed for the specific quantification of L. lactis in cheese matrices and good results in terms of selectivity, correlation coefficient and efficiency were obtained. Thirty-three ripened cheeses were analyzed and, on the basis of RNA analysis, twelve samples showed 106 to 108 CFU of L. lactis per gram of product, thirteen from 103 to 105 CFU/g, and in eight cheeses, L. lactis was not detected. Traditional plating on M17 medium led to loads ranging from 105 to 109 CFU/g, including the cheese samples where no L. lactis was found by RT-qPCR. From these cheeses, none of the colonies isolated on M17 medium was identified as L. lactis species. These data could be interpreted as a lack of selectivity of M17 medium where colony growth is not always related to lactococcal species. At the same time, the absence or low abundance of L. lactis isolates on M17 medium from cheese where L. lactis was detected by RT-qPCR support the hypothesis that L. lactis starter populations are mainly present in viable but not culturable state during ripening and, for this reason, culture-dependent methods have to be supplemented with direct analysis of cheese. PMID:25503474

  18. Mineral nutrition of Aerobacter aerogenes for valine production in a synthetic medium.

    PubMed

    Mukhopadhyay, A K; Majumdar, S K

    1985-01-01

    The effect of a number of mineral salts, like dipotassium hydrogen phosphate, magnesium sulphate, and sodium chloride, and of some trace elements including iron, copper, cobalt, nickel, molybdenum, and calcium, on the production of valine by Aerobacter aerogenes in a synthetic medium was investigated. It was found that all the mineral salts were necessary for valine formation. Among the trace elements, iron and molybdenum were found to be necessary in minute concentrations for the optimum yield of the amino acid, while all the others had an adverse effect on valine production, even at lower levels. PMID:4013530

  19. Effect of Several Clay Minerals and Humic Acid on the Survival of Klebsiella aerogenes Exposed to Ultraviolet Irradiation1

    PubMed Central

    Bitton, Gabriel; Henis, Y.; Lahav, N.

    1972-01-01

    The effect of various clay minerals and humic acid on the survival of Klebsiella aerogenes exposed to ultraviolet (UV) irradiation was investigated. A protective effect was observed and found to depend on the specific light absorption and light scattering properties of the clay minerals and the humic acid used. The higher the specific absorption, the better was the survival of K. aerogenes after UV irradiation. Bacterial survival was lower in clays saturated with divalent cations (Ca, Zn) than in those homoionic to monovalent cations (K). PMID:5031559

  20. Phage-induced fucosidases hydrolysing the exopolysaccharide of Klebsiella aerogenes type 54[A3(S1)

    PubMed Central

    Sutherland, I. W.

    1967-01-01

    Several strains of bacteriophage have been isolated that induce the formation of a polysaccharide hydrolase after infection of Klebsiella aerogenes type 54 [A3(S1)]. The action of this enzyme on polysaccharide solutions was to decrease their viscosity and increase their reducing value. These effects were associated with the release of two oligosaccharides (O1 and O2) from the polysaccharide. These two substances are not identical with any of the four oligosaccharides isolated from autohydrolysates. The two enzymically isolated fractions have been tentatively identified as tetrasaccharides, and oligosaccharide O2 is probably an acetylated version of oligosaccharide O1. This latter oligosaccharide differs in some way, still unknown, from the tetrasaccharide cellobiosylglucuronosylfucose found in acid hydrolysates of the slime polysaccharide. The enzyme is limited in its activity to the polysaccharide excreted by the A3 strain of K. aerogenes type 54 or by similar strains. It is also active on the polysaccharides altered by acid or alkaline treatment. The enzyme has optimum activity at pH6·5. A study of the products released by enzyme action has shown it to be a fucosidase splitting the fucosylglucose linkages found in the intact polysaccharide. PMID:6035518

  1. Purification and antibiofilm activity of AHL-lactonase from endophytic Enterobacter aerogenes VT66.

    PubMed

    Rajesh, P S; Rai, V Ravishankar

    2015-11-01

    The opportunistic pathogen Pseudomonas aeruginosa uses biofilm lifestyle to resist antibiotic treatment. In our study, endophytic bacterium Enterobacter aerogenes VT66 quenched the N-acyl homoserine lactone (AHL) molecules produced by P. aeruginosa PAO1. The quorum quenching activity was attributed to the presence of AHL-lactonase. The AHL-lactonase was purified using column chromatography and purified AHL-lactonase was applied for the control of biofilm formation in P. aeruginosa PAO1. The results showed that purified AHL-lactonase obtained with a molecular weight about 30kDa was able to inhibit more than 70% of biofilm in P. aeruginosa PAO1 (P<0.001). Antibiofilm activity of AHL-lactonase was correlated well with results from staining technique used to determine inhibition of biomass and viable cell activity. Therefore, results unambiguously confirm that the AHL-lactonase from E. aerogenes VT66 could be used as antibiofilm therapeutics in P. aeruginosa associated biomedical applications. PMID:26432367

  2. Study of the role of anaerobic metabolism in succinate production by Enterobacter aerogenes.

    PubMed

    Tajima, Yoshinori; Kaida, Kenichi; Hayakawa, Atsushi; Fukui, Keita; Nishio, Yousuke; Hashiguchi, Kenichi; Fudou, Ryosuke; Matsui, Kazuhiko; Usuda, Yoshihiro; Sode, Koji

    2014-09-01

    Succinate is a core biochemical building block; optimizing succinate production from biomass by microbial fermentation is a focus of basic and applied biotechnology research. Lowering pH in anaerobic succinate fermentation culture is a cost-effective and environmentally friendly approach to reducing the use of sub-raw materials such as alkali, which are needed for neutralization. To evaluate the potential of bacteria-based succinate fermentation under weak acidic (pH <6.2) and anaerobic conditions, we characterized the anaerobic metabolism of Enterobacter aerogenes AJ110637, which rapidly assimilates glucose at pH 5.0. Based on the profile of anaerobic products, we constructed single-gene knockout mutants to eliminate the main anaerobic metabolic pathways involved in NADH re-oxidation. These single-gene knockout studies showed that the ethanol synthesis pathway serves as the dominant NADH re-oxidation pathway in this organism. To generate a metabolically engineered strain for succinate production, we eliminated ethanol formation and introduced a heterogeneous carboxylation enzyme, yielding E. aerogenes strain ?adhE/PCK. The strain produced succinate from glucose with a 60.5% yield (grams of succinate produced per gram of glucose consumed) at pH <6.2 and anaerobic conditions. Thus, we showed the potential of bacteria-based succinate fermentation under weak acidic conditions. PMID:24962116

  3. Effect of nanocomposite packaging containing ZnO on growth of Bacillus subtilis and Enterobacter aerogenes.

    PubMed

    Esmailzadeh, Hakimeh; Sangpour, Parvaneh; Shahraz, Farzaneh; Hejazi, Jalal; Khaksar, Ramin

    2016-01-01

    Recent advances in nanotechnology have opened new windows in active food packaging. Nano-sized ZnO is an inexpensive material with potential antimicrobial properties. The aim of the present study is to evaluate the antibacterial effect of low density Polyethylene (LDPE) containing ZnO nanoparticles on Bacillus subtilis and Enterobacter aerogenes. ZnO nanoparticles have been synthesized by facil molten salt method and have been characterized by X-ray diffraction (XRD), and scanning electron microscopy (SEM). Nanocomposite films containing 2 and 4 wt.% ZnO nanoparticles were prepared by melt mixing in a twin-screw extruder. The growth of both microorganisms has decreased in the presence of ZnO containing nanocomposites compared with controls. Nanocomposites with 4 wt.% ZnO nanoparticles had stronger antibacterial effect against both bacteria in comparison with the 2 wt.% ZnO containing nanocomposites. B. subtilis as Gram-positive bacteria were more sensitive to ZnO containing nanocomposite films compared with E. aerogenes as Gram-negative bacteria. There were no significant differences between the migration of Zn ions from 2 and 4 wt.% ZnO containing nanocomposites and the released Zn ions were not significantly increased in both groups after 14 days compared with the first. Regarding the considerable antibacterial effects of ZnO nanoparticles, their application in active food packaging can be a suitable solution for extending the shelf life of food. PMID:26478403

  4. Studies of the Acetate Kinase-Phosphotransacetylase and the Butanediol-Forming Systems in Aerobacter aerogenes

    PubMed Central

    Brown, T. D. K.; Pereira, C. R. S.; Størmer, F. C.

    1972-01-01

    Mutants of Aerobacter aerogenes devoid of acetate kinase and phosphotransacetylase activities were isolated by selection for resistance to fluoroacetate on lactate medium. The mutants were used to study the role of the acetate kinase-phosphotransacetylase system in growth on acetate and glucose. Acetate kinase-negative and phosphotransacetylase-negative mutants were unable to grow on acetate minimal medium. Their growth rates on glucose minimal medium were identical with that of the parent strain under aerobic conditions, but lower growth rates were observed in the mutant strains during anaerobic growth on glucose medium. The mutants were unable to incorporate [2-14C]-acetate rapidly while growing on glycerol. Variations in acetate kinase and phosphotransacetylase levels during growth on glucose were studied. The specific activities of the enzymes increased approximately fivefold during aerobic growth on glucose in batch culture. The enzyme levels were also studied during anaerobic growth on glucose at constant pH (pH 5.8 and 7.0). Smaller increases in specific activities were found under these conditions. The role of acetate in the induction of the diacetyl (acetoin) reductase was investigated using a mutant deficient in both acetate kinase and phosphotransacetylase. The effect of pH on the induction of this enzyme during growth on glucose under anaerobic conditions was tested. The data support the idea that free acetic acid is the inducer for the enzymes of the butanediol-forming pathway in A. aerogenes. PMID:4640502

  5. Requirement for sodium in the anaerobic growth of Aerobacter aerogenes on citrate.

    PubMed

    O'Brien, R W; Stern, J R

    1969-05-01

    Anaerobic growth of Aerobacter aerogenes on citrate as a carbon source required the presence of Na(+). The growth rate increased with increasing Na(+) concentration and was optimal at 0.10 m Na(+). The requirement was specific for Na(+), which could not be replaced by K(+), NH(4) (+), Li(+), Rb(+), or Cs(+). K(+) was required for growth in the presence of Na(+), the optimal K(+) concentration being 0.15 mm. Enzyme profiles were determined on cells grown in three different media: (i) intermediate Na(+), high K(+) concentration, (ii) high Na(+), high K(+) concentration, and (c) high Na(+), low K(+) concentration. All cells contained the enzymes of the citrate fermentation pathway, namely, citritase and the Na(+)-requiring oxalacetate (OAA) decarboxylase. All of the enzymes of the citric acid cycle were present, except alpha-ketoglutarate dehydrogenase which could not be detected. The incomplete citric acid cycle was, in effect, converted into two biosynthetic pathways leading to glutamate and succinate, respectively. The specific activities of citritase and OAA decarboxylase were lowest in medium (i), and under these conditions the activity of OAA decarboxylase appeared to be limited in vivo by the availability of Na(+). Failure of A. aerogenes to grow anaerobically on citrate in the absence of Na(+) can be explained at the enzymatic level by the Na(+) requirement of the OAA decarboxylase step of the citrate fermentation pathway and by the absence of an alternate pathway of citrate catabolism. PMID:5784198

  6. Histamine production by Enterobacter aerogenes in sailfish and milkfish at various storage temperatures.

    PubMed

    Tsai, Yung-Hsiang; Chang, Shiou-Chung; Kung, Hsien-Feng; Wei, Cheng-I; Hwang, Deng-Fwu

    2005-08-01

    Enterobacter aerogenes was studied for its growth and ability to promote the formation of total volatile base nitrogen (TVBN) and histamine in sailfish (Istiophorus platypterus) and milkfish (Chanos chanos) stored at various temperatures from -20 to 37 degrees C. The optimal temperature for bacterial growth in both fish species was 25 degrees C, whereas the optimal temperature for histamine formation was 37 degrees C. The two fish species inoculated with E. aerogenes, when not properly stored at low temperatures such as 15 degrees C for 36 h, formed histamine at above the U.S. Food and Drug Administration hazardous guideline level of 50 mg/100 g. Milkfish was a better substrate than sailfish for histamine formation by bacterial histidine decarboxylation at elevated temperatures (> 15 degrees C). Although higher contents of TVBN were detected in the spiked sailfish than milkfish during the same storage time at temperatures above 15 degrees C, the use of the 30-mg/100 g level of TVBN as a determination index for fish quality and decomposition was not a good criterion for assessing potential histamine hazard for both fish species. Bacterial growth was controlled by cold storage of the fish at 4 degrees C or below, but histamine formation was stopped only by frozen storage. Once the frozen fish samples were thawed and stored at 25 degrees C, histamine started to accumulate rapidly and reached levels greater than the hazardous action level in 36 h. PMID:21132980

  7. Ornithine transport and exchange in Streptococcus lactis

    SciTech Connect

    Thompson, J.

    1987-09-01

    Resting cells of Streptococcus lactis 133 appeared to accumulate (/sup 14/C)ornithine to a high concentration in the absence of an exogenous energy source. However, analysis of intracellular amino acid pool constituents and results of transport experiments revealed that the accumulation of ornithine represented a homoexchange between extracellular (/sup 14/C)ornithine and unlabeled ornithine in the cell. The energy-independent exchange of ornithine was not inhibited by proton-conducting uncouplers or by metabolic inhibitors. Intracellular (/sup 14/C)ornithine was retained by resting cells after suspension in a buffered medium. However, addition of unlabeled ornithine to the suspension elicited rapid exit of labeled amino acid. The initial rate of exist of (/sup 14/C)ornithine was dependent on the concentration of unlabeled ornithine in the medium, but this accelerative exchange diffusion process caused no net loss of amino acid. By contrast, the presence of a fermentable energy source caused a rapid expulsion of and new decrease in the concentration of intracellular ornithine. Kinetic analyses of amino acid transport demonstrated competitive inhibition between lysine and ornithine, and data obtained by two-dimensional thin-layer chromatography established the heteroexchange of these basic amino acids. The effects of amino acids and of ornithine analogs on both entry and exit of (/sup 14/C)ornithine have been examined. The data suggest that common carrier mediates the entry and exchange of lysine, arginine, and ornithine in cells of S. lactis.

  8. Rewiring Lactococcus lactis for Ethanol Production

    PubMed Central

    Dehli, Tore; Jensen, Peter Ruhdal

    2013-01-01

    Lactic acid bacteria (LAB) are known for their high tolerance toward organic acids and alcohols (R. S. Gold, M. M. Meagher, R. Hutkins, and T. Conway, J. Ind. Microbiol. 10:45–54, 1992) and could potentially serve as platform organisms for production of these compounds. In this study, we attempted to redirect the metabolism of LAB model organism Lactococcus lactis toward ethanol production. Codon-optimized Zymomonas mobilis pyruvate decarboxylase (PDC) was introduced and expressed from synthetic promoters in different strain backgrounds. In the wild-type L. lactis strain MG1363 growing on glucose, only small amounts of ethanol were obtained after introducing PDC, probably due to a low native alcohol dehydrogenase activity. When the same strains were grown on maltose, ethanol was the major product and lesser amounts of lactate, formate, and acetate were formed. Inactivating the lactate dehydrogenase genes ldhX, ldhB, and ldh and introducing codon-optimized Z. mobilis alcohol dehydrogenase (ADHB) in addition to PDC resulted in high-yield ethanol formation when strains were grown on glucose, with only minor amounts of by-products formed. Finally, a strain with ethanol as the sole observed fermentation product was obtained by further inactivating the phosphotransacetylase (PTA) and the native alcohol dehydrogenase (ADHE). PMID:23377945

  9. Lactococcus lactis-based vaccines: current status and future perspectives.

    PubMed

    Bahey-El-Din, Mohammed; Gahan, Cormac G M

    2011-01-01

    Lactococcus lactis offers significant potential as a platform for the delivery of vaccines especially via mucosal routes of administration. The organism has an established history of safe use in the food industry and is highly amenable to genetic manipulation, with many systems available for efficient production of secreted and surface-expressed proteins. Here we describe the benefits of using this organism as a vaccine delivery platform and outline how L. lactis based antigen delivery may be improved. Finally we discuss the safe use of L. lactis vectors and outline the potential for use of biological containment systems and killed lactococcal preparations. PMID:21263226

  10. Cutaneous abscess caused by Corynebacterium lactis in a companion dog.

    PubMed

    Antunes, João Marcelo Azevedo de Paula; Ribeiro, Márcio Garcia; Demoner, Larissa de Castro; Ramos, Juliana Nunes; Baio, Paulo Victor Pereira; Simpson-Louredo, Liliane; Santos, Cíntia Silva; Hirata, Raphael; Ferioli, Raquel Beneton; Romera, Adriana Resmond Cruz; Vieira, Verônica Viana; Mattos-Guaraldi, Ana Luíza

    2015-07-01

    Many new, emerging and re-emerging diseases of humans are caused by pathogens which originate from animals or products of animal origin. Corynebacterium lactis, a recently described species of the genus Corynebacterium, was first isolated from milk of asymptomatic cows. In the present study a cutaneous abscess caused by C. lactis in a dog was recognized by cytologic and histologic examination in addition to 16S rRNA gene analysis of the microorganism. Therefore, C. lactis should be included among other bacterial species recognized as emerging pathogens for companion animals. PMID:25937144

  11. A lactose fermentation product produced by Lactococcus lactis subsp. lactis, acetate, inhibits the motility of flagellated pathogenic bacteria.

    PubMed

    Nakamura, Shuichi; Morimoto, Yusuke V; Kudo, Seishi

    2015-04-01

    Many strains of lactic acid bacteria have been used for the production of probiotics. Some metabolites produced by lactic acid bacteria impair the motilities of pathogenic bacteria. Because bacterial motility is strongly associated with virulence, the metabolic activities of lactic acid bacteria are effective for suppressing bacterial infections. Here we show that lactose fermentation by Lactococcus lactis subsp. lactis inhibits the motility of Salmonella enterica serovar Typhimurium. A single-cell tracking and rotation assay for a single flagellum showed that the swimming behaviour of Salmonella was severely but transiently impaired through disruption of flagellar rotation on exposure to media cultivated with Lac. lactis. Using a pH-sensitive fluorescent protein, we observed that the intracellular pH of Salmonella was decreased because of some fermentation products of Lac. lactis. We identified acetate as the lactose fermentation product of Lac. lactis triggering the paralysis of Salmonella flagella. The motilities of Pseudomonas, Vibrio and Leptospira strains were also severely disrupted by lactose utilization by Lac. lactis. These results highlight the potential use of Lac. lactis for preventing infections by multiple bacterial species. PMID:25573770

  12. Antioxidant activity of phosphorylated exopolysaccharide produced by Lactococcus lactis subsp. lactis.

    PubMed

    Guo, Yuxing; Pan, Daodong; Sun, Yangying; Xin, Lingying; Li, Hua; Zeng, Xiaoqun

    2013-09-12

    Exopolysaccharide (EPS) of Lactococcus lactis subsp. lactis was isolated and purified from MRS culture broth. Phosphorylated exopolysaccharide (P-EPS) was synthesized by using the purified EPS and sodium hexametaphosphate (SHMP). The in vitro and in vivo antioxidant activity of EPS and P-EPS was analyzed. Both EPS and P-EPS displayed superoxide anion (O(2-•)), hydroxyl radical (OH•) and DPPH scavenging activity. Catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activity increased in serum and the livers of mice treated with EPS and P-EPS, while malondialdehyde (MDA) levels decreased. P-EPS was shown to prevent the progression of D-galactose-induced oxidative stress in hepatocytes in vivo. P-EPS showed stronger in vitro and in vivo antioxidant activity than EPS. PMID:23911523

  13. Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar diacetylactis and expression in Escherichia coli.

    PubMed

    Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D

    1990-07-01

    The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. PMID:2117878

  14. Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar diacetylactis and expression in Escherichia coli.

    PubMed Central

    Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D

    1990-01-01

    The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2117878

  15. BactPepDB: a database of predicted peptides from a exhaustive survey of complete prokaryote genomes

    PubMed Central

    Rey, Julien; Deschavanne, Patrick; Tuffery, Pierre

    2014-01-01

    With the recent progress in complete genome sequencing, mining the increasing amount of genomic information available should in theory provide the means to discover new classes of peptides. However, annotation pipelines often do not consider small reading frames likely to be expressed. BactPepDB, available online at http://bactpepdb.rpbs.univ-paris-diderot.fr, is a database that aims at providing an exhaustive re-annotation of all complete prokaryotic genomes—chromosomal and plasmid DNA—available in RefSeq for coding sequences ranging between 10 and 80 amino acids. The identified peptides are classified as (i) previously identified in RefSeq, (ii) entity-overlapping (intragenic) or intergenic, and (iii) potential pseudogenes—intergenic sequences corresponding to a portion of a previously annotated larger gene. Additional information is related to homologs within order, predicted signal sequence, transmembrane segments, disulfide bonds, secondary structure, and the existence of a related 3D structure in the Protein Databank. As a result, BactPepDB provides insights about candidate peptides, and provides information about their conservation, together with some of their expected biological/structural features. The BactPepDB interface allows to search for candidate peptides in the database, or to search for peptides similar to a query, according to the multiple properties predicted or related to genomic localization. Database URL: http://www.yeastgenome.org/ PMID:25377257

  16. DNA Macroarray Profiling of Lactococcus lactis subsp. lactis IL1403 Gene Expression during Environmental Stresses†

    PubMed Central

    Xie, Yi; Chou, Lan-szu; Cutler, Adele; Weimer, Bart

    2004-01-01

    This report describes the use of an oligonucleotide macroarray to profile the expression of 375 genes in Lactococcus lactis subsp. lactis IL1403 during heat, acid, and osmotic stress. A set of known stress-associated genes in IL1403 was used as the internal control on the array. Every stress response was accurately detected using the macroarray, compared to data from previous reports. As a group, the expression patterns of the investigated metabolic genes were significantly altered by heat, acid, and osmotic stresses. Specifically, 13 to 18% of the investigated genes were differentially expressed in each of the environmental stress treatments. Interestingly, the methionine biosynthesis pathway genes (metA-metB1 and metB2-cysK) were induced during heat shock, but methionine utilization genes, such as metK, were induced during acid stress. These data provide a possible explanation for the differences between acid tolerance mechanisms of L. lactis strains IL1403 and MG1363 reported previously. Several groups of transcriptional responses were common among the stress treatments, such as repression of peptide transporter genes, including the opt operon (also known as dpp) and dtpT. Reduction of peptide transport due to environmental stress will have important implications in the cheese ripening process. Although stress responses in lactococci were extensively studied during the last decade, additional information about this bacterium was gained from the use of this metabolic array. PMID:15528540

  17. Characterization of PaxA and Its Operon: a Cohemolytic RTX Toxin Determinant from Pathogenic Pasteurella aerogenes

    PubMed Central

    Kuhnert, Peter; Heyberger-Meyer, Bénédicte; Nicolet, Jacques; Frey, Joachim

    2000-01-01

    Pasteurella aerogenes is known as a commensal bacterium or as an opportunistic pathogen, as well as a primary pathogen found to be involved in abortion cases of humans, swine, and other mammals. Using broad-range DNA probes for bacterial RTX toxin genes, we cloned and subsequently sequenced a new operon named paxCABD encoding the RTX toxin PaxA in P. aerogenes. The pax operon is organized analogous to the classical RTX operons containing the activator gene paxC upstream of the structural toxin gene paxA, which is followed by the secretion protein genes paxB and paxD. The highest sequence similarity of paxA with known RTX toxin genes is found with apxIIIA (82%). PaxA is structurally similar to ApxIIIA and also shows functional analogy to ApxIIIA, since it shows cohemolytic activity with the sphingomyelinase of Staphylococcus aureus, known as the CAMP effect, but is devoid of direct hemolytic activity. In addition, it shows to some extent immunological cross-reactions with ApxIIIA. P. aerogenes isolated from various specimens showed that the pax operon was present in about one-third of the strains. All of the pax-positive strains were specifically related to swine abortion cases or septicemia of newborn piglets. These strains were also shown to produce the PaxA toxin as determined by the CAMP phenomenon, whereas none of the pax-negative strains did. This indicated that the PaxA toxin is involved in the pathogenic potential of P. aerogenes. The examined P. aerogenes isolates were phylogenetically analyzed by 16S rRNA gene (rrs) sequencing in order to confirm their species. Only a small heterogeneity (<0.5%) was observed between the rrs genes of the strains originating from geographically distant farms and isolated at different times. PMID:10603361

  18. Secretion of Streptomyces tendae antifungal protein 1 by Lactococcus lactis.

    PubMed

    Freitas, D A; Leclerc, S; Miyoshi, A; Oliveira, S C; Sommer, P S M; Rodrigues, L; Correa Junior, A; Gautier, M; Langella, P; Azevedo, V A; Le Loir, Y

    2005-11-01

    Lactococcus lactis, the model lactic acid bacterium, is a good candidate for heterologous protein production in both foodstuffs and the digestive tract. We attempted to produce Streptomyces tendae antifungal protein 1 (Afp1) in L. lactis with the objective of constructing a strain able to limit fungal growth. Since Afp1 activity requires disulfide bond (DSB) formation and since intracellular redox conditions are reportedly unfavorable for DSB formation in prokaryotes, Afp1 was produced as a secreted form. An inducible expression-secretion system was used to drive Afp1 secretion by L. lactis; Afp1 was fused or not with LEISSTCDA, a synthetic propeptide (LEISS) that has been described to be a secretion enhancer. Production of Afp1 alone was not achieved, but production of LEISS-Afp1 was confirmed by Western blot and immunodetection with anti-Afp1 antibodies. This protein (molecular mass: 9.8 kDa) is the smallest non-bacteriocin heterologous protein ever reported to be secreted in L. lactis via the Sec-dependent pathway. However, no anti-fungal activity was detected, even in concentrated samples of induced supernatant. This could be due to a too low secretion yield of Afp1 in L. lactis, to the absence of DSB formation, or to an improper DSB formation involving the additional cysteine residue included in LEISS propeptide. This raises questions about size limits, conformation problems, and protein secretion yields in L. lactis. PMID:16258626

  19. Cloning and characterization of a tryptophanase gene from Enterobacter aerogenes SM-18.

    PubMed

    Kawasaki, K; Yokota, A; Oita, S; Kobayashi, C; Yoshikawa, S; Kawamoto, S; Takao, S; Tomita, F

    1993-12-01

    A tryptophanase gene from Enterobacter aerogenes SM-18 was cloned and sequenced. The structural gene for tryptophanase, tnaA, consisted of 1389 bp encoding 462 amino acid residues, and its nucleotide sequence and deduced amino acid sequence showed significant homology to those of tnaA from Escherichia coli K12. A short open reading frame consisting of 31 amino acid residues was found upstream of tnaA, and it showed some similarity to the E. coli tnaC gene known to be a cis-acting regulatory element for transcription. A partial open reading frame homologous to the 5' end of E. coli tnaB was observed at the 3'-flanking region of tnaA. These genes may thus constitute an operon as in E. coli. PMID:7510326

  20. Polygalacturonase production by calcium alginate immobilized Enterobacter aerogenes NBO2 cells.

    PubMed

    Darah, I; Nisha, M; Lim, Sheh-Hong

    2015-03-01

    Bacterial cells of Enterobacter aerogenes NBO2 were entrapped in calcium alginate beads in order to enhance polygalacturonase production compared to free cells. The optimized condition of 5 % (w/v) sodium alginate concentration, agitation speed of 250 rpm, and 15 beads of calcium alginate with inoculum size of 4 % (v/v; 5.4 × 10(7) cells/ml) produced 23.48 U/mL of polygalacturonase compared to free cells of 18.54 U/ml. There was about 26.6 % increment in polygalaturonase production. However, in this study, there was 296.6 % of increment in polygalacturonase production after improvement parameters compared to before improvement parameters of calcium alginate bead immobilization cells (5.92 U/ml). This research has indicated that optimized physical parameters of calcium alginate bead immobilization cells have significantly enhanced the production of polygalacturonase. PMID:25547814

  1. Effect of oxygen supply on growth of Klebsiella aerogenes in a multistage tower fermentor.

    PubMed

    Páca, J

    1978-01-01

    The effect of the rate of oxygen supply on biomass growth, consumption of carbon source formation of metabolic by-products, biomass yeilds referred to C-source and oxygen, respiration rate and the respiratory quotient was studied in a multistage tower fermentor with an interstage backflow, i.e. with a continuous reinoculation of the preceding stages. Experiments were done with Klebsiella aerogenes CCM 2318 in a synthetic glucose medium with constant glucose concentration in the feed, at pH 7.0. temperature 30 degrees C, and dilution rates 0.6 and 0.178 h-1 (referred to one stage). Different behavior of the culture was found at different dilution rates both with oxygen and under oxygen limitation. As compared with the chemostat system, the regime with an interstage backflow exhibited differences in respiration rate and CO2 formation; this attests to a considerably different physiological state of the cells. PMID:348585

  2. Irreproducible and Uninterpretable Polymyxin B MICs for Enterobacter cloacae and Enterobacter aerogenes

    PubMed Central

    Landman, David; Salamera, Julius

    2013-01-01

    Carbapenem-resistant Enterobacter species are emerging nosocomial pathogens. As with most multidrug-resistant Gram-negative pathogens, the polymyxins are often the only therapeutic option. In this study involving clinical isolates of E. cloacae and E. aerogenes, susceptibility testing methods with polymyxin B were analyzed. All isolates underwent testing by the broth microdilution (in duplicate) and agar dilution (in duplicate) methods, and select isolates were examined by the Etest method. Selected isolates were also examined for heteroresistance by population analysis profiling. Using a susceptibility breakpoint of ?2 ?g/ml, categorical agreement by all four dilution tests (two broth microdilution and two agar dilution) was achieved in only 76/114 (67%) of E. cloacae isolates (65 susceptible, 11 resistant). Thirty-eight (33%) had either conflicting or uninterpretable results (multiple skip wells, i.e., wells that exhibit no growth although growth does occur at higher concentrations). Of the 11 consistently resistant isolates, five had susceptible MICs as determined by Etest. Heteroresistant subpopulations were detected in eight of eight isolates tested, with greater percentages in isolates with uninterpretable MICs. For E. aerogenes, categorical agreement between the four dilution tests was obtained in 48/56 (86%), with conflicting and/or uninterpretable results in 8/56 (14%). For polymyxin susceptibility testing of Enterobacter species, close attention must be paid to the presence of multiple skip wells, leading to uninterpretable results. Susceptibility also should not be assumed based on the results of a single test. Until the clinical relevance of skip wells is defined, interpretation of polymyxin susceptibility tests for Enterobacter species should be undertaken with extreme caution. PMID:24088860

  3. Irreproducible and uninterpretable Polymyxin B MICs for Enterobacter cloacae and Enterobacter aerogenes.

    PubMed

    Landman, David; Salamera, Julius; Quale, John

    2013-12-01

    Carbapenem-resistant Enterobacter species are emerging nosocomial pathogens. As with most multidrug-resistant Gram-negative pathogens, the polymyxins are often the only therapeutic option. In this study involving clinical isolates of E. cloacae and E. aerogenes, susceptibility testing methods with polymyxin B were analyzed. All isolates underwent testing by the broth microdilution (in duplicate) and agar dilution (in duplicate) methods, and select isolates were examined by the Etest method. Selected isolates were also examined for heteroresistance by population analysis profiling. Using a susceptibility breakpoint of ?2 ?g/ml, categorical agreement by all four dilution tests (two broth microdilution and two agar dilution) was achieved in only 76/114 (67%) of E. cloacae isolates (65 susceptible, 11 resistant). Thirty-eight (33%) had either conflicting or uninterpretable results (multiple skip wells, i.e., wells that exhibit no growth although growth does occur at higher concentrations). Of the 11 consistently resistant isolates, five had susceptible MICs as determined by Etest. Heteroresistant subpopulations were detected in eight of eight isolates tested, with greater percentages in isolates with uninterpretable MICs. For E. aerogenes, categorical agreement between the four dilution tests was obtained in 48/56 (86%), with conflicting and/or uninterpretable results in 8/56 (14%). For polymyxin susceptibility testing of Enterobacter species, close attention must be paid to the presence of multiple skip wells, leading to uninterpretable results. Susceptibility also should not be assumed based on the results of a single test. Until the clinical relevance of skip wells is defined, interpretation of polymyxin susceptibility tests for Enterobacter species should be undertaken with extreme caution. PMID:24088860

  4. Biosensing and bioremediation of Cr(VI) by cell free extract of Enterobacter aerogenes T2.

    PubMed

    Panda, Jigisha; Sarkar, Priyabrata

    2014-01-01

    Hexavalent chromium or Cr(VI) enters the environment through several anthropogenic activities and it is highly toxic and carcinogenic. Hence it is required to be detected and remediated from the environment. In this study, low-cost and environment-friendly methods of biosensing and bioremediation of Cr(VI) have been proposed. Crude cell free extract (CFE) of previously isolated Enterobacter aerogenes T2 (GU265554; NII 1111) was prepared and exploited to develop a stable biosensor for direct estimation of Cr(VI) in waste water, by using three electrodes via cyclic voltammetry. For bioremediation studies, a homogeneous solution of commercially available sodium alginate and CFE was added dropwise in a continuously stirred calcium chloride solution. Biologically modified calcium alginate beads were produced and these were further utilized for bioremediation studies. The proposed sensor showed linear response in the range of 10-40 μg L(-1) Cr(VI) and the limit of detection was found to be 6.6 μg L(-1) Cr(VI). No interference was observed in presence of metal ions, e.g., lead, cadmium, arsenic, tin etc., except for insignificant interference with molybdenum and manganese. In bioremediation studies, modified calcium alginate beads showed encouraging removal rate 900 mg Cr(VI)/m(3) water per day with a removal efficiency of 90%, much above than reported in literature. The proposed sensing system could be a viable alternative to costly measurement procedures. Calcium alginate beads, modified with CFE of E. aerogenes, could be used in bioremediation of Cr(VI) since it could work in real conditions with extraordinarily high capacity. PMID:24410691

  5. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies are available from the National Academy Press, 2101... bacterium Lactococcus lactis (previously named Streptococcus lactis). The preparation contains the...

  6. Lignes directrices canadiennes sur la rhinosinusite bactérienne aiguë

    PubMed Central

    Kaplan, Alan

    2014-01-01

    Résumé Objectif Faire un résumé clinique des lignes directrices canadiennes sur la rhinosinusite bactérienne aiguë (RSBA) qui présente des éléments d’intérêt pour les médecins de famille. Source des données Les auteurs des lignes directrices ont effectué une recherche documentaire systématique et ont rédigé des recommandations. Une cote a été donnée à la fois en fonction de la fiabilité des données probantes et de la solidité des recommandations. On a sollicité les commentaires d’experts en la matière venant de l’extérieur, ainsi que l’aval de sociétés médicales canadiennes (Association pour la microbiologie médicale et l’infectiologie Canada, Société canadienne d’allergie et d’immunologie clinique, Société canadienne d’otorhinolaryngologie et de chirurgie cervicofaciale, Association canadienne des médecins d’urgence et Regroupement canadien des médecins de famille en santé respiratoire). Message principal Le diagnostic de la RSBA repose sur la présence de symptômes particuliers et leur durée; l’imagerie ou une culture n’est pas nécessaire dans les cas peu compliqués. Le traitement dépend de la gravité des symptômes, notamment avec des corticostéroïdes intranasaux (CSIN) recommandés comme monothérapie pour les cas de légers à modérés, quoique leurs bienfaits soient modestes. Le recours à des CSIN accompagnés d’antibiotiques est réservé aux patients qui ne répondent pas aux CSIN après 72 heures et comme traitement initial des patients dont les symptômes sont graves. Le choix de l’antibiotique doit tenir compte du pathogène soupçonné, du risque de résistance, des problèmes concomitants et des tendances locales de la résistance aux antimicrobiens. Des thérapies d’appoint comme l’irrigation nasale avec une solution saline sont recommandées. En présence de cas réfractaires au traitement, d’épisodes récurrents et de signes de complications, on devrait demander une consultation en otorhinolaryngologie. Les lignes directrices portent sur les situations particulières à l’environnement canadien des soins de santé, y compris les actions à prendre durant les périodes d’attente prolongées pour avoir une consultation avec un spécialiste ou une imagerie. Conclusion Les lignes directrices canadiennes offrent des recommandations à jour pour le diagnostic et le traitement de la RSBA qui tiennent compte de la compréhension en évolution de la maladie. De plus, les lignes directrices présentent des outils utiles pour aider les cliniciens à cerner les épisodes viraux par opposition à ceux d’origine bactérienne, ainsi qu’à prendre en charge de manière optimale leurs patients atteints de RSBA.

  7. Probiotic characterization of potential hydrolases producing Lactococcus lactis subsp. lactis isolated from pickled yam.

    PubMed

    Bhanwar, Seema; Singh, Arashdeep; Ganguli, Abhijit

    2014-02-01

    The aim of this study was to characterize potential probiotic strain co-producing ?-amylase and ?-galactosidase. Sixty-three strains, isolated from pickle samples were screened for their hydrolase producing capacity by utilizing different starches as carbon source. One out of 63 strains, isolated from traditionally fermented pickled yam showing maximum hydrolase activity (?-amylase (36.9?U/ml) and ?-galactosidase (42.6?U/ml)) within a period of 48 hours was identified as Lactococcus lactis subsp. lactis. Further, it was assessed for the probiotic characteristics under gastrointestinal conditions like acidic, alkaline, proteolytic enzymes, bile stress and found to exhibit tolerance to these stresses. The therapeutic potential of the isolate is implicated because of its antagonistic effect against enteric foodborne pathogens (Salmonella typhimurium, Escherichia coli 0157:H7, Staphylococcus aureus, Yersinia enterocolitica and Aeromonas hydrophila). The results of this study entail a potential applicability of the isolate in developing future probiotic foods besides the production of industrially significant hydrolases. PMID:24020495

  8. The Complete Genome Sequence of the Lactic Acid Bacterium Lactococcus lactis ssp. lactis IL1403

    PubMed Central

    Bolotin, Alexander; Wincker, Patrick; Mauger, Stéphane; Jaillon, Olivier; Malarme, Karine; Weissenbach, Jean; Ehrlich, S. Dusko; Sorokin, Alexei

    2001-01-01

    Lactococcus lactis is a nonpathogenic AT-rich gram-positive bacterium closely related to the genus Streptococcus and is the most commonly used cheese starter. It is also the best-characterized lactic acid bacterium. We sequenced the genome of the laboratory strain IL1403, using a novel two-step strategy that comprises diagnostic sequencing of the entire genome and a shotgun polishing step. The genome contains 2,365,589 base pairs and encodes 2310 proteins, including 293 protein-coding genes belonging to six prophages and 43 insertion sequence (IS) elements. Nonrandom distribution of IS elements indicates that the chromosome of the sequenced strain may be a product of recent recombination between two closely related genomes. A complete set of late competence genes is present, indicating the ability of L. lactis to undergo DNA transformation. Genomic sequence revealed new possibilities for fermentation pathways and for aerobic respiration. It also indicated a horizontal transfer of genetic information from Lactococcus to gram-negative enteric bacteria of Salmonella-Escherichia group. [The sequence data described in this paper has been submitted to the GenBank data library under accession no. AE005176.] PMID:11337471

  9. Draft Genome Sequence of Enterobacter aerogenes, a DDE-Degrading and Plant Growth-Promoting Strain Isolated from Cucurbita pepo

    PubMed Central

    Eevers, Nele; Van Hamme, Jonathan D.; Bottos, Eric M.; Weyens, Nele

    2015-01-01

    We report here the draft genome of Enterobacter aerogenes, a Gram-negative bacterium of the Enterobacteriaceae isolated from Cucurbita pepo root tissue. This bacterium shows 2,2-bis(p-chlorophenyl)-1,1-dichloroethylene (DDE)-degrading potential and plant growth-promoting capacity. An analysis of its 4.5-Mb draft genome will enhance the understanding of DDE degradation pathways and phytoremediation applications for DDE-contaminated soils. PMID:25883299

  10. Lactococcus lactis release from calcium alginate beads.

    PubMed Central

    Champagne, C P; Gaudy, C; Poncelet, D; Neufeld, R J

    1992-01-01

    Cell release during milk fermentation by Lactococcus lactis immobilized in calcium alginate beads was examined. Numbers of free cells in the milk gradually increased from 1 x 10(6) to 3 x 10(7) CFU/ml upon successive reutilization of the beads. Rinsing the beads between fermentations did not influence the numbers of free cells in the milk. Cell release was not affected by initial cell density within the beads or by alginate concentration, although higher acidification rates were achieved with increased cell loading. Coating alginate beads with poly-L-lysine (PLL) did not significantly reduce the release of cells during five consecutive fermentations. A double coating of PLL and alginate reduced cell release by a factor of approximately 50. However, acidification of milk with beads having the PLL-alginate coating was slower than that with uncoated beads. Immersing the beads in ethanol to kill cells on the periphery reduced cell release, but acidification activity was maintained. Dipping the beads in aluminum nitrate or a hot CaCl2 solution was not as effective as dipping them in ethanol. Ethanol treatment or heating of the beads appears to be a promising method for maintaining acidification activity while minimizing viable cell release due to loosely entrapped cells near the surface of the alginate beads. PMID:1622208

  11. Production of a nisin-like bacteriocin by Lactococcus lactis subsp. lactis A164 isolated from Kimchi.

    PubMed

    Choi, H J; Cheigh, C I; Kim, S B; Pyun, Y R

    2000-04-01

    Lactococcus lactis subsp. lactis A164 was isolated from Kimchi (Korean traditional fermented vegetables). The bacteriocin produced by strain A164 was active against closely related lactic acid bacteria and some food-borne pathogens including Staphylococcus aureus, Listeria monocytogenes and Salmonella typhimurium. The antimicrobial spectrum was nearly identical to that of nisin. Bacteriocin activity was not destroyed by exposure to elevated temperatures at low pH values, but the activity was lost at high pH values. This bacteriocin was inactivated by pronase E and alpha, beta-chymotrypsin, but not by trypsin, pepsin, and alpha-amylase. Cultures of L. lactis subsp. lactis A164 maintained at a constant pH of 6.0 exhibited maximum production of the bacteriocin. It was purified to homogeneity by ammonium sulphate precipitation, sequential ion exchange chromatography, and ultrafiltration. Tricine-SDS-PAGE of purified bacteriocin gave the same molecular weight of 3.5 kDa as that of nisin. The gene encoding this bacteriocin was amplified by PCR with nisin gene-specific primers and sequenced. It showed identical sequences to the nisin gene. These results indicate that bacteriocin produced by Lactococcus lactis A164 is a nisin-like bacteriocin. PMID:10792514

  12. Genomic exploration of the hemiascomycetous yeasts: 11. Kluyveromyces lactis.

    PubMed

    Bolotin-Fukuhara, M; Toffano-Nioche, C; Artiguenave, F; Duchateau-Nguyen, G; Lemaire, M; Marmeisse, R; Montrocher, R; Robert, C; Termier, M; Wincker, P; Wésolowski-Louvel, M

    2000-12-22

    Random sequencing of the Kluyveromyces lactis genome allowed the identification of 2235-2601 open reading frames (ORFs) homologous to S. cerevisiae ORFs, 51 ORFs which were homologous to genes from other species, 64 tRNAs, the complete rDNA repeat, and a few Ty1- and Ty2-like sequences. In addition, the complete sequence of plasmid pKD1 and a large coverage of the mitochondrial genome were obtained. The global distribution into general functional categories found in Saccharomyces cerevisiae and as defined by MIPS is well conserved in K. lactis. However, detailed examination of certain subcategories revealed a small excess of genes involved in amino acid metabolism in K. lactis. The sequences are deposited at EMBL under the accession numbers AL424881-AL430960. PMID:11152886

  13. Secretory expression of a heterologous nattokinase in Lactococcus lactis.

    PubMed

    Liang, Xiaobo; Zhang, Lixin; Zhong, Jin; Huan, Liandong

    2007-05-01

    Nattokinase has been reported as an oral health product for the prevention of atherosclerosis. We developed a novel strategy to express a nattokinase from Bacillus subtilis in a live delivery vehicle, Lactococcus lactis. Promoter P( nisZ) and signal peptide SP(Usp) were used for inducible and secretory expression of nattokinase in L. lactis. Western blotting analysis demonstrated that nattokinase was successfully expressed, and about 94% of the enzyme was secreted to the culture. The recombinant nattokinase showed potent fibrinolytic activity, equivalent to 41.7 urokinase units per milliliter culture. Expression and delivery of such a fibrinolytic enzyme in the food-grade vehicle L. lactis would facilitate the widespread application of nattokinase in the control and prevention of thrombosis diseases. PMID:17225095

  14. Physiological function of exopolysaccharides produced by Lactococcus lactis.

    PubMed

    Looijesteijn, P J; Trapet, L; de Vries, E; Abee, T; Hugenholtz, J

    2001-02-28

    The physiological function of EPS produced by Lactococcus lactis was studied by comparing the tolerance of the non-EPS producing strain L. lactis ssp. cremoris MG1614 and an EPS producing isogenic variant of this strain to several anti-microbial factors. There was no difference in the sensitivity of the strains to increased temperatures, freezing or freeze-drying and the antibiotics, penicillin and vancomycin. A model system showed that EPS production did not affect the survival of L. lactis during passage through the gastrointestinal tract although the EPS itself was not degraded during this passage. The presence of cell associated EPS and EPS in suspension resulted in an increased tolerance to copper and nisin. Furthermore, cell associated EPS also protected the bacteria against bacteriophages and the cell wall degrading enzyme lysozyme. However, it has not been possible, so far, to increase EPS production using the presence of copper, nisin, lysozyme or bacteriophages as inducing factors. PMID:11252513

  15. Isolation of Lactococcus lactis subsp. cremoris from nature by colony hybridization with rRNA probes.

    PubMed Central

    Salama, M S; Sandine, W E; Giovannoni, S J

    1993-01-01

    Lactococcus lactis subsp. cremoris is widely used in the manufacture of fermented milk products. Despite numerous attempts, efforts to isolate new strains by traditional plating and identification methods have not been successful. Previously, we described oligonucleotide probes for 16S rRNAs which could be used to discriminate L. lactis subsp. cremoris from related strains. These probes were used in colony hybridization experiments to screen large numbers of colonies obtained from enrichment cultures. A total of 170 strains of L. lactis were isolated from six milk samples, two colostrum samples, and one corn sample by using oligonucleotide probe 212RLa specific for the species L. lactis. Fifty-nine of these isolates also hybridized to L. lactis subsp. cremoris-specific probe 68RCa, and 26 of the strains which hybridized to the L. lactis subsp. cremoris-specific probe had the L. lactis subsp. cremoris phenotype. Images PMID:7506898

  16. Chromosomal integration of plasmid DNA by homologous recombination in Enterococcus faecalis and Lactococcus lactis subsp. lactis hosts harboring Tn919.

    PubMed Central

    Casey, J; Daly, C; Fitzgerald, G F

    1991-01-01

    Integration of pCI192, a pBR322-derived vector plasmid containing homology to the chromosomally located conjugative transposon Tn919 was observed in two strains that harbor Tn919, namely, Enterococcus faecalis GF590 and Lactococcus lactis subsp. lactis CH919. Hybridization analysis indicated that single-copy integration of the plasmid had occurred at low frequency. The Tn919::plasmid structure was conjugated from an E. faecalis donor to a L. lactis recipient, although at lower frequencies than was Tn919. Segregation of the tetracycline and chloramphenicol resistance markers during conjugation was observed. The integration strategy described allows for DNA manipulations to be performed in an easily manipulated model host strain with the subsequent transfer of integrated structures by conjugation to any strain capable of receiving Tn919. The results indicate that homologous recombination events may be used to introduce plasmid-encoded genes to the lactococcal chromosome. Images PMID:1662938

  17. Optimization of cultural conditions for conversion of glycerol to ethanol by Enterobacter aerogenes S012

    PubMed Central

    2013-01-01

    The aim of this research is to optimize the cultural conditions for the conversion of glycerol to ethanol by Enterobacter aerogenes S012. Taguchi method was used to screen the cultural conditions based on their signal to noise ratio (SN). Temperature (°C), agitation speed (rpm) and time (h) were found to have the highest influence on both glycerol utilization and ethanol production by the organism while pH had the lowest. Full factorial design, statistical analysis, and regression model equation were used to optimize the selected cultural parameters for maximum ethanol production. The result showed that fermentation at 38°C and 200 rpm for 48 h would be ideal for the bacteria to produce maximum amount of ethanol from glycerol. At these optimum conditions, ethanol production, yield and productivity were 25.4 g/l, 0.53 g/l/h, and 1.12 mol/mol-glycerol, repectively. Ethanol production increased to 26.5 g/l while yield and productivity decreased to 1.04 mol/mol-glycerol and 0.37 g/l/h, respectively, after 72 h. Analysis of the fermentation products was performed using HPLC, while anaerobic condition was created by purging the fermentation vessel with nitrogen gas. PMID:23388539

  18. Biodegradation of ichlorodiphenyltrichloroe-thane: Intermediates in dichlorodiphenylacetic acid metabolism by Aerobacter aerogenes

    USGS Publications Warehouse

    1967-01-01

    The final product of dichlorodiphenyltrichloroethane (DDT) degradation by vertebrates is commonly considered to be dichlorodiphenylacetic acid, DDA (J. E. Peterson and W. H. Robison, Toxicol. Appl. Pharmacol. 6:321, 1964). Recently, certain organisms (A. S. Perry, S. Miller, and A. J. Buckner. J. Agr. Food Chem. 11:457, 1963; J. D. Pinto, M. N. Comien, and M. S. Dunn. J. Biol. Chem. 240:2148, 1965) have been found to degrade further DDA to dichlorobenzophenone (DBP), but the possibility that such degradation was due to microbial action could not be excluded. Significantly, dichlorobenzhydrol (DBH), dichlorophenylmethane (DPM), and dichlorodiphenylethylene (DDE) have been tentatively identified in rats fed DDA (Pinto et al., J. Biol. Chem. 240:2148, 1965). Since DDA as well as DDT is degraded by the ubiquitous microorganism Aerobacter aerogenes (G. Wedemeyer, Appl. Microbiol. 15:569, 1967; J. L. Mendel, and M. S. Walton, Science 151:1527, 1966), it seemed reasonable that the intestinal microflora might be involved in DBP formation, DPM and DBH being intermediates in its pathway from DDA. Since DDA is a (3,y-unsaturated acid, ketone formation via an alkene and an alcohol would be expected (S. G. Waley, Mechanisms of Organic and Enzymatic Reactions, Oxford University Press, London, England 1962).

  19. Effect of Growth Rate on Histidine Catabolism and Histidase Synthesis in Aerobacter aerogenes1

    PubMed Central

    Jensen, Donald E.; Neidhardt, Frederick C.

    1969-01-01

    A study was made of how the catabolism of a carbon and energy source is affected by the biosynthetic demands of growing bacterial cells. Cultures of Aerobacter aerogenes in l-histidine medium were grown in a chemostat at rates determined by the supply of either sulfate or a required amino acid, l-arginine. It was discovered that the rate at which these cells grow under a biosynthetic restriction determines both the rate and the pattern of histidine degradation. (i) Histidine catabolism is partially coupled to the growth rate. This coupling is achieved by catabolite repression of histidase (histidine ammonia lyase; EC 4.3.1.3.), and also by a slightly decreased in vivo function of this enzyme at low growth rates. (ii) The looseness of the coupling results in a direct relationship between growth rate and growth yield, and possibly is correlated with an altered pattern of carbon flow from histidine. (iii) Sudden decreases in growth rate cause total repression of histidase synthesis for substantial periods of time. (iv) Sudden release of biosynthetic restriction leads rapidly to an increase in the functioning of the cells' complement of histidase, an increase in the rate of synthesis of this enzyme, and an increase in the growth yield from histidine. PMID:5781570

  20. Detoxification of mercury, cadmium, and lead in Klebsiella aerogenes NCTC 418 growing in continuous culture.

    PubMed Central

    Aiking, H; Govers, H; van 't Riet, J

    1985-01-01

    Klebsiella aerogenes NCTC 418 growing in the presence of cadmium under glucose-, sulfate-, or phosphate-limited conditions in continuous culture exhibited sulfide formation and Pi accumulation as the only demonstrable detoxification mechanisms. In the presence of mercury under similar conditions only HgS formation could be confirmed, by an increased sensitivity to mercury under sulfate-limited conditions, among others. The fact that the cells were most sensitive to cadmium under conditions of phosphate limitation and most sensitive to mercury under conditions of sulfate limitation led to the hypothesis that these inorganic detoxification mechanisms generally depended on a kind of "facilitated precipitation". The process was coined thus because heavy metals were probably accumulated and precipitated near the cell perimeter due to the relatively high local concentrations of sulfide and phosphate there. Depending on the growth-limiting nutrient, mercury proved to be 25-fold (phosphate limitation), 75-fold (glycerol limitation), or 150-fold (sulfate limitation) more toxic than cadmium to this organism. In the presence of lead, PbS formation was suggested. Since no other detoxification mechanisms were detected, for example, rendering heavy metal ions innocuous as metallo-organic compounds, it was concluded that formation of heavy metal precipitates is crucially important to this organism. In addition, it was observed that several components of a defined mineral medium were able to reduce mercuric ions to elemental mercury. This abiotic mercury volatilization was studied in detail, and its general and environmental implications are discussed. Images PMID:3911898

  1. Detoxification of mercury, cadmium, and lead in Klebsiella aerogenes NCTC 418 growing in continuous culture

    SciTech Connect

    Aiking, H.; Govers, H.; van 'T Riet, J.

    1985-11-01

    Klebsiella aerogenes NCTC 418 growing in the presence of cadmium under glucose-, sulfate-, or phosphate-limited conditions in continuous culture exhibited sulfide formation and P/sub i/ accumulation as the only demonstrable detoxification mechanisms. In the presence of mercury under similar conditions only HgS formation could be confirmed, by an increased sensitivity to mercury under sulfate-limited conditions, among others. The fact that the cells were most sensitive to cadmium under conditions of phosphate limitation and most sensitive to mercury under conditions of sulfate limitation led to the hypothesis that these inorganic detoxification mechanisms generally depended on a kind of facilitated precipitation. The process was coined thus because heavy metals were probably accumulated and precipitated near the cell perimeter due to the relatively high local concentrations of sulfide and phosphate there. Depending on the growth-limiting nutrient, mercury proved to be 25-fold (phosphate limitation), 75-fold (glycerol limitation), or 150-fold (sulfate limitation) more toxic than cadmium to this organism. In the presence of lead, PbS formation was suggested. since no other detoxification mechanisms were detected, for example, rendering heavy metal ions innocuous as metallo-organic compounds, it was concluded that formation of heavy metal precipitates is crucially important to this organism. In addition, it was observed that several components of a defined mineral medium were able to reduce mercuric ions to elemental mercury. This abiotic mercury volatilization was studied in detail, and its general and environmental implications are discussed.

  2. Growth and heavy metal removal by Klebsiella aerogenes at different pH and temperature

    SciTech Connect

    Al-Shahwani, M.F.; Jazrawi, S.F.; Al-Rawi, E.H.; Ayar, N.S.

    1984-01-01

    A strain of Klebsiella aerogenes isolated from Rustamiyah Station for treatment of wastewater was examined for its ability to grow in a media supplemented with maximum tolerance concentrations of Pb/sup + +/, Zn/sup + +/, Ni/sup + +/, and Cd/sup + +/, separately, at different temperatures and initial pH. The results indicated that at 28/sup 0/C during the first 24 hr, Pb/sup + +/ and Ni/sup + +/ had no effect on the growth of the bacteria, while the presence of Zn/sup + +/ and Cd/sup + +/ decreased the cell count. The growth reached a maximum level after the second day and started to decrease gradually. The bacterial count at 37/sup 0/C was less than that at 28/sup 0/C. No bacterial multiplication occurred at 44/sup 0/C. There was little difference between heavy metal removal at 28 and 37/sup 0/C. At 44/sup 0/C, little removal took place. In general, slightly acidic or neutral medium was better for both bacterial growth and metal removal.

  3. Cloning and expression of a novel lactococcal aggregation factor from Lactococcus lactis subsp. lactis BGKP1

    PubMed Central

    2011-01-01

    Background Aggregation may play a main role in the adhesion of bacteria to the gastrointestinal epithelium and their colonization ability, as well as in probiotic effects through co-aggregation with intestinal pathogens and their subsequent removal. The aggregation phenomenon in lactococci is directly associated with the sex factor and lactose plasmid co-integration event or duplication of the cell wall spanning (CWS) domain of PrtP proteinase. Results Lactococcus lactis subsp. lactis BGKP1 was isolated from artisanal semi-hard homemade cheese and selected due to its strong auto-aggregation phenotype. Subsequently, non-aggregating derivative (Agg-) of BGKP1, designated as BGKP1-20, was isolated, too. Comparative analysis of cell surface proteins of BGKP1 and derivative BGKP1-20 revealed a protein of approximately 200 kDa only in the parental strain BGKP1. The gene involved in aggregation (aggL) was mapped on plasmid pKP1 (16.2 kb), cloned and expressed in homologous and heterologous lactococci and enterococci. This novel lactococcal aggregation protein was shown to be sufficient for cell aggregation in all tested hosts. In addition to the aggL gene, six more ORFs involved in replication (repB and repX), restriction and modification (hsdS), transposition (tnp) and possible interaction with mucin (mbpL) were also located on plasmid pKP1. Conclusion AggL is a new protein belonging to the collagen-binding superfamily of proteins and is sufficient for cell aggregation in lactococci. PMID:22182285

  4. Dealing with different methods for Kluyveromyces lactis ?-galactosidase purification

    PubMed Central

    Becerra, M; Cerdãn, E

    1998-01-01

    Several micro-scale chromatography-based procedures for purification of the ?-galactosidase from the yeast Kluyveromyces lactis were assayed. Purified enzyme was suitable to be used as antigen to induce polyclonal antibodies production. Specific staining of non-denaturing PAGE gels with chromogenic substrates allowed the determination of the number of subunits forming the native enzyme. PMID:12734592

  5. Recombinant Lactococcus lactis fails to secrete bovine chymosine.

    PubMed

    Luerce, Tessália Diniz; Azevedo, Marcela Santiago Pacheco; LeBlanc, Jean Guy; Azevedo, Vasco; Miyoshi, Anderson; Pontes, Daniela Santos

    2014-01-01

    Bovine chymosin is an important milk-clotting agent used in the manufacturing of cheeses. Currently, the production of recombinant proteins by genetically modified organisms is widespread, leading to greatly reduced costs. Lactococcus (L.) lactis, the model lactic acid bacterium, was considered a good candidate for heterologous chymosin production for the following reasons: (1) it is considered to be a GRAS (generally regarded as safe) microorganism, (2) only one protease is present on its surface, (3) it can secrete proteins of different sizes, and (4) it allows for the direct production of protein in fermented food products. Thus, three genetically modified L. lactis strains were constructed to produce and target the three different forms of bovine chymosin, prochymosin B, chymosin A and chymosin B to the extracellular medium. Although all three proteins were stably produced in L. lactis, none of the forms were detected in the extracellular medium or showed clotting activity in milk. Our hypothesis is that this secretion deficiency and lack of clotting activity can be explained by the recombinant protein being attached to the cell envelope. Thus, the development of other strategies is necessary to achieve both production and targeting of chymosin in L. lactis, which could facilitate the downstream processing and recovery of this industrially important protein. PMID:25482140

  6. Lactose-mediated carbon catabolite repression of putrescine production in dairy Lactococcus lactis is strain dependent.

    PubMed

    del Rio, Beatriz; Ladero, Victor; Redruello, Begoña; Linares, Daniel M; Fernández, Maria; Martín, Maria Cruz; Alvarez, Miguel A

    2015-06-01

    Lactococcus lactis is the lactic acid bacterial (LAB) species most widely used as a primary starter in the dairy industry. However, several strains of L. lactis produce the biogenic amine putrescine via the agmatine deiminase (AGDI) pathway. We previously reported the putrescine biosynthesis pathway in L. lactis subsp. cremoris GE2-14 to be regulated by carbon catabolic repression (CCR) via glucose but not lactose (Linares et al., 2013). The present study shows that both these sugars repress putrescine biosynthesis in L. lactis subsp. lactis T3/33, a strain isolated from a Spanish artisanal cheese. Furthermore, we demonstrated that both glucose and lactose repressed the transcriptional activity of the aguBDAC catabolic genes of the AGDI route. Finally, a screening performed in putrescine-producing dairy L. lactis strains determined that putrescine biosynthesis was repressed by lactose in all the L. lactis subsp. lactis strains tested, but in only one L. lactis subsp. cremoris strain. Given the obvious importance of the lactose-repression in cheese putrescine accumulation, it is advisable to consider the diversity of L. lactis in this sense and characterize consequently the starter cultures to select the safest strains. PMID:25791004

  7. Caractéristiques bactériologiques des infections de liquide de dialyse péritonéale

    PubMed Central

    Jellouli, Manel; Ferjani, Meriem; Abidi, Kamel; Hammi, Yosra; Abdallah, Taieb Ben; Gargah, Tahar

    2015-01-01

    La péritonite infectieuse (PI) est la principale complication de la dialyse péritonéale (DP). L'objectif de notre travail était de déterminer l’écologie bactérienne des PI et d'adapter l'antibiothérapie selon les germes isolés et les résistances observées. Étude rétrospective effectuée chez tous les enfants traités par DP et ayant présenté une PI dans le service de pédiatrie de l'hôpital Charles Nicolle de Tunis (2004-2013). Au total, 61 ont développé 97 PI. L'incidence des PI était de 0,75 épisode/patient-année. La culture du LDP était négative dans 40 cas. Les Gram Positif ont été notés dans 56% des cas avec prédominance du Staphylococcus aureus. Les Gram négatif étaient retrouvés en seconde position (40%) représentés principalement par le Klebsiella pneumoniae et le Pseudomonas aeruginosa. Des souches de Staphylocoque méticilline résistant étaient isolées dans 21,4%. Les bactéries à Gram positif étaient résistantes aux céphalosporines de première génération dans 25% des cas et aucune résistance à la vancomycine n'avait été décelée. Les bactéries à Gram négatif avaient une résistance globale de 38% avec des souches β-lactamase à spectre élargi (BLSE). L'antibiothérapie empirique devra couvrir les germes à Gram positif par la vancomycine et les germes à Gram négatif par la ceftazidime. PMID:26893796

  8. Modeling Lactococcus lactis using a genome-scale flux model

    PubMed Central

    Oliveira, Ana Paula; Nielsen, Jens; Förster, Jochen

    2005-01-01

    Background Genome-scale flux models are useful tools to represent and analyze microbial metabolism. In this work we reconstructed the metabolic network of the lactic acid bacteria Lactococcus lactis and developed a genome-scale flux model able to simulate and analyze network capabilities and whole-cell function under aerobic and anaerobic continuous cultures. Flux balance analysis (FBA) and minimization of metabolic adjustment (MOMA) were used as modeling frameworks. Results The metabolic network was reconstructed using the annotated genome sequence from L. lactis ssp. lactis IL1403 together with physiological and biochemical information. The established network comprised a total of 621 reactions and 509 metabolites, representing the overall metabolism of L. lactis. Experimental data reported in the literature was used to fit the model to phenotypic observations. Regulatory constraints had to be included to simulate certain metabolic features, such as the shift from homo to heterolactic fermentation. A minimal medium for in silico growth was identified, indicating the requirement of four amino acids in addition to a sugar. Remarkably, de novo biosynthesis of four other amino acids was observed even when all amino acids were supplied, which is in good agreement with experimental observations. Additionally, enhanced metabolic engineering strategies for improved diacetyl producing strains were designed. Conclusion The L. lactis metabolic network can now be used for a better understanding of lactococcal metabolic capabilities and potential, for the design of enhanced metabolic engineering strategies and for integration with other types of 'omic' data, to assist in finding new information on cellular organization and function. PMID:15982422

  9. Statistical optimization of cell disruption techniques for releasing intracellular X-prolyl dipeptidyl aminopeptidase from Lactococcus lactis spp. lactis.

    PubMed

    Üstün-Aytekin, Özlem; Arısoy, Sevda; Aytekin, Ali Özhan; Yıldız, Ece

    2016-03-01

    X-prolyl dipeptidyl aminopeptidase (PepX) is an intracellular enzyme from the Gram-positive bacterium Lactococcus lactis spp. lactis NRRL B-1821, and it has commercial importance. The objective of this study was to compare the effects of several cell disruption methods on the activity of PepX. Statistical optimization methods were performed for two cavitation methods, hydrodynamic (high-pressure homogenization) and acoustic (sonication), to determine the more appropriate disruption method. Two level factorial design (2FI), with the parameters of number of cycles and pressure, and Box-Behnken design (BBD), with the parameters of cycle, sonication time, and power, were used for the optimization of the high-pressure homogenization and sonication methods, respectively. In addition, disruption methods, consisting of lysozyme, bead milling, heat treatment, freeze-thawing, liquid nitrogen, ethylenediaminetetraacetic acid (EDTA), Triton-X, sodium dodecyl sulfate (SDS), chloroform, and antibiotics, were performed and compared with the high-pressure homogenization and sonication methods. The optimized values of high-pressure homogenization were one cycle at 130 MPa providing activity of 114.47 mU ml(-1), while sonication afforded an activity of 145.09 mU ml(-1) at 28 min with 91% power and three cycles. In conclusion, sonication was the more effective disruption method, and its optimal operation parameters were manifested for the release of intracellular enzyme from a L. lactis spp. lactis strain, which is a Gram-positive bacterium. PMID:26584994

  10. Draft Genome Sequence of the Moderately Heat-Tolerant Lactococcus lactis subsp. lactis bv. diacetylactis Strain GL2 from Algerian Dromedary Milk.

    PubMed

    Gabed, Noujoud; Yang, Manli; Bey Baba Hamed, Mohamed; Drici, Habiba; Gross, Roy; Dandekar, Thomas; Liang, Chunguang

    2015-01-01

    Lactococcus lactis subsp. lactis bv. diacetylactis GL2 is a moderately thermotolerant lactic acid bacterium isolated from dromedary raw milk. Here, we present the draft genome sequence of this potential new dairy starter strain, which combines thermotolerance and the capacity to metabolize lactose, casein, and citrate. PMID:26586883

  11. Draft Genome Sequence of the Moderately Heat-Tolerant Lactococcus lactis subsp. lactis bv. diacetylactis Strain GL2 from Algerian Dromedary Milk

    PubMed Central

    Gabed, Noujoud; Yang, Manli; Bey Baba Hamed, Mohamed; Drici, Habiba; Gross, Roy; Dandekar, Thomas

    2015-01-01

    Lactococcus lactis subsp. lactis bv. diacetylactis GL2 is a moderately thermotolerant lactic acid bacterium isolated from dromedary raw milk. Here, we present the draft genome sequence of this potential new dairy starter strain, which combines thermotolerance and the capacity to metabolize lactose, casein, and citrate. PMID:26586883

  12. Investigation and control of an outbreak of Enterobacter aerogenes bloodstream infection in a neonatal intensive care unit in Fiji.

    PubMed

    Narayan, Swastika A; Kool, Jacob L; Vakololoma, Miriama; Steer, Andrew C; Mejia, Amelita; Drake, Anne; Jenney, Adam; Turton, Jane F; Kado, Joseph; Tikoduadua, Lisi

    2009-08-01

    Ten neonates developed blood stream infection with extended-spectrum beta-lactamase-producing Enterobacter aerogenes in a neonatal intensive care unit in Fiji. The source of the outbreak was traced to a bag of contaminated normal saline in the ward, which was used for multiple patients. All isolates recovered from patients were indistinguishable from the bacteria recovered from the normal saline by pulsed-field gel electrophoresis. The outbreak was controlled using simple infection control practices such as reinforcement of strict hand hygiene policy, provision of single use vials of normal saline, and strict aseptic technique for injections. PMID:19552517

  13. [Joint cultivation of Streptococcus lactis, LMU strain, and various species of yeasts].

    PubMed

    Egorov, N S; Kozlova, Iu I; Baranova, I P

    1985-02-01

    When S. lactis, strain LMU and yeast were plated out simultaneously on media containing different amounts of amine nitrogen and vitamins, the yeast did not stimulate the synthesis of nisin. Plating out of S. lactis on media with grown cultures of the Rostov baker's yeast, American baker's yeast, Candida guilliermondii, Candida clausenii, Fabospora fragilis, Fabospora macedoniensis, Octosporomyces octosporus, Saccharomyces cerevisiae, races "Ya" and "M" and Saccharomyces globosus resulted in inhibition of the S. lactis growth and nisin synthesis. Cultivation of S. lactis on media with grown cultures of Saccharomyces ludwigii, Hansenula anomala, Kluyveromyces lactis, Endomyces magnusi, Zigowilliopsis californicus, and Rhodotorula colostri resulted in formation of an association providing active growth and development of S. lactis with complete realization of its biosynthetic capacity. PMID:3923918

  14. Regulation of nisin biosynthesis by continuous cultures and by resting cells of Lactococcus lactis subsp. lactis.

    PubMed

    Meghrous, J; Huot, E; Quittelier, M; Petitdemange, H

    1992-01-01

    Nisin production by Lactococcus lactis subsp. lactis has been investigated using lactose as carbon source. Whether or not continuous cultures were lactose-limited, maximum nisin titre was observed at an intermediate mu value with a sharp peak of activity between 0.2 and 0.3/h. The maximum specific growth rate obtained in the medium used was 0.6/h and the maximum titre of nisin at mu = 0.25/h (160 AU/ml) was about nine-fold higher as compared with activity obtained at a dilution rate of 0.05/h or 0.4/h. With a constant dilution rate of 0.25/h and varying initial lactose concentrations from 3 to 40 g/l, there is an increase in nisin biosynthesis with increasing lactose concentration correlated with higher rates of sugar consumption. A Ymax value of 0.2 g bacterial dry weight and a maintenance coefficient of 124 mg lactose/g bacterial dry weight/h were determined. Lactose consumption increased from 1 to 3.28 g of lactose/g (dry wt) of cell mass/h and the nisin titre from 12.5 to 164.2 AU/ml. At higher values, nisin production declined. This implies that biosynthesis of nisin is regulated by a system of repression and derepression. Addition of lanthionine and beta-methyllanthionine precursors to the medium decreased the nisin titre when either threonine, threonine-cysteine, or cysteine-serine-threonine was added at the optimal dilution rate of 0.25/h; however, simultaneous addition of serine and cysteine elicited a slight increase in nisin activity. Studies with resting cells confirm that the biosynthesis of nisin is tightly regulated, since the production rate can be 5.6-fold higher than in cells grown in continuous culture. In addition, cell-adhered nisin appears to play a role in the production of the enzyme: low levels of cell-adhered nisin elicited high production rates, whereas high levels were not associated with nisin biosynthesis. In addition to pH, magnesium sulphate and lactose concentrations, nitrogen sources were also able to interfere in cell-adherence nisin. PMID:1299840

  15. Cell Wall Anchoring of the Campylobacter Antigens to Lactococcus lactis

    PubMed Central

    Kobierecka, Patrycja A.; Olech, Barbara; Książek, Monika; Derlatka, Katarzyna; Adamska, Iwona; Majewski, Paweł M.; Jagusztyn-Krynicka, Elżbieta K.; Wyszyńska, Agnieszka K.

    2016-01-01

    Campylobacter jejuni is the most frequent cause of human food-borne gastroenteritis and chicken meat is the main source of infection. Recent studies showed that broiler chicken immunization against Campylobacter should be the most efficient way to lower the number of human infections by this pathogen. Induction of the mucosal immune system after oral antigen administration should provide protective immunity to chickens. In this work we tested the usefulness of Lactococcus lactis, the most extensively studied lactic acid bacterium, as a delivery vector for Campylobacter antigens. First we constructed hybrid protein – CjaA antigen presenting CjaD peptide epitopes on its surface. We showed that specific rabbit anti-rCjaAD serum reacted strongly with both CjaA and CjaD produced by a wild type C. jejuni strain. Next, rCjaAD and CjaA were fused to the C-terminus of the L. lactis YndF containing the LPTXG motif. The genes expressing these proteins were transcribed under control of the L. lactis Usp45 promoter and their products contain the Usp45 signal sequences. This strategy ensures a cell surface location of both analyzed proteins, which was confirmed by immunofluorescence assay. In order to evaluate the impact of antigen location on vaccine prototype efficacy, a L. lactis strain producing cytoplasm-located rCjaAD was also generated. Animal experiments showed a decrease of Campylobacter cecal load in vaccinated birds as compared with the control group and showed that the L. lactis harboring the surface-exposed rCjaAD antigen afforded greater protection than the L. lactis producing cytoplasm-located rCjaAD. To the best of our knowledge, this is the first attempt to employ Lactic Acid Bacteria (LAB) strains as a mucosal delivery vehicle for chicken immunization. Although the observed reduction of chicken colonization by Campylobacter resulting from vaccination was rather moderate, the experiments showed that LAB strains can be considered as an alternative vector to deliver heterologous antigens to the bird immune system. Additionally, the analysis of the structure and immunogenicity of the generated rCjaAD hybrid protein showed that the CjaA antigen can be considered as a starting point to construct multiepitope anti-Campylobacter vaccines. PMID:26925040

  16. Cell Wall Anchoring of the Campylobacter Antigens to Lactococcus lactis.

    PubMed

    Kobierecka, Patrycja A; Olech, Barbara; Ksi??ek, Monika; Derlatka, Katarzyna; Adamska, Iwona; Majewski, Pawe? M; Jagusztyn-Krynicka, El?bieta K; Wyszy?ska, Agnieszka K

    2016-01-01

    Campylobacter jejuni is the most frequent cause of human food-borne gastroenteritis and chicken meat is the main source of infection. Recent studies showed that broiler chicken immunization against Campylobacter should be the most efficient way to lower the number of human infections by this pathogen. Induction of the mucosal immune system after oral antigen administration should provide protective immunity to chickens. In this work we tested the usefulness of Lactococcus lactis, the most extensively studied lactic acid bacterium, as a delivery vector for Campylobacter antigens. First we constructed hybrid protein - CjaA antigen presenting CjaD peptide epitopes on its surface. We showed that specific rabbit anti-rCjaAD serum reacted strongly with both CjaA and CjaD produced by a wild type C. jejuni strain. Next, rCjaAD and CjaA were fused to the C-terminus of the L. lactis YndF containing the LPTXG motif. The genes expressing these proteins were transcribed under control of the L. lactis Usp45 promoter and their products contain the Usp45 signal sequences. This strategy ensures a cell surface location of both analyzed proteins, which was confirmed by immunofluorescence assay. In order to evaluate the impact of antigen location on vaccine prototype efficacy, a L. lactis strain producing cytoplasm-located rCjaAD was also generated. Animal experiments showed a decrease of Campylobacter cecal load in vaccinated birds as compared with the control group and showed that the L. lactis harboring the surface-exposed rCjaAD antigen afforded greater protection than the L. lactis producing cytoplasm-located rCjaAD. To the best of our knowledge, this is the first attempt to employ Lactic Acid Bacteria (LAB) strains as a mucosal delivery vehicle for chicken immunization. Although the observed reduction of chicken colonization by Campylobacter resulting from vaccination was rather moderate, the experiments showed that LAB strains can be considered as an alternative vector to deliver heterologous antigens to the bird immune system. Additionally, the analysis of the structure and immunogenicity of the generated rCjaAD hybrid protein showed that the CjaA antigen can be considered as a starting point to construct multiepitope anti-Campylobacter vaccines. PMID:26925040

  17. Cloning in Streptococcus lactis of plasmid-mediated UV resistance and effect on prophage stability

    SciTech Connect

    Chopin, M.C.; Chopin, A.; Rouault, A.; Simon, D.

    1986-02-01

    Plasmid pIL7 (33 kilobases) from Streptococcus lactis enhances UV resistance and prophage stability. A 5.4-kilobase pIL7 fragment carrying genes coding for both characters was cloned into S. lactis, using plasmid pHV1301 as the cloning vector. The recombinant plasmid was subsequently transferred to three other S. lactis strains by transformation or protoplast fusion. Cloned genes were expressed in all tested strains.

  18. Characterization of a Wild, Novel Nisin A-Producing Lactococcus Strain with an L. lactis subsp. cremoris Genotype and an L. lactis subsp. lactis Phenotype, Isolated from Greek Raw Milk

    PubMed Central

    Parapouli, Maria; Delbès-Paus, Céline; Kakouri, Athanasia; Koukkou, Anna-Irini; Montel, Marie-Christine

    2013-01-01

    Several molecular taxonomic studies have revealed that many natural (wild) Lactococcus lactis strains of dairy origin which are phenotypically representative of the L. lactis subspecies lactis cluster genotypically within subspecies cremoris and vice versa. Recently, we isolated two wild nisin-producing (Nis+) L. lactis strains, M78 and M104, of the lactis phenotype from Greek raw milk (J. Samelis, A. Lianou, A. Kakouri, C. Delbès, I. Rogelj, B. B. Matijašic, and M. C. Montel, J. Food Prot. 72:783–790, 2009); strain M78 possess a novel nisin A sequence (GenBank accession number HM219853). In this study, the actual subspecies identity of M78 and M104 isolates was elucidated, using 16S rRNA and acmA (encoding lactococcal N-acetylmuramidase) gene and histidine biosynthesis operon polymorphisms and 16S rRNA and ldh (encoding lactate dehydrogenase) gene phylogenies. Except the acmA gene analysis, molecular tools revealed that isolates M78 and M104 clustered with strains of the cremoris genotype, including the LMG 6897T strain, while they were distant from strains of the lactis genotype, including the LMG 6890T strain. The two wild isolates had identical repetitive sequence-based PCR (rep-PCR), randomly amplified polymorphic DNA (RAPD), plasmid, and whole-cell protein profiles and shared high 16S rRNA (99.9%) and ldh (100%) gene sequence homologies. In contrast, they exhibited identical sugar fermentation and enzymatic patterns which were similar to those of the subspecies lactis LMG 6890T strain. To our knowledge, this is the first complete identification report on a wild L. lactis subsp. cremoris genotype of the lactis phenotype which is capable of nisin A production and, thus, has strong potential for use as a novel dairy starter and/or protective culture. PMID:23542625

  19. Biohydrogen and polyhydroxyalkanoate co-production by Enterobacter aerogenes and Rhodobacter sphaeroides from Calophyllum inophyllum oil cake.

    PubMed

    Arumugam, A; Sandhya, M; Ponnusami, V

    2014-07-01

    The feasibility of coupled biohydrogen and polyhydroxyalkanoate production by Enterobacter aerogenes and Rhodobacter sphaeroides using Calophyllum inophyllum oil cake was studied under dark and photo fermentation conditions. The utilization of a non-edible acidic oil cake (C. inophyllum), and exploitation of a modified minimal salt media led to reduction in the cost of media. Cost of fermentation is reduced by implementation of alternate dark-photo fermentative periods and through the use of a co-culture consisting of a dark fermentative (E. aerogenes) and a photo fermentative (R. sphaeroides) bacterium. The biohydrogen and polyhydroxyalkanoate produced were 7.95 L H2/L media and 10.73 g/L media, respectively, under alternate dark and photo fermentation and were 3.23 L H2/L media and 5.6g/L media, respectively under complete dark fermentation. The characteristics of the oil cake and alternate dark (16 h) and photo (8h) fermentative conditions were found to be supportive in producing high biohydrogen and polyhydroxyalkanoate (PHA) yield. PMID:24859207

  20. Biohydrogen and Bioethanol Production from Biodiesel-Based Glycerol by Enterobacter aerogenes in a Continuous Stir Tank Reactor

    PubMed Central

    Jitrwung, Rujira; Yargeau, Viviane

    2015-01-01

    Crude glycerol from the biodiesel manufacturing process is being produced in increasing quantities due to the expanding number of biodiesel plants. It has been previously shown that, in batch mode, semi-anaerobic fermentation of crude glycerol by Enterobacter aerogenes can produce biohydrogen and bioethanol simultaneously. The present study demonstrated the possible scaling-up of this process from small batches performed in small bottles to a 3.6-L continuous stir tank reactor (CSTR). Fresh feed rate, liquid recycling, pH, mixing speed, glycerol concentration, and waste recycling were optimized for biohydrogen and bioethanol production. Results confirmed that E. aerogenes uses small amounts of oxygen under semi-anaerobic conditions for growth before using oxygen from decomposable salts, mainly NH4NO3, under anaerobic condition to produce hydrogen and ethanol. The optimal conditions were determined to be 500 rpm, pH 6.4, 18.5 g/L crude glycerol (15 g/L glycerol) and 33% liquid recycling for a fresh feed rate of 0.44 mL/min. Using these optimized conditions, the process ran at a lower media cost than previous studies, was stable after 7 days without further inoculation and resulted in yields of 0.86 mol H2/mol glycerol and 0.75 mol ethanol/mole glycerol. PMID:25970750

  1. Biohydrogen and Bioethanol Production from Biodiesel-Based Glycerol by Enterobacter aerogenes in a Continuous Stir Tank Reactor.

    PubMed

    Jitrwung, Rujira; Yargeau, Viviane

    2015-01-01

    Crude glycerol from the biodiesel manufacturing process is being produced in increasing quantities due to the expanding number of biodiesel plants. It has been previously shown that, in batch mode, semi-anaerobic fermentation of crude glycerol by Enterobacter aerogenes can produce biohydrogen and bioethanol simultaneously. The present study demonstrated the possible scaling-up of this process from small batches performed in small bottles to a 3.6-L continuous stir tank reactor (CSTR). Fresh feed rate, liquid recycling, pH, mixing speed, glycerol concentration, and waste recycling were optimized for biohydrogen and bioethanol production. Results confirmed that E. aerogenes uses small amounts of oxygen under semi-anaerobic conditions for growth before using oxygen from decomposable salts, mainly NH4NO3, under anaerobic condition to produce hydrogen and ethanol. The optimal conditions were determined to be 500 rpm, pH 6.4, 18.5 g/L crude glycerol (15 g/L glycerol) and 33% liquid recycling for a fresh feed rate of 0.44 mL/min. Using these optimized conditions, the process ran at a lower media cost than previous studies, was stable after 7 days without further inoculation and resulted in yields of 0.86 mol H2/mol glycerol and 0.75 mol ethanol/mole glycerol. PMID:25970750

  2. Transcriptional Regulation of Fatty Acid Biosynthesis in Lactococcus lactis

    PubMed Central

    Eckhardt, Tom H.; Skotnicka, Dorota; Kok, Jan

    2013-01-01

    Here we study the influence of the putative fatty acid biosynthesis (FAB) regulator FabT (originally called RmaG [Llmg_1788]) on gene transcription in Lactococcus lactis MG1363. A strain with a knockout mutation of the putative regulator was constructed, and its transcriptome was compared to that of the wild-type strain. Almost all FAB genes were significantly upregulated in the knockout. Using electrophoretic mobility shift assays (EMSAs) and DNase I footprinting, the binding motif of the regulator and the binding locations in the genome were characterized. Fatty acid composition analysis revealed that a strain lacking FabT contained significantly more saturated acyl chains in its phospholipids. This observation demonstrates that the vital pathway of FAB in L. lactis is regulated by the repressor FabT. PMID:23275247

  3. Proteomic Signature of Lactococcus lactis NCDO763 Cultivated in Milk†

    PubMed Central

    Gitton, Christophe; Meyrand, Mickael; Wang, Juhui; Caron, Christophe; Trubuil, Alain; Guillot, Alain; Mistou, Michel-Yves

    2005-01-01

    We have compared the proteomic profiles of L. lactis subsp. cremoris NCDO763 growing in the synthetic medium M17Lac, skim milk microfiltrate (SMM), and skim milk. SMM was used as a simple model medium to reproduce the initial phase of growth of L. lactis in milk. To widen the analysis of the cytoplasmic proteome, we used two different gel systems (pH ranges of 4 to 7 and 4.5 to 5.5), and the proteins associated with the cell envelopes were also studied by two-dimensional electrophoresis. In the course of the study, we analyzed about 800 spots and identified 330 proteins by mass spectrometry. We observed that the levels of more than 50 and 30 proteins were significantly increased upon growth in SMM and milk, respectively. The large redeployment of protein synthesis was essentially associated with an activation of pathways involved in the metabolism of nitrogenous compounds: peptidolytic and peptide transport systems, amino acid biosynthesis and interconversion, and de novo biosynthesis of purines. We also showed that enzymes involved in reactions feeding the purine biosynthetic pathway in one-carbon units and amino acids have an increased level in SMM and milk. The analysis of the proteomic data suggested that the glutamine synthetase (GS) would play a pivotal role in the adaptation to SMM and milk. The analysis of glnA expression during growth in milk and the construction of a glnA-defective mutant confirmed that GS is an essential enzyme for the development of L. lactis in dairy media. This analysis thus provides a proteomic signature of L. lactis, a model lactic acid bacterium, growing in its technological environment. PMID:16269754

  4. Mobile CRISPR/Cas-Mediated Bacteriophage Resistance in Lactococcus lactis

    PubMed Central

    Millen, Anne M.; Horvath, Philippe; Boyaval, Patrick; Romero, Dennis A.

    2012-01-01

    Lactococcus lactis is a biotechnological workhorse for food fermentations and potentially therapeutic products and is therefore widely consumed by humans. It is predominantly used as a starter microbe for fermented dairy products, and specialized strains have adapted from a plant environment through reductive evolution and horizontal gene transfer as evidenced by the association of adventitious traits with mobile elements. Specifically, L. lactis has armed itself with a myriad of plasmid-encoded bacteriophage defensive systems to protect against viral predation. This known arsenal had not included CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins), which forms a remarkable microbial immunity system against invading DNA. Although CRISPR/Cas systems are common in the genomes of closely related lactic acid bacteria (LAB), none was identified within the eight published lactococcal genomes. Furthermore, a PCR-based search of the common LAB CRISPR/Cas systems (Types I and II) in 383 industrial L. lactis strains proved unsuccessful. Here we describe a novel, Type III, self-transmissible, plasmid-encoded, phage-interfering CRISPR/Cas discovered in L. lactis. The native CRISPR spacers confer resistance based on sequence identity to corresponding lactococcal phage. The interference is directed at phages problematic to the dairy industry, indicative of a responsive system. Moreover, targeting could be modified by engineering the spacer content. The 62.8-kb plasmid was shown to be conjugally transferrable to various strains. Its mobility should facilitate dissemination within microbial communities and provide a readily applicable system to naturally introduce CRISPR/Cas to industrially relevant strains for enhanced phage resistance and prevention against acquisition of undesirable genes. PMID:23240053

  5. Lactococcus lactis subsp. lactis infection in Bester sturgeon, a cultured hybrid of Huso huso × Acipenser ruthenus, in Taiwan.

    PubMed

    Chen, Ming-Hui; Hung, Shao-Wen; Shyu, Ching-Lin; Lin, Cheng-Chung; Liu, Pan-Chen; Chang, Chen-Hsuan; Shia, Wei-Yau; Cheng, Ching-Fu; Lin, Shiun-Long; Tu, Ching-Yu; Lin, Yu-Hsing; Wang, Way-Shyan

    2012-10-01

    Approximately 5300 hybrid sturgeons with an average body weight of 600-800 g were farmed in 3 round tankers measuring 3m in diameter each containing 28,000 L of aerated groundwater. According to the owner's description, the diseased fish had anorexia, pale body color, and reddish spots on the abdomen. The morbidity and lethality rates in this outbreak were about 70% (3706/5300) and 100% (3706/3706), respectively. The clinical examination revealed enteritis, enlarged abdomen, and rapid respiration rate. The gross findings revealed a volume of about 4 mL of ascites. The histopathological examination showed multiple massive, hemorrhagic or coagulative necrotic foci in the liver and spleen. Furthermore, there was diffuse infiltration of glycogen in hepatic cells, and a few polymorphonuclear and mononuclear leucocytes were observed surrounding the spleen. Some bacterial clumps were noted around the necrotic foci. We also observed that there was moderate to severe, acute, multifocal, coagulative necrosis in the renal parenchyma, with some necrotic foci present beneath the margin of the kidney. Additionally, multifocal, coagulative necrosis was found in the pancreas. Results of microbiologic examinations, including biochemical characteristics, PCR amplification of 16S rRNA gene, sequencing and comparison, and phylogenetic analysis, revealed the pathogen of this infection was Lactococcus lactis subsp. lactis, and based on the results of an antimicrobial agent sensitivity test the bacterium was only sensitive to ampicillin and florfenicol. Additionally, results of in vivo experimental infections in hybrid tilapia showed that 1×10(8) and 1×10(9) CFU/mL of our isolate caused death in all fish and LD(50) values ranged from 10(2) to 10(5) CFU/mL. To the best of the authors' knowledge, this is the first reported case of Lactococcus lactis subsp. lactis infection in hybrid sturgeon. PMID:22098776

  6. Parameter Estimation of Actuators for Benchmark Active Control Technology (BACT) Wind Tunnel Model with Analysis of Wear and Aerodynamic Loading Effects

    NASA Technical Reports Server (NTRS)

    Waszak, Martin R.; Fung, Jimmy

    1998-01-01

    This report describes the development of transfer function models for the trailing-edge and upper and lower spoiler actuators of the Benchmark Active Control Technology (BACT) wind tunnel model for application to control system analysis and design. A simple nonlinear least-squares parameter estimation approach is applied to determine transfer function parameters from frequency response data. Unconstrained quasi-Newton minimization of weighted frequency response error was employed to estimate the transfer function parameters. An analysis of the behavior of the actuators over time to assess the effects of wear and aerodynamic load by using the transfer function models is also presented. The frequency responses indicate consistent actuator behavior throughout the wind tunnel test and only slight degradation in effectiveness due to aerodynamic hinge loading. The resulting actuator models have been used in design, analysis, and simulation of controllers for the BACT to successfully suppress flutter over a wide range of conditions.

  7. Inactivation of the panE Gene in Lactococcus lactis Enhances Formation of Cheese Aroma Compounds

    PubMed Central

    de Cadiñanos, Luz P. Gómez; García-Cayuela, Tomás; Yvon, Mireille; Martinez-Cuesta, M. Carmen; Peláez, Carmen

    2013-01-01

    Hydroxyacid dehydrogenases limit the conversion of ?-keto acids into aroma compounds. Here we report that inactivation of the panE gene, encoding the ?-hydroxyacid dehydrogenase activity in Lactococcus lactis, enhanced the formation of 3-methylbutanal and 3-methylbutanol. L. lactis IFPL953?panE was an efficient strain producing volatile compounds related to cheese aroma. PMID:23524675

  8. Transfer of DNA killer plasmids from Kluyveromyces lactis to Kluyveromyces fragilis and Candida pseudotropicalis.

    PubMed

    Sugisaki, Y; Gunge, N; Sakaguchi, K; Yamasaki, M; Tamura, G

    1985-12-01

    Killer plasmids pGKL1 and pGKL2 of double-stranded linear DNAs were transferred from Kluyveromyces lactis to strains of Kluyveromyces fragilis and Candida pseudotropicalis. The resultant killer strains produced 17-fold and 6-fold larger amounts of killer toxin than K. lactis did, respectively. The killer toxin produced by each species appeared to be a glycoprotein. PMID:4066615

  9. Complete genome sequence of Lactococcus lactis S0, an efficient producer of nisin.

    PubMed

    Zhao, Fangyuan; Ma, Hongchu; Lu, Ying; Teng, Kunling; Kang, Xusheng; Wang, Fangfang; Yang, Xiaopan; Zhong, Jin

    2015-03-20

    Lactococcus lactis S0 is a nisin Z-producing strain isolated from milk, and the nisin production of the strain can reach 4000 IU/ml under fermenting condition. Here, we present the complete genome sequence of L. lactis S0 which includes a single circular chromosome. PMID:25660422

  10. Cloning and nucleotide sequence of a negative regulator gene for Klebsiella aerogenes arylsulfatase synthesis and identification of the gene as folA.

    PubMed Central

    Azakami, H; Sugino, H; Murooka, Y

    1992-01-01

    A negative regulator gene for synthesis of arylsulfatase in Klebsiella aerogenes was cloned. Deletion analysis showed that the regulator gene was located within a 1.6-kb cloned segment. Transfer of the plasmid, which contains the cloned fragment, into constitutive atsR mutant strains of K. aerogenes resulted in complementation of atsR; the synthesis of arylsulfatase was repressed in the presence of inorganic sulfate or cysteine, and this repression was relieved, in each case, by the addition of tyramine. The nucleotide sequence of the 1.6-kb fragment was determined. From the amino acid sequence deduced from the DNA sequence, we found two open reading frames. One of them lacked the N-terminal region but was highly homologous to the gene which codes for diadenosine tetraphosphatase (apaH) in Escherichia coli. The other open reading frame was located counterclockwise to the apaH-like gene. This gene was highly homologous to the gene which codes for dihydrofolate reductase (folA) in E. coli. We detected 30 times more activity of dihydrofolate reductase in the K. aerogenes strains carrying the plasmid, which contains the arylsulfatase regulator gene, than in the strains without plasmid. Further deletion analysis showed that the K. aerogenes folA gene is consistent with the essential region required for the repression of arylsulfatase synthesis. Transfer of a plasmid containing the E. coli folA gene into atsR mutant cells of K. aerogenes resulted in repression of the arylsulfatase synthesis. Thus, we conclude that the folA gene codes a negative regulator for the ats operon. PMID:1551851

  11. Encapsulated Lactococcus lactis with enhanced gastrointestinal survival for the development of folate enriched functional foods.

    PubMed

    Divya, Jayakumar Beena; Nampoothiri, Kesavan Madhavan

    2015-01-01

    Two lactic acid bacteria (LAB) isolated from cow's milk were identified as Lactococcus lactis strains and designated as L. lactis CM22 and L. lactis CM28. They were immobilised by co-encapsulation using alginate and mannitol and by hybrid entrapment with skim milk, glycerol, CaCO3 and alginate. The encapsulated cells survived better in simulated gastrointestinal conditions compared to the free cells. The percentage survival of probiotics encapsulated by hybrid entrapment method was 62.74% for L. lactis CM22 and 68% for L. lactis CM28. Studies to check their efficacy in fermentative fortification of skim milk and ice cream revealed an enhancement in folate level. PMID:25686721

  12. Short communication: Genotypic and phenotypic identification of environmental streptococci and association of Lactococcus lactis ssp. lactis with intramammary infections among different dairy farms.

    PubMed

    Werner, B; Moroni, P; Gioia, G; Lavín-Alconero, L; Yousaf, A; Charter, M E; Carter, B Moslock; Bennett, J; Nydam, D V; Welcome, F; Schukken, Y H

    2014-11-01

    Lactococcus species are counted among a large and closely related group of environmental streptococci and streptococci-like bacteria that include bovine mastitis pathogenic Streptococcus, Enterococcus, and Aerococcus species. Phenotypic and biochemical identification methods can be inaccurate and unreliable for species within this group, particularly for Lactococcus spp. As a result, the incidence of Lactococcus spp. on the farm may have been historically underreported and consequently little is known about the clinical importance of this genus as a mastitis pathogen. We used molecular genetic identification methods to accurately differentiate 60 environmental streptococci and streptococci-like bacteria isolated from cows with high somatic cell count and chronic intramammary infection (IMI; >2 somatic cell scores above 4) among 5 geographically distinct farms in New York and Minnesota that exhibited an observed increase in IMI. These isolates were phenotypically identified as Streptococcus uberis and Streptococcus spp. Genetic methods identified 42 isolates (70%) as Lactococcus lactis ssp. lactis, including all 10 isolates originally phenotypically identified as Streptococcus uberis. Antibiotic inhibition testing of all Lc. lactis ssp. lactis showed that 7 isolates were resistant to tetracycline. In the present study, a predominance of Lc. lactis ssp. lactis was identified in association with chronic, clinical bovine IMI among all 5 farms and characterized antimicrobial resistance for treatment therapies. Routine use by mastitis testing labs of molecular identification methods for environmental streptococci and streptococci-like bacteria can further define the role and prevalence of Lc. lactis ssp. lactis in association with bovine IMI and may lead to more targeted therapies. PMID:25242419

  13. Function of Ubiquinone in Electron Transport from Reduced Nicotinamide Adenine Dinucleotide to Nitrate and Oxygen in Aerobacter aerogenes

    PubMed Central

    Knook, D. L.; Planta, R. J.

    1971-01-01

    The possible role of quinones in the electron transport system of Aerobacter aerogenes was investigated. The only quinone found in measurable amounts in bacteria grown in minimal media under both aerobic and anaerobic conditions was ubiquinone-8. Membrane-bound ubiquinone-8 could be removed by extraction with pentane, or destroyed by ultraviolet irradiation, with a concomitant loss of both reduced nicotinamide adenine dinucleotide (NADH) oxidase and NADH-linked respiratory nitrate reductase activity. In the extracted membrane preparations, these enzymatic activities could be restored, both to the same degree, by incorporation of ubiquinone-6, -8, or -10, but not by incorporation of menaquinones. The NADH oxidation and the nitrate reduction were sensitive to the respiratory inhibitors dicoumarol, lapachol, and cyanide. The results obtained indicate that ubiquinone-8 mediates the electron transport between NADH and oxygen as well as between NADH and nitrate. Branching of the electron transport chain to oxygen and nitrate occurs after an initial common pathway. PMID:4100202

  14. Function of ubiquinone in electron transport from reduced nicotinamide adenine dinucleotide to nitrate and oxygen in Aerobacter aerogenes.

    PubMed

    Knook, D L; Planta, R J

    1971-02-01

    The possible role of quinones in the electron transport system of Aerobacter aerogenes was investigated. The only quinone found in measurable amounts in bacteria grown in minimal media under both aerobic and anaerobic conditions was ubiquinone-8. Membrane-bound ubiquinone-8 could be removed by extraction with pentane, or destroyed by ultraviolet irradiation, with a concomitant loss of both reduced nicotinamide adenine dinucleotide (NADH) oxidase and NADH-linked respiratory nitrate reductase activity. In the extracted membrane preparations, these enzymatic activities could be restored, both to the same degree, by incorporation of ubiquinone-6, -8, or -10, but not by incorporation of menaquinones. The NADH oxidation and the nitrate reduction were sensitive to the respiratory inhibitors dicoumarol, lapachol, and cyanide. The results obtained indicate that ubiquinone-8 mediates the electron transport between NADH and oxygen as well as between NADH and nitrate. Branching of the electron transport chain to oxygen and nitrate occurs after an initial common pathway. PMID:4100202

  15. Caractérisation de la flore bactérienne des péritonites communautaires opérées au Burkina Faso

    PubMed Central

    Sanou, Mahamoudou; Ky, Armand; Ouangre, Edgard; Bisseye, Cyrille; Sanou, Adama; Nagalo, Bolni Marius; Sanou, Drissa; Simporé, Jacques; Sangare, Lassana; Traore, Rasmata

    2014-01-01

    Introduction La péritonite communautaire est une urgence chirurgicale récurrente chez l'adulte qui constitue une préoccupation majeure pour le chirurgien et l'anesthésiste-réanimateur dans sa prise en charge. L'objectif de cette étude était d’établir non seulement le profil bactériologique des péritoniques communautaires opérées dans le service de chirurgie générale et digestive du CHU-YO mais aussi d’évaluer la sensibilité aux antibiotiques des souches bactériennes isolées à partir de ces dernières. Méthodes Cent six (106) patients ont été recrutés dans cette étude et des prélèvements bactériologiques préopératoires ont été effectués dont 63 se sont révélés positifs. Résultats Sur les 63 prélèvements positifs, 78 germes ont été isolés soit une moyenne de 1,2 germe par échantillon. Escherichia coli été le germe le plus fréquemment isolé (33,3%), suivi des anaérobies (11,5%), Streptococcus sp (9%), Klebsiella pneumoniae (6,4%) et Staphylococcus sp (5,1%). Les antibiotiques les plus efficaces sur les bactéries identifiées dans les péritonites communautaires étaient respectivement l'imipenème (100%), la colistine (100%), la céftriaxone (100%), et la ciprofloxacine (65,4%) Conclusion Le profil de sensibilité des bactéries identifiées dans les principales péritonites communautaires aux antibiotiques montre une augmentation inquiétante du nombre de souches résistantes, notamment à l'association amoxicilline/acide clavulanique PMID:25360201

  16. Rapid Fluorescence Assessment of the Viability of Stressed Lactococcus lactis

    PubMed Central

    Bunthof, Christine J.; van den Braak, Sabina; Breeuwer, Pieter; Rombouts, Frank M.; Abee, Tjakko

    1999-01-01

    The aim of this study was to establish the use of the fluorescent probes carboxyfluorescein (cF) and propidium iodide (PI) for rapid assessment of viability, using Lactococcus lactis subsp. lactis ML3 exposed to different stress treatments. The cF labeling indicated the reproductive capacity of mixtures of nontreated cells and cells killed at 70°C very well. However, after treatment up to 60°C the fraction of cF-labeled cells remained high, whereas the survival decreased for cells treated at above 50°C and was completely lost for those treated at 60°C. In an extended series of experiments, cell suspensions were exposed to heating, freezing, low pH, or bile salts, after which the colony counts, acidification capacity, glycolytic activity, PI exclusion, cF labeling, and cF efflux were measured and compared. The acidification capacity corresponded with the number of CFU. The glycolytic activity, which is an indicator of vitality, was more sensitive to the stress conditions than the reproduction, acidification, and fluorescence parameters. The cF labeling depended on membrane integrity, as was confirmed by PI exclusion. The fraction of cF-labeled cells was not a general indicator of reproduction or acidification, nor was PI exclusion or cF labeling capacity (the internal cF concentration). When the cells were labeled by cF, a subsequent lactose-energized efflux assay was needed for decisive viability assessment. This novel assay proved to be a good and rapid indicator of the reproduction and acidification capacities of stressed L. lactis and has potential for physiological research and dairy applications related to lactic acid bacteria. PMID:10427066

  17. Engineering trehalose synthesis in Lactococcus lactis for improved stress tolerance.

    PubMed

    Carvalho, Ana Lúcia; Cardoso, Filipa S; Bohn, Andreas; Neves, Ana Rute; Santos, Helena

    2011-06-01

    Trehalose accumulation is a common cell defense strategy against a variety of stressful conditions. In particular, our team detected high levels of trehalose in Propionibacterium freudenreichii in response to acid stress, a result that led to the idea that endowing Lactococcus lactis with the capacity to synthesize trehalose could improve the acid tolerance of this organism. To this end, we took advantage of the endogenous genes involved in the trehalose catabolic pathway of L. lactis, i.e., trePP and pgmB, encoding trehalose 6-phosphate phosphorylase and ?-phosphoglucomutase, respectively, which enabled the synthesis of trehalose 6-phosphate. Given that L. lactis lacks trehalose 6-phosphate phosphatase, the respective gene, otsB, from the food-grade organism P. freudenreichii was used to provide the required activity. The trehalose yield was approximately 15% in resting cells and in mid-exponential-phase cells grown without pH control. The intracellular concentration of trehalose reached maximal values of approximately 170 mM, but at least 67% of the trehalose produced was found in the growth medium. The viability of mutant and control strains was examined after exposure to heat, cold or acid shock, and freeze-drying. The trehalose-producing strains showed improved tolerance (5- to 10-fold-higher survivability) to acid (pH 3) and cold shock (4°C); there was also a strong improvement in cell survival in response to heat shock (45°C), and no protection was rendered against dehydration. The insight provided by this work may help the design of food-grade strains optimized for the dairy industry as well as for oral drug delivery. PMID:21515730

  18. Genetically Modified Lactococcus lactis for Delivery of Human Interleukin-10 to Dendritic Cells

    PubMed Central

    Huibregtse, Inge L.; Zaat, Sebatian A.; Kapsenberg, Martien L.; Sartori da Silva, Maria A.; Peppelenbosch, Maikel P.; van Deventer, Sander J. H.; Braat, Henri

    2012-01-01

    Interleukin-10 (IL-10) plays an indispensable role in mucosal tolerance by programming dendritic cells (DCs) to induce suppressor Th-cells. We have tested the modulating effect of L. lactis secreting human IL-10 (L.  lactisIL-10) on DC function in vitro. Monocyte-derived DC incubated with L.  lactisIL-10 induced effector Th-cells that markedly suppressed the proliferation of allogenic Th-cells as compared to L. lactis. This suppressive effect was only seen when DC showed increased CD83 and CD86 expression. Furthermore, enhanced production of IL-10 was measured in both L.  lactisIL-10-derived DC and Th-cells compared to L. lactis-derived DC and Th-cells. Neutralizing IL-10 during DC-Th-cell interaction and coculturing L.  lactisIL-10-derived suppressor Th-cells with allogenic Th-cells in a transwell system prevented the induction of suppressor Th-cells. Only 130 pg/mL of bacterial-derived IL-10 and 40 times more exogenously added recombinant human IL-10 were needed during DC priming for the generation of suppressor Th-cells. The spatially restricted delivery of IL-10 by food-grade bacteria is a promising strategy to induce suppressor Th-cells in vivo and to treat inflammatory diseases. PMID:21811497

  19. Complete Genome Sequence of the Prototype Lactic Acid Bacterium Lactococcus lactis subsp. cremoris MG1363▿

    PubMed Central

    Wegmann, Udo; O'Connell-Motherway, Mary; Zomer, Aldert; Buist, Girbe; Shearman, Claire; Canchaya, Carlos; Ventura, Marco; Goesmann, Alexander; Gasson, Michael J.; Kuipers, Oscar P.; van Sinderen, Douwe; Kok, Jan

    2007-01-01

    Lactococcus lactis is of great importance for the nutrition of hundreds of millions of people worldwide. This paper describes the genome sequence of Lactococcus lactis subsp. cremoris MG1363, the lactococcal strain most intensively studied throughout the world. The 2,529,478-bp genome contains 81 pseudogenes and encodes 2,436 proteins. Of the 530 unique proteins, 47 belong to the COG (clusters of orthologous groups) functional category “carbohydrate metabolism and transport,” by far the largest category of novel proteins in comparison with L. lactis subsp. lactis IL1403. Nearly one-fifth of the 71 insertion elements are concentrated in a specific 56-kb region. This integration hot-spot region carries genes that are typically associated with lactococcal plasmids and a repeat sequence specifically found on plasmids and in the “lateral gene transfer hot spot” in the genome of Streptococcus thermophilus. Although the parent of L. lactis MG1363 was used to demonstrate lysogeny in Lactococcus, L. lactis MG1363 carries four remnant/satellite phages and two apparently complete prophages. The availability of the L. lactis MG1363 genome sequence will reinforce its status as the prototype among lactic acid bacteria through facilitation of further applied and fundamental research. PMID:17307855

  20. Adhesion and immunomodulatory effects of Bifidobacterium lactis HN019 on intestinal epithelial cells INT-407

    PubMed Central

    Liu, Chang; Zhang, Zhuo-Yang; Dong, Ke; Guo, Xiao-Kui

    2010-01-01

    AIM: To elucidate the adherence and immunomodulatory properties of a probiotic strain Bifidobacterium lactis (B. lactis) HN019. METHODS: Adhesion assays of B. lactis HN019 and Salmonella typhimurium (S. typhimurium) ATCC 14028 to INT-407 cells were carried out by detecting copies of species-specific genes with real-time polymerase chain reaction. Morphological study was further conducted by transmission electron microscopy. Interleukin-1β (IL-1β), interleukin-8, and tumor necrosis factor-α (TNF-α) gene expression were assessed while enzyme linked immunosorbent assay was used to detect IL-8 protein secretion. RESULTS: The attachment of S. typhimurium ATCC 14028 to INT407 intestinal epithelial cells was inhibited significantly by B. lactis HN019. B. lactis HN019 could be internalized into the INT-407 cells and attenuated IL-8 mRNA level at both baseline and S. typhimurium-induced pro-inflammatory responses. IL-8 secretion was reduced while IL-1β and TNF-α mRNA expression level remained unchanged at baseline after treated with B. lactis HN019. CONCLUSION: B. lactis HN019 does not up-regulate the intestinal epithelium expressed pro-inflammatory cytokine, it showed the potential to protect enterocytes from an acute inflammatory response induced by enteropathogen. PMID:20458767

  1. Essential oils affect populations of some rumen bacteria in vitro as revealed by microarray (RumenBactArray) analysis

    PubMed Central

    Patra, Amlan K.; Yu, Zhongtang

    2015-01-01

    In a previous study origanum oil (ORO), garlic oil (GAO), and peppermint oil (PEO) were shown to effectively lower methane production, decrease abundance of methanogens, and change abundances of several bacterial populations important to feed digestion in vitro. In this study, the impact of these essential oils (EOs, at 0.50 g/L) on the rumen bacterial community composition and population was further examined using the recently developed RumenBactArray. Species richness (expressed as number of operational taxonomic units, OTUs) in the phylum Firmicutes, especially those in the class Clostridia, was decreased by ORO and GAO, but increased by PEO, while that in the phylum Bacteroidetes was increased by ORO and PEO. Species richness in the genus Butyrivibrio was lowered by all the EOs. Increases of Bacteroidetes OTUs mainly resulted from increases of Prevotella OTUs. Overall, 67 individual OTUs showed significant differences (P ≤ 0.05) in relative abundance across the EO treatments. The predominant OTUs affected by EOs were diverse, including those related to Syntrophococcus sucromutans, Succiniclasticum ruminis, and Lachnobacterium bovis, and those classified to Prevotella, Clostridium, Roseburia, Pseudobutyrivibrio, Lachnospiraceae, Ruminococcaceae, Prevotellaceae, Bacteroidales, and Clostridiales. In total, 60 OTUs were found significantly (P ≤ 0.05) correlated with feed degradability, ammonia concentration, and molar percentage of volatile fatty acids. Taken together, this study demonstrated extensive impact of EOs on rumen bacterial communities in an EO type-dependent manner, especially those in the predominant families Prevotellaceae, Lachnospiraceae, and Ruminococcaceae. The information from this study may aid in understanding the effect of EOs on feed digestion and fermentation by rumen bacteria. PMID:25914694

  2. Essential oils affect populations of some rumen bacteria in vitro as revealed by microarray (RumenBactArray) analysis.

    PubMed

    Patra, Amlan K; Yu, Zhongtang

    2015-01-01

    In a previous study origanum oil (ORO), garlic oil (GAO), and peppermint oil (PEO) were shown to effectively lower methane production, decrease abundance of methanogens, and change abundances of several bacterial populations important to feed digestion in vitro. In this study, the impact of these essential oils (EOs, at 0.50 g/L) on the rumen bacterial community composition and population was further examined using the recently developed RumenBactArray. Species richness (expressed as number of operational taxonomic units, OTUs) in the phylum Firmicutes, especially those in the class Clostridia, was decreased by ORO and GAO, but increased by PEO, while that in the phylum Bacteroidetes was increased by ORO and PEO. Species richness in the genus Butyrivibrio was lowered by all the EOs. Increases of Bacteroidetes OTUs mainly resulted from increases of Prevotella OTUs. Overall, 67 individual OTUs showed significant differences (P ? 0.05) in relative abundance across the EO treatments. The predominant OTUs affected by EOs were diverse, including those related to Syntrophococcus sucromutans, Succiniclasticum ruminis, and Lachnobacterium bovis, and those classified to Prevotella, Clostridium, Roseburia, Pseudobutyrivibrio, Lachnospiraceae, Ruminococcaceae, Prevotellaceae, Bacteroidales, and Clostridiales. In total, 60 OTUs were found significantly (P ? 0.05) correlated with feed degradability, ammonia concentration, and molar percentage of volatile fatty acids. Taken together, this study demonstrated extensive impact of EOs on rumen bacterial communities in an EO type-dependent manner, especially those in the predominant families Prevotellaceae, Lachnospiraceae, and Ruminococcaceae. The information from this study may aid in understanding the effect of EOs on feed digestion and fermentation by rumen bacteria. PMID:25914694

  3. Characterization of Lactococcus lactis isolates from bovine mastitis.

    PubMed

    Plumed-Ferrer, Carme; Uusikylä, Kaisa; Korhonen, Jenni; von Wright, Atte

    2013-12-27

    Lactococcus lactis is a widely used mesophilic dairy starter and has been included in the Qualified Presumption of Safety (QPS) list of the European Food Safety Authority. However, it is increasingly found as the cause of human or animal infections, such as bovine mastitis, probably due to the improvement of the identification of the infective microorganisms. Since there are some grounds to suspect that at least certain variants of L. lactis may cause animal or human diseases, it is important to properly identify the differences between the strains associated with infections and the safe starter strains. Bovine mastitis isolates and dairy starter strains were genotypically characterized and clustered by the 16S rRNA gene sequence and RAPD-PCR fingerprint patterns, and phenotypically characterized by their tolerance to different stress conditions typically found in the intestinal tract of mammals, the carbohydrate- and antibiotic resistance profile, as well as the in vitro adhesion capacity to udder epithelial cells. Genotypically, there were no differences between the mastitis isolates and the dairy starter strains. However, there were clear phenotypic distinctions between mastitis isolates and typical starter strains, the former showing an increased tolerance to temperature, lysozyme, bile salts, pH and antibiotics, as well as improved carbohydrate fermentation capacity, and in vitro adhesion to udder epithelial cells. Although these differences might not be considered as actual virulence factors, they improve the ability of the strain to survive in the body of homeothermic animals and, interestingly, are also typical properties associated with potential probiotic strains. PMID:24080351

  4. Functional Expression of an Orchid Fragrance Gene in Lactococcus lactis

    PubMed Central

    Song, Adelene Ai Lian; Abdullah, Janna O.; Abdullah, Mohd Puad; Shafee, Norazizah; Rahim, Raha A.

    2012-01-01

    Vanda Mimi Palmer (VMP), an orchid hybrid of Vanda tesselata and Vanda Tan Chay Yan is a highly scented tropical orchid which blooms all year round. Previous studies revealed that VMP produces a variety of isoprenoid volatiles during daylight. Isoprenoids are well known to contribute significantly to the scent of most fragrant plants. They are a large group of secondary metabolites which may possess valuable characteristics such as flavor, fragrance and toxicity and are produced via two pathways, the mevalonate (MVA) pathway or/and the 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway. In this study, a sesquiterpene synthase gene denoted VMPSTS, previously isolated from a floral cDNA library of VMP was cloned and expressed in Lactococcus lactis to characterize the functionality of the protein. L. lactis, a food grade bacterium which utilizes the mevalonate pathway for isoprenoid production was found to be a suitable host for the characterization of plant terpene synthases. Through recombinant expression of VMPSTS, it was revealed that VMPSTS produced multiple sesquiterpenes and germacrene D dominates its profile. PMID:22408409

  5. Decarboxylation of ?-Keto Acids by Streptococcus lactis var. maltigenes1

    PubMed Central

    Tucker, J. S.; Morgan, M. E.

    1967-01-01

    Decarboxylation rates for a series of C-3 to C-6 ?-keto acids were determined in the presence of resting cells and cell-free extracts of Streptococcus lactis var. maltigenes. The C-5 and C-6 acids branched at the penultimate carbon atom were converted most rapidly to the respective aldehydes in the manner described for ?-carboxylases. Pyruvate and ?-ketobutyrate did not behave as ?-carboxylase substrates, in that O2 was absorbed when they were reacted with resting cells. The same effect with pyruvate was noted in a nonmalty S. lactis, accounting for CO2 produced by some “homofermentative” streptococci. Mixed substrate reactions indicated that the same enzyme was responsible for decarboxylation of ?-ketoisocaproate and ?-ketoisovalerate, but it appeared unlikely that this enzyme was responsible for the decarboxylation of pyruvate. Ultrasonic disruption of cells of the malty culture resulted in an extract inactive for decarboxylation of pyruvate in the absence of ferricyanide. Dialyzed cell-free extracts were inactive against all keto acids and could not be reactivated. PMID:6049293

  6. Prophage induction in Lactococcus lactis by the bacteriocin Lactococcin 972.

    PubMed

    Madera, Carmen; García, Pilar; Rodríguez, Ana; Suárez, Juan E; Martínez, Beatriz

    2009-01-31

    Lactococcin 972 (Lcn972) is a non-pore forming bacteriocin with a narrow spectrum of activity restricted to Lactococcus. Lcn972 inhibits the incorporation of cell wall precursors in the septum area, thereby inhibiting cell division. In this work, an additional inhibitory effect is described, namely, the induction of the lytic cycle of resident prophages in the lysogenic strain L. lactis IPLA 513. Lcn972 triggered the release of prophages in a concentration-dependent fashion. The extent of prophage induction was influenced by the physiological status of the cultures, being maximal at the early exponential growth phase. A microtiter based protocol was designed and the induction ability of several antimicrobials was compared. Prophages were activated by all cell wall biosynthesis inhibitors tested, although the levels of induction were lower than those obtained after activation of the SOS response. As far as we know, this is the first report of prophage induction by an antimicrobial peptide. Since Lcn972 is active against L. lactis strains currently used in commercial starters, promising applications for dairy fermentations are discussed. PMID:19056139

  7. Cholate-Stimulated Biofilm Formation by Lactococcus lactis Cells ? †

    PubMed Central

    Zaidi, Arsalan Haseeb; Bakkes, Patrick J.; Krom, Bastiaan P.; van der Mei, Henny C.; Driessen, Arnold J. M.

    2011-01-01

    Bile acid resistance by Lactococcus lactis depends on the ABC-type multidrug transporter LmrCD. Upon deletion of the lmrCD genes, cells can reacquire bile acid resistance upon prolonged exposure to cholate, yielding the ?lmrCDr strain. The resistance mechanism in this strain is non-transporter based. Instead, cells show a high tendency to flocculate, suggesting cell surface alterations. Contact angle measurements demonstrate that the ?lmrCDr cells are equipped with an increased cell surface hydrophilicity compared to those of the parental and wild-type strains, while the surface hydrophilicity is reduced in the presence of cholate. ?lmrCDr cells are poor in biofilm formation on a hydrophobic polystyrene surface, but in the presence of subinhibitory concentrations of cholate, biofilm formation is strongly stimulated. Biofilm cells show an enhanced extracellular polymeric substance production and are highly resistant to bile acids. These data suggest that non-transporter-based cholate resistance in L. lactis is due to alterations in the cell surface that stimulate cells to form resistant biofilms. PMID:21335382

  8. Expression of Helicobacter pylori hspA Gene in Lactococcus lactis NICE System and Experimental Study on Its Immunoreactivity

    PubMed Central

    Zhang, Xiao-Juan; Feng, Shu-Ying; Li, Zhi-Tao; Feng, Yan-Ming

    2015-01-01

    Aim. The aim of this study was to develop an oral Lactococcus lactis (L. lactis) vaccine against Helicobacter pylori (H. pylori). Methods. After L. lactis NZ3900/pNZ8110-hspA was constructed, growth curves were plotted to study whether the growth of recombinant L. lactis was affected after hspA was cloned into L. lactis and whether the growth of empty bacteria, empty plasmid bacteria, and recombinant L. lactis was affected by different concentrations of Nisin; SDS-PAGE and Western blot were adopted, respectively, to detect the HspA expressed by recombinant L. lactis and its immunoreactivity. Results. There was no effect observed from the growth curve after exogenous gene hspA was cloned into L. lactis NZ3900; different concentrations of Nisin did not affect the growth of NZ3900 and NZ3900/pNZ8110, while different concentrations of Nisin inhibited the growth of NZ3900/pNZ8110-hspA except 10 ng/mL Nisin. No HspA strip was observed from SDS-PAGE. Western blot analysis showed that HspA expressed by recombinant bacteria had favorable immunoreactivity. Conclusion. The growth of recombinant L. lactis was suppressed even though a small amount of HspA had been induced to express. Therefore recombinant L. lactis only express HspA which was not suitable to be oral vaccine against Helicobacter pylori. PMID:25977689

  9. Molecular analyses of the lactococcin A gene cluster from Lactococcus lactis subsp. lactis biovar diacetylactis WM4.

    PubMed Central

    Stoddard, G W; Petzel, J P; van Belkum, M J; Kok, J; McKay, L L

    1992-01-01

    The genes responsible for bacteriocin production and immunity in Lactococcus lactis subsp. lactis biovar diacetylactis WM4 were localized and characterized by DNA restriction fragment deletion, subcloning, and nucleotide sequence analysis. The nucleotide sequence of a 5.6-kb AvaII restriction fragment revealed a cluster with five complete open reading frames (ORFs) in the same orientation. DNA and protein homology analyses, combined with deletion and Tn5 insertion mutagenesis, implicated four of the ORFs in the production of and immunity to lactococcin A. The last two ORFs in the cluster were the lactococcin A structural and immunity genes, lcnA and lciA. The two ORFs immediately upstream of lcnA and lciA were designated lcnC and lcnD, and the proteins that they encoded showed similarities to proteins of signal sequence-independent secretion systems. lcnC encodes a protein of 716 amino acids that could belong to the HlyB family of ATP-dependent membrane translocators. LcnC contains an ATP binding domain in a conserved C-terminal stretch of approximately 200 amino acids and three putative hydrophobic segments in the N terminus. The lcnD product, LcnD, of 474 amino acids, is essential for lactococcin A expression and shows structural similarities to HlyD and its homologs. On the basis of these results, a secretion apparatus that is essential for the full expression of active lactococcin A is postulated. PMID:1622271

  10. An evaluation and partial characterization of a bacteriocin produced by Lactococcus lactis subsp lactis ST1 isolated from goat milk

    PubMed Central

    Taheri, Parinaz; Samadi², Nasrin; Ehsani, Mohammad Reza; Khoshayand, Mohammad Reza; Jamalifar, Hossein

    2012-01-01

    A bacteriocin-like inhibitory substance producing Lactococcus lactis subsp lactis strain, ST1, isolated from goat milk of Iranian origin and with broad spectrum of activity and desirable technical properties was used for evaluating some futures of bacteriocin inhibitory activity. Cell growth and bacteriocin production studies were carried out in MRS medium incubated statically under uncontrolled pH condition. The antibacterial activity presented a primary metabolite pattern and showed a rapid decrease at the stationary phase. Microaerobiosis and capnophily growth conditions resulted in higher bacteriocin production while aerobiosis showed negative effect on both cell growth and bacteriocin production. Bacteriocin production, on the other hand, was favored in MRS broth (pH; 6.5) inoculated with 0.1 ml l-1 fresh culture when incubation was carried out at 30 °C. This indicated that the conditions resulted in higher levels of growth were frequently favoring bacteriocin production by ST1 as well. Decrease in activity, at the stationary growth phase, was much pronounced in favored growth condition. Nutrient depletion, deferent effect of low pH on bacteriocin production and/or protein degradation seemed more responsible for this phenomenon. The study also provided further data on new method for bacteriocin release from the cell wall of producer. It was clearly shown that both heating and ultrasound shock for 5 min at pH 2 could increase bacteriocin activity significantly. The release was more pronounced in the presence of 0.5% Tween80. PMID:24031976

  11. L+-lactic acid production from starch by a novel amylolytic Lactococcus lactis subsp. lactis B84.

    PubMed

    Petrov, Kaloyan; Urshev, Zoltan; Petrova, Penka

    2008-06-01

    A new Lactococcus lactis subsp. lactis B84, capable of utilizing starch as a sole carbon source and producing L(+)-lactate, was isolated from spontaneously fermented rye sourdough. Aiming at maximum lactic acid productivity, the components of the media and the cultivation conditions were varied. In MRS-starch medium (with absence of yeast and meat extracts), at 33 degrees C, agitation 200 rpm and pH 6.0 for 6 days complete starch hydrolysis occurred and 5.5 gl(-1) lactic acid were produced from 18 gl(-1) starch. The identification of strain B84 was based on genetic criteria. Amplified ribosomal DNA restriction analysis (ARDRA), PCR with species-specific primers and sequencing of the 16S rDNA proved its species affiliation. Four genes for enzymes, involved in starch degradation were detected in B84 genome: amyL, amyY, glgP and apu, coding cytoplasmic and extracellular alpha-amylases, glycogen phosphorylase and amylopullulanase, respectively. Reverse transcription PCR experiments showed that both genes, encoding alpha-amylases (amyL and amyY) were expressed into mRNAs, whereas apu and glgP were not. Amylase activity assay was performed at different pH and temperatures. The cell-bond amylase proved to be the key enzyme, involved in the starch hydrolysis with maximum activity at 45 degrees C and pH 5.4. PMID:18456109

  12. Antilisterial Activity of Nisin-Like Bacteriocin-Producing Lactococcus lactis subsp. lactis Isolated from Traditional Sardinian Dairy Products

    PubMed Central

    Cosentino, Sofia; Fadda, Maria Elisabetta; Deplano, Maura; Melis, Roberta; Pomata, Rita; Pisano, Maria Barbara

    2012-01-01

    With the aim of selecting LAB strains with antilisterial activity to be used as protective cultures to enhance the safety of dairy products, the antimicrobial properties of 117 Lactococcus lactis subsp. lactis isolated from artisanal Sardinian dairy products were evaluated, and six strains were found to produce bacteriocin-like substances. The capacity of these strains to antagonize Listeria monocytogenes during cocultivation in skimmed milk was evaluated, showing a reduction of L. monocytogenes counts of approximately 4 log units compared to the positive control after 24?h of incubation. In order for a strain to be used as bioprotective culture, it should be carefully evaluated for the presence of virulence factors, to determine what potential risks might be involved in its use. None of the strains tested was found to produce biogenic amines or to possess haemolytic activity. In addition, all strains were sensitive to clinically important antibiotics such as ampicillin, tetracycline, and vancomycin. Our results suggest that these bac+ strains could be potentially applied in cheese manufacturing to control the growth of L. monocytogenes. PMID:22536018

  13. Effect of selenium-enriched exopolysaccharide produced by Lactococcus lactis subsp. lactis on signaling molecules in mouse spleen lymphocytes.

    PubMed

    Liu, Lu; Pan, Daodong; Zeng, Xiaoqun; Li, Hua

    2013-10-01

    Selenium-enriched exopolysaccharides (Se-EPS) produced by Lactococcus lactis subsp. lactis can be used as a safe and effective selenium (Se) supplement. Analysis of the Se content and monosaccharide components of Se-EPS demonstrated that it consisted of mannose, fucose, ribose, glucose, galactose, and arabinose with a molar ratio of 5.48 : 0.39 : 9.77 : 4.03 : 1.00 : 1.92, and an Se content of 183.263 ?g g(-1). The differing effects of Se-EPS and EPS on calcium channels and certain key secondary messengers in spleen lymphocytes were examined and compared. Results showed that low-dose Se-EPS, but not EPS, increased the intracellular calcium ([Ca(2+)]i) levels of mouse spleen lymphocytes. Se-EPS also increased the expression and phosphorylation of Ca(2+)-calmodulin-dependent kinase (CaMK) II in lymphocytes. In addition, increased intracellular Ca(2+) levels were also found in the cells with blocked Ca(2+) channels. We speculated that Se-EPS enhanced the activation and proliferation of lymphocytes through calcium signaling by drawing from extracellular and intracellular stores. Low-dose Se-EPS also enhanced NO production, cAMP levels and PKA activity. We speculated that low-dose Se-EPS may activate certain pathways, including the calcium channel, NO, cAMP, and PKA related pathways. PMID:24056684

  14. Study of the Citrate Metabolism of Lactococcus lactis subsp. lactis Biovar Diacetylactis by Means of C Nuclear Magnetic Resonance.

    PubMed

    Verhue, W M; Tjan, F S

    1991-11-01

    The metabolic fate of citrate and pyruvate in four strains of Lactococcus lactis subsp. lactis biovar diacetylactis has been studied by means of C nuclear magnetic resonance, using as a substrate either [3-C]pyruvic acid or custom-synthesized citric acid that is C labeled either at carbons 2 and 4 or at carbon 3. The fermentations were carried out batchwise in modified M17 broth. For the actual conversions of the C-labeled substrates, cells at the end of their logarithmic growth phase were used to minimize the conversion to lactic acid. A mass balance of the main citric acid metabolites was obtained; the four strains produced from 50 to 70% (on a molar basis) lactic acid from either citrate or pyruvate. The remaining 50 to 30% was converted mainly to either alpha-acetolactic acid (for one strain) or acetoin (for the other three strains). One of the strains produced an exceptionally high concentration of the diacetyl precursor alpha-acetolactic acid. Another strain (SDC6) also produced alpha-acetolactic acid, but this was decarboxylated to acetoin at a high rate. The C nuclear magnetic resonance method confirmed that the biosynthesis of alpha-acetolactic acid occurs via condensation of pyruvate and "active" acetaldehyde. Diacetyl was not found as a direct metabolite of citrate or pyruvate metabolism. PMID:16348592

  15. Quantitative PCR for the specific quantification of Lactococcus lactis and Lactobacillus paracasei and its interest for Lactococcus lactis in cheese samples.

    PubMed

    Achilleos, Christine; Berthier, Françoise

    2013-12-01

    The first objective of this work was to develop real-time quantitative PCR (qPCR) assays to quantify two species of mesophilic lactic acid bacteria technologically active in food fermentation, including cheese making: Lactococcus lactis and Lactobacillus paracasei. The second objective was to compare qPCR and plate counts of these two species in cheese samples. Newly designed primers efficiently amplified a region of the tuf gene from the target species. Sixty-three DNA samples from twenty different bacterial species, phylogenetically related or commonly found in raw milk and dairy products, were selected as positive and negative controls. Target DNA was successfully amplified showing a single peak on the amplicon melting curve; non-target DNA was not amplified. Quantification was linear over 5 log units (R(2) > 0.990), down to 22 gene copies/?L per well for Lc. lactis and 73 gene copies/?L per well for Lb. paracasei. qPCR efficiency ranged from 82.9% to 93.7% for Lc. lactis and from 81.1% to 99.5% for Lb. paracasei. At two stages of growth, Lc. lactis was quantified in 12 soft cheeses and Lb. paracasei in 24 hard cooked cheeses. qPCR proved to be useful for quantifying Lc. lactis, but not Lb. paracasei. PMID:24010609

  16. Integrated evaluation of aerogenic pollution by air-transported heavy metals (Pb, Cd, Ni, Zn, Mn and Cu) in the analysis of the main deposit media.

    PubMed

    Baltr?nait?, Edita; Baltr?nas, Pranas; Lietuvninkas, Arvydas; Serevi?ien?, Vaida; Zuokait?, Egl?

    2014-01-01

    The composition of the ambient air is constantly changing; therefore, the monitoring of ambient air quality to detect the changes caused by aerogenic pollutants makes the essential part of general environmental monitoring. To achieve more effective improvement of the ambient air quality, the Directive 2008/50/EC on 'Ambient Air Quality and Cleaner Air for Europe' was adopted by the European Parliament and the European Council. It informed the public and enterprises about a negative effect of pollution on humans, animals and plants, as well as about the need for monitoring aerogenic pollutants not only at the continuous monitoring stations but also by using indicator methods, i.e. by analysing natural deposit media. The problem of determining the relationship between the accumulation level of pollutants by a deposit medium and the level of air pollution and its risks is constantly growing in importance. The paper presents a comprehensive analysis of the response of the main four deposit media, i.e. snow cover, soil, pine bark and epigeic mosses, to the long-term pollution by aerogenic pollutants which can be observed in the area of oil refinery influence. Based on the quantitative expressions of the amounts of the accumulated pollutants in the deposit media, the territory of the oil refinery investigated in this paper has been referred to the areas of mild or moderate pollution. PMID:23933956

  17. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) and 1 CFR part 51. Copies are available from the National Academy Press, 2101 Constitution Ave. NW... Streptococcus lactis). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC...

  18. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) and 1 CFR part 51. Copies are available from the National Academy Press, 2101 Constitution Ave. NW... Streptococcus lactis). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC...

  19. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...) and 1 CFR part 51. Copies are available from the National Academy Press, 2101 Constitution Ave. NW... Streptococcus lactis). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC...

  20. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) and 1 CFR part 51. Copies are available from the National Academy Press, 2101 Constitution Ave. NW... Streptococcus lactis). The preparation contains the enzyme aminopeptidase (CAS Reg. No. 9031-94-1; EC...

  1. The Autoproteolysis of Lactococcus lactis Lactocepin III Affects Its Specificity towards β-Casein

    PubMed Central

    Flambard, Benedicte; Juillard, Vincent

    2000-01-01

    The effect of autoproteolysis of Lactococcus lactis lactocepin III on its specificity towards β-casein was investigated. β-Casein degradation was performed by using either an autolysin-defective derivative of L. lactis MG1363 carrying the proteinase genes of L. lactis SK11, which was unable to transport oligopeptides, or autoproteolyzed enzyme purified from L. lactis SK11. Comparison of the peptide pools by high-performance liquid chromatography analysis revealed significant differences. To analyze these differences in more detail, the peptides released by the cell-anchored proteinase were identified by on-line coupling of liquid chromatography to mass spectrometry. More than 100 oligopeptides were released from β-casein by the cell-anchored proteinase. Analysis of the cleavage sites indicated that the specificity of peptide bond cleavage by the cell-anchored proteinase differed significantly from that of the autoproteolyzed enzyme. PMID:11097880

  2. The Transcriptional and Gene Regulatory Network of Lactococcus lactis MG1363 during Growth in Milk

    PubMed Central

    de Jong, Anne; Hansen, Morten E.; Kuipers, Oscar P.; Kilstrup, Mogens; Kok, Jan

    2013-01-01

    In the present study we examine the changes in the expression of genes of Lactococcus lactis subspecies cremoris MG1363 during growth in milk. To reveal which specific classes of genes (pathways, operons, regulons, COGs) are important, we performed a transcriptome time series experiment. Global analysis of gene expression over time showed that L. lactis adapted quickly to the environmental changes. Using upstream sequences of genes with correlated gene expression profiles, we uncovered a substantial number of putative DNA binding motifs that may be relevant for L. lactis fermentative growth in milk. All available novel and literature-derived data were integrated into network reconstruction building blocks, which were used to reconstruct and visualize the L. lactis gene regulatory network. This network enables easy mining in the chrono-transcriptomics data. A freely available website at http://milkts.molgenrug.nl gives full access to all transcriptome data, to the reconstructed network and to the individual network building blocks. PMID:23349698

  3. Expanding the molecular toolbox for Lactococcus lactis: construction of an inducible thioredoxin gene fusion expression system

    PubMed Central

    2011-01-01

    Background The development of the Nisin Inducible Controlled Expression (NICE) system in the food-grade bacterium Lactococcus lactis subsp. cremoris represents a cornerstone in the use of Gram-positive bacterial expression systems for biotechnological purposes. However, proteins that are subjected to such over-expression in L. lactis may suffer from improper folding, inclusion body formation and/or protein degradation, thereby significantly reducing the yield of soluble target protein. Although such drawbacks are not specific to L. lactis, no molecular tools have been developed to prevent or circumvent these recurrent problems of protein expression in L. lactis. Results Mimicking thioredoxin gene fusion systems available for E. coli, two nisin-inducible expression vectors were constructed to over-produce various proteins in L. lactis as thioredoxin fusion proteins. In this study, we demonstrate that our novel L. lactis fusion partner expression vectors allow high-level expression of soluble heterologous proteins Tuc2009 ORF40, Bbr_0140 and Tuc2009 BppU/BppL that were previously insoluble or not expressed using existing L. lactis expression vectors. Over-expressed proteins were subsequently purified by Ni-TED affinity chromatography. Intact heterologous proteins were detected by immunoblotting analyses. We also show that the thioredoxin moiety of the purified fusion protein was specifically and efficiently cleaved off by enterokinase treatment. Conclusions This study is the first description of a thioredoxin gene fusion expression system, purposely developed to circumvent problems associated with protein over-expression in L. lactis. It was shown to prevent protein insolubility and degradation, allowing sufficient production of soluble proteins for further structural and functional characterization. PMID:21827702

  4. Lactococcus lactis Metabolism and Gene Expression during Growth on Plant Tissues

    PubMed Central

    Golomb, Benjamin L.

    2014-01-01

    Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484

  5. Bifidobacterium lactis 420 and fish oil enhance intestinal epithelial integrity in Caco-2 cells.

    PubMed

    Mokkala, Kati; Laitinen, Kirsi; Röytiö, Henna

    2016-03-01

    Increased intestinal permeability is a predisposing factor for low-grade inflammation-associated conditions, including obesity and type 2 diabetes. Dietary components may influence intestinal barrier integrity. We hypothesized that the dietary supplements Bifidobacterium lactis 420, Lactobacillus rhamnosus HN001, and fish oil have beneficial impacts on intestinal barrier integrity. In addition, we hypothesized that the coadministration of these components results in synergistic benefits to the integrity of the intestinal barrier. To study this, we investigated the impact of cell-free culture supernatant from dietary supplements B lactis 420 and L rhamnosus HN001, and fish oil, separately and in combination, on intestinal permeability in a CaCo-2 cell model. Administered separately, both B lactis 420 supernatant and fish oil significantly increased the integrity of the intestinal epithelial barrier, as determined by an increase in transepithelial electrical resistance (TEER), whereas L rhamnosus did not. The TEER increase with B lactis 420 was dose dependent. Interestingly, a combination of B lactis 420 supernatant and fish oil negated the increase in TEER of the single components. mRNA expression of tight junction proteins, measured by real-time quantitative polymerase chain reaction, was not altered, but the mRNA expression of myosin light chain kinase increased after fish oil treatment. To conclude, single dietary components, namely, B lactis 420 and fish oil, induced beneficial effects on intestinal barrier integrity in vitro, whereas a combination of 2 beneficial test compounds resulted in a null effect. PMID:26923511

  6. Variations in bile tolerance among Lactococcus lactis strains derived from different sources.

    PubMed

    Takanashi, Shihori; Miura, Ai; Abe, Koko; Uchida, Junya; Itoi, Shiro; Sugita, Haruo

    2014-07-01

    Lactococcus lactis subsp. lactis has been isolated from the intestines of marine fish and is a candidate probiotic for aquaculture. In order to use the bacterium as a probiotic, properties such as bile tolerance need to be assessed. Here, we compared bile tolerance in L. lactis strains derived from different sources. Three L. lactis subsp. lactis strains from marine fish (MFL), freshwater fish (FFL), and cheese starter (CSL) were used along with an Lactococcus lactis subsp. cremoris strain from cheese starter (CSC). The four strains were grown under various culture conditions: deMan-Rogosa-Sharpe (MRS) broth containing bile salts/acids, MRS agar containing oxgall, and phosphate-buffered saline (PBS) containing fish bile. Survival/growth of the strains in the presence of sodium cholate and sodium deoxycholate varied in the order MFL, CSL > CSC > FFL; in the presence of sodium taurocholate, the order was MFL > CSL > CSC > FFL. In liquid media containing various concentrations of oxgall, survival of the strains was observed in the order MFL > CSL > FFL and CSC. The survival of MFL was not affected by bile collected from the goldfish (Carassius auratus subsp. auratus) or the puffer fish (Takifugu niphobles), although the other strains showed significant inhibition of growth. It is a novel and beneficial finding that MFL has the highest resistance to bile acid. PMID:24395331

  7. Fate and efficacy of lacticin 3147-producing Lactococcus lactis in the mammalian gastrointestinal tract.

    PubMed

    Dobson, Alleson; Crispie, Fiona; Rea, Mary C; O'Sullivan, Orla; Casey, Pat G; Lawlor, Peadar G; Cotter, Paul D; Ross, Paul; Gardiner, Gillian E; Hill, Colin

    2011-06-01

    Gastrointestinal survival of the bacteriocin-producing strain, Lactococcus lactis DPC6520, was evaluated systematically in vitro and in vivo with a view to using this strain to deliver biologically active lacticin 3147, a broad-spectrum bacteriocin, to the gut. The activity of the lacticin 3147 producer was also evaluated against two clinically relevant pathogens: Clostridium difficile and Listeria monocytogenes. When suspended in an appropriate matrix, the lactococcal strain is capable of surviving simulated gastrointestinal juices similar to the porcine probiotic, Lactobacillus salivarius DPC6005. Upon administration of L. lactis DPC6520 to pigs (n=4), excretion rates of ?10(2) -10(5) CFU g(-1) faeces were observed by day 5. Although passage through the gastrointestinal tract (GIT) did not affect lacticin 3147 production by L. lactis DPC6520 isolates, activity was undetectable in faecal samples by an agar well diffusion assay. Furthermore, L. lactis DPC6520 had no inhibitory effect on C. difficile or other bacterial populations in a human distal colon model, while lactococcal counts declined 10,000-fold over 24 h. The lacticin 3147 producer failed to prevent L. monocytogenes infection in a mouse model, even though a mean L. lactis DPC6520 count of 4.7 × 10(4) CFU g(-1) faeces was obtained over the 5-day administration period. These data demonstrate that L. lactis DPC6520 is capable of surviving transit through the GIT, and yet lacks antimicrobial efficacy in the models of infection used. PMID:21314706

  8. Characterization of the genes of the 2,3-butanediol operons from Klebsiella terrigena and Enterobacter aerogenes.

    PubMed Central

    Blomqvist, K; Nikkola, M; Lehtovaara, P; Suihko, M L; Airaksinen, U; Stråby, K B; Knowles, J K; Penttilä, M E

    1993-01-01

    The genes involved in the 2,3-butanediol pathway coding for alpha-acetolactate decarboxylase, alpha-acetolactate synthase (alpha-ALS), and acetoin (diacetyl) reductase were isolated from Klebsiella terrigena and shown to be located in one operon. This operon was also shown to exist in Enterobacter aerogenes. The budA gene, coding for alpha-acetolactate decarboxylase, gives in both organisms a protein of 259 amino acids. The amino acid similarity between these proteins is 87%. The K. terrigena genes budB and budC, coding for alpha-ALS and acetoin reductase, respectively, were sequenced. The 559-amino-acid-long alpha-ALS enzyme shows similarities to the large subunits of the Escherichia coli anabolic alpha-ALS enzymes encoded by the genes ilvB, ilvG, and ilvI. The K. terrigena alpha-ALS is also shown to complement an anabolic alpha-ALS-deficient E. coli strain for valine synthesis. The 243-amino-acid-long acetoin reductase has the consensus amino acid sequence for the insect-type alcohol dehydrogenase/ribitol dehydrogenase family and has extensive similarities with the N-terminal and internal regions of three known dehydrogenases and one oxidoreductase. Images PMID:8444801

  9. Mutational analysis of the hyc-operon determining the relationship between hydrogenase-3 and NADH pathway in Enterobacter aerogenes.

    PubMed

    Pi, Jian; Jawed, Muhammad; Wang, Jun; Xu, Li; Yan, Yunjun

    2016-01-01

    In this study, the hydrogenase-3 gene cluster (hycDEFGH) was isolated and identified from Enterobacter aerogenes CCTCC AB91102. All gene products were highly homologous to the reported bacterial hydrogenase-3 (Hyd-3) proteins. The genes hycE, hycF, hycG encoding the subunits of hydrogenase-3 were targeted for genetic knockout to inhibit the FHL hydrogen production pathway via the Red recombination system, generating three mutant strains AB91102-E (?hycE), AB91102-F (?hycF) and AB91102-G (?hycG). Deletion of the three genes affected the integrity of hydrogenase-3. The hydrogen production experiments with the mutant strains showed that no hydrogen was detected compared with the wild type (0.886mol/mol glucose), demonstrating that knocking out any of the three genes could inhibit NADH hydrogen production pathway. Meanwhile, the metabolites of the mutant strains were significantly changed in comparison with the wild type, indicating corresponding changes in metabolic flux by mutation. Additionally, the activity of NADH-mediated hydrogenase was found to be nil in the mutant strains. The chemostat experiments showed that the NADH/NAD(+) ratio of the mutant strains increased nearly 1.4-fold compared with the wild type. The NADH-mediated hydrogenase activity and NADH/NAD(+) ratio analysis both suggested that NADH pathway required the involvement of the electron transport chain of hydrogenase-3. PMID:26672442

  10. Host-pathogen interactions in specific pathogen-free chickens following aerogenous infection with Chlamydia psittaci and Chlamydia abortus.

    PubMed

    Kalmar, Isabelle; Berndt, Angela; Yin, Lizi; Chiers, Koen; Sachse, Konrad; Vanrompay, Daisy

    2015-03-15

    Although Chlamydia (C.) psittaci infections are recognized as an important factor causing economic losses and impairing animal welfare in poultry production, the specific mechanisms leading to severe clinical outcomes are poorly understood. In the present study, we comparatively investigated pathology and host immune response, as well as systemic dissemination and expression of essential chlamydial genes in the course of experimental aerogeneous infection with C. psittaci and the closely related C. abortus, respectively, in specific pathogen-free chicks. Clinical signs appeared sooner and were more severe in the C. psittaci-infected group. Compared to C. abortus infection, more intense systemic dissemination of C. psittaci correlated with higher and faster infiltration of immune cells, as well as more macroscopic lesions and epithelial pathology, such as hyperplasia and erosion. In thoracic air sac tissue, mRNA expression of immunologically relevant factors, such as IFN-?, IL-1?, IL-6, IL-17, IL-22, LITAF and iNOS was significantly stronger up-regulated in C. psittaci- than in C. abortus-infected birds between 3 and 14 days post-infection. Likewise, transcription rates of the chlamydial genes groEL, cpaf and ftsW were consistently higher in C. psittaci during the acute phase. These findings illustrate that the stronger replication of C. psittaci in its natural host also evoked a more intense immune response than in the case of C. abortus infection. PMID:25638671

  11. Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

    PubMed Central

    Osuna, R; Schwacha, A; Bender, R A

    1994-01-01

    Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator. Images PMID:8071231

  12. Phenolic compounds: Strong inhibitors derived from lignocellulosic hydrolysate for 2,3-butanediol production by Enterobacter aerogenes.

    PubMed

    Lee, Sang Jun; Lee, Ju Hun; Yang, Xiaoguang; Kim, Sung Bong; Lee, Ja Hyun; Yoo, Hah Young; Park, Chulhwan; Kim, Seung Wook

    2015-12-01

    Lignocellulosic biomass are attractive feedstocks for 2,3-butanediol production due to their abundant supply and low price. During the hydrolysis of lignocellulosic biomass, various byproducts are formed and their effects on 2,3-butanediol production were not sufficiently studied compared to ethanol production. Therefore, the effects of compounds derived from lignocellulosic biomass (weak acids, furan derivatives and phenolics) on the cell growth, the 2,3-butanediol production and the enzymes activity involved in 2,3-butanediol production were evaluated using Enterobacter aerogenes ATCC 29007. The phenolic compounds showed the most toxic effects on cell growth, 2,3-butanediol production and enzyme activity, followed by furan derivatives and weak acids. The significant effects were not observed in the presence of acetic acid and formic acid. Also, feasibility of 2,3-butanediol production from lignocellulosic biomass was evaluated using Miscanthus as a feedstock. In the fermentation of Miscanthus hydrolysate, 11.00 g/L of 2,3-butanediol was obtained from 34.62 g/L of reducing sugar. However, 2,3-butanediol was not produced when the concentration of total phenolic compounds in the hydrolysate increased to more than 1.5 g/L. The present study provides useful information to develop strategies for biological production of 2,3-butanediol and to establish biorefinery for biochemicals from lignocellulosic biomass. PMID:26479290

  13. Genome shuffling of Lactococcus lactis subspecies lactis YF11 for improving nisin Z production and comparative analysis.

    PubMed

    Zhang, Y F; Liu, S Y; Du, Y H; Feng, W J; Liu, J H; Qiao, J J

    2014-05-01

    Nisin has been widely used in the food industry as a safe and natural preservative to increase the shelf time of many foods. In this study, genome shuffling was applied to improve nisin Z production of Lactococcus lactis ssp. lactis YF11 (YF11) via recursive protoplast fusion. Ultraviolet irradiation and diethyl sulfate mutagenesis were used to generate parental strains for genome shuffling. After 4 rounds of genome shuffling, the best-performing strain F44 was obtained, which showed dramatic improvements in tolerance to both glucose (ranging from 8 to 15% (wt/vol) and nisin (ranging from 5,000 to 14,000 IU/mL). Fed-batch fermentation showed that the nisin titer of F44 was up to 4,023 IU/mL, which was 2.4 times that of the starting strain YF11. Field emission scanning electron microscope micrographs of YF11 and F44 revealed the apparent differences in cell morphology. Whereas YF11 displayed long and thin cell morphology, F44 cells were short and thick and with a raised surface in the middle of the cell. With the increasing glucose and nisin content in the medium, cells of both YF11 and F44 tended to become shrunken; however, alterations in YF11 cells were more pronounced than those of F44 cells, especially when cultured in tolerance medium containing both nisin and glucose. Nuclear magnetic resonance analysis demonstrated that the structure of nisin from YF11 and F44 was the same. Expression profiling of nisin synthesis related genes by real-time quantitative PCR showed that the transcription level of nisin structural gene nisZ and immunity gene nisI of F44 was 48 and 130% higher than that of the starting strain YF11, respectively. These results could provide valuable insights into the molecular basis underlying the nisin overproduction mechanism in L. lactis, thus facilitating the future construction of industrial strains for nisin production. PMID:24612797

  14. Food-grade cloning and expression system for Lactococcus lactis.

    PubMed Central

    Platteeuw, C; van Alen-Boerrigter, I; van Schalkwijk, S; de Vos, W M

    1996-01-01

    A versatile set of cloning and expression vectors has been developed for application in self-cloning and other genetic modifications of Lactococcus lactis. The expression vectors were equipped with the controlled and strong lacA promoter of the lactococcal lactose operon. In addition, the transcriptional terminator of the aminopeptidase N gene, pepN, was inserted, which in some cases increased the genetic stabilities of the vectors and the cloned DNA. The small, 0.3-kb lacF gene encoding the soluble carrier enzyme IIALac was used as a dominant selection marker in the plasmid-free L. lactis strain NZ3000 carrying an in-frame deletion of the chromosomal lacF gene. Lactose-utilizing transformants were easily selected on lactose indicator plates at high frequencies and showed a copy number of approximately 50 plasmids per cell. All vectors were stably maintained in the lacF strain NZ3000 when grown on lactose, and only the high-level expression vectors showed some instability when their host was grown on glucose-containing medium. The application potentials of the expression vectors carrying the lacF marker were determined by cloning of the promoterless Escherichia coli gusA reporter gene under control of the lacA promoter followed by analysis of its expression. While in one of the vectors this resulted in a promoter-down mutation in the -10 region of the lacA promoter, in other vectors high-level and controlled expression of the gusA gene was observed. PMID:8975595

  15. [Evaluation of the reincubation of positive blood cultures for detection in the BACT-ALERT system for the detection of polymicrobial bacteremia].

    PubMed

    Soloaga, R; Manganello, S; Francabandiera, D; Nagel, C; Squassi, V; Fernández, A; Gutfraind, Z; Tokumoto, M; Delbart, H; Galanternik, L; Procopio, A

    2000-01-01

    Between February and September 1997, 6588 blood cultures at the Instituto de Cardiología y Cirugía Cardiovascular and Hospital de Niños Ricardo Gutiérrez were studied by using the Bact-Alert system (Organon Teknika) 341 contaminants and 294 episodes of bacteremia (600 samples) were analyzed. From these samples, 280 (95.3%) were monomicrobial episodes and 14 (4.7%) polymicrobial episodes. Positive blood cultures detected by the Bact-Alert system were processed and then reincubated during 7 days, when they were Gram stained and subcultured in blood agar, chocolate agar (both in 5-10% CO2), laked blood agar supplemented with hemin and vitamin K in anaerobic atmosphere (only anaerobic bottles) and CLDE (aerobic conditions). Following reincubation, 3 out of 14 polymicrobial bacteremias were detected, rising the level of detection from 3.7% to 4.7%. Taking into account the total number of bacteremias, only in 3 out of 294 (1%), a second microorganism was detected. Otherwise, in blood cultures where a contaminating microorganism was initially isolated, no further isolates representing a true bacteremia were recovered. Reincubation and terminal subculture of initially positive blood cultures did not provide relevant data in order to change therapeutic measures in the studied population. Due to the increase in costs and labor we consider that this methodology is not routinely advised. PMID:10785943

  16. Evaluation of Lactococcus lactis Isolates from Nondairy Sources with Potential Dairy Applications Reveals Extensive Phenotype-Genotype Disparity and Implications for a Revised Species

    PubMed Central

    Cavanagh, Daniel; Casey, Aidan; Altermann, Eric; Cotter, Paul D.; Fitzgerald, Gerald F.

    2015-01-01

    Lactococcus lactis is predominantly associated with dairy fermentations, but evidence suggests that the domesticated organism originated from a plant niche. L. lactis possesses an unusual taxonomic structure whereby strain phenotypes and genotypes often do not correlate, which in turn has led to confusion in L. lactis classification. A bank of L. lactis strains was isolated from various nondairy niches (grass, vegetables, and bovine rumen) and was further characterized on the basis of key technological traits, including growth in milk and key enzyme activities. Phenotypic analysis revealed all strains from nondairy sources to possess an L. lactis subsp. lactis phenotype (lactis phenotype); however, seven of these strains possessed an L. lactis subsp. cremoris genotype (cremoris genotype), determined by two separate PCR assays. Multilocus sequence typing (MLST) showed that strains with lactis and cremoris genotypes clustered together regardless of habitat, but it highlighted the increased diversity that exists among “wild” strains. Calculation of average nucleotide identity (ANI) and tetranucleotide frequency correlation coefficients (TETRA), using the JSpecies software tool, revealed that L. lactis subsp. cremoris and L. lactis subsp. lactis differ in ANI values by ∼14%, below the threshold set for species circumscription. Further analysis of strain TIFN3 and strains from nonindustrial backgrounds revealed TETRA values of <0.99 in addition to ANI values of <95%, implicating that these two groups are separate species. These findings suggest the requirement for a revision of L. lactis taxonomy. PMID:25841018

  17. Characterization of a bacteriocin produced by Lactococcus lactis subsp. lactis CRL 1584 isolated from a Lithobates catesbeianus hatchery.

    PubMed

    Pasteris, Sergio E; Vera Pingitore, Esteban; Ale, Cesar E; Nader-Macías, María E Fatima

    2014-03-01

    Lactococcus lactis CRL 1584 isolated from a Lithobates catesbeianus hatchery inhibits the growth of Citrobacter freundii (a bullfrog pathogen) and Listeria monocytogenes by a synergistic effect between lactic acid, hydrogen peroxide and a bacteriocin-like molecule. The chemical characterization of the bacteriocin in cell-free supernatants indicates that it has a proteinaceous nature. Hexadecane and ethyl acetate did not modify the bacteriocin activity, while 10 and 20 % (v/v) chloroform decreased the activity by 29 and 43 %, respectively. The antimicrobial peptide was heat stable since 85 % of residual activity was detected when neutralized supernatants were heated at 80 °C for 30 min. Moreover, no bacteriocin inactivation was observed when supernatants were kept at -20 °C for 3 months. The synthesis of the bacteriocin was associated with bacterial growth, highest production (2,100 AU/ml) being detected at the end of the exponential growth phase. At pH ranges of 5-6.5 and 5.0-5.5 the inhibitory molecule was stable when stored for 2 days at 4 and 25 °C, respectively. Moreover, it had a bactericidal effect on L. monocytogenes and the ultrastructural studies of pathogenic cells revealed clumping of the cytoplasmic material, increased periplasmic space and cell wall modifications. The deduced amino acid sequence of the bacteriocin was identical to nisin Z and the genetic determinants for its production are harbored in the chromosome. These results, described for the first time in L. lactis from a bullfrog hatchery, will increase knowledge of the bacteriocin under study with a view to its potential inclusion in probiotics for raniculture or biopreservatives. PMID:24150985

  18. Lactose metabolism in Streptococcus lactis: studies with a mutant lacking glucokinase and mannose-phosphotransferase activities

    SciTech Connect

    Thompson, J.; Chassy, B.M.; Egan, W.

    1985-04-01

    A mutant of Streptococcus lactis 133 has been isolated that lacks both glucokinase and phosphoenolpyruvate-dependent mannose- phosphotransferase (mannose-PTS) activities. The double mutant S. lactis 133 mannose-PTSd GK- is unable to utilize either exogenously supplied or intracellularly generated glucose for growth. Fluorographic analyses of metabolites formed during the metabolism of (/sup 14/C)lactose labeled specifically in the glucose or galactosyl moiety established that the cells were unable to phosphorylate intracellular glucose. However, cells of S. lactis 133 mannose-PTSd GK- readily metabolized intracellular glucose 6-phosphate, and the growth rates and cell yield of the mutant and parental strains on sucrose were the same. During growth on lactose, S. lactis 133 mannose-PTSd GK- fermented only the galactose moiety of the disaccharide, and 1 mol of glucose was generated per mol of lactose consumed. For an equivalent concentration of lactose, the cell yield of the mutant was 50% that of the wild type. The specific rate of lactose utilization by growing cells of S. lactis 133 mannose-PTSd GK- was ca. 50% greater than that of the wild type, but the cell doubling times were 70 and 47 min, respectively. High-resolution /sup 31/P nuclear magnetic resonance studies of lactose transport by starved cells of S. lactis 133 and S. lactis 133 mannose-PTSd GK- showed that the latter cells contained elevated lactose-PTS activity. Throughout exponential growth on lactose, the mutant maintained an intracellular steady-state glucose concentration of 100 mM.

  19. Interaction between the genomes of Lactococcus lactis and phages of the P335 species.

    PubMed

    Kelly, William J; Altermann, Eric; Lambie, Suzanne C; Leahy, Sinead C

    2013-01-01

    Phages of the P335 species infect Lactococcus lactis and have been particularly studied because of their association with strains of L. lactis subsp. cremoris used as dairy starter cultures. Unlike other lactococcal phages, those of the P335 species may have a temperate or lytic lifestyle, and are believed to originate from the starter cultures themselves. We have sequenced the genome of L. lactis subsp. cremoris KW2 isolated from fermented corn and found that it contains an integrated P335 species prophage. This 41 kb prophage (? KW2) has a mosaic structure with functional modules that are highly similar to several other phages of the P335 species associated with dairy starter cultures. Comparison of the genomes of 26 phages of the P335 species, with either a lytic or temperate lifestyle, shows that they can be divided into three groups and that the morphogenesis gene region is the most conserved. Analysis of these phage genomes in conjunction with the genomes of several L. lactis strains shows that prophage insertion is site specific and occurs at seven different chromosomal locations. Exactly how induced or lytic phages of the P335 species interact with carbohydrate cell surface receptors in the host cell envelope remains to be determined. Genes for the biosynthesis of a variable cell surface polysaccharide and for lipoteichoic acids (LTAs) are found in L. lactis and are the main candidates for phage receptors, as the genes for other cell surface carbohydrates have been lost from dairy starter strains. Overall, phages of the P335 species appear to have had only a minor role in the adaptation of L. lactis subsp. cremoris strains to the dairy environment, and instead they appear to be an integral part of the L. lactis chromosome. There remains a great deal to be discovered about their role, and their contribution to the evolution of the bacterial genome. PMID:24009606

  20. Vaccination against Staphylococcus aureus experimental endocarditis using recombinant Lactococcus lactis expressing ClfA or FnbpA.

    PubMed

    Veloso, Tiago Rafael; Mancini, Stefano; Giddey, Marlyse; Vouillamoz, Jacques; Que, Yok-Ai; Moreillon, Philippe; Entenza, José Manuel

    2015-07-01

    Staphylococcus aureus is a major cause of serious infections in humans and animals and a vaccine is becoming a necessity. Lactococcus lactis is a non-pathogenic bacterium that can be used as a vector for the delivery of antigens. We investigated the ability of non-living L. lactis heterologously expressing S. aureus clumping factor A (ClfA) and fibronectin-binding protein A (FnbpA), alone or together, to elicit an immune response in rats and protect them from S. aureus experimental infective endocarditis (IE). L. lactis ClfA was used for immunization against S. aureus Newman (expressing ClfA but not FnbpA), while L. lactis ClfA, L. lactis FnbpA, as well as L. lactis ClfA/FnbpA, were used against S. aureus P8 (expressing ClfA and FnbpA). Vaccination of rats with L. lactis ClfA elicited antibodies that inhibited binding of S. aureus Newman to fibrinogen, triggered the production of IL-17A and conferred protection to 13/19 (68%) of the animals from IE (P<0.05). Immunization with L. lactis ClfA, L. lactis FnbpA or L. lactis ClfA/FnbpA also produced antibodies against the target proteins, but these did not prevent binding of S. aureus P8 to fibrinogen or fibronectin and did not protect animals against S. aureus P8 IE. Moreover, immunization with constructs containing FnbpA did not increase IL-17A production. These results indicate that L. lactis is a valuable antigen delivery system able to elicit efficient humoral and cellular responses. However, the most appropriate antigens affording protection against S. aureus IE are yet to be elucidated. PMID:26048778

  1. Characterization of the Structural Gene Encoding Nisin F, a New Lantibiotic Produced by a Lactococcus lactis subsp. lactis Isolate from Freshwater Catfish (Clarias gariepinus)?

    PubMed Central

    de Kwaadsteniet, M.; ten Doeschate, K.; Dicks, L. M. T.

    2008-01-01

    Lactococcus lactis F10, isolated from freshwater catfish, produces a bacteriocin (BacF) active against Staphylococcus aureus, Staphylococcus carnosus, Lactobacillus curvatus, Lactobacillus plantarum, and Lactobacillus reuteri. The operon encoding BacF is located on a plasmid. Sequencing of the structural gene revealed no homology to other nisin genes. Nisin F is described. PMID:18039827

  2. In Vivo Evolution of Bacterial Resistance in Two Cases of Enterobacter aerogenes Infections during Treatment with Imipenem

    PubMed Central

    Santini, Sébastien; Pinet, Elizabeth; Claverie, Jean-Michel; Davin-Régli, Anne-Véronique; Pagès, Jean-Marie; Masi, Muriel

    2015-01-01

    Infections caused by multidrug resistant (MDR) bacteria are a major concern worldwide. Changes in membrane permeability, including decreased influx and/or increased efflux of antibiotics, are known as key contributors of bacterial MDR. Therefore, it is of critical importance to understand molecular mechanisms that link membrane permeability to MDR in order to design new antimicrobial strategies. In this work, we describe genotype-phenotype correlations in Enterobacter aerogenes, a clinically problematic and antibiotic resistant bacterium. To do this, series of clinical isolates have been periodically collected from two patients during chemotherapy with imipenem. The isolates exhibited different levels of resistance towards multiple classes of antibiotics, consistently with the presence or the absence of porins and efflux pumps. Transport assays were used to characterize membrane permeability defects. Simultaneous genome-wide analysis allowed the identification of putative mutations responsible for MDR. The genome of the imipenem-susceptible isolate G7 was sequenced to closure and used as a reference for comparative genomics. This approach uncovered several loci that were specifically mutated in MDR isolates and whose products are known to control membrane permeability. These were omp35 and omp36, encoding the two major porins; rob, encoding a global AraC-type transcriptional activator; cpxA, phoQ and pmrB, encoding sensor kinases of the CpxRA, PhoPQ and PmrAB two-component regulatory systems, respectively. This report provides a comprehensive analysis of membrane alterations relative to mutational steps in the evolution of MDR of a recognized nosocomial pathogen. PMID:26398358

  3. In Vivo Evolution of Bacterial Resistance in Two Cases of Enterobacter aerogenes Infections during Treatment with Imipenem.

    PubMed

    Philippe, Nadège; Maigre, Laure; Santini, Sébastien; Pinet, Elizabeth; Claverie, Jean-Michel; Davin-Régli, Anne-Véronique; Pagès, Jean-Marie; Masi, Muriel

    2015-01-01

    Infections caused by multidrug resistant (MDR) bacteria are a major concern worldwide. Changes in membrane permeability, including decreased influx and/or increased efflux of antibiotics, are known as key contributors of bacterial MDR. Therefore, it is of critical importance to understand molecular mechanisms that link membrane permeability to MDR in order to design new antimicrobial strategies. In this work, we describe genotype-phenotype correlations in Enterobacter aerogenes, a clinically problematic and antibiotic resistant bacterium. To do this, series of clinical isolates have been periodically collected from two patients during chemotherapy with imipenem. The isolates exhibited different levels of resistance towards multiple classes of antibiotics, consistently with the presence or the absence of porins and efflux pumps. Transport assays were used to characterize membrane permeability defects. Simultaneous genome-wide analysis allowed the identification of putative mutations responsible for MDR. The genome of the imipenem-susceptible isolate G7 was sequenced to closure and used as a reference for comparative genomics. This approach uncovered several loci that were specifically mutated in MDR isolates and whose products are known to control membrane permeability. These were omp35 and omp36, encoding the two major porins; rob, encoding a global AraC-type transcriptional activator; cpxA, phoQ and pmrB, encoding sensor kinases of the CpxRA, PhoPQ and PmrAB two-component regulatory systems, respectively. This report provides a comprehensive analysis of membrane alterations relative to mutational steps in the evolution of MDR of a recognized nosocomial pathogen. PMID:26398358

  4. Effects of eliminating pyruvate node pathways and of coexpression of heterogeneous carboxylation enzymes on succinate production by Enterobacter aerogenes.

    PubMed

    Tajima, Yoshinori; Yamamoto, Yoko; Fukui, Keita; Nishio, Yousuke; Hashiguchi, Kenichi; Usuda, Yoshihiro; Sode, Koji

    2015-02-01

    Lowering the pH in bacterium-based succinate fermentation is considered a feasible approach to reduce total production costs. Newly isolated Enterobacter aerogenes strain AJ110637, a rapid carbon source assimilator under weakly acidic (pH 5.0) conditions, was selected as a platform for succinate production. Our previous work showed that the ?adhE/PCK strain, developed from AJ110637 with inactivated ethanol dehydrogenase and introduced Actinobacillus succinogenes phosphoenolpyruvate carboxykinase (PCK), generated succinate as a major product of anaerobic mixed-acid fermentation from glucose under weakly acidic conditions (pH <6.2). To further improve the production of succinate by the ?adhE/PCK strain, metabolically engineered strains were designed based on the elimination of pathways that produced undesirable products and the introduction of two carboxylation pathways from phosphoenolpyruvate and pyruvate to oxaloacetate. The highest production of succinate was observed with strain ES04/PCK+PYC, which had inactivated ethanol, lactate, acetate, and 2,3-butanediol pathways and coexpressed PCK and Corynebacterium glutamicum pyruvate carboxylase (PYC). This strain produced succinate from glucose with over 70% yield (gram per gram) without any measurable formation of ethanol, lactate, or 2,3-butanediol under weakly acidic conditions. The impact of lowering the pH from 7.0 to 5.5 on succinate production in this strain was evaluated under pH-controlled batch culture conditions and showed that the lower pH decreased the succinate titer but increased its yield. These findings can be applied to identify additional engineering targets to increase succinate production. PMID:25416770

  5. Influence of metabolic end-products on the growth efficiency of Klebsiella aerogenes in anaerobic chemostat culture.

    PubMed

    Teixeira de Mattos, M J; Plomp, P J; Neijssel, O M; Tempest, D W

    1984-01-01

    Progressively increasing the input concentration of growth-limiting nutrient (glucose, ammonia, K+) to anaerobic chemostat cultures of Klebsiella aerogenes (D = 0.38 h-1; 35 degrees C; pH 6.8) led to a non-linear increase in bacterial cell concentration. At modest population densities, residual growth-limiting substrate levels increased substantially, with increasing input concentration, and the culture bacterial dry weight tended to a constant value. With the glucose-limited culture, increasing the glucose input concentration above 20 g X 1(-1) led to accumulation of unused glucose and a change in the fermentation pattern. There was a concomitant lowering of the yield value with respect to glucose consumption, and the calculated YATP value similarly declined. Addition of extra essential (non-limiting) nutrients to the culture was without effect. Similarly, addition of individual fermentation products (acetate, ethanol, D-lactate, 2,3-butanediol, succinate) to the feed medium, in varying concentrations and in different combinations, failed to influence the fermentation pattern or the energetics of cell synthesis. However, a clear correlation was observed between the yield values (of both glucose- and K+-limited cultures) and the steady state concentration of CO2 in the effluent gas. Increasing the concentration CO2 either by increasing the population density or lowering the sparging rate of nitrogen gas through the culture, effected a lowering of the yield values. It is suggested that dissolved CO2 exerts an effect on both metabolism and the energetics of cell synthesis. A possible mechanism of energy dissipation (i.e., a futile cycle) involving carboxylation and decarboxylation reactions is proposed. PMID:6442120

  6. Kentucky Department for Natural Resources and Environmental Protection permit application for air contaminant source: SRC-I Demonstruation Plant, Newman, Kentucky. Appendix B. Best available control technology (BACT) proposals. [Demonstration plant at Newman, KY

    SciTech Connect

    Not Available

    1980-11-21

    The best available control technology (BACT) proposals for the following areas of the SRC-I demonstration plant are described: coal preparation and handling, SRC process and deashing, coke and liquid fuels (control of particles and hydrocarbon vapors), cryogenic systems and fuel gas purification (including sulfur recovery system and venting of gaseous wastes). (LTN)

  7. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    PubMed Central

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  8. Protein secretion in Lactococcus lactis : an efficient way to increase the overall heterologous protein production

    PubMed Central

    Le Loir, Yves; Azevedo, Vasco; Oliveira, Sergio C; Freitas, Daniela A; Miyoshi, Anderson; Bermúdez-Humarán, Luis G; Nouaille, Sébastien; Ribeiro, Luciana A; Leclercq, Sophie; Gabriel, Jane E; Guimaraes, Valeria D; Oliveira, Maricê N; Charlier, Cathy; Gautier, Michel; Langella, Philippe

    2005-01-01

    Lactococcus lactis, the model lactic acid bacterium (LAB), is a food grade and well-characterized Gram positive bacterium. It is a good candidate for heterologous protein delivery in foodstuff or in the digestive tract. L. lactis can also be used as a protein producer in fermentor. Many heterologous proteins have already been produced in L. lactis but only few reports allow comparing production yields for a given protein either produced intracellularly or secreted in the medium. Here, we review several works evaluating the influence of the localization on the production yields of several heterologous proteins produced in L. lactis. The questions of size limits, conformation, and proteolysis are addressed and discussed with regard to protein yields. These data show that i) secretion is preferable to cytoplasmic production; ii) secretion enhancement (by signal peptide and propeptide optimization) results in increased production yield; iii) protein conformation rather than protein size can impair secretion and thus alter production yields; and iv) fusion of a stable protein can stabilize labile proteins. The role of intracellular proteolysis on heterologous cytoplasmic proteins and precursors is discussed. The new challenges now are the development of food grade systems and the identification and optimization of host factors affecting heterologous protein production not only in L. lactis, but also in other LAB species. PMID:15631634

  9. Staphylococcus aureus Virulence Expression Is Impaired by Lactococcus lactis in Mixed Cultures? †

    PubMed Central

    Even, Sergine; Charlier, Cathy; Nouaille, Sébastien; Ben Zakour, Nouri L.; Cretenet, Marina; Cousin, Fabien J.; Gautier, Michel; Cocaign-Bousquet, Muriel; Loubière, Pascal; Le Loir, Yves

    2009-01-01

    Staphylococcus aureus is responsible for numerous food poisonings due to the production of enterotoxins by strains contaminating foodstuffs, especially dairy products. Several parameters, including interaction with antagonistic flora such as Lactococcus lactis, a lactic acid bacterium widely used in the dairy industry, can modulate S. aureus proliferation and virulence expression. We developed a dedicated S. aureus microarray to investigate the effect of L. lactis on staphylococcal gene expression in mixed cultures. This microarray was used to establish the transcriptomic profile of S. aureus in mixed cultures with L. lactis in a chemically defined medium held at a constant pH (6.6). Under these conditions, L. lactis hardly affected S. aureus growth. The expression of most genes involved in the cellular machinery, carbohydrate and nitrogen metabolism, and stress responses was only slightly modulated: a short time lag in mixed compared to pure cultures was observed. Interestingly, the induction of several virulence factors and regulators, including the agr locus, sarA, and some enterotoxins, was strongly affected. This work clearly underlines the complexity of L. lactis antagonistic potential for S. aureus and yields promising leads for investigations into nonantibiotic biocontrol of this major pathogen. PMID:19429556

  10. Nisin Production by a Mixed-Culture System Consisting of Lactococcus lactis and Kluyveromyces marxianus

    PubMed Central

    Shimizu, Hiroshi; Mizuguchi, Taiji; Tanaka, Eiji; Shioya, Suteaki

    1999-01-01

    To control the pH during antimicrobial peptide (nisin) production by a lactic acid bacterium, Lactococcus lactis subsp. lactis (ATCC11454), a novel method involving neither addition of alkali nor a separation system such as a ceramic membrane filter and electrodialyzer was developed. A mixed culture of L. lactis and Kluyveromyces marxianus, which was isolated from kefir grains, was utilized in the developed system. The interaction between lactate production by L. lactis and its assimilation by K. marxianus was used to control the pH. To utilize the interaction of these microorganisms to maintain high-level production of nisin, the kinetics of growth of, and production of lactate, acetate, and nisin by, L. lactis were investigated. The kinetics of growth of and lactic acid consumption by K. marxianus were also investigated. Because the pH of the medium could be controlled by the lactate consumption of K. marxianus and the specific lactate consumption rate of K. marxianus could be controlled by changing the dissolved oxygen (DO) concentration, a cascade pH controller coupled with DO control was developed. As a result, the pH was kept constant because the lactate level was kept low and nisin accumulated in the medium to a high level compared with that attained using other pH control strategies, such as with processes lacking pH control and those in which pH is controlled by addition of alkali. PMID:10388714

  11. Bifidobacterium animalis subsp. lactis decreases urinary oxalate excretion in a mouse model of primary hyperoxaluria.

    PubMed

    Klimesova, Klara; Whittamore, Jonathan M; Hatch, Marguerite

    2015-04-01

    Hyperoxaluria significantly increases the risk of calcium oxalate kidney stone formation. Since several bacteria have been shown to metabolize oxalate in vitro, including probiotic bifidobacteria, we focused on the efficiency and possible mechanisms by which bifidobacteria can influence oxalate handling in vivo, especially in the intestines, and compared these results with the reported effects of Oxalobacter formigenes. Bifidobacterium animalis subsp. lactis DSM 10140 and B. adolescentis ATCC 15703 were administered to wild-type (WT) mice and to mice deficient in the hepatic enzyme alanine-glyoxylate aminotransferase (Agxt(-/-), a mouse model of Primary Hyperoxaluria) that were fed an oxalate-supplemented diet. The administration of B. animalis subsp. lactis led to a significant decrease in urinary oxalate excretion in WT and Agxt(-/-) mice when compared to treatment with B. adolescentis. Detection of B. animalis subsp. lactis in feces revealed that 3 weeks after oral gavage with the bacteria 64% of WT mice, but only 37% of Agxt(-/-) mice were colonized. Examining intestinal oxalate fluxes showed there were no significant changes to net oxalate secretion in colonized animals and were therefore not associated with the changes in urinary oxalate excretion. These results indicate that colonization with B. animalis subsp. lactis decreased urinary oxalate excretion by degrading dietary oxalate thus limiting its absorption across the intestine but it did not promote enteric oxalate excretion as reported for O. formigenes. Preventive or therapeutic administration of B. animalis subsp. lactis appears to have some potential to beneficially influence dietary hyperoxaluria in mice. PMID:25269440

  12. Immunomodulatory effect of Lactococcus lactis JCM5805 on human plasmacytoid dendritic cells.

    PubMed

    Sugimura, Tetsu; Jounai, Kenta; Ohshio, Konomi; Tanaka, Takaaki; Suwa, Masahiro; Fujiwara, Daisuke

    2013-12-01

    Plasmacytoid dendritic cells (pDCs) play a crucial role in anti-viral immunity through production of large amounts of interferons (IFNs). A previous study revealed the existence of lactic acid bacteria that directly stimulate pDCs in mice. In this study, we demonstrated that Lactococcus lactis JCM5805 activates human pDCs and induces IFN production in vitro. In addition, our randomized, placebo-controlled, double blind test showed that yogurt fermented with L. lactis JCM5805 activated pDC activity in vivo. This effect was greater in low pDC subjects, and their ability to produce IFNs was increased from the beginning. Furthermore, the risk of morbidity from the common cold was suppressed in the L. lactis JCM5805 group compared with the placebo group. In conclusion, intake of L. lactis JCM5805 can directly activate pDCs and increase the ability to produce IFNs in vivo. Therefore, L. lactis JCM5805 may be a beneficial tool to enhance anti-viral immunity in humans. PMID:24239838

  13. The Prophylactic Effect of Probiotic Enterococcus lactis IW5 against Different Human Cancer Cells.

    PubMed

    Nami, Yousef; Haghshenas, Babak; Haghshenas, Minoo; Abdullah, Norhafizah; Yari Khosroushahi, Ahmad

    2015-01-01

    Enterococcus lactis IW5 was obtained from human gut and the potential probiotic characteristics of this organism were then evaluated. Results showed that this strain was highly resistant to low pH and high bile salt and adhered strongly to Caco-2 human epithelial colorectal cell lines. The supernatant of E. lactis IW5 strongly inhibited the growth of several pathogenic bacteria and decreased the viability of different cancer cells, such as HeLa, MCF-7, AGS, HT-29, and Caco-2. Conversely, E. lactis IW5 did not inhibit the viability of normal FHs-74 cells. This strain did not generate toxic enzymes, including ?-glucosidase, ?-glucuronidase, and N-acetyl-?-glucosaminidase and was highly susceptible to ampicillin, gentamycin, penicillin, vancomycin, clindamycin, sulfamethoxazol, and chloramphenicol but resistant to erythromycin and tetracyclin. This study provided evidence for the effect of E. lactis IW5 on cancer cells. Therefore, E. lactis IW5, as a bioactive therapeutics, should be subjected to other relevant tests to verify the therapeutic suitability of this strain for clinical applications. PMID:26635778

  14. Oral vaccination of mice against rodent malaria with recombinant Lactococcus lactis expressing MSP-119

    PubMed Central

    Zhang, Zhi-Hong; Jiang, Pei-Hong; Li, Ning-Jun; Shi, Mi; Huang, Weida

    2005-01-01

    AIM: To construct the recombinant Lactococcus lactis as oral delivery vaccination against malaria. METHODS: The C-terminal 19-ku fragments of MSP1 (MSP-119) of Plasmodium yoelii 265-BY was expressed in L. lactis and the recombinant L. lactis was administered orally to BALB/c and C57BL/6 mice. After seven interval vaccinations within 4 wk, the mice were challenged with P. yoelii 265-BY parasites of erythrocytic stage. The protective efficacy of recombinant L. lactis was evaluated. RESULTS: The peak parasitemias in average for the experiment groups of BALB/c and C57BL/6 mice were 0.8±0.4% and 20.8±26.5%, respectively, and those of their control groups were 12.0±0.8% and 60.8±9.6%, respectively. None of the BALB/c mice in both experimental group and control group died during the experiment. However, all the C57BL/6 mice in the control group died within 23 d and all the vaccinated mice survived well. CONCLUSION: The results imply the potential of recombinant L. lactis as oral delivery vaccination against malaria. PMID:16437602

  15. Proteome analyses of heme-dependent respiration in Lactococcus lactis: involvement of the proteolytic system.

    PubMed

    Vido, Karin; Le Bars, Dominique; Mistou, Michel-Yves; Anglade, Patricia; Gruss, Alexandra; Gaudu, Philippe

    2004-03-01

    Sugar fermentation was long considered the sole means of energy metabolism available to lactic acid bacteria. We recently showed that metabolism of Lactococcus lactis shifts progressively from fermentation to respiration during growth when oxygen and heme are available. To provide insights into this phenomenon, we compared the proteomic profiles of L. lactis under fermentative and respiratory growth conditions in rich medium. We identified 21 proteins whose levels differed significantly between these conditions. Two major groups of proteins were distinguished, one involved in carbon metabolism and the second in nitrogen metabolism. Unexpectedly, enzymes of the proteolytic system (PepO1 and PepC) which are repressed in rich medium in fermentation growth were induced under respiratory conditions despite the availability of free amino acids. A triple mutant (dtpT dtpP oppA) deficient in oligopeptide transport displayed normal respiration, showing that increased proteolytic activity is not an absolute requirement for respiratory metabolism. Transcriptional analysis confirmed that pepO1 is induced under respiration-permissive conditions. This induction was independent of CodY, the major regulator of proteolytic functions in L. lactis. We also observed that pepO1 induction is redox sensitive. In a codY mutant, pepO1 expression was increased twofold in aeration and eightfold in respiration-permissive conditions compared to static conditions. These observations suggest that new regulators activate proteolysis in L. lactis, which help to maintain the energetic needs of L. lactis during respiration. PMID:14996795

  16. Intranasal immunization of recombinant Lactococcus lactis induces protection against H5N1 virus in ferrets.

    PubMed

    Lei, Han; Peng, Xiaojue; Ouyang, Jiexiu; Zhao, Daxian; Jiao, Huifeng; Shu, Handing; Ge, Xinqi

    2015-01-22

    The increasing outbreaks of highly pathogenic avian influenza A (HPAI) H5N1 viruses in birds and human bring out an urgent need to develop a safe and effective vaccine to control and prevent H5N1 infection. Lactococcus lactis (L. lactis) based vaccine platform is a promising approach for mucosal H5N1 vaccine development. Intranasal immunization is the potential to induce mucosal immune response which is associated with protective immunity. To develop a safe and effective mucosal vaccine against HAPI H5N1, we extended our previous study by evaluating the immunogenicity of L. lactis-psA-HA1 in the absence of adjuvant via intranasal route in the ferret model. Ferrets administered intranasally with L. lactis-pgsA-HA1 could elicit robust humoral and mucosal immune responses, as well as significant HI titers. Importantly, ferrets were completely protected from H5N1 virus challenge. These findings suggest that L. lactis-pgsA-HA1 can be considered an alternative mucosal vaccine during A/H5N1 pandemic. PMID:25445345

  17. The Prophylactic Effect of Probiotic Enterococcus lactis IW5 against Different Human Cancer Cells

    PubMed Central

    Nami, Yousef; Haghshenas, Babak; Haghshenas, Minoo; Abdullah, Norhafizah; Yari Khosroushahi, Ahmad

    2015-01-01

    Enterococcus lactis IW5 was obtained from human gut and the potential probiotic characteristics of this organism were then evaluated. Results showed that this strain was highly resistant to low pH and high bile salt and adhered strongly to Caco-2 human epithelial colorectal cell lines. The supernatant of E. lactis IW5 strongly inhibited the growth of several pathogenic bacteria and decreased the viability of different cancer cells, such as HeLa, MCF-7, AGS, HT-29, and Caco-2. Conversely, E. lactis IW5 did not inhibit the viability of normal FHs-74 cells. This strain did not generate toxic enzymes, including β-glucosidase, β-glucuronidase, and N-acetyl-β-glucosaminidase and was highly susceptible to ampicillin, gentamycin, penicillin, vancomycin, clindamycin, sulfamethoxazol, and chloramphenicol but resistant to erythromycin and tetracyclin. This study provided evidence for the effect of E. lactis IW5 on cancer cells. Therefore, E. lactis IW5, as a bioactive therapeutics, should be subjected to other relevant tests to verify the therapeutic suitability of this strain for clinical applications. PMID:26635778

  18. Complete Genome Sequences of Four Novel Lactococcus lactis Phages Distantly Related to the Rare 1706 Phage Species.

    PubMed

    Kot, Witold; Neve, Horst; Vogensen, Finn K; Heller, Knut J; Sørensen, Søren J; Hansen, Lars H

    2014-01-01

    Lactoccocus lactis is a Gram-positive bacterium widely used in the dairy industry in the production of an array of cheeses and other fermented milk products. Here, we describe the sequencing and genome annotations of a set of four phages virulent to L. lactis and exhibiting similarities to phage 1706. PMID:25013130

  19. Complete Genome Sequences of Four Novel Lactococcus lactis Phages Distantly Related to the Rare 1706 Phage Species

    PubMed Central

    Vogensen, Finn K.; Heller, Knut J.; Sørensen, Søren J.; Hansen, Lars H.

    2014-01-01

    Lactoccocus lactis is a Gram-positive bacterium widely used in the dairy industry in the production of an array of cheeses and other fermented milk products. Here, we describe the sequencing and genome annotations of a set of four phages virulent to L. lactis and exhibiting similarities to phage 1706. PMID:25013130

  20. Quantifying the effect of hand wash duration, soap use, ground beef debris, and drying methods on the removal of Enterobacter aerogenes on hands.

    PubMed

    Jensen, Dane A; Danyluk, Michelle D; Harris, Linda J; Schaffner, Donald W

    2015-04-01

    Hand washing is recognized as a crucial step in preventing foodborne disease transmission by mitigating crosscontamination among hands, surfaces, and foods. This research was undertaken to establish the importance of several keys factors (soap, soil, time, and drying method) in reducing microorganisms during hand washing. A nonpathogenic nalidixic acid-resistant Enterobacter aerogenes surrogate for Salmonella was used to assess the efficacy of using soap or no soap for 5 or 20 s on hands with or without ground beef debris and drying with paper towel or air. Each experiment consisted of 20 replicates, each from a different individual with ∼ 6 log CFU/ml E. aerogenes on their hands. A reduction of 1.0 ± 0.4 and 1.7 ± 0.8 log CFU of E. aerogenes was observed for a 5-s wash with no soap and a 20-s wash with soap, respectively. When there was no debris on the hands, there was no significant difference between washing with and without soap for 20 s (P > 0.05). Likewise, there was no significant difference in the reductions achieved when washing without soap, whether or not debris was on the hands (P > 0.05). A significantly greater reduction (P < 0.05) in E. aerogenes (0.5 log CFU greater reduction) was observed with soap when there was ground beef debris on the hands. The greatest difference (1.1 log CFU greater average reduction) in effectiveness occurred when ground beef debris was on the hands and a 20-s wash with water was compared with a 20-s wash with soap. Significantly greater (P < 0.05) reductions were observed with paper towel drying compared with air (0.5 log CFU greater reductions). Used paper towels may contain high bacterial levels (>4.0 log CFU per towel) when hands are highly contaminated. Our results support future quantitative microbial risk assessments needed to effectively manage risks of foodborne illness in which food workers' hands are a primary cause. PMID:25836392

  1. Evolution of Lactococcus lactis Phages within a Cheese Factory▿

    PubMed Central

    Rousseau, Geneviève M.; Moineau, Sylvain

    2009-01-01

    We have sequenced the double-stranded DNA genomes of six lactococcal phages (SL4, CB13, CB14, CB19, CB20, and GR7) from the 936 group that were isolated over a 9-year period from whey samples obtained from a Canadian cheese factory. These six phages infected the same two industrial Lactococcus lactis strains out of 30 tested. The CB14 and GR7 genomes were found to be 100% identical even though they were isolated 14 months apart, indicating that a phage can survive in a cheese plant for more than a year. The other four genomes were related but notably different. The length of the genomes varied from 28,144 to 32,182 bp, and they coded for 51 to 55 open reading frames. All five genomes possessed a 3′ overhang cos site that was 11 nucleotides long. Several structural proteins were also identified by nano-high-performance liquid chromatography-tandem mass spectrometry, confirming bioinformatic analyses. Comparative analyses suggested that the most recently isolated phages (CB19 and CB20) were derived, in part, from older phage isolates (CB13 and CB14/GR7). The organization of the five distinct genomes was similar to the previously sequenced lactococcal phage genomes of the 936 group, and from these sequences, a core genome was determined for lactococcal phages of the 936 group. PMID:19542338

  2. In vitro fermentation of prebiotic oligosaccharides by Bifidobacterium lactis HN019 and Lactobacillus spp.

    PubMed

    Sims, Ian M; Ryan, Jason L J; Kim, Sang H

    2014-02-01

    The utilisation of various prebiotic oligosaccharides by probiotic strains of Bifidobacterium lactis, Lactobacillus rhamnosus and Lactobacillus acidophilus was investigated in order to determine the synbiotic potential of various prebiotic/probiotic combinations. Analysis by HPLC and high-performance anion-exchange chromatography of the cell-free medium taken during growth of the three probiotic bacteria showed differences in the consumption of the various oligosaccharides. Analysis of galactooligosaccharides showed that both L. rhamnosus and B. lactis consumed mostly mono- and di-saccharide, while L. acidophilus consumed oligosaccharides up to trisaccharide. Both B. lactis and L. acidophilus utilised fructooligosaccharides and inulin, but showed different patterns of oligosaccharide consumption. Only L. rhamnosus grew on ?-glucan oligosaccharides and preferentially consumed the trisaccharide. The results indicate the synbiotic potential of the various probiotic/prebiotic combinations, particularly L. acidophilus/galactooligosaccharides, L. acidophilus/fructooligosaccharides or inulin and L. rhamnosus/?-glucan oligosaccharides. PMID:24239979

  3. The Yeast Fungus Trichosporon lactis Found as an Epizoic Colonizer of Dung Beetle Exoskeletons.

    PubMed

    Górz, Andrzej; Boroń, Piotr

    2016-02-01

    The study on the biology and biodiversity of coprophagous Scarabaeoidea carried out in the Polish Carpathians revealed the occurrence of unusual epizoic excrescences on various dung beetles species of the genus Onthophagus. The excrescences occur on the elytra, prothorax, and head of the studied beetles. Detailed research on this phenomenon determined that the fungus grew in the form of multicellular thalli. The ITS-based identification of fungal material collected from beetles' exoskeletons resulted in a 100 % match with Trichosporon lactis. Until now, only a yeast lifestyle/stage was known for this basidiomycete species. Therefore, in this paper, we describe a new substrate for growth of T. lactis and its unknown and intriguing relationship with dung beetles. The results obtained in this study open up numerous research possibilities on the new role of dung beetles in terrestrial ecosystems, as well as on using the physiological properties of T. lactis to restore soils. PMID:26385555

  4. A new protein of alpha-amylase activity from Lactococcus lactis.

    PubMed

    Wasko, Adam; Polak-Berecka, Magdalena; Targonski, Zdzislaw

    2010-09-01

    An extracellular alpha-amylase from Lactococcus lactis IBB500 was purified and characterized. The optimum conditions for the enzyme activity were pH 4.5, temperature of 35 degrees C, enzyme molecular mass of 121 kDa. The genome analysis and a plasmid curing experiment indicated that amy+ genes were located in a plasmid of 30 kb. An analysis of phylogenetic relationships strongly supported a hypothesis of horizontal gene transfer. A strong homology was found for the peptides with the sequence of alpha-amylases from Ralstonia pikettii and Ralstonia solanacearum. The protein of alpha-amylase activity purified in this study is the first one described for the Lactococcus lactis species, and this paper is the first report on Lactococcus lactis strain as a microorganism belonging to amylolytic lactic acid bacteria (ALAB). PMID:20890096

  5. Proteinase Activity in Slow Lactic Acid-Producing Variants of Streptococcus lactis

    PubMed Central

    Pearce, L. E.; Skipper, N. A.; Jarvis, B. D. W.

    1974-01-01

    Variants of Streptococcus lactis that produce lactic acid slowly in milk were isolated by inducing plasmid loss in the wild type at 39 to 40 C. Such strains had lost most of their surface-bound proteinase activity and were designated prt-. The specific proteinase activities of S. lactis C10 prt+ whole cells and solubilized cell walls were 7 and 18 times, respectively, those of the prt- strain, but spheroplast lysates of prt+ and prt- strains contained similar proteinase activity. S. lactis H1 showed a similar relative distribution of activity between prt+ and prt- cellular fractions, although the overall level was lower. The limited growth in milk, characteristic of prt- strains, can be explained in terms of their low surface-bound proteinase activity. PMID:4208513

  6. Modulation of gut-associated lymphoid tissue functions with genetically modified Lactococcus lactis.

    PubMed

    Rottiers, Pieter; De Smedt, Tim; Steidler, Lothar

    2009-01-01

    Lactic acid bacteria are a group of taxonomically diverse, Gram-positive food-grade bacteria that have been safely consumed throughout history. The lactic acid bacterium Lactococcus lactis, well-known for its use in the manufacture of cheese, can be genetically engineered and orally formulated to deliver therapeutic proteins in the gastrointestinal tract. This review focuses on the genetic engineering of Lactococcus lactis to secrete high-quality, correctly processed bioactive molecules derived from a eukaryotic background. The therapeutic applications of these genetically modified strains are discussed, with special regards to immunomodulation. PMID:19954359

  7. Lactococcus lactis M4, a potential host for the expression of heterologous proteins

    PubMed Central

    2011-01-01

    Background Many plasmid-harbouring strains of Lactococcus lactis have been isolated from milk and other sources. Plasmids of Lactococcus have been shown to harbour antibiotic resistance genes and those that express some important proteins. The generally regarded as safe (GRAS) status of L. lactis also makes it an attractive host for the production of proteins that are beneficial in numerous applications such as the production of biopharmaceutical and nutraceutical. In the present work, strains of L. lactis were isolated from cow's milk, plasmids were isolated and characterised and one of the strains was identified as a potential new lactococcal host for the expression of heterologous proteins. Results Several bacterial strains were isolated from cow's milk and eight of those were identified as Lactococcus lactis by 16S rRNA sequence analysis. Antibiotic susceptibility tests that were carried out showed that 50% of the isolates had almost identical antibiotic resistance patterns compared to the control strains MG1363 and ATCC 11454. Plasmid profiling results indicated the lack of low molecular weight plasmids for strain M4. Competent L. lactis M4 and MG1363 were prepared and electrotransformed with several lactococcal plasmids such as pMG36e, pAR1411, pAJ01 and pMG36e-GFP. Plasmid isolation and RE analyses showed the presence of these plasmids in both M4 and the control strain after several generations, indicating the ability of M4 to maintain heterologous plasmids. SDS-PAGE and Western blot analyses also confirmed the presence of GFP, demonstrating the potential of heterologous protein expression in M4. Conclusions Based on the 16S rRNA gene molecular analysis, eight Gram-positive cocci milk isolates were identified as L. lactis subsp. lactis. One of the strains, L. lactis M4 was able to maintain transformed low molecular weight plasmid vectors and expressed the GFP gene. This strain has the potential to be developed into a new lactococcal host for the expression of heterologous proteins. PMID:21518457

  8. Secretion of biologically active interferon-gamma inducible protein-10 (IP-10) by Lactococcus lactis

    PubMed Central

    Villatoro-Hernandez, Julio; Loera-Arias, Maria J; Gamez-Escobedo, Anali; Franco-Molina, Moises; Gomez-Gutierrez, Jorge G; Rodriguez-Rocha, Humberto; Gutierrez-Puente, Yolanda; Saucedo-Cardenas, Odila; Valdes-Flores, Jesus; Montes-de-Oca-Luna, Roberto

    2008-01-01

    Background Chemokines are a large group of chemotactic cytokines that regulate and direct migration of leukocytes, activate inflammatory responses, and are involved in many other functions including regulation of tumor development. Interferon-gamma inducible-protein-10 (IP-10) is a member of the C-X-C subfamily of the chemokine family of cytokines. IP-10 specifically chemoattracts activated T lymphocytes, monocytes, and NK cells. IP-10 has been described also as a modulator of other antitumor cytokines. These properties make IP-10 a novel therapeutic molecule for the treatment of chronic and infectious diseases. Currently there are no suitable live biological systems to produce and secrete IP-10. Lactococcus lactis has been well-characterized over the years as a safe microorganism to produce heterologous proteins and to be used as a safe, live vaccine to deliver antigens and cytokines of interest. Here we report a recombinant strain of L. lactis genetically modified to produce and secrete biologically active IP-10. Results The IP-10 coding region was isolated from human cDNA and cloned into an L. lactis expression plasmid under the regulation of the pNis promoter. By fusion to the usp45 secretion signal, IP-10 was addressed out of the cell. Western blot analysis demonstrated that recombinant strains of L. lactis secrete IP-10 into the culture medium. Neither degradation nor incomplete forms of IP-10 were detected in the cell or supernatant fractions of L. lactis. In addition, we demonstrated that the NICE (nisin-controlled gene expression) system was able to express IP-10 "de novo" even two hours after nisin removal. This human IP-10 protein secreted by L. lactis was biological active as demonstrated by Chemotaxis assay over human CD3+T lymphocytes. Conclusion Expression and secretion of mature IP-10 was efficiently achieved by L. lactis forming an effective system to produce IP-10. This recombinant IP-10 is biologically active as demonstrated by its ability to chemoattract human CD3+ T lymphocytes. This strain of recombinant L. lactis represents a potentially useful tool to be used as a live vaccine in vivo. PMID:18662403

  9. Yeast on the milky way: genetics, physiology and biotechnology of Kluyveromyces lactis.

    PubMed

    Rodicio, Rosaura; Heinisch, Jürgen J

    2013-05-01

    The milk yeast Kluyveromyces lactis has a life cycle similar to that of Saccharomyces cerevisiae and can be employed as a model eukaryote using classical genetics, such as the combination of desired traits, by crossing and tetrad analysis. Likewise, a growing set of vectors, marker cassettes and tags for fluorescence microscopy are available for manipulation by genetic engineering and investigating its basic cell biology. We here summarize these applications, as well as the current knowledge regarding its central metabolism, glucose and extracellular stress signalling pathways. A short overview on the biotechnological potential of K. lactis concludes this review. PMID:23576126

  10. Engineering of self-sustaining systems: substituting the yeast glucose transporter plus hexokinase for the Lactococcus lactis phosphotransferase system in a Lactococcus lactis network in silico.

    PubMed

    Adamczyk, Malgorzata; Westerhoff, Hans V

    2012-07-01

    The success rate of introducing new functions into a living species is still rather unsatisfactory. Much of this is due to the very essence of the living state, i.e. its robustness towards perturbations. Living cells are bound to notice that metabolic engineering is being effected, through changes in metabolite concentrations. In this study, we asked whether one could engage in such engineering without changing metabolite concentrations. We have illustrated that, in silico, one can do so in principle. We have done this for the case of substituting the yeast glucose transporter plus hexokinase for the Lactococcus lactis phosphotransferase system, in an L. lactis network, this engineering is 'silent' in terms of metabolite concentrations and almost all fluxes. PMID:22700394

  11. Cross-protection of Lactococcus lactis-displayed HA2 subunit against homologous and heterologous influenza A viruses in mice.

    PubMed

    Lei, Han; Peng, Xiaojue; Zhao, Daxian; Jiao, Huifeng; Ouyang, Jiexiu

    2015-12-01

    Current influenza vaccines provide strain-specific protection against homologous subtypes and need to be updated annually. Therefore, it is essential to develop a universal vaccine that would induce broadly cross-protective immunity against homologous and heterologous influenza A viruses. The highly conserved HA2 subunit is a promising candidate for developing a universal influenza vaccine. Here, we hypothesized that the HA2 subunit could be displayed on the surface of Lactococcus lactis (L. lactis), using Spax as an anchor protein (L. lactis/pNZ8008-Spax-HA2) and that L. lactis/pNZ8008-Spax-HA2 would have immunogenicity by oral administration without the use of adjuvant in the mouse model. To address this hypothesis, we show that oral vaccination of mice with L. lactis/pNZ8008-Spax-HA2 elicited significant humoral and mucosal immune responses. Importantly, L. lactis/pNZ8008-Spax-HA2 provided 100 % protection against homologous H5N1 or heterologous H1N1 virus challenge. These results suggest that an HA2 subunit presented on the surface of L. lactis is an effective universal vaccine candidate against influenza A viruses in the poultry industry and in humans. PMID:26358264

  12. Short- and long-term dynamics in the intestinal microbiota following ingestion of Bifidobacterium animalis subsp. lactis GCL2505.

    PubMed

    Tanaka, Yoshiyuki; Takami, Kazuyo; Nishijima, Tomohiko; Aoki, Ryo; Mawatari, Takashi; Ikeda, Takayuki

    2015-01-01

    Bifidobacterium animalis subsp. lactis GCL2505 (B. lactis GCL2505) is able to survive passage through the intestines and proliferate. The daily dynamics of the intestinal bifidobacteria following ingestion of probiotics are not yet clear. Moreover, the effects of long-term ingestion of probiotics on the intestinal microbiota have not been well studied. Two experiments were performed in the present study. In Experiment 1, 53 healthy female volunteers received B. lactis GCL2505; B. bifidum GCL2080, which can survive but not proliferate in the intestine; or yogurt fermented with Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus for 2 weeks, and the daily dynamics of intestinal bifidobacteria were investigated. The number of fecal bifidobacteria significantly increased on day 1, and this was maintained until day 14 in the B. lactis GCL2505 ingestion group. However, no significant change in the number of fecal bifidobacteria was observed in the other groups throughout the ingestion period. In Experiment 2, 38 constipated volunteers received either B. lactis GCL2505 or a placebo for 8 weeks. Both the number of fecal bifidobacteria and the frequency of defecation significantly increased throughout the ingestion period in the B. lactis GCL2505 ingestion group. These results suggested that the proliferation of ingested bifidobacteria within the intestine contributed to a rapid increase in the amount of intestinal bifidobacteria and subsequent maintenance of these levels. Moreover, B. lactis GCL2505 improved the intestinal microbiota more effectively than non-proliferating bifidobacteria and lactic acid bacteria. PMID:26594607

  13. Short- and long-term dynamics in the intestinal microbiota following ingestion of Bifidobacterium animalis subsp. lactis GCL2505

    PubMed Central

    TANAKA, Yoshiyuki; TAKAMI, Kazuyo; NISHIJIMA, Tomohiko; AOKI, Ryo; MAWATARI, Takashi; IKEDA, Takayuki

    2015-01-01

    Bifidobacterium animalis subsp. lactis GCL2505 (B. lactis GCL2505) is able to survive passage through the intestines and proliferate. The daily dynamics of the intestinal bifidobacteria following ingestion of probiotics are not yet clear. Moreover, the effects of long-term ingestion of probiotics on the intestinal microbiota have not been well studied. Two experiments were performed in the present study. In Experiment 1, 53 healthy female volunteers received B. lactis GCL2505; B. bifidum GCL2080, which can survive but not proliferate in the intestine; or yogurt fermented with Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus for 2 weeks, and the daily dynamics of intestinal bifidobacteria were investigated. The number of fecal bifidobacteria significantly increased on day 1, and this was maintained until day 14 in the B. lactis GCL2505 ingestion group. However, no significant change in the number of fecal bifidobacteria was observed in the other groups throughout the ingestion period. In Experiment 2, 38 constipated volunteers received either B. lactis GCL2505 or a placebo for 8 weeks. Both the number of fecal bifidobacteria and the frequency of defecation significantly increased throughout the ingestion period in the B. lactis GCL2505 ingestion group. These results suggested that the proliferation of ingested bifidobacteria within the intestine contributed to a rapid increase in the amount of intestinal bifidobacteria and subsequent maintenance of these levels. Moreover, B. lactis GCL2505 improved the intestinal microbiota more effectively than non-proliferating bifidobacteria and lactic acid bacteria. PMID:26594607

  14. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Application in the control of Listeria monocytogenes in fresh Minas-type goat cheese.

    PubMed

    Furtado, Danielle N; Todorov, Svetoslav D; Landgraf, Mariza; Destro, Maria T; Franco, Bernadette D G M

    2015-03-01

    Listeria monocytogenes is a pathogen frequently found in dairy products. Its control in fresh cheeses is difficult, due to the psychrotrophic properties and salt tolerance. Bacteriocinogenic lactic acid bacteria (LAB) with proven in vitro antilisterial activity can be an innovative technological approach but their application needs to be evaluated by means of in situ tests. In this study, a novel bacteriocinogenic Lactococcus lactis strain ( Lc . lactis DF4Mi), isolated from raw goat milk, was tested for control of growth of L. monocytogenes in artificially contaminated fresh Minas type goat cheese during storage under refrigeration. A bacteriostatic effect was achieved, and counts after 10 days were 3 log lower than in control cheeses with no added LAB. However, this effect did not differ significantly from that obtained with a non-bacteriocinogenic Lc. lactis strain. Addition of nisin (12.5 mg/kg) caused a rapid decrease in the number of viable L. monocytogenes in the cheeses, suggesting that further studies with the purified bacteriocin DF4Mi may open new possibilities for this strain as biopreservative in dairy products. PMID:26221109

  15. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Application in the control of Listeria monocytogenes in fresh Minas-type goat cheese

    PubMed Central

    Furtado, Danielle N.; Todorov, Svetoslav D.; Landgraf, Mariza; Destro, Maria T.; Franco, Bernadette D.G.M.

    2015-01-01

    Listeria monocytogenes is a pathogen frequently found in dairy products. Its control in fresh cheeses is difficult, due to the psychrotrophic properties and salt tolerance. Bacteriocinogenic lactic acid bacteria (LAB) with proven in vitro antilisterial activity can be an innovative technological approach but their application needs to be evaluated by means of in situ tests. In this study, a novel bacteriocinogenic Lactococcus lactis strain ( Lc . lactis DF4Mi), isolated from raw goat milk, was tested for control of growth of L. monocytogenes in artificially contaminated fresh Minas type goat cheese during storage under refrigeration. A bacteriostatic effect was achieved, and counts after 10 days were 3 log lower than in control cheeses with no added LAB. However, this effect did not differ significantly from that obtained with a non-bacteriocinogenic Lc. lactis strain. Addition of nisin (12.5 mg/kg) caused a rapid decrease in the number of viable L. monocytogenes in the cheeses, suggesting that further studies with the purified bacteriocin DF4Mi may open new possibilities for this strain as biopreservative in dairy products. PMID:26221109

  16. Characterization of Lactococcus lactis Phage 949 and Comparison with Other Lactococcal Phages▿

    PubMed Central

    Samson, Julie E.; Moineau, Sylvain

    2010-01-01

    The virulent Lactococcus lactis phage 949 was isolated in 1975 from cheese whey in New Zealand. This phage is a member of the Siphoviridae family and of a rare lactococcal phage group that bears its name (949 group). It has an icosahedral capsid (79-nm diameter) and a very long noncontractile tail (length, 500 nm; width, 12 nm). It infected 7 of 59 tested L. lactis strains, a somewhat expanded host range for a rare lactococcal phage. The abortive phage infection defense mechanisms AbiQ and AbiT strongly inhibited the multiplication of phage 949, but AbiK and AbiV did not. Its double-stranded DNA (dsDNA) genome of 114,768 bp is, to date, the largest among lactococcal phages. Its GC content was calculated at 32.7%, which is the lowest reported for a lactococcal phage. Its 154 open reading frames (ORFs) share limited identity with database sequences. In addition, terminal redundancy was observed as well as the presence of six tRNAs, one group I intron, and putative recombinases. SDS-PAGE coupled with mass spectrometry identified 13 structural proteins. The genomes of the members of the 10 currently known L. lactis phage groups were used to construct a proteomic tree. Each L. lactis phage group separated into distinct genetic clusters, validating the current classification scheme. Of note, members of the polythetic P335 groups were clearly separated into subgroups. PMID:20802084

  17. Xylo-oligosaccharides enhance the growth of bifidobacteria and Bifidobacterium lactis in a simulated colon model.

    PubMed

    Mäkeläinen, H; Forssten, S; Saarinen, M; Stowell, J; Rautonen, N; Ouwehand, A C

    2010-03-01

    A semi-continuous, anaerobic colon simulator, with four vessels mimicking the conditions of the human large intestine, was used to study the fermentation of xylo-oligosaccharides (XOS). Three XOS compounds and a xylan preparation were fermented for 48 hours by human colonic microbes. Fructo-oligosaccharides (FOS) were used as a prebiotic reference. As a result of the fermentation, the numbers of Bifidobacterium increased in all XOS and xylan simulations when compared to the growth observed in the baseline simulations, and increased levels of Bifidobacterium lactis were measured with the two XOS compounds that had larger distribution of the degree of polymerisation. Fermentation of XOS and xylan increased the microbial production of short chain fatty acids in the simulator vessels; especially the amounts of butyrate and acetate were increased. XOS was more efficient than FOS in increasing the numbers of B. lactis in the colonic model, whereas FOS increased the Bifidobacterium longum numbers more. The selective fermentation of XOS by B. lactis has been demonstrated in pure culture studies, and these results further indicate that the combination of B. lactis and XOS would form a successful, selective synbiotic combination. PMID:21831753

  18. Deletion of the PDR16 gene influences the plasma membrane properties of the yeast Kluyveromyces lactis.

    PubMed

    Toth Hervay, Nora; Goffa, Eduard; Svrbicka, Alexandra; Simova, Zuzana; Griac, Peter; Jancikova, Iva; Gaskova, Dana; Morvova, Marcela; Sikurova, Libusa; Gbelska, Yvetta

    2015-04-01

    The plasma membrane is the first line of cell defense against changes in external environment, thus its integrity and functionality are of utmost importance. The plasma membrane properties depend on both its protein and lipid composition. The PDR16 gene is involved in the control of Kluyveromyces lactis susceptibility to drugs and alkali metal cations. It encodes the homologue of the major K. lactis phosphatidylinositol transfer protein Sec14p. Sec14p participates in protein secretion, regulation of lipid synthesis, and turnover in vivo. We report here that the plasma membrane of the Klpdr16Δ mutant is hyperpolarized and its fluidity is lower than that of the parental strain. In addition, protoplasts prepared from the Klpdr16Δ cells display decreased stability when subjected to hypo-osmotic conditions. These changes in membrane properties lead to an accumulation of radiolabeled fluconazole and lithium cations inside mutant cells. Our results point to the fact that the PDR16 gene of K. lactis (KlPDR16) influences the plasma membrane properties in K. lactis that lead to subsequent changes in susceptibility to a broad range of xenobiotics. PMID:25742422

  19. Bifidobacterium animalis ssp. lactis 420 Protects against Indomethacin-Induced Gastric Permeability in Rats

    PubMed Central

    Lyra, Anna; Saarinen, Markku; Putaala, Heli; Olli, Kaisa; Lahtinen, Sampo J.; Ouwehand, Arthur C.; Madetoja, Mari; Tiihonen, Kirsti

    2012-01-01

    Gastrointestinal (GI) adverse effects such as erosion and increased permeability are common during the use of nonsteroidal anti-inflammatory drugs (NSAIDs). Our objective was to assess whether Bifidobacterium animalis ssp. lactis 420 protects against NSAID-induced GI side effects in a rat model. A total of 120 male Wistar rats were allocated into groups designated as control, NSAID, and probiotic. The NSAID and probiotic groups were challenged with indomethacin (10?mg/kg?1; single dose). The probiotic group was also supplemented daily with 1010?CFU of B. lactis 420 for seven days prior to the indomethacin administration. The control group rats received no indomethacin or probiotic. The permeability of the rat intestine was analysed using carbohydrate probes and the visual damage of the rat stomach mucosa was graded according to severity. B. lactis 420 significantly reduced the indomethacin-induced increase in stomach permeability. However, the protective effect on the visual mucosal damage was not significant. The incidence of severe NSAID-induced lesions was, nevertheless, reduced from 50% to 33% with the probiotic treatment. To conclude, the B. lactis 420 supplementation protected the rats from an NSAID-induced increase in stomach permeability and may reduce the formation of more serious GI mucosal damage and/or enhance the recovery rate of the stomach mucosa. PMID:22848210

  20. Kinetics and regulation of lactose transport and metabolism in Kluyveromyces lactis JA6.

    PubMed

    Santos, A M; Silveira, W B; Fietto, L G; Brandão, R L; Castro, I M

    2014-07-01

    Kluyveromyces lactis strains are able to assimilate lactose. They have been used industrially to eliminate this sugar from cheese whey and in other industrial products. In this study, we investigated specific features and the kinetic parameters of the lactose transport system in K. lactis JA6. In lactose grown cells, lactose was transported by a system transport with a half-saturation constant (K s) of 1.49 ± 0.38 mM and a maximum velocity (V max) of 0.96 ± 0.12 mmol. (g dry weight)(-1) h(-1) for lactose. The transport system was constitutive and energy-dependent. Results obtained by different approaches showed that the lactose transport system was regulated by glucose at the transcriptional level and by glucose and other sugars at a post-translational level. In K. lactis JA6, galactose metabolization was under glucose control. These findings indicated that the regulation of lactose-galactose regulon in K. lactis was similar to the regulation of galactose regulon in Saccharomyces cerevisiae. PMID:24504708

  1. Oral immunization of mice with Lactococcus lactis expressing the rotavirus VP8* protein.

    PubMed

    Rodríguez-Díaz, Jesús; Montava, Rebeca; Viana, Rosa; Buesa, Javier; Pérez-Martínez, Gaspar; Monedero, Vicente

    2011-06-01

    The efficacy of recombinant Lactococcus lactis as a delivery vehicle for a rotavirus antigen was evaluated in a mouse model. The rotavirus VP8* protein was expressed intracellularly and extracellularly in L. lactis wild type and in an alr mutant deficient in alanine racemase activity, necessary for the synthesis of the cell-wall component D: -alanine. When the mucosal immune response was evaluated by measuring VP8*-specific IgA antibody in faeces, wild-type L. lactis triggered a low IgA synthesis only when the secreting strain was used. In contrast, VP8*-specific IgA was detected in faeces of both groups of mice orally given the alr mutant expressing extracellular VP8* and intracellular VP8*, which reached levels similar to that obtained with the wild type secreting strain. However, oral administration of the recombinant strains did not induce serum IgG or IgA responses. L. lactis cell-wall mutants may therefore provide certain advantages when low-antigenic proteins are expressed intracellularly. However, the low immune response obtained by using this antigen-bacterial host combination prompts to the use of new strains and vaccination protocols in order to develop acceptable rotavirus immunization levels. PMID:21302132

  2. Influence of Osmolarity and the Presence of an Osmoprotectant on Lactococcus lactis Growth and Bacteriocin Production

    PubMed Central

    Uguen, Patricia; Hamelin, Jack; Le Pennec, Jean-Paul; Blanco, Carlos

    1999-01-01

    Growth inhibition of Lactococcus lactis provoked by increasing osmolarity is reversed when glycine betaine (GB) or its analogs are added to a defined medium. Lacticin 481 production increased sharply with growth medium osmolarity in the absence of osmoprotectant but remained unaffected when GB was supplied in media of increasing osmolarity. PMID:9872793

  3. Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

  4. Genome Sequence of Lactococcus lactis subsp. cremoris Mast36, a Strain Isolated from Bovine Mastitis

    PubMed Central

    Gazzola, Simona; Fontana, Cecilia; Bassi, Daniela; Cocconcelli, Pier-Sandro; von Wright, Atte

    2015-01-01

    The genome sequence of Lactococcus lactis subsp. cremoris Mast36, isolated from bovine mastitis, is reported here. This strain was shown to be able to grow in milk and still possess genes of vegetable origin. The genome also contains a cluster of genes associated with pathogenicity. PMID:25999570

  5. The Plasmid Complement of Lactococcus lactis UC509.9 Encodes Multiple Bacteriophage Resistance Systems

    PubMed Central

    Ainsworth, Stuart; Mahony, Jennifer

    2014-01-01

    Lactococcus lactis subsp. cremoris strains are used globally for the production of fermented dairy products, particularly hard cheeses. Believed to be of plant origin, L. lactis strains that are used as starter cultures have undergone extensive adaptation to the dairy environment, partially through the acquisition of extrachromosomal DNA in the form of plasmids that specify technologically important phenotypic traits. Here, we present a detailed analysis of the eight plasmids of L. lactis UC509.9, an Irish dairy starter strain. Key industrial phenotypes were mapped, and genes that are typically associated with lactococcal plasmids were identified. Four distinct, plasmid-borne bacteriophage resistance systems were identified, including two abortive infection systems, AbiB and AbiD1, thereby supporting the observed phage resistance of L. lactis UC509.9. AbiB escape mutants were generated for phage sk1, which were found to carry mutations in orf6, which encodes the major capsid protein of this phage. PMID:24814781

  6. Complete Genome Sequence of Lactococcus lactis Strain AI06, an Endophyte of the Amazonian Açaí Palm

    PubMed Central

    de Oliveira, Viviane Matoso; de Almeida Pina, André Vicioli; Pérez-Chaparro, Paula Juliana; de Almeida, Lara Mendes; de Vasconcelos, Janaina Mota; de Oliveira, Layanna Freitas; da Silva, Daisy Elaine Andrade; Rogez, Hervé Louis Ghislain; Cretenet, Marina; Mamizuka, Elsa Masae; Nunes, Marcio Roberto Teixeira

    2014-01-01

    We report the genome, in a single chromosome, of Lactococcus lactis strain AI06, isolated from the mesocarp of the açaí fruit (Euterpe oleracea) in eastern Amazonia, Brazil. This strain is an endophyte of the açaí palm and also a component of the microbiota of the edible food product. PMID:25414513

  7. Complete Genome Sequence of Lactococcus lactis Strain AI06, an Endophyte of the Amazonian Açaí Palm.

    PubMed

    McCulloch, John Anthony; de Oliveira, Viviane Matoso; de Almeida Pina, André Vicioli; Pérez-Chaparro, Paula Juliana; de Almeida, Lara Mendes; de Vasconcelos, Janaina Mota; de Oliveira, Layanna Freitas; da Silva, Daisy Elaine Andrade; Rogez, Hervé Louis Ghislain; Cretenet, Marina; Mamizuka, Elsa Masae; Nunes, Marcio Roberto Teixeira

    2014-01-01

    We report the genome, in a single chromosome, of Lactococcus lactis strain AI06, isolated from the mesocarp of the açaí fruit (Euterpe oleracea) in eastern Amazonia, Brazil. This strain is an endophyte of the açaí palm and also a component of the microbiota of the edible food product. PMID:25414513

  8. The major facilitator superfamily transporter Knq1p modulates boron homeostasis in Kluyveromyces lactis.

    PubMed

    Svrbicka, Alexandra; Toth Hervay, Nora; Gbelska, Yvetta

    2016-03-01

    Boron is an essential micronutrient for living cells, yet its excess causes toxicity. To date, the mechanisms of boron toxicity are poorly understood. Recently, the ScATR1 gene has been identified encoding the main boron efflux pump in Saccharomyces cerevisiae. In this study, we analyzed the ScATR1 ortholog in Kluyveromyces lactis-the KNQ1 gene, to understand whether it participates in boron stress tolerance. We found that the KNQ1 gene, encoding a permease belonging to the major facilitator superfamily, is required for K. lactis boron tolerance. Deletion of the KNQ1 gene led to boron sensitivity and its overexpression increased K. lactis boron tolerance. The KNQ1 expression was induced by boron and the intracellular boron concentration was controlled by Knq1p. The KNQ1 promoter contains two putative binding motifs for the AP-1-like transcription factor KlYap1p playing a central role in oxidative stress defense. Our results indicate that the induction of the KNQ1 expression requires the presence of KlYap1p and that Knq1p like its ortholog ScAtr1p in S. cerevisiae functions as a boron efflux pump providing boron resistance in K. lactis. PMID:26142045

  9. Péritonites infectieuses en dialyse péritonéale continue ambulatoire au CHU de Rabat: profil bactériologique sur trois ans

    PubMed Central

    Lioussfi, Zineb; Rhou, Hakima; Ezzaitouni, Fatima; Ouzeddoun, Naima; Bayahia, Rabea; Benamar, Loubna

    2012-01-01

    Introduction La péritonite infectieuse (PI) est une des complications les plus sévères et les plus fréquentes de la dialyse péritonéale (DP). But: Déterminer le taux des PI et les germes en causes, et évaluer l’efficacité des protocoles thérapeutiques entrepris chez les patients traités par DP au CHU de Rabat. Méthodes Etude rétrospective effectuée en Septembre 2009 chez tous les patients traités par DP continue ambulatoire (DPCA) au CHU de Rabat depuis l’ouverture de l’unité de DP en Juillet 2006. Ont été inclus dans cette étude, tous les patients ayant fait une péritonite. Pour tous nos patients, nous avons relevé les données cliniques, biologiques et bactériologiques. Nous avons également recherché les causes des péritonites, le délai de survenue par rapport au début de la dialyse, et la durée moyenne de formation des patients. Résultats Au cours de la période de l’étude, 28 épisodes de PI sont survenus chez 19 patients dont la moyenne d’âge est de 46±16 (19-78) ans, avec une prédominance masculine (12 hommes/ 7 femmes). Le taux des PI dans notre unité de DP est de 21.07 mois-patients calculé par le RDPLF. Leur délai de survenue par rapport au début de la dialyse au centre est de 7.9 ±8 (1-29) mois. Lors de ces PI, les bactéries à Gram négatif (BGN) ont été retrouvées dans 55% des cas, contre uniquement 45% pour les Gram positifs. Conclusion La PI est une complication grave et redoutable de la DP. Le taux de PI dans notre centre de DPCA est de 21m-p ce qui correspond au taux acceptable définie par les sociétés internationales. Les germes les plus responsables des PI dans notre centre sont les BGN et la contamination semble être manu-portée se faisant essentiellement à partir de la flore environnementale et cutanée. PMID:22593777

  10. Adaptative Potential of the Lactococcus Lactis IL594 Strain Encoded in Its 7 Plasmids

    PubMed Central

    Gołębiewski, Marcin; Żylińska, Joanna; Grynberg, Marcin; Bardowski, Jacek K.

    2011-01-01

    The extrachromosomal gene pool plays a significant role both in evolution and in the environmental adaptation of bacteria. The L. lactis subsp. lactis IL594 strain contains seven plasmids, named pIL1 to pIL7, and is the parental strain of the plasmid-free L. lactis IL1403, which is one of the best characterized lactococcal strains of LAB. Complete nucleotide sequences of pIL1 (6,382 bp), pIL2 (8,277 bp), pIL3 (19,244 bp), pIL4 (48,979), pIL5 (23,395), pIL6 (28,435 bp) and pIL7 (28,546) were established and deposited in the generally accessible database (GeneBank). Nine highly homologous repB-containing replicons, belonging to the lactococcal theta-type replicons, have been identified on the seven plasmids. Moreover, a putative region involved in conjugative plasmid mobilization was found on four plasmids, through identification of the presence of mob genes and/or oriT sequences. Detailed bioinformatic analysis of the plasmid nucleotide sequences provided new insight into the repertoire of plasmid-encoded functions in L. lactis, and indicated that plasmid genes from IL594 strain can be important for L. lactis adaptation to specific environmental conditions (e.g. genes coding for proteins involved in DNA repair or cold shock response) as well as for technological processes (e.g. genes encoding citrate and lactose utilization, oligopeptide transport, restriction-modification system). Moreover, global gene analysis indicated cooperation between plasmid- and chromosome-encoded metabolic pathways. PMID:21789242

  11. Bifidobacterium animalis subsp. lactis decreases urinary oxalate excretion in a mouse model of primary hyperoxaluria

    PubMed Central

    Whittamore, Jonathan M.; Hatch, Marguerite

    2015-01-01

    Hyperoxaluria significantly increases the risk of calcium oxalate kidney stone formation. Since several bacteria have been shown to metabolize oxalate in vitro, including probiotic bifidobacteria, we focused on the efficiency and possible mechanisms by which bifidobacteria can infuence oxalate handling in vivo, especially in the intestines, and compared these results with the reported effects of Oxalobacter formigenes. Bifidobacterium animalis subsp. lactis DSM 10140 and B. adolescentis ATCC 15703 were administered to wild-type (WT) mice and to mice defcient in the hepatic enzyme alanine-glyoxylate aminotransferase (Agxt−/−, a mouse model of Primary Hyperoxaluria) that were fed an oxalate-supplemented diet. The administration of B. animalis subsp. lactis led to a significant decrease in urinary oxalate excretion in WT and Agxt−/− mice when compared to treatment with B. adolescent-is. Detection of B. animalis subsp. lactis in feces revealed that 3 weeks after oral gavage with the bacteria 64 % of WT mice, but only 37 % of Agxt−/− mice were colonized. Examining intestinal oxalate fuxes showed there were no significant changes to net oxalate secretion in colonized animals and were therefore not associated with the changes in urinary oxalate excretion. These results indicate that colonization with B. animalis subsp. lactis decreased urinary oxalate excretion by degrading dietary oxalate thus limiting its absorption across the intestine but it did not promote enteric oxalate excretion as reported for O. formigenes. Preventive or therapeutic administration of B. animalis subsp. lactis appears to have some potential to beneficially infuence dietary hyperoxaluria in mice. PMID:25269440

  12. Chromosomal Diversity in Lactococcus lactis and the Origin of Dairy Starter Cultures

    PubMed Central

    Kelly, William J.; Ward, Lawrence J. H.; Leahy, Sinead C.

    2010-01-01

    A large collection of Lactococcus lactis strains, including wild-type isolates and dairy starter cultures, were screened on the basis of their phenotype and the macrorestriction patterns produced from pulsed-field gel electrophoresis (PFGE) analysis of SmaI digests of genomic DNA. Three groups of dairy starter cultures, used for different purposes in the dairy industry, and a fourth group made up of strains isolated from the environment were selected for analysis of their chromosomal diversity using the endonuclease I-CeuI. Chromosome architecture was largely conserved with each strain having six copies of the rRNA genes, and the chromosome size of individual strains ranged between 2,240 and 2,688 kb. The origin of L. lactis strains showed the greatest correlation with chromosome size, and dairy strains, particularly those with the cremoris phenotype, had smaller chromosomes than wild-type strains. Overall, this study, coupled with analysis of the sequenced L. lactis genomes, provides evidence that defined strain dairy starter cultures have arisen from plant L. lactis strains. Adaptation of these strains to the dairy environment has involved loss of functions resulting in smaller chromosomes and acquisition of genes (usually plasmid associated) that facilitate growth in milk. We conclude that dairy starter cultures generally and the industrially used cremoris and diacetylactis phenotype strains in particular comprise a specialized group of L. lactis strains that have been selected to become an essential component of industrial processes and have evolved accordingly, so that they are no longer fit to survive outside the dairy environment. PMID:20847124

  13. Bacteriocin-Producing Lactic Acid Bacteria Isolated from Mangrove Forests in Southern Thailand as Potential Bio-Control Agents: Purification and Characterization of Bacteriocin Produced by Lactococcus lactis subsp. lactis KT2W2L.

    PubMed

    Hwanhlem, Noraphat; Biscola, Vanessa; El-Ghaish, Shady; Jaffrès, Emmanuel; Dousset, Xavier; Haertlé, Thomas; H-Kittikun, Aran; Chobert, Jean-Marc

    2013-12-01

    The aim of this work was to purify and characterize the bacteriocin produced by Lactococcus lactis subsp. lactis KT2W2L previously isolated from mangrove forests in southern Thailand, in order to evaluate its potential as new food protective agent. The active peptide from the cell-free supernatant of this strain was purified in 4 steps: (1) precipitation with 70 % saturated ammonium sulfate, (2) elution on a reversed-phase cartridge using different concentrations of acetonitrile, (3) cation-exchange chromatography and (4) final purification by reversed-phase HPLC on a C8 column. The molecular mass of 3,329.5254 Da of the purified bacteriocin, determined by mass spectrometry, is nearly identical to that of peptide nisin Z. The activity of the purified bacteriocin was unaffected by pH (2.0-10.0), thermostable but was sensitive to proteolytic enzymes. The bacteriocin activity was stable after 8 weeks of storage at -20 °C and 7 weeks of storage at 4 °C, but decreased after 3 weeks of storage at 37 °C. It was stable when incubated for 1 month at 4 °C in 0-30 % NaCl. Inhibitory spectrum of this bacteriocin showed a wide range of activity against similar bacterial strains, food-spoilage and food-borne pathogens. L. lactis subsp. lactis KT2W2L was sensitive to kanamycin, penicillin and tetracycline but resistant to ampicillin, gentamicin and vancomycin. The fragment obtained after amplification of genomic DNA from L. lactis subsp. lactis KT2W2L, with specific primers for bacteriocin genes, presented 99 % homology to the nisin Z gene. PCR amplification demonstrated that L. lactis subsp. lactis KT2W2L does not harbor virulence genes cylA, cylB, efaAfs and esp. The bacteriocin and its producing strain may find application as bio-preservatives for reduction in food-spoilage and food-borne pathogens in food products. PMID:26783072

  14. Transcriptional analysis of the cyclopropane fatty acid synthase gene of Lactococcus lactis MG1363 at low pH.

    PubMed

    Budin-Verneuil, Aurélie; Maguin, Emmanuelle; Auffray, Yanick; Ehrlich, S Dusko; Pichereau, Vianney

    2005-09-15

    Cyclopropane fatty acid synthase (cfa) catalyses the transfer of a methyl group from S-adenosylmethionine (SAM) to unsaturated fatty acids. Northern blot experiments demonstrated that the Lactococcus lactis MG1363 cfa gene is mainly expressed as a bicistronic transcript together with metK, the gene encoding SAM synthetase, and is highly induced by acidity. The cfa promoter was characterized by 5'-RACE PCR, and fused to beta-galactosidase by cloning into the pAK80 plasmid. This transcriptional fusion was highly induced by acidity (23-fold at pH 5) as well as during entry into the stationary phase (8-fold) in L. lactis. Interestingly, the cfa promoter expression is repressed in a L. lactis relA* mutant which accumulates (p)ppGpp, whereas its induction by acidity appeared independent of (p)ppGpp in L. lactis and in Escherichia coli. PMID:16098686

  15. Promoter and signal sequence from filamentous fungus can drive recombinant protein production in the yeast Kluyveromyces lactis.

    PubMed

    Madhavan, Aravind; Sukumaran, Rajeev K

    2014-08-01

    Cross-recognition of promoters from filamentous fungi in yeast can have important consequences towards developing fungal expression systems, especially for the rapid evaluation of their efficacy. A truncated 510bp inducible Trichoderma reesei cellobiohydrolase I (cbh1) promoter was tested for the expression of green fluorescent protein (GFP) in Kluyveromyces lactis after disrupting its native β-galactosidase (lac4) promoter. The efficiency of the CBH1 secretion signal was also evaluated by fusing it to the lac4 promoter of the yeast, which significantly increased the secretion of recombinant protein in K. lactis compared to the native α-mating factor secretion signal. The fungal promoter is demonstrated to have potential to drive heterologous protein production in K. lactis; and the small sized T. reesei cbh1 secretion signal can mediate the protein secretion in K. lactis with high efficiency. PMID:24661814

  16. Constructing a recombinant hyaluronic acid biosynthesis operon and producing food-grade hyaluronic acid in Lactococcus lactis.

    PubMed

    Sheng, Juzheng; Ling, Peixue; Wang, Fengshan

    2015-02-01

    Hyaluronic acid (HA), a natural high molecular weight polysaccharide, is produced by Streptococcus zooepidemicus. However, Streptococcus has several drawbacks including its potential to produce exotoxins, so there is demand for an alternative HA source. Here, a recombinant HA biosynthesis operon, as well as the HA biosynthesis operon of S. zooepidemicus were introduced into L. lactis using the nisin-controlled expression system, respectively. HA was successfully synthesized by recombinant L. lactis. Furthermore, overexpression of the endogenous enzymes directing the synthesis of precursor sugars was effective at increasing HA production, and increasing the supply of UDP-activated monosaccharide donors aided synthesis of monodisperse HA polysaccharides. Besides GRAS host strain (L. lactis) and NICE system, the selecting marker (lacF gene) of the recombinant strain is also food grade. Therefore, HA produced by recombinant L. lactis overcomes the problems associated with Streptococcus and provides a source of food-grading HA appropriate for widespread biotechnological applications. PMID:25447786

  17. Reduced Binding of the Endolysin LysTP712 to Lactococcus lactis ΔftsH Contributes to Phage Resistance

    PubMed Central

    Roces, Clara; Campelo, Ana B.; Escobedo, Susana; Wegmann, Udo; García, Pilar; Rodríguez, Ana; Martínez, Beatriz

    2016-01-01

    Absence of the membrane protease FtsH in Lactococcus lactis hinders release of the bacteriophage TP712. In this work we have analyzed the mechanism responsible for the non-lytic phenotype of L. lactis ΔftsH after phage infection. The lytic cassette of TP712 contains a putative antiholin–pinholin system and a modular endolysin (LysTP712). Inducible expression of the holin gene demonstrated the presence of a dual start motif which is functional in both wildtype and L. lactis ΔftsH cells. Moreover, simulating holin activity with ionophores accelerated lysis of wildtype cells but not L. lactis ΔftsH cells, suggesting inhibition of the endolysin rather than a role of FtsH in holin activation. However, zymograms revealed the synthesis of an active endolysin in both wildtype and L. lactis ΔftsH TP712 lysogens. A reporter protein was generated by fusing the cell wall binding domain of LysTP712 to the fluorescent mCherry protein. Binding of this reporter protein took place at the septa of both wildtype and L. lactis ΔftsH cells as shown by fluorescence microscopy. Nonetheless, fluorescence spectroscopy demonstrated that mutant cells bound 40% less protein. In conclusion, the non-lytic phenotype of L. lactis ΔftsH is not due to direct action of the FtsH protease on the phage lytic proteins but rather to a putative function of FtsH in modulating the architecture of the L. lactis cell envelope that results in a lower affinity of the phage endolysin to its substrate. PMID:26904011

  18. Cloning, nucleotide sequence, expression, and chromosomal location of ldh, the gene encoding L-(+)-lactate dehydrogenase, from Lactococcus lactis.

    PubMed Central

    Llanos, R M; Hillier, A J; Davidson, B E

    1992-01-01

    A gene (designated ldh) that encodes fructose-1,6-bisphosphate-activated L-(+)-lactate dehydrogenase was cloned from Lactococcus lactis subsp. lactis. Plasmids containing ldh conferred fructose-1,6-bisphosphate-activated L-(+)-lactate dehydrogenase activity on Escherichia coli cells. This activity was conferred only when a promoter had been introduced into the plasmid to express the cloned ldh. The nucleotide sequence of ldh predicted a chain length of 324 amino acids and a subunit molecular weight of 34,910 for the enzyme, after removal of the N-terminal methionine residue. Northern analyses of L. lactis subsp. lactis RNA showed that a 4.1-kb transcript hybridized strongly with ldh and that 1.2- and 1.1-kb transcripts hybridized to much lesser extents. Promoter- and terminator-cloning studies in which we used the vectors pGKV210 and pGKV259 in L. lactis subsp. lactis revealed that the 5' flanking DNA of ldh is devoid of transcription initiation signals and that transcription entering the 3' flanking DNA from either direction is efficiently terminated. These data and the data from Northern analyses led to the conclusion that ldh is expressed as the 3' gene of the 4.1-kb transcript and suggested that posttranscriptional processing yielded the shorter transcripts. We determined that ldh is located on the L. lactis subsp. lactis chromosome between coordinates 1.619 and 1.669 of the previously reported physical map (D. L. Tulloch, L. R. Finch, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 173:2768-2775, 1991). Images PMID:1400245

  19. Expression of PprI from Deinococcus radiodurans Improves Lactic Acid Production and Stress Tolerance in Lactococcus lactis

    PubMed Central

    Dong, Xiangrong; Tian, Bing; Dai, Shang; Li, Tao; Guo, Linna; Tan, Zhongfang; Jiao, Zhen; Jin, Qingsheng; Wang, Yanping; Hua, Yuejin

    2015-01-01

    PprI is a general switch protein that regulates the expression of certain proteins involved in pathways of cellular resistance in the extremophilic bacterium Deinococcus radiodurans. In this study, we transformed pprI into Lactococcus lactis strain MG1363 using the lactococcal shuttle vector pMG36e and investigated its effects on the tolerance and lactic acid production of L. lactis while under stress. PprI was stably expressed in L. lactis as confirmed by western blot assays. L. lactis expressing PprI exhibited significantly improved resistance to oxidative stress and high osmotic pressure. This enhanced cellular tolerance to stressors might be due to the regulation of resistance-related genes (e.g., recA, recO, sodA, and nah) by pprI. Moreover, transformed L. lactis demonstrated increased lactic acid production, attributed to enhanced lactate dehydrogenase activity. These results suggest that pprI can improve the tolerance of L. lactis to environmental stresses, and this transformed bacterial strain is a promising candidate for industrial applications of lactic acid production. PMID:26562776

  20. Proteomic Analyses To Reveal the Protective Role of Glutathione in Resistance of Lactococcus lactis to Osmotic Stress?

    PubMed Central

    Zhang, Yanhe; Zhang, Yanping; Zhu, Yan; Mao, Shaoming; Li, Yin

    2010-01-01

    Previously, we have shown that glutathione can protect Lactococcus lactis against oxidative stress and acid stress. In this study, we show that glutathione taken up by L. lactis SK11 can protect this organism against osmotic stress. When exposed to 5 M NaCl, L. lactis SK11 cells containing glutathione exhibited significantly improved survival compared to the control cells. Transmission electron microscopy showed that the integrity of L. lactis SK11 cells containing glutathione was maintained for at least 24 h, whereas autolysis of the control cells occurred within 2 h after exposure to this osmotic stress. Comparative proteomic analyses using SK11 cells containing or not containing glutathione that were exposed or not exposed to osmotic stress were performed. The results revealed that 21 of 29 differentially expressed proteins are involved in metabolic pathways, mainly sugar metabolism. Several glycolytic enzymes of L. lactis were significantly upregulated in the presence of glutathione, which might be the key for improving the general stress resistance of a strain. Together with the results of previous studies, the results of this study demonstrated that glutathione plays important roles in protecting L. lactis against multiple environmental stresses; thus, glutathione can be considered a general protectant for improving the robustness and stability of dairy starter cultures. PMID:20348298

  1. The ldh phylogeny for environmental isolates of Lactococcus lactis is consistent with rRNA genotypes but not with phenotypes.

    PubMed Central

    Urbach, E; Daniels, B; Salama, M S; Sandine, W E; Giovannoni, S J

    1997-01-01

    Lactate dehydrogenase (ldh) gene sequences, levels of 16S rRNA group-specific probe binding, and phenotypic characteristics were compared for 45 environmental isolates and four commercial starter strains of Lactococcus lactis to identify evolutionary groups best suited to cheddar cheese manufacture, ldh sequences from the environmental isolates showed high similarity to those from two groups of L. lactis used for industrial fermentations, L. lactis subsp. cremoris and subsp. lactis. Within each phylogenetically defined subspecies, ldh sequence similarities were greater than 99.1%. Strains with phenotypic traits formerly diagnostic for both subspecies were found in each ldh similarity group, but only strains belonging to L. lactis subsp. cremoris by both the newer, genetic and the older, superseded phenotypic criteria were judged potentially suitable for the commercial production of cheddar cheese. Identical evolutionary relationships were inferred from ldh sequences and from binding of subspecies-specific, 16S rRNA-directed oligonucleotide probes. However, groups defined according to these chromosomal traits bore no relationship to patterns of arginine deamination, carbon substrate utilization, or bacteriophage sensitivity, which may be encoded by cryptic genes or sexually transmissible genetic elements. Fourteen new L. lactis subsp. cremoris isolates were identified as suitable candidates for cheddar cheese manufacture, and 10 of these were completely resistant to three different batteries of commercial bacteriophages known to reduce starter activity. PMID:9023947

  2. Expression of PprI from Deinococcus radiodurans Improves Lactic Acid Production and Stress Tolerance in Lactococcus lactis.

    PubMed

    Dong, Xiangrong; Tian, Bing; Dai, Shang; Li, Tao; Guo, Linna; Tan, Zhongfang; Jiao, Zhen; Jin, Qingsheng; Wang, Yanping; Hua, Yuejin

    2015-01-01

    PprI is a general switch protein that regulates the expression of certain proteins involved in pathways of cellular resistance in the extremophilic bacterium Deinococcus radiodurans. In this study, we transformed pprI into Lactococcus lactis strain MG1363 using the lactococcal shuttle vector pMG36e and investigated its effects on the tolerance and lactic acid production of L. lactis while under stress. PprI was stably expressed in L. lactis as confirmed by western blot assays. L. lactis expressing PprI exhibited significantly improved resistance to oxidative stress and high osmotic pressure. This enhanced cellular tolerance to stressors might be due to the regulation of resistance-related genes (e.g., recA, recO, sodA, and nah) by pprI. Moreover, transformed L. lactis demonstrated increased lactic acid production, attributed to enhanced lactate dehydrogenase activity. These results suggest that pprI can improve the tolerance of L. lactis to environmental stresses, and this transformed bacterial strain is a promising candidate for industrial applications of lactic acid production. PMID:26562776

  3. Secretion and properties of a hybrid Kluyveromyces lactis-Aspergillus niger ?-galactosidase

    PubMed Central

    Rodríguez, Ángel Pereira; Leiro, Rafael Fernández; Trillo, M Cristina; Cerdán, M Esperanza; Siso, M Isabel González; Becerra, Manuel

    2006-01-01

    Background The ?-galactosidase from Kluyveromyces lactis is a protein of outstanding biotechnological interest in the food industry and milk whey reutilization. However, due to its intracellular nature, its industrial production is limited by the high cost associated to extraction and downstream processing. The yeast-system is an attractive method for producing many heterologous proteins. The addition of a secretory signal in the recombinant protein is the method of choice to sort it out of the cell, although biotechnological success is not guaranteed. The cell wall acting as a molecular sieve to large molecules, culture conditions and structural determinants present in the protein, all have a decisive role in the overall process. Protein engineering, combining domains of related proteins, is an alternative to take into account when the task is difficult. In this work, we have constructed and analyzed two hybrid proteins from the ?-galactosidase of K. lactis, intracellular, and its Aspergillus niger homologue that is extracellular. In both, a heterologous signal peptide for secretion was also included at the N-terminus of the recombinant proteins. One of the hybrid proteins obtained has interesting properties for its biotechnological utilization. Results The highest levels of intracellular and extracellular ?-galactosidase were obtained when the segment corresponding to the five domain of K. lactis ?-galactosidase was replaced by the corresponding five domain of the A. niger ?-galactosidase. Taking into account that this replacement may affect other parameters related to the activity or the stability of the hybrid protein, a thoroughly study was performed. Both pH (6.5) and temperature (40°C) for optimum activity differ from values obtained with the native proteins. The stability was higher than the corresponding to the ?-galactosidase of K. lactis and, unlike this, the activity of the hybrid protein was increased by the presence of Ni2+. The affinity for synthetic (ONPG) or natural (lactose) substrates was higher in the hybrid than in the native K. lactis ?-galactosidase. Finally, a structural-model of the hybrid protein was obtained by homology modelling and the experimentally determined properties of the protein were discussed in relation to it. Conclusion A hybrid protein between K. lactis and A. niger ?-galactosidases was constructed that increases the yield of the protein released to the growth medium. Modifications introduced in the construction, besides to improve secretion, conferred to the protein biochemical characteristics of biotechnological interest. PMID:17176477

  4. Metabolic engineering of Kluyveromyces lactis for L-ascorbic acid (vitamin C) biosynthesis

    PubMed Central

    2013-01-01

    Background L-ascorbic acid (L-AA) is naturally synthesized in plants from D-glucose by 10 steps pathway. The pathway branch to synthesize L-galactose, the key intermediate for L-ascorbic acid biosynthesis, has been recently elucidated. Budding yeast produces an 5-carbon ascorbic acid analogue Dehydro-D-arabinono 1,4-lactone (D-DAL), which is synthesized from D-arabinose. Yeast is able to synthesize L-ascorbic acid only if it is cultivated in the presence of one of its precursors: L-galactose, L-galactono 1,4-lactone, or L-gulono 1,4-lactone extracted from plants or animals. To avoid feeding the yeast culture with this “L” enantiomer, we engineered Kluyveromyces lactis with L-galactose biosynthesis pathway genes: GDP-mannose 3,5-epimerase (GME), GDP-L-galactose phosphorylase (VTC2) and L-galactose-1-phosphate phosphatase (VTC4) isolated from Arabidopsis thaliana. Results Plasmids were constructed and modified such that the cloned plant genes were targeted to the K. lactis LAC4 Locus by homologous recombination and that the expression was associated to the growth on D-galactose or lactose. Upon K. lactis transformation, GME was under the control of the native LAC4 promoter whereas VTC2 and VTC4 were expressed from the S. cerevisiae promoters GPD1 and ADH1 respectively. The expression in K. lactis, of the L-galactose biosynthesis genes was determined by Reverse Transcriptase-PCR and western blotting. The recombinant yeasts were capable to produce about 30 mg.L-1 of L-ascorbic acid in 48 hours of cultivation when cultured on rich medium with 2% (w/v) D-galactose. We also evaluated the L-AA production culturing recombinant recombinant strains in cheese whey, a waste product during cheese production, as an alternative source of lactose. Conclusions This work is the first attempt to engineer K. lactis cells for L-ascorbic acid biosynthesis by a fermentation process without any trace of “L” isomers precursors in the culture medium. We have engineered K. lactis strains capable of converting lactose and D-galactose into L-galactose, by the integration of the genes from the A. thaliana L-galactose pathway. L-galactose is a rare sugar, which is one of the main precursors for L-AA production. PMID:23799937

  5. Intranasal immunization with live recombinant Lactococcus lactis combined with heat-labile toxin B subunit protects chickens from highly pathogenic avian influenza H5N1 virus.

    PubMed

    Lei, Han; Peng, Xiaojue; Shu, Handing; Zhao, Daxian

    2015-01-01

    Development of safe and effective vaccines to prevent highly pathogenic avian influenza H5N1 virus infection is a challenging goal. Lactococcus lactis (L. lactis) is an ideal delivery vector for vaccine development, and it has been shown previously that oral immunization of encapsulated secretory L. lactis-hemagglutinin (HA) could provide complete protection against homologous H5N1 virus challenge in the mice model. While intranasal immunization is an appealing approach, it is now reported that secretory L. lactis-HA combined with mucosal adjuvant heat-labile toxin B subunit (LTB) could provide protective immunity in the chicken model. As compared to intranasal immunization with L. lactis-HA alone, L. lactis-HA combined with LTB (L. lactis-HA?+?LTB) could elicit robust neutralizing antibody responses and mucosal IgA responses, as well as strong cellular immune responses in the vaccinated chickens. Importantly, intranasal immunization with L. lactis-HA?+?LTB could provide 100% protection against H5N1 virus challenge. Taken together, these results suggest that intranasal immunization with L. lactis-HA?+?LTB can be considered as an effective approach for preventing and controlling infection of H5N1 virus in poultry during an avian influenza A/H5N1 pandemic. PMID:24861477

  6. Plasmids of Raw Milk Cheese Isolate Lactococcus lactis subsp. lactis Biovar diacetylactis DPC3901 Suggest a Plant-Based Origin for the Strain ▿ †

    PubMed Central

    Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F.; Ross, R. Paul

    2011-01-01

    The four-plasmid complement of the raw milk cheese isolate Lactococcus lactis subsp. lactis biovar diacetylactis DPC3901 was sequenced, and some genetic features were functionally analyzed. The complete sequences of pVF18 (18,977 bp), pVF21 (21,739 bp), pVF22 (22,166 bp), and pVF50 (53,876 bp) were obtained. Each plasmid contained genes not previously described for Lactococcus, in addition to genes associated with plant-derived lactococcal strains. Most of the novel genes were found on pVF18 and encoded functions typical of bacteria associated with plants, such as activities of plant cell wall modification (orf11 and orf25). In addition, a predicted high-affinity regulated system for the uptake of cobalt was identified (orf19 to orf21 [orf19-21]), which has a single database homolog on a plant-derived Leuconostoc plasmid and whose functionality was demonstrated following curing of pVF18. pVF21 and pVF22 encode additional metal transporters, which, along with orf19-21 of pVF18, could enhance host ability to uptake growth-limiting amounts of biologically essential ions within the soil. In addition, vast regions from pVF50 and pVF21 share significant homology with the plant-derived lactococcal plasmid pGdh442, which is indicative of extensive horizontal gene transfer and recombination between these plasmids and suggests a common plant niche for their hosts. Phenotypes associated with these regions include glutamate dehydrogenase activity and Na+ and K+ transport. The presence of numerous plant-associated markers in L. lactis DPC3901 suggests a plant origin for the raw milk cheese isolate and provides for the first time the genetic basis to support the concept of the plant-milk transition for Lactococcus strains. PMID:21803914

  7. Plasmids of raw milk cheese isolate Lactococcus lactis subsp. lactis biovar diacetylactis DPC3901 suggest a plant-based origin for the strain.

    PubMed

    Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F; Ross, R Paul

    2011-09-01

    The four-plasmid complement of the raw milk cheese isolate Lactococcus lactis subsp. lactis biovar diacetylactis DPC3901 was sequenced, and some genetic features were functionally analyzed. The complete sequences of pVF18 (18,977 bp), pVF21 (21,739 bp), pVF22 (22,166 bp), and pVF50 (53,876 bp) were obtained. Each plasmid contained genes not previously described for Lactococcus, in addition to genes associated with plant-derived lactococcal strains. Most of the novel genes were found on pVF18 and encoded functions typical of bacteria associated with plants, such as activities of plant cell wall modification (orf11 and orf25). In addition, a predicted high-affinity regulated system for the uptake of cobalt was identified (orf19 to orf21 [orf19-21]), which has a single database homolog on a plant-derived Leuconostoc plasmid and whose functionality was demonstrated following curing of pVF18. pVF21 and pVF22 encode additional metal transporters, which, along with orf19-21 of pVF18, could enhance host ability to uptake growth-limiting amounts of biologically essential ions within the soil. In addition, vast regions from pVF50 and pVF21 share significant homology with the plant-derived lactococcal plasmid pGdh442, which is indicative of extensive horizontal gene transfer and recombination between these plasmids and suggests a common plant niche for their hosts. Phenotypes associated with these regions include glutamate dehydrogenase activity and Na(+) and K(+) transport. The presence of numerous plant-associated markers in L. lactis DPC3901 suggests a plant origin for the raw milk cheese isolate and provides for the first time the genetic basis to support the concept of the plant-milk transition for Lactococcus strains. PMID:21803914

  8. Safety of Bifidobacterium animalis subsp. lactis (B. lactis) strain BB-12-supplemented yogurt in healthy adults on antibiotics: a phase I safety study

    PubMed Central

    Merenstein, Daniel J; Tan, Tina P; Molokin, Aleksey; Smith, Keisha Herbin; Roberts, Robert F; Shara, Nawar M; Mete, Mihriye; Sanders, Mary Ellen; Solano-Aguilar, Gloria

    2015-01-01

    Probiotics are live microorganisms that, when administered in sufficient doses, provide health benefits on the host. The United States Food and Drug Administration (FDA) requires phase I safety studies for probiotics when the intended use of the product is as a drug. The purpose of the study was to determine the safety of Bifidobacterium animalis subsp lactis (B. lactis) strain BB-12 (BB-12)-supplemented yogurt when consumed by a generally healthy group of adults who were prescribed a 10-day course of antibiotics for a respiratory infection. Secondary aims were to assess the ability of BB-12 to affect the expression of whole blood immune markers associated with cell activation and inflammatory response. A phase I, double-blinded, randomized controlled study was conducted in compliance with FDA guidelines for an Investigational New Drug (IND). Forty participants were randomly assigned to consume 4 ounces of either BB-12 -supplemented yogurt or non-supplemented control yogurt daily for 10 d. The primary outcome was to assess safety and tolerability, assessed by the number of reported adverse events. A total of 165 non-serious adverse events were reported, with no differences between the control and BB-12 groups. When compared to the control group, B lactis fecal levels were modestly higher in the BB-12-supplemented group. In a small subset of patients, changes in whole blood expression of genes associated with regulation and activation of immune cells were detected in the BB-12-supplemented group. BB-12-supplemented yogurt is safe and well tolerated when consumed by healthy adults concurrently taking antibiotics. This study will form the basis for future randomized clinical trials investigating the potential immunomodulatory effects of BB-12-supplemented yogurt in a variety of disease states. PMID:25569274

  9. Safety of Bifidobacterium animalis subsp. lactis (B. lactis) strain BB-12-supplemented yogurt in healthy adults on antibiotics: a phase I safety study.

    PubMed

    Merenstein, Daniel J; Tan, Tina P; Molokin, Aleksey; Smith, Keisha Herbin; Roberts, Robert F; Shara, Nawar M; Mete, Mihriye; Sanders, Mary Ellen; Solano-Aguilar, Gloria

    2015-01-01

    Probiotics are live microorganisms that, when administered in sufficient doses, provide health benefits on the host. The United States Food and Drug Administration (FDA) requires phase I safety studies for probiotics when the intended use of the product is as a drug. The purpose of the study was to determine the safety of Bifidobacterium animalis subsp lactis (B. lactis) strain BB-12 (BB-12)-supplemented yogurt when consumed by a generally healthy group of adults who were prescribed a 10-day course of antibiotics for a respiratory infection. Secondary aims were to assess the ability of BB-12 to affect the expression of whole blood immune markers associated with cell activation and inflammatory response. A phase I, double-blinded, randomized controlled study was conducted in compliance with FDA guidelines for an Investigational New Drug (IND). Forty participants were randomly assigned to consume 4 ounces of either BB-12 -supplemented yogurt or non-supplemented control yogurt daily for 10 d. The primary outcome was to assess safety and tolerability, assessed by the number of reported adverse events. A total of 165 non-serious adverse events were reported, with no differences between the control and BB-12 groups. When compared to the control group, B lactis fecal levels were modestly higher in the BB-12-supplemented group. In a small subset of patients, changes in whole blood expression of genes associated with regulation and activation of immune cells were detected in the BB-12-supplemented group. BB-12-supplemented yogurt is safe and well tolerated when consumed by healthy adults concurrently taking antibiotics. This study will form the basis for future randomized clinical trials investigating the potential immunomodulatory effects of BB-12-supplemented yogurt in a variety of disease states. PMID:25569274

  10. Defined bacterial culture development for methane generation from lactose. [Streptococcus lactis; Clostridium formicoaceticum; Methanococcus mazei

    SciTech Connect

    Yang, S.T.; Tang, I.C.; Okos, M.R.

    1988-06-20

    The defined microbial cultures for methane generation from lactose were investigated. A mixed culture consisting of homolactic (Streptococcus lactis), homoacetic (Clostridium formicoaceticum), and acetate-utilizing methanogenic (Methanococcus mazei) bacteria was used to convert lactose and whey permeate to methane at mesophilic temperatures (35-37/sup 0/C) and a pH around 7.0. Lactose was first converted to lactic acid by S. lactis, then to acetic acid by C. formicoaceticum, and finally to methane and CO/sub 2/ by M. mazei. About 5.3 mol methane were obtained from each mole of lactose consumed, and the conversion of acetate to methane was the rate-limiting step for this mixed-culture fermentation.

  11. Fractionation of Dipeptidase Activities of Streptococcus lactis and Dipeptidase Specificity of Some Lactic Acid Bacteria

    PubMed Central

    Sørhaug, Terje; Solberg, Peter

    1973-01-01

    Proteins in sonic extracts of Streptococcus lactis were separated by starch-gel electrophoresis at high voltage. Each slab was sliced longitudinally, and half was stained for peptidases in a mixture containing a peptide, L-amino acid oxidase (snake venom), peroxidase, and o-dianisdine; the other half was stained in amido black for protein. In addition to sonic treatment, trypsin also released enzyme from acetone-treated cells. Glycyl-L-phenylalanine, L-phenylalanyl-glycine, L-alanyl-L-phenylalanine, and L-phenylalanyl-L-alanine served as substrates in characterizing the enzymes. Five different fractions of various specificities appeared in the gels. Broad-range substrate specificities were found for sonic extracts of S. lactis, S. cremoris, S. durans, and Lactobacillus acidophilus. Images PMID:4633426

  12. Construction and application of a food-grade expression system for Lactococcus lactis.

    PubMed

    Lu, Wenwei; Kong, Jian; Kong, Wentao

    2013-06-01

    A food-grade host/vector expression system for Lactococcus lactis was constructed using alanine racemase gene (alr) as the complementation marker. We obtained an alanine racemase auxotrophic mutant L. lactis NZ9000?alr by double-crossover recombination using temperature-sensitive integration plasmid pG(+)host9 and a food-grade vector pALR with entirely lactococcal DNA elements, including lactococcal replicon, nisin-inducible promoter PnisA and the alr gene from Lactobacillus casei BL23 as a complementation marker. By using the new food-grade host/vector system, the green fluorescent protein and capsid protein of porcine circovirus type II were successfully overexpressed under the nisin induction. These results indicate that this food-grade host/vector expression system has application potential as an excellent antigen delivery vehicle, and is also suitable for the use in the manufacture of ingredients for the food industry. PMID:22674186

  13. Secretion of biologically active human interleukin 22 (IL-22) by Lactococcus lactis.

    PubMed

    Loera-Arias, María J; Villatoro-Hernández, Julio; Parga-Castillo, Miguel A; Salcido-Montenegro, Alejandro; Barboza-Quintana, Oralia; Muñoz-Maldonado, Gerardo E; Montes-de-Oca-Luna, Roberto; Saucedo-Cárdenas, Odila

    2014-12-01

    Interleukin-22 (IL-22) participates in the modulation of innate immunity and inflammation. This cytokine has important therapeutic potential, such as with ulcerative colitis, liver and lung injury, and infection, in different animal models. We generated a Lactococcus lactis strain that secretes human IL-22 under the regulation of the nisin-inducible promoter. Identification and secretion of this cytokine was demonstrated using western blots of culture supernatants from IL-22-expressing bacteria. The recombinant IL-22 protein produced by L. lactis was biologically active as determined by its ability to induce IL-10 secretion when co-cultured with a colon epithelial cell line in vitro. We consider this novel strain a promising live vaccine for various therapeutic applications. PMID:25214209

  14. Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis

    PubMed Central

    2013-01-01

    Background Glycolic acid is a C2 hydroxy acid that is a widely used chemical compound. It can be polymerised to produce biodegradable polymers with excellent gas barrier properties. Currently, glycolic acid is produced in a chemical process using fossil resources and toxic chemicals. Biotechnological production of glycolic acid using renewable resources is a desirable alternative. Results The yeasts Saccharomyces cerevisiae and Kluyveromyces lactis are suitable organisms for glycolic acid production since they are acid tolerant and can grow in the presence of up to 50 g l-1 glycolic acid. We engineered S. cerevisiae and K. lactis for glycolic acid production using the reactions of the glyoxylate cycle to produce glyoxylic acid and then reducing it to glycolic acid. The expression of a high affinity glyoxylate reductase alone already led to glycolic acid production. The production was further improved by deleting genes encoding malate synthase and the cytosolic form of isocitrate dehydrogenase. The engineered S. cerevisiae strain produced up to about 1 g l-1 of glycolic acid in a medium containing d-xylose and ethanol. Similar modifications in K. lactis resulted in a much higher glycolic acid titer. In a bioreactor cultivation with d-xylose and ethanol up to 15 g l-1 of glycolic acid was obtained. Conclusions This is the first demonstration of engineering yeast to produce glycolic acid. Prior to this work glycolic acid production through the glyoxylate cycle has only been reported in bacteria. The benefit of a yeast host is the possibility for glycolic acid production also at low pH, which was demonstrated in flask cultivations. Production of glycolic acid was first shown in S. cerevisiae. To test whether a Crabtree negative yeast would be better suited for glycolic acid production we engineered K. lactis in the same way and demonstrated it to be a better host for glycolic acid production. PMID:24053654

  15. Roles of thioredoxin reductase during the aerobic life of Lactococcus lactis.

    PubMed

    Vido, Karin; Diemer, Hélène; Van Dorsselaer, Alain; Leize, Emmanuelle; Juillard, Vincent; Gruss, Alexandra; Gaudu, Philippe

    2005-01-01

    Thiol-disulfide bond balance is generally maintained in bacteria by thioredoxin reductase-thioredoxin and/or glutathione-glutaredoxin systems. Some gram-positive bacteria, including Lactococcus lactis, do not produce glutathione, and the thioredoxin system is presumed to be essential. We constructed an L. lactis trxB1 mutant. The mutant was obtained under anaerobic conditions in the presence of dithiothreitol (DTT). Unexpectedly, the trxB1 mutant was viable without DTT and under aerated static conditions, thus disproving the essentiality of this system. Aerobic growth of the trxB1 mutant did not require glutathione, also ruling out the need for this redox maintenance system. Proteomic analyses showed that known oxidative stress defense proteins are induced in the trxB1 mutant. Two additional effects of trxB1 were not previously reported in other bacteria: (i) induction of proteins involved in fatty acid or menaquinone biosynthesis, indicating that membrane synthesis is part of the cellular response to a redox imbalance, and (ii) alteration of the isoforms of the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GapB). We determined that the two GapB isoforms in L. lactis differed by the oxidation state of catalytic-site cysteine C152. Unexpectedly, a decrease specific to the oxidized, inactive form was observed in the trxB1 mutant, possibly because of proteolysis of oxidized GapB. This study showed that thioredoxin reductase is not essential in L. lactis and that its inactivation triggers induction of several mechanisms acting at the membrane and metabolic levels. The existence of a novel redox function that compensates for trxB1 deficiency is suggested. PMID:15629931

  16. Identification of a Stimulant for Lactobacillus casei Produced by Streptococcus lactis

    PubMed Central

    Branen, A. L.; Keenan, T. W.

    1970-01-01

    A compound stimulatory to the growth of Lactobacillus casei was isolated from cell extracts of Streptococcus lactis, purified, and characterized. The stimulant was identified as a small peptide with a molecular weight of approximately 4,500 daltons. The purified peptide gave negative tests for nucleic acids, phosphorus, glucosamine, and carbohydrates. Sixteen amino acids were detected in acid hydrolysates of this peptide. Serine, proline, glycine, alanine, leucine, and glutamic acid were present in hydrolysates in greatest abundance. PMID:5485084

  17. Phenotypic and genetic characterization of the bacteriophage abortive infection mechanism AbiK from Lactococcus lactis.

    PubMed Central

    Emond, E; Holler, B J; Boucher, I; Vandenbergh, P A; Vedamuthu, E R; Kondo, J K; Moineau, S

    1997-01-01

    The natural plasmid pSRQ800 isolated from Lactococcus lactis subsp. lactis W1 conferred strong phage resistance against small isometric phages of the 936 and P335 species when introduced into phage-sensitive L. lactis strains. It had very limited effect on prolate phages of the c2 species. The phage resistance mechanism encoded on pSRQ800 is a temperature-sensitive abortive infection system (Abi). Plasmid pSRQ800 was mapped, and the Abi genetic determinant was localized on a 4.5-kb EcoRI fragment. Cloning and sequencing of the 4.5-kb fragment allowed the identification of two large open reading frames. Deletion mutants showed that only orf1 was needed to produce the Abi phenotype. orf1 (renamed abiK) coded for a predicted protein of 599 amino acids (AbiK) with an estimated molecular size of 71.4 kDa and a pI of 7.98. DNA and protein sequence alignment programs found no significant homology with databases. However, a database query based on amino acid composition suggested that AbiK might be in the same protein family as AbiA. No phage DNA replication nor phage structural protein production was detected in infected AbiK+ L. lactis cells. This system is believed to act at or prior to phage DNA replication. WHen cloned into a high-copy vector, AbiK efficiency increased 100-fold. AbiK provides another powerful tool that can be useful in controlling phages during lactococcal fermentations. PMID:9097424

  18. Acetate Utilization in Lactococcus lactis Deficient in Lactate Dehydrogenase: a Rescue Pathway for Maintaining Redox Balance

    PubMed Central

    Hols, Pascal; Ramos, Ana; Hugenholtz, Jeroen; Delcour, Jean; de Vos, Willem M.; Santos, Helena; Kleerebezem, Michiel

    1999-01-01

    Acetate was shown to improve glucose fermentation in Lactococcus lactis deficient in lactate dehydrogenase. 13C and 1H nuclear magnetic resonance studies using [2-13C]glucose and [2-13C]acetate as substrates demonstrated that acetate was exclusively converted to ethanol. This novel pathway provides an alternative route for NAD+ regeneration in the absence of lactate dehydrogenase. PMID:10464231

  19. Measuring Kinetic Dissociation/Association Constants Between Lactococcus lactis Bacteria and Mucins Using Living Cell Probes

    PubMed Central

    Le, Doan Thanh Lam; Guérardel, Yann; Loubière, Pascal; Mercier-Bonin, Muriel; Dague, Etienne

    2011-01-01

    In this work we focused on quantifying adhesion between Lactococcus lactis, the model for lactic acid bacteria (LAB) and mucins. Interactions between two strains of L. lactis (IBB477 and MG1820 as control) and pig gastric mucin–based coating were measured and compared with the use of atomic force microscopy. Analysis of retraction force-distance curves shed light on the differential contributions of nonspecific and specific forces. An increased proportion of specific adhesive events was obtained for IBB477 (20% vs. 5% for the control). Blocking assays with free pig gastric mucin and its O-glycan moiety showed that oligosaccharides play a major (but not exclusive) role in L. lactis-mucins interactions. Specific interactions were analyzed in terms of kinetic constants. An increase in the loading rate of atomic force microscope tip led to a higher force between interacting biological entities, which was directly linked to the kinetic dissociation constant (Koff). Enhancing the contact time between the tip and the sample allowed an increase in the interaction probability, which can be related to the kinetic association constant (Kon). Variations in the loading rate and contact time enabled us to determine Kon (3.3 × 102 M−1·s−1) and Koff (0.46 s−1), and the latter was consistent with values given in the literature for sugar-protein interactions. PMID:22261074

  20. The Nanomechanical Properties of Lactococcus lactis Pili Are Conditioned by the Polymerized Backbone Pilin.

    PubMed

    Castelain, Mickaël; Duviau, Marie-Pierre; Canette, Alexis; Schmitz, Philippe; Loubière, Pascal; Cocaign-Bousquet, Muriel; Piard, Jean-Christophe; Mercier-Bonin, Muriel

    2016-01-01

    Pili produced by Lactococcus lactis subsp. lactis are putative linear structures consisting of repetitive subunits of the major pilin PilB that forms the backbone, pilin PilA situated at the distal end of the pilus, and an anchoring pilin PilC that tethers the pilus to the peptidoglycan. We determined the nanomechanical properties of pili using optical-tweezers force spectroscopy. Single pili were exposed to optical forces that yielded force-versus-extension spectra fitted using the Worm-Like Chain model. Native pili subjected to a force of 0-200 pN exhibit an inextensible, but highly flexible ultrastructure, reflected by their short persistence length. We tested a panel of derived strains to understand the functional role of the different pilins. First, we found that both the major pilin PilB and sortase C organize the backbone into a full-length organelle and dictate the nanomechanical properties of the pili. Second, we found that both PilA tip pilin and PilC anchoring pilin were not essential for the nanomechanical properties of pili. However, PilC maintains the pilus on the bacterial surface and may play a crucial role in the adhesion- and biofilm-forming properties of L. lactis. PMID:27010408

  1. Transcriptomic profile of aguR deletion mutant of Lactococcus lactis subsp. cremoris CECT 8666

    PubMed Central

    del Rio, Beatriz; Linares, Daniel M.; Redruello, Begoña; Martin, Maria Cruz; Fernandez, Maria; de Jong, Anne; Kuipers, Oscar P.; Ladero, Victor; Alvarez, Miguel A.

    2015-01-01

    Lactococcus lactis subsp. cremoris CECT 8666 (formerly GE2-14) is a dairy strain that catabolizes agmatine (a decarboxylated derivative of arginine) into the biogenic amine putrescine by the agmatine deiminase (AGDI) pathway [1]. The AGDI cluster of L. lactis is composed by five genes aguR, aguB, aguD, aguA and aguC. The last four genes are responsible for the deamination of agmatine to putrescine and are co-transcribed as a single policistronic mRNA forming the catabolic operon aguBDAC[1]. aguR encodes a transmembrane protein that functions as a one-component signal transduction system that senses the agmatine concentration of the medium and accordingly regulates the transcription of aguBDAC[2], which is also transcriptionally regulated by carbon catabolic repression (CCR) via glucose, but not by other sugars such as lactose and galactose [1], [3]. Here we report the transcriptional profiling of the aguR gene deletion mutant (L. lactis subsp. cremoris CECT 8666 ∆aguR) [2] compared to the wild type strain, both grown in M17 medium with galactose as carbon source and supplemented with agmatine. The transcriptional profiling data of AguR-regulated genes were deposited in the Gene Expression Omnibus (GEO) database under accession no. GSE59514. PMID:26697381

  2. Transcriptomic profile of aguR deletion mutant of Lactococcus lactis subsp. cremoris CECT 8666.

    PubMed

    Del Rio, Beatriz; Linares, Daniel M; Redruello, Begoña; Martin, Maria Cruz; Fernandez, Maria; de Jong, Anne; Kuipers, Oscar P; Ladero, Victor; Alvarez, Miguel A

    2015-12-01

    Lactococcus lactis subsp. cremoris CECT 8666 (formerly GE2-14) is a dairy strain that catabolizes agmatine (a decarboxylated derivative of arginine) into the biogenic amine putrescine by the agmatine deiminase (AGDI) pathway [1]. The AGDI cluster of L. lactis is composed by five genes aguR, aguB, aguD, aguA and aguC. The last four genes are responsible for the deamination of agmatine to putrescine and are co-transcribed as a single policistronic mRNA forming the catabolic operon aguBDAC[1]. aguR encodes a transmembrane protein that functions as a one-component signal transduction system that senses the agmatine concentration of the medium and accordingly regulates the transcription of aguBDAC[2], which is also transcriptionally regulated by carbon catabolic repression (CCR) via glucose, but not by other sugars such as lactose and galactose [1], [3]. Here we report the transcriptional profiling of the aguR gene deletion mutant (L. lactis subsp. cremoris CECT 8666 ∆aguR) [2] compared to the wild type strain, both grown in M17 medium with galactose as carbon source and supplemented with agmatine. The transcriptional profiling data of AguR-regulated genes were deposited in the Gene Expression Omnibus (GEO) database under accession no. GSE59514. PMID:26697381

  3. Distinctive features of homologous recombination in an 'old' microorganism, Lactococcus lactis.

    PubMed

    Quiberoni, A; Rezaïki, L; El Karoui, M; Biswas, I; Tailliez, P; Gruss, A

    2001-03-01

    Homologous recombination is needed to assure faithful inheritance of DNA material, especially under stress conditions. The same enzymes that repair broken chromosomes via recombination also generate biodiversity. Their activities may result in intrachromosomal rearrangements, assimilation of foreign DNA, or a combination of these events. It is generally supposed that homologous recombination systems are conserved, and function the same way everywhere as they do in Escherichia coli, the accepted paradigm. Studies in an 'older' microorganism, the gram-positive bacterium of the low GC branch Lactococcus lactis, confirm that many enzymes are conserved across species lines. However, the main components of the double strand break (DSB) repair system, an exonuclease/helicase (Exo/hel) and a short DNA modulator sequence Chi, differ markedly between bacteria, especially when compared to the gram-negative analogues. Based on our studies, a model is proposed for the functioning of the two-subunit Exo/hel of L. lactis and other gram-positive bacteria, which differs from that of the three-subunit E. coli enzyme. The differences between bacterial DSB repair systems may underlie a selection for diversity when dealing with DSB. These and other features of homologous recombination in L. lactis are discussed. PMID:11316366

  4. Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system.

    PubMed

    Miro?czuk, Aleksandra M; Krasowska, Anna; Murzyn, Anna; P?achetka, Ma?gorzata; Lukaszewicz, Marcin

    2012-01-01

    In this work the subC gene from Bacillus licheniformis encoding subtilisin was cloned into the nisin-controlled expression (NICE) vectors (pNZ8048 and pNZ8148) with or without the signal peptide SP Usp45 directing extracellular secretion via Sec machinery. Extracellular protease production and activity was tested using Lactococcus lactis NZ9000 as host, which could be used for rennet production. The efficiency of protein production was tested using purified nisin and the supernatant of L. lactis NZ970 nisin producer. Similar results were obtained for 1 ng/ml nisin and 10 000 diluted supernatant. SP Usp45 signal peptide effectively directed extracellular localization of active and stable protease. SubC signal for extracellular localization in B. licheniformis, was also recognized by L. lactis Sec pathway, although with lower efficiency, as shown by a 3-fold lower protease activity in the medium. Protease production and activity was optimized using parameters such as induction time, nutrients (glucose, casitone) supplementation during growth or protease stabilization by calcium ions. The results were also verified in fed-batch bioreactor for further scale-up of the expression system. PMID:23961373

  5. Characterization of Lactococcus lactis response to ampicillin and ciprofloxacin using surface-enhanced Raman spectroscopy.

    PubMed

    Wang, Panxue; Pang, Shintaro; Zhang, Hua; Fan, Mingtao; He, Lili

    2016-01-01

    Decades of antibiotic use or misuse has resulted in antibiotic resistance in lactic acid bacteria, a group of common culture starters and probiotic microorganisms. This has urged researchers to study how lactic acid bacteria respond to antibiotics, so as to have a better strategy to identify and predict the antibiotic-resistant bacteria. This study aimed to characterize the biochemical profiles of Lactococcus lactis responding to antibiotics using surface-enhanced Raman spectroscopy (SERS). Lactococcus lactis exposed to antibiotics was mixed with 50-nm gold nanoparticles for subsequent SERS measurements. The SERS spectra analyzed by principal component analysis showed no significant change after 30 min of antibiotic treatment, whereas distinct changes were clearly observed after 60 and 90 min of antibiotic treatment. Different antibiotics induced different spectral changes, and these changes revealed the detailed biochemical information of cellular responses. This study demonstrates that the SERS method developed not only senses the changes in the bacterial cell wall, but also reveals details of the biochemical profiles, which help us to understand how lactic acid bacteria respond to antibiotics, as well as to set a base for the detection of antibiotic susceptibility of bacteria by SERS. Graphical Abstract Ciprofloxacin induced changes in the Lactococcus lactis cell wall and the corresponding SERS spectra. PMID:26613795

  6. Angiotensin-converting enzyme inhibitory activity of milk fermented by wild and industrial Lactococcus lactis strains.

    PubMed

    Rodríguez-Figueroa, J C; Reyes-Díaz, R; González-Córdova, A F; Troncoso-Rojas, R; Vargas-Arispuro, I; Vallejo-Cordoba, B

    2010-11-01

    Angiotensin I-converting enzyme inhibitory (ACEI) activity was evaluated and compared in <3 KDa water-soluble extracts (WSE) isolated from milk fermented by wild and commercial starter culture Lactococcus lactis strains after 48 h of incubation. The highest ACEI activities were found in WSE from milk inoculated with wild L. lactis strains isolated from artisanal dairy products and commercial starter cultures. On the other hand, the lowest ACEI activities were found in WSE from milk inoculated with wild strains isolated from vegetables. Moreover, the IC(50) values (concentration that inhibits 50% activity) of WSE from artisanal dairy products were the lowest, indicating that these fractions were the most effective in inhibiting 50% of ACE activity. In fact, a strain isolated from artisanal cheese presented the lowest IC(50) (13 μg/mL). Thus, it appears that wild L. lactis strains isolated from artisanal dairy products and commercial starter cultures showed good potential for the production of fermented dairy products with ACEI properties. PMID:20965317

  7. Molecular and Metabolic Adaptations of Lactococcus lactis at Near-Zero Growth Rates

    PubMed Central

    Ercan, Onur; Wels, Michiel; Smid, Eddy J.

    2014-01-01

    This paper describes the molecular and metabolic adaptations of Lactococcus lactis during the transition from a growing to a near-zero growth state by using carbon-limited retentostat cultivation. Transcriptomic analyses revealed that metabolic patterns shifted between lactic- and mixed-acid fermentations during retentostat cultivation, which appeared to be controlled at the level of transcription of the corresponding pyruvate dissipation-encoding genes. During retentostat cultivation, cells continued to consume several amino acids but also produced specific amino acids, which may derive from the conversion of glycolytic intermediates. We identify a novel motif containing CTGTCAG in the upstream regions of several genes related to amino acid conversion, which we propose to be the target site for CodY in L. lactis KF147. Finally, under extremely low carbon availability, carbon catabolite repression was progressively relieved and alternative catabolic functions were found to be highly expressed, which was confirmed by enhanced initial acidification rates on various sugars in cells obtained from near-zero-growth cultures. The present integrated transcriptome and metabolite (amino acids and previously reported fermentation end products) study provides molecular understanding of the adaptation of L. lactis to conditions supporting low growth rates and expands our earlier analysis of the quantitative physiology of this bacterium at near-zero growth rates toward gene regulation patterns involved in zero-growth adaptation. PMID:25344239

  8. Codon usage in Kluyveromyces lactis and in yeast cytochrome c-encoding genes.

    PubMed

    Freire-Picos, M A; González-Siso, M I; Rodríguez-Belmonte, E; Rodríguez-Torres, A M; Ramil, E; Cerdán, M E

    1994-02-11

    Codon usage (CU) in Kluyveromyces lactis has been studied. Comparison of CU in highly and lowly expressed genes reveals the existence of 21 optimal codons; 18 of them are also optimal in other yeasts like Saccharomyces cerevisiae or Candida albicans. Codon bias index (CBI) values have been recalculated with reference to the assignment of optimal codons in K. lactis and compared to those previously reported in the literature taking as reference the optimal codons from S. cerevisiae. A new index, the intrinsic codon deviation index (ICDI), is proposed to estimate codon bias of genes from species in which optimal codons are not known; its correlation with other index values, like CBI or effective number of codons (Nc), is high. A comparative analysis of CU in six cytochrome-c-encoding genes (CYC) from five yeasts is also presented and the differences found in the codon bias of these genes are discussed in relation to the metabolic type to which the corresponding yeasts belong. Codon bias in the CYC from K. lactis and S. cerevisiae is correlated to mRNA levels. PMID:8112587

  9. A virulent phage infecting Lactococcus garvieae, with homology to Lactococcus lactis phages.

    PubMed

    Eraclio, Giovanni; Tremblay, Denise M; Lacelle-Côté, Alexia; Labrie, Simon J; Fortina, Maria Grazia; Moineau, Sylvain

    2015-12-01

    A new virulent phage belonging to the Siphoviridae family and able to infect Lactococcus garvieae strains was isolated from compost soil. Phage GE1 has a prolate capsid (56 by 38 nm) and a long noncontractile tail (123 nm). It had a burst size of 139 and a latent period of 31 min. Its host range was limited to only two L. garvieae strains out of 73 tested. Phage GE1 has a double-stranded DNA genome of 24,847 bp containing 48 predicted open reading frames (ORFs). Putative functions could be assigned to only 14 ORFs, and significant matches in public databases were found for only 17 ORFs, indicating that GE1 is a novel phage and its genome contains several new viral genes and encodes several new viral proteins. Of these 17 ORFs, 16 were homologous to deduced proteins of virulent phages infecting the dairy bacterium Lactococcus lactis, including previously characterized prolate-headed phages. Comparative genome analysis confirmed the relatedness of L. garvieae phage GE1 to L. lactis phages c2 (22,172 bp) and Q54 (26,537 bp), although its genome organization was closer to that of phage c2. Phage GE1 did not infect any of the 58 L. lactis strains tested. This study suggests that phages infecting different lactococcal species may have a common ancestor. PMID:26407890

  10. The Nanomechanical Properties of Lactococcus lactis Pili Are Conditioned by the Polymerized Backbone Pilin

    PubMed Central

    Castelain, Mickaël; Duviau, Marie-Pierre; Canette, Alexis; Schmitz, Philippe; Loubière, Pascal; Cocaign-Bousquet, Muriel; Piard, Jean-Christophe; Mercier-Bonin, Muriel

    2016-01-01

    Pili produced by Lactococcus lactis subsp. lactis are putative linear structures consisting of repetitive subunits of the major pilin PilB that forms the backbone, pilin PilA situated at the distal end of the pilus, and an anchoring pilin PilC that tethers the pilus to the peptidoglycan. We determined the nanomechanical properties of pili using optical-tweezers force spectroscopy. Single pili were exposed to optical forces that yielded force-versus-extension spectra fitted using the Worm-Like Chain model. Native pili subjected to a force of 0–200 pN exhibit an inextensible, but highly flexible ultrastructure, reflected by their short persistence length. We tested a panel of derived strains to understand the functional role of the different pilins. First, we found that both the major pilin PilB and sortase C organize the backbone into a full-length organelle and dictate the nanomechanical properties of the pili. Second, we found that both PilA tip pilin and PilC anchoring pilin were not essential for the nanomechanical properties of pili. However, PilC maintains the pilus on the bacterial surface and may play a crucial role in the adhesion- and biofilm-forming properties of L. lactis. PMID:27010408

  11. Use of Lactococcus lactis to enrich sourdough bread with γ-aminobutyric acid.

    PubMed

    Bhanwar, Seema; Bamnia, Meenakshi; Ghosh, Moushumi; Ganguli, Abhijit

    2013-02-01

    Fried sourdough bread (bhatura) with an elevated amount of γ-aminobutyric acid (GABA) was produced using lactic acid bacteria (LAB). The LAB starter was screened and isolated from pickled yam showing highest GABA content and was identified as Lactococcus lactis subsp. lactis. The maximum GABA production in de Man Rogosa Sharpe (MRS) media supplemented with monosodium glutamate (MSG) was 110 mg/100 ml at pH 5, and 1-3% NaCl did not change the production of GABA significantly (p>0.05). When MSG was replaced with Vigna mungo in sourdough, the amount of GABA for bhatura was 226.22 mg/100 g representing about 10-fold increase. A sensory evaluation resulted as the overall general acceptability of bhatura to be 4.91 ± 0.03 on a five-point hedonic scale. Thus, the results indicated the potential of L. lactis as a LAB starter for the production of GABA-enriched bhatura. Although other physiological effects can be expected in the product, animal and clinical studies are mandatory prior to application of this food. PMID:22765269

  12. Genome sequence analysis of potential probiotic strain Leuconostoc lactis EFEL005 isolated from kimchi.

    PubMed

    Moon, Jin Seok; Choi, Hye Sun; Shin, So Yeon; Noh, Sol Ji; Jeon, Che Ok; Han, Nam Soo

    2015-05-01

    Leuconostoc lactis EFEL005 (KACC 91922) isolated from kimchi showed promising probiotic attributes; resistance against acid and bile salts, absence of transferable genes for antibiotic resistance, broad utilization of prebiotics, and no hemolytic activity. To expand our understanding of the species, we generated a draft genome sequence of the strain and analyzed its genomic features related to the aforementioned probiotic properties. Genome assembly resulted in 35 contigs, and the draft genome has 1,688,202 base pairs (bp) with a G+C content of 43.43%, containing 1,644 protein-coding genes and 50 RNA genes. The average nucleotide identity analysis showed high homology (? 96%) to the type strain L. lactis KCTC3528, but low homology (? 95%) to L. lactis KCTC3773 (formerly L. argentinum). Genomic analysis revealed the presence of various genes for sucrose metabolism (glucansucrases, invertases, sucrose phosphorylases, and mannitol dehydrogenase), acid tolerance (F1F0 ATPases, cation transport ATPase, branched-chain amino acid permease, and lysine decarboxylase), vancomycin response regulator, and antibacterial peptide (Lactacin F). No gene for production of biogenic amines (histamine and tyramine) was found. This report will facilitate the understanding of probiotic properties of this strain as a starter for fermented foods. PMID:25935305

  13. Production of bacteriocin-like inhibitory substance by Bifidobacterium lactis in skim milk supplemented with additives.

    PubMed

    Martinez, Fabio Andres Castillo; Domínguez, José Manuel; Converti, Attilio; Oliveira, Ricardo Pinheiro de Souza

    2015-08-01

    Bacteriocins are natural compounds used as food biopreservatives instead of chemical preservatives. Bifidobacterium animalis subsp. lactis (Bifid. lactis) was shown to produce a bacteriocin-like inhibitory substance (BLIS) able to inhibit the growth of Listeria monocytogenes selected as an indicator microorganism. To enhance this production by the strain Bifid. lactis BL 04, skim milk (SM) was used as a fermentation medium either in the presence or in the absence of yeast extract, Tween 80 or inulin as stimulating additives, and the results in terms of bacterial growth and BLIS production were compared with those obtained in a traditional high cost complex medium such as Man, Rogosa and Sharpe (MRS). To this purpose, all the cultivations were carried out in flasks at 200 rpm under anaerobic conditions ensured by a nitrogen flowrate of 1.0 L/min for 48 h, and BLIS production was quantified by means of a modified agar diffusion assay at low values of both temperature and concentration of List. monocytogenes. Although all these ingredients were shown to exert positive influence on BLIS production in both media, yeast extract and SM were by far the best ingredient and the best medium, respectively, allowing for a BLIS production at the late exponential phase of 2000 AU/ml. PMID:25850555

  14. A bacteriocin gene cluster able to enhance plasmid maintenance in Lactococcus lactis

    PubMed Central

    2014-01-01

    Background Lactococcus lactis is widely used as a dairy starter and has been extensively studied. Based on the acquired knowledge on its physiology and metabolism, new applications have been envisaged and there is an increasing interest of using L. lactis as a cell factory. Plasmids constitute the main toolbox for L. lactis genetic engineering and most rely on antibiotic resistant markers for plasmid selection and maintenance. In this work, we have assessed the ability of the bacteriocin Lactococcin 972 (Lcn972) gene cluster to behave as a food-grade post-segregational killing system to stabilize recombinant plasmids in L. lactis in the absence of antibiotics. Lcn972 is a non-lantibiotic bacteriocin encoded by the 11-kbp plasmid pBL1 with a potent antimicrobial activity against Lactococcus. Results Attempts to clone the full lcn972 operon with its own promoter (P972), the structural gene lcn972 and the immunity genes orf2-orf3 in the unstable plasmid pIL252 failed and only plasmids with a mutated promoter were recovered. Alternatively, cloning under other constitutive promoters was approached and achieved, but bacteriocin production levels were lower than those provided by pBL1. Segregational stability studies revealed that the recombinant plasmids that yielded high bacteriocin titers were maintained for at least 200 generations without antibiotic selection. In the case of expression vectors such as pTRL1, the Lcn972 gene cluster also contributed to plasmid maintenance without compromising the production of the fluorescent mCherry protein. Furthermore, unstable Lcn972 recombinant plasmids became integrated into the chromosome through the activity of insertion sequences, supporting the notion that Lcn972 does apply a strong selective pressure against susceptible cells. Despite of it, the Lcn972 gene cluster was not enough to avoid the use of antibiotics to select plasmid-bearing cells right after transformation. Conclusions Inserting the Lcn972 cluster into segregational unstable plasmids prevents their lost by segregation and probable could be applied as an alternative to the use of antibiotics to support safer and more sustainable biotechnological applications of genetically engineered L. lactis. PMID:24886591

  15. Recombinant porcine epidermal growth factor-secreting Lactococcus lactis promotes the growth performance of early-weaned piglets

    PubMed Central

    2014-01-01

    Background Epidermal growth factor (EGF) is an important growth factor in regulation of cell proliferation, differentiation, survival and apoptosis. Studies showed that food-grade Lactococcus lactis (L. lactis) and NICE expression system have superior performance in exogenous protein expression. This study aimed to construct and express porcine EGF (pEGF), and use L. lactis as vehicle for producing and delivering pEGF. Furthermore, investigating biological activity of pEGF and exploring applications feasibility of combination effects of L. lactis and pEGF on early weaned piglets’ production. Results A recombinant Lactococcus lactis which produced and secreted pEGF at 1000 ng/ml in culture supernatant was generated. Secreted pEGF was a fully biologically active protein, as demonstrated by its capacity to stimulate L929 mouse fibroblast cell line proliferation in vitro. For in vivo study, forty piglets were randomly allocated to control, antibiotic control, empty vector-expressing L. lactis (LL-EV) and pEGF-secreting L. lactis (LL-pEGF). After 14 d of rearing, final body weight and average daily gain in LL-pEGF were greater (P < 0.05, 8.95 vs. 8.37 kg, 206.1 vs. 157.7 g/day, respectively) than those in control, but no significant differences between LL-pEGF, LL-EV and antibiotic control. Overall period average daily feed intake was higher in LL-pEGF, LL-EV and antibiotic control than in control (P < 0.05, 252.9, 255.6, 250.0, 207.3 g/day, respectively). No significant difference was observed on ADFI/ADG. LL-pEGF increased villous height in the duodenum, jejunum and ileum than in control and LL-EV (P < 0.05). Sucrase in the 3 intestinal segments, aminopeptidase A in the duodenum and Jejunum, aminopeptidase N and dipeptidase IV in the duodenum in LL-pEGF were higher than those in control (P < 0.05). Furthermore, Escherichia coli and Enterococcus counts decreased in the ileum and Lactobacillus increased in the ileum and cecum digesta in LL-pEGF compare with the control (P < 0.05). Lactobacillus increased in the cecum in LL-EV compared with control and antibiotic control (P < 0.05). Conclusion We have generated a recombinant Lactococcus lactis which produced and secreted fully biologically active porcine EGF. Oral administration of pEGF-secreting L. lactis had beneficial effects on intestinal health and performance of early-weaned piglets. PMID:25142032

  16. Écologie bactérienne de l'infection nosocomiale au service de réanimation de l'hôpital Laquintinie de Douala, Cameroun

    PubMed Central

    Njall, Clotilde; Adiogo, Dieudonné; Bita, André; Ateba, Noel; Sume, Gérald; Kollo, Basile; Binam, Fidèle; Tchoua, Romain

    2013-01-01

    Introduction L'objectif principal de notre étude était d'identifier les bactéries associées à l'infection nosocomiale, dans le service de réanimation, de l'hôpital Laquintinie de Douala en vue d'améliorer la prise en charge et diminuer la létalité. Méthodes Il s'agissait d'une étude transversale et descriptive, menée du 1er mars au 31 mai 2011.Tous les patients hospitalisés depuis au moins 48 h étaient inclus dans l’étude et ceux présentant une infection documentée à l'admission étaient exclus. L'analyse des donnés a été faite par le logiciel SPSS 16.Les tests de Khi deux pour la signification. Résultats La prévalence de l'infection nosocomiale était de 12%, elle concernait des personnes âgées de plus de 60 ans et présentant une infection urinaire dans 79% des cas. La létalité était de 72% pour une durée moyenne de séjour de 11,7 ± 12,1 jours. Les bactéries responsables étaient en majorité des bactéries gram positifs (BGN), dont E coli dans 23,1% et les cocci gram positifs(CGP), dans 15,4% des cas. Conclusion L’étude de la résistance aux antibiotiques, montre une multi résistance, dont il faut tenir compte en mettant en place une stratégie de prévention active. PMID:23785545

  17. Use of murine models to detect the allergenicity of genetically modified Lactococcus lactis NZ9000/pNZPNK.

    PubMed

    Chiang, Shen-Shih; Liu, Chin-Feng; Ku, Ting-Wei; Mau, Jeng-Leun; Lin, Hsin-Tang; Pan, Tzu-Ming

    2011-04-27

    By introducing aprN into Lactococcus lactis NZ9000, the genetically modified L. lactis NZ9000/pNZPNK successfully expressed the nattokinase. The safety assessment of this novel strain was based on allergenicity of pepsin digestion stability and murine model serologic identity. Subjecting to the GM strain and host to pepsin digestion, the soluble fractions and cell debris were fast degraded completely. Feeding with ovalbumin resulted in significantly higher production of IgG1 and IgE as compared to that of L. lactis NZ9000/pNZPNK or L. lactis NZ9000. Further, the serum IgG2a level increased dose-dependently at week 2 and induced immune reaction toward Th1 pathway. Secretion of cytokines IL-4 and IL-10 fed with lactococci was significantly lower than that of the OVA group. L. lactis NZ9000/pNZPNK did not increase the proliferation of type 2 helper T cells in spleen or induce allergenicity in BALB/c mice. On the basis of the results, the new GM lactic acid bacterium is regarded as safe to use. PMID:21410287

  18. Protective Vaccination against Infectious Bursal Disease Virus with Whole Recombinant Kluyveromyces lactis Yeast Expressing the Viral VP2 Subunit

    PubMed Central

    Arnold, Marina; Durairaj, Vijay; Mundt, Egbert; Schulze, Katja; Breunig, Karin D.; Behrens, Sven-Erik

    2012-01-01

    Here we report on vaccination approaches against infectious bursal disease (IBD) of poultry that were performed with complete yeast of the species Kluyveromyces lactis (K. lactis). Employing a genetic system that enables the rapid production of stably transfected recombinant K. lactis, we generated yeast strains that expressed defined quantities of the virus capsid forming protein VP2 of infectious bursal disease virus (IBDV). Both, subcutaneous as well as oral vaccination regiments with the heat-inactivated but otherwise untreated yeast induced IBDV-neutralizing antibodies in mice and chickens. A full protection against a subsequent IBDV infection was achieved by subcutaneous inoculation of only milligram amounts of yeast per chicken. Oral vaccination also generated protection: while mortality was observed in control animals after virus challenge, none of the vaccinees died and ca. one-tenth were protected as indicated by the absence of lesions in the bursa of Fabricius. Recombinant K. lactis was thus indicated as a potent tool for the induction of a protective immune response by different applications. Subcutaneously applied K. lactis that expresses the IBDV VP2 was shown to function as an efficacious anti-IBD subunit vaccine. PMID:23024743

  19. Study of the influence of yeast inoculum concentration (Yarrowia lipolytica and Kluyveromyces lactis) on blue cheese aroma development using microbiological models.

    PubMed

    Price, Elliott J; Linforth, Robert S T; Dodd, Christine E R; Phillips, Carol A; Hewson, Louise; Hort, Joanne; Gkatzionis, Konstantinos

    2014-02-15

    Yarrowia lipolytica and Kluyveromyces lactis occur as part of Stilton cheese microflora yet are not controlled during production. This study investigated the influence of their inoculum concentration on aroma production. Models of Y. lipolytica and K. lactis, with Penicillium roqueforti, were analysed using instrumental and sensory analysis. Different concentrations of Y. lipolytica produced important changes in the aroma profiles of microbiological models, analysed by solid-phase microextraction (SPME GC-MS). Sensory analysis with discrimination tests showed differences were detectable via human perception but did not concern the similarity to blue cheese odour. Increasing the inoculum concentration of K. lactis resulted in decreased variation between replicates. Partial least squares (PLS) regression on Flash profile data showed models inoculated with low concentrations of K. lactis exhibited blue cheese-related attributes, associated with increased ketone production. Results suggest that controlling the amount of Y. lipolytica and K. lactis during production offers potential to manipulate blue cheese aroma development. PMID:24128502

  20. NDM-1 encoded by a pNDM-BJ01-like plasmid p3SP-NDM in clinical Enterobacter aerogenes.

    PubMed

    Chen, Zhenhong; Li, Hongxia; Feng, Jiao; Li, Yuxue; Chen, Xin; Guo, Xuemin; Chen, Weijun; Wang, Li; Lin, Lei; Yang, Huiying; Yang, Wenhui; Wang, Jie; Zhou, Dongsheng; Liu, Changting; Yin, Zhe

    2015-01-01

    A carbapenem-nonsusceptible Enterobacter aerogenes strain named 3-SP was isolated from a human case of pneumonia in a Chinese teaching hospital. NDM-1 carbapenemase is produced by a pNDM-BJ01-like conjugative plasmid designated p3SP-NDM to account for carbapenem resistance of 3-SP. p3SP-NDM was fully sequenced and compared with all publically available pNDM-BJ01-like plasmids. The genetic differences between p3SP-NDM and pNDM-BJ01 include only 18 single nucleotide polymorphisms, a 1 bp deletion and a 706 bp deletion. p3SP-NDM and pNDM-BJ01 harbor an identical Tn125 element organized as ISAba125, bla NDM-1, ble MBL, ?trpF, dsbC, cutA, ?groES, groEL, ISCR27, and ISAba125. The bla NDM-1 surrounding regions in these pNDM-BJ01-like plasmids have a conserved linear organization ISAba14-aphA6-Tn125-unknown IS, with considerable genetic differences identified within or immediately downstream of Tn125. All reported pNDM-BJ01-like plasmids are exclusively found in Acinetobacter, whereas this is the first report of identification of a pNDM-BJ01-like plasmid in Enterobacteriaceae. PMID:25926823

  1. Analysis of a Soluble (UreD:UreF:UreG)2 Accessory Protein Complex and Its Interactions with Klebsiella aerogenes Urease by Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Farrugia, Mark A.; Han, Linjie; Zhong, Yueyang; Boer, Jodi L.; Ruotolo, Brandon T.; Hausinger, Robert P.

    2013-09-01

    Maturation of the nickel-containing urease of Klebsiella aerogenes is facilitated by the UreD, UreF, and UreG accessory proteins along with the UreE metallo-chaperone. A fusion of the maltose binding protein and UreD (MBP-UreD) was co-isolated with UreF and UreG in a soluble complex possessing a (MBP-UreD:UreF:UreG)2 quaternary structure. Within this complex a UreF:UreF interaction was identified by chemical cross-linking of the amino termini of its two UreF protomers, as shown by mass spectrometry of tryptic peptides. A pre-activation complex was formed by the interaction of (MBP-UreD:UreF:UreG)2 and urease. Mass spectrometry of intact protein species revealed a pathway for synthesis of the urease pre-activation complex in which individual hetero-trimer units of the (MBP-UreD:UreF:UreG)2 complex bind to urease. Together, these data provide important new insights into the structures of protein complexes associated with urease activation.

  2. Malonate-bound structure of the glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) and characterization of the native Fe[supscript 2+] metal-ion preference

    SciTech Connect

    Jackson, Colin J.; Hadler, Kieran S.; Carr, Paul D.; Oakley, Aaron J.; Yip, Sylvia; Schenk, Gerhard; Ollis, David L.

    2010-09-20

    The structure of a malonate-bound form of the glycerophosphodiesterase from Enterobacter aerogenes, GpdQ, has been refined at a resolution of 2.2 {angstrom} to a final R factor of 17.1%. The structure was originally solved to 2.9 {angstrom} resolution using SAD phases from Zn{sup 2+} metal ions introduced into the active site of the apoenzyme [Jackson et al. (2007), J. Mol. Biol. 367, 1047-1062]. However, the 2.9 {angstrom} resolution was insufficient to discern significant details of the architecture of the binuclear metal centre that constitutes the active site. Furthermore, kinetic analysis revealed that the enzyme lost a significant amount of activity in the presence of Zn{sup 2+}, suggesting that it is unlikely to be a catalytically relevant metal ion. In this communication, a higher resolution structure of GpdQ is presented in which malonate is visibly coordinated in the active site and analysis of the native metal-ion preference is presented using atomic absorption spectroscopy and anomalous scattering. Catalytic implications of the structure and its Fe{sup 2+} metal-ion preference are discussed.

  3. Malonate-bound structure of the glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) and characterization of the native Fe[superscript 2+] metal-ion preference

    SciTech Connect

    Jackson, Colin J.; Hadler, Kieran S.; Carr, Paul D.; Oakley, Aaron J.; Yip, Sylvia; Schenk, Gerhard; Ollis, David L.

    2011-09-28

    The structure of a malonate-bound form of the glycerophosphodiesterase from Enterobacter aerogenes, GpdQ, has been refined at a resolution of 2.2 {angstrom} to a final R factor of 17.1%. The structure was originally solved to 2.9 {angstrom} resolution using SAD phases from Zn{sup 2+} metal ions introduced into the active site of the apoenzyme [Jackson et al. (2007), J. Mol. Biol. 367, 1047-1062]. However, the 2.9 {angstrom} resolution was insufficient to discern significant details of the architecture of the binuclear metal centre that constitutes the active site. Furthermore, kinetic analysis revealed that the enzyme lost a significant amount of activity in the presence of Zn2+, suggesting that it is unlikely to be a catalytically relevant metal ion. In this communication, a higher resolution structure of GpdQ is presented in which malonate is visibly coordinated in the active site and analysis of the native metal-ion preference is presented using atomic absorption spectroscopy and anomalous scattering. Catalytic implications of the structure and its Fe{sup 2+} metal-ion preference are discussed.

  4. NDM-1 encoded by a pNDM-BJ01-like plasmid p3SP-NDM in clinical Enterobacter aerogenes

    PubMed Central

    Chen, Zhenhong; Li, Hongxia; Feng, Jiao; Li, Yuxue; Chen, Xin; Guo, Xuemin; Chen, Weijun; Wang, Li; Lin, Lei; Yang, Huiying; Yang, Wenhui; Wang, Jie; Zhou, Dongsheng; Liu, Changting; Yin, Zhe

    2015-01-01

    A carbapenem-nonsusceptible Enterobacter aerogenes strain named 3-SP was isolated from a human case of pneumonia in a Chinese teaching hospital. NDM-1 carbapenemase is produced by a pNDM-BJ01-like conjugative plasmid designated p3SP-NDM to account for carbapenem resistance of 3-SP. p3SP-NDM was fully sequenced and compared with all publically available pNDM-BJ01-like plasmids. The genetic differences between p3SP-NDM and pNDM-BJ01 include only 18 single nucleotide polymorphisms, a 1 bp deletion and a 706 bp deletion. p3SP-NDM and pNDM-BJ01 harbor an identical Tn125 element organized as ISAba125, blaNDM?1, bleMBL, ?trpF, dsbC, cutA, ?groES, groEL, ISCR27, and ISAba125. The blaNDM?1 surrounding regions in these pNDM-BJ01-like plasmids have a conserved linear organization ISAba14-aphA6-Tn125-unknown IS, with considerable genetic differences identified within or immediately downstream of Tn125. All reported pNDM-BJ01-like plasmids are exclusively found in Acinetobacter, whereas this is the first report of identification of a pNDM-BJ01-like plasmid in Enterobacteriaceae. PMID:25926823

  5. Genetically Engineered Lactococcus lactis Protect against House Dust Mite Allergy in a BALB/c Mouse Model

    PubMed Central

    Ai, Chunqing; Zhang, Qiuxiang; Ren, Chengcheng; Wang, Gang; Liu, Xiaoming; Tian, Fengwei; Zhao, Jianxin; Zhang, Hao; Chen, Yong Q.; Chen, Wei

    2014-01-01

    Background Mucosal vaccine based on lactic acid bacteria is an attractive concept for the prevention and treatment of allergic diseases, but their mechanisms of action in vivo are poorly understood. Therefore, we sought to investigate how recombinant major dust mite allergen Der p2-expressing Lactococcus lactis as a mucosal vaccine induced the immune tolerance against house dust mite allergy in a mouse model. Methods Three strains of recombinant L. lactis producing Der p2 in different cell components (extracellular, intracellular and cell wall) were firstly constructed. Their prophylactic potential was evaluated in a Der p2-sensitised mouse model, and immunomodulation properties at the cellular level were determined by measuring cytokine production in vitro. Results Der p2 expressed in the different recombinant L. lactis strains was recognized by a polyclonal anti-Der p2 antibody. Oral treatment with the recombinant L. lactis prior sensitization significantly prevented the development of airway inflammation in the Der p2-sensitized mice, as determined by the attenuation of inflammatory cells infiltration in the lung tissues and decrease of Th2 cytokines IL-4 and IL-5 levels in bronchoalveolar lavage. In addition, the serum allergen-specific IgE levels were significantly reduced, and the levels of IL-4 in the spleen and mesenteric lymph nodes cell cultures were also markedly decreased upon allergen stimulation in the mice fed with the recombinant L. lactis strains. These protective effects correlated with a significant up-regulation of regulatory T cells in the mesenteric lymph nodes. Conclusion Oral pretreatment with live recombinant L. lactis prevented the development of allergen-induced airway inflammation primarily by the induction of specific mucosal immune tolerance. PMID:25290938

  6. Anti-inflammatory effects of Lactococcus lactis NCDO 2118 during the remission period of chemically induced colitis

    PubMed Central

    2014-01-01

    Background Many probiotic bacteria have been described as promising tools for the treatment and prevention of inflammatory bowel diseases (IBDs). Most of these bacteria are lactic acid bacteria, which are part of the healthy human microbiota. However, little is known about the effects of transient bacteria present in normal diets, including Lactococcus lactis. Methods In the present study, we analysed the immunomodulatory effects of three L. lactis strains in vitro using intestinal epithelial cells. L. lactis NCDO 2118 was administered for 4 days to C57BL/6 mice during the remission period of colitis induced by dextran sodium sulphate (DSS). Results Only one strain, L. lactis NCDO 2118, was able to reduce IL-1?-induced IL-8 secretion in Caco-2 cells, suggesting a potential anti-inflammatory effect. Oral treatment using L. lactis NCDO 2118 resulted in a milder form of recurrent colitis than that observed in control diseased mice. This protective effect was not attributable to changes in secretory IgA (sIgA); however, NCDO 2118 administration was associated with an early increase in IL-6 production and sustained IL-10 production in colonic tissue. Mice fed L. lactis NCDO 2118 had an increased number of regulatory CD4+ T cells (Tregs) bearing surface TGF-? in its latent form (Latency-associated peptide-LAP) in the mesenteric lymph nodes and spleen. Conclusions Here, we identified a new probiotic strain with a potential role in the treatment of IBD, and we elucidated some of the mechanisms underlying its anti-inflammatory effect. PMID:25110521

  7. Lactococcus lactis V7 inhibits the cell invasion of bovine mammary epithelial cells by Escherichia coli and Staphylococcus aureus.

    PubMed

    Assis, B Seridan; Germon, P; Silva, A M; Even, S; Nicoli, J R; Le Loir, Y

    2015-01-01

    Bovine mastitis, an inflammatory disease of the mammary gland often associated to bacterial infection, is the first cause of antibiotic use in dairy cattle. Because of the risk of antibioresistance emergence, alternative non-antibiotic strategies are needed to prevent or to cure bovine mastitis and reduce the antibiotic use in veterinary medicine. In this work, we investigated Lactococcus lactis V7, a strain isolated from the mammary gland, as a probiotic option against bovine mastitis. Using bovine mammary epithelial cell (bMEC) culture, and two representative strains for Escherichia coli and for Staphylococcus aureus, two major mastitis pathogens, we investigated L. lactis V7 ability to inhibit cell invasion (i.e. adhesion and internalization) of these pathogens into bMEC. L. lactis V7 ability to modulate the production of CXCL8, a key chemokine IL-8 responsible for neutrophil influx, in bMEC upon challenge with E. coli was investigated by an ELISA dosage of CXCL8 in bMEC culture supernatants. We showed that L. lactis V7 inhibited the internalisation of both E. coli and S. aureus strains into bMEC, whereas it inhibited the adhesion of only one out of the two S. aureus strains and of none of the E. coli strains tested. Investigation of the bMEC immune response showed that L. lactis V7 alone induced a slight increase in CXCL8 production in bMEC and that it increased the inflammatory response in bMEC challenged with the E. coli strains. Altogether these features of L. lactis V7 make it a potential promising candidate for a probiotic prevention strategy against bovine mastitis. PMID:26322541

  8. Purification and characterization of two phosphoglucomutases from Lactococcus lactis subsp. lactis and their regulation in maltose- and glucose-utilizing cells.

    PubMed Central

    Qian, N; Stanley, G A; Hahn-Hägerdal, B; Rådström, P

    1994-01-01

    Two distinct forms of phosphoglucomutase were found in Lactococcus lactis subsp. lactis, strains 19435 and 65.1, growing on maltose: beta-phosphoglucomutase (beta-PGM), which catalyzes the reversible conversion of beta-glucose 1-phosphate to glucose 6-phosphate in the maltose catabolism, and alpha-phosphoglucomutase (alpha-PGM). beta-PGM was purified to more than 90% homogeneity in crude cell extract from maltose-grown lactococci, and polyclonal antisera to the enzyme were prepared. The molecular mass of beta-PGM was estimated by gel filtration to be 28 kDa; its isoelectric point was 4.8. The corresponding values for alpha-PGM were 65 kDa and 4.4, respectively. The expression of both PGM enzymes was investigated under different growth conditions. The specific activity and amount of beta-PGM per milliliter of cell extract increased with time in lactococci grown on maltose, but the enzyme was absent in lactococci grown on glucose, indicating enzyme synthesis to be induced by maltose in the growth medium. When glucose was added to maltose-grown lactococci, both the specific activity and amount of beta-PGM per milliliter of cell extract decreased rapidly. This suggests that synthesis of beta-PGM is repressed by glucose in the medium. Although the specific activity of alpha-PGM did not change during growth on maltose or glucose, lactococcal strain 19435 showed a much higher specific activity of both alpha- and beta-PGM than strain 65.1 when grown on maltose. Images PMID:8071206

  9. Production of fermented milk using a malty compound-producing strain of Lactococcus lactis subsp. lactis biovar. diacetylactis, isolated from Zimbabwean naturally fermented milk.

    PubMed

    Narvhus, J A; Osteraas, K; Mutukumira, T; Abrahamsen, R K

    1998-05-01

    Malty compound-producing Lactococcus lactis subsp. lactis biovar. diacetylactis strain INF-DM1, originally isolated from naturally fermented milk in Zimbabwe was used to prepare fermented milk from ordinary milk, milk enriched with 2.5% (w/v) skimmed milk powder and by 2.5% (w/v) increase in dry matter by ultrafiltration. Inoculated milk was incubated at 22, 30 and 37 degrees C. Analyses were made after 0, 9, 18 and 24 h incubation and also after 24 h incubation followed by storage for one week at 4 degrees C. Samples were analysed for volatile compounds including malty compounds and for organic acids, pH and log cfu/g. All samples were also judged for sensory attributes. Products made from enriched milks showed increased viscosity which was most marked in ultrafiltrated milk incubated at 30 and 37 degrees C. The levels of certain compounds (lactic acid, citrate and diacetyl) were significantly affected by milk type. Incubation temperature had a significant effect on starter growth rate and the rate of production and amount of the malty compounds, lactate, diacetyl, ethanol, acetoin and acetaldehyde. 3-Methyl butanal concentrations were above the taste threshold level of 0.06 ppm in almost all products, including stored products. Although initial growth rate was fastest at 37 degrees C, an uncoupling of acid production and growth was observed after 9 h incubation, suggesting that this is above the optimum temperature for this strain. In addition, products incubated at 37 degrees C showed a tendency to whey separation, indicating that this temperature is also too high to give optimum product quality. All products attained good scores in sensory analysis provided that fermentation was complete. Variation in the levels of malty compounds during the fermentation had no significant effect on the sensory score for total flavour. PMID:9631339

  10. BACT/LAER (Best Available Control Technology/Lowest Achievable Emission Rate) Clearinghouse: a compilation of control-technology determinations. First supplement to 1985 edition. Summary tables and Appendices A-G. Final report

    SciTech Connect

    Dunbar, D.; Rust, G.

    1986-05-01

    The volume explains the history of the BACT/LAER Clearinghouse, the background of the report format development, and acknowledges the continued support and effort of STAPPA and ALAPCO members. The volume contains three summary tables consisting of: a list of new control technology determinations received since May 1985, a list of all control-technology determinations that have been submitted, and a list of control-technology determinations for external combustion sources (boilers). A detailed listing of source type codes and abbreviations for process and emission limits are also shown. The volume contains the detailed source listing for the determinations submitted since May 1985. The detailed source listing normally contains the following information: source type and size; company name and location; whether determination was BACT or LAER for new or modified source; the person, agency and phone number that made the determination; permit issue date; estimated date of start-up; processes subject to this permit; through-put capacity; pollutant(s) emitted; emission limits; control equipment or process modification; a section for notes; and review status dates.

  11. Nisin inducible production of listeriolysin O in Lactococcus lactis NZ9000

    PubMed Central

    Bahey-El-Din, Mohammed; Griffin, Brendan T; Gahan, Cormac GM

    2008-01-01

    Background Listeria monocytogenes is a well-characterized food-borne pathogen that infects pregnant women and immunocompromised individuals. Listeriolysin O (LLO) is the major virulence factor of the pathogen and is often used as a diagnostic marker for detection of L. monocytogenes. In addition, LLO represents a potent antigen driving T cell-mediated immunity during infection. In the present work, Lactococcus lactis NZ9000 was used as an expression host to hyper-produce LLO under inducible conditions using the NICE (NIsin Controlled Expression) system. We created a modified pNZ8048 vector encoding a six-His-tagged LLO downstream of the strong inducible PnisA promoter. Results The constructed vector (pNZPnisA:CYTO-LLO) was expressed in L. lactis NZ9000 and was best induced at mid-log phase with 0.2% v/v nisin for 4 h statically at 30°C. Purification of the His-tagged LLO was accomplished by Ni-NTA affinity chromatography and functionality was confirmed through haemolytic assays. Total LLO yield (measured as total protein content) was 4.43–5.9 mg per litre culture and the haemolytic activity was still detectable after 8 months of storage at 4°C. Conclusion The LLO production method described in this work provides an approach to efficient LLO production in the Gram-positive Lactococcus bacterium to yield a significant source of the protein for research and diagnostic applications. Expression of LLO in L. lactis has a number of benefits over E. coli which may facilitate both in vivo and in vitro applications of this system. PMID:18664263

  12. Expression of food-grade phytase in Lactococcus lactis from optimized conditions in milk broth.

    PubMed

    Miao, Yuzhi; Xu, Hui; Fei, Baojin; Qiao, Dairong; Cao, Yi

    2013-07-01

    The major objective of this study was to engineer lactic acid bacteria to produce the enzyme phytase from a gene native to Bacillus subtilis GYPB04. The phytase gene (phyC) of B. subtilis GYPB04 was cloned into the plasmid pMG36e for expression in Lactococcus lactis. The enzyme activity in L. lactis cultured in GM17 broth was 20.25 U/mL at 36°C. The expressed phytase was characterized as active in a pH range of 2.0-9.0 at a temperature range of 20-80°C, with an optimum pH of 5.5-6.5 and temperature of 60°C. When cultured in food-grade milk broth, the transformed L. lactis grew to an OD(600 nm) value of 1.05 and had a phytase yield of 13.58 U/mL. In same broth under optimized conditions for cell growth and phytase production, the transformant reached an OD(600 nm) value of 1.68 and a phytase yield of 42.12 U/mL, representing approximately 1.6-fold and 3.1-fold increases, respectively, compared to growth in natural milk broth. Fermentation was scaled to 5 L under optimized conditions, and product analysis revealed a final OD(600 nm) value of 1.89 and an extracellular enzyme activity of 24.23 U/mL. The results of this study may be used in the dairy fermentation industry for the development of functional, healthy yogurts and other fermented dairy foods that provide both active phytase and viable probiotics to the consumer. PMID:23453854

  13. Metabolome analysis of milk fermented by ?-aminobutyric acid-producing Lactococcus lactis.

    PubMed

    Hagi, Tatsuro; Kobayashi, Miho; Nomura, Masaru

    2016-02-01

    ?-Aminobutyric acid (GABA) is one of the most important functional components in fermented foods because of its physiological functions, such as neurotransmission and antihypertensive activities. However, little is known about components other than GABA in GABA-rich fermented foods. A metabolomic approach offers an opportunity to discover bioactive and flavor components in fermented food. To find specific components in milk fermented with GABA-producing Lactococcus lactis 01-7, we compared the components found in GABA-rich fermented milk with those found in control milk fermented without GABA production using capillary electrophoresis time-of-flight mass spectrometry. A principal component analysis score plot showed a clear differentiation between the control milk fermented with L. lactis 01-1, which does not produce GABA, and GABA-rich milk fermented with a combination of L. lactis strains 01-1 and 01-7. As expected, the amount of GABA in GABA-rich fermented milk was much higher (1,216-fold) than that of the control milk. Interestingly, the amount of Orn was also much higher (27-fold) than that of the control milk. Peptide analysis showed that levels of 6 putative angiotensin-I-converting enzyme (ACE)-inhibitory peptides were also higher in the GABA-rich fermented milk. Furthermore, ACE-inhibitory activity of GABA-rich fermented milk tended to be higher than that of the control milk. These results indicate that the GABA-producing strain 01-7 provides fermented milk with other functional components in addition to GABA. PMID:26686724

  14. Inside the adaptation process of Lactobacillus delbrueckii subsp. lactis to bile.

    PubMed

    Burns, Patricia; Sánchez, Borja; Vinderola, Gabriel; Ruas-Madiedo, Patricia; Ruiz, Lorena; Margolles, Abelardo; Reinheimer, Jorge; de los Reyes-Gavilán, Clara G

    2010-08-15

    Progressive adaptation to bile might render some lactobacilli able to withstand physiological bile salt concentrations. In this work, the adaptation to bile was evaluated on previously isolated dairy strains of Lactobacillus delbrueckii subsp. lactis 200 and L. delbrueckii subsp. lactis 200+, a strain derived thereof with stable bile-resistant phenotype. The adaptation to bile was obtained by comparing cytosolic proteomes of both strains grown in the presence or absence of bile. Proteomics were complemented with physiological studies on both strains focusing on glycolytic end-products, the ability to adhere to the human intestinal epithelial cell line HT29-MTX and survival to simulated gastrointestinal conditions. Protein pattern comparison of strains grown with and without bile allowed us to identify 9 different proteins whose production was regulated by bile in both strains, and 17 proteins that showed differences in their levels between the parental and the bile-resistant derivative. These included general stress response chaperones, proteins involved in transcription and translation, in peptidoglycan/exopolysaccharide biosynthesis, in the lipid and nucleotide metabolism and several glycolytic and pyruvate catabolism enzymes. Differences in the level of metabolic end-products of the sugar catabolism were found between the strains 200 and 200+. A decrease in the adhesion of both strains to the intestinal cell line was detected in the presence of bile. In simulated gastric and intestinal juices, a protective effect was exerted by milk improving the survival of both microorganisms. These results indicate that bile tolerance in L. delbrueckii subsp. lactis involves several mechanisms responding to the deleterious impact of bile salts on bacterial physiology. PMID:20621375

  15. Transcriptome profiling of Lactococcus lactis subsp. cremoris CECT 8666 in response to agmatine

    PubMed Central

    del Rio, Beatriz; Redruello, Begoña; Martin, M. Cruz; Fernandez, Maria; de Jong, Anne; Kuipers, Oscar P.; Ladero, Victor; Alvarez, Miguel A.

    2015-01-01

    The dairy strain Lactococcus lactis subsp. cremoris CECT 8666 (formerly GE2-14) synthesizes the biogenic amine putrescine from agmatine via the agmatine deiminase (AGDI) pathway [1]. The AGDI cluster of L. lactis is composed by five genes aguR, aguB, aguD, aguA and aguC. The last four genes are co-transcribed as a single policistronic mRNA forming the catabolic operon aguBDAC, which encodes the proteins necessary for agmatine uptake and its conversion into putrescine [1], [2]. The first gene of the cluster, aguR, encodes a transmembrane protein that functions as a one-component signal transduction system that senses the agmatine concentration of the medium and accordingly regulates the transcription of aguBDAC[2]. The catabolic operon aguBDAC is transcriptionally activated by agmatine [2] and transcriptionally regulated by carbon catabolite repression (CCR) via glucose, but not by other sugars such as lactose or galactose [1], [3]. On the contrary, the transcription of the aguR regulatory gene is not subject to CCR regulation [1], [3] nor is regulated by agmatine [2]. In this study we report the transcriptional profiling of L. lactis subsp. cremoris CECT 8666 grown in M17 medium with galactose (GalM17) as carbon source and supplemented with agmatine, compared to that of the strain grown in the same culture medium without agmatine. The transcriptional profiling data of agmatine-regulated genes were deposited in the Gene Expression Omnibus (GEO) database under Accession no. GSE74808. PMID:26981381

  16. Transcriptome profiling of Lactococcus lactis subsp. cremoris CECT 8666 in response to agmatine.

    PubMed

    Del Rio, Beatriz; Redruello, Begoña; Martin, M Cruz; Fernandez, Maria; de Jong, Anne; Kuipers, Oscar P; Ladero, Victor; Alvarez, Miguel A

    2016-03-01

    The dairy strain Lactococcus lactis subsp. cremoris CECT 8666 (formerly GE2-14) synthesizes the biogenic amine putrescine from agmatine via the agmatine deiminase (AGDI) pathway [1]. The AGDI cluster of L. lactis is composed by five genes aguR, aguB, aguD, aguA and aguC. The last four genes are co-transcribed as a single policistronic mRNA forming the catabolic operon aguBDAC, which encodes the proteins necessary for agmatine uptake and its conversion into putrescine [1], [2]. The first gene of the cluster, aguR, encodes a transmembrane protein that functions as a one-component signal transduction system that senses the agmatine concentration of the medium and accordingly regulates the transcription of aguBDAC[2]. The catabolic operon aguBDAC is transcriptionally activated by agmatine [2] and transcriptionally regulated by carbon catabolite repression (CCR) via glucose, but not by other sugars such as lactose or galactose [1], [3]. On the contrary, the transcription of the aguR regulatory gene is not subject to CCR regulation [1], [3] nor is regulated by agmatine [2]. In this study we report the transcriptional profiling of L. lactis subsp. cremoris CECT 8666 grown in M17 medium with galactose (GalM17) as carbon source and supplemented with agmatine, compared to that of the strain grown in the same culture medium without agmatine. The transcriptional profiling data of agmatine-regulated genes were deposited in the Gene Expression Omnibus (GEO) database under Accession no. GSE74808. PMID:26981381

  17. Enzymatic synthesis and characterization of hydroquinone galactoside using Kluyveromyces lactis lactase.

    PubMed

    Kim, Go-Eun; Lee, Jin-Ha; Jung, Sun-Hwa; Seo, Eun-Seong; Jin, Sheng-De; Kim, Ghahyun J; Cha, Jaeho; Kim, Eui-Joong; Park, Ki-Deok; Kim, Doman

    2010-09-01

    Hydroquinone galactoside (HQ-Gal) as a potential skin whitening agent was synthesized by the reaction of lactase (beta-galactosidase) from Kluyveromyces lactis, Aspergillus oryzae, Bacillus circulans, and Thermus sp. with lactose as a donor and HQ as an acceptor. Among these lactases, the acceptor reaction involving HQ and lactose with K. lactis lactase showed a higher conversion ratio to HQ-Gal (60.27%). HQ-Gal was purified using butanol partitioning and silica gel column chromatography. The structure of the purified HQ-Gal was determined by nuclear magnetic resonance, and the ionic product was observed at m/z 295 (C12H16O7Na)+ using matrix assisted laser desorption ionization time-of-flight mass spectrometry. HQ-Gal was identified as 4-hydroxyphenyl-beta-d-galactopyranoside. The optimum conditions for HQ-Gal synthesis by K. lactis determined using response surface methodology were 50 mM HQ, 60 mM lactose, and 20 U mL(-1) lactase. These conditions produced a yield of 2.01 g L(-1) HQ-Gal. The half maximal inhibitory concentration (IC50) of diphenylpicrylhydrazyl scavenging activity was 3.31 mM, indicating a similar antioxidant activity compared to beta-arbutin (IC50=3.95 mM). The Ki value of HQ-Gal (0.75 mM) against tyrosinase was smaller than that of beta-arbutin (Ki=1.97 mM), indicating its superiority as an inhibitor. HQ-Gal inhibited (23%) melanin synthesis without being significantly toxic to the cells, while beta-arbutin exhibited only 8% reduction of melanin synthesis in B16 melanoma cells compared with the control. These results indicate that HQ-Gal may be a suitable functional component in the cosmetics industry. PMID:20687552

  18. Leuconostoc lactis beta-galactosidase is encoded by two overlapping genes.

    PubMed Central

    David, S; Stevens, H; van Riel, M; Simons, G; de Vos, W M

    1992-01-01

    A 16-kb BamHI fragment of the lactose plasmid pNZ63 from Leuconostoc lactis NZ6009 was cloned in Escherichia coli MC1061 by using pACYC184 and was found to express a functional beta-galactosidase. Deletion and complementation analysis showed that the coding region for beta-galactosidase was located on a 5.8-kb SalI-BamHI fragment. Nucleotide sequence analysis demonstrated that this fragment contained two partially overlapping genes, lacL (1,878 bp) and lacM (963 bp), that could encode proteins with calculated sizes of 72,113 and 35,389 Da, respectively. The L. lactis beta-galactosidase was overproduced in E. coli by using a lambda pL expression system. Two new proteins with M(r)s of 75,000 and 36,000 appeared upon induction of PL. The N-terminal sequences of these proteins corresponded to those deduced from the lacL and lacM gene sequences. Mutation and deletion analysis showed that lacL expression is essential for LacM production and that both the lacL and lacM genes are required for the production of a functional beta-galactosidase in E. coli. The deduced amino acid sequences of the LacL and LacM proteins showed considerable identity with the sequences of the N- and C-terminal parts, respectively, of beta-galactosidases from other lactic acid bacteria or E. coli. DNA and protein sequence alignments suggest that the L. lactis lacL and lacM genes have been generated by an internal deletion in an ancestral beta-galactosidase gene. Images PMID:1624440

  19. Microencapsulation of Bifidobacterium animalis subsp. lactis and Lactobacillus acidophilus in cocoa butter using spray chilling technology

    PubMed Central

    Pedroso, D.L.; Dogenski, M.; Thomazini, M.; Heinemann, R.J.B.; Favaro-Trindade, C.S.

    2013-01-01

    In the present study, the cells of Bifidobacterium animalis subsp. lactis (BI-01) and Lactobacillus acidophilus (LAC-04) were encapsulated in cocoa butter using spray-chilling technology. Survival assays were conducted to evaluate the resistance of the probiotics to the spray-chilling process, their resistance to the simulated gastric and intestinal fluids (SGF and SIF), and their stability during 90 days of storage. The viability of the cells was not affected by microencapsulation. The free and encapsulated cells of B. animalis subsp. lactis were resistant to both SGF and SIF. The micro-encapsulated cells of L. acidophilus were more resistant to SGF and SIF than the free cells; the viability of the encapsulated cells was enhanced by 67%, while the free cells reached the detection limit of the method (103 CFU/g). The encapsulated probiotics were unstable when they were stored at 20 °C. The population of encapsulated L. acidophilus decreased drastically when they were stored at 7 °C; only 20% of cells were viable after 90 days of storage. The percentage of viable cells of the encapsulated B. animalis subsp.lactis, however, was 72% after the same period of storage. Promising results were obtained when the microparticles were stored at −18 °C; the freeze granted 90 days of shelf life to the encapsulated cells. These results suggest that the spray-chilling process using cocoa butter as carrier protects L. acidophilus from gastrointestinal fluids. However, the viability of the cells during storage must be improved. PMID:24516445

  20. 13C Nuclear Magnetic Resonance Studies of Citrate and Glucose Cometabolism by Lactococcus lactis

    PubMed Central

    Ramos, Ana; Jordan, Kieran N.; Cogan, Timothy M.; Santos, Helena

    1994-01-01

    13C nuclear magnetic resonance (13C-NMR) was used to investigate the metabolism of citrate plus glucose and pyruvate plus glucose by nongrowing cells of Lactococcus lactis subsp. lactis 19B under anaerobic conditions. The metabolism of citrate plus glucose during growth was also monitored directly by in vivo NMR. Although pyruvate is a common intermediate metabolite in the metabolic pathways of both citrate and glucose, the origin of the carbon atoms in the fermentation products was determined by using selectively labeled substrates, e.g., [2,4-13C]citrate, [3-13C]pyruvate, and [2-13C]glucose. The presence of an additional substrate caused a considerable stimulation in the rates of substrate utilization, and the pattern of end products was changed. Acetate plus acetoin and butanediol represented more than 80% (molar basis) of the end products of the metabolism of citrate (or pyruvate) alone, but when glucose was also added, 80% of the citrate (or pyruvate) was converted to lactate. This result can be explained by the activation of lactate dehydrogenase by fructose 1,6-bisphosphate, an intermediate in glucose metabolism. The effect of different concentrations of glucose on the metabolism of citrate by dilute cell suspensions was also probed by using analytical methods other than NMR. Pyruvate dehydrogenase (but not pyruvate formate-lyase) was active in the conversion of pyruvate to acetyl coenzyme A. α-Acetolactate was detected as an intermediate metabolite of citrate or pyruvate metabolism, and the labeling pattern of the end products agrees with the α-acetolactate pathway. It was demonstrated that the contribution of the acetyl coenzyme A pathway for the synthesis of diacetyl, should it exist, is lower than 10%. Evidence for the presence of internal carbon reserves in L. lactis is presented. PMID:16349269

  1. Efficient secretory expression of the sweet-tasting protein brazzein in the yeast Kluyveromyces lactis.

    PubMed

    Jo, Hyun-Joo; Noh, Jin-Seok; Kong, Kwang-Hoon

    2013-08-01

    Brazzein is an intensely sweet-tasting protein with high water solubility, heat stability, and taste properties resembling those of carbohydrate sweeteners. In the present study, we describe the expression of the synthetic gene encoding brazzein, a sweet protein in the yeast Kluyveromyces lactis. The synthetic brazzein gene was designed based on the biased codons of the yeast, so as to optimize its expression, as well as on the extracellular secretion for expression in an active, soluble form. The synthesized brazzein gene was cloned into the secretion vector pKLAC2, which contains the yeast prepropeptide signal from the Saccharomycescerevisiae ?-mating factor. The constructed plasmid pKLAC2-des-pE1M-brazzein was introduced into the yeast K. lactis GG799. The yeast transformants were cultured for high-yield secretion of the recombinant des-pE1M-brazzein in YPGal medium for 96 h at 30°C. The expressed recombinant des-pE1M-brazzein was purified by CM-Sepharose column chromatography and approximately 104 mg/L was obtained. The purity and conformational state of the recombinant des-pE1M-brazzein were confirmed using SDS-PAGE, HPLC, and circular dichroism. The identity of the recombinant protein was also confirmed by N-terminal amino acid analysis and taste testing. The purified recombinant des-pE1M-brazzein had an intrinsic sweetness in its minor form, approximately 2130 times sweeter than sucrose on a weight basis. These results demonstrate that the K. lactis expression system is useful for producing the recombinant brazzein in active form at a high yield with attributes useful in the food industry. PMID:23684772

  2. Optimization of nisin production by Lactococcus lactis UQ2 using supplemented whey as alternative culture medium.

    PubMed

    González-Toledo, S Y; Domínguez-Domínguez, J; García-Almendárez, B E; Prado-Barragán, L A; Regalado-González, C

    2010-08-01

    Lactococcus lactis UQ2 is a nisin A-producing native strain. In the present study, the production of nisin by L. lactis UQ2 in a bioreactor using supplemented sweet whey (SW) was optimized by a statistical design of experiments and response surface methodology (RSM). In a 1st approach, a fractional factorial design (FFD) of the order 2(5-1) with 3 central points was used. The effect on nisin production of air flow, SW, soybean peptone (SP), MgSO(4)/MnSO(4) mixture, and Tween 80 was evaluated. From FFD, the most significant factors affecting nisin production were SP (P = 0.011), and SW (P = 0.037). To find optimum conditions, a central composite design (CCD) with 2 central points was used. Three factors were considered, SW (7 to 10 g/L), SP (7 to10 g/L), and small amounts of added nisin as self-inducer (NI 34.4 to 74.4 IU/L). Nisin production was expressed as international units (IU). From RSM, an optimum nisin activity of 180 IU/mL was predicted at 74.4 IU/L NI, 13.8 g/L SP, and 14.9 or 5.11 g/L SW, while confirmatory experiments showed a maximum activity of 178 +/- 5.2 IU/mL, verifying the validity of the model. The 2nd-order model showed a coefficient of determination (R(2)) of 0.828. Optimized conditions were used for constant pH fermentations, where a maximum activity of 575 +/- 17 IU/mL was achieved at pH 6.5 after 12 h. The adsorption-desorption technique was used to partially purify nisin, followed by drying. The resulting powder showed an activity of 102150 IU/g. Practical Application: Nisin production was optimized using supplemented whey as alternative culture medium, using a native L. lactis UQ2 strain. Soybean peptone, SW, and subinhibitory amounts of nisin were successfully employed to optimize nisin production by L. lactis UQ2. Dried semipurified nisin showed an activity of 102150 IU/g. PMID:20722935

  3. Prebiotic Effects of Agave salmiana Fructans in Lactobacillus acidophilus and Bifidobacterium lactis Cultures.

    PubMed

    Castro-Zavala, Adriana; Juárez-Flores, Bertha I; Pinos-Rodríguez, Juan M; Delgado-Portales, Rosa E; Aguirre-Rivera, Juan R; Alcocer-Gouyonnet, Francisco

    2015-11-01

    Agave salmiana is a fructan rich species that is widely distributed in Mexico. The aim of this investigation was to extract the fructans of A. salmiana and evaluate their prebiotic effect in 48 hours in vitro cultures of Bifidobacterium lactis and Lactobacillus acidophilus and to compare this effect with other available fructan sources. A significant difference in pH, optical density and biomass was found in the cultures depending on the source of fructans and the type of bacteria. It was possible to determine a dose-response effect of the A. salmiana fructans and the growth of the studied strains. PMID:26749843

  4. Dynamic analysis of the Lactococcus lactis transcriptome in cheeses made from milk concentrated by ultrafiltration reveals multiple strategies of adaptation to stresses.

    PubMed

    Cretenet, Marina; Laroute, Valérie; Ulvé, Vincent; Jeanson, Sophie; Nouaille, Sébastien; Even, Sergine; Piot, Michel; Girbal, Laurence; Le Loir, Yves; Loubière, Pascal; Lortal, Sylvie; Cocaign-Bousquet, Muriel

    2011-01-01

    Lactococcus lactis is used extensively for the production of various cheeses. At every stage of cheese fabrication, L. lactis has to face several stress-generating conditions that result from its own modification of the environment as well as externally imposed conditions. We present here the first in situ global gene expression profile of L. lactis in cheeses made from milk concentrated by ultrafiltration (UF-cheeses), a key economical cheese model. The transcriptomic response of L. lactis was analyzed directly in a cheese matrix, starting from as early as 2 h and continuing for 7 days. The growth of L. lactis stopped after 24 h, but metabolic activity was maintained for 7 days. Conservation of its viability relied on an efficient proteolytic activity measured by an increasing, quantified number of free amino acids in the absence of cell lysis. Extensive downregulation of genes under CodY repression was found at day 7. L. lactis developed multiple strategies of adaptation to stressful modifications of the cheese matrix. In particular, expression of genes involved in acidic- and oxidative-stress responses was induced. L. lactis underwent unexpected carbon limitation characterized by an upregulation of genes involved in carbon starvation, principally due to the release of the CcpA control. We report for the first time that in spite of only moderately stressful conditions, lactococci phage is repressed under UF-cheese conditions. PMID:21075879

  5. Dynamic Analysis of the Lactococcus lactis Transcriptome in Cheeses Made from Milk Concentrated by Ultrafiltration Reveals Multiple Strategies of Adaptation to Stresses ▿

    PubMed Central

    Cretenet, Marina; Laroute, Valérie; Ulvé, Vincent; Jeanson, Sophie; Nouaille, Sébastien; Even, Sergine; Piot, Michel; Girbal, Laurence; Le Loir, Yves; Loubière, Pascal; Lortal, Sylvie; Cocaign-Bousquet, Muriel

    2011-01-01

    Lactococcus lactis is used extensively for the production of various cheeses. At every stage of cheese fabrication, L. lactis has to face several stress-generating conditions that result from its own modification of the environment as well as externally imposed conditions. We present here the first in situ global gene expression profile of L. lactis in cheeses made from milk concentrated by ultrafiltration (UF-cheeses), a key economical cheese model. The transcriptomic response of L. lactis was analyzed directly in a cheese matrix, starting from as early as 2 h and continuing for 7 days. The growth of L. lactis stopped after 24 h, but metabolic activity was maintained for 7 days. Conservation of its viability relied on an efficient proteolytic activity measured by an increasing, quantified number of free amino acids in the absence of cell lysis. Extensive downregulation of genes under CodY repression was found at day 7. L. lactis developed multiple strategies of adaptation to stressful modifications of the cheese matrix. In particular, expression of genes involved in acidic- and oxidative-stress responses was induced. L. lactis underwent unexpected carbon limitation characterized by an upregulation of genes involved in carbon starvation, principally due to the release of the CcpA control. We report for the first time that in spite of only moderately stressful conditions, lactococci phage is repressed under UF-cheese conditions. PMID:21075879

  6. Anti-inflammatory properties of fermented soy milk with Lactococcus lactis subsp. lactis S-SU2 in murine macrophage RAW264.7 cells and DSS-induced IBD model mice.

    PubMed

    Kawahara, Miho; Nemoto, Maki; Nakata, Toru; Kondo, Saya; Takahashi, Hajime; Kimura, Bon; Kuda, Takashi

    2015-06-01

    Six lactic acid bacteria strains (four Lactobacillus plantarum strains and one each of Lactococcus lactis subsp. lactis and Pediococcus pentosaceus) have been isolated and shown to possess anti-oxidant activity. In this study, we determined their acid, bile, salt resistance, and adhesion activity on human enterocyte-like HT-29-Luc and Caco-2 cells. An isolate Lc. lactis S-SU2 showed highest bile resistance and adhesion activity compared to type strains. S-SU2 could ferment both 10% skimmed milk and soy milk while the type strain could not ferment soy milk. Soy milk fermented with S-SU2 showed an increased nitric oxide (NO) secretion in the mouse macrophage RAW264.7 cells without bacterial lipopolysaccharide (LPS). Furthermore, the inhibitory effects of the fermented soy milk on Escherichia coli O111 LPS-induced NO secretion were higher than those of fresh soy milk. Inflammatory bowel disease (IBD) was induced in mice fed either 5% (w/v) dextran sodium sulfate (DSS) in drinking water or 50% soy milk in drinking water. Shortening of colon length, breaking of epithelial cells, lowering liver and thymus weights, and enlargement of spleen are some of the characteristics observed in the IBD, which were prevented by the use of soy milk fermented with Lc. lactis S-SU2. PMID:25887264

  7. Mutational and Computational Evidence That a Nickel-Transfer Tunnel in UreD Is Used for Activation of Klebsiella aerogenes Urease.

    PubMed

    Farrugia, Mark A; Wang, Beibei; Feig, Michael; Hausinger, Robert P

    2015-10-20

    Nickel-containing urease from Klebsiella aerogenes requires four accessory proteins for proper active site metalation. The metallochaperone UreE delivers nickel to UreG, a GTPase that forms a UreD/UreF/UreG complex, which binds to urease apoprotein via UreD. Prior in silico analysis of the homologous, structurally characterized UreH/UreF/UreG complex from Helicobacter pylori identified a water tunnel originating at a likely nickel-binding motif in UreG, passing through UreF, and exiting UreH, suggestive of a role for the channel in providing the metal to urease apoprotein for its activation; however, no experimental support was reported for the significance of this tunnel. Here, specific variants were designed to disrupt a comparable 34.6 Å predicted internal tunnel, alternative channels, and surface sites for UreD. Cells producing a set of tunnel-disrupting variants of UreD exhibited greatly reduced urease specific activities, whereas other mutants had no appreciable effect on activity. Affinity pull-down studies of cell-free extracts from tunnel-disrupting mutant cultures showed no loss of UreD interactions with urease or UreF/UreG. The nickel contents of urease samples enriched from activity-deficient cultures were decreased, while zinc and iron incorporation increased. Molecular dynamics simulations revealed size restrictions in the internal channels of the UreD variants. These findings support the role of a molecular tunnel in UreD as a direct facilitator of nickel transfer into urease, illustrating a new paradigm in active site metallocenter assembly. PMID:26401965

  8. Klebsiella aerogenes UreF: Identification of the UreG Binding Site and Role in Enhancing the Fidelity of Urease Activation†

    PubMed Central

    Boer, Jodi L.; Hausinger, Robert P.

    2012-01-01

    The Ni-containing active site of Klebsiella aerogenes urease is assembled through the concerted action of the UreD, UreE, UreF, and UreG accessory proteins. UreE functions as a metallochaperone that delivers Ni to a complex of UreD—UreF—UreG bound to urease apoprotein, with UreG serving as a GTPase during enzyme activation. The present study focuses on the role of UreF, previously proposed to act as a GTPase activating protein (GAP) of UreG. Sixteen conserved UreF surface residues that may play roles in protein:protein interactions were independently changed to Ala. When produced in the context of the entire urease gene cluster, cell-free extracts of nine site-directed mutants had less than 10% of the wild-type urease activity. Enrichment of the variant forms of UreF, as the UreE-F fusion proteins, uniformly resulted in co-purification of UreD and urease apoprotein; whereas UreG bound to only a subset of the species. Notably, reduced interaction with UreG correlated with the low activity mutants. The affected residues in UreF map to a distinct surface on the crystal structure, defining the UreG binding site. In contrast to the hypothesis that UreF is a GAP, the UreD—UreF—UreG—urease apoprotein complex containing K165A UreF exhibited significantly greater levels of GTPase activity than that containing the wild-type protein. Additional studies demonstrated the UreG GTPase activity was largely uncoupled from urease activation for the complex containing this UreF variant. Further experiments with these complexes provided evidence that UreF gates the GTPase activity of UreG to enhance the fidelity of urease metallocenter assembly, especially in the presence of the non-cognate metal Zn. PMID:22369361

  9. The Carbohydrate Metabolism Signature of Lactococcus lactis Strain A12 Reveals Its Sourdough Ecosystem Origin

    PubMed Central

    Passerini, Delphine; Coddeville, Michèle; Le Bourgeois, Pascal; Loubière, Pascal; Ritzenthaler, Paul; Fontagné-Faucher, Catherine; Cocaign-Bousquet, Muriel

    2013-01-01

    Lactococcus lactis subsp. lactis strain A12 was isolated from sourdough. Combined genomic, transcriptomic, and phenotypic analyses were performed to understand its survival capacity in the complex sourdough ecosystem and its role in the microbial community. The genome sequence comparison of strain A12 with strain IL1403 (a derivative of an industrial dairy strain) revealed 78 strain-specific regions representing 23% of the total genome size. Most of the strain-specific genes were involved in carbohydrate metabolism and are potentially required for its persistence in sourdough. Phenotype microarray, growth tests, and analysis of glycoside hydrolase content showed that strain A12 fermented plant-derived carbohydrates, such as arabinose and ?-galactosides. Strain A12 exhibited specific growth rates on raffinose that were as high as they were on glucose and was able to release sucrose and galactose outside the cell, providing soluble carbohydrates for sourdough microflora. Transcriptomic analysis identified genes specifically induced during growth on raffinose and arabinose and reveals an alternative pathway for raffinose assimilation to that used by other lactococci. PMID:23872564

  10. Cocultivation of Lactococcus lactis and Teredinobacter turnirae for biological chitin extraction from prawn waste.

    PubMed

    Aytekin, Ozhan; Elibol, Murat

    2010-03-01

    In this study, mainly biological treatment of prawn waste for chitin production was investigated. Lactic acid and protease fermentations were applied to extract chitin from prawn waste in the presence of various glucose concentrations. The results obtained were also compared with those of chemical method which was consisted of first mineral removal and then protein removal sequence. Different strategies were applied using lactic acid producing bacterium, Lactococcus lactis, and a protease producer, marine bacterium Teredinobacter turnirae. Both bacteria were first cultivated individually and then cofermented. In their individual cultivation, L. lactis removed the inorganic materials efficiently, while T. turnirae performed better in deproteinization process. Cofermentation of both bacteria was also conducted using three different protocols. The highest process yield (95.5%) was obtained when T. turnirae was first inoculated. Although the extraction of chitin by biological treatment was incomplete compared to the chemical method, the biological treatment employed here could still be considered as an alternative method in a more environmentally benign approach. PMID:19506911

  11. Adaptation of Lactococcus lactis to high growth temperature leads to a dramatic increase in acidification rate.

    PubMed

    Chen, Jun; Shen, Jing; Ingvar Hellgren, Lars; Ruhdal Jensen, Peter; Solem, Christian

    2015-01-01

    Lactococcus lactis is essential for most cheese making, and this mesophilic bacterium has its growth optimum around 30 °C. We have, through adaptive evolution, isolated a mutant TM29 that grows well up to 39 °C, and continuous growth at 40 °C is possible if pre-incubated at a slightly lower temperature. At the maximal permissive temperature for the wild-type, 38 °C, TM29 grows 33% faster and has a 12% higher specific lactate production rate than its parent MG1363, which results in fast lactate accumulation. Genome sequencing was used to reveal the mutations accumulated, most of which were shown to affect thermal tolerance. Of the mutations with more pronounced effects, two affected expression of single proteins (chaperone; riboflavin transporter), two had pleiotropic effects (RNA polymerase) which changed the gene expression profile, and one resulted in a change in the coding sequence of CDP-diglyceride synthase. A large deletion containing 10 genes was also found to affect thermal tolerance significantly. With this study we demonstrate a simple approach to obtain non-GMO derivatives of the important L. lactis that possess properties desirable by the industry, e.g. thermal robustness and increased rate of acidification. The mutations we have identified provide a genetic basis for further investigation of thermal tolerance. PMID:26388459

  12. Purification and characterization of a novel glucansucrase from Leuconostoc lactis EG001.

    PubMed

    Kim, Yong-Mo; Yeon, Min Ji; Choi, Nack-Shick; Chang, Young-Hyo; Jung, Min Young; Song, Jae Jun; Kim, Joong Su

    2010-07-20

    A gene encoding glucansucrase was identified in Leuconostoc lactis EG001 isolated from lactic acid bacteria (LAB) in Kimchi, a traditional Korean fermented food. The L. lactis EG001 glucansucrase gene consists of 4503 bp open reading frame (ORF) and encodes an enzyme of 1500 amino acids with an apparent molecular mass of 165 kDa. The deduced amino-acid sequence showed the highest amino-acid sequence identity (75%) to that of dextransucrase of L. mesenteroides. The gene was cloned and over-expressed in Escherichia coli strain. The recombinant enzyme was purified via Ni-NTA affinity chromatography and its enzymatic properties were characterized. The enzyme exhibited optimum activity at 30 degrees C and pH 5.0. In addition, the enzyme was able to catalyze the glycosylation of l-ascorbic acid to l-ascorbic acid 2-glucoside. The glycosylated product via EG001 glucansucrase has the potential as an antioxidant in industrial applications. PMID:19853426

  13. A foodgrade preparation of nisin from diluted milk fermented with Lactococcus lactis W8.

    PubMed

    Mitra, Suranjita; Mukhopadhyay, Bidhan Chandra; Biswas, Swadesh Ranjan

    2009-12-01

    Lactococcus lactis strain W8, which contains the nisin Z gene in its genome, grew well and produced nisin in cow's milk at temperatures of 30 to 37 degrees C. Maximum production of nisin was achieved at 6 h and was 4,000 activity units (AU) per ml in skim milk and 2,400 AU/ml in 3% fat milk. The organism produced nisin even in 20 times diluted skim milk and 3% fat milk at 1,000 and 600 AU/ml, respectively. Boiling of the fermented milk (pH 4.2) made with this culture allowed the separation of the liquid part (whey) from the curd. When 20 times diluted skim milk was fermented and the whey derived from it was lyophilized, the yield of nisin was 60,000 AU/g. The antimicrobial activity of the nisin preparation was stable for at least 1 year at refrigeration temperature. L. lactis W8 may have significant applications in the food industry for a cost-effective natural nisin preparation. PMID:20003749

  14. The Construction and Application of the Multi-copy Integration Vector in K. lactis.

    PubMed

    Tang, Nan-Yun; Huo, Ke-Ke; Li, Yu-Yang

    1996-01-01

    The vector pIRK was constructed by using a 2.2 kb EcoRI fragment of rDNA from Kluyveromyces lactis for targeted homologous recombination, with the URA3 gene from Saccharomyces cerevisiae acting as a selection marker. By the examination of the copy number, stability and chromosomal location of the vector in K. lactis transformants the results demonstrated that: (1) of the different transformants, the average copy number of the plasmid pIRK was 120 per cell; (2) after 50 generations of growth in rich medium, the vector displayed high stability. (3) all integration events occurred in the chromosome IV where genomic rDNA located. Using this vector, the LAC4 gene cloned from K. fragilis was expressed. The yield of beta-galactosidase related directly to the vector's copy number. The highest activity of beta-galactosidase produced by transformants was 8.6 times higher than that produced by the wild type strain of K. fragilis under the same conditions. PMID:12232616

  15. Cyclopropane fatty acid synthase from Oenococcus oeni: expression in Lactococcus lactis subsp. cremoris and biochemical characterization.

    PubMed

    To, Thi Mai Huong; Grandvalet, Cosette; Alexandre, Hervé; Tourdot-Maréchal, Raphaëlle

    2015-11-01

    Bacterial cyclopropane fatty acid synthases (CFA synthases) catalyze the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to the double bond of a lipid chain, thereby forming a cyclopropane ring. CFAs contribute to resistance to acidity, dryness, and osmotic imbalance in many bacteria. This work describes the first biochemical characterization of a lactic acid bacterium CFA synthase. We have overexpressed Oenococcus oeni CFA synthase in E. coli in order to purify the enzyme. The optimum cyclopropanation activity was obtained at pH 5.6 and 35.8 °C. The high K(m) (AdoMet) value obtained (2.26 mM) demonstrates the low affinity of O. oeni enzyme toward the L. lactis subsp. cremoris unsaturated phospholipids. These results explain the partial complementation of the L. lactis subsp. cremoris cfa mutant by the O. oeni cfa gene and suggest a probable substrate specificity of the O. oeni enzyme. The current study reveals an essential hypothesis about the specificity of O. oeni CFA synthase which could play a key function in the acid tolerance mechanisms of this enological bacterium. PMID:26294376

  16. In vivo regulation of glycolysis and characterization of sugar: phosphotransferase systems in Streptococcus lactis.

    PubMed Central

    Thompson, J

    1978-01-01

    Two novel procedures have been used to regulate, in vivo, the formation of phosphoenolpyruvate (PEP) from glycolysis in Streptococcus lactis ML3. In the first procedure, glucose metabolism was specifically inhibited by p-chloromercuribenzoate. Autoradiographic and enzymatic analyses showed that the cells contained glucose 6-phosphate, fructose 6-phosphate, fructose-1,6-diphosphate, and triose phosphates.Dithiothreitol reversed the p-chloromercuribenzoate inhibition, and these intermediates were rapidly and quantitatively transformed into 3- and 2-phosphoglycerates plus PEP. The three intermediates were not further metabolized and constituted the intracellular PEP potential. The second procedure simply involved starvation of the organisms. The starved cells were devoid of glucose 6-phosphate, fructose 6-phosphate, fructose- 1,6-diphosphate, and triose phosphates but contained high levels of 3- and 2-phosphoglycerates and PEP (ca. 40 mM in total). The capacity to regulate PEP formation in vivo permitted the characterization of glucose and lactose phosphotransferase systems in physiologically intact cells. Evidence has been obtained for "feed forward" activation of pyruvate kinase in vivo by phosphorylated intermediates formed before the glyceraldehyde-3-phosphate dehydrogenase reaction in the glycolytic sequence. The data suggest that pyruvate kinase (an allosteric enzyme) plays a key role in the regulation of glycolysis and phosphotransferase system functions in S. lactis ML3. Images PMID:101523

  17. Statistical investigation of Kluyveromyces lactis cells permeabilization with ethanol by response surface methodology.

    PubMed

    de Faria, Janaína T; Rocha, Pollyana F; Converti, Attilio; Passos, Flávia M L; Minim, Luis A; Sampaio, Fábio C

    2013-12-01

    The aim of our study was to select the optimal operating conditions to permeabilize Kluyveromyces lactis cells using ethanol as a solvent as an alternative to cell disruption and extraction. Cell permeabilization was carried out by a non-mechanical method consisting of chemical treatment with ethanol, and the results were expressed as β-galactosidase activity. Experiments were conducted under different conditions of ethanol concentration, treatment time and temperature according to a central composite rotatable design (CCRD), and the collected results were then worked out by response surface methodology (RSM). Cell permeabilization was improved by an increase in ethanol concentration and simultaneous decreases in the incubation temperature and treatment time. Such an approach allowed us to identify an optimal range of the independent variables within which the β-galactosidase activity was optimized. A maximum permeabilization of 2,816 mmol L(-1) oNP min(-1) g(-1) was obtained by treating cells with 75.0% v/v of ethanol at 20.0 °C for 15.0 min. The proposed methodology resulted to be effective and suited for K. lactis cells permeabilization at a lab-scale and promises to be of possible interest for future applications mainly in the food industry. PMID:24688494

  18. Adaptation of Lactococcus lactis to high growth temperature leads to a dramatic increase in acidification rate

    PubMed Central

    Chen, Jun; Shen, Jing; Ingvar Hellgren, Lars; Ruhdal Jensen, Peter; Solem, Christian

    2015-01-01

    Lactococcus lactis is essential for most cheese making, and this mesophilic bacterium has its growth optimum around 30 °C. We have, through adaptive evolution, isolated a mutant TM29 that grows well up to 39 °C, and continuous growth at 40 °C is possible if pre-incubated at a slightly lower temperature. At the maximal permissive temperature for the wild-type, 38 °C, TM29 grows 33% faster and has a 12% higher specific lactate production rate than its parent MG1363, which results in fast lactate accumulation. Genome sequencing was used to reveal the mutations accumulated, most of which were shown to affect thermal tolerance. Of the mutations with more pronounced effects, two affected expression of single proteins (chaperone; riboflavin transporter), two had pleiotropic effects (RNA polymerase) which changed the gene expression profile, and one resulted in a change in the coding sequence of CDP-diglyceride synthase. A large deletion containing 10 genes was also found to affect thermal tolerance significantly. With this study we demonstrate a simple approach to obtain non-GMO derivatives of the important L. lactis that possess properties desirable by the industry, e.g. thermal robustness and increased rate of acidification. The mutations we have identified provide a genetic basis for further investigation of thermal tolerance. PMID:26388459

  19. Autolysis of Lactococcus lactis caused by induced overproduction of its major autolysin, AcmA.

    PubMed Central

    Buist, G; Karsens, H; Nauta, A; van Sinderen, D; Venema, G; Kok, J

    1997-01-01

    The optical density of a culture of lactococcus lactis MG1363 was reduced more than 60% during prolonged stationary phase. Reduction in optical density (autolysis) was almost absent in a culture of an isogenic mutant containing a deletion in the major autolysin gene, acmA. An acmA mutant carrying multiple coples of a plasmid encoding AcmA lysed to a greater extent than the wild-type strain did. Intercellular action of AcmA was shown by mixing end-exponential-phase cultures of an acmA deletion mutant and a tripeptidase (pepT) deletion mutant. PepT, produced by the acmA mutant, was detected in the supernatant of the mixed culture, but no PepT was present in the culture supernatant of the acmA mutant. A plasmid was constructed in which acmA, lacking its own promoter, was placed downstream of the inducible promoter/operator region of the temperate lactococcal bacteriophage r1t. After mitomycin induction of an exponential-phase culture of L. lactis LL302 carrying this plasmid, the cells became subject to autolysis, resulting in the release of intracellular proteins. PMID:9212419

  20. Multilocus Sequence Typing Scheme for the Characterization of 936-Like Phages Infecting Lactococcus lactis

    PubMed Central

    Moisan, Maxim

    2012-01-01

    Lactococcus lactis phage infections are costly for the dairy industry because they can slow down the fermentation process and adversely impact product safety and quality. Although many strategies have been developed to better control phage populations, new virulent phages continue to emerge. Thus, it is beneficial to develop an efficient method for the routine identification of new phages within a dairy plant to rapidly adapt antiphage tactics. Here, we present a multilocus sequence typing (MLST) scheme for the characterization of the 936-like phages, the most prevalent phage group infecting L. lactis strains worldwide. The proposed MLST system targets the internal portion of five highly conserved genomic sequences belonging to the packaging, morphogenesis, and lysis modules. Our MLST scheme was used to analyze 100 phages with different restriction fragment length polymorphism (RFLP) patterns isolated from 11 different countries between 1971 and 2010. PCR products were obtained for all the phages analyzed, and sequence analysis highlighted the high discriminatory power of the MLST system, detecting 93 different sequence types. A conserved locus within the lys gene (coding for endolysin) was the most discriminative, with 65 distinct alleles. The locus within the mcp gene (major capsid protein) was the most conserved (54 distinct alleles). Phylogenetic analyses of the concatenated sequences exhibited a strong concordance of the clusters with the phage host range, indicating the clonal evolution of these phages. A public database has been set up for the proposed MLST system, and it can be accessed at http://pubmlst.org/bacteriophages/. PMID:22522686

  1. Detection of Bacteriophage-Infected Cells of Lactococcus lactis by Using Flow Cytometry▿

    PubMed Central

    Michelsen, Ole; Cuesta-Dominguez, Álvaro; Albrechtsen, Bjarne; Jensen, Peter Ruhdal

    2007-01-01

    Bacteriophage infection in dairy fermentation constitutes a serious problem worldwide. We have studied bacteriophage infection in Lactococcus lactis by using the flow cytometer. The first effect of the infection of the bacterium is a change from cells in chains toward single cells. We interpret this change as a consequence of a cease in cell growth, while the ongoing cell divisions leave the cells as single cells. Late in the infection cycle, cells with low-density cell walls appear, and these cells can be detected on cytograms of light scatter versus, for instance, fluorescence of stained DNA. We describe a new method for detection of phage infection in Lactococcus lactis dairy cultures. The method is based on flow cytometric detection of cells with low-density cell walls. The method allows fast and early detection of phage-infected bacteria, independently of which phage has infected the culture. The method can be performed in real time and therefore increases the chance of successful intervention in the fermentation process. PMID:17921265

  2. [Stability of Lactococcus lactis phages treated with sodium hypochlorite and during storage].

    PubMed

    Parada, J L; de Fabrizio, S V

    2001-01-01

    Survival of lytic bacteriophages active against Lactococcus lactis ssp. lactis and ssp. cremoris was determined after treatment with sodium hypochlorite and during storage at 4 degrees C. Three phages were isolated from dairy plants in Argentina (ARG) and the other phages were isolated in the United States of America (US). All of them represent phages that infected cheese manufacture industries and belong to different morphological or serological groups. These phages showed higher survival in M17 broth, buffered with sodium glycerophosphate, than in trypteine soy broth (TSB). Phage populations did not decrease significantly during 14 weeks in M17 broth, whereas in TSB the titers of phage suspensions began to decline around 9 days. In addition, the effect of sodium hypochlorite was more marked in broth than in milk. A higher surviving fraction was obtained in milk, even when tenfold higher concentrations of chlorine were used. The effect of hypochlorite on phages of the same serological group was quite similar and independent of phage morphology. However, phage 137-1, which belongs to other serological group, showed lower resistance to sodium hypochlorite. Comparing the hypochlorite inactivation for ARG and US phages, it was observed that they have their own inactivation values, independently of their origin and morphological group. Long periods of time and high concentrations of chlorine were necessary to reduce the surviving fraction in milk. This indicates that hypochlorite concentrations and times of contact can be critical for the efficiency of the operative sanitization processes. PMID:11494761

  3. Antiviral Effects of Lactococcus lactis on Feline Calicivirus, A Human Norovirus Surrogate.

    PubMed

    Aboubakr, Hamada A; El-Banna, Amr A; Youssef, Mohammed M; Al-Sohaimy, Sobhy A A; Goyal, Sagar M

    2014-08-17

    Foodborne viruses, particularly human norovirus (NV) and hepatitis virus type A, are a cause of concern for public health making it necessary to explore novel and effective techniques for prevention of foodborne viral contamination, especially in minimally processed and ready-to-eat foods. This study aimed to determine the antiviral activity of a probiotic lactic acid bacterium (LAB) against feline calicivirus (FCV), a surrogate of human NV. Bacterial growth medium filtrate (BGMF) of Lactococcus lactis subsp. lactis LM0230 and its bacterial cell suspension (BCS) were evaluated separately for their antiviral activity against FCV grown in Crandell-Reese feline kidney (CRFK) cells. No significant antiviral effect was seen when CRFK cells were pre-treated with either BGMF (raw or pH 7-adjusted BGMF) or BCS. However, pre-treatment of FCV with BGMF and BCS resulted in a reduction in virus titers of 1.3 log10 tissue culture infectious dose (TCID)50 and 1.8 log10 TCID50, respectively. The highest reductions in FCV infectivity were obtained when CRFK cells were co-treated with FCV and pH 7-adjusted BGMF or with FCV and BCS (7.5 log10 TCID50 and 6.0 log10 TCID50, respectively). These preliminary results are encouraging and indicate the need for continued studies on the role of probiotics and LAB on inactivation of viruses in various types of foods. PMID:25129102

  4. Proteomic characterization of the acid tolerance response in Lactococcus lactis MG1363.

    PubMed

    Budin-Verneuil, Aurélie; Pichereau, Vianney; Auffray, Yanick; Ehrlich, Dusko S; Maguin, Emmanuelle

    2005-12-01

    Exponentially growing cells of Lactococcus lactis MG1363 are able to develop an Acid Tolerance Response (ATR) when incubated at pH 5, in both rich (M17)--and chemically defined (SA)--culture media. Physiological and proteomic characterization of this adaptive response indicated that L. lactis reorganizes its metabolism in response to acid stress to a great extent and quite differently in the two media. The development of ATR was fully dependent on protein de novo synthesis in SA and only partly dependent in M17. 2D gel electrophoresis revealed a total of 90 spots induced by acidity, 80 of which were identified by mass spectrometry. Only 10 proteins (BglA, PycA, GlmS, HasC, ArgS, GatA, AtpA, ArcB, Cfa, and SodA) were overproduced in the two media. A transcriptional analysis of the corresponding genes suggested that for half of them the mode of regulation may differ in the two media. Among the protein spots upregulated during the ATR in SA but not in M17, 13 already displayed an elevated rate of synthesis in M17 at neutral pH. These proteins could play an important role in the development of the protein de novo synthesis-independent ATR observed in M17. PMID:16237734

  5. Proteome phenotyping of acid stress-resistant mutants of Lactococcus lactis MG1363.

    PubMed

    Budin-Verneuil, Aurélie; Pichereau, Vianney; Auffray, Yanick; Ehrlich, Dusko; Maguin, Emmanuelle

    2007-06-01

    To cope with medium acidity, Lactococcus lactis has evolved a number of inducible mechanisms commonly referred as acid stress response. To better understand the molecular basis of this response, several mutants constitutively tolerant to acidity were previously obtained by insertional random mutagenesis of L. lactis MG1363. Mutants in which the GMP synthase gene (i.e. guaA), the (p)ppGpp synthase gene (i.e. relA*) or the high affinity phosphate transport system (i.e. pstS) are inactivated are further characterized in this study. 2-DE was performed and showed that 42, 26, and 35 protein spots are positively deregulated in the guaA, relA*, and pstS mutants, respectively, as compared to the wild-type strain. Most of these proteins were identified by MS. Proteomes comparison of the mutants guaA, relA*, and pstS as well as the acid adaptation proteome of the wild-type strain revealed (i) the presence of numerous overlaps and (ii) that only five proteins were overexpressed in the four conditions, suggesting that these proteins play a crucial role in the constitutive acid stress tolerance of the mutants and in the acid tolerance response of the wild-type strain. PMID:17514678

  6. Two Lactococcus lactis thioredoxin paralogues play different roles in responses to arsenate and oxidative stress.

    PubMed

    Efler, Petr; Kilstrup, Mogens; Johnsen, Stig; Svensson, Birte; Hägglund, Per

    2015-03-01

    Thioredoxin (Trx) maintains intracellular thiol groups in a reduced state and is involved in a wide range of cellular processes, including ribonucleotide reduction, sulphur assimilation, oxidative stress responses and arsenate detoxification. The industrially important lactic acid bacterium Lactococcus lactis contains two Trxs. TrxA is similar to the well-characterized Trx homologue from Escherichia coli and contains the common WCGPC active site motif, while TrxD is atypical and contains an aspartate residue in the active site (WCGDC). To elucidate the physiological roles of the two Trx paralogues, deletion mutants ?trxA, ?trxD and ?trxA?trxD were constructed. In general, the ?trxA?trxD strain was significantly more sensitive than either of the ?trxA and ?trxD mutants. Upon exposure to oxidative stress, growth of the ?trxA strain was diminished while that of the ?trxD mutant was similar to the wild-type. The lack of TrxA also appears to impair methionine sulphoxide reduction. Both ?trxA and ?trxD strains displayed growth inhibition after treatment with sodium arsenate and tellurite as compared with the wild-type, suggesting partially overlapping functions of TrxA and TrxD. Overall the phenotype of the ?trxA mutant matches established functions of WCGPC-type Trx while TrxD appears to play a more restricted role in stress resistance of Lac. lactis. PMID:25564497

  7. Bifidobacterium animalis subsp. lactis fermented milk product reduces inflammation by altering a niche for colitogenic microbes

    PubMed Central

    Veiga, Patrick; Gallini, Carey Ann; Beal, Chloé; Michaud, Monia; Delaney, Mary L.; DuBois, Andrea; Khlebnikov, Artem; van Hylckama Vlieg, Johan E.T.; Punit, Shivesh; Glickman, Jonathan N.; Onderdonk, Andrew; Glimcher, Laurie H.; Garrett, Wendy S.

    2010-01-01

    Intestinal health requires the coexistence of eukaryotic self with the gut microbiota and dysregulated host-microbial interactions can result in intestinal inflammation. Here, we show that colitis improved in T-bet−/−Rag2−/− mice that consumed a fermented milk product containing Bifidobacterium animalis subsp. lactis DN-173 010 strain. A decrease in cecal pH and alterations in short chain fatty acid profiles occurred with consumption, and there were concomitant increases in the abundance of select lactate-consuming and butyrate-producing bacteria. These metabolic shifts created a nonpermissive environment for the Enterobacteriaceae recently identified as colitogenic in a T-bet−/−Rag2−/− ulcerative colitis mouse model. In addition, 16S rRNA-based analysis of the T-bet−/−Rag2−/−fecal microbiota suggest that the structure of the endogenous gut microbiota played a key role in shaping the host response to the bacterial strains studied herein. We have identified features of the gut microbiota, at the membership and functional level, associated with response to this B. lactis-containing fermented milk product, and therefore this model provides a framework for evaluating and optimizing probiotic-based functional foods. PMID:20921388

  8. Modeling of the Competitive Growth of Listeria monocytogenes and Lactococcus lactis in Vegetable Broth

    PubMed Central

    Breidt, Frederick; Fleming, Henry P.

    1998-01-01

    Current mathematical models used by food microbiologists do not address the issue of competitive growth in mixed cultures of bacteria. We developed a mathematical model which consists of a system of nonlinear differential equations describing the growth of competing bacterial cell cultures. In this model, bacterial cell growth is limited by the accumulation of protonated lactic acid and decreasing pH. In our experimental system, pure and mixed cultures of Lactococcus lactis and Listeria monocytogenes were grown in a vegetable broth medium. Predictions of the model indicate that pH is the primary factor that limits the growth of L. monocytogenes in competition with a strain of L. lactis which does not produce the bacteriocin nisin. The model also predicts the values of parameters that affect the growth and death of the competing populations. Further development of this model will incorporate the effects of additional inhibitors, such as bacteriocins, and may aid in the selection of lactic acid bacterium cultures for use in competitive inhibition of pathogens in minimally processed foods. PMID:9726854

  9. Comparison of the Complete Genome Sequences of Bifidobacterium animalis subsp. lactis DSM 10140 and Bl-04 ? †

    PubMed Central

    Barrangou, Rodolphe; Briczinski, Elizabeth P.; Traeger, Lindsay L.; Loquasto, Joseph R.; Richards, Melissa; Horvath, Philippe; Coûté-Monvoisin, Anne-Claire; Leyer, Gregory; Rendulic, Snjezana; Steele, James L.; Broadbent, Jeffery R.; Oberg, Taylor; Dudley, Edward G.; Schuster, Stephan; Romero, Dennis A.; Roberts, Robert F.

    2009-01-01

    Bifidobacteria are important members of the human gut flora, especially in infants. Comparative genomic analysis of two Bifidobacterium animalis subsp. lactis strains revealed evolution by internal deletion of consecutive spacer-repeat units within a novel clustered regularly interspaced short palindromic repeat locus, which represented the largest differential content between the two genomes. Additionally, 47 single nucleotide polymorphisms were identified, consisting primarily of nonsynonymous mutations, indicating positive selection and/or recent divergence. A particular nonsynonymous mutation in a putative glucose transporter was linked to a negative phenotypic effect on the ability of the variant to catabolize glucose, consistent with a modification in the predicted protein transmembrane topology. Comparative genome sequence analysis of three Bifidobacterium species provided a core genome set of 1,117 orthologs complemented by a pan-genome of 2,445 genes. The genome sequences of the intestinal bacterium B. animalis subsp. lactis provide insights into rapid genome evolution and the genetic basis for adaptation to the human gut environment, notably with regard to catabolism of dietary carbohydrates, resistance to bile and acid, and interaction with the intestinal epithelium. The high degree of genome conservation observed between the two strains in terms of size, organization, and sequence is indicative of a genomically monomorphic subspecies and explains the inability to differentiate the strains by standard techniques such as pulsed-field gel electrophoresis. PMID:19376856

  10. An alternative, arginase-independent pathway for arginine metabolism in Kluyveromyces lactis involves guanidinobutyrase as a key enzyme

    PubMed Central

    Romagnoli, G; Verhoeven, M D; Mans, R; Fleury Rey, Y; Bel-Rhlid, R; van den Broek, M; Maleki Seifar, R; Ten Pierick, A; Thompson, M; Müller, V; Wahl, S A; Pronk, J T; Daran, J M

    2014-01-01

    Most available knowledge on fungal arginine metabolism is derived from studies on Saccharomyces cerevisiae, in which arginine catabolism is initiated by releasing urea via the arginase reaction. Orthologues of the S. cerevisiae genes encoding the first three enzymes in the arginase pathway were cloned from Kluyveromyces lactis and shown to functionally complement the corresponding deletion in S. cerevisiae. Surprisingly, deletion of the single K. lactis arginase gene KlCAR1 did not completely abolish growth on arginine as nitrogen source. Growth rate of the deletion mutant strongly increased during serial transfer in shake-flask cultures. A combination of RNAseq-based transcriptome analysis and 13C-15N-based flux analysis was used to elucidate the arginase-independent pathway. Isotopic 13C15N-enrichment in ?-aminobutyrate revealed succinate as the entry point in the TCA cycle of the alternative pathway. Transcript analysis combined with enzyme activity measurements indicated increased expression in the Klcar1? mutant of a guanidinobutyrase (EC.3.5.3.7), a key enzyme in a new pathway for arginine degradation. Expression of the K. lactis KLLA0F27995g (renamed KlGBU1) encoding guanidinobutyrase enabled S. cerevisiae to use guanidinobutyrate as sole nitrogen source and its deletion in K. lactis almost completely abolish growth on this nitrogen source. Phylogenetic analysis suggests that this enzyme activity is widespread in fungi. PMID:24912400

  11. Contribution of Lactococcus lactis reducing properties to the downregulation of a major virulence regulator in Staphylococcus aureus, the agr system.

    PubMed

    Nouaille, Sébastien; Rault, Lucie; Jeanson, Sophie; Loubière, Pascal; Le Loir, Yves; Even, Sergine

    2014-11-01

    Staphylococcus aureus is a major cause of food poisoning outbreaks associated with dairy products, because of the ingestion of preformed enterotoxins. The biocontrol of S. aureus using lactic acid bacteria (LAB) offers a promising opportunity to fight this pathogen while respecting the product ecosystem. We had previously established the ability of Lactococcus lactis, a lactic acid bacterium widely used in the dairy industry, to downregulate a major staphylococcal virulence regulator, the accessory gene regulator (agr) system, and, as a consequence, agr-controlled enterotoxins. In the present paper, we have shown that the oxygen-independent reducing properties of L. lactis contribute to agr downregulation. Neutralizing lactococcal reduction by adding potassium ferricyanide or maintaining the oxygen pressure constant at 50% released agr downregulation in the presence of L. lactis. This downregulation still occurred in an S. aureus srrA mutant, indicating that the staphylococcal respiratory response regulator SrrAB was not the only component in the signaling pathway. Therefore, this study clearly demonstrates the ability of L. lactis reducing properties to interfere with the expression of S. aureus virulence, thus highlighting this general property of LAB as a lever to control the virulence expression of this major pathogen in a food context and beyond. PMID:25192992

  12. Effect of oral Lactococcus lactis containing endostatin on 1, 2-dimethylhydrazine-induced colon tumor in rats

    PubMed Central

    Li, Wei; Li, Chong-Bi

    2005-01-01

    AIM: To investigate the effects of oral Lactococcus lactis (L lactis) containing endostatin on 1, 2-dimethylhydrazine (DMH)-induced rat colorectal cancer. METHODS: Recombinant endostatin was produced by the expression of L lactis NZ9000. Sixty male Wistar rats were injected with DMH (40 mg/kg body weight) subcutaneously once a week for 10 wk to induce colorectal cancer. The rats were gavaged with 1 mL of endostatin at a dose of 1×108/d and fed with the basal diet. The animals were killed after 22 wk for histopathological examination. The total time of experimental observation was 58 wk. RESULTS: Rat endostatin protein was expressed in L lactis. Recombinant endostatin exhibited a significant effect on colorectal cancer (P<0.05). Furthermore, the mean survival time of the rats treated with endostatin was longer than that of the animals treated with DMH. There was no statistically significant difference between the rats treated with endostatin and those treated with DMH. The results showed that endostatin could not result in complete cure. CONCLUSION: Oral endostatin exerts an influence on the progression of chemically induced colon tumors. PMID:16437622

  13. Hsp65-producing Lactococcus lactis prevents experimental autoimmune encephalomyelitis in mice by inducing CD4+LAP+ regulatory T cells

    PubMed Central

    Rezende, Rafael M.; Oliveira, Rafael P.; Medeiros, Samara R.; Gomes-Santos, Ana C.; Alves, Andrea C.; Loli, Flávia G.; Guimarães, Mauro A.F.; Amaral, Sylvia S.; da Cunha, André P.; Weiner, Howard L.; Azevedo, Vasco; Miyoshi, Anderson; Faria, Ana M.C.

    2013-01-01

    Heat shock proteins (Hsps) participate in the cellular response to stress and they are hiperexpressed in inflammatory conditions. They are also known to play a major role in immune modulation, controlling, for instance, autoimmune responses. In this study, we showed that oral administration of a recombinant Lactococcus lactis strain that produces and releases LPS-free Hsp65 prevented the development of experimental autoimmune encephalomyelitis (EAE) in C57BL/6 mice. This was confirmed by the reduced inflammatory cell infiltrate and absence of injury signs in the spinal cord. The effect was associated with reduced IL-17 and increased IL-10 production in mesenteric lymph node and spleen cell cultures. Hsp65-producing-L. lactis-fed mice had a remarkable increase in the number of natural and inducible CD4+Foxp3+ regulatory T (Treg) cells and CD4+LAP+ (Latency-associated peptide) Tregs - which express the membrane-bound TGF-β - in spleen, inguinal and mesenteric lymph nodes as well as in spinal cord. Moreover, many Tregs co-expressed Foxp3 and LAP. In vivo depletion of LAP+ cells abrogated the effect of Hsp65-producing L. lactis in EAE prevention and worsened disease in medium-fed mice. Thus, Hsp65-L.lactis seems to boost this critical regulatory circuit involved in controlling EAE development in mice. PMID:22939403

  14. Hsp65-producing Lactococcus lactis prevents experimental autoimmune encephalomyelitis in mice by inducing CD4+LAP+ regulatory T cells.

    PubMed

    Rezende, Rafael M; Oliveira, Rafael P; Medeiros, Samara R; Gomes-Santos, Ana C; Alves, Andrea C; Loli, Flávia G; Guimarães, Mauro A F; Amaral, Sylvia S; da Cunha, André P; Weiner, Howard L; Azevedo, Vasco; Miyoshi, Anderson; Faria, Ana M C

    2013-02-01

    Heat shock proteins (Hsps) participate in the cellular response to stress and they are hiperexpressed in inflammatory conditions. They are also known to play a major role in immune modulation, controlling, for instance, autoimmune responses. In this study, we showed that oral administration of a recombinant Lactococcus lactis strain that produces and releases LPS-free Hsp65 prevented the development of experimental autoimmune encephalomyelitis (EAE) in C57BL/6 mice. This was confirmed by the reduced inflammatory cell infiltrate and absence of injury signs in the spinal cord. The effect was associated with reduced IL-17 and increased IL-10 production in mesenteric lymph node and spleen cell cultures. Hsp65-producing-L. lactis-fed mice had a remarkable increase in the number of natural and inducible CD4+Foxp3+ regulatory T (Treg) cells and CD4+LAP+ (Latency-associated peptide) Tregs - which express the membrane-bound TGF-β - in spleen, inguinal and mesenteric lymph nodes as well as in spinal cord. Moreover, many Tregs co-expressed Foxp3 and LAP. In vivo depletion of LAP+ cells abrogated the effect of Hsp65-producing L. lactis in EAE prevention and worsened disease in medium-fed mice. Thus, Hsp65-L.lactis seems to boost this critical regulatory circuit involved in controlling EAE development in mice. PMID:22939403

  15. Identification and characterization of tetracycline resistance in Lactococcus lactis isolated from Polish raw milk and fermented artisanal products.

    PubMed

    Zycka-Krzesinska, Joanna; Boguslawska, Joanna; Aleksandrzak-Piekarczyk, Tamara; Jopek, Jakub; Bardowski, Jacek K

    2015-10-15

    To assess the occurrence of antibiotic-resistant Lactic Acid Bacteria (LAB) in Polish raw milk and fermented artisanal products, a collection comprising 500 isolates from these products was screened. Among these isolates, six strains (IBB28, IBB160, IBB161, IBB224, IBB477 and IBB487) resistant to tetracycline were identified. The strains showing atypical tetracycline resistance were classified as Lactococcus lactis: three of them were identified as L. lactis subsp. cremoris (IBB224, IBB477 and IBB487) and the other three (IBB28, IBB160, IBB161) were identified as L. lactis subsp. lactis. The mechanism involving Ribosomal Protection Proteins (RPP) was identified as responsible for tetracycline resistance. Three of the tested strains (IBB28, IBB160 and IBB224) had genes encoding the TetS protein, whereas the remaining three (IBB161, IBB477 and IBB487) expressed TetM. The results also demonstrated that the genes encoding these proteins were located on genetic mobile elements. The tet(S) gene was found to be located on plasmids, whereas tet(M) was found within the Tn916 transposon. PMID:26204235

  16. Interaction of Bifidobacterium animalis subspecies lactis (Bb12) and Salmonella typhimurium in continuous-flow chemostatic culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A commercially available probiotic, Bifidobacterium animalis subspecies lactis (Bb12) was adapted to and maintained in a continuous-flow chemostat culture. We evaluated the growth characteristics and in interactive effects of Bb12 and a porcine-derived Salmonella typhimurium (St) when cultivated si...

  17. Oral Vaccination with the Porcine Rotavirus VP4 Outer Capsid Protein Expressed by Lactococcus lactis Induces Specific Antibody Production

    PubMed Central

    Li, Yi-jing; Ma, Guang-peng; Li, Gui-wei; Qiao, Xin-yuan; Ge, Jun-wei; Tang, Li-jie; Liu, Min; Liu, Li-wei

    2010-01-01

    The objective of this study to design a delivery system resistant to the gastrointestinal environment for oral vaccine against porcine rotavirus. Lactococcus lactis NZ9000 was transformed with segments of vP4 of the porcine rotavirus inserted into the pNZ8112 surface-expression vector, and a recombinant L. lactis expressing VP4 protein was constructed. An approximately 27?kDa VP4 protein was confirmed by SDS-PAGE , Western blot and immunostaining analysis. BALB/c mice were immunized orally with VP4-expression recombinant L. lactis and cellular, mucosal and systemic humoral immune responses were examined. Specific anti-VP4 secretory IgA and IgG were found in feces, ophthalmic and vaginal washes and in serum. The induced antibodies demonstrated neutralizing effects on porcine rotavirus infection on MA104 cells. Our findings suggest that oral immunization with VP4-expressing L. lactis induced both specific local and systemic humoral and cellular immune responses in mice. PMID:20625406

  18. Contribution of Lactococcus lactis Reducing Properties to the Downregulation of a Major Virulence Regulator in Staphylococcus aureus, the agr System

    PubMed Central

    Nouaille, Sébastien; Rault, Lucie; Jeanson, Sophie; Loubière, Pascal; Le Loir, Yves

    2014-01-01

    Staphylococcus aureus is a major cause of food poisoning outbreaks associated with dairy products, because of the ingestion of preformed enterotoxins. The biocontrol of S. aureus using lactic acid bacteria (LAB) offers a promising opportunity to fight this pathogen while respecting the product ecosystem. We had previously established the ability of Lactococcus lactis, a lactic acid bacterium widely used in the dairy industry, to downregulate a major staphylococcal virulence regulator, the accessory gene regulator (agr) system, and, as a consequence, agr-controlled enterotoxins. In the present paper, we have shown that the oxygen-independent reducing properties of L. lactis contribute to agr downregulation. Neutralizing lactococcal reduction by adding potassium ferricyanide or maintaining the oxygen pressure constant at 50% released agr downregulation in the presence of L. lactis. This downregulation still occurred in an S. aureus srrA mutant, indicating that the staphylococcal respiratory response regulator SrrAB was not the only component in the signaling pathway. Therefore, this study clearly demonstrates the ability of L. lactis reducing properties to interfere with the expression of S. aureus virulence, thus highlighting this general property of LAB as a lever to control the virulence expression of this major pathogen in a food context and beyond. PMID:25192992

  19. Interaction of Bifidobacterium animalis subspecies lactis (Bb 12) and Salmonella typhimurium in continuous-flow chemostatic culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A commercially available probiotic, Bifidobacterium animalis subspecies lactis (Bb12) was adapted to and maintained in a continuous-flow chemostat culture. We evaluated the growth characteristics and interactive effects of Bb12 and a porcine-derived Salmonella typhimurium (St) when cultivated singly...

  20. Genotypic and Phenotypic Analysis of Dairy Lactococcus lactis Biodiversity in Milk: Volatile Organic Compounds as Discriminating Markers

    PubMed Central

    Dhaisne, Amandine; Guellerin, Maeva; Laroute, Valérie; Laguerre, Sandrine; Le Bourgeois, Pascal; Loubiere, Pascal

    2013-01-01

    The diversity of nine dairy strains of Lactococcus lactis subsp. lactis in fermented milk was investigated by both genotypic and phenotypic analyses. Pulsed-field gel electrophoresis and multilocus sequence typing were used to establish an integrated genotypic classification. This classification was coherent with discrimination of the L. lactis subsp. lactis bv. diacetylactis lineage and reflected clonal complex phylogeny and the uniqueness of the genomes of these strains. To assess phenotypic diversity, 82 variables were selected as important dairy features; they included physiological descriptors and the production of metabolites and volatile organic compounds (VOCs). Principal-component analysis (PCA) demonstrated the phenotypic uniqueness of each of these genetically closely related strains, allowing strain discrimination. A method of variable selection was developed to reduce the time-consuming experimentation. We therefore identified 20 variables, all associated with VOCs, as phenotypic markers allowing discrimination between strain groups. These markers are representative of the three metabolic pathways involved in flavor: lipolysis, proteolysis, and glycolysis. Despite great phenotypic diversity, the strains could be divided into four robust phenotypic clusters based on their metabolic orientations. Inclusion of genotypic diversity in addition to phenotypic characters in the classification led to five clusters rather than four being defined. However, genotypic characters make a smaller contribution than phenotypic variables (no genetic distances selected among the most contributory variables). This work proposes an original method for the phenotypic differentiation of closely related strains in milk and may be the first step toward a predictive classification for the manufacture of starters. PMID:23709512

  1. Versatile vector suite for the extracytoplasmic production and purification of heterologous His-tagged proteins in Lactococcus lactis.

    PubMed

    Neef, Jolanda; Milder, Fin J; Koedijk, Danny G A M; Klaassens, Marindy; Heezius, Erik C; van Strijp, Jos A G; Otto, Andreas; Becher, Dörte; van Dijl, Jan Maarten; Buist, Girbe

    2015-11-01

    Recent studies have shown that the Gram-positive bacterium Lactococcus lactis can be exploited for the expression of heterologous proteins; however, a versatile set of vectors suitable for inducible extracellular protein production and subsequent purification of the expressed proteins by immobilized metal affinity chromatography was so far lacking. Here we describe three novel vectors that, respectively, facilitate the nisin-inducible production of N- or C-terminally hexa-histidine (His6)-tagged proteins in L. lactis. One of these vectors also encodes a tobacco etch virus (TEV) protease cleavage site allowing removal of the N-terminal His6-tag from expressed proteins. Successful application of the developed vectors for protein expression, purification and/or functional studies is exemplified with six different cell wall-bound or secreted proteins from Staphylococcus aureus. The results show that secretory production of S. aureus proteins is affected by the position, N- or C-terminal, of the His6-tag. This seems to be due to an influence of the His6-tag on protein stability. Intriguingly, the S. aureus IsdB protein, which is phosphorylated in S. aureus, was also found to be phosphorylated when heterologously produced in L. lactis, albeit not on the same Tyr residue. This implies that this particular post-translational protein modification is to some extent conserved in S. aureus and L. lactis. Altogether, we are confident that the present vector set combined with the L. lactis expression host has the potential to become a very useful tool in optimization of the expression, purification and functional analysis of extracytoplasmic bacterial proteins. PMID:26160391

  2. Host lysozyme-mediated lysis of Lactococcus lactis facilitates delivery of colitis-attenuating superoxide dismutase to inflamed colons.

    PubMed

    Ballal, Sonia A; Veiga, Patrick; Fenn, Kathrin; Michaud, Monia; Kim, Jason H; Gallini, Carey Ann; Glickman, Jonathan N; Quéré, Gaëlle; Garault, Peggy; Béal, Chloé; Derrien, Muriel; Courtin, Pascal; Kulakauskas, Saulius; Chapot-Chartier, Marie-Pierre; van Hylckama Vlieg, Johan; Garrett, Wendy S

    2015-06-23

    Beneficial microbes that target molecules and pathways, such as oxidative stress, which can negatively affect both host and microbiota, may hold promise as an inflammatory bowel disease therapy. Prior work showed that a five-strain fermented milk product (FMP) improved colitis in T-bet(-/-) Rag2(-/-) mice. By varying the number of strains used in the FMP, we found that Lactococcus lactis I-1631 was sufficient to ameliorate colitis. Using comparative genomic analyses, we identified genes unique to L. lactis I-1631 involved in oxygen respiration. Respiration of oxygen results in reactive oxygen species (ROS) generation. Also, ROS are produced at high levels during intestinal inflammation and cause tissue damage. L. lactis I-1631 possesses genes encoding enzymes that detoxify ROS, such as superoxide dismutase (SodA). Thus, we hypothesized that lactococcal SodA played a role in attenuating colitis. Inactivation of the sodA gene abolished L. lactis I-1631's beneficial effect in the T-bet(-/-) Rag2(-/-) model. Similar effects were obtained in two additional colonic inflammation models, Il10(-/-) mice and dextran sulfate sodium-treated mice. Efforts to understand how a lipophobic superoxide anion (O2 (-)) can be detoxified by cytoplasmic lactoccocal SodA led to the finding that host antimicrobial-mediated lysis is a prerequisite for SodA release and SodA's extracytoplasmic O2 (-) scavenging. L. lactis I-1631 may represent a promising vehicle to deliver antioxidant, colitis-attenuating SodA to the inflamed intestinal mucosa, and host antimicrobials may play a critical role in mediating SodA's bioaccessibility. PMID:26056274

  3. Host lysozyme-mediated lysis of Lactococcus lactis facilitates delivery of colitis-attenuating superoxide dismutase to inflamed colons

    PubMed Central

    Ballal, Sonia A.; Veiga, Patrick; Fenn, Kathrin; Michaud, Monia; Kim, Jason H.; Gallini, Carey Ann; Glickman, Jonathan N.; Quéré, Gaëlle; Garault, Peggy; Béal, Chloé; Derrien, Muriel; Courtin, Pascal; Kulakauskas, Saulius; Chapot-Chartier, Marie-Pierre; van Hylckama Vlieg, Johan; Garrett, Wendy S.

    2015-01-01

    Beneficial microbes that target molecules and pathways, such as oxidative stress, which can negatively affect both host and microbiota, may hold promise as an inflammatory bowel disease therapy. Prior work showed that a five-strain fermented milk product (FMP) improved colitis in T-bet−/− Rag2−/− mice. By varying the number of strains used in the FMP, we found that Lactococcus lactis I-1631 was sufficient to ameliorate colitis. Using comparative genomic analyses, we identified genes unique to L. lactis I-1631 involved in oxygen respiration. Respiration of oxygen results in reactive oxygen species (ROS) generation. Also, ROS are produced at high levels during intestinal inflammation and cause tissue damage. L. lactis I-1631 possesses genes encoding enzymes that detoxify ROS, such as superoxide dismutase (SodA). Thus, we hypothesized that lactococcal SodA played a role in attenuating colitis. Inactivation of the sodA gene abolished L. lactis I-1631’s beneficial effect in the T-bet−/− Rag2−/− model. Similar effects were obtained in two additional colonic inflammation models, Il10−/− mice and dextran sulfate sodium-treated mice. Efforts to understand how a lipophobic superoxide anion (O2−) can be detoxified by cytoplasmic lactoccocal SodA led to the finding that host antimicrobial-mediated lysis is a prerequisite for SodA release and SodA’s extracytoplasmic O2− scavenging. L. lactis I-1631 may represent a promising vehicle to deliver antioxidant, colitis-attenuating SodA to the inflamed intestinal mucosa, and host antimicrobials may play a critical role in mediating SodA’s bioaccessibility. PMID:26056274

  4. Direct Identification of Staphylococcus aureus and Determination of Methicillin Susceptibility From Positive Blood-Culture Bottles in a Bact/ALERT System Using Binax Now S. aureus and PBP2a Tests

    PubMed Central

    Heraud, Sandrine; Freydiere, Anne-Marie; Doleans-Jordheim, Anne; Bes, Michèle; Tristan, Anne; Vandenesch, François; Laurent, Frederic

    2015-01-01

    Staphylococcus aureus bacteremia is associated with high mortality and morbidity, requiring prompt and appropriate antimicrobial treatment. Therefore, it is important to detect methicillin-resistant S. aureus (MRSA) rapidly from blood cultures. Two immunochromatographic tests, BinaxNow S. aureus and BinaxNow PBP2a, were directly applied to 79 Bact/Alert bottles that were positive for Gram positive cocci in cluster aggregations. Sensitivity and specificity for the identification of S. aureus and determination of methicillin resistance were 94% and 87%, and 100% and 100%, respectively, with less than 30 min of performance time. These tests are efficient and rapid; these tests are valuable alternatives to more sophisticated and expensive methods used in the diagnosis of MRSA bacteremia. PMID:26131419

  5. Direct Identification of Staphylococcus aureus and Determination of Methicillin Susceptibility From Positive Blood-Culture Bottles in a Bact/ALERT System Using Binax Now S. aureus and PBP2a Tests.

    PubMed

    Heraud, Sandrine; Freydiere, Anne-Marie; Doleans-Jordheim, Anne; Bes, Michèle; Tristan, Anne; Vandenesch, François; Laurent, Frederic; Dauwalder, Olivier

    2015-07-01

    Staphylococcus aureus bacteremia is associated with high mortality and morbidity, requiring prompt and appropriate antimicrobial treatment. Therefore, it is important to detect methicillin-resistant S. aureus (MRSA) rapidly from blood cultures. Two immunochromatographic tests, BinaxNow S. aureus and BinaxNow PBP2a, were directly applied to 79 Bact/Alert bottles that were positive for Gram positive cocci in cluster aggregations. Sensitivity and specificity for the identification of S. aureus and determination of methicillin resistance were 94% and 87%, and 100% and 100%, respectively, with less than 30 min of performance time. These tests are efficient and rapid; these tests are valuable alternatives to more sophisticated and expensive methods used in the diagnosis of MRSA bacteremia. PMID:26131419

  6. Yeast Kluyveromyces lactis as host for expression of the bacterial lipase: cloning and adaptation of the new lipase gene from Serratia sp.

    PubMed

    Šiekštel?, Rimantas; Veteikyt?, Aušra; Tvaska, Bronius; Matijošyt?, Inga

    2015-10-01

    Many microbial lipases have been successfully expressed in yeasts, but not in industrially attractive Kluyveromyces lactis, which among other benefits can be cultivated on a medium supplemented with whey--cheap and easily available industrial waste. A new bacterial lipase from Serratia sp. was isolated and for the first time expressed into the yeast Kluyveromyces lactis by heterologous protein expression system based on a strong promoter of Kluyveromyces marxianus triosephosphate isomerase gene and signal peptide of Kluyveromyces marxianus endopolygalacturonase gene. In addition, the bacterial lipase gene was synthesized de novo by taking into account a codon usage bias optimal for K. lactis and was expressed into the yeast K. lactis also. Both resulting strains were characterized by high output level of the target protein secreted extracellularly. Secreted lipases were characterized for activity and stability. PMID:26254038

  7. Immunogenicity and immunoprotection of porcine circovirus type 2 (PCV2) Cap protein displayed by Lactococcus lactis.

    PubMed

    Li, Peng-Cheng; Qiao, Xu-Wen; Zheng, Qi-Sheng; Hou, Ji-Bo

    2016-01-27

    The capsid (Cap) protein, an important immunoprotective protein of porcine circovirus type 2 (PCV2), was expressed on the cell surface of the Gram-positive food-grade bacterium, Lactococcus lactis. Cap protein was fused to the peptidoglycan binding domain (known as the protein anchor domain, PA) of the lactococcal AcmA cell-wall hydrolase. The Cap protein fusion was non-covalently rebound to the surface of non-genetically modified, non-living high-binder L. lactis cells (designated Gram-positive enhancer matrix (GEM) particles). Expression of the recombinant GEM-displaying capsid protein (GEM-PA-Cap) was verified by Western blotting and immunofluorescence and transmission electron microscopy assays. To evaluate the immunogenicity of the recombinant Cap protein (rCap), 20 PCV2-seronegative piglets were immunized with the GEM-PA-Cap subunit vaccine, GEM alone, or phosphate-buffered saline (PBS, challenge control and empty control). Each group consisted of five piglets. The results showed that the level of PCV2-specific antibodies in piglets immunized with the GEM-PA-Cap subunit vaccine was significantly higher than that of the piglets immunized with GEM alone or the control group at all the time points post-vaccination (P<0.01). After challenge with the PCV2 wild-type strain, piglets that received the GEM-PA-Cap subunit vaccine showed significantly higher average daily weight gain (DWG) and shorter fever duration than the other two groups (P<0.001). Furthermore, a significant reduction in the gross lung lesion scores and lymph node lesion scores was noted in the GEM-PA-Cap-immunized group compared with the scores of the GEM or PBS-treated group (P<0.01). The results suggest that recombinant rCap displayed by L. lactis GEM particles provided the piglets with significant immunoprotection from PCV2-associated disease. Thus, the novel GEM-PA-Cap subunit vaccine has potential to be considered an effective and safe candidate vaccine against PCV2 infection in piglets. PMID:26372858

  8. RNA-Seq reveals transcriptomic interactions of Bacillus subtilis natto and Bifidobacterium animalis subsp. lactis in whole soybean solid-state co-fermentation.

    PubMed

    Wang, Hai Kuan; Ng, Yi Kai; Koh, Eileen; Yao, Lina; Chien, Ang Sze; Lin, Hui Xin; Lee, Yuan Kun

    2015-10-01

    Bifidobacteria are anaerobes and are difficult to culture in conventional fermentation system. It was observed that Bacillus subtilis natto enhanced growth of Bifidobacterium animalis subsp. lactis v9 by about 3-fold in a whole soybean solid-state co-fermentation, in a non-anaerobic condition. For the purpose of understanding the metabolic interactions between Bif. animalis subsp. lactis v9 and Ba. subtilis natto, the transcriptome of Bif. animalis subsp. lactis v9 and Ba. subtilis natto was analyzed in single and mixed cultures using RNA-Seq. Compared with the single culture, 459 genes of Bif. animalis subsp. lactis v9 were up regulated and 21 were down regulated in the mixed culture with Ba. subtilis natto, with more than 2-fold difference. Predictive metagenomic analyses suggested that Ba. subtilis natto up regulated transport functions, complex carbohydrates and amino acid metabolism, DNA repair, oxydative stress-related functions, and cell growth of Bif. animalis subsp. lactis v9. In the mixed culture with Bif. animalis subsp. lactis v9, only 3 transcripts of Ba. subtilis natto were over-expressed and 3115 were under-expressed with more than 2-fold difference. The highest down-regulated genes were those involved in carbohydrate and amino acid metabolism. The data presented here demonstrated a parasitic-like interaction regulated at the transcription level, between Ba. subtilis natto and Bif. animalis subsp. lactis in the mixed culture. The over-expression of genes involved in substrate uptake and metabolism in Bif. animalis subsp. lactis in the mixed culture nevertheless, led to its higher cell concentration in the nutrient rich whole soybean medium. PMID:26187824

  9. Selection of a Bifidobacterium animalis subsp. lactis Strain with a Decreased Ability To Produce Acetic Acid

    PubMed Central

    Margolles, Abelardo

    2012-01-01

    We have characterized a new strain, Bifidobacterium animalis subsp. lactis CECT 7953, obtained by random UV mutagenesis, which produces less acetic acid than the wild type (CECT 7954) in three different experimental settings: De Man-Rogosa-Sharpe broth without sodium acetate, resting cells, and skim milk. Genome sequencing revealed a single Phe-Ser substitution in the acetate kinase gene product that seems to be responsible for the strain's reduced acid production. Accordingly, acetate kinase specific activity was lower in the low acetate producer. Strain CECT 7953 produced less acetate, less ethanol, and more yoghourt-related volatile compounds in skim milk than the wild type did. Thus, CECT 7953 shows promising potential for the development of dairy products fermented exclusively by a bifidobacterial strain. PMID:22389372

  10. Neuro-fuzzy based model of batch fermentation of Kluyveromyces marxianus var. lactis MC5

    PubMed Central

    Ilkova, Tatiana; Petrov, Mitko

    2014-01-01

    In this work a neuro-fuzzy based model of a whey batch fermentation process by a strain Kluyveromyces marxianus var. lactis MC5 is presented. A three-layered neuro-fuzzy network is realized. The simulation results are compared with conventional models (based on mass balance and differential equations). The neuro-fuzzy model provides a better fitness and allows inclusion of linguistic variables (such as colour, smell, taste, morphophysiology, etc.). The accuracy is approximately equal to this achieved by a conventional neural network. The proposed approach is flexible (with regard to the process model) and quite robust (with regard to the possible uncertainties and to the optimization surface). Future work will focus on applying this approach for modelling of different biotechnological processes. PMID:26019585

  11. Lactococcus lactis SpOx Spontaneous Mutants: a Family of Oxidative-Stress-Resistant Dairy Strains§

    PubMed Central

    Rochat, Tatiana; Gratadoux, Jean-Jacques; Corthier, Gérard; Coqueran, Bérard; Nader-Macias, Maria-Elena; Gruss, Alexandra; Langella, Philippe

    2005-01-01

    Numerous industrial bacteria generate hydrogen peroxide (H2O2), which may inhibit the growth of other bacteria in mixed ecosystems. We isolated spontaneous oxidative-stress-resistant (SpOx) Lactococcus lactis mutants by using a natural selection method with milk-adapted strains on dairy culture medium containing H2O2. Three SpOx mutants displayed greater H2O2 resistance. One of them, SpOx3, demonstrated better behavior in different oxidative-stress situations: (i) higher long-term survival upon aeration in LM17 and milk and (ii) the ability to grow with H2O2-producing Lactobacillus delbrueckii subsp. delbrueckii strains. Furthermore, the transit kinetics of the SpOx3 mutant in the digestive tract of a human flora-associated mouse model was not affected. PMID:15870374

  12. Evolution of a Lytic Bacteriophage via DNA Acquisition from the Lactococcus lactis Chromosome †

    PubMed Central

    Moineau, Sylvain; Pandian, Sithian; Klaenhammer, Todd R.

    1994-01-01

    We discovered a phage-host interaction in which the lytic phage ul36, in response to pressure exerted by an abortive phage resistance mechanism, acquired a large DNA fragment from the chromosome of Lactococcus lactis NCK203 to form a new phage, ul37. Phage ul37 was characterized at morphological, phenotypic, and genotypic levels and was found to be a member of the P335 species. Although it exhibits a high level of DNA homology with ul36, phage ul37 is resistant to the abortive mechanism and has a longer tail, a different base plate, and apparently a different origin of replication. The chromosomal DNA implicated in the formation of new phage ul37 was disrupted by site-specific integration in NCK203. This strategy prevented the appearance of ul37 during subsequent infections with ul36. Images PMID:16349277

  13. Intracellular production of IFN-alpha 2b in Lactococcus lactis.

    PubMed

    Bayat, Omid; Baradaran, Ali; Ariff, Arbakariya; Mohamad, Rosfarizan; Rahim, Raha Abdul

    2014-03-01

    Human interferon alpha (IFN-?) was expressed in two strains of Lactococcus lactis by aid of two promoters (P32 and Pnis) giving rise to two recombinant strains: MG:IFN and NZ:IFN, respectively. The expression of IFN was confirmed by ELISA and western blotting. Highest production was achieved using glucose for growth of both recombinant strains with nisin, used for induction of the recombinant strain with Pnis promoter, at 30 ng/ml. The optimum time for MG:IFN was 9 h and for NZ:IFN was 4.5 h. The highest productions by MG:IFN and NZ:IFN were 1.9 and 2.4 ?g IFN/l, respectively. Both of the expressed IFNs showed bioactivities of 1.9 × 10(6) IU/mg that were acceptable for further clinical studies. PMID:24185903

  14. Decreased susceptibility to antifungals in respiratory-deficient Kluyveromyces lactis mutants.

    PubMed

    Sarinová, M; Straková, V; Balková, K; Gbelská, Y

    2007-01-01

    Decreased susceptibility of K. lactis mutants impaired in the function of cytochrome c, cytochrome c1 and cytochrome-c oxidase to fluconazole, bifonazole and amphotericin B in comparison with the isogenic wild-type strain was observed. Flow cytometry with rhodamine 6G did not show any changes in the accumulation of the dye in the mutant cells compared with the corresponding wild-type strain. Sterol analysis showed similar overall amount of sterols in both wild-type and mutant cells. Taking into account the increased amphotericin B resistance and significantly diminished susceptibility of mutant cells to lyticase digestion, the cell wall structure and/or composition may probably be responsible for the observed changes in the susceptibility of mutants to the antifungal compounds used. PMID:18298045

  15. Genetic structure and transcriptional analysis of the arginine deiminase (ADI) cluster in Lactococcus lactis MG1363.

    PubMed

    Budin-Verneuil, Aurélie; Maguin, Emmanuelle; Auffray, Yanick; Ehrlich, Dusko S; Pichereau, Vianney

    2006-07-01

    In a recent proteomic analysis, we showed the overproduction of the ArcA and ArcB proteins in Lactococcus lactis MG1363 at low pH. The corresponding genes belong to the arcABD1C1C2TD2 cluster that encodes components of the arginine deiminase pathway. In this study, we characterized this cluster at the genetic level. Northern blot experiments showed the expression of at least seven transcripts, all induced by acidity. Transcript analysis using 5'RACE PCR (rapid amplification of cDNA ends polymerase chain reaction) in the arcB-arcD1 intergenic region. In silico analysis identified nine stem-loop structures, all located in intergenic regions. Collectively, these data suggest a role for RNA processing and (or) premature termination in the differential expression of genes within the arcABD1C1C2TD2 cluster. PMID:16917516

  16. Zinc uptake, oxidative stress and the FNR-like proteins of Lactococcus lactis.

    PubMed

    Scott, C; Rawsthorne, H; Upadhyay, M; Shearman, C A; Gasson, M J; Guest, J R; Green, J

    2000-11-01

    Lactococcus lactis ssp. cremoris MG1363 contains two FNR homologues, FlpA and FlpB, encoded by the distal genes of two paralogous operons (orfX(A/B)-orfY(A/B)-flpA/B). An flpA flpB double mutant strain is hypersensitive to hydrogen peroxide and has a depleted intracellular Zn(II) pool. The phenotypes of the flp mutant strains suggest that FlpA and FlpB control the expression of high and low affinity ATP-dependent Zn(II) uptake systems, respectively. Plate tests revealed that expression from a orfX(B)::lac reporter was activated by Cd(II), consistent with other Zn(II)-regulated systems. The link between a failure to acquire Zn(II) and hypersensitivity to oxidative stress suggests that Zn(II) may be required to protect vulnerable protein thiols from oxidation. PMID:11040433

  17. Computational analysis of the interaction between transcription factors and the predicted secreted proteome of the yeast Kluyveromyces lactis

    PubMed Central

    Brustolini, Otávio JB; Fietto, Luciano G; Cruz, Cosme D; Passos, Flávia ML

    2009-01-01

    Background Protein secretion is a cell translocation process of major biological and technological significance. The secretion and downstream processing of proteins by recombinant cells is of great commercial interest. The yeast Kluyveromyces lactis is considered a promising host for heterologous protein production. Because yeasts naturally do not secrete as many proteins as filamentous fungi, they can produce secreted recombinant proteins with few contaminants in the medium. An ideal system to address the secretion of a desired protein could be exploited among the native proteins in certain physiological conditions. By applying algorithms to the completed K. lactis genome sequence, such a system could be selected. To this end, we predicted protein subcellular locations and correlated the resulting extracellular secretome with the transcription factors that modulate the cellular response to a particular environmental stimulus. Results To explore the potential Kluyveromyces lactis extracellular secretome, four computational prediction algorithms were applied to 5076 predicted K. lactis proteins from the genome database. SignalP v3 identified 418 proteins with N-terminal signal peptides. From these 418 proteins, the Phobius algorithm predicted that 176 proteins have no transmembrane domains, and the big-PI Predictor identified 150 proteins as having no glycosylphosphatidylinositol (GPI) modification sites. WoLF PSORT predicted that the K. lactis secretome consists of 109 putative proteins, excluding subcellular targeting. The transcription regulators of the putative extracellular proteins were investigated by searching for DNA binding sites in their putative promoters. The conditions to favor expression were obtained by searching Gene Ontology terms and using graph theory. Conclusion A public database of K. lactis secreted proteins and their transcription factors are presented. It consists of 109 ORFs and 23 transcription factors. A graph created from this database shows 134 nodes and 884 edges, suggesting a vast number of relationships to be validated experimentally. Most of the transcription factors are related to responses to stress such as drug, acid and heat resistance, as well as nitrogen limitation, and may be useful for inducing maximal expression of potential extracellular proteins. PMID:19555482

  18. Molecular Insights on the Recognition of a Lactococcus lactis Cell Wall Pellicle by the Phage 1358 Receptor Binding Protein

    PubMed Central

    Farenc, Carine; Spinelli, Silvia; Vinogradov, Evgeny; Tremblay, Denise; Blangy, Stéphanie; Sadovskaya, Irina

    2014-01-01

    ABSTRACT The Gram-positive bacterium Lactococcus lactis is used for the production of cheeses and other fermented dairy products. Accidental infection of L. lactis cells by virulent lactococcal tailed phages is one of the major risks of fermentation failures in industrial dairy factories. Lactococcal phage 1358 possesses a host range limited to a few L. lactis strains and strong genomic similarities to Listeria phages. We report here the X-ray structures of phage 1358 receptor binding protein (RBP) in complex with monosaccharides. Each monomer of its trimeric RBP is formed of two domains: a “shoulder” domain linking the RBP to the rest of the phage and a jelly roll fold “head/host recognition” domain. This domain harbors a saccharide binding crevice located in the middle of a monomer. Crystal structures identified two sites at the RBP surface, ?8 ? from each other, one accommodating a GlcNAc monosaccharide and the other accommodating a GlcNAc or a glucose 1-phosphate (Glc1P) monosaccharide. GlcNAc and GlcNAc1P are components of the polysaccharide pellicle that we identified at the cell surface of L. lactis SMQ-388, the host of phage 1358. We therefore modeled a galactofuranose (Galf) sugar bridging the two GlcNAc saccharides, suggesting that the trisaccharidic motif GlcNAc-Galf-GlcNAc (or Glc1P) might be common to receptors of genetically distinct lactococcal phages p2, TP091-1, and 1358. Strain specificity might therefore be elicited by steric clashes induced by the remaining components of the pellicle hexasaccharide. Taken together, these results provide a first insight into the molecular mechanism of host receptor recognition by lactococcal phages. IMPORTANCE Siphophages infecting the Gram-positive bacterium Lactococcus lactis are sources of milk fermentation failures in the dairy industry. We report here the structure of the pellicle polysaccharide from L. lactis SMQ-388, the specific host strain of phage 1358. We determined the X-ray structures of the lytic lactococcal phage 1358 receptor binding protein (RBP) in complex with monosaccharides. The positions and nature of monosaccharides bound to the RBP are in agreement with the pellicle structure and suggest a general binding mode of lactococcal phages to their pellicle saccharidic receptor. PMID:24719416

  19. Lactococcus lactis as an adjuvant and delivery vehicle of antigens against pneumococcal respiratory infections

    PubMed Central

    Vintiñi, Elisa; Villena, Julio; Raya, Raul

    2010-01-01

    Most studies of Lactococcus lactis as delivery vehicles of pneumococcal antigens are focused on the effectiveness of mucosal recombinant vaccines against Streptococcus pneumoniae in animal models. At present, there are three types of pneumococcal vaccines: capsular polysaccharide pneumococcal vaccines (PPV), protein-polysaccharide conjugate pneumococcal vaccines (PCV) and protein-based pneumococcal vaccines (PBPV). Only PPV and PCV have been licensed. These vaccines, however, do not represent a definitive solution. Novel, safe and inexpensive vaccines are necessary, especially in developing countries. Probiotic microorganisms such as lactic acid bacteria (LAB) are an interesting alternative for their use as vehicles in pneumococcal vaccines due to their GRAS (Generally Recognized As Safe) status. Thus, the adjuvanticity of Lactococcus lactis by itself represents added value over the use of other bacteria, a question dealt with in this review. In addition, the expression of different pneumococcal antigens as well as the use of oral and nasal mucosal routes of administration of lactococcal vaccines is considered. The advantages of nasal live vaccines are evident; nonetheless, oral vaccines can be a good alternative when the adequate dose is used. Another point addressed here is the use of live versus inactivated vaccines. In this sense, few researchers have focused on inactivated strains to be used as vaccines against pneumoccoccus. The immunogenicity of live vaccines is better than the one afforded by inactivated ones; however, the probiotic-inactivated vaccine combination has improved this matter considerably. The progress made so far in the protective immune response induced by recombinant vaccines, the successful trials in animal models and the safety considerations of their application in humans suggest that the use of recombinant vaccines represents a good short-term option in the control of pneumococcal diseases. PMID:21326831

  20. Genetic and Physiological Responses of Bifidobacterium animalis subsp. lactis to Hydrogen Peroxide Stress

    PubMed Central

    Oberg, Taylor S.; Ward, Robert E.; Steele, James L.

    2013-01-01

    Consumer interest in probiotic bifidobacteria is increasing, but industry efforts to secure high cell viability in foods is undermined by these anaerobes' sensitivity to oxidative stress. To address this limitation, we investigated genetic and physiological responses of two fully sequenced Bifidobacterium animalis subsp. lactis strains, BL-04 and DSM 10140, to hydrogen peroxide (H2O2) stress. Although the genome sequences for these strains are highly clonal, prior work showed that they differ in both intrinsic and inducible H2O2 resistance. Transcriptome analysis of early-stationary-phase cells exposed to a sublethal H2O2 concentration detected significant (P < 0.05) changes in expression of 138 genes in strain BL-04 after 5 min and 27 genes after 20 min. Surprisingly, no significant changes in gene expression were detected in DSM 10140 at either time. Genomic data suggested that differences in H2O2 stress resistance might be due to a mutation in a BL-04 gene encoding long-chain fatty acid coenzyme A (CoA) ligase. To explore this possibility, membrane fatty acids were isolated and analyzed by gas chromatography-mass spectrometry (GC-MS). Results confirmed that the strains had significantly different lipid profiles: the BL-04 membrane contained higher percentages of C14:0 and C16:0 and lower percentages of C18:1n9. Alteration of the DSM 10140 membrane lipid composition using modified growth medium to more closely mimic that of BL-04 yielded cells that showed increased intrinsic resistance to lethal H2O2 challenge but did not display an inducible H2O2 stress response. The results show that deliberate stress induction or membrane lipid modification can be employed to significantly improve H2O2 resistance in B. animalis subsp. lactis strains. PMID:23772066

  1. Lactococcus lactis as an adjuvant and delivery vehicle of antigens against pneumococcal respiratory infections.

    PubMed

    Medina, Marcela; Vintiñi, Elisa; Villena, Julio; Raya, Raul; Alvarez, Susana

    2010-01-01

    Most studies of Lactococcus lactis as delivery vehicles of pneumococcal antigens are focused on the effectiveness of mucosal recombinant vaccines against Streptococcus pneumoniae in animal models. At present, there are three types of pneumococcal vaccines: capsular polysaccharide pneumococcal vaccines (PPV), protein-polysaccharide conjugate pneumococcal vaccines (PCV) and protein-based pneumococcal vaccines (PBPV). Only PPV and PCV have been licensed. These vaccines, however, do not represent a definitive solution. Novel, safe and inexpensive vaccines are necessary, especially in developing countries. Probiotic microorganisms such as lactic acid bacteria (LAB) are an interesting alternative for their use as vehicles in pneumococcal vaccines due to their GRAS (Generally Recognized As Safe) status. Thus, the adjuvanticity of Lactococcus lactis by itself represents added value over the use of other bacteria, a question dealt with in this review. In addition, the expression of different pneumococcal antigens as well as the use of oral and nasal mucosal routes of administration of lactococcal vaccines is considered. The advantages of nasal live vaccines are evident; nonetheless, oral vaccines can be a good alternative when the adequate dose is used. Another point addressed here is the use of live versus inactivated vaccines. In this sense, few researchers have focused on inactivated strains to be used as vaccines against pneumoccoccus. The immunogenicity of live vaccines is better than the one afforded by inactivated ones; however, the probiotic-inactivated vaccine combination has improved this matter considerably. The progress made so far in the protective immune response induced by recombinant vaccines, the successful trials in animal models and the safety considerations of their application in humans suggest that the use of recombinant vaccines represents a good short-term option in the control of pneumococcal diseases. PMID:21326831

  2. Pilus Biogenesis in Lactococcus lactis: Molecular Characterization and Role in Aggregation and Biofilm Formation

    PubMed Central

    Oxaran, Virginie; Ledue-Clier, Florence; Dieye, Yakhya; Herry, Jean-Marie; Péchoux, Christine; Meylheuc, Thierry; Briandet, Romain; Juillard, Vincent; Piard, Jean-Christophe

    2012-01-01

    The genome of Lactococcus lactis strain IL1403 harbors a putative pilus biogenesis cluster consisting of a sortase C gene flanked by 3 LPxTG protein encoding genes (yhgD, yhgE, and yhhB), called here pil. However, pili were not detected under standard growth conditions. Over-expression of the pil operon resulted in production and display of pili on the surface of lactococci. Functional analysis of the pilus biogenesis machinery indicated that the pilus shaft is formed by oligomers of the YhgE pilin, that the pilus cap is formed by the YhgD pilin and that YhhB is the basal pilin allowing the tethering of the pilus fibers to the cell wall. Oligomerization of pilin subunits was catalyzed by sortase C while anchoring of pili to the cell wall was mediated by sortase A. Piliated L. lactis cells exhibited an auto-aggregation phenotype in liquid cultures, which was attributed to the polymerization of major pilin, YhgE. The piliated lactococci formed thicker, more aerial biofilms compared to those produced by non-piliated bacteria. This phenotype was attributed to oligomers of YhgE. This study provides the first dissection of the pilus biogenesis machinery in a non-pathogenic Gram-positive bacterium. Analysis of natural lactococci isolates from clinical and vegetal environments showed pili production under standard growth conditions. The identification of functional pili in lactococci suggests that the changes they promote in aggregation and biofilm formation may be important for the natural lifestyle as well as for applications in which these bacteria are used. PMID:23236417

  3. Effect of Exopolysaccharides on Phage-Host Interactions in Lactococcus lactis

    PubMed Central

    Deveau, Hélène; Van Calsteren, Marie-Rose; Moineau, Sylvain

    2002-01-01

    In this study, we report that Lactococcus lactis strains producing exopolysaccharides (EPS) are sensitive to virulent phages. Eight distinct lytic phages (Q61 to Q68) specifically infecting Eps+ strains were isolated in 47 buttermilk samples obtained from 13 North American factories. The eight phages were classified within the 936 species by the multiplex PCR method, indicating that these phages are not fundamentally distinct from those infecting Eps− L. lactis strains. The host range of these phages was determined with 19 Lactococcus strains, including 7 Eps+ and 12 Eps− cultures. Three phages (Q62, Q63, and Q64) attacked only the Eps+ strain SMQ-419, whereas the five other phages (Q61, Q65, Q66, Q67, and Q68) infected only the Eps+ strain SMQ-420. The five other Eps+ strains (H414, MLT2, MLT3, SMQ-461, and SMQ-575) as well as the 12 Eps− strains were insensitive to these phages. The monosaccharide composition of the polymer produced by the seven Eps+ strains was determined. The EPS produced by strains MLT3, SMQ-419, and SMQ-575 contained glucose, galactose, and rhamnose. The EPS fabricated by H414 contained only galactose. The EPS made by MLT2, SMQ-420, and SMQ-461 contained glucose and galactose. These findings indicate that the sugar composition of the EPS has no effect on phage sensitivity. The plasmid encoding the eps operon was cured from the two phage-sensitive strains. The cured derivatives were still phage sensitive, which indicates that EPS are not necessary for phage infection. Phage adsorption assays showed that the production of EPS does not confer a significant phage resistance phenotype. PMID:12200288

  4. Regulation of nisin biosynthesis and immunity in Lactococcus lactis 6F3.

    PubMed Central

    Engelke, G; Gutowski-Eckel, Z; Kiesau, P; Siegers, K; Hammelmann, M; Entian, K D

    1994-01-01

    The biosynthetic genes of the nisin-producing strain Lactococcus lactis 6F3 are organized in an operon-like structure starting with the structural gene nisA followed by the genes nisB, nisT, and nisC, which are probably involved in chemical modification and secretion of the prepeptide (G. Engelke, Z. Gutowski-Eckel, M. Hammelmann, and K.-D. Entian, Appl. Environ. Microbiol. 58:3730-3743, 1992). Subcloning of an adjacent 5-kb downstream region revealed additional genes involved in nisin biosynthesis. The gene nisI, which encodes a lipoprotein, causes increased immunity after its transformation into nisin-sensitive L. lactis MG1614. It is followed by the gene nisP, coding for a subtilisin-like serine protease possibly involved in processing of the secreted leader peptide. Adjacent to the 3' end of nisP the genes nisR and nisK were identified, coding for a regulatory protein and a histidine kinase, showing marked similarities to members of the OmpR/EnvZ-like subgroup of two-component regulatory systems. The deduced amino acid sequences of nisR and nisK exhibit marked similarities to SpaR and SpaK, which were recently identified as the response regulator and the corresponding histidine kinase of subtilin biosynthesis. By using antibodies directed against the nisin prepeptide and the NisB protein, respectively, we could show that nisin biosynthesis is regulated by the expression of its structural and biosynthetic genes. Prenisin expression starts in the exponential growth phase and precedes that of the NisB protein by approximately 30 min. Both proteins are expressed to a maximum in the stationary growth phase. Images PMID:8161176

  5. How recombinant swollenin from Kluyveromyces lactis affects cellulosic substrates and accelerates their hydrolysis

    PubMed Central

    2011-01-01

    Background In order to generate biofuels, insoluble cellulosic substrates are pretreated and subsequently hydrolyzed with cellulases. One way to pretreat cellulose in a safe and environmentally friendly manner is to apply, under mild conditions, non-hydrolyzing proteins such as swollenin - naturally produced in low yields by the fungus Trichoderma reesei. To yield sufficient swollenin for industrial applications, the first aim of this study is to present a new way of producing recombinant swollenin. The main objective is to show how swollenin quantitatively affects relevant physical properties of cellulosic substrates and how it affects subsequent hydrolysis. Results After expression in the yeast Kluyveromyces lactis, the resulting swollenin was purified. The adsorption parameters of the recombinant swollenin onto cellulose were quantified for the first time and were comparable to those of individual cellulases from T. reesei. Four different insoluble cellulosic substrates were then pretreated with swollenin. At first, it could be qualitatively shown by macroscopic evaluation and microscopy that swollenin caused deagglomeration of bigger cellulose agglomerates as well as dispersion of cellulose microfibrils (amorphogenesis). Afterwards, the effects of swollenin on cellulose particle size, maximum cellulase adsorption and cellulose crystallinity were quantified. The pretreatment with swollenin resulted in a significant decrease in particle size of the cellulosic substrates as well as in their crystallinity, thereby substantially increasing maximum cellulase adsorption onto these substrates. Subsequently, the pretreated cellulosic substrates were hydrolyzed with cellulases. Here, pretreatment of cellulosic substrates with swollenin, even in non-saturating concentrations, significantly accelerated the hydrolysis. By correlating particle size and crystallinity of the cellulosic substrates with initial hydrolysis rates, it could be shown that the swollenin-induced reduction in particle size and crystallinity resulted in high cellulose hydrolysis rates. Conclusions Recombinant swollenin can be easily produced with the robust yeast K. lactis. Moreover, swollenin induces deagglomeration of cellulose agglomerates as well as amorphogenesis (decrystallization). For the first time, this study quantifies and elucidates in detail how swollenin affects different cellulosic substrates and their hydrolysis. PMID:21943248

  6. Continuous D-lactic acid production by a novel thermotolerant Lactobacillus delbrueckii subsp. lactis QU 41.

    PubMed

    Tashiro, Yukihiro; Kaneko, Wataru; Sun, Yanqi; Shibata, Keisuke; Inokuma, Kentaro; Zendo, Takeshi; Sonomoto, Kenji

    2011-03-01

    We isolated and characterized a D-lactic acid-producing lactic acid bacterium (D-LAB), identified as Lactobacillus delbrueckii subsp. lactis QU 41. When compared to Lactobacillus coryniformis subsp. torquens JCM 1166?(T) and L. delbrueckii subsp. lactis JCM 1248?(T), which are also known as D-LAB, the QU 41 strain exhibited a high thermotolerance and produced D-lactic acid at temperatures of 50 °C and higher. In order to optimize the culture conditions of the QU 41 strain, we examined the effects of pH control, temperature, neutralizing reagent, and initial glucose concentration on D-lactic acid production in batch cultures. It was found that the optimal production of 20.1 g/l D-lactic acid was acquired with high optical purity (>99.9% of D-lactic acid) in a pH 6.0-controlled batch culture, by adding ammonium hydroxide as a neutralizing reagent, at 43 °C in MRS medium containing 20 g/l glucose. As a result of product inhibition and low cell density, continuous cultures were investigated using a microfiltration membrane module to recycle flow-through cells in order to improve D-lactic acid productivity. At a dilution rate of 0.87 h(-1), the high cell density continuous culture exhibited the highest D-lactic acid productivity of 18.0 g/l/h with a high yield (ca. 1.0 g/g consumed glucose) and a low residual glucose (<0.1 g/l) in comparison with systems published to date. PMID:21165615

  7. Near infrared spectroscopy coupled with radial basis function neural network for at-line monitoring of Lactococcus lactis subsp. fermentation

    PubMed Central

    Liu, Yan; Lu, Chengyu; Meng, Qingfan; Lu, Jiahui; Fu, Yao; Liu, Botong; Zhou, Yongcan; Guo, Weiliang; Teng, Lesheng

    2015-01-01

    In our previous work, partial least squares (PLSs) were employed to develop the near infrared spectroscopy (NIRs) models for at-line (fast off-line) monitoring key parameters of Lactococcus lactis subsp. fermentation. In this study, radial basis function neural network (RBFNN) as a non-linear modeling method was investigated to develop NIRs models instead of PLS. A method named moving window radial basis function neural network (MWRBFNN) was applied to select the characteristic wavelength variables by using the degree approximation (Da) as criterion. Next, the RBFNN models with selected wavelength variables were optimized by selecting a suitable constant spread. Finally, the effective spectra pretreatment methods were selected by comparing the robustness of the optimum RBFNN models developed with pretreated spectra. The results demonstrated that the robustness of the optimal RBFNN models were better than the PLS models for at-line monitoring of glucose and pH of L. lactis subsp. fermentation. PMID:26858554

  8. Milk fermented with a 15-lipoxygenase-1-producing Lactococcus lactis alleviates symptoms of colitis in a murine model.

    PubMed

    Saraiva, Tessalia D L; Morais, Katia; Pereira, Vanessa B; de Azevedo, Marcela; Rocha, Clarissa S; Prosperi, Camila C; Gomes-Santos, Ana C; Bermudez-Humaran, Luis; Faria, Ana M C; Blottiere, Herve M; Langella, Philippe; Miyoshi, Anderson; de LeBlanc, Alejandra de Moreno; LeBlanc, Jean G; Azevedo, Vasco

    2015-01-01

    Inflammatory bowel diseases (IBD), such as Crohn's disease and ulcerative colitis, is characterized by extensive inflammation due to dysregulation of the innate and adaptive immune system whose exact etiology is not yet completely understood. Currently there is no cure for IBD, thus the search for new molecules capable of controlling IBD and their delivery to the site of inflammation are the goal of many researchers. The aim of this work was to evaluate the anti-inflammatory effect of the administration of milks fermented by a Lactococcus (L.) lactis strain producing 15-lipoxygenase-1 (15-LOX-1) using a trinitrobenzenesulfonic acid-induced IBD mouse model. The results obtained demonstrated that 15-LOX-1 producing L. lactis was effective in the prevention of the intestinal damage associated to inflammatory bowel disease in a murine model. The work also confirmed previous studies showing that fermented milk is an effective form of administration of recombinant lactic acid bacteria expressing beneficial molecules. PMID:25395213

  9. Enolase and Glycolytic Flux Play a Role in the Regulation of the Glucose Permease Gene RAG1 of Kluyveromyces lactis

    PubMed Central

    Lemaire, Marc; Wésolowski-Louvel, Micheline

    2004-01-01

    We isolated a mutant, rag17, which is impaired in glucose induction of expression of the major glucose transporter gene RAG1. The RAG17 gene encodes a protein 87% identical to S. cerevisiae enolases (Eno1 and Eno2). The Kleno null mutant showed no detectable enolase enzymatic activity and has severe growth defects on glucose and gluconeogenic carbon sources, indicating that K. lactis has a single enolase gene. In addition to RAG1, the transcription of several glycolytic genes was also strongly reduced in the ?Kleno mutant. Moreover, the defect in RAG1 expression was observed in other mutants of the glycolytic pathway (hexokinase and phosphoglycerate kinase). Therefore, it seems that the enolase and a functional glycolytic flux are necessary for induction of expression of the Rag1 glucose permease in K. lactis. PMID:15514048

  10. Intracellular and Extracellular Expression of Bacillus thuringiensis Crystal Protein Cry5B in Lactococcus lactis for Use as an Anthelminthic.

    PubMed

    Durmaz, Evelyn; Hu, Yan; Aroian, Raffi V; Klaenhammer, Todd R

    2015-01-01

    The Bacillus thuringiensis crystal (Cry) protein Cry5B (140 kDa) and a truncated version of the protein, tCry5B (79 kDa), are lethal to nematodes. Genes encoding the two proteins were separately cloned into a high-copy-number vector with a strong constitutive promoter (pTRK593) in Lactococcus lactis for potential oral delivery against parasitic nematode infections. Western blots using a Cry5B-specific antibody revealed that constitutively expressed Cry5B and tCry5B were present in both cells and supernatants. To increase production, cry5B was cloned into the high-copy-number plasmid pMSP3535H3, carrying a nisin-inducible promoter. Immunoblotting revealed that 3 h after nisin induction, intracellular Cry5B was strongly induced at 200 ng/ml nisin, without adversely affecting cell viability or cell membrane integrity. Both Cry5B genes were also cloned into plasmid pTRK1061, carrying a promoter and encoding a transcriptional activator that invoke low-level expression of prophage holin and lysin genes in Lactococcus lysogens, resulting in a leaky phenotype. Cry5B and tCry5B were actively expressed in the lysogenic strain L. lactis KP1 and released into cell supernatants without affecting culture growth. Lactate dehydrogenase (LDH) assays indicated that Cry5B, but not LDH, leaked from the bacteria. Lastly, using intracellular lysates from L. lactis cultures expressing both Cry5B and tCry5B, in vivo challenges of Caenorhabditis elegans worms demonstrated that the Cry proteins were biologically active. Taken together, these results indicate that active Cry5B proteins can be expressed intracellularly in and released extracellularly from L. lactis, showing potential for future use as an anthelminthic that could be delivered orally in a food-grade microbe. PMID:26682852

  11. Unraveling the role of surface mucus-binding protein and pili in muco-adhesion of Lactococcus lactis.

    PubMed

    Le, Doan Thanh Lam; Tran, Thi-Ly; Duviau, Marie-Pierre; Meyrand, Mickael; Guérardel, Yann; Castelain, Mickaël; Loubière, Pascal; Chapot-Chartier, Marie-Pierre; Dague, Etienne; Mercier-Bonin, Muriel

    2013-01-01

    Adhesion of bacteria to mucus may favor their persistence within the gut and their beneficial effects to the host. Interactions between pig gastric mucin (PGM) and a natural isolate of Lactococcus lactis (TIL448) were measured at the single-cell scale and under static conditions, using atomic force microscopy (AFM). In parallel, these interactions were monitored at the bacterial population level and under shear flow. AFM experiments with a L. lactis cell-probe and a PGM-coated surface revealed a high proportion of specific adhesive events (60%) and a low level of non-adhesive ones (2%). The strain muco-adhesive properties were confirmed by the weak detachment of bacteria from the PGM-coated surface under shear flow. In AFM, rupture events were detected at short (100-200 nm) and long distances (up to 600-800 nm). AFM measurements on pili and mucus-binding protein defective mutants demonstrated the comparable role played by these two surface proteinaceous components in adhesion to PGM under static conditions. Under shear flow, a more important contribution of the mucus-binding protein than the pili one was observed. Both methods differ by the way of probing the adhesion force, i.e. negative force contact vs. sedimentation and normal-to-substratum retraction vs. tangential detachment conditions, using AFM and flow chamber, respectively. AFM blocking assays with free PGM or O-glycan fractions purified from PGM demonstrated that neutral oligosaccharides played a major role in adhesion of L. lactis TIL448 to PGM. This study dissects L. lactis muco-adhesive phenotype, in relation with the nature of the bacterial surface determinants. PMID:24260308

  12. Unraveling the Role of Surface Mucus-Binding Protein and Pili in Muco-Adhesion of Lactococcus lactis

    PubMed Central

    Duviau, Marie-Pierre; Meyrand, Mickael; Guérardel, Yann; Castelain, Mickaël; Loubière, Pascal; Chapot-Chartier, Marie-Pierre; Dague, Etienne; Mercier-Bonin, Muriel

    2013-01-01

    Adhesion of bacteria to mucus may favor their persistence within the gut and their beneficial effects to the host. Interactions between pig gastric mucin (PGM) and a natural isolate of Lactococcus lactis (TIL448) were measured at the single-cell scale and under static conditions, using atomic force microscopy (AFM). In parallel, these interactions were monitored at the bacterial population level and under shear flow. AFM experiments with a L. lactis cell-probe and a PGM-coated surface revealed a high proportion of specific adhesive events (60%) and a low level of non-adhesive ones (2%). The strain muco-adhesive properties were confirmed by the weak detachment of bacteria from the PGM-coated surface under shear flow. In AFM, rupture events were detected at short (100−200 nm) and long distances (up to 600−800 nm). AFM measurements on pili and mucus-binding protein defective mutants demonstrated the comparable role played by these two surface proteinaceous components in adhesion to PGM under static conditions. Under shear flow, a more important contribution of the mucus-binding protein than the pili one was observed. Both methods differ by the way of probing the adhesion force, i.e. negative force contact vs. sedimentation and normal-to-substratum retraction vs. tangential detachment conditions, using AFM and flow chamber, respectively. AFM blocking assays with free PGM or O-glycan fractions purified from PGM demonstrated that neutral oligosaccharides played a major role in adhesion of L. lactis TIL448 to PGM. This study dissects L. lactis muco-adhesive phenotype, in relation with the nature of the bacterial surface determinants. PMID:24260308

  13. Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363?

    PubMed Central

    Zomer, Aldert L.; Buist, Girbe; Larsen, Rasmus; Kok, Jan; Kuipers, Oscar P.

    2007-01-01

    Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363?ccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric ?35 sequence at an average position of ?56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative ?35 and ?10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical ?10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism. PMID:17028270

  14. Intracellular and Extracellular Expression of Bacillus thuringiensis Crystal Protein Cry5B in Lactococcus lactis for Use as an Anthelminthic

    PubMed Central

    Durmaz, Evelyn; Hu, Yan; Aroian, Raffi V.

    2015-01-01

    The Bacillus thuringiensis crystal (Cry) protein Cry5B (140 kDa) and a truncated version of the protein, tCry5B (79 kDa), are lethal to nematodes. Genes encoding the two proteins were separately cloned into a high-copy-number vector with a strong constitutive promoter (pTRK593) in Lactococcus lactis for potential oral delivery against parasitic nematode infections. Western blots using a Cry5B-specific antibody revealed that constitutively expressed Cry5B and tCry5B were present in both cells and supernatants. To increase production, cry5B was cloned into the high-copy-number plasmid pMSP3535H3, carrying a nisin-inducible promoter. Immunoblotting revealed that 3 h after nisin induction, intracellular Cry5B was strongly induced at 200 ng/ml nisin, without adversely affecting cell viability or cell membrane integrity. Both Cry5B genes were also cloned into plasmid pTRK1061, carrying a promoter and encoding a transcriptional activator that invoke low-level expression of prophage holin and lysin genes in Lactococcus lysogens, resulting in a leaky phenotype. Cry5B and tCry5B were actively expressed in the lysogenic strain L. lactis KP1 and released into cell supernatants without affecting culture growth. Lactate dehydrogenase (LDH) assays indicated that Cry5B, but not LDH, leaked from the bacteria. Lastly, using intracellular lysates from L. lactis cultures expressing both Cry5B and tCry5B, in vivo challenges of Caenorhabditis elegans worms demonstrated that the Cry proteins were biologically active. Taken together, these results indicate that active Cry5B proteins can be expressed intracellularly in and released extracellularly from L. lactis, showing potential for future use as an anthelminthic that could be delivered orally in a food-grade microbe. PMID:26682852

  15. Oral Administration of Lactococcus lactis Expressing Synthetic Genes of Myelin Antigens in Decreasing Experimental Autoimmune Encephalomyelitis in Rats

    PubMed Central

    Kasarello, Kaja; Kwiatkowska-Patzer, Barbara; Lipkowski, Andrzej W.; Bardowski, Jacek K.; Szczepankowska, Agnieszka K.

    2015-01-01

    Background Multiple sclerosis is a human autoimmunological disease that causes neurodegeneration. One of the potential ways to stop its development is induction of oral tolerance, whose effect lies in decreasing immune response to the fed antigen. It was shown in animal models that administration of specific epitopes of the three main myelin proteins – myelin oligodendrocyte glycoprotein (MOG), myelin basic protein (MBP), and proteolipid protein (PLP) – results in induction of oral tolerance and suppression of disease symptoms. Use of bacterial cells to produce and deliver antigens to gut mucosa seems to be an attractive method for oral tolerance induction in treatment of diseases with autoimmune background. Material/Methods Synthetic genes of MOG35-55, MBP85-97, and PLP139-151 myelin epitopes were generated and cloned in Lactococcus lactis under a CcpA-regulated promoter. The tolerogenic effect of bacterial preparations was tested on experimental autoimmune encephalomyelitis, which is the animal model of MS. EAE was induced in rats by intradermal injection of guinea pig spinal cord homogenate into hind paws. Results Rats were administered preparations containing whole-cell lysates of L. lactis producing myelin antigens using different feeding schemes. Our study demonstrates that 20-fold, but not 4-fold, intragastric administration of autoantigen-expressing L. lactis cells under specific conditions reduces the clinical symptoms of EAE in rats. Conclusions The present study evaluated the use of myelin antigens produced in L. lactis in inhibiting the onset of experimental autoimmune encephalomyelitis in rats. Obtained results indicate that application of such recombinant cells can be an attractive method of oral tolerance induction. PMID:26026273

  16. Secreted Factors from Bifidobacterium animalis subsp. lactis Inhibit NF-?B-Mediated Interleukin-8 Gene Expression in Caco-2 Cells?

    PubMed Central

    Wang, Zhonggui; Wang, Jinfeng; Cheng, Yi; Liu, Xin; Huang, Ying

    2011-01-01

    The objective of the present study was to evaluate the anti-inflammatory effects of Bifidobacterium animalis subsp. lactis strain BB12 in stimulated Caco-2 cells and to characterize the factors responsible for these anti-inflammatory effects. Characterization and purification studies indicate that BB12's anti-inflammatory factors might include a 50-kDa proteinaceous compound that is stable under a variety of heat and pH conditions. PMID:21926200

  17. Improved bioethanol production in an engineered Kluyveromyces lactis strain shifted from respiratory to fermentative metabolism by deletion of NDI1

    PubMed Central

    González-Siso, María Isabel; Touriño, Alba; Vizoso, Ángel; Pereira-Rodríguez, Ángel; Rodríguez-Belmonte, Esther; Becerra, Manuel; Cerdán, María Esperanza

    2015-01-01

    In this paper, we report the metabolic engineering of the respiratory yeast Kluyveromyces lactis by construction and characterization of a null mutant (?klndi1) in the single gene encoding a mitochondrial alternative internal dehydrogenase. Isolated mitochondria of the ?klndi1 mutant show unaffected rate of oxidation of exogenous NADH, but no oxidation of matrix NADH; this confirms that KlNdi1p is the only internal NADH dehydrogenase in K.?lactis mitochondria. Permeabilized cells of the ?klndi1 mutant do not show oxidation of matrix NADH, which suggests that shuttle systems to transfer the NADH from mitochondrial matrix to cytosol, for being oxidized by external dehydrogenases, are not functional. The ?klndi1 mutation decreases the chronological life span in absence of nutrients. The expression of KlNDI1 is increased by glutathione reductase depletion. The ?klndi1 mutation shifts the K.?lactis metabolism from respiratory to fermentative: the ?klndi1 strain shows reduced respiration rate and increased ethanol production from glucose, while it does not grow in non-fermentable carbon sources such as lactate. The biotechnological benefit of the ?klndi1 mutant for bioethanol production from waste cheese whey lactose was proved. PMID:25186243

  18. Identification of an essential gene responsible for D-Asp incorporation in the Lactococcus lactis peptidoglycan crossbridge.

    PubMed

    Veiga, Patrick; Piquet, Sandra; Maisons, Aurélie; Furlan, Sylviane; Courtin, Pascal; Chapot-Chartier, Marie-Pierre; Kulakauskas, Saulius

    2006-12-01

    Bacteria such as Lactococcus lactis have D-aspartate (D-Asp) or its amidated derivative D-asparagine (D-Asn), in their peptidoglycan (PG) interpeptide crossbridge. We performed a subtractive genome analysis to identify L. lactis gene yxbA, orthologues of which being present only in bacteria containing D-amino acids in their PG crossbridge, but absent from those that instead insert L-amino acids or glycine. Inactivation of yxbA required a complementing Streptococcus pneumoniae murMN genes, which express enzymes that incorporate L-Ser-L-Ala or L-Ala-L-Ala in the PG crossbridge. Our results show that (i) yxbA encodes D-Asp ligase responsible for incorporation of D-Asp in the PG crossbridge, and we therefore renamed it as aslA, (ii) it is an essential gene, which makes its product a potential target for specific antimicrobials, (iii) the absence of D-Asp may be complemented by L-Ser-L-Ala or L-Ala-L-Ala in the L. lactis PG, indicating that the PG synthesis machinery is not selective for the side-chain residues, and (iv) lactococcal strains having L-amino acids in their PG crossbridge display defects in cell wall integrity, but are able to efficiently anchor cell wall proteins, indicating relative flexibility of lactococcal transpeptidation reactions with respect to changes in PG sidechain composition. PMID:17083466

  19. Live probiotic Bifidobacterium lactis bacteria inhibit the toxic effects induced by wheat gliadin in epithelial cell culture

    PubMed Central

    Lindfors, K; Blomqvist, T; Juuti-Uusitalo, K; Stenman, S; Venäläinen, J; Mäki, M; Kaukinen, K

    2008-01-01

    Wheat gliadin induces severe intestinal symptoms and small-bowel mucosal damage in coeliac disease patients. At present, the only effective treatment for the disease is a strict life-long gluten-free diet. In this study we investigated whether probiotics Lactobacillus fermentum or Bifidobacterium lactis can inhibit the toxic effects of gliadin in intestinal cell culture conditions. The ability of live probiotics to inhibit peptic-tryptic digested gliadin-induced damage to human colon cells Caco-2 was evaluated by measuring epithelial permeability by transepithelial resistance, actin cytoskeleton arrangements by the extent of membrane ruffling and expression of tight junctional protein ZO-1. B. lactis inhibited the gliadin-induced increase dose-dependently in epithelial permeability, higher concentrations completely abolishing the gliadin-induced decrease in transepithelial resistance. The same bacterial strain also inhibited the formation of membrane ruffles in Caco-2 cells induced by gliadin administration. Furthermore, it also protected the tight junctions of Caco-2 cells against the effects of gliadin, as evinced by the pattern of ZO-1 expression. We conclude thus that live B. lactis bacteria can counteract directly the harmful effects exerted by coeliac-toxic gliadin and would clearly warrant further studies of its potential as a novel dietary supplement in the treatment of coeliac disease. PMID:18422736

  20. Improved bioethanol production in an engineered Kluyveromyces lactis strain shifted from respiratory to fermentative metabolism by deletion of NDI1.

    PubMed

    González-Siso, María Isabel; Touriño, Alba; Vizoso, Ángel; Pereira-Rodríguez, Ángel; Rodríguez-Belmonte, Esther; Becerra, Manuel; Cerdán, María Esperanza

    2015-03-01

    In this paper, we report the metabolic engineering of the respiratory yeast Kluyveromyces lactis by construction and characterization of a null mutant (Δklndi1) in the single gene encoding a mitochondrial alternative internal dehydrogenase. Isolated mitochondria of the Δklndi1 mutant show unaffected rate of oxidation of exogenous NADH, but no oxidation of matrix NADH; this confirms that KlNdi1p is the only internal NADH dehydrogenase in K. lactis mitochondria. Permeabilized cells of the Δklndi1 mutant do not show oxidation of matrix NADH, which suggests that shuttle systems to transfer the NADH from mitochondrial matrix to cytosol, for being oxidized by external dehydrogenases, are not functional. The Δklndi1 mutation decreases the chronological life span in absence of nutrients. The expression of KlNDI1 is increased by glutathione reductase depletion. The Δklndi1 mutation shifts the K. lactis metabolism from respiratory to fermentative: the Δklndi1 strain shows reduced respiration rate and increased ethanol production from glucose, while it does not grow in non-fermentable carbon sources such as lactate. The biotechnological benefit of the Δklndi1 mutant for bioethanol production from waste cheese whey lactose was proved. PMID:25186243

  1. A set of aspartyl protease-deficient strains for improved expression of heterologous proteins in Kluyveromyces lactis

    PubMed Central

    Ganatra, Mehul B; Vainauskas, Saulius; Hong, Julia M; Taylor, Troy E; Denson, John-Paul M; Esposito, Dominic; Read, Jeremiah D; Schmeisser, Hana; Zoon, Kathryn C; Hartley, James L; Taron, Christopher H

    2011-01-01

    Secretion of recombinant proteins is a common strategy for heterologous protein expression using the yeast Kluyveromyces lactis. However, a common problem is degradation of a target recombinant protein by secretory pathway aspartyl proteases. In this study, we identified five putative pfam00026 aspartyl proteases encoded by the K. lactis genome. A set of selectable marker-free protease deletion mutants was constructed in the prototrophic K. lactis GG799 industrial expression strain background using a PCR-based dominant marker recycling method based on the Aspergillus nidulans acetamidase gene (amdS). Each mutant was assessed for its secretion of protease activity, its health and growth characteristics, and its ability to efficiently produce heterologous proteins. In particular, despite having a longer lag phase and slower growth compared with the other mutants, a ?yps1 mutant demonstrated marked improvement in both the yield and the quality of Gaussia princeps luciferase and the human chimeric interferon Hy3, two proteins that experienced significant proteolysis when secreted from the wild-type parent strain. PMID:21166768

  2. Identification of the beta-glucosidase gene from Bifidobacterium animalis subsp. lactis and its expression in B. bifidum BGN4.

    PubMed

    Youn, So Youn; Park, Myeong Soo; Ji, Geun Eog

    2012-12-01

    beta-Glucosidase is necessary for the bioconversion of glycosidic phytochemicals in food. Two Bifidobacterium strains (Bifidobacterium animalis subsp. lactis SH5 and B. animalis subsp. lactis RD68) with relatively high beta- glucosidase activities were selected among 46 lactic acid bacteria. A beta-glucosidase gene (bbg572) from B. lactis was shotgun cloned, fully sequenced, and analyzed for its transcription start site, structural gene, and deduced transcriptional terminator. The structural gene of bbg572 was 1,383 bp. Based on amino sequence similarities, bbg572 was assigned to family 1 of the glycosyl hydrolases. To overexpress bbg572 in Bifidobacterium, several bifidobacteria expression vectors were constructed by combining several promoters and a terminator sequence from different bifidobacteria. The maximum activity of recombinant Bbg572 was achieved when it was expressed under its own promoter and terminator. Its enzyme activity increased 31-fold compared with those of its parental strains. The optimal pH for Bbg572 was pH 6.0. Bbg572 was stable at 37-40 degrees C. It hydrolyzed isoflavones, quercetins, and disaccharides with various beta-glucoside linkages. Bbg572 also converted the ginsenosides Rb1 and Rb2. These results suggest that this new beta-glucosidase-positive Bifidobacterium transformant can be utilized for the production of specific aglycone products. PMID:23221535

  3. On Lactococcus lactis UL719 competitivity and nisin (Nisaplin(®)) capacity to inhibit Clostridium difficile in a model of human colon.

    PubMed

    Le Lay, Christophe; Fernandez, Benoit; Hammami, Riadh; Ouellette, Marc; Fliss, Ismail

    2015-01-01

    Clostridium difficile is the most frequently identified enteric pathogen in patients with nosocomially acquired, antibiotic-associated diarrhea and pseudomembranous colitis. Although metronidazole and vancomycin were effective, an increasing number of treatment failures and recurrence of C. difficile infection are being reported. Use of probiotics, particularly metabolically active lactic acid bacteria, was recently proposed as an alternative for the medical community. The aim of this study was to assess a probiotic candidate, nisin Z-producer Lactococcus lactis UL719, competitivity and nisin (Nisaplin(®)) capacity to inhibit C. difficile in a model of human colon. Bacterial populations was enumerated by qPCR coupled to PMA treatment. L. lactis UL719 was able to survive and proliferate under simulated human colon, did not alter microbiota composition, but failed to inhibit C. difficile. While a single dose of 19 ?mol/L (5× the MIC) was not sufficient to inhibit C. difficile, nisin at 76 ?mol/L (20×the MIC) was effective at killing the pathogen. Nisin (at 76 ?mol/L) caused some temporary changes in the microbiota with Gram-positive bacteria being the mostly affected. These results highlight the capacity of L. lactis UL719 to survive under simulated human colon and the efficacy of nisin as an alternative in the treatment of C. difficile infections. PMID:26441942

  4. Codon and Propeptide Optimizations to Improve the Food-grade Expression of Bile Salt Hydrolase in Lactococcus lactis.

    PubMed

    Dong, Zixing; Zhang, Juan; Li, Huazhong; Du, Guocheng; Chen, Jian; Lee, Byonghoon

    2015-01-01

    To achieve the food-grade expression of bile salt hydrolase (BSH, EC 3.5.1.24) from Lactobacillus plantarum BBE7, the nisin controlled gene expression system (NICE), food-grade selection maker and signal peptide of Lactococcus lactis were used in this study. The open reading frame of BSH was optimized based on the codon bias of L. lactis, resulting in 12-fold and 9.5% increases in the intracellular and extracellular BSH activities, respectively. Three synthetic propeptides, LEISSTCDA (acidic), LGISSTCNA (neutral) and LKISSTCHA (basic) were also fused with signal peptide SPusp45 of vector pNZ8112 and introduced into the food-grade expression vector pNZ8149, respectively. Among these propeptides, acidic propeptide was effective in increasing the secretion efficiency and yield of BSH in recombinant bacteria, while neutral propeptide had no significant effect on the secretion of BSH. In contrast, basic propeptide strongly reduced the extracellular expression of BSH. By using codon optimization and the acidic propeptide together, the extracellular BSH activity was increased by 11.3%, reaching its maximum of 3.56 U/mg. To the best of our knowledge, this is the first report on the intracellular and extracellular expression of BSH using food-grade expression system, which would lay a solid foundation for large-scale production of BSH and other heterologous proteins in L. lactis. PMID:26059800

  5. Genome-Scale Genotype-Phenotype Matching of Two Lactococcus lactis Isolates from Plants Identifies Mechanisms of Adaptation to the Plant Niche? †

    PubMed Central

    Siezen, Roland J.; Starrenburg, Marjo J. C.; Boekhorst, Jos; Renckens, Bernadet; Molenaar, Douwe; van Hylckama Vlieg, Johan E. T.

    2008-01-01

    Lactococcus lactis is a primary constituent of many starter cultures used for the manufacturing of fermented dairy products, but the species also occurs in various nondairy niches such as (fermented) plant material. Three genome sequences of L. lactis dairy strains (IL-1403, SK11, and MG1363) are publicly available. An extensive molecular and phenotypic diversity analysis was now performed on two L. lactis plant isolates. Diagnostic sequencing of their genomes resulted in over 2.5 Mb of sequence for each strain. A high synteny was found with the genome of L. lactis IL-1403, which was used as a template for contig mapping and locating deletions and insertions in the plant L. lactis genomes. Numerous genes were identified that do not have homologs in the published genome sequences of dairy L. lactis strains. Adaptation to growth on substrates derived from plant cell walls is evident from the presence of gene sets for the degradation of complex plant polymers such as xylan, arabinan, glucans, and fructans but also for the uptake and conversion of typical plant cell wall degradation products such as ?-galactosides, ?-glucosides, arabinose, xylose, galacturonate, glucuronate, and gluconate. Further niche-specific differences are found in genes for defense (nisin biosynthesis), stress response (nonribosomal peptide synthesis and various transporters), and exopolysaccharide biosynthesis, as well as the expected differences in various mobile elements such as prophages, plasmids, restriction-modification systems, and insertion sequence elements. Many of these genes were identified for the first time in Lactococcus lactis. In most cases good correspondence was found with the phenotypic characteristics of these two strains. PMID:18039825

  6. Proteomic and Functional Consequences of Hexokinase Deficiency in Glucose-repressible Kluyveromyces lactis

    PubMed Central

    Mates, Nadia; Kettner, Karina; Heidenreich, Falk; Pursche, Theresia; Migotti, Rebekka; Kahlert, Günther; Kuhlisch, Eberhard; Breunig, Karin D.; Schellenberger, Wolfgang; Dittmar, Gunnar; Hoflack, Bernard; Kriegel, Thomas M.

    2014-01-01

    The analysis of glucose signaling in the Crabtree-positive eukaryotic model organism Saccharomyces cerevisiae has disclosed a dual role of its hexokinase ScHxk2, which acts as a glycolytic enzyme and key signal transducer adapting central metabolism to glucose availability. In order to identify evolutionarily conserved characteristics of hexokinase structure and function, the cellular response of the Crabtree-negative yeast Kluyveromyces lactis to rag5 null mutation and concomitant deficiency of its unique hexokinase KlHxk1 was analyzed by means of difference gel electrophoresis. In total, 2,851 fluorescent spots containing different protein species were detected in the master gel representing all of the K. lactis proteins that were solubilized from glucose-grown KlHxk1 wild-type and mutant cells. Mass spectrometric peptide analysis identified 45 individual hexokinase-dependent proteins related to carbohydrate, short-chain fatty acid and tricarboxylic acid metabolism as well as to amino acid and protein turnover, but also to general stress response and chromatin remodeling, which occurred as a consequence of KlHxk1 deficiency at a minimum 3-fold enhanced or reduced level in the mutant proteome. In addition, three proteins exhibiting homology to 2-methylcitrate cycle enzymes of S. cerevisiae were detected at increased concentrations, suggesting a stimulation of pyruvate formation from amino acids and/or fatty acids. Experimental validation of the difference gel electrophoresis approach by post-lysis dimethyl labeling largely confirmed the abundance changes detected in the mutant proteome via the former method. Taking into consideration the high proportion of identified hexokinase-dependent proteins exhibiting increased proteomic levels, KlHxk1 is likely to have a repressive function in a multitude of metabolic pathways. The proteomic alterations detected in the mutant classify KlHxk1 as a multifunctional enzyme and support the view of evolutionary conservation of dual-role hexokinases even in organisms that are less specialized than S. cerevisiae in terms of glucose utilization. PMID:24434903

  7. Proton motive force in growing Streptococcus lactis and Staphylococcus aureus cells under aerobic and anaerobic conditions.

    PubMed

    Kashket, E R

    1981-04-01

    Measurements of the electrochemical gradient of hydrogen ions, which gives rise to the proton motive force (PMF), were carried out with growing Streptococcus lactis and Staphylococcus aureus cells. The facultative anaerobe was chosen in order to compare the PMF of cells growing aerobically and anaerobically. It was expected that during aerobic growth the cells would have a higher PMF than during anaerobic growth, because the H+-translocating ATPase (BF0F1) operates in the direction of H+ influx and ATP synthesis during respiration, whereas under anaerobic conditions the BF0F1 hydrolyzes glycolytically generated ATP and establishes the proton gradient by extruding H+. The electrical component of the PMF, delta psi, and the chemical gradient of H+, delta pH, were measured with radiolabeled tetraphenylphosphonium and benzoate ions. In both S. lactis and S. aureus cells, the PMF was constant during the exponential phase of batch growth and decreased in the stationary phase. In both species of bacteria, the exponential-phase PMF was not affected by varying the growth rate by adding different sugars to the medium. The relative contributions of delta psi and delta pH to the PMF, however, depended on the pH of the medium. The internal pH of S. aureus was constant at pH 7.4 to 7.6 under all conditions of growth tested. Under aerobic conditions, the delta psi of exponential phase S. aureus remained fairly constant at 160 to 170 mV. Thus, the PMF was 250 to 270 mV in cells growing aerobically in media at pH 6 and progressively lower in media of higher pH, reaching 195 to 205 mV at pH 7. Under anaerobic conditions, the delta psi ranged from 100 to 120 mV in cells at pH 6.3 to 7, resulting in a PMF of 150 to 140 mV. Thus, the mode of energy metabolism (i.e., respiration versus fermentation) and the pH of the medium are the two important factors influencing the PMF of these gram-positive cells during growth. PMID:6260743

  8. Proteomic and functional consequences of hexokinase deficiency in glucose-repressible Kluyveromyces lactis.

    PubMed

    Mates, Nadia; Kettner, Karina; Heidenreich, Falk; Pursche, Theresia; Migotti, Rebekka; Kahlert, Günther; Kuhlisch, Eberhard; Breunig, Karin D; Schellenberger, Wolfgang; Dittmar, Gunnar; Hoflack, Bernard; Kriegel, Thomas M

    2014-03-01

    The analysis of glucose signaling in the Crabtree-positive eukaryotic model organism Saccharomyces cerevisiae has disclosed a dual role of its hexokinase ScHxk2, which acts as a glycolytic enzyme and key signal transducer adapting central metabolism to glucose availability. In order to identify evolutionarily conserved characteristics of hexokinase structure and function, the cellular response of the Crabtree-negative yeast Kluyveromyces lactis to rag5 null mutation and concomitant deficiency of its unique hexokinase KlHxk1 was analyzed by means of difference gel electrophoresis. In total, 2,851 fluorescent spots containing different protein species were detected in the master gel representing all of the K. lactis proteins that were solubilized from glucose-grown KlHxk1 wild-type and mutant cells. Mass spectrometric peptide analysis identified 45 individual hexokinase-dependent proteins related to carbohydrate, short-chain fatty acid and tricarboxylic acid metabolism as well as to amino acid and protein turnover, but also to general stress response and chromatin remodeling, which occurred as a consequence of KlHxk1 deficiency at a minimum 3-fold enhanced or reduced level in the mutant proteome. In addition, three proteins exhibiting homology to 2-methylcitrate cycle enzymes of S. cerevisiae were detected at increased concentrations, suggesting a stimulation of pyruvate formation from amino acids and/or fatty acids. Experimental validation of the difference gel electrophoresis approach by post-lysis dimethyl labeling largely confirmed the abundance changes detected in the mutant proteome via the former method. Taking into consideration the high proportion of identified hexokinase-dependent proteins exhibiting increased proteomic levels, KlHxk1 is likely to have a repressive function in a multitude of metabolic pathways. The proteomic alterations detected in the mutant classify KlHxk1 as a multifunctional enzyme and support the view of evolutionary conservation of dual-role hexokinases even in organisms that are less specialized than S. cerevisiae in terms of glucose utilization. PMID:24434903

  9. Lactococcus lactis is an Efficient Expression System for Mammalian Membrane Proteins Involved in Liver Detoxification, CYP3A4, and MGST1.

    PubMed

    Bakari, Sana; Lembrouk, Mehdi; Sourd, Laura; Ousalem, Fares; André, François; Orlowski, Stéphane; Delaforge, Marcel; Frelet-Barrand, Annie

    2016-04-01

    Despite the great importance of human membrane proteins involved in detoxification mechanisms, their wide use for biochemical approaches is still hampered by several technical difficulties considering eukaryotic protein expression in order to obtain the large amounts of protein required for functional and/or structural studies. Lactococcus lactis has emerged recently as an alternative heterologous expression system to Escherichia coli for proteins that are difficult to express. The aim of this work was to check its ability to express mammalian membrane proteins involved in liver detoxification, i.e., CYP3A4 and two isoforms of MGST1 (rat and human). Genes were cloned using two different strategies, i.e., classical or Gateway-compatible cloning, and we checked the possible influence of two affinity tags (6×-His-tag and Strep-tag II). Interestingly, all proteins could be successfully expressed in L. lactis at higher yields than those previously obtained for these proteins with classical expression systems (E. coli, Saccharomyces cerevisiae) or those of other eukaryotic membrane proteins expressed in L. lactis. In addition, rMGST1 was fairly active after expression in L. lactis. This study highlights L. lactis as an attractive system for efficient expression of mammalian detoxification membrane proteins at levels compatible with further functional and structural studies. PMID:26961909

  10. Oral immunization with recombinant Lactococcus lactis delivering a multi-epitope antigen CTB-UE attenuates Helicobacter pylori infection in mice.

    PubMed

    Li, Xinyang; Xing, Yingying; Guo, Le; Lv, Xiaobo; Song, Hui; Xi, Tao

    2014-10-01

    Urease is an essential virulence factor and colonization factor for Helicobacter pylori (H. pylori) and is considered as an excellent vaccine candidate antigen. However, conventional technologies for preparing an injectable vaccine require purification of the antigenic protein and preparation of an adjuvant. Lactococcus lactis NZ9000 (L. lactis) could serve as an antigen-delivering vehicle for the development of edible vaccine. In previous study, we constructed a multi-epitope vaccine, designated CTB-UE, which is composed of the mucosal adjuvant cholera toxin B subunit (CTB), three Th cell epitopes and two B-cell epitopes from urease subunits. To develop a novel type of oral vaccine against H. pylori, genetically modified L. lactis strains were established to secrete this epitope vaccine extracellularly in this study. Oral prophylactic immunization with recombinant L. lactis significantly elicited humoral anti-urease antibody responses (P < 0.001) and reduced the gastric colonization of H. pylori from 7.14 ± 0.95 to 4.68 ± 0.98 log10 CFU g(-1) stomach. This L. lactis oral vaccine offers a promising vaccine candidate for the control of H. pylori infection. PMID:24687988

  11. Immunogenicity of oral vaccination with Lactococcus lactis derived vaccine candidate antigen (UreB) of Helicobacter pylori fused with the human interleukin 2 as adjuvant.

    PubMed

    Zhang, Hong-xin; Qiu, Yu-yu; Zhao, Ying-hui; Liu, Xin-ting; Liu, Ming; Yu, Ai-lian

    2014-02-01

    Helicobacter pylori (H. pylori) infection remains a significant global public health problem. Vaccine, especially edible vaccine, is considered to be effective in the management of H. pylori infections. By using recombinant technology, Lactococcus lactis (L. lactis) could serve as an antigen-delivering vehicle for the development of edible vaccine. The aim of this study was to produce edible UreB (urease B) vaccine derived from L. lactis against H. pylori. The UreB subunit is the most effective and common immunogen of all strains of H. pylori. The UreB was produced as a chimeric protein fused with IL-2 (human interleukin 2) as the mucosal adjuvant. Mucosal immunization of mice with recombinant L. lactis NZ9000 containing the UreB-IL-2 protein elicited more anti-UreB antibody that specifically bounded to the purified bacterial UreB protein and more cytokines such as IFN-?, IL-4, and IL-17, and had a lower H. pylori burden and urease activity than control mice. These results suggest that the recombinant L. lactis expressing UreB-IL-2 can be potentially used as an edible vaccine for controlling H. pylori infection. PMID:24036137

  12. Proteinase PrtP impairs lactococcin LcnB activity in Lactococcus lactis BGMN1-501: new insights into bacteriocin regulation

    PubMed Central

    Vukotic, Goran; Mirkovic, Nemanja; Jovcic, Branko; Miljkovic, Marija; Strahinic, Ivana; Fira, Djordje; Radulovic, Zorica; Kojic, Milan

    2015-01-01

    Proteinases and bacteriocins are of great importance to the dairy industry, but their interactions have not been studied so far. Lactococcus lactis subsp. lactis BGMN1-5 is a natural isolate from homemade semi-hard cheese which produces two bacteriocins (Lactococcin B and LsbB), as well as proteinase PrtP. A medium-dependent increase in the bacteriocin LcnB activity of L. lactis BGMN1-501, a derivate of L. lactis subsp. lactis BGMN1-5, was shown to be accompanied by a decrease in its promoter activity. A similar effect of media components on gene expression was reported for proteinase PrtP, whose gene is co-localized on the same plasmid as the lcnB gene. Thus, the PrtP-LcnB interplay was investigated. Single gene knockout mutants were constructed with disrupted prtP or lcnB genes. PrtP- mutants showed higher bacteriocin activity that had lost its growth medium dependence, which was in contrast to the original strain. When LcnB from this mutant was combined with proteinase from the LcnB- mutant in vitro, its activity was rendered to the original level, suggesting that proteinase reduces bacteriocin activity. We propose a new model of medium dependent expression of these genes with regard to the effects of their interaction in vivo. PMID:25713574

  13. Isolation and characterization of a nisin-like bacteriocin produced by a Lactococcus lactis strain isolated from charqui, a Brazilian fermented, salted and dried meat product.

    PubMed

    Biscola, V; Todorov, S D; Capuano, V S C; Abriouel, H; Gálvez, A; Franco, B D G M

    2013-03-01

    A Lactococcus lactis subsp. lactis strain (L. lactis 69) capable to produce a heat-stable bacteriocin was isolated from charqui, a Brazilian fermented, salted and sun-dried meat product. The bacteriocin inhibited, in vitro, Listeria monocytogenes, Staphylococcus aureus, several lactic acid bacteria isolated from foods and spoilage halotolerant bacteria isolated from charqui. The activity of the bacteriocin was not affected by pH (2.0-10.0), heating (100 °C), and chemical agents (1% w/v). Treatment of growing cells of L. monocytogenes ScottA with the cell-free supernatant of L. lactis 69 resulted in complete cell inactivation. L. lactis 69 harbored the gene for the production of a nisin-like bacteriocin, and the amino acid sequence of the active peptide was identical to sequences previously described for nisin Z. However, differences were observed regarding the leader peptide. Besides, the isolate was able to survive and produce bacteriocins in culture medium with NaCl content up to 20%, evidencing a potential application as an additional hurdle in the preservation of charqui. PMID:23273471

  14. Factors Affecting Inducible Expression of Outer Membrane Protein A (OmpA) of Shigella dysenteriae Type-1 in Lactococcus lactis Using Nisin Inducible Controlled Expression (NICE).

    PubMed

    Yagnik, Bhrugu; Patel, Shivangi; Dave, Maitree; Sharma, Drashya; Padh, Harish; Desai, Priti

    2016-03-01

    Potential use of Lactococcus lactis (L. lactis) as a heterologous protein expression host as well as for delivery of multiple therapeutic proteins has been investigated extensively using Nisin Inducible Controlled Expression (NICE) system. Optimum inducible expression of heterologous protein by NICE system in L. lactis depends on multiple factors. To study the unexplored role of factors affecting heterologous protein expression in L. lactis using NICE, the present study outlines the optimization of various key parameters such as inducer concentration, host's proteases and precipitating agent using Outer membrane protein A (OmpA). For efficient expression and secretion of OmpA, pSEC:OmpA vector was successfully constructed. To circumvent the troubles encountered during detection of expressed OmpA, the precipitating agent was switched from TCA to methanol. Nevertheless, detection was achieved accompanied by degraded protein products. Speculating the accountability of observed degradation at higher inducer concentration, different nisin concentrations were evaluated. Lower nisin concentrations were found desirable for optimum expression of OmpA. Consistently observed degradation was eliminated by incorporation of protease inhibitor cocktail which inhibits intracellular proteases and expression in VEL1153 (NZ9000 ?htrA) strain which inhibits extracellular protease leading to optimum expression of OmpA. Versatility and complexity of NICE system in L. lactis requires fine-tuning of target protein specific parameters for optimum expression. PMID:26843700

  15. pH-Rate Profiles Support a General Base Mechanism for Galactokinase (Lactococcus lactis)

    PubMed Central

    Reinhardt, Laurie A.; Thoden, James B.; Peters, Greg S.; Holden, Hazel M.; Cleland, W.W.

    2013-01-01

    Galactokinase (GALK), a member the Leloir pathway for normal galactose metabolism, catalyzes the conversion of α-D-galactose to galactose-1-phosphate. For this investigation, we studied the kinetic mechanism and pH profiles of the enzyme from Lactococcus lactis. Our results show that the mechanism for its reaction is sequential in both directions. Mutant proteins D183A and D183N are inactive (<10,000 fold), supporting the role of Asp183 as a catalytic base that deprotonates the C-1 hydroxyl group of galactose. The pH–kcat profile of the forward reaction has a pKa of 6.9 ± 0.2 that likely is due to Asp183. The pH-kcat/KGal profile of the reverse reaction further substantiates this role as it is lacking a key pKa required for a direct proton transfer mechanism. The R36A and R36N mutant proteins show over 100-fold lower activity than that for the wild-type enzyme, thus suggesting that Arg36 lowers the pKa of the C-1 hydroxyl to facilitate deprotonation. PMID:23872454

  16. Recovery and purification of a Kluyvermyces lactis β-galactosidase by Mixed Mode Chromatography.

    PubMed

    Lima, Micael de Andrade; Freitas, Maria de Fátima Matos de; Gonçalves, Luciana Rocha Barros; Silva Junior, Ivanildo José da

    2016-03-15

    Mixed Mode Chromatography (MMC) is a potential separation technique that allows simultaneous ionic and hydrophobic interactions between the adsorbent and the adsorbate. The aim of this work was to assess the recovery and purification of a Kluyveromyces lactis β-galactosidase employing MMC. Protein precipitation and dialysis were performed in order to concentrate the enzyme of interest and eliminate cell debris and other interferences inherent in the fermentation medium. The best conditions for both adsorption and desorption were attained by a non-factorial Central Composite Experimental Design and employed in the chromatographic runs with resin CAPTO MMC. Fermentation yielded mean values of total enzyme concentration of 0.44mg/mL, enzymatic activity (employing lactose as a substrate) of 74U/mL and specific activity of 168U/mg. The Purification Factor (PF) obtained was of 1.17. After precipitation and dialysis, the subsequent chromatographic run resulted in recovery values ​​of 41.0 and 48.2% of total protein concentration and enzymatic activity, respectively. SDS-PAGE electrophoresis confirmed the purification evolution throughout the unit operations employed, attesting the feasibility of the technique to obtain enzymes with not only considerable degree of purity but also possessing high-added value. PMID:26927878

  17. NMR resonance assignments of the lantibiotic immunity protein NisI from Lactococcus lactis.

    PubMed

    Hacker, Carolin; Christ, Nina Alexandra; Duchardt-Ferner, Elke; Korn, Sophie; Berninger, Lucija; Kötter, Peter; Entian, Karl-Dieter; Wöhnert, Jens

    2015-10-01

    The lantibiotic nisin is a small antimicrobial peptide which acts against a wide range of Gram-positive bacteria. Nisin-producing Lactococcus lactis strains express four genes for self-protection against their own antimicrobial compound. This immunity system consists of the lipoprotein NisI and the ABC transporter NisFEG. NisI is attached to the outside of the cytoplasmic membrane via a covalently linked diacylglycerol anchor. Both the lipoprotein and the ABC transporter are needed for full immunity but the exact immunity mechanism is still unclear. To gain insights into the highly specific immunity mechanism of nisin producing strains on a structural level we present here the backbone resonance assignment of NisI (25.8 kDa) as well as the virtually complete (1)H,(15)N,(13)C chemical shift assignments for the isolated 12.7 kDa N-terminal and 14.6 kDa C-terminal domains of NisI. PMID:25613223

  18. Molecular Clues To Understand the Aerotolerance Phenotype of Bifidobacterium animalis subsp. lactis

    PubMed Central

    Ruiz, Lorena; Gueimonde, Miguel; Ruas-Madiedo, Patricia; Ribbera, Angela; de los Reyes-Gavilán, Clara G.; Ventura, Marco; Sánchez, Borja

    2012-01-01

    Oxygen is one of the abiotic factors negatively affecting the survival of Bifidobacterium strains used as probiotics, mainly due to the induction of lethal oxidative damage. Aerobic conditions are present during the process of manufacture and storage of functional foods, and aerotolerance is a desired trait for bifidobacteria intended for use in industry. In the present study, the molecular response of Bifidobacterium animalis subsp. lactis IPLA4549 to aerobic conditions is presented. Molecular targets affected by oxygen were studied using two-dimensional electrophoresis (2DE) and quantitative reverse transcriptase (qRT) PCR. Globally, oxygen stress induced a shift in the glycolytic pathway toward the production of acetic acid with a concomitant increase in ATP formation. Several changes in the expression of genes coding for enzymes involved in redox reactions were detected, although the redox ratio remained unaltered. Interestingly, cells grown under aerobic conditions were characterized by higher activity of coproporphyrinogen III oxidase, which can directly detoxify molecular oxygen, and by higher NADH oxidase specific activity, which can oxidize NADH using hydrogen peroxide. In turn, this is in agreement with the glycolytic shift toward acetate production, in that more NADH molecules may be available due to the lower level of lactic acid formation. These findings further our ability to elucidate the mechanisms by which B. animalis copes with an oxygen-containing atmosphere. PMID:22101052

  19. Genome organization of the killer plasmid pGK12 from Kluyveromyces lactis.

    PubMed Central

    Tommasino, M; Ricci, S; Galeotti, C L

    1988-01-01

    We have determined the entire sequence of the plasmid K2 from Kluyveromyces lactis which is involved in the maintenance of both killer plasmids in the cell. K2 shares many of the characteristics of the smaller killer plasmid K1: high A+T content (74.7%) and very compact genomic organization. K2 contains ten open reading frames. Some of them overlap on different strands and some on the same strand. Northern blotting of K2 transcripts shows that at least eight ORFs are transcribed. Analysis of the predicted aminoacid sequence of ORF2 from K2 reveals homology with the aminoacid sequence of ORF 1 from K1 and with several viral DNA polymerases. The sequence of K2 from Saccaromyces cerevisiae F102-2 was also determined. Only one nucleotide difference was found between the K2 sequence from the two yeasts. This mutation does not change the genome organization of the plasmid and has only minimal effect on the structure of the encoded proteins. Images PMID:3041369

  20. Production of nisin-like bacteriocins by Lactococcus lactis strains isolated from vegetables.

    PubMed

    Franz, C M; Du Toit, M; von Holy, A; Schillinger, U; Holzapfel, W H

    1997-01-01

    Four bacteriocin producing lactic acid bacteria isolated from vegetables were identified as Lactococcus lactis strains on the basis of physiological and biochemical characteristics, carbohydrate fermentation patterns and analysis of total soluble protein pattern by SDS PAGE. The bacteriocins had a wide spectrum of activity as antagonism was detected not only towards a variety of lactic acid bacteria, but also to Staphylococcus aureus and Listeria monocytogenes. These bacteriocins were resistant to heating at 121 degree C for 15 minutes and showed highest activity at low pH (<5.0). They were inactivated by the proteolytic enzymes alpha-chymotrypsin and proteinase K, but not by lipase, alpha-amylase, catalase or lysozyme. These bacteriocinogenic Lactococcus strains were all immune to the bacteriocins produced as well as to commercial nisin. Bacteriocin producer culture supernatants showed a high degree (70 or 100%) of cross-reactivity in the nisin ELISA, suggesting similarity of the produced bacteriocins to nisin. The potential application of bacteriocin producing lactococci of vegetable origin for safety assurance of vegetable foods and controlling vegetable fermentations is discussed. PMID:9265741

  1. Dual inducible expression of recombinant GFP and targeted antisense RNA in Lactococcus lactis.

    PubMed

    Oddone, Gian M; Mills, David A; Block, David E

    2009-09-01

    The food-grade status and probiotic activity of lactic acid bacteria (LAB) make them attractive hosts for production and oral delivery of therapeutic heterologous vaccines and other proteins, yet these bacteria currently do not achieve recombinant protein expression at levels comparable to those seen in Escherichia coli and Saccharomyces cerevisiae. Limited levels of expressed recombinant protein per cell most likely constrain the vaccine's immunogenic potential with respect to the magnitude and specificity of the immune response. With the goal of increasing recombinant protein expression per cell in Lactococcus lactis IL1403, a model LAB, we have constructed and evaluated a new vector that permits simultaneously-induced expression of GFP, a model recombinant protein, and antisense RNA inhibition of the clpP-encoded intracellular protease. While silencing of the rational target clpP does not lead to increased GFP per cell, the new dual-expression system provides an efficient and potentially high-throughput metabolic engineering tool for strain improvement. PMID:19523486

  2. Obligatory coupling between proton entry and the synthesis of adenosine 5'-triphosphate in Streptococcus lactis.

    PubMed Central

    Maloney, P C

    1977-01-01

    Proton influx was measured after imposition of an electrochemical potential difference for protons (delta muH+) across the cell membrane of the anaerobe, Streptococcus lactis. As delta muH+ was increased, there was an approximately parallel increase in proton entry, until delta muH+ attained 175 to 200 mV. At this point, a new pathway became available for proton entry, allowing an abrupt increase in both the rate and extent of H+ influx. This gated response depended upon the value of delta muH+ itself, and not upon the value of either the membrane potential or the pH gradient. For delta muH+ above 175 to 200 mV, elevated proton entry occurred only in cells having a functional membrane-bound Ca2+-stimulated, Mg2+stimulated adenosine 5'-triphosphatase (EC 3.6.1.3). When present, elevated proton entry coincided with the appearance of net synthesis of adenosine 5'-triphosphate catalyzed by this adenosine 5'-triphosphatase. These observations demonstrate that membrane-bound adenosine 5'-triphosphatase catalyzes an obligatory coupling between the inward movement of protons and synthesis of adenosine 5'-triphosphate. PMID:21165

  3. Evaluation of the performance of Torulaspora delbrueckii, Williopsis saturnus, and Kluyveromyces lactis in lychee wine fermentation.

    PubMed

    Chen, Dai; Yap, Zhi Yin; Liu, Shao-Quan

    2015-08-01

    This study evaluated the effects of three non-Saccharomyces yeasts, namely Torulaspora delbrueckii PRELUDE, Williopsis saturnus NCYC22, and Kluyveromyces lactis KL71 on lychee juice fermentation. The fermentation performance of these non-Saccharomyces yeasts was significantly different. T. delbrueckii PRELUDE had the fastest rate of growth and high sugar consumption. W. saturnus NCYC22 used the lowest amount of sugars, but consumed the highest amount of nitrogen. Correspondingly, strain PRELUDE produced the highest level of ethanol (7.6% v/v), followed by strain KL71 (3.4% v/v) and strain NCYC22 (0.8% v/v). Aroma character-impact terpenes and terpenoids could be partially retained in all lychee wines, with higher odour activity values (OAVs) of geraniol and citronellol in strain KL71. However, strain KL71 and strain NCYC22 over-produced ethyl acetate. Strain PRELUDE had a better ability to generate high levels of ethanol, isoamyl alcohol, 2-phenylethyl alcohol, ethyl octanoate, and ethyl decanoate and retained high OAVs of lychee aroma-character compounds cis-rose oxide (16.5) and linalool (3.5). Thus, it is deemed to be a promising non-Saccharomyces yeast for lychee wine fermentation. PMID:25955287

  4. Bacteriophage Resistance of a ΔthyA Mutant of Lactococcus lactis Blocked in DNA Replication

    PubMed Central

    Pedersen, Martin B.; Jensen, Peter R.; Janzen, Thomas; Nilsson, Dan

    2002-01-01

    The thyA gene, which encodes thymidylate synthase (TS), of Lactococcus lactis CHCC373 was sequenced, including the upstream and downstream regions. We then deleted part of thyA by gene replacement. The resulting strain, MBP71 ΔthyA, was devoid of TS activity, and in media without thymidine, such as milk, there was no detectable dTTP pool in the cells. Hence, DNA replication was abolished, and acidification by MBP71 was completely unaffected by the presence of nine different phages tested at a multiplicity of infection (MOI) of 0.1. Nonreplicating MBP71 must be inoculated at a higher level than CHCC373 to achieve a certain pH within a specified time. For a pH of 5.2 to be reached in 6 h, the inoculation level of MBP71 must be 17-fold higher than for CHCC373. However, by adding a limiting amount of thymidine this could be lowered to just 5-fold the normal amount, while acidification was unaffected with MBP71 up to an MOI of 0.01. It was found that nonreplicating MBP71 produced largely the same products as CHCC373, though the acetaldehyde production of the former was higher. PMID:12039762

  5. Challenges in lin-log modelling of glycolysis in Lactococcus lactis.

    PubMed

    del Rosario, R C H; Mendoza, E; Voit, E O

    2008-05-01

    The performance of the lin-log method for modelling the glycolytic pathway in Lactococcus lactis using in vivo time-series data is investigated. The network structure of this pathway has been studied in previous reports and the authors concentrate here on the challenge of fitting the lin-log model parameters to experimental data. To calibrate the estimation methods, the performance of the lin-log method on a simpler model of a small gene regulatory system was first investigated, which has become a benchmark in the field. Two families of optimisation algorithms were employed. One computes the objective function by solving a system of ordinary differential equations (ODEs), whereas the other discretises the ODEs and incorporates them as nonlinear equality constraints in the optimisation problem. Gradient-based, simplex-based and stochastic search algorithms were used to solve the former, whereas only a gradient-based algorithm was used to solve the latter. Although the estimation methods succeeded in determining the parameter values for the small gene network model, they did not yield a satisfactory lin-log model for the glycolytic pathway. The main reasons are apparently that several system variables approach low, and ultimately zero concentrations, which are intrinsically problematic for lin-log models, and that this pathway does not offer a natural non-zero reference state. [Includes supplementary material.]. PMID:18537454

  6. Oral Administration of Recombinant Lactococcus lactis Expressing HSP65 and Tandemly Repeated P277 Reduces the Incidence of Type I Diabetes in Non-Obese Diabetic Mice

    PubMed Central

    Ma, Yanjun; Liu, Jingjing; Hou, Jing; Dong, Yuankai; Lu, Yong; Jin, Liang; Cao, Rongyue; Li, Taiming; Wu, Jie

    2014-01-01

    Diabetes mellitus type 1 (DM1) is an autoimmune disease that gradually destroys insulin-producing beta-cells. We have previously reported that mucosal administration of fusion protein of HSP65 with tandem repeats of P277 (HSP65-6P277) can reduce the onset of DM1 in non-obese diabetic (NOD) mice. To deliver large amounts of the fusion protein and to enhance long-term immune tolerance effects, in the present study, we investigated the efficacy of using orally administrated L. lactis expressing HSP65-6P277 to reduce the incidence of DM1 in NOD mice. L. lactis strain NZ9000 was engineered to express HSP65-6P277 either constitutively or by nisin induction. After immunization via gavage with the recombinant L. lactis strains to groups of 4-week old female NOD mice for 36 weeks, we observed that oral administration of recombinant L. Lactis resulted in the prevention of hyperglycemia, improved glucose tolerance and reduced insulitis. Immunologic analysis showed that treatment with recombinant L. lactis induced HSP65- and P277- specific T cell immuno-tolerance, as well as antigen-specific proliferation of splenocytes. The results revealed that the DM1-preventing function was in part caused by a reduction in the pro-inflammatory cytokine IFN-? and an increase in the anti-inflammatory cytokine IL-10. Orally administered recombinant L. lactis delivering HSP65-6P277 may be an effective therapeutic approach in preventing DM1. PMID:25157497

  7. Trimming of two major type 1 diabetes driving antigens, GAD65 and IA-2, allows for successful expression in Lactococcus lactis.

    PubMed

    Robert, S; Van Huynegem, K; Gysemans, C; Mathieu, C; Rottiers, P; Steidler, L

    2015-01-01

    Type 1 diabetes (T1D) is a chronic autoimmune disease characterised by excessive immune reactions against auto-antigens of pancreatic ?-cells. Restoring auto-antigen tolerance remains the superior therapeutic strategy. Oral auto-antigen administration uses the tolerogenic nature of the gut-associated immune system to induce antigen-specific tolerance. However, due to gastric degradation, proper mucosal product delivery often imposes a challenge. Recombinant Lactococcus lactis have proven to be effective and safe carriers for gastrointestinal delivery of therapeutic products: L. lactis secreting diabetes-associated auto-antigens in combination with interleukin (IL)-10 have demonstrated therapeutic efficacy in a well-defined mouse model for T1D. Here, we describe the construction of recombinant L. lactis secreting the 65 kDa isoform of glutamic acid decarboxylase (GAD65) and tyrosine phosphatase-like protein ICA512 (IA-2), two major T1D-related auto-antigens. Attempts to secrete full size human GAD65 and IA-2 protein by L. lactis were unsuccessful. Trimming of GAD65 and IA-2 was investigated to optimise antigen secretion while maintaining sufficient bacterial growth. GAD65370-575 and IA-2635-979 showed to be efficiently secreted by recombinant L. lactis. Antigen secretion was verified by immunoblotting. Plasmid-derived GAD65 and IA-2 expression was combined in single strains with human IL-10 expression, a desired combination to allow tolerance induction. This study reports the generation of recombinant L. lactis secreting two major diabetes-related auto-antigens: human GAD65 and IA-2, by themselves or combined with the anti-inflammatory cytokine human IL-10. Prohibitive sequence obstacles hampering antigen secretion were resolved by trimming the full size proteins. PMID:25576592

  8. Lactococcus lactis carrying the pValac DNA expression vector coding for IL-10 reduces inflammation in a murine model of experimental colitis

    PubMed Central

    2014-01-01

    Background Inflammatory bowel diseases (IBD) are intestinal disorders characterized by inflammation in the gastrointestinal tract. Interleukin-10 is one of the most important anti-inflammatory cytokines involved in the intestinal immune system and because of its role in downregulating inflammatory cascades, its potential for IBD therapy is under study. We previously presented the development of an invasive strain of Lactococcus lactis (L. lactis) producing Fibronectin Binding Protein A (FnBPA) which was capable of delivering, directly to host cells, a eukaryotic DNA expression vector coding for IL-10 of Mus musculus (pValac:il-10) and diminish inflammation in a trinitrobenzene sulfonic acid (TNBS)-induced mouse model of intestinal inflammation. As a new therapeutic strategy against IBD, the aim of this work was to evaluate the therapeutic effect of two L. lactis strains (the same invasive strain evaluated previously and the wild-type strain) carrying the therapeutic pValac:il-10 plasmid in the prevention of inflammation in a dextran sodium sulphate (DSS)-induced mouse model. Results Results obtained showed that not only delivery of the pValac:il-10 plasmid by the invasive strain L. lactis MG1363 FnBPA+, but also by the wild-type strain L. lactis MG1363, was effective at diminishing intestinal inflammation (lower inflammation scores and higher IL-10 levels in the intestinal tissues, accompanied by decrease of IL-6) in the DSS-induced IBD mouse model. Conclusions Administration of both L. lactis strains carrying the pValac:il-10 plasmid was effective at diminishing inflammation in this murine model of experimental colitis, showing their potential for therapeutic intervention of IBD. PMID:25106058

  9. Multi-omics approach to study the growth efficiency and amino acid metabolism in Lactococcus lactis at various specific growth rates

    PubMed Central

    2011-01-01

    Background Lactococcus lactis is recognised as a safe (GRAS) microorganism and has hence gained interest in numerous biotechnological approaches. As it is fastidious for several amino acids, optimization of processes which involve this organism requires a thorough understanding of its metabolic regulations during multisubstrate growth. Results Using glucose limited continuous cultivations, specific growth rate dependent metabolism of L. lactis including utilization of amino acids was studied based on extracellular metabolome, global transcriptome and proteome analysis. A new growth medium was designed with reduced amino acid concentrations to increase precision of measurements of consumption of amino acids. Consumption patterns were calculated for all 20 amino acids and measured carbon balance showed good fit of the data at all growth rates studied. It was observed that metabolism of L. lactis became more efficient with rising specific growth rate in the range 0.10 - 0.60 h-1, indicated by 30% increase in biomass yield based on glucose consumption, 50% increase in efficiency of nitrogen use for biomass synthesis, and 40% reduction in energy spilling. The latter was realized by decrease in the overall product formation and higher efficiency of incorporation of amino acids into biomass. L. lactis global transcriptome and proteome profiles showed good correlation supporting the general idea of transcription level control of bacterial metabolism, but the data indicated that substrate transport systems together with lower part of glycolysis in L. lactis were presumably under allosteric control. Conclusions The current study demonstrates advantages of the usage of strictly controlled continuous cultivation methods combined with multi-omics approach for quantitative understanding of amino acid and energy metabolism of L. lactis which is a valuable new knowledge for development of balanced growth media, gene manipulations for desired product formation etc. Moreover, collected dataset is an excellent input for developing metabolic models. PMID:21349178

  10. Etude de la flore bactérienne contaminant les téléphones mobiles avant et après la désinfection: comparaison entre les professionnels soignants de l'hôpital militaire d'instruction Mohammed V de Rabat et les témoins

    PubMed Central

    Uwingabiye, Jean; Moustanfii, Wafaa; Chadli, Meryem; Sekhsokh, Yassine

    2015-01-01

    Introduction L'objectif de notre travail était évaluer la contamination microbienne des téléphones mobiles utilisés par les personnels soignants des différents services de l'hôpital militaire d'instructions Mohammed V de Rabat et la comparer à celui d'une population témoin et aussi démontrer l'efficacité des solutions hydroalcoolique dans la désinfection de ces téléphones mobiles. Méthodes Il s'agit d'une étude descriptive transversale réalisée sur une période de 9 mois entre septembre 2010 et juin 2011, dans le service de bactériologie de l'hôpital militaire d'Instruction Mohammed V. Résultats L’étude bactériologique a été faite sur 240 téléphones mobiles dont 50% provenaient de personnels de sante. Le taux de contamination bactérienne de tous les téléphones mobiles était de 100%. Les cultures des bactéries isolées au niveau des téléphones mobiles du personnel médical étaient plus polymorphes que celles de la population témoin (p=0,028). Parmi 437 bactéries isolées: 223(51%) provenaient de téléphones de personnels de santé et 214(49%) de téléphones de la population témoin avec une différence qui n’était pas statistiquement significative(p>0,05) sauf pour les isolats de Staphylocoque à coagulase négative et Staphylococcus aureus. Les bactéries isolées étaient représentées par: Staphylocoque à coagulase (57,7%), Staphylococcus aureus (18,1%), Corynebacterium sp (18,8%), Bacillus sp (2,3%) et autres (2,2%). La différence entre la prévalence des bactéries isolées selon les services et les fonctions des personnels de santé n’était pas statistiquement significative (p>0,05). La désinfection des téléphones portables par la solution hydroalcoolique a réduit à 99,5% le nombre des colonies. Conclusion Ce travail montre que les téléphones portables pourraient jouer un rôle dans la transmission des infections nosocomiales et communautaires. Dans le cadre de prévention de ces risques, il faut sensibiliser les utilisateurs des téléphones mobiles l'importance du lavage des mains et l'utilisation des solutions hydro alcoolique pour désinfecter aussi bien les téléphones portables que les mains. PMID:26977234

  11. Tumor Necrosis Factor Alpha Modulates the Dynamics of the Plasminogen-Mediated Early Interaction between Bifidobacterium animalis subsp. lactis and Human Enterocytes

    PubMed Central

    Centanni, Manuela; Bergmann, Simone; Turroni, Silvia; Hammerschmidt, Sven; Chhatwal, Gursharan Singh; Brigidi, Patrizia

    2012-01-01

    The capacity to intervene with the host plasminogen system has recently been considered an important component in the interaction process between Bifidobacterium animalis subsp. lactis and the human host. However, its significance in the bifidobacterial microecology within the human gastrointestinal tract is still an open question. Here we demonstrate that human plasminogen favors the B. animalis subsp. lactis BI07 adhesion to HT29 cells. Prompting the HT29 cell capacity to activate plasminogen, tumor necrosis factor alpha (TNF-?) modulated the plasminogen-mediated bacterium-enterocyte interaction, reducing the bacterial adhesion to the enterocytes and enhancing migration to the luminal compartment. PMID:22287006

  12. Prospective uses of recombinant Lactococcus lactis expressing both listeriolysin O and mutated internalin A from Listeria monocytogenes as a tool for DNA vaccination.

    PubMed

    De Azevedo, M S P; Santos Rocha, C; Pereira, V B; De Oliveira Junior, A F; De Sousa, C S; Azevedo, V; LeBlanc, J G; Chatel, J M; Miyoshi, A

    2015-01-01

    In this study, Lactococcus lactis was engineered to express mutated internalin A on its surface and to secrete large amounts of listeriolysin O (LLO) in order to improve its potential as a vehicle for DNA vaccination. Western blotting experiments demonstrated that the bacterium expressed LLO in both the cytoplasmic and extracellular compartments, with higher quantities found in the culture supernatants. A hemolytic assay showed that the recombinant strain secreted 250 ng active LLO/mg total protein. This mInlA/LLO-producing strain of L. lactis may be used as an alternative tool in DNA vaccination against a number of infectious diseases or in cancer therapy. PMID:26782496

  13. The Peptidyl-Prolyl Isomerase Motif Is Lacking in PmpA, the PrsA-Like Protein Involved in the Secretion Machinery of Lactococcus lactis

    PubMed Central

    Drouault, Sophie; Anba, Jamila; Bonneau, Sophie; Bolotin, Alexander; Ehrlich, S. Dusko; Renault, Pierre

    2002-01-01

    The prsA-like gene from Lactococcus lactis encoding its single homologue to PrsA, an essential protein triggering the folding of secreted proteins in Bacillus subtilis, was characterized. This gene, annotated pmpA, encodes a lipoprotein of 309 residues whose expression is increased 7- to 10-fold when the source of nitrogen is limited. A slight increase in the expression of the PrsA-like protein (PLP) in L. lactis removed the degradation products previously observed with the Staphylococcus hyicus lipase used as a model secreted protein. This shows that PmpA either triggers the folding of the secreted lipase or activates its degradation by the cell surface protease HtrA. Unlike the case for B. subtilis, the inactivation of the gene encoding PmpA reduced only slightly the growth rate of L. lactis in standard conditions. However, it almost stopped its growth when the lipase was overexpressed in the presence of salt in the medium. Like PrsA of B. subtilis and PrtM of L. lactis, the L. lactis PmpA protein could thus have a foldase activity that facilitates protein secretion. These proteins belong to the third family of peptidyl-prolyl cis/trans-isomerases (PPIases) for which parvulin is the prototype. Almost all PLP from gram-positive bacteria contain a domain with the PPIase signature. An exception to this situation was found only in Streptococcaceae, the family to which L. lactis belongs. PLP from Streptococcus pneumoniae and Enterococcus faecalis possess this signature, but those of L. lactis, Streptococcus pyogenes, and Streptococcus mutans do not. However, secondary structure predictions suggest that the folding of PLP is conserved over the entire length of the proteins, including the unconserved signature region. The activity associated with the expression of PmpA in L. lactis and these genomic data show that either the PPIase motif is not necessary for PPIase activity or, more likely, PmpA foldase activity does not necessarily require PPIase activity. PMID:12147493

  14. N5-(1-carboxyethyl)-ornithine, a new amino acid from the intracellular pool of Streptococcus lactis.

    PubMed Central

    Thompson, J; Curtis, M A; Miller, S P

    1986-01-01

    Intracellular concentrations of amino acids were determined in cells of Streptococcus lactis 133 during growth in complex, spent, and chemically defined media. Glutamic and aspartic acids represented the major constituents of the amino acid pool. However, organisms grown in spent medium or in defined medium supplemented with ornithine also contained unusually high levels of two additional amino acids. One of these amino acids was ornithine. The second compound exhibited properties of a neutral amino acid by coelution with valine from the amino acid analyzer. The compound did not, however, comigrate with valine or any other standard amino acid by two-dimensional thin-layer chromatography. The unknown amino acid was purified by paper and thin-layer chromatography, and its molecular structure was determined by 1H and 13C nuclear magnetic resonance spectroscopy. This new amino acid was shown to be N5-(1-carboxyethyl)-ornithine. The 14C-labeled compound was formed by cells of S. lactis 133 during growth in spent medium or defined medium containing [14C]ornithine. Formation of the derivative by resting cells required ornithine and the presence of a metabolizable sugar. N5-(1-Carboxyethyl)-ornithine was synthesized chemically from both poly-S-ornithine and (2S)-N2-carbobenzyloxy-ornithine as a 1:1 mixture of two diastereomers. The physical and chemical properties of the amino acid purified from S. lactis 133 were identical to those of one of the synthetic diastereomers. The bis-N-trifluoroacetyl-di-n-butyl esters of the natural and synthetic compounds generated identical gas chromatography-mass spectrometry spectra. A mechanism is suggested for the in vivo synthesis of N5-(1-carboxyethyl)-ornithine, and the possible functions of this new amino acid are discussed. Images PMID:3090017

  15. Cloning and characterization of Kluyveromyces lactis SEC14, a gene whose product stimulates Golgi secretory function in Saccharomyces cerevisiae.

    PubMed Central

    Salama, S R; Cleves, A E; Malehorn, D E; Whitters, E A; Bankaitis, V A

    1990-01-01

    The Saccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that is required for secretory protein movement from the Golgi complex. That some conservation of SEC14p function may exist was initially suggested by experiments that revealed immunoreactive polypeptides in cell extracts of the divergent yeasts Kluyveromyces lactis and Schizosaccharomyces pombe. We have cloned and characterized the K. lactis SEC14 gene (SEC14KL). Immunoprecipitation experiments indicated that SEC14KL encoded the K. lactis structural homolog of SEC14p. In agreement with those results, nucleotide sequence analysis of SEC14KL revealed a gene product of 301 residues (Mr, 34,615) and 77% identity to SEC14p. Moreover, a single ectopic copy of SEC14KL was sufficient to render S. cerevisiae sec14-1(Ts) mutants, or otherwise inviable sec14-129::HIS3 mutant strains, completely proficient for secretory pathway function by the criteria of growth, invertase secretion, and kinetics of vacuolar protein localization. This efficient complementation of sec14-129::HIS3 was observed to occur when the rates of SEC14pKL and SEC14p synthesis were reduced by a factor of 7 to 10 with respect to the wild-type rate of SEC14p synthesis. Taken together, these data provide evidence that the high level of structural conservation between SEC14p and SEC14pKL reflects a functional identity between these polypeptides as well. On the basis of the SEC14p and SEC14pKL primary sequence homology to the human retinaldehyde-binding protein, we suggest that the general function of these SEC14p species may be to regulate the delivery of a hydrophobic ligand to Golgi membranes so that biosynthetic secretory traffic can be supported. Images PMID:2198263

  16. Recombinant expressions of sweet plant protein mabinlin II in Escherichia coli and food-grade Lactococcus lactis.

    PubMed

    Gu, Wenliang; Xia, Qiyu; Yao, Jing; Fu, Shaoping; Guo, Jianchun; Hu, Xinwen

    2015-04-01

    Sweet plant proteins, which are safe, natural, low-calorie sweeteners, may be suitable replacements for sugars in the food and beverage industries. Mabinlin II, a sweet plant protein, shows the most pronounced heat stability and acid resistance of any of the six known types of plant sweet proteins. However, mabinlin II is difficult to extract from the Capparis masaikai plant, which is itself becoming increasingly scarce. This limits the use of naturally acquired mabinlin II. In this study, recombinant mabinlin II proteins were expressed and purified in Escherichia coli and in food-grade Lactococcus lactis. Recombinant mabinlin II proteins MBL-BH (containing the B-chains of mabinlin II downstream fused with His-tag) and MBL-ABH (containing the A- and B-chains of mabinlin II downstream fused with His-tag) were expressed in E. coli in the form of inclusion bodies. They were then purified and renatured. The refolded MBL-BH was found to be 100 times sweeter than sucrose by weight, but it was not heat-stable. Refolded MBL-ABH was neither sweet nor heat-stable. Recombinant mabinlin II proteins were secreted and expressed intracellularly in food-grade L. lactis, in which the concentrated cell samples and culture medium samples were detected using enzyme-linked immunosorbent assay and Western blotting analysis with anti-mabinlin II polyclonal antibody. This study demonstrated that the single B chain of mabinlin II has a sweet taste. The recombinant mabinlin II proteins have been successfully expressed in food-grade L. lactis, which is a crucial step in the production of mabinlin II through microorganism expression systems. PMID:25649203

  17. Characterization of the novel nisin-sucrose conjugative transposon Tn5276 and its insertion in Lactococcus lactis.

    PubMed Central

    Rauch, P J; De Vos, W M

    1992-01-01

    A novel, chromosomally located conjugative transposon in Lactococcus lactis, Tn5276, was identified and characterized. It encodes the production of and immunity to nisin, a lanthionine-containing peptide with antimicrobial activity, and the capacity to utilize sucrose via a phosphotransferase system. Conjugal transfer of Tn5276 was demonstrated from L. lactis NIZO R5 to different L. lactis strains and a recombination-deficient mutant. The integration of Tn5276 into the plasmid-free strain MG1614 was analyzed by using probes based on the gene for the nisin precursor (nisA) and the gene for sucrose-6-phosphate hydrolase (sacA). The transposon inserted at various locations in the MG1614 chromosome and showed a preference for orientation-specific insertion into a single target site (designated site 1). By using restriction mapping in combination with field inversion gel electrophoresis and DNA cloning of various parts of the element including its left and right ends, a physical map of the 70-kb Tn5276 was constructed, and the nisA and sacA genes were located. The nucleotide sequences of Tn5276 junctions in donor strain NIZO R5 and in site 1 of an MG1614-derived transconjugant were determined and compared with that of site 1 in recipient strain MG1614. The results show that the A + T-rich ends of Tn5276 are flanked by a direct hexanucleotide repeat in both the donor and the transconjugant but that the element does not contain a clear inverted repeat. Images PMID:1310502

  18. Production of human lysozyme in biofilm reactor and optimization of growth parameters of Kluyveromyces lactis K7.

    PubMed

    Ercan, Duygu; Demirci, Ali

    2013-07-01

    Lysozyme (1,4-?-N-acetylmuramidase) is a lytic enzyme, which degrades the bacterial cell wall. Lysozyme has been of interest in medicine, cosmetics, and food industries because of its anti-bactericidal effect. Kluyveromyces lactis K7 is a genetically modified organism that expresses human lysozyme. There is a need to improve the human lysozyme production by K. lactis K7 to make the human lysozyme more affordable. Biofilm reactor provides high biomass by including a solid support, which microorganisms grow around and within. Therefore, the aim of this study was to produce the human lysozyme in biofilm reactor and optimize the growth conditions of K. lactis K7 for the human lysozyme production in biofilm reactor with plastic composite support (PCS). The PCS, which includes polypropylene, soybean hull, soybean flour, bovine albumin, and salts, was selected based on biofilm formation on PCS (CFU/g), human lysozyme production (U/ml), and absorption of lysozyme inside the support. To find the optimum combination of growth parameters, a three-factor Box-Behnken design of response surface method was used. The results suggested that the optimum conditions for biomass and lysozyme productions were different (27 °C, pH 6, 1.33 vvm for biomass production; 25 °C, pH 4, no aeration for lysozyme production). Then, different pH and aeration shift strategies were tested to increase the biomass at the first step and then secrete the lysozyme after the shift. As a result, the lysozyme production amount (141 U/ml) at 25 °C without pH and aeration control was significantly higher than the lysozyme amount at evaluated pH and aeration shift conditions (p?

  19. Mechanism of Citrate Metabolism by an Oxaloacetate Decarboxylase-Deficient Mutant of Lactococcus lactis IL1403 ▿

    PubMed Central

    Pudlik, Agata M.; Lolkema, Juke S.

    2011-01-01

    Citrate metabolism in resting cells of Lactococcus lactis IL1403(pFL3) results in the formation of two end products from the intermediate pyruvate, acetoin and acetate (A. M. Pudlik and J. S. Lolkema, J. Bacteriol. 193:706–714, 2011). Pyruvate is formed from citrate following uptake by the transporter CitP through the subsequent actions of citrate lyase and oxaloacetate decarboxylase. The present study describes the metabolic response of L. lactis when oxaloacetate accumulates in the cytoplasm. The oxaloacetate decarboxylase-deficient mutant ILCitM(pFL3) showed nearly identical rates of citrate consumption, but the end product profile in the presence of glucose shifted from mainly acetoin to only acetate. In addition, in contrast to the parental strain, the mutant strain did not generate proton motive force. Citrate consumption by the mutant strain was coupled to the excretion of oxaloacetate, with a yield of 80 to 85%. Following citrate consumption, oxaloacetate was slowly taken up by the cells and converted to pyruvate by a cryptic decarboxylase and, subsequently, to acetate. The transport of oxaloacetate is catalyzed by CitP. The parental strain IL1403(pFL3) containing CitP consumed oxaloacetate, while the original strain, IL1403, not containing CitP, did not. Moreover, oxaloacetate consumption was enhanced in the presence of l-lactate, indicating exchange between oxaloacetate and l-lactate catalyzed by CitP. Hence, when oxaloacetate inadvertently accumulates in the cytoplasm, the physiological response of L. lactis is to excrete oxaloacetate in exchange with citrate by an electroneutral mechanism catalyzed by CitP. Subsequently, in a second step, oxaloacetate is taken up by CitP and metabolized to pyruvate and acetate. PMID:21665973

  20. Mortality and translocation assay to study the protective capacity of Bifidobacterium lactis INL1 against Salmonella Typhimurium infection in mice.

    PubMed

    Zacarías, M F; Reinheimer, J; Forzani, L; Grangette, C; Vinderola, G

    2014-12-01

    The mouse has been largely used for the study of the protective capacity of probiotics against intestinal infections caused by Salmonella. In this work we aimed at comparing the mortality and translocation assay for the study of the protective capacity of the human breast milk-derived strain Bifidobacterium animalis subsp. lactis INL1 on a model of gut infection by Salmonella enterica subsp. enterica serovar Typhimurium. Different doses of S. Typhimurium FUNED and B. animalis subsp. lactis INL 1 were administered to Balb/c mice in a mortality or a translocation assay. The survival of the control group in the mortality assay resulted to be variable along experiments, and then we preferred to use a translocation assay where the preventive administration of 109 cfu of bifidobacteria/mouse for 10 consecutive days significantly reduced the number of infected animals and the levels of translocation to liver and spleen, with enhanced secretory immunoglobulin A and interleukin 10 production in the small and large intestine, respectively. Ten days of B. animalis subsp. lactis strain INL1 administration to mice significantly reduced both the incidence and the severity of Salmonella infection in a mouse model of translocation. This work provided the first evidence that a translocation assay, compared to a mortality assay, could be more useful to study the protective capacity of probiotics against Salmonella infection, as more information can be obtained from mice and less suffering is conferred to animals due to the fact that the mortality assay is shorter than the latter. These facts are in line with the guidelines of animal research recently established by the National Centre for the Replacement, Refinement & Reduction of Animals in Research. PMID:24902954

  1. Bidirectional cell-surface anchoring function of C-terminal repeat region of peptidoglycan hydrolase of Lactococcus lactis IL1403.

    PubMed

    Tarahomjoo, Shirin; Katakura, Yoshio; Satoh, Eiichi; Shioya, Suteaki

    2008-02-01

    With the aim of constructing an efficient protein display system for lactic acid bacteria (LABs), the effect of fusion direction on the cell-surface binding activity of the C-terminal region of the peptidoglycan hydrolase (CPH) of Lactococcus lactis IL1403 was studied. CPH fused to the alpha-amylase (AMY) of Streptococcus bovis 148 either at its C-terminus (CPH-AMY) or at its N-terminus (AMY-CPH) was expressed intracellularly in Escherichia coli. This domain was able to direct binding of AMY to the surface of L. lactis ATCC 19435 in both constructs. However, the number of bound molecules per cell and the specific activity for starch digestion in the case of CPH-AMY were 3 and 14 times greater than those in the case of AMY-CPH, respectively. Of the LABs tested, L. lactis ATCC 19435 showed the highest binding capability for CPH-AMY, up to 6 x 10(4) molecules per cell, with a dissociation rate constant of 5.00 x 10(-5) s(-1). The binding of CPH-AMY to the surface of Lactobacillus delbrueckii ATCC 9649 cells was very stable with a dissociation rate constant of 6.96 x 10(-6) s(-1). The production of CPH-AMY in the soluble form increased 3-fold as a result of coexpression with a molecular chaperone, trigger factor. The results of this study suggest the usefulness of CPH as a bidirectional anchor protein for the production of cell-surface adhesive enzymes in E. coli. Furthermore, the importance of the fusion direction of CPH in determining cell-surface binding and enzymatic activities was shown. PMID:18343337

  2. Effect of in ovo administration of inulin and Lactococcus lactis on immune-related gene expression in broiler chickens.

    PubMed

    Płowiec, Arkadiusz; Sławińska, Anna; Siwek, Maria Z; Bednarczyk, Marek F

    2015-11-01

    OBJECTIVE To evaluate the effect of in ovo administration of inulin and Lactococcus lactis on immune-related gene expression in broiler chickens. ANIMALS 45 Ross broilers. PROCEDURES On day 12 of embryonic development, 360 eggs were equally allocated among 3 treatment groups and injected with 0.2 mL of a solution that contained 1.76 mg of inulin (prebiotic group) or 1.76 mg of inulin enriched with 1,000 CFUs of L lactis subsp lactis 2955 (synbiotic group), or they were injected with 0.2 mL of saline (0.9% NaCl) solution (control). At 1, 14, and 35 days after hatching, 5 male birds from each group were euthanized, and the spleen and cecal tonsils were harvested for determination of interleukin (IL)-4, IL-6, IL-8, IL-12p40, IL-18, cluster of differentiation 80, interferon-β, and interferon-γ expression by means of a reverse transcription quantitative PCR assay. Gene expressions in the cecal tonsils and spleens of chickens in the prebiotic and synbiotic groups were compared with those of control chickens at each tissue collection time. RESULTS Compared with control birds, immune-related gene expression was downregulated in birds in the prebiotic and synbiotic groups, and the magnitude of that downregulation was more pronounced in the cecal tonsils than in the spleen and increased with age. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated that in ovo administration of a prebiotic or synbiotic to broilers was associated with downregulation of immune-related gene expression in the cecal tonsils and spleen. The magnitude of that downregulation increased with age and was most likely caused by stabilization of the gastrointestinal microbiota. PMID:26512543

  3. The Lcn972 Bacteriocin-Encoding Plasmid pBL1 Impairs Cellobiose Metabolism in Lactococcus lactis?

    PubMed Central

    Campelo, Ana B.; Gaspar, Paula; Roces, Clara; Rodríguez, Ana; Kok, Jan; Kuipers, Oscar P.; Neves, Ana Rute; Martínez, Beatriz

    2011-01-01

    pBL1 is a Lactococcus lactis theta-replicating 10.9-kbp plasmid that encodes the synthetic machinery of the bacteriocin Lcn972. In this work, the transcriptomes of exponentially growing L. lactis strains with and without pBL1 were compared. A discrete response was observed, with a total of 10 genes showing significantly changed expression. Upregulation of the lactococcal oligopeptide uptake (opp) system was observed, which was likely linked to a higher nitrogen demand required for Lcn972 biosynthesis. Strikingly, celB, coding for the membrane porter IIC of the cellobiose phosphoenolpyruvate-dependent phosphotransferase system (PTS), and the upstream gene llmg0186 were downregulated. Growth profiles for L. lactis strains MG1363, MG1363/pBL1, and MG1363 ?celB grown in chemically defined medium (CDM) containing cellobiose confirmed slower growth of MG1363/pBL1 and MG1363 ?celB, while no differences were observed with growth on glucose. The presence of pBL1 shifted the fermentation products toward a mixed acid profile and promoted substantial changes in intracellular pool sizes for glycolytic intermediates in cells growing on cellobiose as determined by high-pressure liquid chromatography (HPLC) and nuclear magnetic resonance (NMR). Overall, these data support the genetic evidence of a constriction in cellobiose uptake. Notably, several cell wall precursors accumulated, while other UDP-activated sugar pools were lower, which could reflect rerouting of precursors toward the production of structural or storage polysaccharides. Moreover, cells growing slowly on cellobiose and those lacking celB were more tolerant to Lcn972 than cellobiose-adapted cells. Thus, downregulation of celB could help to build up a response against the antimicrobial activity of Lcn972, enhancing self-immunity of the producer cells. PMID:21890668

  4. A novel, lactase-based selection and strain improvement strategy for recombinant protein expression in Kluyveromyces lactis

    PubMed Central

    2012-01-01

    Background The Crabtree-negative yeast species Kluyveromyces lactis has been established as an attractive microbial expression system for recombinant proteins at industrial scale. Its LAC genes allow for utilization of the inexpensive sugar lactose as a sole source of carbon and energy. Lactose efficiently induces the LAC4 promoter, which can be used to drive regulated expression of heterologous genes. So far, strain manipulation of K. lactis by homologous recombination was hampered by the high rate of non-homologous end-joining. Results Selection for growth on lactose was applied to target the insertion of heterologous genes downstream of the LAC4 promoter into the K. lactis genome and found to yield high numbers of positive transformants. Concurrent reconstitution of the ?-galactosidase gene indicated the desired integration event of the expression cassette, and ?-galactosidase activity measurements were used to monitor gene expression for strain improvement and fermentation optimization. The system was particularly improved by usage of a cell lysis resistant strain, VAK367-D4, which allowed for protein accumulation in long-term fermentation. Further optimization was achieved by increased gene dosage of KlGAL4 encoding the activator of lactose and galactose metabolic genes that led to elevated transcription rates. Pilot experiments were performed with strains expressing a single-chain antibody fragment (scFvox) and a viral envelope protein (BVDV-E2), respectively. scFvox was shown to be secreted into the culture medium in an active, epitope-binding form indicating correct processing and protein folding; the E2 protein could be expressed intracellularly. Further data on the influence of protein toxicity on batch fermentation and potential post-transcriptional bottlenecks in protein accumulation were obtained. Conclusions A novel Kluyveromyces lactis host-vector system was developed that places heterologous genes under the control of the chromosomal LAC4 promoter and that allows monitoring of its transcription rates by ?-galactosidase measurement. The procedure is rapid and efficient, and the resulting recombinant strains contain no foreign genes other than the gene of interest. The recombinant strains can be grown non-selectively in rich medium and stably maintained even when the gene product exerts protein toxicity. PMID:22905717

  5. Stability of active prophages in industrial Lactococcus lactis strains in the presence of heat, acid, osmotic, oxidative and antibiotic stressors.

    PubMed

    Ho, Chun-Hoong; Stanton-Cook, Mitchell; Beatson, Scott A; Bansal, Nidhi; Turner, Mark S

    2016-03-01

    Lactococcus lactis is a starter bacterium commonly used in cheese making where it has an important role in acid-mediated curd formation as well as the development of flavour compounds. Industrial L. lactis strains can harbour one or more inducible prophages which when induced can affect cell growth and possibly lead to cell lysis. This is undesirable during growth and fermentation, but can beneficially lead to faster release of enzymes during cheese ripening. Lactococci can encounter multiple stress inducing conditions during the production of cheese, such as low and high temperatures, low pH, high osmotic pressure and long-term incubation. In this study, we tested the effect of these industrial stressors on prophage induction in two cheese making L. lactis subsp. cremoris strains (ASCC890049 and ASCC890310) as well as the laboratory strain L. lactis MG1363. Firstly, in order to identify inducible prophages in these strains we exposed them to the prophage inducing chemical mitomycin C (MMC) for 1 and 2h and then subjected the total genomic DNA to next-generation Illumina sequencing. Mapping of sequence reads back to the genome sequences revealed regions which contained a much higher fold coverage indicating DNA replication. These regions were amplified by up to 332-fold per cell (relative to the control tufA gene) and were identified as having similarities to different subgroups of P335 phages including MG-5, TP901-1, ul36.k1, bIL286, TP712 and BK5-T. Next, quantitative PCR was used to confirm the strong induction of prophages by MMC and then determine the copy number of the inducible prophages following exposure to various growth inhibitory levels of HCl, lactic acid, high temperature, NaCl, hydrogen peroxide and bacitracin. With the exception of a slight induction (2 to 4-fold) with hydrogen peroxide and long-term incubation after 21days in one industrial strain, none of the other stressors induced prophage DNA replication. These findings show that the repression system that maintains prophages in the dormant state in cheese making lactococcal strains is very tight and that several stressors encountered singularly are not predicted to be major inducers of prophage activation. PMID:26773254

  6. Complete genome sequence of Bifidobacterium animalis subsp. lactis A6, a probiotic strain with high acid resistance ability.

    PubMed

    Sun, Erna; Zhao, Liang; Ren, Fazheng; Liu, Songling; Zhang, Ming; Guo, Huiyuan

    2015-04-20

    Bifidobacterium animalis subsp. lactis A6 (BAA6) (CGMCC No. 9273) was a probiotic strain isolated from the feces of a centenarian. Previous study showed that BAA6 had high acid resistance to low pH which is a critical factor influencing its healthy benefits. Elaborating the stress resistant mechanisms of bifidobacteria is important to extensively exploit this probiotic. Here, we reported the complete genome sequence of BAA6 that contains 1,958,651 bp encoding 1622 CDSs, 16 rRNA genes, 52 tRNA genes. PMID:25707999

  7. Kluyveromyces lactis: A Suitable Yeast Model to Study Cellular Defense Mechanisms against Hypoxia-Induced Oxidative Stress

    PubMed Central

    González Siso, M. Isabel; Cerdán, M. Esperanza

    2012-01-01

    Studies about hypoxia-induced oxidative stress in human health disorders take advantage from the use of unicellular eukaryote models. A widely extended model is the fermentative yeast Saccharomyces cerevisiae. In this paper, we describe an overview of the molecular mechanisms induced by a decrease in oxygen availability and their interrelationship with the oxidative stress response in yeast. We focus on the differential characteristics between S. cerevisiae and the respiratory yeast Kluyveromyces lactis, a complementary emerging model, in reference to multicellular eukaryotes. PMID:22928082

  8. Effect of a fermented milk containing Bifidobacterium lactis DN-173010 on Chinese constipated women

    PubMed Central

    Yang, Yue-Xin; He, Mei; Hu, Gang; Wei, Jie; Pages, Philippe; Yang, Xian-Hua; Bourdu-Naturel, Sophie

    2008-01-01

    AIM: To investigate the effect of a fermented milk containing Bifidobacterium lactis DN-173010 and yogurt strains (BIO®) on adult women with constipation in Beijing. METHODS: A total of 135 adult females with constipation were randomly allocated to consume for 2 wk either 100 g of the test fermented milk or 100 g of an acidified milk containing non-living bacteria (control). Stool frequency, defecation condition scores, stool consistency and food intake were recorded at baseline and after 1 and 2 wk in an intention-to-treat population of 126 subjects. In parallel, safety evaluation parameters were performed. RESULTS: At baseline, no differences were found between groups. Following consumption of test product, stool frequency was significantly increased after 1 wk (3.5 ± 1.5 vs 2.4 ± 0.6, P < 0.01) and 2 wk (4.1 ± 1.7 vs 2.4 ± 0.6, P < 0.01), vs baseline. Similarly, after 1 and 2 wk, of test product consumption, defecation condition (1.1 ± 0.9 vs 1.9 ± 1.2, P < 0.01 and 0.8 ± 1.0 vs 1.9 ± 1.2, P < 0.01, respectively) and stool consistency (1.0 ± 0.8 vs 1.5 ± 1.1, P < 0.01 and 0.6 ± 0.8 vs 1.5 ± 1.1, P < 0.01, respectively) were significantly improved. Compared with the control group, stool frequency was also significantly increased (3.5 ± 1.5 vs 2.5 ± 0.9, P < 0.01 and 4.1 ± 1.7 vs 2.6 ± 1.0, P < 0.01, respectively), and defecation condition (1.1 ± 0.9 vs 1.6 ± 1.1, P < 0.01 and 0.8 ± 1.0 vs 1.6 ± 1.1, P < 0.01, respectively) and stool consistency (1.0 ± 0.8 vs 1.4 ± 1.0, P < 0.05 and 0.6 ± 0.8 vs 1.3 ± 1.0, P < 0.01, respectively) significantly decreased after 1 and 2 wk of product consumption. During the same period, food intake did not change between the two groups, and safety parameters of the subjects were within normal ranges. CONCLUSION: This study suggests a beneficial effect of a fermented milk containing B. lactis DN-173010 on stool frequency, defecation condition and stool consistency in adult women with constipation constipated women after 1 and 2 wk of consumption. PMID:18985817

  9. Evaluation of viability Bifidobacterium animalis subsp. lactis LKM512 in dogs.

    PubMed

    Nakamura, A; Ohnishi, Y; Shirotori, K; Matsumoto, M

    2015-12-01

    In dogs, gastric acid is not neutralised even when a meal is present in the stomach. Moreover, dogs take longer to digest their meals than humans do. Accordingly, the most important characteristic of any probiotics considered for use in dogs is high acid tolerance. The probiotic strain Bifidobacterium animalis subsp. lactis LKM512 (hereafter referred to as LKM512) not only exhibits potent acid tolerance, but also has the ability to adhere to intestinal mucin. The aim of the present study was to explore the potential of LKM512 as a probiotic in dogs. Specifically, we investigated whether LKM512 can survive in the large intestine in dogs. LKM512 preparations containing 10(10) cfu were administered daily for 14 days in five dogs. Faeces were collected on the day before administration (day 0) as well as on days 7 and 14, and 7 days after administration was halted (day 21). The numbers of viable LKM512 present in faeces were determined by both culture-based techniques and molecular analysis. Changes in intestinal bacterial populations were analysed by 16S rRNA gene semiconductor sequencing using the Ion Torrent Personal Genome Machine (PGM). On days 7 and 14, the numbers of viable LKM512 that were detected in faeces by culture-based techniques and molecular analysis were greater than the original daily dosage. 16S rRNA gene sequence analysis using the PGM indicated that relative proportions of Bifidobacterium spp. and Bifidobacteriaceae were significantly higher after administration than before. The present study demonstrated that LKM512 can survive strong gastric acid, and proliferate in the large intestine of dogs. Therefore, LKM512 may be a useful canine probiotic. PMID:26322543

  10. Crystal Structure of Hexokinase KlHxk1 of Kluyveromyces lactis

    PubMed Central

    Kuettner, E. Bartholomeus; Kettner, Karina; Keim, Antje; Svergun, Dmitri I.; Volke, Daniela; Singer, David; Hoffmann, Ralf; Müller, Eva-Christina; Otto, Albrecht; Kriegel, Thomas M.; Sträter, Norbert

    2010-01-01

    Crystal structures of the unique hexokinase KlHxk1 of the yeast Kluyveromyces lactis were determined using eight independent crystal forms. In five crystal forms, a symmetrical ring-shaped homodimer was observed, corresponding to the physiological dimer existing in solution as shown by small-angle x-ray scattering. The dimer has a head-to-tail arrangement such that the small domain of one subunit interacts with the large domain of the other subunit. Dimer formation requires favorable interactions of the 15 N-terminal amino acids that are part of the large domain with amino acids of the small domain of the opposite subunit, respectively. The head-to-tail arrangement involving both domains of the two KlHxk1 subunits is appropriate to explain the reduced activity of the homodimer as compared with the monomeric enzyme and the influence of substrates and products on dimer formation and dissociation. In particular, the structure of the symmetrical KlHxk1 dimer serves to explain why phosphorylation of conserved residue Ser-15 may cause electrostatic repulsions with nearby negatively charged residues of the adjacent subunit, thereby inducing a dissociation of the homologous dimeric hexokinases KlHxk1 and ScHxk2. Two complex structures of KlHxk1 with bound glucose provide a molecular model of substrate binding to the open conformation and the subsequent classical domain closure motion of yeast hexokinases. The entirety of the novel data extends the current concept of glucose signaling in yeast and complements the induced-fit model by integrating the events of N-terminal phosphorylation and dissociation of homodimeric yeast hexokinases. PMID:20943665

  11. Monte-Carlo modeling of the central carbon metabolism of Lactococcus lactis: insights into metabolic regulation.

    PubMed

    Murabito, Ettore; Verma, Malkhey; Bekker, Martijn; Bellomo, Domenico; Westerhoff, Hans V; Teusink, Bas; Steuer, Ralf

    2014-01-01

    Metabolic pathways are complex dynamic systems whose response to perturbations and environmental challenges are governed by multiple interdependencies between enzyme properties, reactions rates, and substrate levels. Understanding the dynamics arising from such a network can be greatly enhanced by the construction of a computational model that embodies the properties of the respective system. Such models aim to incorporate mechanistic details of cellular interactions to mimic the temporal behavior of the biochemical reaction system and usually require substantial knowledge of kinetic parameters to allow meaningful conclusions. Several approaches have been suggested to overcome the severe data requirements of kinetic modeling, including the use of approximative kinetics and Monte-Carlo sampling of reaction parameters. In this work, we employ a probabilistic approach to study the response of a complex metabolic system, the central metabolism of the lactic acid bacterium Lactococcus lactis, subject to perturbations and brief periods of starvation. Supplementing existing methodologies, we show that it is possible to acquire a detailed understanding of the control properties of a corresponding metabolic pathway model that is directly based on experimental observations. In particular, we delineate the role of enzymatic regulation to maintain metabolic stability and metabolic recovery after periods of starvation. It is shown that the feedforward activation of the pyruvate kinase by fructose-1,6-bisphosphate qualitatively alters the bifurcation structure of the corresponding pathway model, indicating a crucial role of enzymatic regulation to prevent metabolic collapse for low external concentrations of glucose. We argue that similar probabilistic methodologies will help our understanding of dynamic properties of small-, medium- and large-scale metabolic networks models. PMID:25268481

  12. Mapping the ATP binding site in the plasma membrane H(+)-ATPase from Kluyveromyces lactis.

    PubMed

    Sampedro, José G; Nájera, Hugo; Uribe-Carvajal, Salvador; Ruiz-Granados, Yadira G

    2014-11-01

    The plasma membrane H(+)-ATPase from Kluyveromyces lactis contains 14 tryptophan residues. Binding a nucleotide or unfolding with Gnd-HCl quenched intrinsic fluorescence by??60% suggesting that in the H(+)-ATPase-Nucleotide complex there is solvent-mediated collisional quenching of W505 fluorescence. N-bromosuccinimide (NBS) treatment of H(+)-ATPase modified a single W residue in both native and Gnd-HCl-unfolded H(+)-ATPase. Denaturing the H(+)-ATPase with 1% SDS led to expose six tryptophan residues while requiring 17 NBS/H(+)-ATPase. The remaining eight tryptophan residues kept buried indicating a highly stable TM domain. Acrylamide generated static quenching of fluorescence; partial in the native enzyme (V?=?0.43 M(-1)) and complete in the Gnd-HCl-unfolded H(+)-ATPase (V?=?0.81 M(-1)). Collisional quenching (K sv) increased from 3.12 to 7.45 M(-1) upon H(+)-ATPase unfolding. W505 fluorescence titration with NBS yielded a molar ratio of 6 NBS/H(+)-ATPase and quenched???60% fluorescence. In the recombinant N-domain, the distance between W505 and MantATP was estimated to be 21 Å by FRET. The amino acid residues involved in nucleotide binding were identified by N-domain molecular modelling and docking with ATP. In the N-domain/ATP complex model, the distance between W505 and ATP was 20.5 Å. ATP binding leads to a conformational change in the N-domain of H(+)-ATPase that exposes W505 to the environment. PMID:25345860

  13. Isolation and characterization of the RAD59 homologue of Kluyveromyces lactis.

    PubMed

    van den Bosch, M; Zonneveld, J B; Lohman, P H; Pastink, A

    2001-07-01

    Homologous recombination in the yeast Saccharomyces cerevisiae is under the control of the RAD52 epistasis group. Genes belonging to this group show strong conservation during evolution and homologues of most members have been identified in other eukaryotic organisms such as Schizosaccharomyces pombe, Drosophila and mammals. A homologue of the ScRAD59 gene, which shows structural and functional overlap with ScRAD52, has not been identified in other organisms until now. Previous assessment of the ScRAD59 function revealed that the product of this gene is required for certain types of ScRAD51-independent recombination and single-strand annealing. Also, in the distantly related fission yeast, Sch. pombe, a second RAD52 homologue has been identified (rad/22B+), but this gene more closely resembles ScRAD52 than ScRAD59 at the amino-acid level. In this study, the isolation of a homologue of ScRAD59 in Kluyveromyces lactis, KlRAD59, is described. A Klrad159 null allele results in moderate sensitivity to X-rays, indicating that the KlRAD59 gene is involved in the repair of X-ray-induced DNA damage. The amino acids in the putative K1Rad59 protein share 53% identity and 11% similarity with ScRad59. The KlRAD59 gene fully complements both the X-ray-sensitive phenotype and defects in recombination of the Scrad59 mutant strain. Our results underscore the evolutionary conservation of the RAD52 group of genes and provide evidence that the presence of additional RAD52 homologues is not limited to Sac. cerevisiae and Sch. pombe and might be a general phenomenon. PMID:11525403

  14. Les infections urinaires chez les patients insuffisants rénaux chroniques hospitalisés au service de néphrologie: profil bactériologique et facteurs de risque

    PubMed Central

    Chemlal, Abdeljalil; Ismaili, Fatiha Alaoui; Karimi, Ilham; Elharraqui, Ryme; Benabdellah, Nawal; Bekaoui, Samira; Haddiya, Intissar; Bentata, Yassamine

    2015-01-01

    L'infection urinaire chez l'insuffisant rénal est fréquente et particulière dans sa prise en charge diagnostique et thérapeutique. L'objectif de notre étude est de déterminer le profil bactériologique et d’étudier les facteurs de risque des infections urinaires chez le patient insuffisant rénal chronique en milieu de néphrologie. Etude prospective débutée en Septembre 2012 menée au service de néphrologie à l'hôpital régional d'Oujda de l'oriental Marocain. Ont été inclus tous les patients hospitalisés en néphrologie avec une infection urinaire documentée. Nous avons analysé les données démographiques, cliniques, biologiques, et thérapeutiques de nos patients à l'admission et au cours de leurs hospitalisations. 48 épisodes d'infections urinaires chez 43 patients ont été colligés dont 3 enfants. L'incidence de l'infection urinaire dans notre étude était de 4,65%. La médiane d’âge était de 53 (32-66) années. 60,4% étaient de sexe féminin. Le germe isolé était un Escheria Coli dans 58,3% et un Klebsiella dans 29,2%. Le germe isolé était résistant à l'amoxicilline-acide clavulanique dans 83% des cas. L'antibiotique prescris en premiére intention chez nos patients était une céphalosporine de 3 éme génération dans 50%. L’évolution chez nos patients était favorable dans 89,6% des cas. 33,3% avaient présenté un sepsis et on a noté le décès dans 10,4% des cas. Les infections urinaires chez l'insuffisant rénal chronique reste très grave vu leur lourde morbi-mortalié d'où l'intêrét d'un dépistage précoce chez cette population. Un usage raisonné des antibiotiques est nécessaire afin de prévenir l'extension des résistances bactériennes. PMID:26213601

  15. Production of spent mushroom substrate hydrolysates useful for cultivation of Lactococcus lactis by dilute sulfuric acid, cellulase and xylanase treatment.

    PubMed

    Qiao, Jian-Jun; Zhang, Yan-Fei; Sun, Li-Fan; Liu, Wei-Wei; Zhu, Hong-Ji; Zhang, Zhijun

    2011-09-01

    Spent mushroom substrate (SMS) was treated with dilute sulfuric acid followed by cellulase and xylanase treatment to produce hydrolysates that could be used as the basis for media for the production of value added products. A L9 (3(4)) orthogonal experiment was performed to optimize the acid treatment process. Pretreatment with 6% (w/w) dilute sulfuric acid at 120°C for 120 min provided the highest reducing sugar yield of 267.57 g/kg SMS. No furfural was detected in the hydrolysates. Exposure to 20PFU of cellulase and 200 XU of xylanase per gram of pretreated SMS at 40°C resulted in the release of 79.85 g/kg or reducing sugars per kg acid pretreated SMS. The dilute sulfuric acid could be recycled to process fresh SMS four times. SMS hydrolysates neutralized with ammonium hydroxide, sodium hydroxide, or calcium hydroxide could be used as the carbon source for cultivation of Lactococcus lactis subsp. lactis W28 and a cell density of 2.9×10(11)CFU/mL could be obtained. The results provide a foundation for the development of value-added products based on SMS. PMID:21683588

  16. Crystallization and preliminary X-ray diffraction studies of hexokinase KlHxk1 from Kluyveromyces lactis

    SciTech Connect

    Kuettner, E. Bartholomeus; Kriegel, Thomas M.; Keim, Antje; Naumann, Manfred; Sträter, Norbert

    2007-05-01

    Crystals of the enzyme hexokinase 1 from the yeast K. lactis (KlHxk1) suitable for X-ray analysis were obtained in various space groups. Glucose acts as both a carbon source and a hormone-like regulator of gene expression in eukaryotic organisms from yeast to man. Phosphorylation of glucose is executed by hexokinases, which represent a class of multifunctional enzymes that, in addition to their contribution to the uptake and initiation of metabolism of glucose, fructose and mannose, are involved in glucose signalling. The genome of the budding yeast Kluyveromyces lactis encodes a single hexokinase (KlHxk1) and a single glucokinase (KlGlk1). KlHxk1 exists in a monomer–homodimer equilibrium which is presumed to play a role in metabolic regulation. In order to evaluate the physiological significance of KlHxk1 dimerization on a molecular level, the enzyme was crystallized and subjected to X-ray structure analysis. Crystallization employing ammonium sulfate, diammonium phosphate or polyethylene glycol 6000 at pH values of 8.0–9.5 gave seven different crystal forms of KlHxk1. Crystallographic data to 1.66 Å resolution were obtained using synchrotron radiation. Structure determination of KlHxk1 in various packing environments will reveal the full architecture of the homodimeric enzyme and complete our mechanistic understanding of the catalytic and regulatory functions of the enzyme.

  17. Spatial Distribution of Lactococcus lactis Colonies Modulates the Production of Major Metabolites during the Ripening of a Model Cheese.

    PubMed

    Le Boucher, Clémentine; Gagnaire, Valérie; Briard-Bion, Valérie; Jardin, Julien; Maillard, Marie-Bernadette; Dervilly-Pinel, Gaud; Le Bizec, Bruno; Lortal, Sylvie; Jeanson, Sophie; Thierry, Anne

    2015-01-01

    In cheese, lactic acid bacteria are immobilized at the coagulation step and grow as colonies. The spatial distribution of bacterial colonies is characterized by the size and number of colonies for a given bacterial population within cheese. Our objective was to demonstrate that different spatial distributions, which lead to differences in the exchange surface between the colonies and the cheese matrix, can influence the ripening process. The strategy was to generate cheeses with the same growth and acidification of a Lactococcus lactis strain with two different spatial distributions, big and small colonies, to monitor the production of the major ripening metabolites, including sugars, organic acids, peptides, free amino acids, and volatile metabolites, over 1 month of ripening. The monitored metabolites were qualitatively the same for both cheeses, but many of them were more abundant in the small-colony cheeses than in the big-colony cheeses over 1 month of ripening. Therefore, the results obtained showed that two different spatial distributions of L. lactis modulated the ripening time course by generating moderate but significant differences in the rates of production or consumption for many of the metabolites commonly monitored throughout ripening. The present work further explores the immobilization of bacteria as colonies within cheese and highlights the consequences of this immobilization on cheese ripening. PMID:26497453

  18. Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae.

    PubMed

    Sequeiros, Cynthia; Garcés, Marisa E; Vallejo, Marisol; Marguet, Emilio R; Olivera, Nelda L

    2015-04-01

    Bacteriocin-producing Lactococcus lactis TW34 was isolated from marine fish. TW34 bacteriocin inhibited the growth of the fish pathogen Lactococcus garvieae at 5 AU/ml (minimum inhibitory concentration), whereas the minimum bactericidal concentration was 10 AU/ml. Addition of TW34 bacteriocin to L. garvieae cultures resulted in a decrease of six orders of magnitude of viable cells counts demonstrating a bactericidal mode of action. The direct detection of the bacteriocin activity by Tricine-SDS-PAGE showed an active peptide with a molecular mass ca. 4.5 kDa. The analysis by MALDI-TOF-MS detected a strong signal at m/z 2,351.2 that corresponded to the nisin leader peptide mass without the initiating methionine, whose sequence STKDFNLDLVSVSKKDSGASPR was confirmed by MS/MS. Sequence analysis of nisin structural gene confirmed that L. lactis TW34 was a nisin Z producer. This nisin Z-producing strain with probiotic properties might be considered as an alternative in the prevention of lactococcosis, a global disease in aquaculture systems. PMID:25549984

  19. Characterization of phiLC3, a Lactococcus lactis subsp. cremoris temperature bacteriophage with cohesive single-stranded DNA ends.

    PubMed Central

    Lillehaug, D; Lindqvist, B; Birkeland, N K

    1991-01-01

    The temperate bacteriophage phiLC3, isolated from Lactococcus lactis subsp. cremoris, has an isometric head and a flexible tail containing 1 major protein and 8 minor proteins. Infection of a permissive L. lactis host strain yields a burst of about 50 phages per infected cell with a latent period of 60 min. A detailed restriction map of the phage chromosome was constructed by using 12 different restriction enzymes. The phage chromosome is a 33-kb linear double-stranded DNA molecule with unique cohesive ends and with a G + C content of 36.5%. Chemical sequencing of the DNA ends revealed 13-base 3' extended complementary single strands with a relatively high percentage of G + C. Pulsed-field gel electrophoretic analysis of DNA from a strain lysogenized with phiLC3 was used to localize the prophage to a 320-kb BamHI restriction endonuclease fragment from the host chromosomal DNA. This result indicates that lysogeny involves integration of the phage into the host chromosome. A spontaneous phiLC3 clear plaque mutant that was unable to give rise to lysogens was isolated. Images PMID:1840480

  20. Glucose Metabolism in Lactococcus lactis MG1363 under Different Aeration Conditions: Requirement of Acetate To Sustain Growth under Microaerobic Conditions

    PubMed Central

    Nordkvist, Mikkel; Jensen, Niels Bang Siemsen; Villadsen, John

    2003-01-01

    Lactococcus lactis subsp. lactis MG1363 was grown in batch cultures on a defined medium with glucose as the energy source under different aeration conditions, namely, anaerobic conditions, aerobic conditions, and microaerobic conditions with a dissolved oxygen tension of 5% (when saturation with air was used as the reference). The maximum specific growth rate was high (0.78 to 0.91 h−1) under all aeration conditions but decreased with increasing aeration, and more than 90% of the glucose was converted to lactate. However, a shift in by-product formation was observed. Increasing aeration resulted in acetate, CO2, and acetoin replacing formate and ethanol as end products. Under microaerobic conditions, growth came to a gradual halt, although more than 60% of the glucose was still left. A decline in growth was not observed during microaerobic cultivation when acetate was added to the medium. We hypothesize that the decline in growth was due to a lack of acetyl coenzyme A (acetyl-CoA) needed for fatty acid synthesis since acetyl-CoA can be synthesized from acetate by means of acetate kinase and phosphotransacetylase activities. PMID:12788751

  1. Behavior and viability of spontaneous oxidative stress-resistant Lactococcus lactis mutants in experimental fermented milk processing.

    PubMed

    Oliveira, M N; Almeida, K E; Damin, M R; Rochat, T; Gratadoux, J-J; Miyoshi, A; Langella, P; Azevedo, V

    2009-01-01

    Previously, we isolated two strains of spontaneous oxidative (SpOx2 and SpOx3) stress mutants of Lactococcus lactis subsp cremoris. Herein, we compared these mutants to a parental wild-type strain (J60011) and a commercial starter in experimental fermented milk production. Total solid contents of milk and fermentation temperature both affected the acidification profile of the spontaneous oxidative stress-resistant L. lactis mutants during fermented milk production. Fermentation times to pH 4.7 ranged from 6.40 h (J60011) to 9.36 h (SpOx2); V(max) values were inversely proportional to fermentation time. Bacterial counts increased to above 8.50 log(10) cfu/mL. The counts of viable SpOx3 mutants were higher than those of the parental wild strain in all treatments. All fermented milk products showed post-fermentation acidification after 24 h of storage at 4 degrees C; they remained stable after one week of storage. PMID:19731206

  2. Biological characteristics and probiotic effect of Leuconostoc lactis strain isolated from the intestine of black porgy fish.

    PubMed

    Zhang, Wei; Liu, Mingqi; Dai, Xianjun

    2013-01-01

    A strain of lactic acid bacteria, Leuconostoc lactis, was isolated from the intestinal tract of black porgy, Sparus macrocephalus, and identified by conventional biochemical characteristics and 16S rDNA gene sequence analysis. The isolated strain had the ability of bile tolerance and resistance to low pH, and survived well in the trypsinase and pepsin solution. But the highly concentrated dose of trypsinase and pepsin affect the viability of the isolated strain. The isolate was resistant to several antibiotics, including Cephalothin, Ceftriaxone, Imipenem and Tobramycin. The isolate could auto-aggregate itself and coaggregate with other bacteria in vitro. The autoaggregation percentage increased to 23.29% after 20 h of incubation. The percentage of coaggregation were respectively 31.21%, 29.44%, 10.74%, 16.49%, 24.36%, 24.41% and 20.99% for Vibrio parahaemolyticus, Listeria monocytogenes, Escherichia coli O157, Salmonella typhimurium, Shigella, Staphylococcus aureus and Proteusbacillus vulgaris after 20 h incubation of a mixed suspension. The supernatant of the strain inhibited the growth of several pathogens, such as V.parahaemolyticus, Vibrio harveyi, Vibrio alginolyticus, Staphylococcus aureus, Escherichia coli O157, Salmonella typhimurium, Bacillus subtilis, Proteusbacillus vulgaris and Shigella. These results indicated that the isolate, Leuconostoc lactis, might be an attractive candidate for perspectival strain for probiotics in marine aquaculture. PMID:24516418

  3. Lactobacillus delbrueckii ssp. lactis R4 prevents Salmonella typhimurium SL1344-induced damage to tight junctions and adherens junctions.

    PubMed

    Yu, Qinghua; Zhu, Liqi; Wang, Zhisheng; Li, Pengcheng; Yang, Qian

    2012-08-01

    Cell junctions are the gatekeepers of the paracellular route and defend the mucosal barrier. Several enteropathogenic bacteria can invade intestinal epithelial cells by targeting and damaging cell junctions. It is not well understood how Salmonella typhimurium is able to overcome the intestinal barrier and gain access to the circulation, nor is it understood how Lactobacillus prevents the invasion of S. typhimurium. Therefore, we sought to determine whether infection with S. typhimurium SL1344 could regulate the molecular composition of cell junctions and whether Lactobacillus delbrueckii ssp. lactis R4 could affect this modification. Our data demonstrated that infection of Caco-2 cells with S. typhimurium over 2 h resulted in a redistribution of claudin-1, ZO-1, occluding, and E-cadherin. Western blot analysis of epithelial cell lysates demonstrated that S. typhimurium could decrease the expression of cell junction proteins. However, L. delbrueckii ssp. lactis R4 ameliorated this destruction and induced increased expression of ZO-1, occludin, and E-cadherin relative to the levels in the control group. The results of these experiments implied that S. typhimurium may facilitate its uptake and distribution within the host by regulating the molecular composition of cell junctions. Furthermore, Lactobacillus may prevent the adhesion and invasion of pathogenic bacteria by maintaining cell junctions and the mucosal barrier. PMID:22923109

  4. Construction and expression of a heterologous protein in Lactococcus lactis by using the nisin-controlled gene expression system: the case of the PRRSV ORF6 gene.

    PubMed

    Wang, Z H; Wang, Y L; Zeng, X Y

    2014-01-01

    The porcine reproductive and respiratory syndrome virus (PRRSV) continues to be a threat, exerting significant economic effects on the swine industry worldwide. However, none of the current commercially available vaccines can completely prevent respiratory infection, trans-placental transmission, pig-to-pig transmission of the virus, or maintain immune protection in sows. This study provides information on PRRSV and a review of available options for PRRS control strategies based on its pathogenic characteristics, immune properties, and biological characteristics. In this study, the nisin-controlled expression system of Lactococcus lactis was selected as a vector to express the ORF6 gene of PRRSV. Food-grade recombinant, L. lactis PNZ8149/NZ3900-M/PRRS, which contained the lactose operon, was successfully constructed. The molecular weight of the expressed recombinant protein was approximately 19 kDa. Furthermore, the recombinant protein was located on the surface of L. lactis and showed reactogenicity with the antibody against PRRSV. Results of this study are expected to lay a theoretical foundation for development of genetically engineered L. lactis mucosal vaccines and to provide information related to its immune activity and adjuvant effects. PMID:24634130

  5. Acoustic Emission Signal of Lactococcus lactis before and after Inhibition with NaN3 and Infection with Bacteriophage c2

    PubMed Central

    Stencel, John M.; Hicks, Clair D.; Payne, Fred; Ozevin, Didem

    2013-01-01

    The detection of acoustic emission (AE) from Lactococcus lactis, ssp lactis is reported in which emission intensities are used to follow and define metabolic activity during growth in nutrient broths. Optical density (OD) data were also acquired during L. lactis growth at 32°C and provided insight into the timing of the AE signals relative to the lag, logarithmic, and stationary growth phases of the bacteria. The inclusion of a metabolic inhibitor, NaN3, into the nutrient broth eliminated bacteria metabolic activity according to the OD data, the absence of which was confirmed using AE data acquisition. The OD and AE data were also acquired before and after the addition of Bacteriophage c2 in L. lactis containing nutrient broths during the early or middle logarithmic phase; c2 phage m.o.i. (Multiplicity of infection) was varied to help differentiate whether the detected AE was from bacteria cells during lysis or from the c2 phage during genome injection into the cells. It is proposed that AE measurements using piezoelectric sensors are sensitive enough to detect bacteria at the amount near 104?cfu/mL, to provide real time data on bacteria metabolic activity and to dynamically monitor phage infection of cells. PMID:24349820

  6. A novel multi-locus sequence typing (MLST) protocol for Leuconostoc lactis isolates from traditional dairy products in China and Mongolia

    PubMed Central

    2014-01-01

    Background Economically, Leuconostoc lactis is one of the most important species in the genus Leuconostoc. It plays an important role in the food industry including the production of dextrans and bacteriocins. Currently, traditional molecular typing approaches for characterisation of this species at the isolate level are either unavailable or are not sufficiently reliable for practical use. Multilocus sequence typing (MLST) is a robust and reliable method for characterising bacterial and fungal species at the molecular level. In this study, a novel MLST protocol was developed for 50 L. lactis isolates from Mongolia and China. Results Sequences from eight targeted genes (groEL, carB, recA, pheS, murC, pyrG, rpoB and uvrC) were obtained. Sequence analysis indicated 20 different sequence types (STs), with 13 of them being represented by a single isolate. Phylogenetic analysis based on the sequences of eight MLST loci indicated that the isolates belonged to two major groups, A (34 isolates) and B (16 isolates). Linkage disequilibrium analyses indicated that recombination occurred at a low frequency in L. lactis, indicating a clonal population structure. Split-decomposition analysis indicated that intraspecies recombination played a role in generating genotypic diversity amongst isolates. Conclusions Our results indicated that MLST is a valuable tool for typing L. lactis isolates that can be used for further monitoring of evolutionary changes and population genetics. PMID:24912963

  7. Development of a new DNA vaccine based on mycobacterial ESAT-6 antigen delivered by recombinant invasive Lactococcus lactis FnBPA+.

    PubMed

    Pereira, Vanessa Bastos; Saraiva, Tessália Diniz Luerce; Souza, Bianca Mendes; Zurita-Turk, Meritxell; Azevedo, Marcela Santiago Pacheco; De Castro, Camila Prósperi; Mancha-Agresti, Pamela; Dos Santos, Janete Soares Coelho; Santos, Ana Cristina Gomes; Faria, Ana Maria Caetano; Leclercq, Sophie; Azevedo, Vasco; Miyoshi, Anderson

    2015-02-01

    The use of the food-grade bacterium Lactococcus lactis as a vehicle for the oral delivery of DNA vaccine plasmids constitutes a promising strategy for vaccination. The delivery of DNA plasmids into eukaryotic cells is of critical importance for subsequent DNA expression and effectiveness of the vaccine. In this context, the use of the recombinant invasive L. lactis FnBPA+ (fibronectin-binding protein A) strain for the oral delivery of the eukaryotic expression vector vaccination using lactic acid bacteria (pValac), coding for the 6-kDa early secreted antigenic target (ESAT-6) gene of Mycobacterium tuberculosis, could represent a new DNA vaccine strategy against tuberculosis. To this end, the ESAT-6 sequence was cloned into the pValac vector; the L. lactis fibronectin-binding protein A (FnBPA)+ (pValac:ESAT-6) strain was obtained, and its immunological profile was checked in BALB/c mice. This strain was able to significantly increase interferon gamma (IFN-?) production in spleen cells, showing a systemic T helper 1 (Th1) cell response. The mice also showed a significant increase in specific secretory immunoglobulin A (sIgA) production in colon tissue and fecal extracts. Thus, this is the first time that L. lactis has been used to deliver a plasmid DNA harboring a gene that encodes an antigen against tuberculosis through mucous membranes. PMID:25503506

  8. Growth Phase-Dependent Proteomes of the Malaysian Isolated Lactococcus lactis Dairy Strain M4 Using Label-Free Qualitative Shotgun Proteomics Analysis

    PubMed Central

    Yap, Theresa Wan Chen; Rabu, Amir; Abu Bakar, Farah Diba; Abdul Rahim, Raha; Mahadi, Nor Muhammad; Illias, Rosli Md.

    2014-01-01

    Lactococcus lactis is the most studied mesophilic fermentative lactic acid bacterium. It is used extensively in the food industry and plays a pivotal role as a cell factory and also as vaccine delivery platforms. The proteome of the Malaysian isolated L. lactis M4 dairy strain, obtained from the milk of locally bred cows, was studied to elucidate the physiological changes occurring between the growth phases of this bacterium. In this study, ultraperformance liquid chromatography nanoflow electrospray ionization tandem mass spectrometry (UPLC- nano-ESI-MSE) approach was used for qualitative proteomic analysis. A total of 100 and 121 proteins were identified from the midexponential and early stationary growth phases, respectively, of the L. lactis strain M4. During the exponential phase, the most important reaction was the generation of sufficient energy, whereas, in the early stationary phase, the metabolic energy pathways decreased and the biosynthesis of proteins became more important. Thus, the metabolism of the cells shifted from energy production in the exponential phase to the synthesis of macromolecules in the stationary phase. The resultant proteomes are essential in providing an improved view of the cellular machinery of L. lactis during the transition of growth phases and hence provide insight into various biotechnological applications. PMID:24982972

  9. Genome Sequence Analysis of the Biogenic Amine-Producing Strain Lactococcus lactis subsp. cremoris CECT 8666 (Formerly GE2-14)

    PubMed Central

    del Rio, Beatriz; Linares, Daniel M.; Fernandez, Maria; Mayo, Baltasar; Martin, M. Cruz; Alvarez, Miguel A.

    2014-01-01

    We here report a 2,801,031-bp annotated draft assembly for the Lactococcus lactis subsp. cremoris GE2-14 genome. This dairy strain produces the biogenic amine putrescine. This sequence may help identify the mechanisms regulating putrescine biosynthesis and throw light on ways to reduce its presence in fermented foods. PMID:25342694

  10. Nisin production in a chitin-including continuous fermentation system with Lactococcus lactis displaying a cell wall chitin-binding domain.

    PubMed

    ?im?ek, Ömer

    2014-03-01

    The limiting factors in the continuous production of nisin are high amount of biomass loss and low dilution rate application. In this study, a chitin-including continuous nisin fermentation system (CICON-FER) was constructed for high volumetric nisin production using nisin producer L. lactis displaying cell wall chitin-binding domain (ChBD) together with chitin in the reactor. In this respect, the highest binding conditions of relevant L. lactis cells to chitin were determined. Then the chitin flakes carrying nisin-producing L. lactis cells were used within the CICON-FER system at different dilution rates (0.1-0.9 h?¹) and initial glucose concentrations (20-60 g l?¹). The results revealed that the pH 7 conditions and the use of 100 mM sodium phosphate buffer with 0.1 % Tween 20 and Triton X-100 significantly increased the binding capacity of ChBD displaying L. lactis cells to chitin. The constructed CICON-FER system maintained the presence of the ChBD surface displaying L. lactis cells in the reactor system until 0.9 h?¹ dilution rate that resulted in a considerably high level of volumetric nisin production and productivity (10,500 IU ml?¹ and 9,450 IU ml?¹ h?¹, respectively) with the combination of a 0.9-h?¹ dilution rate and a 40-g l?¹ initial glucose concentration. In conclusion, an innovative nisin fermentation system that yielded the highest nisin production thus far and that was feasible for industrial application was created. PMID:24342966

  11. Cold shock proteins of Lactococcus lactis MG1363 are involved in cryoprotection and in the production of cold-induced proteins.

    PubMed

    Wouters, J A; Frenkiel, H; de Vos, W M; Kuipers, O P; Abee, T

    2001-11-01

    Members of the group of 7-kDa cold-shock proteins (CSPs) are the proteins with the highest level of induction upon cold shock in the lactic acid bacterium Lactococcus lactis MG1363. By using double-crossover recombination, two L. lactis strains were generated in which genes encoding CSPs are disrupted: L. lactis NZ9000 Delta AB lacks the tandemly orientated cspA and cspB genes, and NZ9000 Delta ABE lacks cspA, cspB, and cspE. Both strains showed no differences in growth at normal and at low temperatures compared to that of the wild-type strain, L. lactis NZ9000. Two-dimensional gel electrophoresis showed that upon disruption of the cspAB genes, the production of remaining CspE at low temperature increased, and upon disruption of cspA, cspB, and cspE, the production of CspD at normal growth temperatures increased. Northern blot analysis showed that control is most likely at the transcriptional level. Furthermore, it was established by a proteomics approach that some (non-7-kDa) cold-induced proteins (CIPs) are not cold induced in the csp-lacking strains, among others the histon-like protein HslA and the signal transduction protein LlrC. This supports earlier observations (J. A. Wouters, M. Mailhes, F. M. Rombouts, W. M. De Vos, O. P. Kuipers, and T. Abee, Appl. Environ. Microbiol. 66:3756-3763, 2000). that the CSPs of L. lactis might be directly involved in the production of some CIPs upon low-temperature exposure. Remarkably, the adaptive response to freezing by prior exposure to 10 degrees C was significantly reduced in strain NZ9000 Delta ABE but not in strain NZ9000 Delta AB compared to results with wild-type strain NZ9000, indicating a notable involvement of CspE in cryoprotection. PMID:11679342

  12. Growth of infants fed formula supplemented with Bifidobacterium lactis Bb12 or Lactobacillus GG: a systematic review of randomized controlled trials

    PubMed Central

    2013-01-01

    Background Growth is an essential outcome measure for evaluating the safety of any new ingredients, including probiotics, added to infant formulae. The aim of this systematic review was to determine the effects of supplementation of infant formulae with Bifidobacterium lactis Bb12 (B lactis) and/or Lactobacillus rhamnosus GG (LGG) compared with unsupplemented formula on the growth of healthy infants. Methods The MEDLINE, EMBASE, and Cochrane Library databases were searched in June 2013 for relevant randomized controlled trials (RCTs) conducted in healthy term infants. Unpublished data were obtained from the manufacturer of B lactis-supplemented formula. The primary outcome measures were weight, length, and head circumference. Results Nine eligible trials were identified. Compared with unsupplemented controls, supplementation of infant formula with B lactis had no effect on weight gain [4 RCTs, n = 266, mean difference (MD) 0.96 g/day, 95% confidence interval (CI) -0.70 to 2.63)], length gain (4 RCTs, n = 261, MD −0.39 mm/month, 95% CI −1.32 to 0.53), or head circumference gain (3 RCTs, n = 207, MD 0.56 mm/month, 95% CI −0.17 to 1.30). Data limited to one small (n = 105) trial suggest that infants who received standard infant formula supplemented with LGG grew significantly better. No such effect was observed in infants fed hydrolyzed formula supplemented with LGG. Conclusions Supplementation of infant formula with B lactis results in growth similar to what is found in infants fed unsupplemented formula. Limited data do not allow one to reach a conclusion regarding the effect of LGG supplementation on infant growth. PMID:24215626

  13. Increase of stress resistance in Lactococcus lactis via a novel food-grade vector expressing a shsp gene from Streptococcus thermophilus

    PubMed Central

    Tian, Hongtao; Tan, Jianxin; Zhang, Lifang; Gu, Xinxi; Xu, Wentao; Guo, Xinghua; Luo, Yunbo

    2012-01-01

    The effects of the expression of a small heat shock protein (shsp) gene from Streptococcus thermophilus on stress resistance in Lactococcus lactis under different environmental stresses were investigated in this study. pMG36e-shsp, an expression vector, was first constructed by inserting a shsp open reading frame (ORF) cloned from S. thermophilus strain St-QC into pMG36e. Then, a food-grade expression vector, pMG-shsp, was generated by deleting the erythromycin resistance gene from pMG36e-shsp. The transformation rate of pMG-shsp was comparable to that of pMG36e-shsp when each of these two vectors was introduced into L. lactis. These results demonstrated that the shsp ORF could successfully used as a food-grade selection marker in both pMG-shsp and pMG36e-shsp. Furthermore, the growth characteristics were almost the same between L. lactis ML23 transformants harboring pMG36e or pMG-shsp. The survival rate of L. lactis ML23 expressing the shsp ORF were increased to 0.032%, 0.006%, 0.0027%, 0.03%, and 0.16% under the following environmental stresses: heat, acid, ethanol, bile salt and H2O2, respectively. These results indicated that the expression of the shsp gene in the food-grade vector pMG-shsp conferred resistance to environmental stresses without affecting the growth characteristics of L. lactis ML23. PMID:24031940

  14. Survival, acid and bile tolerance, and surface hydrophobicity of microencapsulated B. animalis ssp. lactis Bb12 during storage at room temperature.

    PubMed

    Dianawati, Dianawati; Shah, Nagendra P

    2011-01-01

    Survival, acid and bile tolerance, and surface hydrophobicity of microencapsulated Bifidobacterium animalis ssp. lactis Bb12 were studied during storage at room temperature (25 °C) at low water activity (0.07, 0.1, and 0.2). Two types of alginate-based systems were prepared with and without mannitol as microencapsulant of B. animalis ssp. lactis Bb12. Formation of gel beads containing cells was achieved by dropping each emulsion into CaCl(2) solution; then, the beads were freeze dried. Survival, acid tolerance during 2-h exposure in de Man, Rogosa, Sharpe (MRS) broth at pH 2.0, bile tolerance during 8-h exposure in MRS broth containing taurocholic acid at pH 5.8, and retention of surface hydrophobicity were determined after freeze drying and during storage. The result showed that neither alginate nor alginate-mannitol formulation was effective in protecting B. animalis ssp. lactis Bb12 during freezing and freeze drying. The viability in alginate-mannitol and alginate formulations after freeze drying was 6.61 and 6.34 log CFU/g, respectively. Storage at low a(w) improved survival, acid tolerance, bile tolerance, and surface hydrophobicity retention of microencapsulated B. animalis ssp. lactis Bb12 when compared with controlled storage in an aluminum foil (with a(w) of 0.38 and 0.40 for alginate-mannitol and alginate formulations, respectively). Alginate mannitol was more effective than the alginate system during a short period of storage, but its effectiveness decreased during a long period of storage (80% survival at 10 wk). Nevertheless, storage of microencapsulated B. animalis ssp. lactis Bb12 in an aluminum foil without a(w) adjustment during 10 wk at room temperature was not effective (survival was 64% to 65%). PMID:22416710

  15. Engineering the cell surface display of cohesins for assembly of cellulosome-inspired enzyme complexes on Lactococcus lactis

    PubMed Central

    2010-01-01

    Background The assembly and spatial organization of enzymes in naturally occurring multi-protein complexes is of paramount importance for the efficient degradation of complex polymers and biosynthesis of valuable products. The degradation of cellulose into fermentable sugars by Clostridium thermocellum is achieved by means of a multi-protein "cellulosome" complex. Assembled via dockerin-cohesin interactions, the cellulosome is associated with the cell surface during cellulose hydrolysis, forming ternary cellulose-enzyme-microbe complexes for enhanced activity and synergy. The assembly of recombinant cell surface displayed cellulosome-inspired complexes in surrogate microbes is highly desirable. The model organism Lactococcus lactis is of particular interest as it has been metabolically engineered to produce a variety of commodity chemicals including lactic acid and bioactive compounds, and can efficiently secrete an array of recombinant proteins and enzymes of varying sizes. Results Fragments of the scaffoldin protein CipA were functionally displayed on the cell surface of Lactococcus lactis. Scaffolds were engineered to contain a single cohesin module, two cohesin modules, one cohesin and a cellulose-binding module, or only a cellulose-binding module. Cell toxicity from over-expression of the proteins was circumvented by use of the nisA inducible promoter, and incorporation of the C-terminal anchor motif of the streptococcal M6 protein resulted in the successful surface-display of the scaffolds. The facilitated detection of successfully secreted scaffolds was achieved by fusion with the export-specific reporter staphylococcal nuclease (NucA). Scaffolds retained their ability to associate in vivo with an engineered hybrid reporter enzyme, E. coli β-glucuronidase fused to the type 1 dockerin motif of the cellulosomal enzyme CelS. Surface-anchored complexes exhibited dual enzyme activities (nuclease and β-glucuronidase), and were displayed with efficiencies approaching 104 complexes/cell. Conclusions We report the successful display of cellulosome-inspired recombinant complexes on the surface of Lactococcus lactis. Significant differences in display efficiency among constructs were observed and attributed to their structural characteristics including protein conformation and solubility, scaffold size, and the inclusion and exclusion of non-cohesin modules. The surface-display of functional scaffold proteins described here represents a key step in the development of recombinant microorganisms capable of carrying out a variety of metabolic processes including the direct conversion of cellulosic substrates into fuels and chemicals. PMID:20840763

  16. Effect of Infant Formula Containing a Low Dose of the Probiotic Bifidobacterium lactis CNCM I-3446 on Immune and Gut Functions in C-Section Delivered Babies: A Pilot Study

    PubMed Central

    Baglatzi, L.; Gavrili, S.; Stamouli, K.; Zachaki, S.; Favre, L.; Pecquet, S.; Benyacoub, J.; Costalos, C.

    2016-01-01

    BACKGROUND In the absence of breast-feeding and its immunomodulatory factors, supplementation of starter infant formula (IF) with probiotics is currently used to support immune functions and gut development. AIM To assess whether immune-related beneficial effects of regular dose (107 CFU/g of powder) of the probiotic Bifidobacterium lactis CNCM I-3446 (hereafter named B. lactis) in starter IF supplementation can be maintained with starter IF containing a low dose (104 CFU/g of powder) of B. lactis. METHOD This trial was designed as a pilot, prospective, double-blind, randomized, single-center clinical trial of two parallel groups (n = 77 infants/group) of C-section delivered infants receiving a starter IF containing either low dose or regular dose of the probiotic B. lactis from birth to six months of age. In addition, a reference group of infants breast-fed for a minimum of four months (n = 44 infants), also born by C-section, were included. All groups were then provided follow-up formula without B. lactis up to 12 months of age. Occurrence of diarrhea, immune and gut maturation, responses to vaccinations, and growth were assessed from birth to 12 months. The effect of low-dose B. lactis formula was compared to regular-dose B. lactis formula, considered as reference for IF with probiotics, and both were further compared to breast-feeding as a physiological reference. RESULTS Data showed that feeding low-dose B. lactis IF provides similar effects as feeding regular-dose B. lactis IF or breast milk. No consistent statistical differences regarding early life protection against gastrointestinal infections, immune and gut maturation, microbiota establishment, and growth were observed between randomized formula-fed groups as well as with the breast-fed reference group. CONCLUSION This pilot study suggests that supplementing C-section born neonates with low-dose B. lactis-containing starter formula may impact immune as well as gut maturation similarly to regular-dose B. lactis, close to the breast-feeding reference. PMID:26997881

  17. Novel phage group infecting Lactobacillus delbrueckii subsp. lactis, as revealed by genomic and proteomic analysis of bacteriophage Ldl1.

    PubMed

    Casey, Eoghan; Mahony, Jennifer; Neve, Horst; Noben, Jean-Paul; Dal Bello, Fabio; van Sinderen, Douwe

    2015-02-01

    Ldl1 is a virulent phage infecting the dairy starter Lactobacillus delbrueckii subsp. lactis LdlS. Electron microscopy analysis revealed that this phage exhibits a large head and a long tail and bears little resemblance to other characterized phages infecting Lactobacillus delbrueckii. In vitro propagation of this phage revealed a latent period of 30 to 40 min and a burst size of 59.9 +/- 1.9 phage particles. Comparative genomic and proteomic analyses showed remarkable similarity between the genome of Ldl1 and that of Lactobacillus plantarum phage ATCC 8014-B2. The genomic and proteomic characteristics of Ldl1 demonstrate that this phage does not belong to any of the four previously recognized L. delbrueckii phage groups, necessitating the creation of a new group, called group e, thus adding to the knowledge on the diversity of phages targeting strains of this industrially important lactic acid bacterial species. PMID:25501478

  18. [Isolation of S-adenosyl-L-methionine from an enriched Kluyveromyces lactis mutant, grown in whey media].

    PubMed

    Mincheva, K P; Balutsov, V M

    2002-01-01

    The ability of six lactose-digesting yeast strains to accumulate S-adenosyl-L-methionine (AdoMet) when grown on whey medium was studied. Kluyveromyces lactis ATCC 8585 accumulated the greatest amount of AdoMet (15.2 mg per gram biomass) and was chosen for the development of an Ado-Met-enriched mutant. The Ado-Met-enriched mutant AM-65 was selected from mutants induced with N-methyl-N-nitro-N'-nitrosoguanidine. The strain accumulated 61.6 mg AdoMet per gram biomass. The effect of concentrations of medium components on AdoMet biosynthesis was studied. The ability of the mutant to accumulate AdoMet remained stable after multiple reinoculations. PMID:12325294

  19. Engineering BmpA as a carrier for surface display of IgG-binding domain on Lactococcus lactis.

    PubMed

    Zadravec, Petra; Mavri?, Anja; Bogovi? Matijasic, Bojana; Štrukelj, Borut; Berlec, Aleš

    2014-01-01

    Basic membrane protein A (BmpA) is a potential carrier protein for surface display of the IgG-binding domain on Lactococcus lactis. We have shown that it can increase the adhesion of bacteria to the intestinal cell model by 1.3-fold and have improved BmpA-based surface display by engineering the BmpA molecule. The bulk of the BmpA molecule was shown to be important in surface display; however, limited shortening (variant Bmp1) resulted in a large increase in the surface display ability. The closeness of the N- and the C-terminals in the Bmp1 model and the inefficiency of the spacer suggest that the distance of the passenger from the membrane is not of prime importance in surface display. PMID:24336343

  20. Mucosal and systemic immunity in mice after intranasal immunization with recombinant Lactococcus lactis expressing ORF6 of PRRSV.

    PubMed

    Wang, Zhen-hua; Cao, Xiao-han; Du, Xiao-gang; Feng, Hai-bo; Di-Wang; He-Song; Zeng, Xian-yin

    2014-02-01

    The purpose of the study was to construct mucosal vaccine of a recombinant Lactococcus lactis expressing PRRSV ORF6 gene and evaluate mucosal and systemic immune response against PRRSV in mice after intranasal immunization. The result show that the vaccine can stimulate mice to produce specific IgG in serum and remarkable special s-IgA in lung lavage fluid, at the same time, the contents of cytokines IL-2 and IFN-? of the experimental group were significant higher than those of the control group (P < 0.01), however, the contents of cytokines IL-4 was not different to the all groups. In summary, the constructed mucosal vaccine can significantly induce mucosal immune, humoral immunity and cellular immunity involved Th1 type cytokines, which will lay a theoretical foundation on immune mechanism and new efficient vaccines for PRRSV. PMID:24423464

  1. Recombinant Lactococcus lactis can make the difference in antigen-specific immune tolerance induction, the Type 1 Diabetes case

    PubMed Central

    2014-01-01

    Especially in western civilizations, immune diseases that are driven by innocuous (auto- or allo-) antigens are gradually evolving to become pandemic threats. A particularly poignant example is type 1 diabetes, where young children are confronted with the perspective and consequences of total pancreatic β-cell destruction. Along these disquieting observations we find ourselves equipped with impressively accumulating molecular immunological knowledge on the ins and outs of these pathologies. Often, however, it is difficult to translate this wealth into efficacious medicines. The molecular understanding, the concept of oral tolerance induction, the benefit of using recombinant Lactococcus lactis therein and recent openings towards their clinical use may well enable turning all colors to their appropriate fields on this Rubik's cube. PMID:25185797

  2. Effect of Lactococcus lactis CLFP 100 and Leuconostoc mesenteroides CLFP 196 on Aeromonas salmonicida Infection in brown trout (Salmo trutta).

    PubMed

    Balcázar, José Luis; Vendrell, Daniel; de Blas, Ignacio; Ruiz-Zarzuela, Imanol; Múzquiz, José Luis

    2009-01-01

    Aeromonas salmonicida is the etiological agent of furunculosis in salmonid fish. This pathogen is important from an epizootic perspective because fish surviving an outbreak can remain lifelong asymptomatic carriers, serving as reservoirs of infection. As a result, the early detection and the control of infection are essential to prevent the spread of new furunculosis outbreaks. We have thus analyzed the effect of probiotic administration on the incidence of A. salmonicida in brown trout (Salmo trutta), that were subjected to temperature stress. Treatment with probiotic strains (Lactococcus lactis CLFP 100 and Leuconostoc mesenteroides CLFP 196) resulted in a higher survival rate after challenge, activation of phagocytic cells in the head kidney, and a lower rate of pathogen proliferation in the intestine as determined by real-time PCR. PMID:19556745

  3. Novel Phage Group Infecting Lactobacillus delbrueckii subsp. lactis, as Revealed by Genomic and Proteomic Analysis of Bacteriophage Ldl1

    PubMed Central

    Casey, Eoghan; Mahony, Jennifer; Neve, Horst; Noben, Jean-Paul; Dal Bello, Fabio

    2014-01-01

    Ldl1 is a virulent phage infecting the dairy starter Lactobacillus delbrueckii subsp. lactis LdlS. Electron microscopy analysis revealed that this phage exhibits a large head and a long tail and bears little resemblance to other characterized phages infecting Lactobacillus delbrueckii. In vitro propagation of this phage revealed a latent period of 30 to 40 min and a burst size of 59.9 ± 1.9 phage particles. Comparative genomic and proteomic analyses showed remarkable similarity between the genome of Ldl1 and that of Lactobacillus plantarum phage ATCC 8014-B2. The genomic and proteomic characteristics of Ldl1 demonstrate that this phage does not belong to any of the four previously recognized L. delbrueckii phage groups, necessitating the creation of a new group, called group e, thus adding to the knowledge on the diversity of phages targeting strains of this industrially important lactic acid bacterial species. PMID:25501478

  4. Effect of Fermentation Conditions on Growth of Streptococcus cremoris AM2 and Leuconostoc lactis CNRZ 1091 in Pure and Mixed Cultures

    PubMed Central

    Boquien, Clair-Yves; Corrieu, Georges; Desmazeaud, Michel J.

    1988-01-01

    Two strains of mesophilic lactic acid bacteria, Streptococcus cremoris AM2 and Leuconostoc lactis CNRZ 1091, were grown in pure and mixed cultures in the presence or absence of citrate (15 mM) and at controlled (pH 6.5) or uncontrolled pH. Microbial cell densities at the end of growth, maximum growth rates, the pH decrease of the medium resulting from growth, and the corresponding acidification rates were determined to establish comparisons. The control of pH in pure cultures had no effect on L. lactis CNRZ 1091 populations. The final populations of S. cremoris AM2, however, were at least five times higher than when the pH was not controlled (4 × 108 vs. 2 × 109 CFU · ml?1). The pH had no effect on the growth rate of either strain. That of S. cremoris AM2 (0.8 h?1) was about twice that of L. lactis CNRZ 1091. When the pH fell below 5, the growth of both strains decreased or stopped altogether. Citrate had no effect on S. cremoris AM2, while final populations of L. lactis CNRZ 1091 were two to three times higher (3 × 108 CFU · ml?1); it had no effect on the maximum growth rates of the two strains. Citrate attenuated the pH decrease of the medium and reduced the maximum acidification rate of the culture by 50%, due to the growth of S. cremoris AM2. Acidification due to L. lactis CNRZ 1091, however, was very slight. Regardless of the conditions of pH and citrate, the total bacterial population in mixed culture was lower (by 39%) than that of the sum of each pure culture. Mixed culture improved the maximum growth rate of L. lactis CNRZ 1091 (0.6 h?1) by 50%, while that of S. cremoris AM2 was unaffected. The acidification rate of the growth medium in mixed culture, affected by the presence of citrate, resulted from the development and activity of S. cremoris AM2. PMID:16347760

  5. Contribution of citrate metabolism to the growth of Lactococcus lactis CRL264 at low pH.

    PubMed

    Sánchez, Claudia; Neves, Ana Rute; Cavalheiro, João; dos Santos, Margarida Moreira; García-Quintáns, Nieves; López, Paloma; Santos, Helena

    2008-02-01

    Lactococcus lactis subsp. lactis biovar diacetylactis CRL264 is a natural strain isolated from cheese (F. Sesma, D. Gardiol, A. P. de Ruiz Holgado, and D. de Mendoza, Appl. Environ. Microbiol. 56:2099-2103, 1990). The effect of citrate on the growth parameters at a very acidic pH value was studied with this strain and with derivatives whose citrate uptake capacity was genetically manipulated. The culture pH was maintained at 4.5 to prevent alkalinization of the medium, a well-known effect of citrate metabolism. In the presence of citrate, the maximum specific growth rate and the specific glucose consumption rate were stimulated. Moreover, a more efficient energy metabolism was revealed by analysis of the biomass yields relative to glucose consumption or ATP production. Thus, it was shown that the beneficial effect of citrate on growth under acid stress conditions is not primarily due to the concomitant alkalinization of the medium but stems from less expenditure of ATP, derived from glucose catabolism, to achieve pH homeostasis. After citrate depletion, a deleterious effect on the final biomass was apparent due to organic acid accumulation, particularly acetic acid. On the other hand, citrate metabolism endowed cells with extra ability to counteract lactic and acetic acid toxicity. In vivo 13C nuclear magnetic resonance provided strong evidence for the operation of a citrate/lactate exchanger. Interestingly, the greater capacity for citrate transport correlated positively with the final biomass and growth rates of the citrate-utilizing strains. We propose that increasing the citrate transport capacity of CRL264 could be a useful strategy to improve further the ability of this strain to cope with strongly acidic conditions. PMID:18156322

  6. Contribution of Citrate Metabolism to the Growth of Lactococcus lactis CRL264 at Low pH?

    PubMed Central

    Sánchez, Claudia; Neves, Ana Rute; Cavalheiro, João; dos Santos, Margarida Moreira; García-Quintáns, Nieves; López, Paloma; Santos, Helena

    2008-01-01

    Lactococcus lactis subsp. lactis biovar diacetylactis CRL264 is a natural strain isolated from cheese (F. Sesma, D. Gardiol, A. P. de Ruiz Holgado, and D. de Mendoza, Appl. Environ. Microbiol. 56:2099-2103, 1990). The effect of citrate on the growth parameters at a very acidic pH value was studied with this strain and with derivatives whose citrate uptake capacity was genetically manipulated. The culture pH was maintained at 4.5 to prevent alkalinization of the medium, a well-known effect of citrate metabolism. In the presence of citrate, the maximum specific growth rate and the specific glucose consumption rate were stimulated. Moreover, a more efficient energy metabolism was revealed by analysis of the biomass yields relative to glucose consumption or ATP production. Thus, it was shown that the beneficial effect of citrate on growth under acid stress conditions is not primarily due to the concomitant alkalinization of the medium but stems from less expenditure of ATP, derived from glucose catabolism, to achieve pH homeostasis. After citrate depletion, a deleterious effect on the final biomass was apparent due to organic acid accumulation, particularly acetic acid. On the other hand, citrate metabolism endowed cells with extra ability to counteract lactic and acetic acid toxicity. In vivo 13C nuclear magnetic resonance provided strong evidence for the operation of a citrate/lactate exchanger. Interestingly, the greater capacity for citrate transport correlated positively with the final biomass and growth rates of the citrate-utilizing strains. We propose that increasing the citrate transport capacity of CRL264 could be a useful strategy to improve further the ability of this strain to cope with strongly acidic conditions. PMID:18156322

  7. Short communication: Bacteriocin KC24 produced by Lactococcus lactis KC24 from kimchi and its antilisterial effect in UHT milk.

    PubMed

    Han, E J; Lee, N-K; Choi, S Y; Paik, H-D

    2013-01-01

    The severity of Listeria monocytogenes infections emphasizes the need for prevention or elimination of the pathogen from dairy products. Lactococcus lactis KC24, isolated from kimchi, exhibited an antimicrobial effect against food pathogens, including L. monocytogenes ATCC 15313. Lactococcus lactis KC24 was cultured in a 5-L jar fermenter at 35°C, and bacteriocin activity was maximal at 4 h of incubation and persisted for 20 h. Bacteriocin KC24 was inactivated by protease XIV, indicating that it has a proteinaceous nature. Bacteriocin activity was maintained at pH 3.0 to 9.0 and at temperatures of 50 to 121°C. The mode of inhibition against L. monocytogenes ATCC 15313 was shown to involve a bactericidal effect by treatment with 100 and 200 arbitrary units (AU)/mL of bacteriocin KC24. To test the activity of bacteriocin KC24 in a food product, bacteriocin KC24 and nisin (100 and 200 AU/mL) with 4 log cfu/mL of a mixed culture of L. monocytogenes (ATCC 15313, ScottA, H7962, and H7762) were applied to UHT milk. Compared with the control, treatment with bacteriocin KC24 completely inhibited the growth of L. monocytogenes and resulted in no detectable L. monocytogenes after 14 d at 4°C, whereas nisin moderately inhibited L. monocytogenes, resulting in a final concentration after 14 d at 4°C higher than the initial inoculum. Bacteriocin KC24 may prove useful in improving the safety of dairy products. PMID:23127914

  8. A Starter Culture Rotation Strategy Incorporating Paired Restriction/ Modification and Abortive Infection Bacteriophage Defenses in a Single Lactococcus lactis Strain

    PubMed Central

    Durmaz, E.; Klaenhammer, T. R.

    1995-01-01

    Three derivatives of Lactococcus lactis subsp. lactis NCK203, each with a different pair of restriction/ modification (R/M) and abortive infection (Abi) phage defense systems, were constructed and then rotated in repeated cycles of a milk starter culture activity test (SAT). The rotation proceeded successfully through nine successive SATs in the presence of phage and whey containing phage from previous cycles. Lactococcus cultures were challenged with 2 small isometric-headed phages, (phi)31 and ul36, in one rotation series and with a composite of 10 industrial phages in another series. Two native lactococcal R(sup+)/M(sup+) plasmids, pTRK68 and pTRK11, and one recombinant plasmid, pTRK308, harboring a third distinct R/M system were incorporated into three NCK203 derivatives constructed separately for the rotation. The R(sup+)/M(sup+) NCK203 derivatives were transformed with high-copy-number plasmids encoding four Abi genes, abiA, abiC, per31, and per50. Various Abi and R/M combinations constructed in NCK203 were evaluated for their effects on cell growth, level of phage resistance, and retardation of phage development during repeated cycles of the SAT. The three NCK203 derivatives chosen for use in the SAT exhibited additive effects of the R/M and Abi phenotypes against sensitive phages. In such combinations, phage escaping restriction are prevented from completing their infective cycle by an abortive response that kills the host cell. The rotation series successfully controlled modified, recombinant, and mutant phages which were resistant to any one of the individual defense systems by presenting a different set of R/M and Abi defenses in the next test of the rotation. PMID:16534987

  9. Saccharomyces cerevisiae Bat1 and Bat2 Aminotransferases Have Functionally Diverged from the Ancestral-Like Kluyveromyces lactis Orthologous Enzyme

    PubMed Central

    Colón, Maritrini; Hernández, Fabiola; López, Karla; Quezada, Héctor; González, James; López, Geovani; Aranda, Cristina; González, Alicia

    2011-01-01

    Background Gene duplication is a key evolutionary mechanism providing material for the generation of genes with new or modified functions. The fate of duplicated gene copies has been amply discussed and several models have been put forward to account for duplicate conservation. The specialization model considers that duplication of a bifunctional ancestral gene could result in the preservation of both copies through subfunctionalization, resulting in the distribution of the two ancestral functions between the gene duplicates. Here we investigate whether the presumed bifunctional character displayed by the single branched chain amino acid aminotransferase present in K. lactis has been distributed in the two paralogous genes present in S. cerevisiae, and whether this conservation has impacted S. cerevisiae metabolism. Principal Findings Our results show that the KlBat1 orthologous BCAT is a bifunctional enzyme, which participates in the biosynthesis and catabolism of branched chain aminoacids (BCAAs). This dual role has been distributed in S. cerevisiae Bat1 and Bat2 paralogous proteins, supporting the specialization model posed to explain the evolution of gene duplications. BAT1 is highly expressed under biosynthetic conditions, while BAT2 expression is highest under catabolic conditions. Bat1 and Bat2 differential relocalization has favored their physiological function, since biosynthetic precursors are generated in the mitochondria (Bat1), while catabolic substrates are accumulated in the cytosol (Bat2). Under respiratory conditions, in the presence of ammonium and BCAAs the bat1Δ bat2Δ double mutant shows impaired growth, indicating that Bat1 and Bat2 could play redundant roles. In K. lactis wild type growth is independent of BCAA degradation, since a Klbat1Δ mutant grows under this condition. Conclusions Our study shows that BAT1 and BAT2 differential expression and subcellular relocalization has resulted in the distribution of the biosynthetic and catabolic roles of the ancestral BCAT in two isozymes improving BCAAs metabolism and constituting an adaptation to facultative metabolism. PMID:21267457

  10. Characterization of UreG, identification of a UreD-UreF-UreG complex, and evidence suggesting that a nucleotide-binding site in UreG is required for in vivo metallocenter assembly of Klebsiella aerogenes urease.

    PubMed Central

    Moncrief, M B; Hausinger, R P

    1997-01-01

    In vivo urease metallocenter assembly in Klebsiella aerogenes requires the presence of several accessory proteins (UreD, UreF, and UreG) and is further facilitated by UreE. In this study, UreG was isolated and shown to be a monomer with an Mr of 21,814 +/- 20 based on gel filtration chromatography and mass spectrometric results. Although it contains a P-loop motif typically found in nucleotide-binding proteins, UreG did not bind or hydrolyze ATP or GTP, and it exhibited no affinity for ATP- and GTP-linked agarose resins. Site-directed mutagenesis of ureG allowed the substitution of Ala for Lys-20 or Thr-21 in the P-loop motif and resulted in the production of inactive urease in cells grown in the presence of nickel; hence, an intact P-loop may be essential for UreG to function in vivo. These mutant cells were unable to synthesize the UreD-UreF-UreG-urease apoprotein species that are thought to be the key urease activation complexes in the cell. An insoluble protein species containing UreD, UreF, and UreG (termed the DFG complex) was detected in cells carrying deletions in ureE and the urease structural genes. The DFG complex was solubilized in 0.5% Triton X-100 detergent, shown to bind to an ATP-linked agarose resin, and found to elute from the resin in the presence of Mg-ATP. In cells containing a UreG P-loop variant, the DFG complex was formed but did not bind to the nucleotide-linked resin. These results suggest that the UreG P-loop motif may be essential for nucleotide binding by the DFG complex and support the hypothesis that nucleotide hydrolysis is required for in vivo urease metallocenter assembly. PMID:9209019

  11. New insights into the complex regulation of the glycolytic pathway in Lactococcus lactis. I. Construction and diagnosis of a comprehensive dynamic model.

    PubMed

    Dolatshahi, Sepideh; Fonseca, Luis L; Voit, Eberhard O

    2016-01-15

    This article and the companion paper use computational systems modeling to decipher the complex coordination of regulatory signals controlling the glycolytic pathway in the dairy bacterium Lactococcus lactis. In this first article, the development of a comprehensive kinetic dynamic model is described. The model is based on in vivo NMR data that consist of concentration trends in key glycolytic metabolites and cofactors. The model structure and parameter values are identified with a customized optimization strategy that uses as its core the method of dynamic flux estimation. For the first time, a dynamic model with a single parameter set fits all available glycolytic time course data under anaerobic operation. The model captures observations that had not been addressed so far and suggests the existence of regulatory effects that had been observed in other species, but not in L. lactis. The companion paper uses this model to analyze details of the dynamic control of glycolysis under aerobic and anaerobic conditions. PMID:26609637

  12. Production of a recombinant type 1 antifreeze protein analogue by L. lactis and its applications on frozen meat and frozen dough.

    PubMed

    Yeh, Chuan-Mei; Kao, Bi-Yu; Peng, Hsuan-Jung

    2009-07-22

    In this study, a novel recombinant type I antifreeze protein analogue (rAFP) was produced and secreted by Lactococcus lactis, a food-grade microorganism of major commercial importance. Antifreeze proteins are potent cryogenic protection agents for the cryopreservation of food and pharmaceutical materials. A food-grade expression and fermentation system (BSE- and antibiotic-free) for the production and secretion of high levels of rAFP was developed. Lyophilized, crude rAFP produced by L. lactis was tested in a frozen meat and frozen dough processing model. The frozen meat treated with the antifreeze protein showed less drip loss, less protein loss, and a high score on juiciness by sensory evaluation. Frozen dough treated with the rAFP showed better fermentation capacity than untreated frozen dough. Breads baked from frozen dough treated with rAFP acquired the same consumer acceptance as fresh bread. PMID:19545118

  13. Production and purification of staphylococcal nuclease in Lactococcus lactis using a new expression-secretion system and a pH-regulated mini-reactor

    PubMed Central

    2010-01-01

    Background Staphylococcal (or micrococcal) nuclease or thermonuclease (SNase or Nuc) is a naturally-secreted nucleic acid degrading enzyme that participates in Staphylococcus aureus spread in the infected host. Purified Nuc protein can be used as an exogenous reagent to clear cellular extracts and improve protein purification. Here, a recombinant form of Nuc was produced and secreted in a Gram-positive host, Lactococcus lactis, and purified from the culture medium. Results The gene segment corresponding to the S. aureus nuclease without its signal peptide was cloned in an expression-secretion vector. It was then fused to a lactococcal sequence encoding a signal peptide, and expressed under the control of a lactococcal promoter that is inducible by zinc starvation. An L. lactis subsp cremoris model strain (MG1363) transformed with the resulting plasmid was grown in either of two media (GM17v and CDM) that are free of animal compounds, allowing GMP (Good Manufacturing Practice) production. Induction conditions (concentration of the metal chelator EDTA and timing of addition) in small-scale pH-regulated fermentors were optimized using LacMF (Lactis Multi-Fermentor), a home-made parallel fermentation control system able to monitor 12 reactors simultaneously. Large amounts of recombinant Nuc (rNuc) were produced and secreted in both media, and rNuc was purified from GM17v medium in a single-step procedure. Conclusions In L. lactis, rNuc production and secretion were optimal after induction by 0.5 mM EDTA in small scale (200 mL) GM17v exponential phase cultures (at an OD600 of 2), leading to a maximal protein yield of 210 mg per L of culture medium. Purified rNuc was highly active, displaying a specific activity of 2000 U/mg. PMID:20492646

  14. The lactose transporter in Leuconostoc lactis is a new member of the LacS subfamily of galactoside-pentose-hexuronide translocators.

    PubMed Central

    Vaughan, E E; David, S; de Vos, W M

    1996-01-01

    The gene encoding the lactose transport protein (lacS) of Leuconostoc lactis NZ6009 has been cloned from its native lactose plasmid, pNZ63, by functional complementation of lactose permease-deficient Escherichia coli mutants. Nucleotide sequence analysis revealed an open reading frame with the capacity to encode a protein of 639 amino acids which had limited but significant identity to the lactose transport carriers (LacS) of Streptococcus thermophilus (34.5%) and Lactobacillus bulgaricus (35.6%). This similarity was present both in the amino-terminal hydrophobic carrier domain, which is homologous to the E. coli melibiose transporter, and in the carboxy-terminal enzyme IIA-like regulatory domain. The flanking regions of DNA surrounding lacS were also sequenced. Preceding the lacS gene was a small open reading frame in the same orientation encoding a deduced 95-amino-acid protein with a sequence similar to the amino-terminal portion of beta-galactosidase I from Bacillus stearothermophilus. The lacS gene was separated from the downstream beta-galactosidase genes (lacLM) by 2 kb of DNA containing an IS3-like insertion sequence, which is a novel arrangement for lac genes in comparison with that in other lactic acid bacteria. The lacS gene was cloned in an E. coli-Streptococcus shuttle vector and was expressed both in a lacS deletion derivative of S. thermophilus and in a pNZ63-cured strain, L. lactis NZ6091. The role of the LacS protein was confirmed by uptake assays in which substantial uptake of radiolabeled lactose or galactose was observed with L. lactis or S. thermophilus plasmids harboring an intact lacS gene. Furthermore, galactose uptake was observed in NZ6091, suggesting the presence of at least one more transport system for galactose in L. lactis. PMID:8633855

  15. Fermentation and aerobic metabolism of cellodextrins by yeasts. [Candida wickerhamii; C. guiliermondii; C. molischiana; Debaryomyces polymorphus; Pichia guilliermondii; Clavispora lusitaniae; Kluyveromyces lactis; Brettanomyces claussenii; Rhodotorula minuta; Dekkera intermedia

    SciTech Connect

    Freer, S.N. )

    1991-03-01

    The fermentation and aerobic metabolism of cellodextrins by 14 yeast species or strains was monitored. When grown aerobically, Candida wickerhamii, C. guilliermondii, and C. molischiana metabolized cellodextrins of degree of polymerization 3 to 6. C. wicherhamii and C. molischiana also fermented these substrates, while C. guilliermondii fermented only cellodextrins of degree of polymerization {<=} 3. Debaryomyces polymorphus, Pichia guilliermondii, Clavispora lusitaniae, and one of two strains of Kluyveromyces lactis metabolized glucose, cellobiose, and cellotriose when grown aerobically. These yeasts also fermented these substrates, except for K. lactis, which fermented only glucose and cellobiose. The remaining species/strains tested, K. lactis, Brettanomyces claussenii, Brettanomyces anomalus, Kluyveromyces dobzhanskii, Rhodotorula minuta, and Dekkera intermedia, both fermented and aerobically metabolized glucose and cellobiose. Crude enzyme preparations from all 14 yeast species or strains were tested for ability to hydrolyze cellotriose and cellotretose. Most of the yeasts produced an enzyme(s) capable of hydrolyzing cellotriose. However, with two exceptions, R. minuta and P. guilliermondii, only the yeasts that metabolized cellodextrins of degree of polymerization >3 produced an enzyme(s) that hydrolyzed cellotretose.

  16. In vitro studies of Lactobacillus delbrueckii subsp. lactis in Atlantic salmon (Salmo salar L.) foregut: tissue responses and evidence of protection against Aeromonas salmonicida subsp. salmonicida epithelial damage.

    PubMed

    Salinas, Irene; Myklebust, Reidar; Esteban, Maria Angeles; Olsen, Rolf Erik; Meseguer, José; Ringø, Einar

    2008-04-01

    Probiotic bacteria increase the host health status and protect mucosal tissue against pathogen-caused damage in mammalian models. Using an in vitro (intestinal sac) method this study aimed to address (a) the in vitro ability of Lactobacillus delbrueckii subsp. lactis to remain in the gastrointestinal tract of Atlantic salmon (Salmo salar L.) and (b) its ability to prevent cellular damage caused by successive incubation with Aeromonas salmonicida subsp. salmonicida the causative agent of furunculosis. Short in vitro incubation of salmon foregut with (TRITC)-labelled L. delbrueckii subsp. lactis showed that the probiont was able to colonize the enterocyte surface as studied by confocal microscopy. Furthermore, foregut incubated with the probiotic bacteria only, resulted in a healthy intestinal barrier whereas exposure to A. salmonicida disrupted its integrity. However, pre-treatment of salmon intestine with L. delbrueckii subsp. lactis prevented Aeromonas damaging effects. These results are promising in the context of the use of non-autochthonous probiotic bacteria as prophylactic agents against fish bacterial infections in the gastrointestinal tract. PMID:18054448

  17. Cloning and Expression of Plantaricin W Produced by Lactobacillus plantarum U10 Isolate from "Tempoyak" Indonesian Fermented Food as Immunity Protein in Lactococcus lactis.

    PubMed

    Lages, Aksar Chair; Mustopa, Apon Zaenal; Sukmarini, Linda; Suharsono

    2015-10-01

    Plantaricins, one of bacteriocin produced by Lactobacillus plantarum, are already known to have activities against several pathogenic bacterium. L. plantarum U10 isolated from "tempoyak," an Indonesian fermented food, produced one kind of plantaricin designated as plantaricin W (plnW). The plnW is suggested as a putative membrane location of protein and has similar conserved motif which is important as immunity to bacteriocin itself. Thus, due to study about this plantaricin, several constructs have been cloned and protein was analyzed in Lactococcus lactis. In this study, plnW gene was successfully cloned into vector NICE system pNZ8148 and created the transformant named L. lactis NZ3900 pNZ8148-WU10. PlnW protein was 25.3 kDa in size. The concentration of expressed protein was significantly increased by 10 ng/mL nisin induction. Furthermore, PlnW exhibited protease activity with value of 2.22 ± 0.05 U/mL and specific activity about 1.65 ± 0.03 U/mg protein with 50 ng/mL nisin induction. Immunity study showed that the PlnW had immunity activity especially against plantaricin and rendered L. lactis recombinant an immunity broadly to other bacteriocins such as pediocin, fermentcin, and acidocin. PMID:26276444

  18. Immunoprotection against influenza H5N1 virus by oral administration of enteric-coated recombinant Lactococcus lactis mini-capsules.

    PubMed

    Lei, Han; Xu, Yuhong; Chen, Jian; Wei, Xiaohui; Lam, Dominic Man-Kit

    2010-11-25

    Edible vaccines that can be made widely available and easily administered could bring great benefit to the worldwide battle against pandemic viral infections. They can be used not only for the vaccination of humans and domesticated animals, but also for wild herds and live stock which are otherwise difficult to vaccinate. In this study, we report the development of an edible mini-capsule form of live, non-persisting, recombinant Lactococcus lactis (L. lactis) vaccine against the highly virulent influenza H5N1 strain. Recombinant L. lactis-based H5N1 HA antigen expression constructs were made and shown to be able to induce higher levels of HA-specific serum IgG and fecal IgA antibody production after oral administration. The vectors were then formulated into a mini-capsule dosage form and fed to mouse. Four doses of oral administration rendered complete protection of the mouse against lethal challenges of H5N1 virus. PMID:20850860

  19. On Lactococcus lactis UL719 competitivity and nisin (Nisaplin®) capacity to inhibit Clostridium difficile in a model of human colon

    PubMed Central

    Le Lay, Christophe; Fernandez, Benoit; Hammami, Riadh; Ouellette, Marc; Fliss, Ismail

    2015-01-01

    Clostridium difficile is the most frequently identified enteric pathogen in patients with nosocomially acquired, antibiotic-associated diarrhea and pseudomembranous colitis. Although metronidazole and vancomycin were effective, an increasing number of treatment failures and recurrence of C. difficile infection are being reported. Use of probiotics, particularly metabolically active lactic acid bacteria, was recently proposed as an alternative for the medical community. The aim of this study was to assess a probiotic candidate, nisin Z-producer Lactococcus lactis UL719, competitivity and nisin (Nisaplin®) capacity to inhibit C. difficile in a model of human colon. Bacterial populations was enumerated by qPCR coupled to PMA treatment. L. lactis UL719 was able to survive and proliferate under simulated human colon, did not alter microbiota composition, but failed to inhibit C. difficile. While a single dose of 19 μmol/L (5× the MIC) was not sufficient to inhibit C. difficile, nisin at 76 μmol/L (20×the MIC) was effective at killing the pathogen. Nisin (at 76 μmol/L) caused some temporary changes in the microbiota with Gram-positive bacteria being the mostly affected. These results highlight the capacity of L. lactis UL719 to survive under simulated human colon and the efficacy of nisin as an alternative in the treatment of C. difficile infections. PMID:26441942

  20. Establishing the Yeast Kluyveromyces lactis as an Expression Host for Production of the Saposin-Like Domain of the Aspartic Protease Cirsin

    PubMed Central

    Curto, Pedro; Lufrano, Daniela; Pinto, Cátia; Custódio, Valéria; Gomes, Ana Catarina; Trejo, Sebastián A.; Bakás, Laura; Vairo-Cavalli, Sandra; Faro, Carlos

    2014-01-01

    Typical plant aspartic protease zymogens comprise a characteristic and plant-specific insert (PSI). PSI domains can interact with membranes, and a role as a defensive weapon against pathogens has been proposed. However, the potential of PSIs as antimicrobial agents has not been fully investigated and explored yet due to problems in producing sufficient amounts of these domains in bacteria. Here, we report the development of an expression platform for the production of the PSI domain of cirsin in the generally regarded as safe (GRAS) yeast Kluyveromyces lactis. We successfully generated K. lactis transformants expressing and secreting significant amounts of correctly processed and glycosylated PSI, as well as its nonglycosylated mutant. A purification protocol with protein yields of ∼4.0 mg/liter was established for both wild-type and nonglycosylated PSIs, which represents the highest reported yield for a nontagged PSI domain. Subsequent bioactivity assays targeting phytopathogenic fungi indicated that the PSI of cirsin is produced in a biologically active form in K. lactis and provided clear evidence for its antifungal activity. This yeast expression system thereby emerges as a promising production platform for further exploring the biotechnological potential of these plant saposin-like proteins. PMID:24123748

  1. Lactococcus lactis BFE920 activates the innate immune system of olive flounder (Paralichthys olivaceus), resulting in protection against Streptococcus iniae infection and enhancing feed efficiency and weight gain in large-scale field studies.

    PubMed

    Kim, Daniel; Beck, Bo Ram; Heo, Saet-Byeol; Kim, Jungjoon; Kim, Hyun Duk; Lee, Sun-Min; Kim, Youngchan; Oh, So Young; Lee, Kyungro; Do, HyungKi; Lee, KwanHee; Holzapfel, Wilhelm H; Song, Seong Kyu

    2013-11-01

    The protective effect of a food-grade lactic acid bacterium Lactococcus lactis BFE920 against disease of olive flounder (Paralichthys olivaceus) cultivated on a large scale was studied. Initially, antimicrobial activity of L. lactis against several fish pathogens was evaluated in vitro; the probiotic showed strong antibacterial activity against Streptococcus iniae, Streptococcus parauberis and Enterococcus viikkiensis, and moderate activity against Lactococcus garviae. When olive flounders were fed for two weeks with experimental diets containing varying concentrations of L. lactis (1 × 10(6), 5 × 10(6), 2.5 × 10(7) and 1.25 × 10(8) CFU/g feed), all the experimental feed groups showed 68-77% survival upon challenge with S. iniae. A field-scale feeding trial with L. lactis dietary supplement was conducted in a local fish farm (n = 12,000) for three months, and disease resistance, innate immune parameters and growth performance were evaluated. The average weight gain and feed efficiency were increased up to 6.8% and 8.5%, respectively. At the end of the feeding trial, the olive flounders were challenged with S. iniae. The L. lactis-fed group was protected from S. iniae challenge with a 66% survival rate. This disease protection is due to the flounder's innate immunity activated by the L. lactis administration: increased lysosomal activities and production of IL-12 and IFN-?. These data clearly indicated that L. lactis BFE920 may be developed as a functional feed additive for protection against diseases, and for enhancement of feed efficiency and weight gain in olive flounder farming. PMID:24041843

  2. Effects of Roundup(®) and glyphosate on three food microorganisms: Geotrichum candidum, Lactococcus lactis subsp. cremoris and Lactobacillus delbrueckii subsp. bulgaricus.

    PubMed

    Clair, Emilie; Linn, Laura; Travert, Carine; Amiel, Caroline; Séralini, Gilles-Eric; Panoff, Jean-Michel

    2012-05-01

    Use of many pesticide products poses the problem of their effects on environment and health. Amongst them, the effects of glyphosate with its adjuvants and its by-products are regularly discussed. The aim of the present study was to shed light on the real impact on biodiversity and ecosystems of Roundup(®), a major herbicide used worldwide, and the glyphosate it contains, by the study of their effects on growth and viability of microbial models, namely, on three food microorganisms (Geotrichum candidum, Lactococcus lactis subsp. cremoris and Lactobacillus delbrueckii subsp. bulgaricus) widely used as starters in traditional and industrial dairy technologies. The presented results evidence that Roundup(®) has an inhibitory effect on microbial growth and a microbicide effect at lower concentrations than those recommended in agriculture. Interestingly, glyphosate at these levels has no significant effect on the three studied microorganisms. Our work is consistent with previous studies which demonstrated that the toxic effect of glyphosate was amplified by its formulation adjuvants on different human cells and other eukaryotic models. Moreover, these results should be considered in the understanding of the loss of microbiodiversity and microbial concentration observed in raw milk for many years. PMID:22362186

  3. Influence of Environmental Factors on Bacteriocin Production by Human Isolates of Lactococcus lactis MM19 and Pediococcus acidilactici MM33.

    PubMed

    Turgis, Mélanie; Vu, Khanh Dang; Millette, Mathieu; Dupont, Claude; Lacroix, Monique

    2016-03-01

    The influence of temperature, initial pH, and carbon and nitrogen sources on bacteriocin secreted by Lactococcus lactis MM19 (MM19) and Pediococcus acidilactici MM33 (MM33) was evaluated. It was found that 30 and 45 °C were the growth temperatures for higher nisin and pediocin production by MM19 and MM33, respectively. The initial pH values for higher production of nisin and pediocin were 9 and 6, respectively. Glucose and wheat peptone E430 were found as suitable carbon and nitrogen sources, respectively, for highest nisin production by MM19 at 30 °C and initial pH of 9. In these conditions, nisin production could be increased by 6.7 times as compared to the control medium (de Man, Rogosa, and Sharpe-MRS broth). Similarly, fructose and pea peptone were suitable carbon and nitrogen sources, respectively, for highest production of pediocin by MM33 at 45 °C and initial pH of 6. In these conditions, pediocin production by MM33 was increased by three times as compared to the control medium (tryptone-glucose-yeast extract-TGE broth). PMID:26686688

  4. Effect of probiotic yogurt containing Lactobacillus acidophilus and Bifidobacterium lactis on lipid profile in individuals with type 2 diabetes mellitus.

    PubMed

    Ejtahed, H S; Mohtadi-Nia, J; Homayouni-Rad, A; Niafar, M; Asghari-Jafarabadi, M; Mofid, V; Akbarian-Moghari, A

    2011-07-01

    The purpose of this study was to investigate the effects of probiotic and conventional yogurt on the lipid profile in type 2 diabetic people. In a randomized double-blind controlled trial, 60 people (23 males and 37 females) with type 2 diabetes and low-density lipoprotein cholesterol (LDL-C) greater than 2.6 mmol/L were assigned to 2 groups. Participants consumed daily 300 g of probiotic yogurt containing Lactobacillus acidophilus La5 and Bifidobacterium lactis Bb12 or 300 g of conventional yogurt for 6 wk. Fasting blood samples, anthropometric measurements and 3-d, 24-h dietary recalls were collected at the baseline and at the end of the trial. Probiotic yogurt consumption caused a 4.54% decrease in total cholesterol and a 7.45% decrease in LDL-C compared with the control group. No significant changes from baseline were shown in triglyceride and high-density lipoprotein cholesterol (HDL-C) in the probiotic group. The total cholesterol:HDL-C ratio and LDL-C:HDL-C ratio as atherogenic indices significantly decreased in the probiotic group compared with the control group. Probiotic yogurt improved total cholesterol and LDL-C concentrations in type 2 diabetic people and may contribute to the improvement of cardiovascular disease risk factors. PMID:21700013

  5. Energetics of wild-type and mutant multidrug resistance secondary transporter LmrP of Lactococcus lactis.

    PubMed

    Mazurkiewicz, Piotr; Driessen, Arnold J M; Konings, Wil N

    2004-10-01

    LmrP, a proton/multidrug antiporter of Lactococcus lactis, transports a variety of cationic substrates. Previously, two membrane-embedded acidic residues, Asp142 and Glu327, have been reported to be important for multidrug transport activity of LmrP. Here we show that neither Glu327 nor Asp142 is essential for ethidium binding but that Glu327 is a critical residue for the high affinity binding of Hoechst 33342. Substitution of these two residues, however, negatively influences the transport activity. The energetics of transport was studied of two closely related cationic substrates ethidium and propidium that carry one and two positive charges, respectively. Extrusion of monovalent ethidium is dependent on both the electrical membrane potential (Deltapsi) and transmembrane proton gradient (DeltapH), while extrusion of propidium predominantly depends on the DeltapH only. The LmrP mutants D142C and E327C, however, mediate electroneutral ethidium extrusion, but are unable to mediate DeltapH-dependent extrusion of propidium. These data indicate that Asp142 and Glu327 are involved in proton translocation. PMID:15450963

  6. The Maltose ABC Transporter in Lactococcus lactis Facilitates High-Level Sensitivity to the Circular Bacteriocin Garvicin ML

    PubMed Central

    Gabrielsen, Christina; Brede, Dag A.; Hernández, Pablo E.; Nes, Ingolf F.

    2012-01-01

    We generated and characterized a series of spontaneous mutants of Lactococcus lactis IL1403 with average 6- to 11-fold-lowered sensitivities to the circular bacteriocin garvicin ML (GarML). Carbohydrate fermentation assays highlighted changes in carbohydrate metabolism, specifically loss of the ability to metabolize starch and maltose, in these mutants. PCR and sequencing showed that a 13.5-kb chromosomal deletion encompassing 12 open reading frames, mainly involved in starch and maltose utilization, had spontaneously occurred in the GarML-resistant mutants. Growth experiments revealed a correlation between sensitivity to GarML and carbon catabolite repression (CCR); i.e., sensitivity to GarML increased significantly when wild-type cells were grown on maltose and galactose as sole carbohydrates, an effect which was alleviated by the presence of glucose. Among the genes deleted in the mutants were malEFG, which encode a CCR-regulated membrane-bound maltose ABC transporter. The complementation of mutants with these three genes recovered normal sensitivity to the bacteriocin, suggesting an essential role of the maltose ABC transporter in the antimicrobial activity of GarML. This notion was supported by the fact that the level of sensitivity to GarML was dose dependent, increasing with higher expression levels of malEFG over a 50-fold range. To our knowledge, this is the first time a specific protein complex has been demonstrated to be involved in sensitivity to a circular bacteriocin. PMID:22411612

  7. A food-grade fimbrial adhesin FaeG expression system in Lactococcus lactis and Lactobacillus casei.

    PubMed

    Lu, W W; Wang, T; Wang, Y; Xin, M; Kong, J

    2016-03-01

    Enterotoxigenic Escherichia coli (ETEC) infection is the major cause of diarrhea in neonatal piglets. The fimbriae as colonizing factor in the pathogenesis of ETEC constitute a primary target for vaccination against ETEC. Lactic acid bacteria (LAB) are attractive tools to deliver antigens at the mucosal level. With the safety of genetically modified LAB in mind, a food-grade secretion vector (pALRc or pALRb) was constructed with DNA entirely from LAB, including the replicon, promoter, signal peptide, and selection marker alanine racemase gene (alr). To evaluate the feasibility of the system, the nuclease gene (nuc) from Staphylococcus aureus was used as a reporter to be expressed in both Lactococcus lactis and Lactobacillus casei. Subsequently, the extracellular secretion of the fimbrial adhesin FaeG of ETEC was confirmed by Western blot analysis. These results showed that this food-grade expression system has potential as the delivery vehicle for the safe use of genetically modified LAB for the development of vaccines against ETEC infection. PMID:26825016

  8. Towards in vivo regulon kinetics: PurR activation by 5-phosphoribosyl-?-1-pyrophosphate during purine depletion in Lactococcus lactis.

    PubMed

    Jendresen, Christian Bille; Dimitrov, Peter; Gautier, Laurent; Liu, Meng; Martinussen, Jan; Kilstrup, Mogens

    2014-07-01

    Short-term adaptation to changing environments relies on regulatory elements translating shifting metabolite concentrations into a specifically optimized transcriptome. So far the focus of analyses has been divided between regulatory elements identified in vivo and kinetic studies of small molecules interacting with the regulatory elements in vitro. Here we describe how in vivo regulon kinetics can describe a regulon through the effects of the metabolite controlling it, exemplified by temporal purine exhaustion in Lactococcus lactis. We deduced a causal relation between the pathway precursor 5-phosphoribosyl-?-1-pyrophosphate (PRPP) and individual mRNA levels, whereby unambiguous and homogeneous relations could be obtained for PurR regulated genes, thus linking a specific regulon to a specific metabolite. As PurR activates gene expression upon binding of PRPP, the pur mRNA curves reflect the in vivo kinetics of PurR PRPP binding and activation. The method singled out the xpt-pbuX operon as kinetically distinct, which was found to be caused by a guanine riboswitch whose regulation was overlaying the PurR regulation. Importantly, genes could be clustered according to regulatory mechanism and long-term consequences could be distinguished from transient changes--many of which would not be seen in a long-term adaptation to a new environment. The strategy outlined here can be adapted to analyse the individual effects of members from larger metabolomes in virtually any organism, for elucidating regulatory networks in vivo. PMID:24722907

  9. An alkali-thermostable xylanase from Bacillus pumilus functionally expressed in Kluyveromyces lactis and evaluation of its deinking efficiency.

    PubMed

    Thomas, Leya; Ushasree, Mrudula V; Pandey, Ashok

    2014-08-01

    This work aimed at studying the recombinant expression of an alkali- and thermo-stable xylanase from Bacillus pumilus in Kluyveromyces lactis and its use in deinking of civic paper waste. Efficient expression with a 3-fold increase in the activity than the native organism was achieved. An inducer concentration of 2.5% and medium pH of 9.0 was the best for enzyme expression. Purified enzyme showed an optimum activity at temperatures 50 and 60°C and pH 9.0 and 10.0, respectively. At pH 12.0, enzyme retained 74% and 26% activity after 2 and 3h of incubation, respectively. After incubation at 50 and 60°C for 1h, the enzyme showed 100% retention of activity, and remained active for 4h at 60°C retaining 23% residual activity. Partially purified recombinant enzyme showed higher deinking efficiency (273%) of laser print waste paper than crude xylanase from Bacillus and commercial acidic enzyme. This xylanase with superior stability characteristics could be a suitable candidate in paper and pulp industries. PMID:24709528

  10. Chromosomal integration of hyaluronic acid synthesis (has) genes enhances the molecular weight of hyaluronan produced in Lactococcus lactis.

    PubMed

    Hmar, Rothangmawi Victoria; Prasad, Shashi Bala; Jayaraman, Guhan; Ramachandran, Kadathur B

    2014-12-01

    Microbial production of hyaluronic acid (HA) is an attractive substitute for extraction of this biopolymer from animal tissues. Natural producers such as Streptococcus zooepidemicus are potential pathogens; therefore, production of HA by recombinant bacteria that are generally recognized as safe (GRAS) organisms is a viable alternative that is being extensively explored. However, plasmid-based expression systems for HA production by recombinant bacteria have the inherent disadvantage of reduced productivity because of plasmid instability. To overcome this problem, the HA synthesis genes (hasA-hasB and hasA-hasB-hasC) from has-operon of S. zooepidemicus were integrated into the chromosome of Lactococcus lactis by site-directed, double-homologous recombination developing strains VRJ2AB and VRJ3ABC. The chromosomal integration stabilized the genes and obviated the instability observed in plasmid-expressed recombinant strains. The genome-integrated strains produced higher molecular weight (3.5-4 million Dalton [MDa]) HA compared to the plasmid-expressed strains (2 MDa). High molecular weight HA was produced when the intracellular concentration of uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) and uridine diphosphate-glucuronic acid (UDP-GlcUA) was almost equal and hasA to hasB ratio was low. This work suggests an optimal approach to obtain high molecular weight HA in recombinant strains. PMID:25044639

  11. A QM/MM free energy study of the oxidation mechanism of dihydroorotate dehydrogenase (class 1A) from Lactococcus lactis.

    PubMed

    Silva, José Rogério A; Roitberg, Adrian E; Alves, Cláudio Nahum

    2015-01-29

    The dihydroorotate dehydrogenase (DHOD) class 1A enzyme catalyzes is the only redox enzyme in the biosynthetic pathway (de novo) of pyrimidines where dihydroorotate (DHO) is oxidized to orotate (OA) coupled to reduction of a flavin mononucleotide (FMN) cofactor. The rupture of two DHO C-H bonds can proceed in a concerted or stepwise way. Herein, the catalytic mechanism of DHOD from Lactococcus lactis involving DHO oxidation (first half-reaction) was described using a hybrid quantum mechanics/molecular mechanics (QM/MM) approach and molecular dynamics simulations. The free energy profile obtained from self-consistent charge-density functional tight binding/molecular mechanics calculations (corrected by DFT/MM) reveals that this occurs with the proton abstraction from DHO C5 to Cys130 deprotonated and DHO H6 is transferred to FMN N5 in a concerted mechanism with a very low barrier of 5.64 kcal/mol. Finally, through a residual decomposition analysis, the residues that have the main influence on the redox reaction were identified. PMID:25564307

  12. Biogenic amine production by Lactococcus lactis subsp. cremoris strains in the model system of Dutch-type cheese.

    PubMed

    Flasarová, Radka; Pachlová, Vendula; Buňková, Leona; Menšíková, Anna; Georgová, Nikola; Dráb, Vladimír; Buňka, František

    2016-03-01

    The aim of this study was to compare the biogenic amine production of two starter strains of Lactococcus lactis subsp. cremoris (strains from the Culture Collection of Dairy Microorganisms - CCDM 824 and CCDM 946) with decarboxylase positive activity in a model system of Dutch-type cheese during a 90-day ripening period at 10°C. During ripening, biogenic amine and free amino acid content, microbiological characteristics and proximate chemical properties were observed. By the end of the ripening period, the putrescine content in both samples with the addition of the biogenic amine producing strain almost evened out and the