Science.gov

Sample records for bacterial structured rnas

  1. Bacterial transfer RNAs

    PubMed Central

    Shepherd, Jennifer; Ibba, Michael

    2015-01-01

    Transfer RNA is an essential adapter molecule that is found across all three domains of life. The primary role of transfer RNA resides in its critical involvement in the accurate translation of messenger RNA codons during protein synthesis and, therefore, ultimately in the determination of cellular gene expression. This review aims to bring together the results of intensive investigations into the synthesis, maturation, modification, aminoacylation, editing and recycling of bacterial transfer RNAs. Codon recognition at the ribosome as well as the ever-increasing number of alternative roles for transfer RNA outside of translation will be discussed in the specific context of bacterial cells. PMID:25796611

  2. Bacterial RNAs activate innate immunity in Arabidopsis.

    PubMed

    Lee, Boyoung; Park, Yong-Soon; Lee, Soohyun; Song, Geun Cheol; Ryu, Choong-Min

    2016-01-01

    The common molecular patterns of microbes play a critical role in the regulation of plant innate immunity. However, little is known about the role of nucleic acids in this process in plants. We pre-infiltrated Arabidopsis leaves with total RNAs from Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) and subsequently inoculated these plants with the same bacterial cells. Total Pto DC3000 RNAs pre-infiltrated into Arabidopsis leaves elicited plant immune responses against Pto DC3000. However, sheared RNAs and RNase A application failed to induce immunity, suggesting that intact bacterial RNAs function in plant innate immunity. This notion was supported by the positive regulation of superoxide anion levels, callose deposition, two mitogen-activated protein kinases and defense-related genes observed in bacterial RNA-pre-treated leaves. Intriguingly, the Pto DC3000 population was not compromised in known pattern recognition receptor mutants for chitin, flagellin and elongation factor-Tu (EF-Tu). Plant defense-related mutant analyses further revealed that bacterial RNA-elicited innate immunity was normally required for salicylic and jasmonic acid signaling. Notably, among total RNAs, the abundant bacterial RNA species 16S and 23S ribosomal RNAs were the major determinants of this response. Our findings provide evidence that bacterial RNA serves as a microbe-associated molecular pattern in plants. PMID:26499893

  3. Structural analysis of aligned RNAs.

    PubMed

    Voss, Björn

    2006-01-01

    The knowledge about classes of non-coding RNAs (ncRNAs) is growing very fast and it is mainly the structure which is the common characteristic property shared by members of the same class. For correct characterization of such classes it is therefore of great importance to analyse the structural features in great detail. In this manuscript I present RNAlishapes which combines various secondary structure analysis methods, such as suboptimal folding and shape abstraction, with a comparative approach known as RNA alignment folding. RNAlishapes makes use of an extended thermodynamic model and covariance scoring, which allows to reward covariation of paired bases. Applying the algorithm to a set of bacterial trp-operon leaders using shape abstraction it was able to identify the two alternating conformations of this attenuator. Besides providing in-depth analysis methods for aligned RNAs, the tool also shows a fairly well prediction accuracy. Therefore, RNAlishapes provides the community with a powerful tool for structural analysis of classes of RNAs and is also a reasonable method for consensus structure prediction based on sequence alignments. RNAlishapes is available for online use and download at http://rna.cyanolab.de. PMID:17020924

  4. Modulation of Host miRNAs by Intracellular Bacterial Pathogens.

    PubMed

    Das, Kishore; Garnica, Omar; Dhandayuthapani, Subramanian

    2016-01-01

    MicroRNAs (miRNAs) are short non-coding RNAs that regulate the expression of protein coding genes of viruses and eukaryotes at the post-transcriptional level. The eukaryotic genes regulated by miRNAs include those whose products are critical for biological processes such as cell proliferation, metabolic pathways, immune response, and development. It is now increasingly recognized that modulation of miRNAs associated with biological processes is one of the strategies adopted by bacterial pathogens to survive inside host cells. In this review, we present an overview of the recent findings on alterations of miRNAs in the host cells by facultative intracellular bacterial pathogens. In addition, we discuss how the altered miRNAs help in the survival of these pathogens in the intracellular environment. PMID:27536558

  5. Modulation of Host miRNAs by Intracellular Bacterial Pathogens

    PubMed Central

    Das, Kishore; Garnica, Omar; Dhandayuthapani, Subramanian

    2016-01-01

    MicroRNAs (miRNAs) are short non-coding RNAs that regulate the expression of protein coding genes of viruses and eukaryotes at the post-transcriptional level. The eukaryotic genes regulated by miRNAs include those whose products are critical for biological processes such as cell proliferation, metabolic pathways, immune response, and development. It is now increasingly recognized that modulation of miRNAs associated with biological processes is one of the strategies adopted by bacterial pathogens to survive inside host cells. In this review, we present an overview of the recent findings on alterations of miRNAs in the host cells by facultative intracellular bacterial pathogens. In addition, we discuss how the altered miRNAs help in the survival of these pathogens in the intracellular environment. PMID:27536558

  6. Bacterial antisense RNAs are mainly the product of transcriptional noise.

    PubMed

    Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I; Serrano, Luis; Lluch-Senar, Maria

    2016-03-01

    cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome. PMID:26973873

  7. Bacterial antisense RNAs are mainly the product of transcriptional noise

    PubMed Central

    Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I.; Serrano, Luis; Lluch-Senar, Maria

    2016-01-01

    cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome. PMID:26973873

  8. Molecular call and response: the physiology of bacterial small RNAs

    PubMed Central

    Richards, Gregory R.; Vanderpool, Carin K.

    2011-01-01

    The vital role of bacterial small RNAs (sRNAs) in cellular regulation is now well-established. Although many diverse mechanisms by which sRNAs effect changes in gene expression have been thoroughly described, comparatively less is known about their biological roles and effects on cell physiology. Nevertheless, for some sRNAs, insight has been gained into the intricate regulatory interplay that is required to sense external environmental and internal metabolic cues and turn them into physiological outcomes. Here, we review examples of regulation by selected sRNAs, emphasizing signals and regulators required for sRNA expression, sRNA regulatory targets, and the resulting consequences for the cell. We highlight sRNAs involved in regulation of the processes of iron homeostasis (RyhB, PrrF, and FsrA) and carbon metabolism (Spot 42, CyaR, and SgrS). PMID:21843668

  9. Molecular call and response: the physiology of bacterial small RNAs.

    PubMed

    Richards, Gregory R; Vanderpool, Carin K

    2011-10-01

    The vital role of bacterial small RNAs (sRNAs) in cellular regulation is now well-established. Although many diverse mechanisms by which sRNAs bring about changes in gene expression have been thoroughly described, comparatively less is known about their biological roles and effects on cell physiology. Nevertheless, for some sRNAs, insight has been gained into the intricate regulatory interplay that is required to sense external environmental and internal metabolic cues and turn them into physiological outcomes. Here, we review examples of regulation by selected sRNAs, emphasizing signals and regulators required for sRNA expression, sRNA regulatory targets, and the resulting consequences for the cell. We highlight sRNAs involved in regulation of the processes of iron homeostasis (RyhB, PrrF, and FsrA) and carbon metabolism (Spot 42, CyaR, and SgrS). PMID:21843668

  10. Comparative genomics boosts target prediction for bacterial small RNAs.

    PubMed

    Wright, Patrick R; Richter, Andreas S; Papenfort, Kai; Mann, Martin; Vogel, Jörg; Hess, Wolfgang R; Backofen, Rolf; Georg, Jens

    2013-09-10

    Small RNAs (sRNAs) constitute a large and heterogeneous class of bacterial gene expression regulators. Much like eukaryotic microRNAs, these sRNAs typically target multiple mRNAs through short seed pairing, thereby acting as global posttranscriptional regulators. In some bacteria, evidence for hundreds to possibly more than 1,000 different sRNAs has been obtained by transcriptome sequencing. However, the experimental identification of possible targets and, therefore, their confirmation as functional regulators of gene expression has remained laborious. Here, we present a strategy that integrates phylogenetic information to predict sRNA targets at the genomic scale and reconstructs regulatory networks upon functional enrichment and network analysis (CopraRNA, for Comparative Prediction Algorithm for sRNA Targets). Furthermore, CopraRNA precisely predicts the sRNA domains for target recognition and interaction. When applied to several model sRNAs, CopraRNA revealed additional targets and functions for the sRNAs CyaR, FnrS, RybB, RyhB, SgrS, and Spot42. Moreover, the mRNAs gdhA, lrp, marA, nagZ, ptsI, sdhA, and yobF-cspC were suggested as regulatory hubs targeted by up to seven different sRNAs. The verification of many previously undetected targets by CopraRNA, even for extensively investigated sRNAs, demonstrates its advantages and shows that CopraRNA-based analyses can compete with experimental target prediction approaches. A Web interface allows high-confidence target prediction and efficient classification of bacterial sRNAs. PMID:23980183

  11. Getting to PTI of bacterial RNAs: Triggering plant innate immunity by extracellular RNAs from bacteria.

    PubMed

    Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min

    2016-07-01

    Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions. PMID:27301792

  12. Tackling Structures of Long Noncoding RNAs

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2013-01-01

    RNAs are important catalytic machines and regulators at every level of gene expression. A new class of RNAs has emerged called long non-coding RNAs, providing new insights into evolution, development and disease. Long non-coding RNAs (lncRNAs) predominantly found in higher eukaryotes, have been implicated in the regulation of transcription factors, chromatin-remodeling, hormone receptors and many other processes. The structural versatility of RNA allows it to perform various functions, ranging from precise protein recognition to catalysis and metabolite sensing. While major housekeeping RNA molecules have long been the focus of structural studies, lncRNAs remain the least characterized class, both structurally and functionally. Here, we review common methodologies used to tackle RNA structure, emphasizing their potential application to lncRNAs. When considering the complexity of lncRNAs and lack of knowledge of their structure, chemical probing appears to be an indispensable tool, with few restrictions in terms of size, quantity and heterogeneity of the RNA molecule. Probing is not constrained to in vitro analysis and can be adapted to high-throughput sequencing platforms. Significant efforts have been applied to develop new in vivo chemical probing reagents, new library construction protocols for sequencing platforms and improved RNA prediction software based on the experimental evidence. PMID:24304541

  13. Tackling structures of long noncoding RNAs.

    PubMed

    Novikova, Irina V; Hennelly, Scott P; Sanbonmatsu, Karissa Y

    2013-01-01

    RNAs are important catalytic machines and regulators at every level of gene expression. A new class of RNAs has emerged called long non-coding RNAs, providing new insights into evolution, development and disease. Long non-coding RNAs (lncRNAs) predominantly found in higher eukaryotes, have been implicated in the regulation of transcription factors, chromatin-remodeling, hormone receptors and many other processes. The structural versatility of RNA allows it to perform various functions, ranging from precise protein recognition to catalysis and metabolite sensing. While major housekeeping RNA molecules have long been the focus of structural studies, lncRNAs remain the least characterized class, both structurally and functionally. Here, we review common methodologies used to tackle RNA structure, emphasizing their potential application to lncRNAs. When considering the complexity of lncRNAs and lack of knowledge of their structure, chemical probing appears to be an indispensable tool, with few restrictions in terms of size, quantity and heterogeneity of the RNA molecule. Probing is not constrained to in vitro analysis and can be adapted to high-throughput sequencing platforms. Significant efforts have been applied to develop new in vivo chemical probing reagents, new library construction protocols for sequencing platforms and improved RNA prediction software based on the experimental evidence. PMID:24304541

  14. Non-canonical roles of tRNAs and tRNA mimics in bacterial cell biology.

    PubMed

    Katz, Assaf; Elgamal, Sara; Rajkovic, Andrei; Ibba, Michael

    2016-08-01

    Transfer RNAs (tRNAs) are the macromolecules that transfer activated amino acids from aminoacyl-tRNA synthetases to the ribosome, where they are used for the mRNA guided synthesis of proteins. Transfer RNAs are ancient molecules, perhaps even predating the existence of the translation machinery. Albeit old, these molecules are tremendously conserved, a characteristic that is well illustrated by the fact that some bacterial tRNAs are efficient and specific substrates of eukaryotic aminoacyl-tRNA synthetases and ribosomes. Considering their ancient origin and high structural conservation, it is not surprising that tRNAs have been hijacked during evolution for functions outside of translation. These roles beyond translation include synthetic, regulatory and information functions within the cell. Here we provide an overview of the non-canonical roles of tRNAs and their mimics in bacteria, and discuss some of the common themes that arise when comparing these different functions. PMID:27169680

  15. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles.

    PubMed

    Caswell, Clayton C; Oglesby-Sherrouse, Amanda G; Murphy, Erin R

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  16. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles

    PubMed Central

    Caswell, Clayton C.; Oglesby-Sherrouse, Amanda G.; Murphy, Erin R.

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  17. Sizing up long non-coding RNAs: do lncRNAs have secondary and tertiary structure?

    PubMed

    Novikova, Irina V; Hennelly, Scott P; Sanbonmatsu, Karissa Y

    2012-01-01

    Long noncoding RNAs (lncRNAs) play a key role in many important areas of epigenetics, stem cell biology, cancer, signaling and brain function. This emerging class of RNAs constitutes a large fraction of the transcriptome, with thousands of new lncRNAs reported each year. The molecular mechanisms of these RNAs are not well understood. Currently, very little structural data exist. We review the available lncRNA sequence and secondary structure data. Since almost no tertiary information is available for lncRNAs, we review crystallographic structures for other RNA systems and discuss the possibilities for lncRNAs in the context of existing constraints. PMID:23267412

  18. Probing small non-coding RNAs structures.

    PubMed

    Philippe, Jean-Vincent; Ayadi, Lilia; Branlant, Christiane; Behm-Ansmant, Isabelle

    2015-01-01

    The diverse roles of RNAs depend on their ability to fold so as to form biologically functional structures. Thus, understanding the function of a given RNA molecule often requires experimental analysis of its secondary structure by in vitro RNA probing, which is more accurate than using prediction programs only. This chapter presents in vitro RNA probing protocols that we routinely use, from RNA transcript production and purification to RNA structure determination using enzymatic (RNases T1, T2, and V1) and chemical (DMS, CMCT, kethoxal, and Pb(2+)) probing performed on both unlabeled and end-labeled RNAs. PMID:25791596

  19. Structure of transfer RNAs: similarity and variability.

    PubMed

    Giegé, Richard; Jühling, Frank; Pütz, Joern; Stadler, Peter; Sauter, Claude; Florentz, Catherine

    2012-01-01

    Transfer RNAs (tRNAs) are ancient molecules whose origin goes back to the beginning of life on Earth. Key partners in the ribosome-translation machinery, tRNAs read genetic information on messenger RNA and deliver codon specified amino acids attached to their distal 3'-extremity for peptide bond synthesis on the ribosome. In addition to this universal function, tRNAs participate in a wealth of other biological processes and undergo intricate maturation events. Our understanding of tRNA biology has been mainly phenomenological, but ongoing progress in structural biology is giving a robust physico-chemical basis that explains many facets of tRNA functions. Advanced sequence analysis of tRNA genes and their RNA transcripts have uncovered rules that underly tRNA 2D folding and 3D L-shaped architecture, as well as provided clues about their evolution. The increasing number of X-ray structures of free, protein- and ribosome-bound tRNA, reveal structural details accounting for the identity of the 22 tRNA families (one for each proteinogenic amino acid) and for the multifunctionality of a given family. Importantly, the structural role of post-transcriptional tRNA modifications is being deciphered. On the other hand, the plasticity of tRNA structure during function has been illustrated using a variety of technical approaches that allow dynamical insights. The large range of structural properties not only allows tRNAs to be the key actors of translation, but also sustain a diversity of unrelated functions from which only a few have already been pinpointed. Many surprises can still be expected. PMID:21957054

  20. Search for MicroRNAs Expressed by Intracellular Bacterial Pathogens in Infected Mammalian Cells

    PubMed Central

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A.; Xet-Mull, Ana M.; Sisk, Dana M.; Smith, Kristen L. Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H.; Tobin, David M.; Cullen, Bryan R.

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin. PMID:25184567

  1. Structure and Gene-Silencing Mechanisms of Small Noncoding RNAs

    NASA Astrophysics Data System (ADS)

    Chu, Chia-Ying; Rana, Tariq M.

    Small (19-31-nucleotides) noncoding RNAs were identified in the past 10 years for their distinct function in gene silencing. The best known gene-silencing phenomenon, RNA interference (RNAi), is triggered in a sequence-specific manner by endogenously produced or exogenously introduced small doubled-stranded RNAs. As knowledge of the structure and function of the RNAi machinery has expanded, this phenomenon has become a powerful tool for biochemical research; it has enormous potential for therapeutics. This chapter summarizes significant aspects of three major classes of small noncoding, regulatory RNAs: small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). Here, we focus on the biogenesis of these small RNAs, their structural features and coupled effectors as well as the mechanisms of each small regulatory RNA pathway which reveal fascinating ways by which gene silencing is controlled and fine-tuned at an epigenetic level.

  2. Loss of Conserved Noncoding RNAs in Genomes of Bacterial Endosymbionts.

    PubMed

    Matelska, Dorota; Kurkowska, Malgorzata; Purta, Elzbieta; Bujnicki, Janusz M; Dunin-Horkawicz, Stanislaw

    2016-02-01

    The genomes of intracellular symbiotic or pathogenic bacteria, such as of Buchnera, Mycoplasma, and Rickettsia, are typically smaller compared with their free-living counterparts. Here we showed that noncoding RNA (ncRNA) families, which are conserved in free-living bacteria, frequently could not be detected by computational methods in the small genomes. Statistical tests demonstrated that their absence is not an artifact of low GC content or small deletions in these small genomes, and thus it was indicative of an independent loss of ncRNAs in different endosymbiotic lineages. By analyzing the synteny (conservation of gene order) between the reduced and nonreduced genomes, we revealed instances of protein-coding genes that were preserved in the reduced genomes but lost cis-regulatory elements. We found that the loss of cis-regulatory ncRNA sequences, which regulate the expression of cognate protein-coding genes, is characterized by the reduction of secondary structure formation propensity, GC content, and length of the corresponding genomic regions. PMID:26782934

  3. Loss of Conserved Noncoding RNAs in Genomes of Bacterial Endosymbionts

    PubMed Central

    Matelska, Dorota; Kurkowska, Malgorzata; Purta, Elzbieta; Bujnicki, Janusz M.; Dunin-Horkawicz, Stanislaw

    2016-01-01

    The genomes of intracellular symbiotic or pathogenic bacteria, such as of Buchnera, Mycoplasma, and Rickettsia, are typically smaller compared with their free-living counterparts. Here we showed that noncoding RNA (ncRNA) families, which are conserved in free-living bacteria, frequently could not be detected by computational methods in the small genomes. Statistical tests demonstrated that their absence is not an artifact of low GC content or small deletions in these small genomes, and thus it was indicative of an independent loss of ncRNAs in different endosymbiotic lineages. By analyzing the synteny (conservation of gene order) between the reduced and nonreduced genomes, we revealed instances of protein-coding genes that were preserved in the reduced genomes but lost cis-regulatory elements. We found that the loss of cis-regulatory ncRNA sequences, which regulate the expression of cognate protein-coding genes, is characterized by the reduction of secondary structure formation propensity, GC content, and length of the corresponding genomic regions. PMID:26782934

  4. Structure Prediction: New Insights into Decrypting Long Noncoding RNAs

    PubMed Central

    Yan, Kun; Arfat, Yasir; Li, Dijie; Zhao, Fan; Chen, Zhihao; Yin, Chong; Sun, Yulong; Hu, Lifang; Yang, Tuanmin; Qian, Airong

    2016-01-01

    Long noncoding RNAs (lncRNAs), which form a diverse class of RNAs, remain the least understood type of noncoding RNAs in terms of their nature and identification. Emerging evidence has revealed that a small number of newly discovered lncRNAs perform important and complex biological functions such as dosage compensation, chromatin regulation, genomic imprinting, and nuclear organization. However, understanding the wide range of functions of lncRNAs related to various processes of cellular networks remains a great experimental challenge. Structural versatility is critical for RNAs to perform various functions and provides new insights into probing the functions of lncRNAs. In recent years, the computational method of RNA structure prediction has been developed to analyze the structure of lncRNAs. This novel methodology has provided basic but indispensable information for the rapid, large-scale and in-depth research of lncRNAs. This review focuses on mainstream RNA structure prediction methods at the secondary and tertiary levels to offer an additional approach to investigating the functions of lncRNAs. PMID:26805815

  5. Towards structural classification of long non-coding RNAs.

    PubMed

    Sanbonmatsu, Karissa Y

    2016-01-01

    While long non-coding RNAs play key roles in disease and development, few structural studies have been performed to date for this emerging class of RNAs. Previous structural studies are reviewed, and a pipeline is presented to determine secondary structures of long non-coding RNAs. Similar to riboswitches, experimentally determined secondary structures of long non-coding RNAs for one species, may be used to improve sequence/structure alignments for other species. As riboswitches have been classified according to their secondary structure, a similar scheme could be used to classify long non-coding RNAs. This article is part of a Special Issue titled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. PMID:26537437

  6. Structured RNAs that evade or confound exonucleases: function follows form.

    PubMed

    Akiyama, Benjamin M; Eiler, Daniel; Kieft, Jeffrey S

    2016-02-01

    Cells contain powerful RNA decay machinery to eliminate unneeded RNA from the cell, and this process is an important and regulated part of controlling gene expression. However, certain structured RNAs have been found that can robustly resist degradation and extend the lifetime of an RNA. In this review, we present three RNA structures that use a specific three-dimensional fold to provide protection from RNA degradation, and discuss how the recently-solved structures of these RNAs explain their function. Specifically, we describe the Xrn1-resistant RNAs from arthropod-borne flaviviruses, exosome-resistant long non-coding RNAs associated with lung cancer metastasis and found in Kaposi's sarcoma-associated herpesvirus, and tRNA-like sequences occurring in certain plant viruses. These three structures reveal three different mechanisms to protect RNAs from decay and suggest RNA structure-based nuclease resistance may be a widespread mechanism of regulation. PMID:26797676

  7. Structure based approaches for targeting non-coding RNAs with small molecules

    PubMed Central

    Shortridge, Matthew D.; Varani, Gabriele

    2015-01-01

    The increasing appreciation of the central role of non-coding RNAs (miRNAs and long non coding RNAs) in chronic and degenerative human disease makes them attractive therapeutic targets. This would not be unprecedented: the bacterial ribosomal RNA is a mainstay for antibacterial treatment, while the conservation and functional importance of viral RNA regulatory elements has long suggested they would constitute attractive targets for new antivirals. Oligonucleotide-based chemistry has obvious appeals but also considerable pharmacological limitations that are yet to be addressed satisfactorily. Recent studies identifying small molecules targeting non-coding RNAs may provide an alternative approach to oligonucleotide methods. Here we review recent work investigating new structural and chemical principles for targeting RNA with small molecules. PMID:25687935

  8. Multiplicity of 5′ Cap Structures Present on Short RNAs

    PubMed Central

    Yamauchi, Yoshio; Taoka, Masato; de Hoon, Michiel; Gingeras, Thomas R.; Isobe, Toshiaki; Carninci, Piero

    2014-01-01

    Most RNA molecules are co- or post-transcriptionally modified to alter their chemical and functional properties to assist in their ultimate biological function. Among these modifications, the addition of 5′ cap structure has been found to regulate turnover and localization. Here we report a study of the cap structure of human short (<200 nt) RNAs (sRNAs), using sequencing of cDNA libraries prepared by enzymatic pretreatment of the sRNAs with cap sensitive-specificity, thin layer chromatographic (TLC) analyses of isolated cap structures and mass spectrometric analyses for validation of TLC analyses. Processed versions of snoRNAs and tRNAs sequences of less than 50 nt were observed in capped sRNA libraries, indicating additional processing and recapping of these annotated sRNAs biotypes. We report for the first time 2,7 dimethylguanosine in human sRNAs cap structures and surprisingly we find multiple type 0 cap structures (mGpppC, 7mGpppG, GpppG, GpppA, and 7mGpppA) in RNA length fractions shorter than 50 nt. Finally, we find the presence of additional uncharacterized cap structures that wait determination by the creation of needed reference compounds to be used in TLC analyses. These studies suggest the existence of novel biochemical pathways leading to the processing of primary and sRNAs and the modifications of their RNA 5′ ends with a spectrum of chemical modifications. PMID:25079783

  9. Structural and Functional Analysis of Viral siRNAs

    PubMed Central

    Szittya, Gyorgy; Moxon, Simon; Pantaleo, Vitantonio; Toth, Gabor; Rusholme Pilcher, Rachel L.; Moulton, Vincent; Burgyan, Jozsef; Dalmay, Tamas

    2010-01-01

    A large amount of short interfering RNA (vsiRNA) is generated from plant viruses during infection, but the function, structure and biogenesis of these is not understood. We profiled vsiRNAs using two different high-throughput sequencing platforms and also developed a hybridisation based array approach. The profiles obtained through the Solexa platform and by hybridisation were very similar to each other but different from the 454 profile. Both deep sequencing techniques revealed a strong bias in vsiRNAs for the positive strand of the virus and identified regions on the viral genome that produced vsiRNA in much higher abundance than other regions. The hybridisation approach also showed that the position of highly abundant vsiRNAs was the same in different plant species and in the absence of RDR6. We used the Terminator 5′-Phosphate-Dependent Exonuclease to study the 5′ end of vsiRNAs and showed that a perfect control duplex was not digested by the enzyme without denaturation and that the efficiency of the Terminator was strongly affected by the concentration of the substrate. We found that most vsiRNAs have 5′ monophosphates, which was also confirmed by profiling short RNA libraries following either direct ligation of adapters to the 5′ end of short RNAs or after replacing any potential 5′ ends with monophosphates. The Terminator experiments also showed that vsiRNAs were not perfect duplexes. Using a sensor construct we also found that regions from the viral genome that were complementary to non-abundant vsiRNAs were targeted in planta just as efficiently as regions recognised by abundant vsiRNAs. Different high-throughput sequencing techniques have different reproducible sequence bias and generate different profiles of short RNAs. The Terminator exonuclease does not process double stranded RNA, and because short RNAs can quickly re-anneal at high concentration, this assay can be misleading if the substrate is not denatured and not analysed in a dilution

  10. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    SciTech Connect

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S.

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  11. The structure and function of catalytic RNAs.

    PubMed

    Wu, QiJia; Huang, Lin; Zhang, Yi

    2009-03-01

    Before the discovery of ribozymes, RNA had been proposed to function as a catalyst, based on the discovery that RNA folded into high-ordered structures as protein did. This hypothesis was confirmed in the 1980s, after the discovery of Tetrahymena group I intron and RNase P ribozyme. There have been about ten ribozymes identified during the past thirty years, as well as the fact that ribosomes function as ribozymes. Advances have been made in understanding the structures and functions of ribozymes, with numerous crystal structures resolved in the past years. Here we review the structure-function relationship of both small and large ribozymes, especially the structural basis of their catalysis. ribozyme, structure, catalysis. PMID:19294348

  12. Alu element-containing RNAs maintain nucleolar structure and function.

    PubMed

    Caudron-Herger, Maïwen; Pankert, Teresa; Seiler, Jeanette; Németh, Attila; Voit, Renate; Grummt, Ingrid; Rippe, Karsten

    2015-11-12

    Non-coding RNAs play a key role in organizing the nucleus into functional subcompartments. By combining fluorescence microscopy and RNA deep-sequencing-based analysis, we found that RNA polymerase II transcripts originating from intronic Alu elements (aluRNAs) were enriched in the nucleolus. Antisense-oligo-mediated depletion of aluRNAs or drug-induced inhibition of RNA polymerase II activity disrupted nucleolar structure and impaired RNA polymerase I-dependent transcription of rRNA genes. In contrast, overexpression of a prototypic aluRNA sequence increased both nucleolus size and levels of pre-rRNA, suggesting a functional link between aluRNA, nucleolus integrity and pre-rRNA synthesis. Furthermore, we show that aluRNAs interact with nucleolin and target ectopic genomic loci to the nucleolus. Our study suggests an aluRNA-based mechanism that links RNA polymerase I and II activities and modulates nucleolar structure and rRNA production. PMID:26464461

  13. Probing the substrate specificity of the bacterial Pnkp/Hen1 RNA repair system using synthetic RNAs.

    PubMed

    Zhang, Can; Chan, Chio Mui; Wang, Pei; Huang, Raven H

    2012-02-01

    Ribotoxins cleave essential RNAs involved in protein synthesis as a strategy for cell killing. RNA repair systems exist in nature to counteract the lethal actions of ribotoxins, as first demonstrated by the RNA repair system from bacteriophage T4 25 yr ago. Recently, we found that two bacterial proteins, named Pnkp and Hen1, form a stable complex and are able to repair ribotoxin-cleaved tRNAs in vitro. However, unlike the well-studied T4 RNA repair system, the natural RNA substrates of the bacterial Pnkp/Hen1 RNA repair system are unknown. Here we present comprehensive RNA repair assays with the recombinant Pnkp/Hen1 proteins from Anabaena variabilis using a total of 33 different RNAs as substrates that might mimic various damaged forms of RNAs present in living cells. We found that unlike the RNA repair system from bacteriophage T4, the bacterial Pnkp/Hen1 RNA repair system exhibits broad substrate specificity. Based on the experimental data presented here, a model of preferred RNA substrates of the Pnkp/Hen1 repair system is proposed. PMID:22190744

  14. Rise of the RNA machines: exploring the structure of long non-coding RNAs.

    PubMed

    Novikova, Irina V; Hennelly, Scott P; Tung, Chang-Shung; Sanbonmatsu, Karissa Y

    2013-10-01

    Novel, profound and unexpected roles of long non-coding RNAs (lncRNAs) are emerging in critical aspects of gene regulation. Thousands of lncRNAs have been recently discovered in a wide range of mammalian systems, related to development, epigenetics, cancer, brain function and hereditary disease. The structural biology of these lncRNAs presents a brave new RNA world, which may contain a diverse zoo of new architectures and mechanisms. While structural studies of lncRNAs are in their infancy, we describe existing structural data for lncRNAs, as well as crystallographic studies of other RNA machines and their implications for lncRNAs. We also discuss the importance of dynamics in RNA machine mechanism. Determining commonalities between lncRNA systems will help elucidate the evolution and mechanistic role of lncRNAs in disease, creating a structural framework necessary to pursue lncRNA-based therapeutics. PMID:23467124

  15. Accurate and efficient reconstruction of deep phylogenies from structured RNAs

    PubMed Central

    Stocsits, Roman R.; Letsch, Harald; Hertel, Jana; Misof, Bernhard; Stadler, Peter F.

    2009-01-01

    Ribosomal RNA (rRNA) genes are probably the most frequently used data source in phylogenetic reconstruction. Individual columns of rRNA alignments are not independent as a consequence of their highly conserved secondary structures. Unless explicitly taken into account, these correlation can distort the phylogenetic signal and/or lead to gross overestimates of tree stability. Maximum likelihood and Bayesian approaches are of course amenable to using RNA-specific substitution models that treat conserved base pairs appropriately, but require accurate secondary structure models as input. So far, however, no accurate and easy-to-use tool has been available for computing structure-aware alignments and consensus structures that can deal with the large rRNAs. The RNAsalsa approach is designed to fill this gap. Capitalizing on the improved accuracy of pairwise consensus structures and informed by a priori knowledge of group-specific structural constraints, the tool provides both alignments and consensus structures that are of sufficient accuracy for routine phylogenetic analysis based on RNA-specific substitution models. The power of the approach is demonstrated using two rRNA data sets: a mitochondrial rRNA set of 26 Mammalia, and a collection of 28S nuclear rRNAs representative of the five major echinoderm groups. PMID:19723687

  16. Accurate and efficient reconstruction of deep phylogenies from structured RNAs.

    PubMed

    Stocsits, Roman R; Letsch, Harald; Hertel, Jana; Misof, Bernhard; Stadler, Peter F

    2009-10-01

    Ribosomal RNA (rRNA) genes are probably the most frequently used data source in phylogenetic reconstruction. Individual columns of rRNA alignments are not independent as a consequence of their highly conserved secondary structures. Unless explicitly taken into account, these correlation can distort the phylogenetic signal and/or lead to gross overestimates of tree stability. Maximum likelihood and Bayesian approaches are of course amenable to using RNA-specific substitution models that treat conserved base pairs appropriately, but require accurate secondary structure models as input. So far, however, no accurate and easy-to-use tool has been available for computing structure-aware alignments and consensus structures that can deal with the large rRNAs. The RNAsalsa approach is designed to fill this gap. Capitalizing on the improved accuracy of pairwise consensus structures and informed by a priori knowledge of group-specific structural constraints, the tool provides both alignments and consensus structures that are of sufficient accuracy for routine phylogenetic analysis based on RNA-specific substitution models. The power of the approach is demonstrated using two rRNA data sets: a mitochondrial rRNA set of 26 Mammalia, and a collection of 28S nuclear rRNAs representative of the five major echinoderm groups. PMID:19723687

  17. Hfq assists small RNAs in binding to the coding sequence of ompD mRNA and in rearranging its structure

    PubMed Central

    Wroblewska, Zuzanna; Olejniczak, Mikolaj

    2016-01-01

    The bacterial protein Hfq participates in the regulation of translation by small noncoding RNAs (sRNAs). Several mechanisms have been proposed to explain the role of Hfq in the regulation by sRNAs binding to the 5′-untranslated mRNA regions. However, it remains unknown how Hfq affects those sRNAs that target the coding sequence. Here, the contribution of Hfq to the annealing of three sRNAs, RybB, SdsR, and MicC, to the coding sequence of Salmonella ompD mRNA was investigated. Hfq bound to ompD mRNA with tight, subnanomolar affinity. Moreover, Hfq strongly accelerated the rates of annealing of RybB and MicC sRNAs to this mRNA, and it also had a small effect on the annealing of SdsR. The experiments using truncated RNAs revealed that the contributions of Hfq to the annealing of each sRNA were individually adjusted depending on the structures of interacting RNAs. In agreement with that, the mRNA structure probing revealed different structural contexts of each sRNA binding site. Additionally, the annealing of RybB and MicC sRNAs induced specific conformational changes in ompD mRNA consistent with local unfolding of mRNA secondary structure. Finally, the mutation analysis showed that the long AU-rich sequence in the 5′-untranslated mRNA region served as an Hfq binding site essential for the annealing of sRNAs to the coding sequence. Overall, the data showed that the functional specificity of Hfq in the annealing of each sRNA to the ompD mRNA coding sequence was determined by the sequence and structure of the interacting RNAs. PMID:27154968

  18. Nucleotide modifications within bacterial messenger RNAs regulate their translation and are able to rewire the genetic code

    PubMed Central

    Hoernes, Thomas Philipp; Clementi, Nina; Faserl, Klaus; Glasner, Heidelinde; Breuker, Kathrin; Lindner, Herbert; Hüttenhofer, Alexander; Erlacher, Matthias David

    2016-01-01

    Nucleotide modifications within RNA transcripts are found in every organism in all three domains of life. 6-methyladeonsine (m6A), 5-methylcytosine (m5C) and pseudouridine (Ψ) are highly abundant nucleotide modifications in coding sequences of eukaryal mRNAs, while m5C and m6A modifications have also been discovered in archaeal and bacterial mRNAs. Employing in vitro translation assays, we systematically investigated the influence of nucleotide modifications on translation. We introduced m5C, m6A, Ψ or 2′-O-methylated nucleotides at each of the three positions within a codon of the bacterial ErmCL mRNA and analyzed their influence on translation. Depending on the respective nucleotide modification, as well as its position within a codon, protein synthesis remained either unaffected or was prematurely terminated at the modification site, resulting in reduced amounts of the full-length peptide. In the latter case, toeprint analysis of ribosomal complexes was consistent with stalling of translation at the modified codon. When multiple nucleotide modifications were introduced within one codon, an additive inhibitory effect on translation was observed. We also identified the m5C modification to alter the amino acid identity of the corresponding codon, when positioned at the second codon position. Our results suggest a novel mode of gene regulation by nucleotide modifications in bacterial mRNAs. PMID:26578598

  19. Sequence and Structural Analyses for Functional Non-coding RNAs

    NASA Astrophysics Data System (ADS)

    Sakakibara, Yasubumi; Sato, Kengo

    Analysis and detection of functional RNAs are currently important topics in both molecular biology and bioinformatics research. Several computational methods based on stochastic context-free grammars (SCFGs) have been developed for modeling and analysing functional RNA sequences. These grammatical methods have succeeded in modeling typical secondary structures of RNAs and are used for structural alignments of RNA sequences. Such stochastic models, however, are not sufficient to discriminate member sequences of an RNA family from non-members, and hence to detect non-coding RNA regions from genome sequences. Recently, the support vector machine (SVM) and kernel function techniques have been actively studied and proposed as a solution to various problems in bioinformatics. SVMs are trained from positive and negative samples and have strong, accurate discrimination abilities, and hence are more appropriate for the discrimination tasks. A few kernel functions that extend the string kernel to measure the similarity of two RNA sequences from the viewpoint of secondary structures have been proposed. In this article, we give an overview of recent progress in SCFG-based methods for RNA sequence analysis and novel kernel functions tailored to measure the similarity of two RNA sequences and developed for use with support vector machines (SVM) in discriminating members of an RNA family from non-members.

  20. Comparing the three-dimensional structures of Dicistroviridae IGR IRES RNAs with other viral RNA structures.

    PubMed

    Kieft, Jeffrey S

    2009-02-01

    The intergenic region (IGR) internal ribosome entry site (IRES) RNAs do not require any of the canonical translation initiation factors to recruit the ribosome to the viral RNA, they eliminate the need for initiator tRNA, and they begin translation from the A-site. The function of these IRESs depends on a specific three-dimensional folded RNA structure. Thus, a complete understanding of the mechanisms of action of these IRESs requires that we understand their structure in detail. Recently, the structures of both domains of the IGR IRES RNAs were solved by X-ray crystallography, providing the first glimpse into an entire IRES RNA structure. Here, I present an analysis of these structures, emphasizing how the structures explain many aspects of IGR IRES function, discussing how these structures have similarities to motifs found in other viral RNAs, and illustrating how these structures give rise to new mechanistic hypotheses. PMID:18672012

  1. Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction

    PubMed Central

    Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

    2014-01-01

    Purpose: Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Methods: Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting “A site” of 16S rRNA) to riboswitches via docking method. Results: There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with “16S rRNA A site”. Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA “A site” suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. Conclusion: These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches. PMID:24754005

  2. Outside the coding genome, mammalian microRNAs confer structural and functional complexity

    PubMed Central

    Olive, Virginie; Minella, Alex C.; He, Lin

    2015-01-01

    MicroRNAs (miRNAs) comprise a class of small, regulatory noncoding RNAs (ncRNAs) with pivotal roles in post-transcriptional gene regulation. Since their initial discovery in 1993, numerous miRNAs have been identified in mammalian genomes, many of which play important roles in diverse cellular processes in development and disease. These small ncRNAs regulate the expression of many protein-coding genes post-transcriptionally, thus adding a substantial complexity to the molecular networks underlying physiological development and disease. In part, this complexity arises from the distinct gene structures, the extensive genomic redundancy, and the complex regulation of the expression and biogenesis of miRNAs. These characteristics contribute to the functional robustness and versatility of miRNAs and provide important clues to the functional significance of these small ncRNAs. The unique structure and function of miRNAs will continue to inspire many to explore the vast noncoding genome and to elucidate the molecular basis for the functional complexity of mammalian genomes. PMID:25783159

  3. Identification of ta-siRNAs and cis-nat-siRNAs in cassava and their roles in response to cassava bacterial blight.

    PubMed

    Quintero, Andrés; Pérez-Quintero, Alvaro L; López, Camilo

    2013-06-01

    Trans-acting small interfering RNAs (ta-siRNAs) and natural cis-antisense siRNAs (cis-nat-siRNAs) are recently discovered small RNAs (sRNAs) involved in post-transcriptional gene silencing. ta-siRNAs are transcribed from genomic loci and require processing by microRNAs (miRNAs). cis-nat-siRNAs are derived from antisense RNAs produced by the simultaneous transcription of overlapping antisense genes. Their roles in many plant processes, including pathogen response, are mostly unknown. In this work, we employed a bioinformatic approach to identify ta-siRNAs and cis-nat-siRNAs in cassava from two sRNA libraries, one constructed from healthy cassava plants and one from plants inoculated with the bacterium Xanthomonas axonopodis pv. manihotis (Xam). A total of 54 possible ta-siRNA loci were identified in cassava, including a homolog of TAS3, the best studied plant ta-siRNA. Fifteen of these loci were induced, while 39 were repressed in response to Xam infection. In addition, 15 possible cis-natural antisense transcript (cis-NAT) loci producing siRNAs were identified from overlapping antisense regions in the genome, and were found to be differentially expressed upon Xam infection. Roles of sRNAs were predicted by sequence complementarity and our results showed that many sRNAs identified in this work might be directed against various transcription factors. This work represents a significant step toward understanding the roles of sRNAs in the immune response of cassava. PMID:23665476

  4. Small RNAs in plant defense responses during viral and bacterial interactions: similarities and differences

    PubMed Central

    Peláez, Pablo; Sanchez, Federico

    2013-01-01

    Small non-coding RNAs constitute an important class of gene expression regulators that control different biological processes in most eukaryotes. In plants, several small RNA (sRNA) silencing pathways have evolved to produce a wide range of small RNAs with specialized functions. Evidence for the diverse mode of action of the small RNA pathways has been highlighted during plant–microbe interactions. Host sRNAs and small RNA silencing pathways have been recognized as essential components of plant immunity. One way plants respond and defend against pathogen infections is through the small RNA silencing immune system. To deal with plant defense responses, pathogens have evolved sophisticated mechanisms to avoid and counterattack this defense strategy. The relevance of the small RNA-mediated plant defense responses during viral infections has been well-established. Recent evidence points out its importance also during plant–bacteria interactions. Herein, this review discusses recent findings, similarities and differences about the small RNA-mediated arms race between plants and these two groups of microbes, including the small RNA silencing pathway components that contribute to plant immune responses, the pathogen-responsive endogenous sRNAs and the pathogen-delivered effector proteins. PMID:24046772

  5. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome.

    PubMed

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A; Donohue, John P; Noller, Harry F; Kieft, Jeffrey S

    2011-02-01

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA • mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines. PMID:21245352

  6. Precursors of tRNAs are stabilized by methylguanosine cap structures.

    PubMed

    Ohira, Takayuki; Suzuki, Tsutomu

    2016-08-01

    Efficient maturation of transfer RNAs (tRNAs) is required for rapid cell growth. However, the precise timing of tRNA processing in coordination with the order of tRNA modifications has not been thoroughly elucidated. To analyze the modification status of tRNA precursors (pre-tRNAs) during maturation, we isolated pre-tRNAs at various stages from Saccharomyces cerevisiae and subjected them to MS analysis. We detected methylated guanosine cap structures at the 5' termini of pre-tRNAs bearing 5' leader sequences. These capped pre-tRNAs accumulated substantially after inhibition of RNase P activity. Upon depletion of the capping enzyme Ceg1p, the steady state level of capped pre-tRNA was markedly reduced. In addition, a population of capped pre-tRNAs accumulated in strains in which 5' exonucleases were inhibited, indicating that the 5' cap structures protect pre-tRNAs from 5'-exonucleolytic degradation during maturation. PMID:27348091

  7. The Sequence and Structure Determine the Function of Mature Human miRNAs

    PubMed Central

    Wawrzyniak, Dariusz; Jeleniewicz, Jaroslaw; Barciszewska, Miroslawa Z.; Barciszewski, Jan

    2016-01-01

    Micro RNAs (miRNAs) (19–25 nucleotides in length) belong to the group of non-coding RNAs are the most abundant group of posttranscriptional regulators in multicellular organisms. They affect a gene expression by binding of fully or partially complementary sequences to the 3’-UTR of target mRNA. Furthermore, miRNAs present a mechanism by which genes with diverse functions on multiple pathways can be simultaneously regulated at the post-transcriptional level. However, little is known about the specific pathways through which miRNAs with specific sequence or structural motifs regulate the cellular processes. In this paper we showed the broad and deep characteristics of mature miRNAs according to their sequence and structural motifs. We investigated a distinct group of miRNAs characterized by the presence of specific sequence motifs, such as UGUGU, GU-repeats and purine/pyrimidine contents. Using computational function and pathway analysis of their targeted genes, we were able to observe the relevance of sequence and the type of targeted mRNAs. As the consequence of the sequence analysis we finally provide the comprehensive description of pathways, biological processes and proteins associated with the distinct group of characterized miRNAs. Here, we found that the specific group of miRNAs with UGUGU can activate the targets associated to the interferon induction pathway or pathways prominently observed during carcinogenesis. GU-rich miRNAs are prone to regulate mostly processes in neurogenesis, whereas purine/pyrimidine rich miRNAs could be involved rather in transport and/or degradation of RNAs. Additionally, we have also analyzed the simple sequence repeats (SSRs). Their variation within mature miRNAs might be critical for normal miRNA regular activity. Expansion or contraction of SSRs in mature miRNA might directly affect its mRNA interaction or even change the function of that distinct miRNA. Our results prove that due to the specific sequence features, these

  8. Bioinformatics of prokaryotic RNAs

    PubMed Central

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  9. Bioinformatics of prokaryotic RNAs.

    PubMed

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  10. Expression Profiling and Structural Characterization of MicroRNAs in Adipose Tissues of Hibernating Ground Squirrels

    PubMed Central

    Wu, Cheng-Wei; Biggar, Kyle K.; Storey, Kenneth B.

    2014-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that are important in regulating metabolic stress. In this study, we determined the expression and structural characteristics of 20 miRNAs in brown (BAT) and white adipose tissue (WAT) during torpor in thirteen-lined ground squirrels. Using a modified stem-loop technique, we found that during torpor, expression of six miRNAs including let-7a, let-7b, miR-107, miR-150, miR-222 and miR-31 was significantly downregulated in WAT (P < 0.05), which was 16%–54% of euthermic non-torpid control squirrels, whereas expression of three miRNAs including miR-143, miR-200a and miR-519d was found to be upregulated by 1.32–2.34-fold. Similarly, expression of more miRNAs was downregulated in BAT during torpor. We detected reduced expression of 6 miRNAs including miR-103a, miR-107, miR-125b, miR-21, miR-221 and miR-31 (48%–70% of control), while only expression of miR-138 was significantly upregulated (2.91 ± 0.8-fold of the control, P < 0.05). Interestingly, miRNAs found to be downregulated in WAT during torpor were similar to those dysregulated in obese humans for increased adipogenesis, whereas miRNAs with altered expression in BAT during torpor were linked to mitochondrial β-oxidation. miRPath target prediction analysis showed that miRNAs downregulated in both WAT and BAT were associated with the regulation of mitogen-activated protein kinase (MAPK) signaling, while the miRNAs upregulated in WAT were linked to transforming growth factor β (TGFβ) signaling. Compared to mouse sequences, no unique nucleotide substitutions within the stem-loop region were discovered for the associated pre-miRNAs for the miRNAs used in this study, suggesting no structure-influenced changes in pre-miRNA processing efficiency in the squirrel. As well, the expression of miRNA processing enzyme Dicer remained unchanged in both tissues during torpor. Overall, our findings suggest that changes of miRNA expression in adipose tissues may be linked

  11. Expression profiling and structural characterization of microRNAs in adipose tissues of hibernating ground squirrels.

    PubMed

    Wu, Cheng-Wei; Biggar, Kyle K; Storey, Kenneth B

    2014-12-01

    MicroRNAs (miRNAs) are small non-coding RNAs that are important in regulating metabolic stress. In this study, we determined the expression and structural characteristics of 20 miRNAs in brown (BAT) and white adipose tissue (WAT) during torpor in thirteen-lined ground squirrels. Using a modified stem-loop technique, we found that during torpor, expression of six miRNAs including let-7a, let-7b, miR-107, miR-150, miR-222 and miR-31 was significantly downregulated in WAT (P<0.05), which was 16%-54% of euthermic non-torpid control squirrels, whereas expression of three miRNAs including miR-143, miR-200a and miR-519d was found to be upregulated by 1.32-2.34-fold. Similarly, expression of more miRNAs was downregulated in BAT during torpor. We detected reduced expression of 6 miRNAs including miR-103a, miR-107, miR-125b, miR-21, miR-221 and miR-31 (48%-70% of control), while only expression of miR-138 was significantly upregulated (2.91±0.8-fold of the control, P<0.05). Interestingly, miRNAs found to be downregulated in WAT during torpor were similar to those dysregulated in obese humans for increased adipogenesis, whereas miRNAs with altered expression in BAT during torpor were linked to mitochondrial β-oxidation. miRPath target prediction analysis showed that miRNAs downregulated in both WAT and BAT were associated with the regulation of mitogen-activated protein kinase (MAPK) signaling, while the miRNAs upregulated in WAT were linked to transforming growth factor β (TGFβ) signaling. Compared to mouse sequences, no unique nucleotide substitutions within the stem-loop region were discovered for the associated pre-miRNAs for the miRNAs used in this study, suggesting no structure-influenced changes in pre-miRNA processing efficiency in the squirrel. As well, the expression of miRNA processing enzyme Dicer remained unchanged in both tissues during torpor. Overall, our findings suggest that changes of miRNA expression in adipose tissues may be linked to distinct

  12. Structure and operation of bacterial tripartite pumps.

    PubMed

    Hinchliffe, Philip; Symmons, Martyn F; Hughes, Colin; Koronakis, Vassilis

    2013-01-01

    In bacteria such as Pseudomonas aeruginosa and Escherichia coli, tripartite membrane machineries, or pumps, determine the efflux of small noxious molecules, such as detergents, heavy metals, and antibiotics, and the export of large proteins including toxins. They are therefore influential in bacterial survival, particularly during infections caused by multidrug-resistant pathogens. In these tripartite pumps an inner membrane transporter, typically an ATPase or proton antiporter, binds and translocates export or efflux substrates. In cooperation with a periplasmic adaptor protein it recruits and opens a TolC family cell exit duct, which is anchored in the outer membrane and projects across the periplasmic space between inner and outer membranes. Assembled tripartite pumps thus span the entire bacterial cell envelope. We review the atomic structures of each of the three pump components and discuss how these have allowed high-resolution views of tripartite pump assembly, operation, and possible inhibition. PMID:23808339

  13. [Structure and functions of bacterial proteinase precursors].

    PubMed

    Serkina, A V; Shevelev, A B; Chestukhina, G G

    2001-01-01

    The data on the precursors of bacterial proteases were generalized. The structure and special features of processing of the precursors of bacillary subtilisins, the alpha-lytic protease from Lysobacter enzymogenes and the related chymotrypsin-like proteases from Streptomyces griseus, and the metalloproteases from bacilli and Pseudomonas aeruginosa were discussed. The approaches to producing the precursors and the protease propeptides and to in vitro characterizing them were particularly analyzed. The following physiological functions of the propeptides within the protease precursors were considered probable: (a) inhibition of the proteases to protect the host cells from the proteolytic damage; (b) participation in the folding of the mature enzyme; and (c) providing for the protease interaction with the bacterial cell surveillance mechanisms, including protease translocation through the cell wall. PMID:11641907

  14. Riboswitch RNAs

    PubMed Central

    Smith, Angela M.; Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

    2016-01-01

    Riboswitches are cis-encoded, cis-acting RNA elements that directly sense a physiological signal. Signal response results in a change in RNA structure that impacts gene expression. Elements of this type play an important role in bacteria, where they regulate a variety of fundamental cellular pathways. Riboswitch-mediated gene regulation most commonly occurs by effects on transcription attenuation, to control whether a full-length transcript is synthesized, or on translation initiation, in which case the transcript is constitutively synthesized but binding of the translation initiation complex is modulated. An overview of the role of riboswitch RNAs in bacterial gene expression will be provided, and a few examples are described in more detail to illustrate the types of mechanisms that have been uncovered. PMID:20061810

  15. Structural diversity of bacterial flagellar motors

    PubMed Central

    Chen, Songye; Beeby, Morgan; Murphy, Gavin E; Leadbetter, Jared R; Hendrixson, David R; Briegel, Ariane; Li, Zhuo; Shi, Jian; Tocheva, Elitza I; Müller, Axel; Dobro, Megan J; Jensen, Grant J

    2011-01-01

    The bacterial flagellum is one of nature's most amazing and well-studied nanomachines. Its cell-wall-anchored motor uses chemical energy to rotate a microns-long filament and propel the bacterium towards nutrients and away from toxins. While much is known about flagellar motors from certain model organisms, their diversity across the bacterial kingdom is less well characterized, allowing the occasional misrepresentation of the motor as an invariant, ideal machine. Here, we present an electron cryotomographical survey of flagellar motor architectures throughout the Bacteria. While a conserved structural core was observed in all 11 bacteria imaged, surprisingly novel and divergent structures as well as different symmetries were observed surrounding the core. Correlating the motor structures with the presence and absence of particular motor genes in each organism suggested the locations of five proteins involved in the export apparatus including FliI, whose position below the C-ring was confirmed by imaging a deletion strain. The combination of conserved and specially-adapted structures seen here sheds light on how this complex protein nanomachine has evolved to meet the needs of different species. PMID:21673657

  16. Structural and genetic requirements for the biogenesis of tobacco rattle virus-derived small interfering RNAs.

    PubMed

    Donaire, Livia; Barajas, Daniel; Martínez-García, Belén; Martínez-Priego, Llucia; Pagán, Israel; Llave, César

    2008-06-01

    In plants, small RNA-guided processes referred to as RNA silencing control gene expression and serve as an efficient antiviral mechanism. Plant viruses are inducers and targets of RNA silencing as infection involves the production of functional virus-derived small interfering RNAs (siRNAs). Here we investigate the structural and genetic components influencing the formation of Tobacco rattle virus (TRV)-derived siRNAs. TRV siRNAs are mostly 21 nucleotides in length and derive from positive and negative viral RNA strands, although TRV siRNAs of positive polarity are significantly more abundant. This asymmetry appears not to correlate with the presence of highly structured regions of single-stranded viral RNA. The Dicer-like enzyme DCL4, DCL3, or DCL2 targets, alone or in combination, viral templates to promote synthesis of siRNAs of both polarities from all regions of the viral genome. The heterogeneous distribution profile of TRV siRNAs reveals differential contributions throughout the TRV genome to siRNA formation. Indirect evidence suggests that DCL2 is responsible for production of a subset of siRNAs derived from the 3' end region of TRV. TRV siRNA biogenesis and antiviral silencing are strongly dependent on the combined activity of the host-encoded RNA-dependent RNA polymerases RDR1, RDR2, and RDR6, thus providing evidence that perfectly complementary double-stranded RNA serves as a substrate for siRNA production. We conclude that the overall composition of viral siRNAs in TRV-infected plants reflects the combined action of several interconnected pathways involving different DCL and RDR activities. PMID:18353962

  17. Comprehensive identification of internal structure and alternative splicing events in circular RNAs.

    PubMed

    Gao, Yuan; Wang, Jinfeng; Zheng, Yi; Zhang, Jinyang; Chen, Shuai; Zhao, Fangqing

    2016-01-01

    Although previous studies demonstrated circular RNAs (circRNAs) does not exclusively comprise mRNA exons, no study has extensively explored their internal structure. By combining an algorithm with long-read sequencing data and experimental validation, we, for the first time, comprehensively investigate internal components of circRNAs in 10 human cell lines and 62 fruit fly samples, and reveal the prevalence of alternative splicing (AS) events within circRNAs. Significantly, a large proportion of circRNA AS exons can hardly be detected in mRNAs and are enriched with binding sites of distinct splicing factors from those enriched in mRNA exons. We find that AS events in circRNAs have a preference towards nucleus localization and exhibit tissue- and developmental stage-specific expression patterns. This study suggests an independent regulation on the biogenesis or decay of AS events in circRNAs and the identified circular AS isoforms provide targets for future studies on circRNA formation and function. PMID:27350239

  18. Comprehensive identification of internal structure and alternative splicing events in circular RNAs

    PubMed Central

    Gao, Yuan; Wang, Jinfeng; Zheng, Yi; Zhang, Jinyang; Chen, Shuai; Zhao, Fangqing

    2016-01-01

    Although previous studies demonstrated circular RNAs (circRNAs) does not exclusively comprise mRNA exons, no study has extensively explored their internal structure. By combining an algorithm with long-read sequencing data and experimental validation, we, for the first time, comprehensively investigate internal components of circRNAs in 10 human cell lines and 62 fruit fly samples, and reveal the prevalence of alternative splicing (AS) events within circRNAs. Significantly, a large proportion of circRNA AS exons can hardly be detected in mRNAs and are enriched with binding sites of distinct splicing factors from those enriched in mRNA exons. We find that AS events in circRNAs have a preference towards nucleus localization and exhibit tissue- and developmental stage-specific expression patterns. This study suggests an independent regulation on the biogenesis or decay of AS events in circRNAs and the identified circular AS isoforms provide targets for future studies on circRNA formation and function. PMID:27350239

  19. Structural insights into Transcriptional Repression by non-coding RNAs that bind to Human Pol II

    PubMed Central

    Kassube, Susanne A.; Fang, Jie; Grob, Patricia; Yakovchuk, Petro; Goodrich, James A.; Nogales, Eva

    2012-01-01

    Gene transcription is regulated in response to environmental changes as well as developmental cues. In mammalian cells subjected to stress conditions such as heat shock, transcription of most protein-coding genes decreases, while the transcription of heat shock protein genes increases. Repression involves direct binding to RNA polymerase II (Pol II) of certain non-coding RNAs (ncRNAs) that are upregulated upon heat shock. Another class of ncRNAs is also upregulated and binds to Pol II, but does not inhibit transcription. Incorporation of repressive ncRNAs into pre-initiation complexes prevents transcription initiation, while non-repressive ncRNAs are displaced from Pol II by TFIIF. Here, we present cryo-EM reconstructions of human Pol II in complex with six different ncRNAs from mouse and human. Our structures show that both repressive and non-repressive ncRNAs bind to a conserved binding site within the cleft of Pol II. The site, also shared with a previously characterized yeast aptamer, is close to the active center and thus in an ideal position to regulate transcription. Importantly, additional RNA elements extend flexibly beyond the docking site. We propose that the differences concerning the repressive activity of the ncRNA analyzed must be due to the distinct character of these more unstructured, flexible segments of the RNA that emanate from the cleft. PMID:22954660

  20. Biocomputational prediction of small non-coding RNAs in Streptomyces

    PubMed Central

    Pánek, Josef; Bobek, Jan; Mikulík, Karel; Basler, Marek; Vohradský, Jiří

    2008-01-01

    Background The first systematic study of small non-coding RNAs (sRNA, ncRNA) in Streptomyces is presented. Except for a few exceptions, the Streptomyces sRNAs, as well as the sRNAs in other genera of the Actinomyces group, have remained unstudied. This study was based on sequence conservation in intergenic regions of Streptomyces, localization of transcription termination factors, and genomic arrangement of genes flanking the predicted sRNAs. Results Thirty-two potential sRNAs in Streptomyces were predicted. Of these, expression of 20 was detected by microarrays and RT-PCR. The prediction was validated by a structure based computational approach. Two predicted sRNAs were found to be terminated by transcription termination factors different from the Rho-independent terminators. One predicted sRNA was identified computationally with high probability as a Streptomyces 6S RNA. Out of the 32 predicted sRNAs, 24 were found to be structurally dissimilar from known sRNAs. Conclusion Streptomyces is the largest genus of Actinomyces, whose sRNAs have not been studied. The Actinomyces is a group of bacterial species with unique genomes and phenotypes. Therefore, in Actinomyces, new unique bacterial sRNAs may be identified. The sequence and structural dissimilarity of the predicted Streptomyces sRNAs demonstrated by this study serve as the first evidence of the uniqueness of Actinomyces sRNAs. PMID:18477385

  1. Bacterial phylogeny structures soil resistomes across habitats

    NASA Astrophysics Data System (ADS)

    Forsberg, Kevin J.; Patel, Sanket; Gibson, Molly K.; Lauber, Christian L.; Knight, Rob; Fierer, Noah; Dantas, Gautam

    2014-05-01

    Ancient and diverse antibiotic resistance genes (ARGs) have previously been identified from soil, including genes identical to those in human pathogens. Despite the apparent overlap between soil and clinical resistomes, factors influencing ARG composition in soil and their movement between genomes and habitats remain largely unknown. General metagenome functions often correlate with the underlying structure of bacterial communities. However, ARGs are proposed to be highly mobile, prompting speculation that resistomes may not correlate with phylogenetic signatures or ecological divisions. To investigate these relationships, we performed functional metagenomic selections for resistance to 18 antibiotics from 18 agricultural and grassland soils. The 2,895 ARGs we discovered were mostly new, and represent all major resistance mechanisms. We demonstrate that distinct soil types harbour distinct resistomes, and that the addition of nitrogen fertilizer strongly influenced soil ARG content. Resistome composition also correlated with microbial phylogenetic and taxonomic structure, both across and within soil types. Consistent with this strong correlation, mobility elements (genes responsible for horizontal gene transfer between bacteria such as transposases and integrases) syntenic with ARGs were rare in soil by comparison with sequenced pathogens, suggesting that ARGs may not transfer between soil bacteria as readily as is observed between human pathogens. Together, our results indicate that bacterial community composition is the primary determinant of soil ARG content, challenging previous hypotheses that horizontal gene transfer effectively decouples resistomes from phylogeny.

  2. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  3. Tertiary structure of bacterial selenocysteine tRNA.

    PubMed

    Itoh, Yuzuru; Sekine, Shun-ichi; Suetsugu, Shiro; Yokoyama, Shigeyuki

    2013-07-01

    Selenocysteine (Sec) is translationally incorporated into proteins in response to the UGA codon. The tRNA specific to Sec (tRNA(Sec)) is first ligated with serine by seryl-tRNA synthetase (SerRS). In the present study, we determined the 3.1 Å crystal structure of the tRNA(Sec) from the bacterium Aquifex aeolicus, in complex with the heterologous SerRS from the archaeon Methanopyrus kandleri. The bacterial tRNA(Sec) assumes the L-shaped structure, from which the long extra arm protrudes. Although the D-arm conformation and the extra-arm orientation are similar to those of eukaryal/archaeal tRNA(Sec)s, A. aeolicus tRNA(Sec) has unique base triples, G14:C21:U8 and C15:G20a:G48, which occupy the positions corresponding to the U8:A14 and R15:Y48 tertiary base pairs of canonical tRNAs. Methanopyrus kandleri SerRS exhibited serine ligation activity toward A. aeolicus tRNA(Sec) in vitro. The SerRS N-terminal domain interacts with the extra-arm stem and the outer corner of tRNA(Sec). Similar interactions exist in the reported tRNA(Ser) and SerRS complex structure from the bacterium Thermus thermophilus. Although the catalytic C-terminal domain of M. kandleri SerRS lacks interactions with A. aeolicus tRNA(Sec) in the present complex structure, the conformational flexibility of SerRS is likely to allow the CCA terminal region of tRNA(Sec) to enter the SerRS catalytic site. PMID:23649835

  4. Use of genomic probes to detect hepatitis A virus and enterovirus RNAs in wild shellfish and relationship of viral contamination to bacterial contamination.

    PubMed Central

    Le Guyader, F; Apaire-Marchais, V; Brillet, J; Billaudel, S

    1993-01-01

    Genomic probes were used to investigate hepatitis A virus (HAV) and enterovirus RNAs in two types of shellfish from natural beds (Atlantic coast, France). After elution concentration, nucleic acid extracted by proteinase K and purified by phenol-chloroform and ethanol precipitation was assayed by dot blot hybridization. The probes used were a specific HAV probe corresponding to the 3' end (3D polymerase coding region) and an enterovirus probe corresponding to the 5' noncoding region. The method was first tested under experimental conditions by using virus-spiked shellfish before being applied under field conditions. Our results show that shellfish were highly contaminated: enterovirus and HAV RNAs were found in 63 and 67%, respectively, of samples examined with the riboprobes. On the same site, viral (HAV and enterovirus) RNAs were found in a larger fraction of cockles than mussels. Statistical tests of dependence showed no relationship between viral contamination and bacterial contamination (evaluated by fecal coliform counts). Images PMID:8285700

  5. Search for characteristic structural features of mammalian mitochondrial tRNAs.

    PubMed Central

    Helm, M; Brulé, H; Friede, D; Giegé, R; Pütz, D; Florentz, C

    2000-01-01

    A number of mitochondrial (mt) tRNAs have strong structural deviations from the classical tRNA cloverleaf secondary structure and from the conventional L-shaped tertiary structure. As a consequence, there is a general trend to consider all mitochondrial tRNAs as "bizarre" tRNAs. Here, a large sequence comparison of the 22 tRNA genes within 31 fully sequenced mammalian mt genomes has been performed to define the structural characteristics of this specific group of tRNAs. Vertical alignments define the degree of conservation/variability of primary sequences and secondary structures and search for potential tertiary interactions within each of the 22 families. Further horizontal alignments ascertain that, with the exception of serine-specific tRNAs, mammalian mt tRNAs do fold into cloverleaf structures with mostly classical features. However, deviations exist and concern large variations in size of the D- and T-loops. The predominant absence of the conserved nucleotides G18G19 and T54T55C56, respectively in these loops, suggests that classical tertiary interactions between both domains do not take place. Classification of the tRNA sequences according to their genomic origin (G-rich or G-poor DNA strand) highlight specific features such as richness/poorness in mismatches or G-T pairs in stems and extremely low G-content or C-content in the D- and T-loops. The resulting 22 "typical" mammalian mitochondrial sequences built up a phylogenetic basis for experimental structural and functional investigations. Moreover, they are expected to help in the evaluation of the possible impacts of those point mutations detected in human mitochondrial tRNA genes and correlated with pathologies. PMID:11073213

  6. Understanding the Functions of Long Non-Coding RNAs through Their Higher-Order Structures.

    PubMed

    Li, Rui; Zhu, Hongliang; Luo, Yunbo

    2016-01-01

    Although thousands of long non-coding RNAs (lncRNAs) have been discovered in eukaryotes, very few molecular mechanisms have been characterized due to an insufficient understanding of lncRNA structure. Therefore, investigations of lncRNA structure and subsequent elucidation of the regulatory mechanisms are urgently needed. However, since lncRNA are high molecular weight molecules, which makes their crystallization difficult, obtaining information about their structure is extremely challenging, and the structures of only several lncRNAs have been determined so far. Here, we review the structure-function relationships of the widely studied lncRNAs found in the animal and plant kingdoms, focusing on the principles and applications of both in vitro and in vivo technologies for the study of RNA structures, including dimethyl sulfate-sequencing (DMS-seq), selective 2'-hydroxyl acylation analyzed by primer extension-sequencing (SHAPE-seq), parallel analysis of RNA structure (PARS), and fragmentation sequencing (FragSeq). The aim of this review is to provide a better understanding of lncRNA biological functions by studying them at the structural level. PMID:27196897

  7. Identification of candidate structured RNAs in the marine organism 'Candidatus Pelagibacter ubique'

    PubMed Central

    Meyer, Michelle M; Ames, Tyler D; Smith, Daniel P; Weinberg, Zasha; Schwalbach, Michael S; Giovannoni, Stephen J; Breaker, Ronald R

    2009-01-01

    Background Metagenomic sequence data are proving to be a vast resource for the discovery of biological components. Yet analysis of this data to identify functional RNAs lags behind efforts to characterize protein diversity. The genome of 'Candidatus Pelagibacter ubique' HTCC 1062 is the closest match for approximately 20% of marine metagenomic sequence reads. It is also small, contains little non-coding DNA, and has strikingly low GC content. Results To aid the discovery of RNA motifs within the marine metagenome we exploited the genomic properties of 'Cand. P. ubique' by targeting our search to long intergenic regions (IGRs) with relatively high GC content. Analysis of known RNAs (rRNA, tRNA, riboswitches etc.) shows that structured RNAs are significantly enriched in such IGRs. To identify additional candidate structured RNAs, we examined other IGRs with similar characteristics from 'Cand. P. ubique' using comparative genomics approaches in conjunction with marine metagenomic data. Employing this strategy, we discovered four candidate structured RNAs including a new riboswitch class as well as three additional likely cis-regulatory elements that precede genes encoding ribosomal proteins S2 and S12, and the cytoplasmic protein component of the signal recognition particle. We also describe four additional potential RNA motifs with few or no examples occurring outside the metagenomic data. Conclusion This work begins the process of identifying functional RNA motifs present in the metagenomic data and illustrates how existing completed genomes may be used to aid in this task. PMID:19531245

  8. Understanding the Functions of Long Non-Coding RNAs through Their Higher-Order Structures

    PubMed Central

    Li, Rui; Zhu, Hongliang; Luo, Yunbo

    2016-01-01

    Although thousands of long non-coding RNAs (lncRNAs) have been discovered in eukaryotes, very few molecular mechanisms have been characterized due to an insufficient understanding of lncRNA structure. Therefore, investigations of lncRNA structure and subsequent elucidation of the regulatory mechanisms are urgently needed. However, since lncRNA are high molecular weight molecules, which makes their crystallization difficult, obtaining information about their structure is extremely challenging, and the structures of only several lncRNAs have been determined so far. Here, we review the structure–function relationships of the widely studied lncRNAs found in the animal and plant kingdoms, focusing on the principles and applications of both in vitro and in vivo technologies for the study of RNA structures, including dimethyl sulfate-sequencing (DMS-seq), selective 2′-hydroxyl acylation analyzed by primer extension-sequencing (SHAPE-seq), parallel analysis of RNA structure (PARS), and fragmentation sequencing (FragSeq). The aim of this review is to provide a better understanding of lncRNA biological functions by studying them at the structural level. PMID:27196897

  9. Modification of the wobble uridine in bacterial and mitochondrial tRNAs reading NNA/NNG triplets of 2-codon boxes

    PubMed Central

    Armengod, M Eugenia; Meseguer, Salvador; Villarroya, Magda; Prado, Silvia; Moukadiri, Ismaïl; Ruiz-Partida, Rafael; Garzón, M José; Navarro-González, Carmen; Martínez-Zamora, Ana

    2014-01-01

    Posttranscriptional modification of the uridine located at the wobble position (U34) of tRNAs is crucial for optimization of translation. Defects in the U34 modification of mitochondrial-tRNAs are associated with a group of rare diseases collectively characterized by the impairment of the oxidative phosphorylation system. Retrograde signaling pathways from mitochondria to nucleus are involved in the pathophysiology of these diseases. These pathways may be triggered by not only the disturbance of the mitochondrial (mt) translation caused by hypomodification of tRNAs, but also as a result of nonconventional roles of mt-tRNAs and mt-tRNA-modifying enzymes. The evolutionary conservation of these enzymes supports their importance for cell and organismal functions. Interestingly, bacterial and eukaryotic cells respond to stress by altering the expression or activity of these tRNA-modifying enzymes, which leads to changes in the modification status of tRNAs. This review summarizes recent findings about these enzymes and sets them within the previous data context. PMID:25607529

  10. Plant virus-derived small interfering RNAs originate predominantly from highly structured single-stranded viral RNAs.

    PubMed

    Molnár, Attila; Csorba, Tibor; Lakatos, Lóránt; Várallyay, Eva; Lacomme, Christophe; Burgyán, József

    2005-06-01

    RNA silencing is conserved in a broad range of eukaryotes and includes the phenomena of RNA interference in animals and posttranscriptional gene silencing (PTGS) in plants. In plants, PTGS acts as an antiviral system; a successful virus infection requires suppression or evasion of the induced silencing response. Small interfering RNAs (siRNAs) accumulate in plants infected with positive-strand RNA viruses and provide specificity to this RNA-mediated defense. We present here the results of a survey of virus-specific siRNAs characterized by a sequence analysis of siRNAs from plants infected with Cymbidium ringspot tombusvirus (CymRSV). CymRSV siRNA sequences have a nonrandom distribution along the length of the viral genome, suggesting that there are hot spots for virus-derived siRNA generation. CymRSV siRNAs bound to the CymRSV p19 suppressor protein have the same asymmetry in strand polarity as the sequenced siRNAs and are imperfect double-stranded RNA duplexes. Moreover, an analysis of siRNAs derived from two other nonrelated positive-strand RNA viruses showed that they displayed the same asymmetry as CymRSV siRNAs. Finally, we show that Tobacco mosaic virus (TMV) carrying a short inverted repeat of the phytoene desaturase (PDS) gene triggered more accumulation of PDS siRNAs than the corresponding antisense PDS sequence. Taken together, these results suggest that virus-derived siRNAs originate predominantly by direct DICER cleavage of imperfect duplexes in the most folded regions of the positive strand of the viral RNA. PMID:15919934

  11. Shape and secondary structure prediction for ncRNAs including pseudoknots based on linear SVM

    PubMed Central

    2013-01-01

    Background Accurate secondary structure prediction provides important information to undefirstafinding the tertiary structures and thus the functions of ncRNAs. However, the accuracy of the native structure derivation of ncRNAs is still not satisfactory, especially on sequences containing pseudoknots. It is recently shown that using the abstract shapes, which retain adjacency and nesting of structural features but disregard the length details of helix and loop regions, can improve the performance of structure prediction. In this work, we use SVM-based feature selection to derive the consensus abstract shape of homologous ncRNAs and apply the predicted shape to structure prediction including pseudoknots. Results Our approach was applied to predict shapes and secondary structures on hundreds of ncRNA data sets with and without psuedoknots. The experimental results show that we can achieve 18% higher accuracy in shape prediction than the state-of-the-art consensus shape prediction tools. Using predicted shapes in structure prediction allows us to achieve approximate 29% higher sensitivity and 10% higher positive predictive value than other pseudoknot prediction tools. Conclusions Extensive analysis of RNA properties based on SVM allows us to identify important properties of sequences and structures related to their shapes. The combination of mass data analysis and SVM-based feature selection makes our approach a promising method for shape and structure prediction. The implemented tools, Knot Shape and Knot Structure are open source software and can be downloaded at: http://www.cse.msu.edu/~achawana/KnotShape. PMID:23369147

  12. Characterization of Circular RNAs.

    PubMed

    Zhang, Yang; Yang, Li; Chen, Ling-Ling

    2016-01-01

    Accumulated lines of evidence reveal that a large number of circular RNAs are produced in transcriptomes from fruit fly to mouse and human. Unlike linear RNAs shaped with 5' cap and 3' tail, circular RNAs are characterized by covalently closed loop structures without open terminals, thus requiring specific treatments for their identification and validation. Here, we describe a detailed pipeline for the characterization of circular RNAs. It has been successfully applied to the study of circular intronic RNAs derived from intron lariats (ciRNAs) and circular RNAs produced from back spliced exons (circRNAs) in human. PMID:26721494

  13. 3S: shotgun secondary structure determination of long non-coding RNAs.

    PubMed

    Novikova, Irina V; Dharap, Ashutosh; Hennelly, Scott P; Sanbonmatsu, Karissa Y

    2013-09-15

    Long non-coding RNAs (lncRNAs) have emerged as an important class of RNAs playing key roles in development, disease and epigenetics. Knowledge of lncRNA structure may be critical in understanding function for many lncRNA systems. Due to the enormous number of possible folds for these sequences, secondary structure determination presents a significant challenge, both experimentally and computationally. Here, we present a new strategy capable of determining the RNA secondary structure in the wet lab without significant reliance on computational predictions. First, we chemically probe the entire lncRNA. Next, using a shotgun approach, we divide the RNA into overlapping fragments and probe these fragments. We then compare probing profiles of fragments with the profiles of the full RNA and identify similarities. Sequence regions with profiles that are similar in the fragment and full-length transcript possess only base pairing partners within the fragment. Thus, by experimentally folding smaller and smaller fragments of the full RNA and probing these chemically, we are able to isolate modular sub-domains, dramatically reducing the number of possible folds. The method also eliminates the possibility of pseudoknots within a modular sub-domain. The 3S technique is ideally suited for lncRNAs because it is designed for long RNA sequences. The 3S-determined secondary structure of a specific lncRNA in one species (e.g., human) enables searches for instances of the same lncRNA in other species. PMID:23927838

  14. Structure of bacterial respiratory complex I.

    PubMed

    Berrisford, John M; Baradaran, Rozbeh; Sazanov, Leonid A

    2016-07-01

    Complex I (NADH:ubiquinone oxidoreductase) plays a central role in cellular energy production, coupling electron transfer between NADH and quinone to proton translocation. It is the largest protein assembly of respiratory chains and one of the most elaborate redox membrane proteins known. Bacterial enzyme is about half the size of mitochondrial and thus provides its important "minimal" model. Dysfunction of mitochondrial complex I is implicated in many human neurodegenerative diseases. The L-shaped complex consists of a hydrophilic arm, where electron transfer occurs, and a membrane arm, where proton translocation takes place. We have solved the crystal structures of the hydrophilic domain of complex I from Thermus thermophilus, the membrane domain from Escherichia coli and recently of the intact, entire complex I from T. thermophilus (536 kDa, 16 subunits, 9 iron-sulphur clusters, 64 transmembrane helices). The 95Å long electron transfer pathway through the enzyme proceeds from the primary electron acceptor flavin mononucleotide through seven conserved Fe-S clusters to the unusual elongated quinone-binding site at the interface with the membrane domain. Four putative proton translocation channels are found in the membrane domain, all linked by the central flexible axis containing charged residues. The redox energy of electron transfer is coupled to proton translocation by the as yet undefined mechanism proposed to involve long-range conformational changes. This article is part of a Special Issue entitled Respiratory complex I, edited by Volker Zickermann and Ulrich Brandt. PMID:26807915

  15. Expressed miRNAs target feather related mRNAs involved in cell signaling, cell adhesion and structure during chicken epidermal development.

    PubMed

    Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H

    2016-10-15

    MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression at the post-transcriptional level. Previous studies have shown that miRNA regulation contributes to a diverse set of processes including cellular differentiation and morphogenesis which leads to the creation of different cell types in multicellular organisms and is thus key to animal development. Feathers are one of the most distinctive features of extant birds and are important for multiple functions including flight, thermal regulation, and sexual selection. However, the role of miRNAs in feather development has been woefully understudied despite the identification of cell signaling pathways, cell adhesion molecules and structural genes involved in feather development. In this study, we performed a microarray experiment comparing the expression of miRNAs and mRNAs among three embryonic stages of development and two tissues (scutate scale and feather) of the chicken. We combined this expression data with miRNA target prediction tools and a curated list of feather related genes to produce a set of 19 miRNA-mRNA duplexes. These targeted mRNAs have been previously identified as important cell signaling and cell adhesion genes as well as structural genes involved in feather and scale morphogenesis. Interestingly, the miRNA target site of the cell signaling pathway gene, Aldehyde Dehydrogenase 1 Family, Member A3 (ALDH1A3), is unique to birds indicating a novel role in Aves. The identified miRNA target site of the cell adhesion gene, Tenascin C (TNC), is only found in specific chicken TNC splice variants that are differentially expressed in developing scutate scale and feather tissue indicating an important role of miRNA regulation in epidermal differentiation. Additionally, we found that β-keratins, a major structural component of avian and reptilian epidermal appendages, are targeted by multiple miRNA genes. In conclusion, our work provides quantitative expression data on miRNAs and mRNAs

  16. Non-coding Y RNAs as tethers and gates

    PubMed Central

    Wolin, Sandra L; Belair, Cedric; Boccitto, Marco; Chen, Xinguo; Sim, Soyeong; Taylor, David W; Wang, Hong-Wei

    2013-01-01

    Non-coding RNAs (ncRNAs) called Y RNAs are abundant components of both animal cells and a variety of bacteria. In all species examined, these ~100 nt RNAs are bound to the Ro 60 kDa (Ro60) autoantigen, a ring-shaped protein that also binds misfolded ncRNAs in some vertebrate nuclei. Although the function of Ro60 RNPs has been mysterious, we recently reported that a bacterial Y RNA tethers Ro60 to the 3′ to 5′ exoribonuclease polynucleotide phosphorylase (PNPase) to form RYPER (Ro60/Y RNA/PNPase Exoribonuclease RNP), a new RNA degradation machine. PNPase is a homotrimeric ring that degrades single-stranded RNA, and Y RNA-mediated tethering of Ro60 increases the effectiveness of PNPase in degrading structured RNAs. Single particle electron microscopy of RYPER suggests that RNA threads through the Ro60 ring into the PNPase cavity. Further studies indicate that Y RNAs may also act as gates to regulate entry of RNA substrates into the Ro60 channel. These findings reveal novel functions for Y RNAs and raise questions about how the bacterial findings relate to the roles of these ncRNAs in animal cells. Here we review the literature on Y RNAs, highlighting their close relationship with Ro60 proteins and the hypothesis that these ncRNAs function generally to tether Ro60 rings to diverse RNA-binding proteins. PMID:24036917

  17. Jellyfish modulate bacterial dynamic and community structure.

    PubMed

    Tinta, Tinkara; Kogovšek, Tjaša; Malej, Alenka; Turk, Valentina

    2012-01-01

    Jellyfish blooms have increased in coastal areas around the world and the outbreaks have become longer and more frequent over the past few decades. The Mediterranean Sea is among the heavily affected regions and the common bloom-forming taxa are scyphozoans Aurelia aurita s.l., Pelagia noctiluca, and Rhizostoma pulmo. Jellyfish have few natural predators, therefore their carcasses at the termination of a bloom represent an organic-rich substrate that supports rapid bacterial growth, and may have a large impact on the surrounding environment. The focus of this study was to explore whether jellyfish substrate have an impact on bacterial community phylotype selection. We conducted in situ jellyfish-enrichment experiment with three different jellyfish species. Bacterial dynamic together with nutrients were monitored to assess decaying jellyfish-bacteria dynamics. Our results show that jellyfish biomass is characterized by protein rich organic matter, which is highly bioavailable to 'jellyfish-associated' and 'free-living' bacteria, and triggers rapid shifts in bacterial population dynamics and composition. Based on 16S rRNA clone libraries and denaturing gradient gel electrophoresis (DGGE) analysis, we observed a rapid shift in community composition from unculturable Alphaproteobacteria to culturable species of Gammaproteobacteria and Flavobacteria. The results of sequence analyses of bacterial isolates and of total bacterial community determined by culture independent genetic analysis showed the dominance of the Pseudoalteromonadaceae and the Vibrionaceae families. Elevated levels of dissolved proteins, dissolved organic and inorganic nutrient release, bacterial abundance and carbon production as well as ammonium concentrations characterized the degradation process. The biochemical composition of jellyfish species may influence changes in the amount of accumulated dissolved organic and inorganic nutrients. Our results can contribute insights into possible changes in

  18. Jellyfish Modulate Bacterial Dynamic and Community Structure

    PubMed Central

    Tinta, Tinkara; Kogovšek, Tjaša; Malej, Alenka; Turk, Valentina

    2012-01-01

    Jellyfish blooms have increased in coastal areas around the world and the outbreaks have become longer and more frequent over the past few decades. The Mediterranean Sea is among the heavily affected regions and the common bloom - forming taxa are scyphozoans Aurelia aurita s.l., Pelagia noctiluca, and Rhizostoma pulmo. Jellyfish have few natural predators, therefore their carcasses at the termination of a bloom represent an organic-rich substrate that supports rapid bacterial growth, and may have a large impact on the surrounding environment. The focus of this study was to explore whether jellyfish substrate have an impact on bacterial community phylotype selection. We conducted in situ jellyfish - enrichment experiment with three different jellyfish species. Bacterial dynamic together with nutrients were monitored to assess decaying jellyfish-bacteria dynamics. Our results show that jellyfish biomass is characterized by protein rich organic matter, which is highly bioavailable to ‘jellyfish - associated’ and ‘free - living’ bacteria, and triggers rapid shifts in bacterial population dynamics and composition. Based on 16S rRNA clone libraries and denaturing gradient gel electrophoresis (DGGE) analysis, we observed a rapid shift in community composition from unculturable Alphaproteobacteria to culturable species of Gammaproteobacteria and Flavobacteria. The results of sequence analyses of bacterial isolates and of total bacterial community determined by culture independent genetic analysis showed the dominance of the Pseudoalteromonadaceae and the Vibrionaceae families. Elevated levels of dissolved proteins, dissolved organic and inorganic nutrient release, bacterial abundance and carbon production as well as ammonium concentrations characterized the degradation process. The biochemical composition of jellyfish species may influence changes in the amount of accumulated dissolved organic and inorganic nutrients. Our results can contribute insights into

  19. A parallel strategy for predicting the secondary structure of polycistronic microRNAs.

    PubMed

    Han, Dianwei; Tang, Guiliang; Zhang, Jun

    2013-01-01

    The biogenesis of a functional microRNA is largely dependent on the secondary structure of the microRNA precursor (pre-miRNA). Recently, it has been shown that microRNAs are present in the genome as the form of polycistronic transcriptional units in plants and animals. It will be important to design efficient computational methods to predict such structures for microRNA discovery and its applications in gene silencing. In this paper, we propose a parallel algorithm based on the master-slave architecture to predict the secondary structure from an input sequence. We conducted some experiments to verify the effectiveness of our parallel algorithm. The experimental results show that our algorithm is able to produce the optimal secondary structure of polycistronic microRNAs. PMID:23467060

  20. Regulation of transcription by 6S RNAs

    PubMed Central

    Steuten, Benedikt; Hoch, Philipp G; Damm, Katrin; Schneider, Sabine; Köhler, Karen; Wagner, Rolf; Hartmann, Roland K

    2014-01-01

    Whereas, the majority of bacterial non-coding RNAs and functional RNA elements regulate post-transcriptional processes, either by interacting with other RNAs via base-pairing or through binding of small ligands (riboswitches), 6S RNAs affect transcription itself by binding to the housekeeping holoenzyme of RNA polymerase (RNAP). Remarkably, 6S RNAs serve as RNA templates for bacterial RNAP, giving rise to the de novo synthesis of short transcripts, termed pRNAs (product RNAs). Hence, 6S RNAs prompt the enzyme to act as an RNA-dependent RNA polymerase (RdRP). Synthesis of pRNAs exceeding a certain length limit (~13 nt) persistently rearrange the 6S RNA structure, which in turn, disrupts the 6S RNA:RNAP complex. This pRNA synthesis-mediated “reanimation” of sequestered RNAP molecules represents the conceivably fastest mechanism for resuming transcription in cells that enter a new exponential growth phase. The many different 6S RNAs found in a wide variety of bacteria do not share strong sequence homology but have in common a conserved rod-shaped structure with a large internal loop, termed the central bulge; this architecture mediates specific binding to the active site of RNAP. In this article, we summarize the overall state of knowledge as well as very recent findings on the structure, function, and physiological effects of 6S RNA examples from the two model organisms, Escherichia coli and Bacillus subtilis. Comparison of the presently known properties of 6S RNAs in the two organisms highlights common principles as well as diverse features. PMID:24786589

  1. Structure-guided design of fluorescent S-adenosylmethionine analogs for a high-throughput screen to target SAM-I riboswitch RNAs

    PubMed Central

    Hickey, Scott F.; Hammond, Ming C.

    2014-01-01

    Summary Many classes of S-adenosylmethionine (SAM)-binding RNAs and proteins are of interest as potential drug targets in diverse therapeutic areas, from infectious diseases to cancer. In the former case, the SAM-I riboswitch is an attractive target because this structured RNA element is found only in bacterial mRNAs and regulates multiple genes in several human pathogens. Here we describe the synthesis of stable and fluorescent analogs of SAM in which the fluorophore is introduced through a functionalizable linker to the ribose. A Cy5-labeled SAM analog was shown to bind several SAM-I riboswitches via in-line probing and fluorescence polarization (FP) assays, including one from Staphylococcus aureus that controls the expression of SAM synthetase in this organism. A fluorescent ligand displacement assay was developed and validated for high-throughput screening of compounds to target the SAM-I riboswitch class. PMID:24560607

  2. The Structure and Function of Bacterial Actin Homologs

    PubMed Central

    Shaevitz, Joshua W.; Gitai, Zemer

    2010-01-01

    During the past decade, the appreciation and understanding of how bacterial cells can be organized in both space and time have been revolutionized by the identification and characterization of multiple bacterial homologs of the eukaryotic actin cytoskeleton. Some of these bacterial actins, such as the plasmid-borne ParM protein, have highly specialized functions, whereas other bacterial actins, such as the chromosomally encoded MreB protein, have been implicated in a wide array of cellular activities. In this review we cover our current understanding of the structure, assembly, function, and regulation of bacterial actins. We focus on ParM as a well-understood reductionist model and on MreB as a central organizer of multiple aspects of bacterial cell biology. We also discuss the outstanding puzzles in the field and possible directions where this fast-developing area may progress in the future. PMID:20630996

  3. Structures of Human Pumilio with Noncognate RNAs Reveal Molecular Mechanisms for Binding Promiscuity

    SciTech Connect

    Gupta,Y.; Nair, D.; Wharton, R.; Aggarwal, A.

    2008-01-01

    Pumilio is a founder member of the evolutionarily conserved Puf family of RNA-binding proteins that control a number of physiological processes in eukaryotes. A structure of human Pumilio (hPum) Puf domain bound to a Drosophila regulatory sequence showed that each Puf repeat recognizes a single nucleotide. Puf domains in general bind promiscuously to a large set of degenerate sequences, but the structural basis for this promiscuity has been unclear. Here, we describe the structures of hPum Puf domain complexed to two noncognate RNAs, CycBreverse and Puf5. In each complex, one of the nucleotides is ejected from the binding surface, in effect, acting as a 'spacer.' The complexes also reveal the plasticity of several Puf repeats, which recognize noncanonical nucleotides. Together, these complexes provide a molecular basis for recognition of degenerate binding sites, which significantly increases the number of mRNAs targeted for regulation by Puf proteins in vivo.

  4. Argonaute-dependent small RNAs derived from single-stranded, non-structured precursors

    PubMed Central

    Chak, Li-Ling; Okamura, Katsutomo

    2014-01-01

    A general feature of Argonaute-dependent small RNAs is their base-paired precursor structures, and precursor duplex structures are often required for confident annotation of miRNA genes. However, this rule has been broken by discoveries of functional small RNA species whose precursors lack a predictable double-stranded (ds-) RNA structure, arguing that duplex structures are not prerequisite for small RNA loading to Argonautes. The biological significance of single-stranded (ss-) RNA loading has been recognized particularly in systems where active small RNA amplification mechanisms are involved, because even a small amount of RNA molecules can trigger the production of abundant RNA species leading to profound biological effects. However, even in the absence of small RNA amplification mechanisms, recent studies have demonstrated that potent gene silencing can be achieved using chemically modified synthetic ssRNAs that are resistant to RNases in mice. Therefore, such ssRNA-mediated gene regulation may have broader roles than previously recognized, and the findings have opened the door for further research to optimize the design of ss-siRNAs toward future pharmaceutical and biomedical applications of gene silencing technologies. In this review, we will summarize studies about endogenous ssRNA species that are bound by Argonaute proteins and how ssRNA precursors are recognized by various small RNA pathways. PMID:24959173

  5. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  6. The impact of structure dimensions on initial bacterial adhesion.

    PubMed

    Helbig, Ralf; Günther, Denise; Friedrichs, Jens; Rößler, Florian; Lasagni, Andrés; Werner, Carsten

    2016-07-21

    Substrate topography can have profound effects on initial bacterial adhesion during biofilm formation. We applied Staphylococcus epidermidis and Escherichia coli cells onto periodically structured substrates with different structure dimensions, structure types and wetting properties. We found a strong dependence of cell retention on the structure dimensions of the applied substrates. Periodicities in the range of the cell size increased, whereas smaller periodicities decreased cell retention, independent of contact time (minutes to hours) and hydrophobicity. These novel insights on the role of surface topography on bacterial retention might facilitate the development of non-fouling surfaces in the future. PMID:27232637

  7. Capped mRNAs with reduced secondary structure can function in extracts from poliovirus-infected cells

    SciTech Connect

    Sonenberg, N.; Guertin, D.; Lee, K.A.W.

    1982-12-01

    Extracts form poliovirus-infected HeLa cells were used to study ribosome binding of native and denatured reovirus mRNAs and translation of capped mRNAs with different degrees of secondary structure. Here, the authors demonstrate that ribosomes in extracts from poliovirus-infected cells could form initiation complexes with denatured reovirus mRNA, in contrast to their inability to bind native reovirus mRNA. Furthermore, the capped alfalfa mosiac virus 4 RNA, which is most probable devoid of stable secondary structure at its 5' end, could be translated at much higher efficiency than could other capped mRNAs in extracts from poliovirus-infected cells.

  8. Putative secondary structures of unusually long strepsipteran SSU rRNAs and its phylogenetic implications.

    PubMed

    Choe, C P; Hwang, U W; Kim, W

    1999-04-30

    We constructed the putative secondary structures of the small subunit rRNAs (SSU rRNA) from three strepsipteran insects. The primary sequences of the strepsipteran SSU rRNAs are unusually long due to unique and long insertions. In spite of these insertions, the basic shapes of their secondary structures are well maintained as shown in those of other eukaryotes, because these insertions appear mainly in the variable regions. The secondary structures for the V1, V3, V5, V8, and V9 regions are well conserved, even though the primary structures of V1, V5, and V8 regions are quite variable. However, the predicted secondary structures for the V2, V4, and V7 regions are quite different from those of other insects. In the V4 and V7 regions, helices specific to the Strepsiptera exist. These helices have not been reported in other organisms so far. Similarly, four eukaryotic specific helices (E8-1, E10-2, E23-4 and E45-1) not reported in insects exist in the V2, V4, and V8 regions. These helices are formed by the inserted sequences. The secondary structures of the expanded segments of the strepsipteran SSU rRNA were applied to infer the phylogenetic position of Strepsiptera, one of the most enigmatic problems in insect phylogeny. Only the secondary structure of the V7 region showed the weak Strepsiptera/Diptera sister-group relationship. PMID:10340475

  9. Bacterial pectate lyases, structural and functional diversity.

    PubMed

    Hugouvieux-Cotte-Pattat, Nicole; Condemine, Guy; Shevchik, Vladimir E

    2014-10-01

    Pectate lyases are enzymes involved in plant cell wall degradation. They cleave pectin using a β-elimination mechanism, specific for acidic polysaccharides. They are mainly produced by plant pathogens and plant-associated organisms, and only rarely by animals. Pectate lyases are also commonly produced in the bacterial world, either by bacteria living in close proximity with plants or by gut bacteria that find plant material in the digestive tract of their hosts. The role of pectate lyases is essential for plant pathogens, such as Dickeya dadantii, that use a set of pectate lyases as their main virulence factor. Symbiotic bacteria produce their own pectate lyases, but they also induce plant pectate lyases to initiate the symbiosis. Pectin degradation products may act as signals affecting the plant–bacteria interactions. Bacterial pectate lyases are also essential for using the pectin of dead or living plants as a carbon source for growth. In the animal gut, Bacteroides pectate lyases degrade the pectin of ingested food, and this is particularly important for herbivores that depend on their microflora for the digestion of pectin. Some human pathogens, such as Yersinia enterocolitica, produce a few intracellular pectate lyases that can facilitate their growth in the presence of highly pectinolytic bacteria, at the plant surface, in the soil or in the animal gut. PMID:25646533

  10. The structures of nonprotein-coding RNAs that drive internal ribosome entry site function.

    PubMed

    Plank, Terra-Dawn M; Kieft, Jeffrey S

    2012-01-01

    Internal ribosome entry sites (IRESs) are RNA sequences that can recruit the translation machinery independent of the 5' end of the messenger RNA. IRESs are found in both viral and cellular RNAs and are important for regulating gene expression. There is great diversity in the mechanisms used by IRESs to recruit the ribosome and this is reflected in a variety of RNA sequences that function as IRESs. The ability of an RNA sequence to function as an IRES is conferred by structures operating at multiple levels from primary sequence through higher-order three-dimensional structures within dynamic ribonucleoproteins (RNPs). When these diverse structures are compared, some trends are apparent, but overall it is not possible to find universal rules to describe IRES structure and mechanism. Clearly, many different sequences and structures have evolved to perform the function of recruiting, positioning, and activating a ribosome without using the canonical cap-dependent mechanism. However, as our understanding of the specific sequences, structures, and mechanisms behind IRES function improves, more common features may emerge to link these diverse RNAs. PMID:22215521

  11. The structures of non-protein coding RNAs that drive IRES function

    PubMed Central

    Plank, Terra-Dawn M.

    2014-01-01

    Internal Ribosome Entry sites (IRESs) are RNA sequences that can recruit the translation machinery independently of the 5′ end of the messenger RNA. IRESs are found in both viral and cellular RNAs and are important for regulating gene expression. There is great diversity in the mechanisms used by IRESs to recruit the ribosome and this is reflected in a variety of RNA sequences that function as IRESs. The ability of an RNA sequence to function as an IRES is conferred by structures operating at multiple levels from primary sequence through higher-order three-dimensional structures within dynamic RNPs. When these diverse structures are compared, some trends are apparent, but overall it is not possible to find universal rules to describe IRES structure and mechanism. Clearly, many different sequences and structures have evolved to perform the function of recruiting, positioning, and activating a ribosome without using the canonical cap-dependent mechanism. However, as our understanding of the specific sequences, structures, and mechanisms behind IRES function improves, more common features may emerge to link these diverse RNAs. PMID:22215521

  12. Secondary structures of rRNAs from all three domains of life.

    PubMed

    Petrov, Anton S; Bernier, Chad R; Gulen, Burak; Waterbury, Chris C; Hershkovits, Eli; Hsiao, Chiaolong; Harvey, Stephen C; Hud, Nicholas V; Fox, George E; Wartell, Roger M; Williams, Loren Dean

    2014-01-01

    Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2°) structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU) 23S/28S and small subunit (SSU) 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only), Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery). Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision). PMID:24505437

  13. Secondary Structures of rRNAs from All Three Domains of Life

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Gulen, Burak; Waterbury, Chris C.; Hershkovits, Eli; Hsiao, Chiaolong; Harvey, Stephen C.; Hud, Nicholas V.; Fox, George E.; Wartell, Roger M.; Williams, Loren Dean

    2014-01-01

    Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2°) structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU) 23S/28S and small subunit (SSU) 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only), Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery). Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision). PMID:24505437

  14. Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

    NASA Astrophysics Data System (ADS)

    Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

    2016-04-01

    The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

  15. Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

    PubMed Central

    Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

    2016-01-01

    The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function. PMID:27053355

  16. Statistical evidence for conserved, local secondary structure in the coding regions of eukaryotic mRNAs and pre-mRNAs

    PubMed Central

    Meyer, Irmtraud M.; Miklós, István

    2005-01-01

    Owing to the degeneracy of the genetic code, protein-coding regions of mRNA sequences can harbour more than only amino acid information. We search the mRNA sequences of 11 human protein-coding genes for evolutionarily conserved secondary structure elements using RNA-Decoder, a comparative secondary structure prediction program that is capable of explicitly taking the known protein-coding context of the mRNA sequences into account. We detect well-defined, conserved RNA secondary structure elements in the coding regions of the mRNA sequences and show that base-paired codons strongly correlate with sparse codons. We also investigate the role of repetitive elements in the formation of secondary structure and explain the use of alternate start codons in the caveolin-1 gene by a conserved secondary structure element overlapping the nominal start codon. We discuss the functional roles of our novel findings in regulating the gene expression on mRNA level. We also investigate the role of secondary structure on the correct splicing of the human CFTR gene. We study the wild-type version of the pre-mRNA as well as 29 variants with synonymous mutations in exon 12. By comparing our predicted secondary structures to the experimentally determined splicing efficiencies, we find with weak statistical significance that pre-mRNAs with high-splicing efficiencies have different predicted secondary structures than pre-mRNAs with low-splicing efficiencies. PMID:16275783

  17. Characteristics and crystal structure of bacterial inosine-5'-monophosphate dehydrogenase.

    SciTech Connect

    Zhang, R.; Evans, G.; Rotella, F. J.; Westbrook, E. M.; Beno, D.; Huberman, E.; Joachimiak, A.; Collart, F. R.

    1999-01-01

    IMP dehydrogenase (IMPDH) is an essential enzyme that catalyzes the first step unique to GTP synthesis. To provide a basis for the evaluation of IMPDH inhibitors as antimicrobial agents, we have expressed and characterized IMPDH from the pathogenic bacterium Streptococcus pyogenes. Our results show that the biochemical and kinetic characteristics of S. pyogenes IMPDH are similar to other bacterial IMPDH enzymes. However, the lack of sensitivity to mycophenolic acid and the K{sub m} for NAD (1180 {mu}M) exemplify some of the differences between the bacterial and mammalian IMPDH enzymes, making it an attractive target for antimicrobial agents. To evaluate the basis for these differences, we determined the crystal structure of the bacterial enzyme at 1.9 {angstrom} with substrate bound in the catalytic site. The structure was determined using selenomethionine-substituted protein and multiwavelength anomalous (MAD) analysis of data obtained with synchrotron radiation from the undulator beamline (19ID) of the Structural Biology Center at Argonne's Advanced Photon Source. S. pyogenes IMPDH is a tetramer with its four subunits related by a crystallographic 4-fold axis. The protein is composed of two domains: a TIM barrel domain that embodies the catalytic framework and a cystathione {beta}-synthase (CBS) dimer domain of so far unknown function. Using information provided by sequence alignments and the crystal structure, we prepared several site-specific mutants to examine the role of various active site regions in catalysis. These variants implicate the active site flap as an essential catalytic element and indicate there are significant differences in the catalytic environment of bacterial and mammalian IMPDH enzymes. Comparison of the structure of bacterial IMPDH with the known partial structures from eukaryotic organisms will provide an explanation of their distinct properties and contribute to the design of specific bacterial IMPDH inhibitors.

  18. Structure, Mechanism, and Mutation of Bacterial Luciferase.

    PubMed

    Tinikul, Ruchanok; Chaiyen, Pimchai

    2016-01-01

    : Bacterial luciferase is a flavin-dependent monooxygenase found in bioluminescent bacteria. The enzyme catalyzes a light-emitting reaction by using reduced flavin, long chain aldehyde, and oxygen as substrates and yields oxidized flavin, carboxylic acid, and water as products with concomitant emission of blue-green light around 485-490 nm. The enzyme is a heterodimer consisting of two homologous subunits, designated as the α- and β-subunits. The reactive reaction center is located in the α-subunit, whereas the β-subunit is required for maintaining the active conformation of the α-subunit. The enzyme reaction occurs through the generation of a reactive C4a-oxygenflavin adduct, presumably C4a-peroxyflavin, before the light-emitting species is generated from the decomposition of an adduct between the C4a-peroxyflavin and the aldehyde. Because the luciferase reaction generates light, the enzyme has the potential to be used as a bioreporter for a wide variety of applications. With the recent invention of the fusion enzyme that can be expressed in mammalian cells, future possibilities for the development of additional bioreporter applications are promising. PMID:25487767

  19. Unique Gene-Silencing and Structural Properties of 2;#8242;-Fluoro-Modified siRNAs

    SciTech Connect

    Manoharan, Muthiah; Akinc, Akin; Pandey, Rajendra K.; Qin, June; Hadwiger, Philipp; John, Matthias; Mills, Kathy; Charisse, Klaus; Maier, Martin A.; Nechev, Lubomir; Greene, Emily M.; Pallan, Pradeep S.; Rozners, Eriks; Rajeev, Kallanthottathil G.; Egli, Martin

    2015-10-15

    With little or no negative impact on the activity of small interfering RNAs (siRNAs), regardless of the number of modifications or the positions within the strand, the 2'-deoxy-2'-fluoro (2'-F) modification is unique. Furthermore, the 2'-F-modified siRNA (see crystal structure) was thermodynamically more stable and more nuclease-resistant than the parent siRNA, and produced no immunostimulatory response.

  20. Structural Variation in Bacterial Glyoxalase I Enzymes

    PubMed Central

    Suttisansanee, Uthaiwan; Lau, Kelvin; Lagishetty, Satyanarayana; Rao, Krishnamurthy N.; Swaminathan, Subramanyam; Sauder, J. Michael; Burley, Stephen K.; Honek, John F.

    2011-01-01

    The glyoxalase system catalyzes the conversion of toxic, metabolically produced α-ketoaldehydes, such as methylglyoxal, into their corresponding nontoxic 2-hydroxycarboxylic acids, leading to detoxification of these cellular metabolites. Previous studies on the first enzyme in the glyoxalase system, glyoxalase I (GlxI), from yeast, protozoa, animals, humans, plants, and Gram-negative bacteria, have suggested two metal activation classes, Zn2+ and non-Zn2+ activation. Here, we report a biochemical and structural investigation of the GlxI from Clostridium acetobutylicum, which is the first GlxI enzyme from Gram-positive bacteria that has been fully characterized as to its three-dimensional structure and its detailed metal specificity. It is a Ni2+/Co2+-activated enzyme, in which the active site geometry forms an octahedral coordination with one metal atom, two water molecules, and four metal-binding ligands, although its inactive Zn2+-bound form possesses a trigonal bipyramidal geometry with only one water molecule liganded to the metal center. This enzyme also possesses a unique dimeric molecular structure. Unlike other small homodimeric GlxI where two active sites are located at the dimeric interface, the C. acetobutylicum dimeric GlxI enzyme also forms two active sites but each within single subunits. Interestingly, even though this enzyme possesses a different dimeric structure from previously studied GlxI, its metal activation characteristics are consistent with properties of other GlxI. These findings indicate that metal activation profiles in this class of enzyme hold true across diverse quaternary structure arrangements. PMID:21914803

  1. DGCR8 recognizes primary transcripts of microRNAs through highly cooperative binding and formation of higher-order structures

    PubMed Central

    Faller, Michael; Toso, Daniel; Matsunaga, Michio; Atanasov, Ivo; Senturia, Rachel; Chen, Yanqiu; Zhou, Z. Hong; Guo, Feng

    2010-01-01

    DiGeorge critical region 8 (DGCR8) is essential for maturation of microRNAs (miRNAs) in animals. In the cleavage of primary transcripts of miRNAs (pri-miRNAs) by the Drosha nuclease, the DGCR8 protein directly binds and recognizes pri-miRNAs through a mechanism currently controversial. Our previous data suggest that DGCR8 trimerizes upon cooperative binding to pri-mir-30a. However, a separate study proposed a model in which a DGCR8 molecule contacts one or two pri-miRNA molecules using its two double-stranded RNA binding domains. Here, we extensively characterized the interaction between DGCR8 and pri-miRNAs using biochemical and structural methods. First, a strong correlation was observed between the association of DGCR8 with pri-mir-30a and the rate of pri-miRNA processing in vitro. Second, we show that the high binding cooperativity allows DGCR8 to distinguish pri-miRNAs from a nonspecific competitor with subtle differences in dissociation constants. The highly cooperative binding of DGCR8 to a pri-miRNA is mediated by the formation of higher-order structures, most likely a trimer of DGCR8 dimers, on the pri-miRNA. These properties are not limited to its interaction with pri-mir-30a. Furthermore, the amphipathic C-terminal helix of DGCR8 is important both for trimerization of DGCR8 on pri-miRNAs and for the cleavage of pri-miRNAs by Drosha. Finally, our three-dimensional model from electron tomography analysis of the negatively stained DGCR8–pri-mir-30a complex directly supports the trimerization model. Our study provides a molecular basis for recognition of pri-miRNAs by DGCR8. We further propose that the higher-order structures of the DGCR8–pri-miRNA complexes trigger the cleavage of pri-miRNAs by Drosha. PMID:20558544

  2. Interconnected Cavernous Structure of Bacterial Fruiting Bodies

    PubMed Central

    Harvey, Cameron W.; Du, Huijing; Xu, Zhiliang; Kaiser, Dale; Aranson, Igor; Alber, Mark

    2012-01-01

    The formation of spore-filled fruiting bodies by myxobacteria is a fascinating case of multicellular self-organization by bacteria. The organization of Myxococcus xanthus into fruiting bodies has long been studied not only as an important example of collective motion of bacteria, but also as a simplified model for developmental morphogenesis. Sporulation within the nascent fruiting body requires signaling between moving cells in order that the rod-shaped self-propelled cells differentiate into spores at the appropriate time. Probing the three-dimensional structure of myxobacteria fruiting bodies has previously presented a challenge due to limitations of different imaging methods. A new technique using Infrared Optical Coherence Tomography (OCT) revealed previously unknown details of the internal structure of M. xanthus fruiting bodies consisting of interconnected pockets of relative high and low spore density regions. To make sense of the experimentally observed structure, modeling and computer simulations were used to test a hypothesized mechanism that could produce high-density pockets of spores. The mechanism consists of self-propelled cells aligning with each other and signaling by end-to-end contact to coordinate the process of differentiation resulting in a pattern of clusters observed in the experiment. The integration of novel OCT experimental techniques with computational simulations can provide new insight into the mechanisms that can give rise to the pattern formation seen in other biological systems such as dictyostelids, social amoeba known to form multicellular aggregates observed as slugs under starvation conditions. PMID:23300427

  3. Structures of Bacterial Biosynthetic Arginine Decarboxylases

    SciTech Connect

    F Forouhar; S Lew; J Seetharaman; R Xiao; T Acton; G Montelione; L Tong

    2011-12-31

    Biosynthetic arginine decarboxylase (ADC; also known as SpeA) plays an important role in the biosynthesis of polyamines from arginine in bacteria and plants. SpeA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme and shares weak sequence homology with several other PLP-dependent decarboxylases. Here, the crystal structure of PLP-bound SpeA from Campylobacter jejuni is reported at 3.0 {angstrom} resolution and that of Escherichia coli SpeA in complex with a sulfate ion is reported at 3.1 {angstrom} resolution. The structure of the SpeA monomer contains two large domains, an N-terminal TIM-barrel domain followed by a {beta}-sandwich domain, as well as two smaller helical domains. The TIM-barrel and {beta}-sandwich domains share structural homology with several other PLP-dependent decarboxylases, even though the sequence conservation among these enzymes is less than 25%. A similar tetramer is observed for both C. jejuni and E. coli SpeA, composed of two dimers of tightly associated monomers. The active site of SpeA is located at the interface of this dimer and is formed by residues from the TIM-barrel domain of one monomer and a highly conserved loop in the {beta}-sandwich domain of the other monomer. The PLP cofactor is recognized by hydrogen-bonding, {pi}-stacking and van der Waals interactions.

  4. Function, structure, and mechanism in bacterial photosensory LOV proteins

    PubMed Central

    Herrou, Julien; Crosson, Sean

    2012-01-01

    LOV domains are protein photosensors conserved in bacteria, archaea, plants and fungi that detect blue light via a flavin cofactor. In the bacterial kingdom, LOV domains are present in both chemotrophic and phototrophic species, where they are found N-terminally of signaling and regulatory domains such as sensor histidine kinases, diguanylate cyclases/phosphodiesterases, DNA-binding domains, and σ factor regulators. In this review, we describe the current state of knowledge on the function of bacterial LOV proteins, the structural basis of LOV domain-mediated signal transduction, and the use of LOV domains as genetically-encoded photoswitches in synthetic biology. PMID:21822294

  5. Electronic structure of bacterial surface protein layers

    SciTech Connect

    Maslyuk, Volodymyr V.; Mertig, Ingrid; Bredow, Thomas; Mertig, Michael; Vyalikh, Denis V.; Molodtsov, Serguei L.

    2008-01-15

    We report an approach for the calculation of the electronic density of states of the dried two-dimensional crystalline surface protein layer (S layer) of the bacterium Bacillus sphaericus NCTC 9602. The proposed model is based on the consideration of individual amino acids in the corresponding conformation of the peptide chain which additively contribute to the electronic structure of the entire protein complex. The derived results agree well with the experimental data obtained by means of photoemission (PE), resonant PE, and near-edge x-ray absorption spectroscopy.

  6. Experimental sulfate amendment alters peatland bacterial community structure.

    PubMed

    Strickman, R J S; Fulthorpe, R R; Coleman Wasik, J K; Engstrom, D R; Mitchell, C P J

    2016-10-01

    As part of a long-term, peatland-scale sulfate addition experiment, the impact of varying sulfate deposition on bacterial community responses was assessed using 16S tag encoded pyrosequencing. In three separate areas of the peatland, sulfate manipulations included an eight year quadrupling of atmospheric sulfate deposition (experimental), a 3-year recovery to background deposition following 5years of elevated deposition (recovery), and a control area. Peat concentrations of methylmercury (MeHg), a bioaccumulative neurotoxin, were measured, the production of which is attributable to a growing list of microorganisms, including many sulfate-reducing Deltaproteobacteria. The total bacterial and Deltaproteobacterial community structures in the experimental treatment differed significantly from those in the control and recovery treatments that were either indistinguishable or very similar to one another. Notably, the relatively rapid return (within three years) of bacterial community structure in the recovery treatment to a state similar to the control, demonstrates significant resilience of the peatland bacterial community to changes in atmospheric sulfate deposition. Changes in MeHg accumulation between sulfate treatments correlated with changes in the Deltaproteobacterial community, suggesting that sulfate may affect MeHg production through changes in the community structure of this group. PMID:27267720

  7. Use of the U1A Protein to Facilitate Crystallization and Structure Determination of Large RNAs.

    PubMed

    Ferré-D'Amaré, Adrian R

    2016-01-01

    The preparation of well-ordered crystals of RNAs with complex three-dimensional architecture can be facilitated by engineering a binding site for the spliceosomal protein U1A into a functionally and structurally dispensable stem-loop of the RNA of interest. Once suitable crystals are obtained, the U1A protein, of known structure, can be employed to facilitate preparation of heavy atom or anomalously scattering atom derivatives, or as a source of partial model phases for the molecular replacement method. Here, we describe the methods for making U1A preparations suitable for cocrystallization with RNA. As an example, the cocrystallization of the tetracycline aptamer with U1A is also described. PMID:26227038

  8. Myriad Triple-Helix-Forming Structures in the Transposable Element RNAs of Plants and Fungi.

    PubMed

    Tycowski, Kazimierz T; Shu, Mei-Di; Steitz, Joan A

    2016-05-10

    The ENE (element for nuclear expression) is a cis-acting RNA structure that protects viral or cellular noncoding RNAs (ncRNAs) from nuclear decay through triple-helix formation with the poly(A) tail or 3'-terminal A-rich tract. We expanded the roster of nine known ENEs by bioinformatic identification of ∼200 distinct ENEs that reside in transposable elements (TEs) of numerous non-metazoan and one fish species and in four Dicistrovirus genomes. Despite variation within the ENE core, none of the predicted triple-helical stacks exceeds five base triples. Increased accumulation of reporter transcripts in human cells demonstrated functionality for representative ENEs. Location close to the poly(A) tail argues that ENEs are active in TE transcripts. Their presence in intronless, but not intron-containing, hAT transposase genes supports the idea that TEs acquired ENEs to counteract the RNA-destabilizing effects of intron loss, a potential evolutionary consequence of TE horizontal transfer in organisms that couple RNA silencing to splicing deficits. PMID:27134163

  9. Identification and Characterization of Novel Small RNAs in Rickettsia prowazekii

    PubMed Central

    Schroeder, Casey L. C.; Narra, Hema P.; Sahni, Abha; Rojas, Mark; Khanipov, Kamil; Patel, Jignesh; Shah, Riya; Fofanov, Yuriy; Sahni, Sanjeev K.

    2016-01-01

    Emerging evidence implicates a critically important role for bacterial small RNAs (sRNAs) as post-transcriptional regulators of physiology, metabolism, stress/adaptive responses, and virulence, but the roles of sRNAs in pathogenic Rickettsia species remain poorly understood. Here, we report on the identification of both novel and well-known bacterial sRNAs in Rickettsia prowazekii, known to cause epidemic typhus in humans. RNA sequencing of human microvascular endothelial cells (HMECs), the preferred targets during human rickettsioses, infected with R. prowazekii revealed the presence of 35 trans-acting and 23 cis-acting sRNAs, respectively. Of these, expression of two trans-acting (Rp_sR17 and Rp_sR60) and one cis-acting (Rp_sR47) novel sRNAs and four well-characterized bacterial sRNAs (RNaseP_bact_a, α-tmRNA, 4.5S RNA, 6S RNA) was further confirmed by Northern blot or RT-PCR analyses. The transcriptional start sites of five novel rickettsial sRNAs and 6S RNA were next determined using 5′ RLM-RACE yielding evidence for their independent biogenesis in R. prowazekii. Finally, computational approaches were employed to determine the secondary structures and potential mRNA targets of novel sRNAs. Together, these results establish the presence and expression of sRNAs in R. prowazekii during host cell infection and suggest potential functional roles for these important post-transcriptional regulators in rickettsial biology and pathogenesis. PMID:27375581

  10. RNApdbee—a webserver to derive secondary structures from pdb files of knotted and unknotted RNAs

    PubMed Central

    Antczak, Maciej; Zok, Tomasz; Popenda, Mariusz; Lukasiak, Piotr; Adamiak, Ryszard W.; Blazewicz, Jacek; Szachniuk, Marta

    2014-01-01

    In RNA structural biology and bioinformatics an access to correct RNA secondary structure and its proper representation is of crucial importance. This is true especially in the field of secondary and 3D RNA structure prediction. Here, we introduce RNApdbee—a new tool that allows to extract RNA secondary structure from the pdb file, and presents it in both textual and graphical form. RNApdbee supports processing of knotted and unknotted structures of large RNAs, also within protein complexes. The method works not only for first but also for high order pseudoknots, and gives an information about canonical and non-canonical base pairs. A combination of these features is unique among existing applications for RNA structure analysis. Additionally, a function of converting between the text notations, i.e. BPSEQ, CT and extended dot-bracket, is provided. In order to facilitate a more comprehensive study, the webserver integrates the functionality of RNAView, MC-Annotate and 3DNA/DSSR, being the most common tools used for automated identification and classification of RNA base pairs. RNApdbee is implemented as a publicly available webserver with an intuitive interface and can be freely accessed at http://rnapdbee.cs.put.poznan.pl/. PMID:24771339

  11. Comparative analysis of the structure and function of adenovirus virus-associated RNAs.

    PubMed Central

    Ma, Y; Mathews, M B

    1993-01-01

    The protein kinase DAI is an important component of the interferon-induced cellular defense mechanism. In cells infected by adenovirus type 2 (Ad2), activation of the kinase is prevented by the synthesis of a small, highly ordered virus-associated (VA) RNA, VA RNAI. The inhibitory function of this RNA depends on its structure, which has been partially elucidated by a combination of mutagenesis and RNase sensitivity analysis. To gain further insight into the structure and function of this regulatory RNA, we have compared the primary sequences, secondary structures, and functions of seven VA RNA species from five human and animal adenoviruses. The sequences exhibit variable degrees of homology, with a particularly close relationship between the VA RNAII species of Ad2 and Ad7 and notably divergent sequence for the avian (CELO) virus VA RNA. Apart from two pairs of mutually complementary tetranucleotides which are highly conserved, homologies are limited to transcription signals located within the RNA sequence and at its termini. Secondary structure analysis indicated that all seven RNAs conform to the model in which VA RNA possesses three main structural regions, a terminal stem, an apical stem-loop, and a central domain, although these elements vary in size and other details. The apical stem is implicated in binding to DAI, and the central domain is essential for inhibition of DAI activation. One of the pairs of conserved tetranucleotides (CCGG:C/UCGG) provides further evidence for the existence of the apical stem, but the other conserved pair (GGGU:ACCC) strongly suggests a revised structure for the central domain. In two functional assays conducted in vivo, the VA RNAI species of Ad2 and Ad7 were the most active, their corresponding VA RNAII species displayed little activity, and the single VA RNAs of Ad12 and simian adenovirus type 7 exhibited intermediate activity. Correlation of the structural and functional data suggests that the VA RNAII species adopt a

  12. Experimental warming effects on the bacterial community structure and diversity

    NASA Astrophysics Data System (ADS)

    Kim, W.; Han, S.; Adams, J.; Son, Y.

    2014-12-01

    The objective of this study is to investigate the responses of soil bacterial community to future temperature increase by conducting open-field warming experiment. We conducted an open-field experimental warming system using infra-red heater in 2011 and regulated the temperature of warmed plots by 3oC higher than that of control plots constantly. The seeds of Pinus densiflora, Abies holophylla, Abies koreana, Betula costata, Quercus variabilis, Fraxinus rhynchophylla, and Zelkova serrata were planted in each 1 m × 1 m plot (n=3) in April, 2012. We collected soil samples from the rhizosphere of 7 tree species. DNA was extracted and PCR-amplified for the bacterial 16S gene targeting V1-V3 region. The paired-end sequencing was performed at Beijing Genome Institute (BGI, Hong Kong, China) using 2× 100 bp Hiseq2000 (Illumina). This study aimed to answer the following prediction/hypothesis: 1) Experimental warming will change the structure of soil bacterial community, 2) There will be distinct 'indicator group' which response to warming treatment relatively more sensitive than other groups. 3) Warming treatment will enhance the microbial activity in terms of soil respiration. 4) The rhizoplane bacterial communities for each of 7 tree species will show different response pattern to warming treatment. Since the sequence data does not arrive before the submission deadline, therefore, we would like to present the results and discussions on December 2014, AGU Fall Meeting.

  13. Isolation, Characterization, and Aggregation of a Structured Bacterial Matrix Precursor*

    PubMed Central

    Chai, Liraz; Romero, Diego; Kayatekin, Can; Akabayov, Barak; Vlamakis, Hera; Losick, Richard; Kolter, Roberto

    2013-01-01

    Biofilms are surface-associated groups of microbial cells that are embedded in an extracellular matrix (ECM). The ECM is a network of biopolymers, mainly polysaccharides, proteins, and nucleic acids. ECM proteins serve a variety of structural roles and often form amyloid-like fibers. Despite the extensive study of the formation of amyloid fibers from their constituent subunits in humans, much less is known about the assembly of bacterial functional amyloid-like precursors into fibers. Using dynamic light scattering, atomic force microscopy, circular dichroism, and infrared spectroscopy, we show that our unique purification method of a Bacillus subtilis major matrix protein component results in stable oligomers that retain their native α-helical structure. The stability of these oligomers enabled us to control the external conditions that triggered their aggregation. In particular, we show that stretched fibers are formed on a hydrophobic surface, whereas plaque-like aggregates are formed in solution under acidic pH conditions. TasA is also shown to change conformation upon aggregation and gain some β-sheet structure. Our studies of the aggregation of a bacterial matrix protein from its subunits shed new light on assembly processes of the ECM within bacterial biofilms. PMID:23632024

  14. Structure of a bacterial toxin-activating acyltransferase

    PubMed Central

    Greene, Nicholas P.; Hughes, Colin; Koronakis, Vassilis

    2015-01-01

    Secreted pore-forming toxins of pathogenic Gram-negative bacteria such as Escherichia coli hemolysin (HlyA) insert into host–cell membranes to subvert signal transduction and induce apoptosis and cell lysis. Unusually, these toxins are synthesized in an inactive form that requires posttranslational activation in the bacterial cytosol. We have previously shown that the activation mechanism is an acylation event directed by a specialized acyl-transferase that uses acyl carrier protein (ACP) to covalently link fatty acids, via an amide bond, to specific internal lysine residues of the protoxin. We now reveal the 2.15-Å resolution X-ray structure of the 172-aa ApxC, a toxin-activating acyl-transferase (TAAT) from pathogenic Actinobacillus pleuropneumoniae. This determination shows that bacterial TAATs are a structurally homologous family that, despite indiscernible sequence similarity, form a distinct branch of the Gcn5-like N-acetyl transferase (GNAT) superfamily of enzymes that typically use acyl-CoA to modify diverse bacterial, archaeal, and eukaryotic substrates. A combination of structural analysis, small angle X-ray scattering, mutagenesis, and cross-linking defined the solution state of TAATs, with intermonomer interactions mediated by an N-terminal α-helix. Superposition of ApxC with substrate-bound GNATs, and assay of toxin activation and binding of acyl-ACP and protoxin peptide substrates by mutated ApxC variants, indicates the enzyme active site to be a deep surface groove. PMID:26016525

  15. Accuracy of initial codon selection by aminoacyl-tRNAs on the mRNA-programmed bacterial ribosome

    PubMed Central

    Zhang, Jingji; Ieong, Ka-Weng; Johansson, Magnus; Ehrenberg, Måns

    2015-01-01

    We used a cell-free system with pure Escherichia coli components to study initial codon selection of aminoacyl-tRNAs in ternary complex with elongation factor Tu and GTP on messenger RNA-programmed ribosomes. We took advantage of the universal rate-accuracy trade-off for all enzymatic selections to determine how the efficiency of initial codon readings decreased linearly toward zero as the accuracy of discrimination against near-cognate and wobble codon readings increased toward the maximal asymptote, the d value. We report data on the rate-accuracy variation for 7 cognate, 7 wobble, and 56 near-cognate codon readings comprising about 15% of the genetic code. Their d values varied about 400-fold in the 200–80,000 range depending on type of mismatch, mismatch position in the codon, and tRNA isoacceptor type. We identified error hot spots (d = 200) for U:G misreading in second and U:U or G:A misreading in third codon position by His-tRNAHis and, as also seen in vivo, Glu-tRNAGlu. We suggest that the proofreading mechanism has evolved to attenuate error hot spots in initial selection such as those found here. PMID:26195797

  16. Spliceosomal snRNAs in the unicellular eukaryote Trichomonas vaginalis are structurally conserved but lack a 5′-cap structure

    PubMed Central

    Simoes-Barbosa, Augusto; Meloni, Dionigia; Wohlschlegel, James A.; Konarska, Maria M.; Johnson, Patricia J.

    2008-01-01

    Few genes in the divergent eukaryote Trichomonas vaginalis have introns, despite the unusually large gene repertoire of this human-infective parasite. These introns are characterized by extended conserved regulatory motifs at the 5′ and 3′ boundaries, a feature shared with another divergent eukaryote, Giardia lamblia, but not with metazoan introns. This unusual characteristic of T. vaginalis introns led us to examine spliceosomal small nuclear RNAs (snRNAs) predicted to mediate splicing reactions via interaction with intron motifs. Here we identify T. vaginalis U1, U2, U4, U5, and U6 snRNAs, present predictions of their secondary structures, and provide evidence for interaction between the U2/U6 snRNA complex and a T. vaginalis intron. Structural models predict that T. vaginalis snRNAs contain conserved sequences and motifs similar to those found in other examined eukaryotes. These data indicate that mechanisms of intron recognition as well as coordination of the two catalytic steps of splicing have been conserved throughout eukaryotic evolution. Unexpectedly, we found that T. vaginalis spliceosomal snRNAs lack the 5′ trimethylguanosine cap typical of snRNAs and appear to possess unmodified 5′ ends. Despite the lack of a cap structure, U1, U2, U4, and U5 genes are transcribed by RNA polymerase II, whereas the U6 gene is transcribed by RNA polymerase III. PMID:18596255

  17. Interactions in Bacterial Biofilm Development: A Structural Perspective

    PubMed Central

    Garnett, James A; Matthews, Steve

    2012-01-01

    A community-based life style is the normal mode of growth and survival for many bacterial species. These cellular accretions or biofilms are initiated upon recognition of solid phases by cell surface exposed adhesive moieties. Further cell-cell interactions, cell signalling and bacterial replication leads to the establishment of dense populations encapsulated in a mainly self-produced extracellular matrix; this comprises a complex mixture of macromolecules. These fascinating architectures protect the inhabitants from radiation damage, dehydration, pH fluctuations and antimicrobial compounds. As such they can cause bacterial persistence in disease and problems in industrial applications. In this review we discuss the current understandings of these initial biofilm-forming processes based on structural data. We also briefly describe latter biofilm maturation and dispersal events, which although lack high-resolution insights, are the present focus for many structural biologists working in this field. Finally we give an overview of modern techniques aimed at preventing and disrupting problem biofilms. PMID:23305361

  18. From bacterial to human dihydrouridine synthase: automated structure determination

    SciTech Connect

    Whelan, Fiona Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.

    2015-06-30

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  19. Revisiting the structure/function relationships of H/ACA(-like) RNAs: a unified model for Euryarchaea and Crenarchaea

    PubMed Central

    Toffano-Nioche, Claire; Gautheret, Daniel; Leclerc, Fabrice

    2015-01-01

    A structural and functional classification of H/ACA and H/ACA-like motifs is obtained from the analysis of the H/ACA guide RNAs which have been identified previously in the genomes of Euryarchaea (Pyrococcus) and Crenarchaea (Pyrobaculum). A unified structure/function model is proposed based on the common structural determinants shared by H/ACA and H/ACA-like motifs in both Euryarchaea and Crenarchaea. Using a computational approach, structural and energetic rules for the guide:target RNA-RNA interactions are derived from structural and functional data on the H/ACA RNP particles. H/ACA(-like) motifs found in Pyrococcus are evaluated through the classification and their biological relevance is discussed. Extra-ribosomal targets found in both Pyrococcus and Pyrobaculum might support the hypothesis of a gene regulation mediated by H/ACA(-like) guide RNAs in archaea. PMID:26240384

  20. From bacterial to human dihydrouridine synthase: automated structure determination

    PubMed Central

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.

    2015-01-01

    The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr_rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer. PMID:26143927

  1. Changes in the bacterial community structure in stored wormbed leachate.

    PubMed

    Romero-Tepal, Elda M; Contreras-Blancas, Eduardo; Navarro-Noya, Yendi E; Ruíz-Valdiviezo, Víctor M; Luna-Guido, Marco; Gutiérrez-Miceli, Federico A; Dendooven, Luc

    2014-01-01

    Organic wastes, such as cow manure, are often composted with earthworms (vermicomposting) while excess water is drained and collected. This wormbed leachate is nutrient-rich and it has been extensively used to fertilize plants. However, it is derived partially from a not yet finished compost process and could exhibit phytotoxicity or contain potentially hazardous microorganisms. The bacterial community in wormbed leachate derived from vermicomposting of cow manure was studied by pyrosequencing the 16S rRNA gene. The fresh wormbed leachate was rich in Mollicutes, particularly the genus Acholeplasma which contain phytopathogen species. The abundance of the Mollicutes decreased when the leachate was stored, while that of the Rhizobiales and the genus Pseudomonas increased. The bacterial communities changed rapidly in the leachate during storage. The changes in ammonium, nitrate and inorganic carbon content of the wormbed leachate when stored were correlated to changes in the bacterial community structure. It was found that storage of the wormbed leachate might be required before it can be applied to crops as large proportions of potentially plant pathogens were found in the fresh leachate. PMID:24577291

  2. A structural comparison of bacterial microfossils versus nanobacteria and nanofossils

    NASA Astrophysics Data System (ADS)

    Southam, G.; Donald, R.

    1999-12-01

    The formation of bacterial microfossils results from the cell surface immobilization of soluble heavy metals (biomineralization) via passive ionic interactions or by the formation and release of chemical reactive metabolic by-products. These metal-encrusted cell surfaces are resistant to re-mobilization and are typically the only component of the cell that is preserved, for possibly as long as several billion years. The size and shape of microfossils are determined by bacterial morphology, which includes spherical, rod, filamentous, vibriod, helical and stalked structures. The examination of ultra-thin sections using transmission electron microscopy (TEM) reveals that mineralized bacterial cells have the basic shape of the original cell from which they formed and appear hollow. Even in rare cases when the cell envelope and the cytoplasm are mineralized, the cell envelope can be differentiated from the cytoplasm preserving the original cell morphology. Scanning electron microscopy (SEM) cannot differentiate between geochemical and geomicrobiological mineral precipitation. The term `nanobacteria' has been used to describe spherical or rod-shaped minerals (tens of nanometers in diameter) observed using SEM. While these minerals may represent mineralized portions of bacteria, e.g., membrane vesicles, stalks or flagella, they are too small to be bacteria. Conversely, `nanobacteria' may simply represent solid, inorganic precipitates.

  3. A neutral pH thermal hydrolysis method for quantification of structured RNAs.

    PubMed

    Wilson, Stephen C; Cohen, Daniel T; Wang, Xin C; Hammond, Ming C

    2014-07-01

    Riboswitch aptamers adopt diverse and complex tertiary structural folds that contain both single-stranded and double-stranded regions. We observe that this high degree of secondary structure leads to an appreciable hypochromicity that is not accounted for in the standard method to calculate extinction coefficients using nearest-neighbor effects, which results in a systematic underestimation of RNA concentrations. Here we present a practical method for quantifying riboswitch RNAs using thermal hydrolysis to generate the corresponding pool of mononucleotides, for which precise extinction coefficients have been measured. Thermal hydrolysis can be performed at neutral pH without reaction quenching, avoids the use of nucleases or expensive fluorescent dyes, and does not require generation of calibration curves. The accuracy of this method for determining RNA concentrations has been validated using quantitative (31)P-NMR calibrated to an external standard. We expect that this simple procedure will be generally useful for the accurate quantification of any sequence-defined RNA sample, which is often a critical parameter for in vitro binding and kinetic assays. PMID:24860014

  4. A coarse-grained model with implicit salt for RNAs: Predicting 3D structure, stability and salt effect

    SciTech Connect

    Shi, Ya-Zhou; Wang, Feng-Hua; Wu, Yuan-Yan; Tan, Zhi-Jie

    2014-09-14

    To bridge the gap between the sequences and 3-dimensional (3D) structures of RNAs, some computational models have been proposed for predicting RNA 3D structures. However, the existed models seldom consider the conditions departing from the room/body temperature and high salt (1M NaCl), and thus generally hardly predict the thermodynamics and salt effect. In this study, we propose a coarse-grained model with implicit salt for RNAs to predict 3D structures, stability, and salt effect. Combined with Monte Carlo simulated annealing algorithm and a coarse-grained force field, the model folds 46 tested RNAs (≤45 nt) including pseudoknots into their native-like structures from their sequences, with an overall mean RMSD of 3.5 Å and an overall minimum RMSD of 1.9 Å from the experimental structures. For 30 RNA hairpins, the present model also gives the reliable predictions for the stability and salt effect with the mean deviation ∼ 1.0 °C of melting temperatures, as compared with the extensive experimental data. In addition, the model could provide the ensemble of possible 3D structures for a short RNA at a given temperature/salt condition.

  5. Bacterial Community Structure Response to Petroleum Concentration in Groundwater

    NASA Astrophysics Data System (ADS)

    Kitts, C. L.; Wrighton, K. C.; Phillips, W. A.; Cano, R. J.; Lundegard, P. D.

    2004-12-01

    This study characterized the bacterial community present in groundwater samples from the Guadalupe Dunes Restoration Project on the central California coast. The purpose of the study was to determine the changes in bacterial community structure and function in response to variations in the concentration of dissolved phase total petroleum hydrocarbons (TPH) in groundwater plumes at the site. For the purpose of this study groundwater samples were collected at varying distance from TPH source zones in 10 different plumes. All samples were analyzed for ammonia, phosphate, TPH, methane, oxygen, carbon dioxide, nitrate, sulfate, and dissolved iron levels. Chemical analysis revealed that the groundwater chemistry varied between plumes and on a well-to-well basis within a plume. Principle component analyses (PCA) demonstrated that TPH degradation related parameters explained 28% of the variation in the groundwater chemistry. In addition to the physical and chemical analyses, four liters of each groundwater sample were filtered and bacterial DNA was isolated to determine the relationship between groundwater chemistry and bacterial community structure and function. Specific Polymerase Chain Reaction (PCR) primers were used to characterize populations of Eubacteria, and Archaea, as well as function genes for sulfate reducing, methanotrophic, and methanogenic bacteria. Terminal Restriction Fragment (TRF) Length Polymorphisms (or T-RFLP) were used to analyze community structure. Eubacterial and Archaeal groundwater communities were separated into distinct clusters which did not clearly reflect changes in groundwater chemical parameters unless individual plumes were analyzed separately. However, specific Eubacterial and Archaeal TRF peaks did correspond to known petroleum degrading organisms and methanogenic bacteria, respectively. Only one sample produced a positive result for the sulfite reductase gene (dsrAB), indicating that sulfate reduction may not be a dominant process at

  6. Unraveling the Molecular Mechanisms Underlying the Nasopharyngeal Bacterial Community Structure.

    PubMed

    de Steenhuijsen Piters, Wouter A A; Bogaert, Debby

    2016-01-01

    The upper respiratory tract is colonized by a diverse array of commensal bacteria that harbor potential pathogens, such as Streptococcus pneumoniae. As long as the local microbial ecosystem-also called "microbiome"-is in balance, these potentially pathogenic bacterial residents cause no harm to the host. However, similar to macrobiological ecosystems, when the bacterial community structure gets perturbed, potential pathogens can overtake the niche and cause mild to severe infections. Recent studies using next-generation sequencing show that S. pneumoniae, as well as other potential pathogens, might be kept at bay by certain commensal bacteria, including Corynebacterium and Dolosigranulum spp. Bomar and colleagues are the first to explore a specific biological mechanism contributing to the antagonistic interaction between Corynebacterium accolens and S. pneumoniae in vitro [L. Bomar, S. D. Brugger, B. H. Yost, S. S. Davies, K. P. Lemon, mBio 7(1):e01725-15, 2016, doi:10.1128/mBio.01725-15]. The authors comprehensively show that C. accolens is capable of hydrolyzing host triacylglycerols into free fatty acids, which display antipneumococcal properties, suggesting that these bacteria might contribute to the containment of pneumococcus. This work exemplifies how molecular epidemiological findings can lay the foundation for mechanistic studies to elucidate the host-microbe and microbial interspecies interactions underlying the bacterial community structure. Next, translation of these results to an in vivo setting seems necessary to unveil the magnitude and importance of the observed effect in its natural, polymicrobial setting. PMID:26838716

  7. Unraveling the Molecular Mechanisms Underlying the Nasopharyngeal Bacterial Community Structure

    PubMed Central

    de Steenhuijsen Piters, Wouter A. A.

    2016-01-01

    ABSTRACT The upper respiratory tract is colonized by a diverse array of commensal bacteria that harbor potential pathogens, such as Streptococcus pneumoniae. As long as the local microbial ecosystem—also called “microbiome”—is in balance, these potentially pathogenic bacterial residents cause no harm to the host. However, similar to macrobiological ecosystems, when the bacterial community structure gets perturbed, potential pathogens can overtake the niche and cause mild to severe infections. Recent studies using next-generation sequencing show that S. pneumoniae, as well as other potential pathogens, might be kept at bay by certain commensal bacteria, including Corynebacterium and Dolosigranulum spp. Bomar and colleagues are the first to explore a specific biological mechanism contributing to the antagonistic interaction between Corynebacterium accolens and S. pneumoniae in vitro [L. Bomar, S. D. Brugger, B. H. Yost, S. S. Davies, K. P. Lemon, mBio 7(1):e01725-15, 2016, doi:10.1128/mBio.01725-15]. The authors comprehensively show that C. accolens is capable of hydrolyzing host triacylglycerols into free fatty acids, which display antipneumococcal properties, suggesting that these bacteria might contribute to the containment of pneumococcus. This work exemplifies how molecular epidemiological findings can lay the foundation for mechanistic studies to elucidate the host-microbe and microbial interspecies interactions underlying the bacterial community structure. Next, translation of these results to an in vivo setting seems necessary to unveil the magnitude and importance of the observed effect in its natural, polymicrobial setting. PMID:26838716

  8. Molecular, Cellular, and Structural Mechanisms of Cocaine Addiction: A Key Role for MicroRNAs

    PubMed Central

    Jonkman, Sietse; Kenny, Paul J

    2013-01-01

    The rewarding properties of cocaine play a key role in establishing and maintaining the drug-taking habit. However, as exposure to cocaine increases, drug use can transition from controlled to compulsive. Importantly, very little is known about the neurobiological mechanisms that control this switch in drug use that defines addiction. MicroRNAs (miRNAs) are small non-protein coding RNA transcripts that can regulate the expression of messenger RNAs that code for proteins. Because of their highly pleiotropic nature, each miRNA has the potential to regulate hundreds or even thousands of protein-coding RNA transcripts. This property of miRNAs has generated considerable interest in their potential involvement in complex psychiatric disorders such as addiction, as each miRNA could potentially influence the many different molecular and cellular adaptations that arise in response to drug use that are hypothesized to drive the emergence of addiction. Here, we review recent evidence supporting a key role for miRNAs in the ventral striatum in regulating the rewarding and reinforcing properties of cocaine in animals with limited exposure to the drug. Moreover, we discuss evidence suggesting that miRNAs in the dorsal striatum control the escalation of drug intake in rats with extended cocaine access. These findings highlight the central role for miRNAs in drug-induced neuroplasticity in brain reward systems that drive the emergence of compulsive-like drug use in animals, and suggest that a better understanding of how miRNAs control drug intake will provide new insights into the neurobiology of drug addiction. PMID:22968819

  9. Myriad Triple-Helix-Forming Structures in the Transposable Element RNAs of Plants and Fungi

    PubMed Central

    Tycowski, Kazimierz T.; Shu, Mei-Di; Steitz, Joan A.

    2016-01-01

    SUMMARY The ENE (element for nuclear expression) is a cis-acting RNA structure that protects viral or cellular noncoding (nc)RNAs from nuclear decay through triple-helix formation with the poly(A) tail or 3′-terminal A-rich tract. We expanded the roster of 9 known ENEs by bioinformatic identification of ~200 distinct ENEs that reside in transposable elements (TEs) of numerous non-metazoan and one fish species, and in four Dicistrovirus genomes. Despite variation within the ENE core, none of the predicted triple-helical stacks exceeds five base triples. Increased accumulation of reporter transcripts in human cells demonstrated functionality for representative ENEs. Location close to the poly(A) tail argues that ENEs are active in TE transcripts. Their presence in intronless but not intron-containing hAT transposase genes supports the idea that TEs acquired ENEs to counteract the RNA-destabilizing effects of intron loss, a potential evolutionary consequence of TE horizontal transfer in organisms that couple RNA silencing to splicing deficits. PMID:27134163

  10. Mechanistic Insights from Structural Analyses of Ran-GTPase-Driven Nuclear Export of Proteins and RNAs.

    PubMed

    Matsuura, Yoshiyuki

    2016-05-22

    Understanding how macromolecules are rapidly exchanged between the nucleus and the cytoplasm through nuclear pore complexes is a fundamental problem in biology. Exportins are Ran-GTPase-dependent nuclear transport factors that belong to the karyopherin-β family and mediate nuclear export of a plethora of proteins and RNAs, except for bulk mRNA nuclear export. Exportins bind cargo macromolecules in a Ran-GTP-dependent manner in the nucleus, forming exportin-cargo-Ran-GTP complexes (nuclear export complexes). Transient weak interactions between exportins and nucleoporins containing characteristic FG (phenylalanine-glycine) repeat motifs facilitate nuclear pore complex passage of nuclear export complexes. In the cytoplasm, nuclear export complexes are disassembled, thereby releasing the cargo. GTP hydrolysis by Ran promoted in the cytoplasm makes the disassembly reaction virtually irreversible and provides thermodynamic driving force for the overall export reaction. In the past decade, X-ray crystallography of some of the exportins in various functional states coupled with functional analyses, single-particle electron microscopy, molecular dynamics simulations, and small-angle solution X-ray scattering has provided rich insights into the mechanism of cargo binding and release and also begins to elucidate how exportins interact with the FG repeat motifs. The knowledge gained from structural analyses of nuclear export is being translated into development of clinically useful inhibitors of nuclear export to treat human diseases such as cancer and influenza. PMID:26519791

  11. Structure of a Bacterial Cell Surface Decaheme Electron Conduit

    SciTech Connect

    Clarke, Thomas A.; Edwards, Marcus; Gates, Andrew J.; Hall, Andrea; White, Gaye; Bradley, Justin; Reardon, Catherine L.; Shi, Liang; Beliaev, Alex S.; Marshall, Matthew J.; Wang, Zheming; Watmough, Nicholas; Fredrickson, Jim K.; Zachara, John M.; Butt, Julea N.; Richardson, David J.

    2011-05-23

    Some bacterial species are able to utilize extracellular mineral forms of iron and manganese as respiratory electron acceptors. In Shewanella oneidensis this involves deca-heme cytochromes that are located on the bacterial cell surface at the termini of trans-outermembrane (OM) electron transfer conduits. The cell surface cytochromes can potentially play multiple roles in mediating electron transfer directly to insoluble electron sinks, catalyzing electron exchange with flavin electron shuttles or participating in extracellular inter-cytochrome electron exchange along ‘nanowire’ appendages. We present a 3.2 Å crystal structure of one of these deca-heme cytochromes, MtrF, that allows the spatial organization of the ten hemes to be visualized for the first time. The hemes are organized across four domains in a unique crossed conformation, in which a staggered 65 Å octa-heme chain transects the length of the protein and is bisected by a planar 45 Å tetra-heme chain that connects two extended Greek key split β-barrel domains. The structure provides molecular insight into how reduction of insoluble substrate (e.g. minerals), soluble substrates (e.g. flavins) and cytochrome redox partners might be possible in tandem at different termini of a trifurcated electron transport chain on the cell surface.

  12. Pentanol and Benzyl Alcohol Attack Bacterial Surface Structures Differently

    PubMed Central

    Yano, Takehisa; Miyahara, Yoshiko; Morii, Noriyuki; Okano, Tetsuya

    2015-01-01

    The genus Methylobacterium tolerates hygiene agents like benzalkonium chloride (BAC), and infection with this organism is an important public health issue. Here, we found that the combination of BAC with particular alcohols at nonlethal concentrations in terms of their solitary uses significantly reduced bacterial viability after only 5 min of exposure. Among the alcohols, Raman spectroscopic analyses showed that pentanol (pentyl alcohol [PeA]) and benzyl alcohol (BzA) accelerated the cellular accumulation of BAC. Fluorescence spectroscopic assays and morphological assays with giant vesicles indicated that PeA rarely attacked membrane structures, while BzA increased the membrane fluidity and destabilized the structures. Other fluorescent spectroscopic assays indicated that PeA and BzA inactivate bacterial membrane proteins, including an efflux pump for BAC transportation. These findings suggested that the inactivation of membrane proteins by PeA and BzA led to the cellular accumulation but that only BzA also enhanced BAC penetration by membrane fluidization at nonlethal concentrations. PMID:26519389

  13. Structure-Based Design of Bacterial Nitric Oxide Synthase Inhibitors

    PubMed Central

    2015-01-01

    Inhibition of bacterial nitric oxide synthase (bNOS) has the potential to improve the efficacy of antimicrobials used to treat infections by Gram-positive pathogens Staphylococcus aureus and Bacillus anthracis. However, inhibitor specificity toward bNOS over the mammalian NOS (mNOS) isoforms remains a challenge because of the near identical NOS active sites. One key structural difference between the NOS isoforms is the amino acid composition of the pterin cofactor binding site that is adjacent to the NOS active site. Previously, we demonstrated that a NOS inhibitor targeting both the active and pterin sites was potent and functioned as an antimicrobial (Holden, , Proc. Natl. Acad. Sci. U.S.A.2013, 110, 1812724145412). Here we present additional crystal structures, binding analyses, and bacterial killing studies of inhibitors that target both the active and pterin sites of a bNOS and function as antimicrobials. Together, these data provide a framework for continued development of bNOS inhibitors, as each molecule represents an excellent chemical scaffold for the design of isoform selective bNOS inhibitors. PMID:25522110

  14. DGCR8 Acts as an Adaptor for the Exosome Complex to Degrade Double-Stranded Structured RNAs

    PubMed Central

    Macias, Sara; Cordiner, Ross A.; Gautier, Philippe; Plass, Mireya; Cáceres, Javier F.

    2015-01-01

    Summary The Microprocessor complex (DGCR8/Drosha) is required for microRNA (miRNA) biogenesis but also binds and regulates the stability of several types of cellular RNAs. Of particular interest, DGCR8 controls the stability of mature small nucleolar RNA (snoRNA) transcripts independently of Drosha, suggesting the existence of alternative DGCR8 complex(es) with other nucleases to process a variety of cellular RNAs. Here, we found that DGCR8 copurifies with subunits of the nuclear exosome, preferentially associating with its hRRP6-containing nucleolar form. Importantly, we demonstrate that DGCR8 is essential for the recruitment of the exosome to snoRNAs and to human telomerase RNA. In addition, we show that the DGCR8/exosome complex controls the stability of the human telomerase RNA component (hTR/TERC). Altogether, these data suggest that DGCR8 acts as an adaptor to recruit the exosome complex to structured RNAs and induce their degradation. PMID:26687677

  15. Genomewide analysis of Drosophila circular RNAs reveals their structural and sequence properties and age-dependent neural accumulation

    PubMed Central

    Westholm, Jakub O.; Miura, Pedro; Olson, Sara; Shenker, Sol; Joseph, Brian; Sanfilippo, Piero; Celniker, Susan E.; Graveley, Brenton R.; Lai, Eric C.

    2014-01-01

    Circularization was recently recognized to broadly expand transcriptome complexity. Here, we exploit massive Drosophila total RNA-sequencing data, >5 billion paired-end reads from >100 libraries covering diverse developmental stages, tissues and cultured cells, to rigorously annotate >2500 fruitfly circular RNAs. These mostly derive from back-splicing of protein-coding genes and lack poly(A) tails, and circularization of hundreds of genes is conserved across multiple Drosophila species. We elucidate structural and sequence properties of Drosophila circular RNAs, which exhibit commonalities and distinctions from mammalian circles. Notably, Drosophila circular RNAs harbor >1000 well-conserved canonical miRNA seed matches, especially within coding regions, and coding conserved miRNA sites reside preferentially within circularized exons. Finally, we analyze the developmental and tissue specificity of circular RNAs, and note their preferred derivation from neural genes and enhanced accumulation in neural tissues. Interestingly, circular isoforms increase dramatically relative to linear isoforms during CNS aging, and constitute a novel aging biomarker. PMID:25544350

  16. Structure of a bacterial homologue of vitamin K epoxide reductase

    SciTech Connect

    Li, Weikai; Schulman, Sol; Dutton, Rachel J.; Boyd, Dana; Beckwith, Jon; Rapoport, Tom A.

    2010-03-19

    Vitamin K epoxide reductase (VKOR) generates vitamin K hydroquinone to sustain {gamma}-carboxylation of many blood coagulation factors. Here, we report the 3.6 {angstrom} crystal structure of a bacterial homologue of VKOR from Synechococcus sp. The structure shows VKOR in complex with its naturally fused redox partner, a thioredoxin-like domain, and corresponds to an arrested state of electron transfer. The catalytic core of VKOR is a four transmembrane helix bundle that surrounds a quinone, connected through an additional transmembrane segment with the periplasmic thioredoxin-like domain. We propose a pathway for how VKOR uses electrons from cysteines of newly synthesized proteins to reduce a quinone, a mechanism confirmed by in vitro reconstitution of vitamin K-dependent disulphide bridge formation. Our results have implications for the mechanism of the mammalian VKOR and explain how mutations can cause resistance to the VKOR inhibitor warfarin, the most commonly used oral anticoagulant.

  17. Structures of Large RNAs and RNA-Protein Complexes: Toward Structure Determination of Riboswitches.

    PubMed

    Grigg, Jason C; Ke, Ailong

    2015-01-01

    Riboswitches are widespread and important regulatory elements. They are typically present in the mRNA of the gene under their regulation, where they form complex three-dimensional structures that can bind an effector and regulate either transcription or translation of the mRNA. Structural biology has been essential to our understanding of their ligand recognition and conformational switching mechanisms, but riboswitch determination presents several important complications. Overcoming these challenges requires a synergistic approach using rational design of the constructs and supporting methods to biochemically validate the designs and resulting structures. PMID:26068743

  18. Non-coding RNAs including miRNAs, piRNAs, and tRNAs in human cancer

    PubMed Central

    Heyns, Mieke; Kovalchuk, Olga

    2015-01-01

    Over 98% of our genes code for RNA transcripts that will never become translated into protein. Numerous non-coding RNA (ncRNA) transcripts are structurally and functionally diverse. In particular, micro RNAs (miRNAs), piwi-interacting RNAs (piRNAs), and, more recently, transfer RNAs (tRNAs) are implicated as regulators of key genes and processes that are involved in various human diseases, including cancer. Here, we summarize the recent findings and perspectives in the small RNA and cancer research. PMID:26405161

  19. Isoenergetic microarrays to study the structure and interactions of DsrA and OxyS RNAs in two- and three-component complexes⊥

    PubMed Central

    Fratczak, Agata; Kierzek, Ryszard; Kierzek, Elzbieta

    2011-01-01

    Information on the secondary structure and interactions of RNA is important to understand the biological function of RNA as well as in applying RNA as a tool for therapeutic purposes. Recently, the isoenergetic microarray mapping method was developed to improve the prediction of RNA secondary structure. Herein, for the first time, isoenergetic microarrays were used to study the binding of RNA to protein or other RNAs, as well as the interactions of two different RNAs and protein in a three-component complex. The RNAs used as models were the regulatory DsrA and OxyS RNAs from Escherichia coli, the fragments of their target mRNAs (fhlA and rpoS), and their complexes with Hfq protein. The collected results showed the advantages and some limitations of microarray mapping. PMID:21793590

  20. Defined spatial structure stabilizes a synthetic multispecies bacterial community

    PubMed Central

    Kim, Hyun Jung; Boedicker, James Q.; Choi, Jang Wook; Ismagilov, Rustem F.

    2008-01-01

    This paper shows that for microbial communities, “fences make good neighbors.” Communities of soil microorganisms perform critical functions: controlling climate, enhancing crop production, and remediation of environmental contamination. Microbial communities in the oral cavity and the gut are of high biomedical interest. Understanding and harnessing the function of these communities is difficult: artificial microbial communities in the laboratory become unstable because of “winner-takes-all” competition among species. We constructed a community of three different species of wild-type soil bacteria with syntrophic interactions using a microfluidic device to control spatial structure and chemical communication. We found that defined microscale spatial structure is both necessary and sufficient for the stable coexistence of interacting bacterial species in the synthetic community. A mathematical model describes how spatial structure can balance the competition and positive interactions within the community, even when the rates of production and consumption of nutrients by species are mismatched, by exploiting nonlinearities of these processes. These findings provide experimental and modeling evidence for a class of communities that require microscale spatial structure for stability, and these results predict that controlling spatial structure may enable harnessing the function of natural and synthetic multispecies communities in the laboratory. PMID:19011107

  1. A structural basis for electron transfer in bacterial photosynthesis

    SciTech Connect

    Norris, J.R.; DiMagno, T.J.; Angerhofer, A.; Chang, C.H.; El-Kabbani, O.; Schiffer, M.

    1989-01-01

    Triplet data for the primary donor in single crystals of bacterial reaction centers of Rhodobacter sphaeroides and Rhodopseudomonas viridis are interpreted in terms of the corresponding x-ray structures. The analysis of electron paramagnetic resonance data from single crystals (triplet zero field splitting and cation and triplet linewidth of the primary special pair donor of bacterial reaction centers) is extended to systems of a non-crystalline nature. A unified interpretation based on frontier molecular orbitals concludes that the special pair behaves like a supermolecule in all wild-type bacteria investigated here. However, in heterodimers of Rb. capsulatus (His/sup M200/ changed to Leu or Phe with the result that the M-half of the special pair is converted to bacteriopheophytin) the special pair possesses the EPR properties more appropriately described in terms of a monomer. In all cases the triplet state and cation EPR properties appear to be dominated by the highest occupied molecular orbitals. These conclusions derived from EPR experiments are supplemented by data from Stark spectroscopy of reaction centers from Rb. capsulatus. 41 refs., 3 tabs.

  2. Structure-function investigations of bacterial photosynthetic reaction centers.

    PubMed

    Leonova, M M; Fufina, T Yu; Vasilieva, L G; Shuvalov, V A

    2011-12-01

    During photosynthesis light energy is converted into energy of chemical bonds through a series of electron and proton transfer reactions. Over the first ultrafast steps of photosynthesis that take place in the reaction center (RC) the quantum efficiency of the light energy transduction is nearly 100%. Compared to the plant and cyanobacterial photosystems, bacterial RCs are well studied and have relatively simple structure. Therefore they represent a useful model system both for manipulating of the electron transfer parameters to study detailed mechanisms of its separate steps as well as to investigate the common principles of the photosynthetic RC structure, function, and evolution. This review is focused on the research papers devoted to chemical and genetic modifications of the RCs of purple bacteria in order to study principles and mechanisms of their functioning. Investigations of the last two decades show that the maximal rates of the electron transfer reactions in the RC depend on a number of parameters. Chemical structure of the cofactors, distances between them, their relative orientation, and interactions to each other are of great importance for this process. By means of genetic and spectral methods, it was demonstrated that RC protein is also an essential factor affecting the efficiency of the photochemical charge separation. Finally, some of conservative water molecules found in RC not only contribute to stability of the protein structure, but are directly involved in the functioning of the complex. PMID:22339599

  3. Impact of bacterial endotoxin on the structure of DMPC membranes.

    PubMed

    Nagel, Michael; Brauckmann, Stephan; Moegle-Hofacker, Franzeska; Effenberger-Neidnicht, Katharina; Hartmann, Matthias; de Groot, Herbert; Mayer, Christian

    2015-10-01

    Bacterial lipopolysaccharides are believed to have a toxic effect on human cell membranes. In this study, the influence of a lipopolysaccharide (LPS) from Escherichia coli on the structure, the dynamics and the mechanical strength of phospholipid membranes are monitored by nuclear magnetic resonance spectroscopy (NMR) and by atomic force microscopy (AFM). Model membranes are formed from 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) and are either prepared as multilamellar bulk samples or multilamellar vesicles. Field gradient NMR data directly prove the rapid integration of LPS into DMPC membranes. Solid state NMR experiments primarily detect decreasing molecular order parameters with increasing LPS content. This is accompanied by a mechanical softening of the membrane bilayers as is shown by AFM indentation measurements. Altogether, the data prove that lipopolysaccharide molecules quickly insert into phospholipid bilayers, increase membrane fluctuation amplitudes and significantly weaken their mechanical stiffness. PMID:26071197

  4. Structural modification of bacterial cellulose fibrils under ultrasonic irradiation.

    PubMed

    Paximada, Paraskevi; Dimitrakopoulou, Eleni Alkmini; Tsouko, Erminda; Koutinas, Apostolos A; Fasseas, C; Mandala, Ioanna G

    2016-10-01

    Ιn the present study we investigated ultrasounds as a pretreatment process for bacterial cellulose (BC) aqueous suspensions. BC suspensions (0.1-1% wt) subjected to an ultrasonic treatment for different time intervals. Untreated BC presented an extensively entangled fibril network. When a sonication time of 1min was applied BC fibrils appeared less bundled and dropped in width from 110nm to 60nm. For a longer treatment (3-5min) the width of the fibrils increased again to 100nm attributed to an entanglement of their structure. The water holding capacity (WHC) and ζ-potnential of the suspensions was proportional to the sonication time. Their viscosity and stability were also affected; an increase could be seen at short treatments, while a decrease was obvious at longer ones. Concluding, a long ultrasonic irradiation led to similar BC characteristics as the untreated, but a short treatment may be a pre-handling method for improving BC properties. PMID:27312607

  5. Structure of the complete bacterial SRP Alu domain

    PubMed Central

    Kempf, Georg; Wild, Klemens; Sinning, Irmgard

    2014-01-01

    The Alu domain of the signal recognition particle (SRP) arrests protein biosynthesis by competition with elongation factor binding on the ribosome. The mammalian Alu domain is a protein–RNA complex, while prokaryotic Alu domains are protein-free with significant extensions of the RNA. Here we report the crystal structure of the complete Alu domain of Bacillus subtilis SRP RNA at 2.5 Å resolution. The bacterial Alu RNA reveals a compact fold, which is stabilized by prokaryote-specific extensions and interactions. In this ‘closed’ conformation, the 5′ and 3′ regions are clamped together by the additional helix 1, the connecting 3-way junction and a novel minor groove interaction, which we term the ‘minor-saddle motif’ (MSM). The 5′ region includes an extended loop–loop pseudoknot made of five consecutive Watson–Crick base pairs. Homology modeling with the human Alu domain in context of the ribosome shows that an additional lobe in the pseudoknot approaches the large subunit, while the absence of protein results in the detachment from the small subunit. Our findings provide the structural basis for purely RNA-driven elongation arrest in prokaryotes, and give insights into the structural adaption of SRP RNA during evolution. PMID:25270875

  6. Mechanical and structural property analysis of bacterial cellulose composites.

    PubMed

    Dayal, Manmeet Singh; Catchmark, Jeffrey M

    2016-06-25

    Bacterial cellulose (BC) exhibits unique properties including high mechanical strength and high crystallinity. Improvement in the mechanical properties of BC is sought for many applications ranging from food to structural composites to biomedical materials. In this study, different additives including carboxymethyl cellulose (CMC), pectin, gelatin, cornstarch, and corn steep liquor were included in the fermentation media to alter the BC produced. Three different concentrations (1%, 3% and 5%) were chosen for each of the additives, with no additive (0%) as the control. The produced BC was then analyzed to determine tensile and compression modulus. Amongst the tested additives, BC produced in media containing 3% (w/v) pectin had the maximum compressive modulus (142kPa), and BC produced in media containing 1% (w/v) gelatin exhibited the maximum tensile modulus (21MPa). Structural characteristics of BC and BC-additive composites were compared using X-Ray diffraction (XRD). The crystal size and crystallinity of BC was reduced when grown in the presence of CMC and gelatin while pectin only decreased the crystallite size. This suggested that CMC and gelatin may be incorporated into the BC fibril structure. The field emission scanning electron microscopy (FESEM) images showed the increased micro-fibril aggregation in BC pellicles grown in the presence of additives to the culture media. PMID:27083837

  7. Structural photoactivation of a full-length bacterial phytochrome

    PubMed Central

    Björling, Alexander; Berntsson, Oskar; Lehtivuori, Heli; Takala, Heikki; Hughes, Ashley J.; Panman, Matthijs; Hoernke, Maria; Niebling, Stephan; Henry, Léocadie; Henning, Robert; Kosheleva, Irina; Chukharev, Vladimir; Tkachenko, Nikolai V.; Menzel, Andreas; Newby, Gemma; Khakhulin, Dmitry; Wulff, Michael; Ihalainen, Janne A.; Westenhoff, Sebastian

    2016-01-01

    Phytochromes are light sensor proteins found in plants, bacteria, and fungi. They function by converting a photon absorption event into a conformational signal that propagates from the chromophore through the entire protein. However, the structure of the photoactivated state and the conformational changes that lead to it are not known. We report time-resolved x-ray scattering of the full-length phytochrome from Deinococcus radiodurans on micro- and millisecond time scales. We identify a twist of the histidine kinase output domains with respect to the chromophore-binding domains as the dominant change between the photoactivated and resting states. The time-resolved data further show that the structural changes up to the microsecond time scales are small and localized in the chromophore-binding domains. The global structural change occurs within a few milliseconds, coinciding with the formation of the spectroscopic meta-Rc state. Our findings establish key elements of the signaling mechanism of full-length bacterial phytochromes. PMID:27536728

  8. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  9. A model for the tertiary structure of mammalian mitochondrial transfer RNAs lacking the entire 'dihydrouridine' loop and stem.

    PubMed Central

    de Bruijn, M H; Klug, A

    1983-01-01

    The mammalian mitochondrial tRNA(AGY)Ser is unique in lacking the entire dihydrouridine arm. This reduces its secondary structure to a 'truncated cloverleaf'. Experimental evidence on the tertiary structure has been obtained by chemically probing the conformation of both the bovine and human species in their native conformation and at various stages of denaturation. A structural model of the bovine tRNA is presented based on the results of this chemical probing, on a comparison between nine homologous 'truncated cloverleaf' secondary structures and on analogies with the crystal structure of yeast phenylalanine tRNA. The proposed structure is very similar in shape to that of yeast tRNA(Phe) but is slightly smaller in size. It is defined by a unique set of tertiary interactions. Structural considerations suggest that other mammalian mitochondrial tRNAs have smaller dimensions as well. Images Fig. 1. Fig. 1. Fig. 1. Fig. 3. PMID:10872325

  10. Bacterial community structure in aquifers corresponds to stratigraphy

    NASA Astrophysics Data System (ADS)

    Beyer, Andrea; Möller, Silke; Neumann, Stefan; Burow, Katja; Gutmann, Falko; Lindner, Julia; Müsse, Steffen; Kothe, Erika; Büchel, Georg

    2014-05-01

    So far, groundwater microbiology with respect to different host rocks has not been well described in the literature. However, factors influencing the communities would be of interest to provide a tool for mapping groundwater paths. The Thuringian Basin (Germany) studied here, contains formations of the Permian (Zechstein) and also Triassic period of Buntsandstein, Muschelkalk and Keuper, all of which can be found to crop out at the surface in different regions. We analyzed the bacterial community of nine natural springs and sixteen groundwater wells of the respective rock formations as well as core material from the Zechstein salts. For that we sampled in a mine 3 differnet salt rock samples (carnallitite, halite and sylvinitite). To validate the different approaches, similar rock formations were compared and a consistent microbial community for Buntsandstein could be verified. Similary, for Zechstein, the presence of halophiles was seen with cultivation, isolation directly from the rock material and also in groundwater with DNA-dependent approaches. A higher overlap between sandstone- and limestone-derived communities was visible as if compared to the salt formations. Principal component analysis confirmed formation specific patterns for Muschelkalk, Buntsandstein and Zechstein for the bacterial taxa present, with some overlaps. Bacilli and Gammaproteobacteria were the major groups, with the genera Pseudomonas, Marinomonas, Bacillus, Marinobacter and Pseudoalteromonas representing the communities. The bacteria are well adapted to their respective environment with survival strategies including a wide range of salinity which makes them suitable as tracers for fluid movement below the ground. The results indicate the usefulness and robustness of the approach taken here to investigate aquifer community structures in dependence of the stratigraphy of the groundwater reservoir.

  11. Molecular structure and dynamics in bacterial mercury resistance

    SciTech Connect

    Johs, Alexander; Shi, Liang; Miller, Susan M; Summers, Anne O; Liang, Liyuan

    2008-01-01

    Bacteria participate significantly in mercury transformation in natural and industrial environments. Previous studies have shown that bacterial mercury resistance is mediated by the mer operon, typically located on transposons or plasmids. It encodes specific genes that facilitate uptake of mercury species, cleavage of organomercurials, and reduction of Hg(II) to Hg(0). Expression of mer operon genes is regulated by MerR, a metal-responsive regulator protein on the level of transcription. In vitro studies have shown that MerR forms a non-transcribing pre-initiation complex with RNA polymerase and the promoter DNA. Binding of Hg(II) induces conformational changes in MerR and other components of the complex resulting in the transcription of mer operon genes. As part of ongoing investigations on allosteric conformational changes induced by Hg(II) in dimeric MerR, and the implications on the binding of RNA polymerase to the promoter of the mer operon, we applied small angle scattering to study the regulatory mechanism of MerR in the presence and absence of Hg(II). Our results show that in the presence of Hg(II) the MerR dimer undergoes a significant reorientation from a compact state to a conformation revealing two distinct domains. Bacterial reduction of Hg(II) can also occur at concentrations too low to induce mer operon functions. Dissimilatory metal reducing bacteria, such as Shewanella and Geobacter are able to reduce Hg(II) in the presence of mineral oxides. This process has been linked to the activity of outer membrane multiheme cytochromes. We isolated and purified a decaheme outer membrane cytochrome OmcA from Shewanella oneidensis MR-1 and characterized its envelope shape in solution by small angle x-ray scattering. Structural features were identified and compared to homology models. These results show that OmcA is an elongated macromolecule consisting of separate modules, which may be connected by flexible linkers.

  12. Sizing up long non-coding RNAs

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2012-01-01

    Long noncoding RNAs (lncRNAs) play a key role in many important areas of epigenetics, stem cell biology, cancer, signaling and brain function. This emerging class of RNAs constitutes a large fraction of the transcriptome, with thousands of new lncRNAs reported each year. The molecular mechanisms of these RNAs are not well understood. Currently, very little structural data exist. We review the available lncRNA sequence and secondary structure data. Since almost no tertiary information is available for lncRNAs, we review crystallographic structures for other RNA systems and discuss the possibilities for lncRNAs in the context of existing constraints. PMID:23267412

  13. Structural Dynamics of Human Argonaute2 and Its Interaction with siRNAs Designed to Target Mutant tdp43

    PubMed Central

    Bhandare, Vishwambhar

    2016-01-01

    The human Argonaute2 protein (Ago2) is a key player in RNA interference pathway and small RNA recognition by Ago2 is the crucial step in siRNA mediated gene silencing mechanism. The present study highlights the structural and functional dynamics of human Ago2 and the interaction mechanism of Ago2 with a set of seven siRNAs for the first time. The human Ago2 protein adopts two conformations such as “open” and “close” during the simulation of 25 ns. One of the domains named as PAZ, which is responsible for anchoring the 3′-end of siRNA guide strand, is observed as a highly flexible region. The interaction between Ago2 and siRNA, analyzed using a set of siRNAs (targeting at positions 128, 251, 341, 383, 537, 1113, and 1115 of mRNA) designed to target tdp43 mutants causing Amyotrophic Lateral Sclerosis (ALS) disease, revealed the stable and strong recognition of siRNA by the Ago2 protein during dynamics. Among the studied siRNAs, the siRNA341 is identified as a potent siRNA to recognize Ago2 and hence could be used further as a possible siRNA candidate to target the mutant tdp43 protein for the treatment of ALS patients. PMID:27110240

  14. Regulation of histone H4 Lys16 acetylation by predicted alternative secondary structures in roX noncoding RNAs.

    PubMed

    Park, Seung-Won; Kuroda, Mitzi I; Park, Yongkyu

    2008-08-01

    Despite differences in size and sequence, the two noncoding roX1 and roX2 RNAs are functionally redundant for dosage compensation of the Drosophila melanogaster male X chromosome. Consistent with functional conservation, we found that roX RNAs of distant Drosophila species could complement D. melanogaster roX mutants despite low homology. Deletion of a conserved predicted stem-loop structure in roX2, containing a short GUb (GUUNUACG box) in its 3' stem, resulted in a defect in histone H4K16 acetylation on the X chromosome in spite of apparently normal localization of the MSL complex. Two copies of the GUb sequence, newly termed the "roX box," were functionally redundant in roX2, as mutants in a single roX box had no phenotype, but double mutants showed reduced H4K16 acetylation. Interestingly, mutation of two of three roX boxes in the 3' end of roX1 RNA also reduced H4K16 acetylation. Finally, fusion of roX1 sequences containing a roX box restored function to a roX2 deletion RNA lacking its cognate roX box. These results support a model in which the functional redundancy between roX1 and roX2 RNAs is based, at least in part, on short GUUNUACG sequences that regulate the activity of the MSL complex. PMID:18541664

  15. Microfabricated ratchet structures for concentrating and patterning motile bacterial cells

    NASA Astrophysics Data System (ADS)

    Yub Kim, Sang; Lee, Eun Se; Lee, Ho Jae; Lee, Se Yeon; Kuk Lee, Sung; Kim, Taesung

    2010-09-01

    We present a novel microfabricated concentrator for Escherichia coli that can be a stand-alone and self-contained microfluidic device because it utilizes the motility of cells. First of all, we characterize the motility of E. coli cells and various ratcheting structures that can guide cells to move in a desired direction in straight and circular channels. Then, we combine these ratcheting microstructures with the intrinsic tendency of cells to swim on the right side in microchannels to enhance the concentration rates up to 180 fold until the concentrators are fully filled with cells. Furthermore, we demonstrate that cells can be positioned and concentrated with a constant spacing distance on a surface, allowing spatial patterning of motile cells. These results can be applied to biosorption or biosensor devices that are powered by motile cells because they can be highly concentrated without any external mechanical and electrical energy sources. Hence, we believe that the concentrator design holds considerable potential to be applied for concentrating and patterning other motile microbes and providing a versatile structure for motility study of bacterial cells.

  16. X-ray structure of a bacterial oligosaccharyltransferase.

    PubMed

    Lizak, Christian; Gerber, Sabina; Numao, Shin; Aebi, Markus; Locher, Kaspar P

    2011-06-16

    Asparagine-linked glycosylation is a post-translational modification of proteins containing the conserved sequence motif Asn-X-Ser/Thr. The attachment of oligosaccharides is implicated in diverse processes such as protein folding and quality control, organism development or host-pathogen interactions. The reaction is catalysed by oligosaccharyltransferase (OST), a membrane protein complex located in the endoplasmic reticulum. The central, catalytic enzyme of OST is the STT3 subunit, which has homologues in bacteria and archaea. Here we report the X-ray structure of a bacterial OST, the PglB protein of Campylobacter lari, in complex with an acceptor peptide. The structure defines the fold of STT3 proteins and provides insight into glycosylation sequon recognition and amide nitrogen activation, both of which are prerequisites for the formation of the N-glycosidic linkage. We also identified and validated catalytically important, acidic amino acid residues. Our results provide the molecular basis for understanding the mechanism of N-linked glycosylation. PMID:21677752

  17. Crystal structure of a chimaeric bacterial glutamate dehydrogenase.

    PubMed

    Oliveira, Tânia; Sharkey, Michael A; Engel, Paul C; Khan, Amir R

    2016-06-01

    Glutamate dehydrogenases (EC 1.4.1.2-4) catalyse the oxidative deamination of L-glutamate to α-ketoglutarate using NAD(P)(+) as a cofactor. The bacterial enzymes are hexameric, arranged with 32 symmetry, and each polypeptide consists of an N-terminal substrate-binding segment (domain I) followed by a C-terminal cofactor-binding segment (domain II). The catalytic reaction takes place in the cleft formed at the junction of the two domains. Distinct signature sequences in the nucleotide-binding domain have been linked to the binding of NAD(+) versus NADP(+), but they are not unambiguous predictors of cofactor preference. In the absence of substrate, the two domains move apart as rigid bodies, as shown by the apo structure of glutamate dehydrogenase from Clostridium symbiosum. Here, the crystal structure of a chimaeric clostridial/Escherichia coli enzyme has been determined in the apo state. The enzyme is fully functional and reveals possible determinants of interdomain flexibility at a hinge region following the pivot helix. The enzyme retains the preference for NADP(+) cofactor from the parent E. coli domain II, although there are subtle differences in catalytic activity. PMID:27303899

  18. Dimeric Structure of the Bacterial Extracellular Foldase PrsA*

    PubMed Central

    Jakob, Roman P.; Koch, Johanna R.; Burmann, Björn M.; Schmidpeter, Philipp A. M.; Hunkeler, Moritz; Hiller, Sebastian; Schmid, Franz X.; Maier, Timm

    2015-01-01

    Secretion of proteins into the membrane-cell wall space is essential for cell wall biosynthesis and pathogenicity in Gram-positive bacteria. Folding and maturation of many secreted proteins depend on a single extracellular foldase, the PrsA protein. PrsA is a 30-kDa protein, lipid anchored to the outer leaflet of the cell membrane. The crystal structure of Bacillus subtilis PrsA reveals a central catalytic parvulin-type prolyl isomerase domain, which is inserted into a larger composite NC domain formed by the N- and C-terminal regions. This domain architecture resembles, despite a lack of sequence conservation, both trigger factor, a ribosome-binding bacterial chaperone, and SurA, a periplasmic chaperone in Gram-negative bacteria. Two main structural differences are observed in that the N-terminal arm of PrsA is substantially shortened relative to the trigger factor and SurA and in that PrsA is found to dimerize in a unique fashion via its NC domain. Dimerization leads to a large, bowl-shaped crevice, which might be involved in vivo in protecting substrate proteins from aggregation. NMR experiments reveal a direct, dynamic interaction of both the parvulin and the NC domain with secretion propeptides, which have been implicated in substrate targeting to PrsA. PMID:25525259

  19. Holo- And Apo- Structures of Bacterial Periplasmic Heme Binding Proteins

    SciTech Connect

    Ho, W.W.; Li, H.; Eakanunkul, S.; Tong, Y.; Wilks, A.; Guo, M.; Poulos, T.L.

    2009-06-01

    An essential component of heme transport in Gram-negative bacterial pathogens is the periplasmic protein that shuttles heme between outer and inner membranes. We have solved the first crystal structures of two such proteins, ShuT from Shigella dysenteriae and PhuT from Pseudomonas aeruginosa. Both share a common architecture typical of Class III periplasmic binding proteins. The heme binds in a narrow cleft between the N- and C-terminal binding domains and is coordinated by a Tyr residue. A comparison of the heme-free (apo) and -bound (holo) structures indicates little change in structure other than minor alterations in the heme pocket and movement of the Tyr heme ligand from an 'in' position where it can coordinate the heme iron to an 'out' orientation where it points away from the heme pocket. The detailed architecture of the heme pocket is quite different in ShuT and PhuT. Although Arg{sup 228} in PhuT H-bonds with a heme propionate, in ShuT a peptide loop partially takes up the space occupied by Arg{sup 228}, and there is no Lys or Arg H-bonding with the heme propionates. A comparison of PhuT/ShuT with the vitamin B{sub 12}-binding protein BtuF and the hydroxamic-type siderophore-binding protein FhuD, the only two other structurally characterized Class III periplasmic binding proteins, demonstrates that PhuT/ShuT more closely resembles BtuF, which reflects the closer similarity in ligands, heme and B{sub 12}, compared with ligands for FhuD, a peptide siderophore.

  20. Impact of oil on bacterial community structure in bioturbated sediments.

    PubMed

    Stauffert, Magalie; Cravo-Laureau, Cristiana; Jézéquel, Ronan; Barantal, Sandra; Cuny, Philippe; Gilbert, Franck; Cagnon, Christine; Militon, Cécile; Amouroux, David; Mahdaoui, Fatima; Bouyssiere, Brice; Stora, Georges; Merlin, François-Xavier; Duran, Robert

    2013-01-01

    Oil spills threaten coastlines where biological processes supply essential ecosystem services. Therefore, it is crucial to understand how oil influences the microbial communities in sediments that play key roles in ecosystem functioning. Ecosystems such as sediments are characterized by intensive bioturbation due to burrowing macrofauna that may modify the microbial metabolisms. It is thus essential to consider the bioturbation when determining the impact of oil on microbial communities. In this study, an experimental laboratory device maintaining pristine collected mudflat sediments in microcosms closer to true environmental conditions--with tidal cycles and natural seawater--was used to simulate an oil spill under bioturbation conditions. Different conditions were applied to the microcosms including an addition of: standardized oil (Blend Arabian Light crude oil, 25.6 mg.g⁻¹ wet sediment), the common burrowing organism Hediste (Nereis) diversicolor and both the oil and H. diversicolor. The addition of H. diversicolor and its associated bioturbation did not affect the removal of petroleum hydrocarbons. After 270 days, 60% of hydrocarbons had been removed in all microcosms irrespective of the H. diversicolor addition. However, 16S-rRNA gene and 16S-cDNA T-RFLP and RT-PCR-amplicon libraries analysis showed an effect of the condition on the bacterial community structure, composition, and dynamics, supported by PerMANOVA analysis. The 16S-cDNA libraries from microcosms where H. diversicolor was added (oiled and un-oiled) showed a marked dominance of sequences related to Gammaproteobacteria. However, in the oiled-library sequences associated to Deltaproteobacteria and Bacteroidetes were also highly represented. The 16S-cDNA libraries from oiled-microcosms (with and without H. diversicolor addition) revealed two distinct microbial communities characterized by different phylotypes associated to known hydrocarbonoclastic bacteria and dominated by Gammaproteobacteria

  1. Structure of a bacterial cell surface decaheme electron conduit

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Some bacterial species are able to utilize extracellular mineral forms of iron and manganese as respiratory electron acceptors. In Shewanella oneidensis this involves decaheme cytochromes that are located on the bacterial cell surface at the termini of trans-outer-membrane electron transfer conduits...

  2. The effect of deuteration on the structure of bacterial cellulose

    SciTech Connect

    Bali, Garima; Foston, Marcus; O'Neill, Hugh Michael; Evans, Barbara R; He, Junhong; Ragauskas, Arthur

    2013-01-01

    ABSTRACT In vivo generated deuterated bacterial cellulose, cultivated from 100% deuterated glycerol in D2O medium, was analyzed for deuterium incorporation by ionic liquid dissolution and 2H and 1H nuclear magnetic resonance (NMR). A solution NMR method of the dissolved cellulose was used to determine that this bacterial cellulose had 85 % deuterium incorporation. Acetylation and 1H and 2H NMR of deuterated bacterial cellulose indicated near equal deuteration at all sites of the glucopyranosyl ring except C-6 which was partly deuterated. Despite the high level of deuterium incorporation there were no significant differences in the molecular and morphological properties were observed for the deuterated and protio bacterial cellulose samples. The highly deuterated bacterial cellulose presented here can be used as a model substrate for studying cellulose biopolymer properties via future small angle neutron scattering (SANS) studies.

  3. Formation of triple-helical structures by the 3′-end sequences of MALAT1 and MENβ noncoding RNAs

    PubMed Central

    Brown, Jessica A.; Valenstein, Max L.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.

    2012-01-01

    Stability of the long noncoding-polyadenylated nuclear (PAN) RNA from Kaposi's sarcoma-associated herpesvirus is conferred by an expression and nuclear retention element (ENE). The ENE protects PAN RNA from a rapid deadenylation-dependent decay pathway via formation of a triple helix between the U-rich internal loop of the ENE and the 3′-poly(A) tail. Because viruses borrow molecular mechanisms from their hosts, we searched highly abundant human long-noncoding RNAs and identified putative ENE-like structures in metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) and multiple endocrine neoplasia-β (MENβ) RNAs. Unlike the PAN ENE, the U-rich internal loops of both predicted cellular ENEs are interrupted by G and C nucleotides and reside upstream of genomically encoded A-rich tracts. We confirmed the ability of MALAT1 and MENβ sequences containing the predicted ENE and A-rich tract to increase the levels of an intronless β-globin reporter RNA. UV thermal denaturation profiles at different pH values support formation of a triple-helical structure composed of multiple U•A-U base triples and a single C•G-C base triple. Additional analyses of the MALAT1 ENE revealed that robust stabilization activity requires an intact triple helix, strong stems at the duplex-triplex junctions, a G-C base pair flanking the triplex to mediate potential A-minor interactions, and the 3′-terminal A of the A-rich tract to form a blunt-ended triplex lacking unpaired nucleotides at the duplex-triplex junction. These examples of triple-helical, ENE-like structures in cellular noncoding RNAs, are unique. PMID:23129630

  4. RNase R mutants elucidate the catalysis of structured RNA: RNA-binding domains select the RNAs targeted for degradation.

    PubMed

    Matos, Rute Gonçalves; Barbas, Ana; Arraiano, Cecília Maria

    2009-10-15

    The RNase II superfamily is a ubiquitous family of exoribonucleases that are essential for RNA metabolism. RNase II and RNase R degrade RNA in the 3'-->5' direction in a processive and sequence-independent manner. However, although RNase R is capable of degrading highly structured RNAs, the RNase II activity is impaired by the presence of secondary structures. RNase II and RNase R share structural properties and have a similar modular domain organization. The eukaryotic RNase II homologue, Rrp44/Dis3, is the catalytic subunit of the exosome, one of the most important protein complexes involved in the maintenance of the correct levels of cellular RNAs. In the present study, we constructed truncated RNase II and RNase R proteins and point mutants and characterized them regarding their exoribonucleolytic activity and RNA-binding ability. We report that Asp280 is crucial for RNase R activity without affecting RNA binding. When Tyr324 was changed to alanine, the final product changed from 2 to 5 nt in length, showing that this residue is responsible for setting the end-product. We have shown that the RNB domain of RNase II has catalytic activity. The most striking result is that the RNase R RNB domain itself degrades double-stranded substrates even in the absence of a 3'-overhang. Moreover, we have demonstrated for the first time that the substrate recognition of RNase R depends on the RNA-binding domains that target the degradation of RNAs that are 'tagged' by a 3'-tail. These results can have important implications for the study of poly(A)-dependent RNA degradation mechanisms. PMID:19630750

  5. Structural basis for m7G recognition and 2'-O-methyl discrimination in capped RNAs by the innate immune receptor RIG-I.

    PubMed

    Devarkar, Swapnil C; Wang, Chen; Miller, Matthew T; Ramanathan, Anand; Jiang, Fuguo; Khan, Abdul G; Patel, Smita S; Marcotrigiano, Joseph

    2016-01-19

    RNAs with 5'-triphosphate (ppp) are detected in the cytoplasm principally by the innate immune receptor Retinoic Acid Inducible Gene-I (RIG-I), whose activation triggers a Type I IFN response. It is thought that self RNAs like mRNAs are not recognized by RIG-I because 5'ppp is capped by the addition of a 7-methyl guanosine (m7G) (Cap-0) and a 2'-O-methyl (2'-OMe) group to the 5'-end nucleotide ribose (Cap-1). Here we provide structural and mechanistic basis for exact roles of capping and 2'-O-methylation in evading RIG-I recognition. Surprisingly, Cap-0 and 5'ppp double-stranded (ds) RNAs bind to RIG-I with nearly identical Kd values and activate RIG-I's ATPase and cellular signaling response to similar extents. On the other hand, Cap-0 and 5'ppp single-stranded RNAs did not bind RIG-I and are signaling inactive. Three crystal structures of RIG-I complexes with dsRNAs bearing 5'OH, 5'ppp, and Cap-0 show that RIG-I can accommodate the m7G cap in a cavity created through conformational changes in the helicase-motif IVa without perturbing the ppp interactions. In contrast, Cap-1 modifications abrogate RIG-I signaling through a mechanism involving the H830 residue, which we show is crucial for discriminating between Cap-0 and Cap-1 RNAs. Furthermore, m7G capping works synergistically with 2'-O-methylation to weaken RNA affinity by 200-fold and lower ATPase activity. Interestingly, a single H830A mutation restores both high-affinity binding and signaling activity with 2'-O-methylated dsRNAs. Our work provides new structural insights into the mechanisms of host and viral immune evasion from RIG-I, explaining the complexity of cap structures over evolution. PMID:26733676

  6. Oritavancin for acute bacterial skin and skin structure infection

    PubMed Central

    Messina, Julia A.; Fowler, Vance G.; Corey, G. Ralph

    2015-01-01

    Introduction Inpatient treatment of acute bacterial skin and skin structure infections (ABSSSI) exerts a significant economic burden on the healthcare system. Oritavancin is a concentration-dependent, rapidly bactericidal agent approved for the treatment of ABSSSI. Its prolonged half-life with one-time intravenous (IV) dosing offers a potential solution to this burden. In addition, oritavancin represents an alternative therapy for Streptococci and multidrug resistant gram-positive bacteria including methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus. Animal models have also shown promising results with oritavancin for other disease states including those that require long courses of IV therapy. Areas covered This review covers oritavancin’s basic chemistry, spectrum of activity, pharmacodynamics/ pharmacokinetics, efficacy in clinical trials, and provides expert opinion on future directions. To compose this review, a search of PubMed was performed, and articles written in the English language were selected based on full text availability. Expert Opinion If oritavancin is proven to be a cost-effective strategy for outpatient treatment and prevents complications of prolonged IV therapy, it will be sought as an alternative antibiotic therapy for ABSSSI. In addition, further clinical data demonstrating efficacy in gram-positive infections requiring prolonged therapy such as endocarditis and osteomyelitis could support oritavancin’s success in the current market. PMID:25803197

  7. MicroRNAs: Potential Biomarkers and Therapeutic Targets for Alveolar Bone Loss in Periodontal Disease

    PubMed Central

    Kagiya, Tadayoshi

    2016-01-01

    Periodontal disease is an inflammatory disease caused by bacterial infection of tooth-supporting structures, which results in the destruction of alveolar bone. Osteoclasts play a central role in bone destruction. Osteoclasts are tartrate-resistant acid phosphatase (TRAP)-positive multinucleated giant cells derived from hematopoietic stem cells. Recently, we and other researchers revealed that microRNAs are involved in osteoclast differentiation. MicroRNAs are novel, single-stranded, non-coding, small (20–22 nucleotides) RNAs that act in a sequence-specific manner to regulate gene expression at the post-transcriptional level through cleavage or translational repression of their target mRNAs. They regulate various biological activities such as cellular differentiation, apoptosis, cancer development, and inflammatory responses. In this review, the roles of microRNAs in osteoclast differentiation and function during alveolar bone destruction in periodontal disease are described. PMID:27529224

  8. MicroRNAs: Potential Biomarkers and Therapeutic Targets for Alveolar Bone Loss in Periodontal Disease.

    PubMed

    Kagiya, Tadayoshi

    2016-01-01

    Periodontal disease is an inflammatory disease caused by bacterial infection of tooth-supporting structures, which results in the destruction of alveolar bone. Osteoclasts play a central role in bone destruction. Osteoclasts are tartrate-resistant acid phosphatase (TRAP)-positive multinucleated giant cells derived from hematopoietic stem cells. Recently, we and other researchers revealed that microRNAs are involved in osteoclast differentiation. MicroRNAs are novel, single-stranded, non-coding, small (20-22 nucleotides) RNAs that act in a sequence-specific manner to regulate gene expression at the post-transcriptional level through cleavage or translational repression of their target mRNAs. They regulate various biological activities such as cellular differentiation, apoptosis, cancer development, and inflammatory responses. In this review, the roles of microRNAs in osteoclast differentiation and function during alveolar bone destruction in periodontal disease are described. PMID:27529224

  9. Bioturbating shrimp alter the structure and diversity of bacterial communities in coastal marine sediments.

    PubMed

    Laverock, Bonnie; Smith, Cindy J; Tait, Karen; Osborn, A Mark; Widdicombe, Steve; Gilbert, Jack A

    2010-12-01

    Bioturbation is a key process in coastal sediments, influencing microbially driven cycling of nutrients as well as the physical characteristics of the sediment. However, little is known about the distribution, diversity and function of the microbial communities that inhabit the burrows of infaunal macroorganisms. In this study, terminal-restriction fragment length polymorphism analysis was used to investigate variation in the structure of bacterial communities in sediment bioturbated by the burrowing shrimp Upogebia deltaura or Callianassa subterranea. Analyses of 229 sediment samples revealed significant differences between bacterial communities inhabiting shrimp burrows and those inhabiting ambient surface and subsurface sediments. Bacterial communities in burrows from both shrimp species were more similar to those in surface-ambient than subsurface-ambient sediment (R=0.258, P<0.001). The presence of shrimp was also associated with changes in bacterial community structure in surrounding surface sediment, when compared with sediments uninhabited by shrimp. Bacterial community structure varied with burrow depth, and also between individual burrows, suggesting that the shrimp's burrow construction, irrigation and maintenance behaviour affect the distribution of bacteria within shrimp burrows. Subsequent sequence analysis of bacterial 16S rRNA genes from surface sediments revealed differences in the relative abundance of bacterial taxa between shrimp-inhabited and uninhabited sediments; shrimp-inhabited sediment contained a higher proportion of proteobacterial sequences, including in particular a twofold increase in Gammaproteobacteria. Chao1 and ACE diversity estimates showed that taxon richness within surface bacterial communities in shrimp-inhabited sediment was at least threefold higher than that in uninhabited sediment. This study shows that bioturbation can result in significant structural and compositional changes in sediment bacterial communities, increasing

  10. Biosynthesis and structural characterization of silver nanoparticles from bacterial isolates

    SciTech Connect

    Zaki, Sahar; El Kady, M.F.; Abd-El-Haleem, Desouky

    2011-10-15

    Graphical abstract: In this study five bacterial isolates belong to different genera were found to be able to biosynthesize silver nanoparticles. Biosynthesis and spectral characterization are reported here. Highlights: {yields} About 300 bacterial isolates were screened for their ability to produce nanosilvers {yields} Five of them were potential candidates for synthesis of silver nanoparticles {yields} Production of silver nanoparticles was examined using UV-Vis, XRD, SEM and EDS. {yields} The presence of nanoparticles with all five bacterial isolates was confirmed. -- Abstract: This study aimed to develop a green process for biosynthesis of silver nanomaterials by some Egyptian bacterial isolates. This target was achieved by screening an in-house culture collection consists of 300 bacterial isolates for silver nanoparticle formation. Through screening process, it was observed that strains belonging to Escherichia coli (S30, S78), Bacillus megaterium (S52), Acinetobacter sp. (S7) and Stenotrophomonas maltophilia (S54) were potential candidates for synthesis of silver nanoparticles. The extracellular production of silver nanoparticles by positive isolates was investigated by UV-Vis spectroscopy, X-ray diffraction (XRD), transmission electron microscope (TEM), scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). The results demonstrated that UV-visible spectrum of the aqueous medium containing silver ion showed a peak at 420 nm corresponding to the plasmon absorbance of silver nanoparticles. Scanning electron microscopy micrograph showed formation of silver nanoparticles in the range of 15-50 nm. XRD-spectrum of the silver nanoparticles exhibited 2{theta} values corresponding to the silver nanocrystal that produce in hexagonal and cubic crystal configurations with different plane of orientation. In addition, the signals of the silver atoms were observed by EDS-spectrum analysis that confirms the presence of silver nanoparticles (Ag

  11. Inforna 2.0: A Platform for the Sequence-Based Design of Small Molecules Targeting Structured RNAs.

    PubMed

    Disney, Matthew D; Winkelsas, Audrey M; Velagapudi, Sai Pradeep; Southern, Mark; Fallahi, Mohammad; Childs-Disney, Jessica L

    2016-06-17

    The development of small molecules that target RNA is challenging yet, if successful, could advance the development of chemical probes to study RNA function or precision therapeutics to treat RNA-mediated disease. Previously, we described Inforna, an approach that can mine motifs (secondary structures) within target RNAs, which is deduced from the RNA sequence, and compare them to a database of known RNA motif-small molecule binding partners. Output generated by Inforna includes the motif found in both the database and the desired RNA target, lead small molecules for that target, and other related meta-data. Lead small molecules can then be tested for binding and affecting cellular (dys)function. Herein, we describe Inforna 2.0, which incorporates all known RNA motif-small molecule binding partners reported in the scientific literature, a chemical similarity searching feature, and an improved user interface and is freely available via an online web server. By incorporation of interactions identified by other laboratories, the database has been doubled, containing 1936 RNA motif-small molecule interactions, including 244 unique small molecules and 1331 motifs. Interestingly, chemotype analysis of the compounds that bind RNA in the database reveals features in small molecule chemotypes that are privileged for binding. Further, this updated database expanded the number of cellular RNAs to which lead compounds can be identified. PMID:27097021

  12. Structural requirements for protein-catalyzed annealing of U4 and U6 RNAs during di-snRNP assembly

    PubMed Central

    Didychuk, Allison L.; Montemayor, Eric J.; Brow, David A.; Butcher, Samuel E.

    2016-01-01

    Base-pairing of U4 and U6 snRNAs during di-snRNP assembly requires large-scale remodeling of RNA structure that is chaperoned by the U6 snRNP protein Prp24. We investigated the mechanism of U4/U6 annealing in vitro using an assay that enables visualization of ribonucleoprotein complexes and faithfully recapitulates known in vivo determinants for the process. We find that annealing, but not U6 RNA binding, is highly dependent on the electropositive character of a 20 Å-wide groove on the surface of Prp24. During annealing, we observe the formation of a stable ternary complex between U4 and U6 RNAs and Prp24, indicating that displacement of Prp24 in vivo requires additional factors. Mutations that stabilize the U6 ‘telestem’ helix increase annealing rates by up to 15-fold, suggesting that telestem formation is rate-limiting for U4/U6 pairing. The Lsm2–8 complex, which binds adjacent to the telestem at the 3′ end of U6, provides a comparable rate enhancement. Collectively, these data identify domains of the U6 snRNP that are critical for one of the first steps in assembly of the megaDalton U4/U6.U5 tri-snRNP complex, and lead to a dynamic model for U4/U6 pairing that involves a striking degree of evolved cooperativity between protein and RNA. PMID:26673715

  13. Fungal and bacterial community structure downwind of a cattle feedyard

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soils provide a complex microhabitat for harboring a diverse group of microorganisms. The interaction of soil type, crop type, agroecosystem, and land management practices may all influence agricultural bacterial communities. In a previous study, we documented the long-term environmental impacts of ...

  14. Multiple G-quartet structures in pre-edited mRNAs suggest evolutionary driving force for RNA editing in trypanosomes.

    PubMed

    Leeder, W-Matthias; Hummel, Niklas F C; Göringer, H Ulrich

    2016-01-01

    Mitochondrial transcript maturation in African trypanosomes requires a U-nucleotide specific RNA editing reaction. In its most extreme form hundreds of U's are inserted into and deleted from primary transcripts to generate functional mRNAs. Unfortunately, both origin and biological role of the process have remained enigmatic. Here we report a so far unrecognized structural feature of pre-edited mRNAs. We demonstrate that the cryptic pre-mRNAs contain numerous clustered G-nt, which fold into G-quadruplex (GQ) structures. We identified 27 GQ's in the different pre-mRNAs and demonstrate a positive correlation between the steady state abundance of guide (g)RNAs and the sequence position of GQ-elements. We postulate that the driving force for selecting G-rich sequences lies in the formation of DNA/RNA hybrid G-quadruplex (HQ) structures between the pre-edited transcripts and the non-template strands of mitochondrial DNA. HQ's are transcription termination/replication initiation sites and thus guarantee an unperturbed replication of the mt-genome. This is of special importance in the insect-stage of the parasite. In the transcription-on state, the identified GQ's require editing as a GQ-resolving activity indicating a link between replication, transcription and RNA editing. We propose that the different processes have coevolved and suggest the parasite life-cycle and the single mitochondrion as evolutionary driving forces. PMID:27436151

  15. Multiple G-quartet structures in pre-edited mRNAs suggest evolutionary driving force for RNA editing in trypanosomes

    PubMed Central

    Leeder, W.-Matthias; Hummel, Niklas F. C.; Göringer, H. Ulrich

    2016-01-01

    Mitochondrial transcript maturation in African trypanosomes requires a U-nucleotide specific RNA editing reaction. In its most extreme form hundreds of U’s are inserted into and deleted from primary transcripts to generate functional mRNAs. Unfortunately, both origin and biological role of the process have remained enigmatic. Here we report a so far unrecognized structural feature of pre-edited mRNAs. We demonstrate that the cryptic pre-mRNAs contain numerous clustered G-nt, which fold into G-quadruplex (GQ) structures. We identified 27 GQ’s in the different pre-mRNAs and demonstrate a positive correlation between the steady state abundance of guide (g)RNAs and the sequence position of GQ-elements. We postulate that the driving force for selecting G-rich sequences lies in the formation of DNA/RNA hybrid G-quadruplex (HQ) structures between the pre-edited transcripts and the non-template strands of mitochondrial DNA. HQ’s are transcription termination/replication initiation sites and thus guarantee an unperturbed replication of the mt-genome. This is of special importance in the insect-stage of the parasite. In the transcription-on state, the identified GQ’s require editing as a GQ-resolving activity indicating a link between replication, transcription and RNA editing. We propose that the different processes have coevolved and suggest the parasite life-cycle and the single mitochondrion as evolutionary driving forces. PMID:27436151

  16. Regulatory RNAs in Bacteria

    PubMed Central

    Waters, Lauren S.; Storz, Gisela

    2011-01-01

    RNA regulators in bacteria are a heterogenous group of molecules that act by various mechanisms to modulate a wide range of physiological responses. One class comprises riboswitches, which are parts of the mRNAs they regulate. These leader sequences fold into structures amenable to conformational changes upon the binding of small molecules. Riboswitches thus sense and respond to the availability of various nutrients in the cell. Other small transcripts bind to proteins, among them global regulators, and antagonize their functions. The largest and most extensively studied set of small RNA regulators act through base pairing with RNAs, usually modulating the translation and stability of mRNAs. The majority of these small RNAs regulate responses to changes in environmental conditions. Finally, a recently discovered group of RNA regulators, known as the CRISPR RNAs, contain short regions of homology to bacteriophage and plasmid sequences. CRISPR RNAs interfere with bacteriophage infection and plasmid conjugation by targeting the homologous foreign DNA through an unknown mechanism. Here we discuss what is known about these RNA regulators, as well as the many intriguing questions that remain to be addressed. PMID:19239884

  17. Bacterial population structure of the jute-retting environment.

    PubMed

    Munshi, Tulika K; Chattoo, Bharat B

    2008-08-01

    Jute is one of the most versatile bast fibers obtained through the process of retting, which is a result of decomposition of stalks by the indigenous microflora. However, bacterial communities associated with the retting of jute are not well characterized. To investigate the presence of microorganisms during the process of jute retting, full-cycle rRNA approach was followed, and two 16S rRNA gene libraries, from jute-retting locations of Krishnanagar and Barrackpore, were constructed. Phylotypes affiliating to seven bacterial divisions were identified in both libraries. The bulk of clones came from Proteobacteria ( approximately 37, 41%) and a comparatively smaller proportion of clones from the divisions-Firmicutes ( approximately 11, 12%), Cytophaga-Flexibacter-Bacteroidetes group (CFB; approximately 9, 7%), Verrucomicrobia ( approximately 6, 5%), Acidobacteria ( approximately 4, 5%), Chlorobiales ( approximately 5, 5%), and Actinobacteria ( approximately 4, 2%) were identified. Percent coverage value and diversity estimations of phylotype richness, Shannon-Weiner index, and evenness confirmed the diverse nature of both the libraries. Evaluation of the retting waters by whole cell rRNA-targeted flourescent in situ hybridization, as detected by domain- and group-specific probes, we observed a considerable dominance of the beta-Proteobacteria (25.9%) along with the CFB group (24.4%). In addition, 32 bacterial species were isolated on culture media from the two retting environments and identified by 16S rDNA analysis, confirming the presence of phyla, Proteobacteria ( approximately 47%), Firmicutes ( approximately 22%), CFB group ( approximately 19%), and Actinobacteria ( approximately 13%) in the retting niche. Thus, our study presents the first quantification of the dominant and diverse bacterial phylotypes in the retting ponds, which will further help in improving the retting efficiency, and hence the fiber quality. PMID:18097714

  18. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  19. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  20. Supraglacial bacterial community structures vary across the Greenland ice sheet.

    PubMed

    Cameron, Karen A; Stibal, Marek; Zarsky, Jakub D; Gözdereliler, Erkin; Schostag, Morten; Jacobsen, Carsten S

    2016-02-01

    The composition and spatial variability of microbial communities that reside within the extensive (>200 000 km(2)) biologically active area encompassing the Greenland ice sheet (GrIS) is hypothesized to be variable. We examined bacterial communities from cryoconite debris and surface ice across the GrIS, using sequence analysis and quantitative PCR of 16S rRNA genes from co-extracted DNA and RNA. Communities were found to differ across the ice sheet, with 82.8% of the total calculated variation attributed to spatial distribution on a scale of tens of kilometers separation. Amplicons related to Sphingobacteriaceae, Pseudanabaenaceae and WPS-2 accounted for the greatest portion of calculated dissimilarities. The bacterial communities of ice and cryoconite were moderately similar (global R = 0.360, P = 0.002) and the sampled surface type (ice versus cryoconite) did not contribute heavily towards community dissimilarities (2.3% of total variability calculated). The majority of dissimilarities found between cryoconite 16S rRNA gene amplicons from DNA and RNA was calculated to be the result of changes in three taxa, Pseudanabaenaceae, Sphingobacteriaceae and WPS-2, which together contributed towards 80.8 ± 12.6% of dissimilarities between samples. Bacterial communities across the GrIS are spatially variable active communities that are likely influenced by localized biological inputs and physicochemical conditions. PMID:26691594

  1. Characterization of two small RNAs of Pseudomonas syringae DC3000

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Small RNAs (sRNAs) are important components of many regulatory pathways and have been shown to have key roles in regulation of factors important for virulence. To date, only a few sRNAs have been described for the bacterial plant pathogen Pseudomonas syringae. One approach to identify novel candid...

  2. Structural Aspects of Bacterial Outer Membrane Protein Assembly.

    PubMed

    Calmettes, Charles; Judd, Andrew; Moraes, Trevor F

    2015-01-01

    The outer membrane of Gram-negative bacteria is predominantly populated by β-Barrel proteins and lipid anchored proteins that serve a variety of biological functions. The proper folding and assembly of these proteins is essential for bacterial viability and often plays a critical role in virulence and pathogenesis. The β-barrel assembly machinery (Bam) complex is responsible for the proper assembly of β-barrels into the outer membrane of Gram-negative bacteria, whereas the localization of lipoproteins (Lol) system is required for proper targeting of lipoproteins to the outer membrane. PMID:26621472

  3. Structural basis for m7G recognition and 2′-O-methyl discrimination in capped RNAs by the innate immune receptor RIG-I

    PubMed Central

    Devarkar, Swapnil C.; Wang, Chen; Miller, Matthew T.; Ramanathan, Anand; Jiang, Fuguo; Khan, Abdul G.; Patel, Smita S.; Marcotrigiano, Joseph

    2016-01-01

    RNAs with 5′-triphosphate (ppp) are detected in the cytoplasm principally by the innate immune receptor Retinoic Acid Inducible Gene-I (RIG-I), whose activation triggers a Type I IFN response. It is thought that self RNAs like mRNAs are not recognized by RIG-I because 5′ppp is capped by the addition of a 7-methyl guanosine (m7G) (Cap-0) and a 2′-O-methyl (2′-OMe) group to the 5′-end nucleotide ribose (Cap-1). Here we provide structural and mechanistic basis for exact roles of capping and 2′-O-methylation in evading RIG-I recognition. Surprisingly, Cap-0 and 5′ppp double-stranded (ds) RNAs bind to RIG-I with nearly identical Kd values and activate RIG-I’s ATPase and cellular signaling response to similar extents. On the other hand, Cap-0 and 5′ppp single-stranded RNAs did not bind RIG-I and are signaling inactive. Three crystal structures of RIG-I complexes with dsRNAs bearing 5′OH, 5′ppp, and Cap-0 show that RIG-I can accommodate the m7G cap in a cavity created through conformational changes in the helicase-motif IVa without perturbing the ppp interactions. In contrast, Cap-1 modifications abrogate RIG-I signaling through a mechanism involving the H830 residue, which we show is crucial for discriminating between Cap-0 and Cap-1 RNAs. Furthermore, m7G capping works synergistically with 2′-O-methylation to weaken RNA affinity by 200-fold and lower ATPase activity. Interestingly, a single H830A mutation restores both high-affinity binding and signaling activity with 2′-O-methylated dsRNAs. Our work provides new structural insights into the mechanisms of host and viral immune evasion from RIG-I, explaining the complexity of cap structures over evolution. PMID:26733676

  4. Statistical analysis of the Bacterial Carbohydrate Structure Data Base (BCSDB): Characteristics and diversity of bacterial carbohydrates in comparison with mammalian glycans

    PubMed Central

    Herget, Stephan; Toukach, Philip V; Ranzinger, René; Hull, William E; Knirel, Yuriy A; von der Lieth, Claus-Wilhelm

    2008-01-01

    Background There are considerable differences between bacterial and mammalian glycans. In contrast to most eukaryotic carbohydrates, bacterial glycans are often composed of repeating units with diverse functions ranging from structural reinforcement to adhesion, colonization and camouflage. Since bacterial glycans are typically displayed at the cell surface, they can interact with the environment and, therefore, have significant biomedical importance. Results The sequence characteristics of glycans (monosaccharide composition, modifications, and linkage patterns) for the higher bacterial taxonomic classes have been examined and compared with the data for mammals, with both similarities and unique features becoming evident. Compared to mammalian glycans, the bacterial glycans deposited in the current databases have a more than ten-fold greater diversity at the monosaccharide level, and the disaccharide pattern space is approximately nine times larger. Specific bacterial subclasses exhibit characteristic glycans which can be distinguished on the basis of distinctive structural features or sequence properties. Conclusion For the first time a systematic database analysis of the bacterial glycome has been performed. This study summarizes the current knowledge of bacterial glycan architecture and diversity and reveals putative targets for the rational design and development of therapeutic intervention strategies by comparing bacterial and mammalian glycans. PMID:18694500

  5. The structure and functions of bacterial communities in an agrocenosis

    NASA Astrophysics Data System (ADS)

    Dobrovol'skaya, T. G.; Khusnetdinova, K. A.; Manucharova, N. A.; Balabko, P. N.

    2016-01-01

    The most significant factor responsible for the specific taxonomic composition of the bacterial communities in the agrocenosis studied was found to be a part or organ of plants (leaves, flowers, roots, fruits). A stage of plant ontogeny also determines changes of taxa. In the course of the plant growth, eccrisotrophic bacteria are replaced by hydrolytic ones that belong to the group of cellulose-decomposing bacteria. Representatives of the proteobacteria genera that are difficult to identify by phenotypic methods were determined using molecular-biological methods. They were revealed only on oat leaves in the moist period. As the vetch-oat mixture was fertilized with BIOUD-1 (foliar application) in the phyllosphere of both oats and vetch, on all the plant organs, representatives of the Rhodococcus genus as dominants were isolated. This fact was related to the capability of bacteria to decompose the complex aromatic compounds that are ingredients of the fertilizers applied. Another positive effect for plants of the bacterial communities forming in agrocenoses is the presence of bacteria that are antagonists of phytopathogenic bacteria. Thus, in agrocenoses, some interrelationships promoting the growth and reproduction of plants are formed in crop plants and bacteria.

  6. Target activation by regulatory RNAs in bacteria

    PubMed Central

    Papenfort, Kai; Vanderpool, Carin K.

    2015-01-01

    Bacterial small regulatory RNAs (sRNAs) are commonly known to repress gene expression by base pairing to target mRNAs. In many cases, sRNAs base pair with and sequester mRNA ribosome-binding sites, resulting in translational repression and accelerated transcript decay. In contrast, a growing number of examples of translational activation and mRNA stabilization by sRNAs have now been documented. A given sRNA often employs a conserved region to interact with and regulate both repressed and activated targets. However, the mechanisms underlying activation differ substantially from repression. Base pairing resulting in target activation can involve sRNA interactions with the 5′ untranslated region (UTR), the coding sequence or the 3′ UTR of the target mRNAs. Frequently, the activities of protein factors such as cellular ribonucleases and the RNA chaperone Hfq are required for activation. Bacterial sRNAs, including those that function as activators, frequently control stress response pathways or virulence-associated functions required for immediate responses to changing environments. This review aims to summarize recent advances in knowledge regarding target mRNA activation by bacterial sRNAs, highlighting the molecular mechanisms and biological relevance of regulation. PMID:25934124

  7. tRNAs as Antibiotic Targets

    PubMed Central

    Chopra, Shaileja; Reader, John

    2014-01-01

    Transfer RNAs (tRNAs) are central players in the protein translation machinery and as such are prominent targets for a large number of natural and synthetic antibiotics. This review focuses on the role of tRNAs in bacterial antibiosis. We will discuss examples of antibiotics that target multiple stages in tRNA biology from tRNA biogenesis and modification, mature tRNAs, aminoacylation of tRNA as well as prevention of proper tRNA function by small molecules binding to the ribosome. Finally, the role of deacylated tRNAs in the bacterial “stringent response” mechanism that can lead to bacteria displaying antibiotic persistence phenotypes will be discussed. PMID:25547494

  8. Bacterial community structure is indicative of chemical inputs in the Upper Mississippi River

    PubMed Central

    Staley, Christopher; Gould, Trevor J.; Wang, Ping; Phillips, Jane; Cotner, James B.; Sadowsky, Michael J.

    2014-01-01

    Local and regional associations between bacterial communities and nutrient and chemical concentrations were assessed in the Upper Mississippi River in Minnesota to determine if community structure was associated with discrete types of chemical inputs associated with different land cover. Bacterial communities were characterized by Illumina sequencing of the V6 region of 16S rDNA and compared to >40 chemical and nutrient concentrations. Local bacterial community structure was shaped primarily by associations among bacterial orders. However, order abundances were correlated regionally with nutrient and chemical concentrations, and were also related to major land coverage types. Total organic carbon and total dissolved solids were among the primary abiotic factors associated with local community composition and co-varied with land cover. Escherichia coli concentration was poorly related to community composition or nutrient concentrations. Abundances of 14 bacterial orders were related to land coverage type, and seven showed significant differences in abundance (P ≤ 0.046) between forested or anthropogenically-impacted sites. This study identifies specific bacterial orders that were associated with chemicals and nutrients derived from specific land cover types and may be useful in assessing water quality. Results of this study reveal the need to investigate community dynamics at both the local and regional scales and to identify shifts in taxonomic community structure that may be useful in determining sources of pollution in the Upper Mississippi River. PMID:25339945

  9. Bacterial community structure and soil properties of a subarctic tundra soil in Council, Alaska

    PubMed Central

    Kim, Hye Min; Jung, Ji Young; Yergeau, Etienne; Hwang, Chung Yeon; Hinzman, Larry; Nam, Sungjin; Hong, Soon Gyu; Kim, Ok-Sun; Chun, Jongsik; Lee, Yoo Kyung

    2014-01-01

    The subarctic region is highly responsive and vulnerable to climate change. Understanding the structure of subarctic soil microbial communities is essential for predicting the response of the subarctic soil environment to climate change. To determine the composition of the bacterial community and its relationship with soil properties, we investigated the bacterial community structure and properties of surface soil from the moist acidic tussock tundra in Council, Alaska. We collected 70 soil samples with 25-m intervals between sampling points from 0–10 cm to 10–20 cm depths. The bacterial community was analyzed by pyrosequencing of 16S rRNA genes, and the following soil properties were analyzed: soil moisture content (MC), pH, total carbon (TC), total nitrogen (TN), and inorganic nitrogen ( and ). The community compositions of the two different depths showed that Alphaproteobacteria decreased with soil depth. Among the soil properties measured, soil pH was the most significant factor correlating with bacterial community in both upper and lower-layer soils. Bacterial community similarity based on jackknifed unweighted unifrac distance showed greater similarity across horizontal layers than through the vertical depth. This study showed that soil depth and pH were the most important soil properties determining bacterial community structure of the subarctic tundra soil in Council, Alaska. PMID:24893754

  10. Domain swapping between homologous bacterial small RNAs dissects processing and Hfq binding determinants and uncovers an aptamer for conditional RNase E cleavage

    PubMed Central

    Göpel, Yvonne; Khan, Muna Ayesha; Görke, Boris

    2016-01-01

    In E. coli, small RNA GlmZ activates the glmS mRNA by base-pairing in an Hfq dependent manner. When not required, GlmZ is bound by adaptor protein RapZ and recruited to RNase E, which cleaves GlmZ in its base-pairing sequence. Small RNA GlmY counteracts cleavage of GlmZ by sequestration of RapZ. Although both sRNAs are highly homologous, only GlmZ specifically binds Hfq and undergoes cleavage by RNase E. We used domain swapping to identify the responsible modules. Two elements, the 3′ terminal oligo(U) stretch and the base-pairing region enable GlmZ to interact with Hfq. Accordingly, Hfq inhibits cleavage of GlmZ, directing it to base-pairing. Intriguingly, the central stem loop of GlmZ is decisive for cleavage, whereas the sequence comprising the actual cleavage site is dispensable. Assisted by RapZ, RNase E cleaves any RNA fused to the 3′ end of this module. These results suggest a novel mode for RNase E recognition, in which one of the required handholds in the substrate is replaced by an RNA binding protein. This device can generate RNAs of interest in their 5′ monophosphorylated form on demand. As these species are rapidly degraded, this tool allows to regulate gene expression post-transcriptionally by modulation of RapZ levels. PMID:26531825

  11. Plant Virus-Derived Small Interfering RNAs Originate Predominantly from Highly Structured Single-Stranded Viral RNAs†

    PubMed Central

    Molnár, Attila; Csorba, Tibor; Lakatos, Lóránt; Várallyay, Éva; Lacomme, Christophe; Burgyán, József

    2005-01-01

    RNA silencing is conserved in a broad range of eukaryotes and includes the phenomena of RNA interference in animals and posttranscriptional gene silencing (PTGS) in plants. In plants, PTGS acts as an antiviral system; a successful virus infection requires suppression or evasion of the induced silencing response. Small interfering RNAs (siRNAs) accumulate in plants infected with positive-strand RNA viruses and provide specificity to this RNA-mediated defense. We present here the results of a survey of virus-specific siRNAs characterized by a sequence analysis of siRNAs from plants infected with Cymbidium ringspot tombusvirus (CymRSV). CymRSV siRNA sequences have a nonrandom distribution along the length of the viral genome, suggesting that there are hot spots for virus-derived siRNA generation. CymRSV siRNAs bound to the CymRSV p19 suppressor protein have the same asymmetry in strand polarity as the sequenced siRNAs and are imperfect double-stranded RNA duplexes. Moreover, an analysis of siRNAs derived from two other nonrelated positive-strand RNA viruses showed that they displayed the same asymmetry as CymRSV siRNAs. Finally, we show that Tobacco mosaic virus (TMV) carrying a short inverted repeat of the phytoene desaturase (PDS) gene triggered more accumulation of PDS siRNAs than the corresponding antisense PDS sequence. Taken together, these results suggest that virus-derived siRNAs originate predominantly by direct DICER cleavage of imperfect duplexes in the most folded regions of the positive strand of the viral RNA. PMID:15919934

  12. Structural dynamics of double-helical RNAs composed of CUG/CUG- and CUG/CGG-repeats.

    PubMed

    Tamjar, Jevgenia; Katorcha, Elizaveta; Popov, Alexander; Malinina, Lucy

    2012-01-01

    Human genetic trinucleotide repeat expansion diseases (TREDs) are characterized by triplet repeat expansions, most frequently found as CNG-tracts in genome. At RNA level, such expansions suggestively result in formation of double-helical hairpins that become a potential source for small RNAs involved in RNA interference (RNAi). Here, we present three crystal structures of RNA fragments composed of triplet repeats CUG and CGG/CUG, as well as two crystal structures of same triplets in a protein-bound state. We show that both 20mer pG(CUG)(6)C and 19mer pGG(CGG)(3)(CUG)(2)CC form A-RNA duplexes, in which U·U or G·U mismatches are flanked/stabilized by two consecutive Watson-Crick G·C base pairs resulting in high-stacking GpC steps in every third position of the duplex. Despite interruption of this regularity in another 19mer, p(CGG)(3)C(CUG)(3), the oligonucleotide still forms regular double-helical structure, characterized, however, by 12 bp (rather than 11 bp) per turn. Analysis of newly determined molecular structures reveals the dynamic aspects of U·U and G·U mismatching within CNG-repetitive A-RNA and in a protein-bound state, as well as identifies an additional mode of U·U pairing essential for its dynamics and sheds the light on possible role of regularity of trinucleotide repeats for double-helical RNA structure. Findings are important for understanding the structural behavior of CNG-repetitive RNA double helices implicated in TREDs. PMID:22731704

  13. Hydrologic linkages drive spatial structuring of bacterial assemblages and functioning in alpine floodplains.

    PubMed

    Freimann, Remo; Bürgmann, Helmut; Findlay, Stuart E G; Robinson, Christopher T

    2015-01-01

    Microbial community assembly and microbial functions are affected by a number of different but coupled drivers such as local habitat characteristics, dispersal rates, and species interactions. In groundwater systems, hydrological flow can introduce spatial structure and directional dependencies among these drivers. We examined the importance of hydrology in structuring bacterial communities and their function within two alpine floodplains during different hydrological states. Piezometers were installed in stream sediments and surrounding riparian zones to assess hydrological flows and also were used as incubation chambers to examine bacterial community structures and enzymatic functions along hydrological flow paths. Spatial eigenvector models in conjunction with models based on physico-chemical groundwater characteristics were used to evaluate the importance of hydrologically-driven processes influencing bacterial assemblages and their enzymatic activities. Our results suggest a strong influence (up to 40% explained variation) of hydrological connectivity on enzymatic activities. The effect of hydrology on bacterial community structure was considerably less strong, suggesting that assemblages demonstrate large functional plasticity/redundancy. Effect size varied between hydrological periods but flow-related mechanisms always had the most power in explaining both bacterial structure and functioning. Changes in hydrology should be considered in models predicting ecosystem functioning and integrated into ecosystem management strategies for floodplains. PMID:26579113

  14. Hydrologic linkages drive spatial structuring of bacterial assemblages and functioning in alpine floodplains

    PubMed Central

    Freimann, Remo; Bürgmann, Helmut; Findlay, Stuart E. G.; Robinson, Christopher T.

    2015-01-01

    Microbial community assembly and microbial functions are affected by a number of different but coupled drivers such as local habitat characteristics, dispersal rates, and species interactions. In groundwater systems, hydrological flow can introduce spatial structure and directional dependencies among these drivers. We examined the importance of hydrology in structuring bacterial communities and their function within two alpine floodplains during different hydrological states. Piezometers were installed in stream sediments and surrounding riparian zones to assess hydrological flows and also were used as incubation chambers to examine bacterial community structures and enzymatic functions along hydrological flow paths. Spatial eigenvector models in conjunction with models based on physico-chemical groundwater characteristics were used to evaluate the importance of hydrologically-driven processes influencing bacterial assemblages and their enzymatic activities. Our results suggest a strong influence (up to 40% explained variation) of hydrological connectivity on enzymatic activities. The effect of hydrology on bacterial community structure was considerably less strong, suggesting that assemblages demonstrate large functional plasticity/redundancy. Effect size varied between hydrological periods but flow-related mechanisms always had the most power in explaining both bacterial structure and functioning. Changes in hydrology should be considered in models predicting ecosystem functioning and integrated into ecosystem management strategies for floodplains. PMID:26579113

  15. Structure-based receptor MIMICS targeted against bacterial superantigen toxins

    DOEpatents

    Gupta, Goutam; Hong-Geller, Elizabeth; Shiflett, Patrick R.; Lehnert, Nancy M.

    2009-08-18

    The invention provides therapeutic compositions useful in the treatment of bacterial superantigen mediated conditions, such as Toxic Shock Syndrome. The compositions comprise genetically engineered bifunctional polypeptides containing a specific T-cell receptor binding domain and a specific MHC class II receptor binding domain, each targeting non-overlapping epitopes on a superantigen molecule against which they are designed. The anti-superantigen "receptor mimetics" or "chimeras" are rationally designed to recreate the modality of superantigen binding directly to both the TCR and the MHC-II receptor, and are capable of acting as decoys for superantigen binding, effectively out-competing the host T-cell and MHC-II receptors, the natural host receptors.

  16. Bacterial community structure and function shift across a northern boreal forest fire chronosequence

    PubMed Central

    Sun, Hui; Santalahti, Minna; Pumpanen, Jukka; Köster, Kajar; Berninger, Frank; Raffaello, Tommaso; Asiegbu, Fred O.; Heinonsalo, Jussi

    2016-01-01

    Soil microbial responses to fire are likely to change over the course of forest recovery. Investigations on long-term changes in bacterial dynamics following fire are rare. We characterized the soil bacterial communities across three different times post fire in a 2 to 152-year fire chronosequence by Illumina MiSeq sequencing, coupled with a functional gene array (GeoChip). The results showed that the bacterial diversity did not differ between the recently and older burned areas, suggesting a concomitant recovery in the bacterial diversity after fire. The differences in bacterial communities over time were mainly driven by the rare operational taxonomic units (OTUs < 0.1%). Proteobacteria (39%), Acidobacteria (34%) and Actinobacteria (17%) were the most abundant phyla across all sites. Genes involved in C and N cycling pathways were present in all sites showing high redundancy in the gene profiles. However, hierarchical cluster analysis using gene signal intensity revealed that the sites with different fire histories formed separate clusters, suggesting potential differences in maintaining essential biogeochemical soil processes. Soil temperature, pH and water contents were the most important factors in shaping the bacterial community structures and function. This study provides functional insight on the impact of fire disturbance on soil bacterial community. PMID:27573440

  17. Mineral composition and charcoal determine the bacterial community structure in artificial soils.

    PubMed

    Ding, Guo-Chun; Pronk, Geertje Johanna; Babin, Doreen; Heuer, Holger; Heister, Katja; Kögel-Knabner, Ingrid; Smalla, Kornelia

    2013-10-01

    To study the influence of the clay minerals montmorillonite (M) and illite (I), the metal oxides ferrihydrite (F) and aluminum hydroxide (A), and charcoal (C) on soil bacterial communities, seven artificial soils with identical texture provided by quartz (Q) were mixed with sterilized manure as organic carbon source before adding a microbial inoculant derived from a Cambisol. Bacterial communities established in artificial soils after 90 days of incubation were compared by DGGE analysis of bacterial and taxon-specific 16S rRNA gene amplicons. The bacterial community structure of charcoal-containing soils highly differed from the other soils at all taxonomic levels studied. Effects of montmorillonite and illite were observed for Bacteria and Betaproteobacteria, but not for Actinobacteria or Alphaproteobacteria. A weak influence of metal oxides on Betaproteobacteria was found. Barcoded pyrosequencing of 16S rRNA gene amplicons done for QM, QI, QIF, and QMC revealed a high bacterial diversity in the artificial soils. The composition of the artificial soils was different from the inoculant, and the structure of the bacterial communities established in QMC soil was most different from the other soils, suggesting that charcoal provided distinct microenvironments and biogeochemical interfaces formed. Several populations with discriminative relative abundance between artificial soils were identified. PMID:23289489

  18. Parallel changes in the taxonomical structure of bacterial communities exposed to a similar environmental disturbance

    PubMed Central

    Laplante, Karine; Derome, Nicolas

    2011-01-01

    Bacterial communities play a central role in ecosystems, by regulating biogeochemical fluxes. Therefore, understanding how multiple functional interactions between species face environmental perturbations is a major concern in conservation biology. Because bacteria can use several strategies, including horizontal gene transfers (HGT), to cope with rapidly changing environmental conditions, potential decoupling between function and taxonomy makes the use of a given species as a general bioindicator problematic. The present work is a first step to characterize the impact of a recent polymetallic gradient over the taxonomical networks of five lacustrine bacterial communities. Given that evolutionary convergence represents one of the best illustration of natural selection, we focused on a system composed of two pairs of impacted and clean lakes in order to test whether similar perturbation exerts a comparable impact on the taxonomical networks of independent bacterial communities. First, we showed that similar environmental stress drove parallel structural changes at the taxonomic level on two independent bacterial communities. Second, we showed that a long-term exposure to contaminant gradients drove significant taxonomic structure changes within three interconnected bacterial communities. Thus, this model lake system is relevant to characterize the strategies, namely acclimation and/or adaptation, of bacterial communities facing environmental perturbations, such as metal contamination. PMID:22393517

  19. Assessment of bacterial community structure in nitrifying biofilm under inorganic carbon-sufficient and -limited conditions.

    PubMed

    Bae, Hyokwan; Chung, Yun-Chul; Yang, Heejeong; Lee, Changsoo; Aryapratama, Rio; Yoo, Young J; Lee, Seockheon

    2015-01-01

    In this work, nitrification and changes in the composition of the total bacterial community under inorganic carbon (IC)-limited conditions, in a nitrifying moving bed biofilm reactor, was investigated. A culture-independent analysis of cloning and sequencing based on the 16S rRNA gene was applied to quantify the bacterial diversity and to determine bacterial taxonomic assignment. IC concentrations had significant effects on the stability of ammonia-oxidation as indicated by the reduction of the nitrogen conversion rate with high NH4(+)-N loadings. The predominance of Nitrosomonas europaea was maintained in spite of changes in the IC concentration. In contrast, heterotrophic bacterial species contributed to a high bacterial diversity, and to a dynamic shift in the bacterial community structure, under IC-limited conditions. In this study, individual functions of heterotrophic bacteria were estimated based on taxonomic information. Possible key roles of coexisting heterotrophic bacteria are the assimilation of organic compounds of extracellular polymeric substances produced by nitrifiers, and biofilm formation by providing a filamentous structure and aggregation properties. PMID:25560266

  20. Study on the Coordination Structure of Pt Sorbed on Bacterial Cells Using X-Ray Absorption Fine Structure Spectroscopy

    PubMed Central

    Tanaka, Kazuya; Watanabe, Naoko

    2015-01-01

    Biosorption has been intensively investigated as a promising technology for the recovery of precious metals from solution. However, the detailed mechanism responsible for the biosorption of Pt on a biomass is not fully understood because of a lack of spectroscopic studies. We applied X-ray absorption fine structure spectroscopy to elucidate the coordination structure of Pt sorbed on bacterial cells. We examined the sorption of Pt(II) and Pt(IV) species on bacterial cells of Bacillus subtilis and Shewanella putrefaciens in NaCl solutions. X-ray absorption near-edge structure and extended X-ray absorption fine structure (EXAFS) of Pt-sorbed bacteria suggested that Pt(IV) was reduced to Pt(II) on the cell’s surface, even in the absence of an organic material as an exogenous electron donor. EXAFS spectra demonstrated that Pt sorbed on bacterial cells has a fourfold coordination of chlorine ions, similar to PtCl42-, which indicated that sorption on the protonated amine groups of the bacterial cells. This work clearly demonstrated the coordination structure of Pt sorbed on bacterial cells. The findings of this study will contribute to the understanding of Pt biosorption on biomass, and facilitate the development of recovery methods for rare metals using biosorbent materials. PMID:25996945

  1. Intrinsic factors of Peltigera lichens influence the structure of the associated soil bacterial microbiota.

    PubMed

    Leiva, Diego; Clavero-León, Claudia; Carú, Margarita; Orlando, Julieta

    2016-11-01

    Definition of lichens has evolved from bi(tri)partite associations to multi-species symbioses, where bacteria would play essential roles. Besides, although soil bacterial communities are known to be affected by edaphic factors, when lichens grow upon them these could become less preponderant. We hypothesized that the structure of both the lichen microbiota and the microbiota in the soil underneath lichens is shaped by lichen intrinsic and extrinsic factors. In this work, intrinsic factors corresponded to mycobiont and cyanobiont identities of Peltigera lichens, metabolite diversity and phenoloxidase activity and extrinsic factors involved the site of the forest where lichens grow. Likewise, the genetic and metabolic structure of the lichen and soil bacterial communities were analyzed by fingerprinting. Among the results, metabolite diversity was inversely related to the genetic structure of bacterial communities of lichens and soils, highlighting the far-reaching effect of these substances; while phenoloxidase activity was inversely related to the metabolic structure only of the lichen bacterial microbiota, presuming a more limited effect of the products of these enzymes. Soil bacterial microbiota was different depending on the site and, strikingly, according to the cyanobiont present in the lichen over them, which could indicate an influence of the photobiont metabolism on the availability of soil nutrients. PMID:27543320

  2. Crystal structure of a bacterial phosphoglucomutase, an enzyme involved in the virulence of multiple human pathogens

    PubMed Central

    Mehra-Chaudhary, Ritcha; Mick, Jacob; Tanner, John J.; Henzl, Michael T.; Beamer, Lesa J.

    2011-01-01

    The crystal structure of the enzyme phosphoglucomutase from Salmonella typhimurium (StPGM) is reported at 1.7 Å resolution. This is the first high-resolution structural characterization of a bacterial protein from this large enzyme family, which has a central role in metabolism and is also important to bacterial virulence and infectivity. A comparison of the active site of StPGM with that of other phosphoglucomutases reveals conserved residues that are likely involved in catalysis and ligand binding for the entire enzyme family. An alternate crystal form of StPGM and normal mode analysis give insights into conformational changes of the C-terminal domain that occur upon ligand binding. A novel observation from the StPGM structure is an apparent dimer in the asymmetric unit of the crystal, mediated largely through contacts in an N-terminal helix. Analytical ultracentrifugation and small-angle X-ray scattering confirm that StPGM forms a dimer in solution. Multiple sequence alignments and phylogenetic studies show that a distinct subset of bacterial PGMs share the signature dimerization helix, while other bacterial and eukaryotic PGMs are likely monomers. These structural, biochemical, and bioinformatic studies of StPGM provide insights into the large α-d-phosphohexomutase enzyme superfamily to which it belongs, and are also relevant to the design of inhibitors specific to the bacterial PGMs. PMID:21246636

  3. Surface-structured bacterial cellulose with guided assembly-based biolithography (GAB).

    PubMed

    Bottan, Simone; Robotti, Francesco; Jayathissa, Prageeth; Hegglin, Alicia; Bahamonde, Nicolas; Heredia-Guerrero, José A; Bayer, Ilker S; Scarpellini, Alice; Merker, Hannes; Lindenblatt, Nicole; Poulikakos, Dimos; Ferrari, Aldo

    2015-01-27

    A powerful replica molding methodology to transfer on-demand functional topographies to the surface of bacterial cellulose nanofiber textures is presented. With this method, termed guided assembly-based biolithography (GAB), a surface-structured polydimethylsiloxane (PDMS) mold is introduced at the gas-liquid interface of an Acetobacter xylinum culture. Upon bacterial fermentation, the generated bacterial cellulose nanofibers are assembled in a three-dimensional network reproducing the geometric shape imposed by the mold. Additionally, GAB yields directional alignment of individual nanofibers and memory of the transferred geometrical features upon dehydration and rehydration of the substrates. Scanning electron and atomic force microscopy are used to establish the good fidelity of this facile and affordable method. Interaction of surface-structured bacterial cellulose substrates with human fibroblasts and keratinocytes illustrates the efficient control of cellular activities which are fundamental in skin wound healing and tissue regeneration. The deployment of surface-structured bacterial cellulose substrates in model animals as skin wound dressing or body implant further proves the high durability and low inflammatory response to the material over a period of 21 days, demonstrating beneficial effects of surface structure on skin regeneration. PMID:25525956

  4. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression

    PubMed Central

    Derrien, Thomas; Johnson, Rory; Bussotti, Giovanni; Tanzer, Andrea; Djebali, Sarah; Tilgner, Hagen; Guernec, Gregory; Martin, David; Merkel, Angelika; Knowles, David G.; Lagarde, Julien; Veeravalli, Lavanya; Ruan, Xiaoan; Ruan, Yijun; Lassmann, Timo; Carninci, Piero; Brown, James B.; Lipovich, Leonard; Gonzalez, Jose M.; Thomas, Mark; Davis, Carrie A.; Shiekhattar, Ramin; Gingeras, Thomas R.; Hubbard, Tim J.; Notredame, Cedric; Harrow, Jennifer; Guigó, Roderic

    2012-01-01

    The human genome contains many thousands of long noncoding RNAs (lncRNAs). While several studies have demonstrated compelling biological and disease roles for individual examples, analytical and experimental approaches to investigate these genes have been hampered by the lack of comprehensive lncRNA annotation. Here, we present and analyze the most complete human lncRNA annotation to date, produced by the GENCODE consortium within the framework of the ENCODE project and comprising 9277 manually annotated genes producing 14,880 transcripts. Our analyses indicate that lncRNAs are generated through pathways similar to that of protein-coding genes, with similar histone-modification profiles, splicing signals, and exon/intron lengths. In contrast to protein-coding genes, however, lncRNAs display a striking bias toward two-exon transcripts, they are predominantly localized in the chromatin and nucleus, and a fraction appear to be preferentially processed into small RNAs. They are under stronger selective pressure than neutrally evolving sequences—particularly in their promoter regions, which display levels of selection comparable to protein-coding genes. Importantly, about one-third seem to have arisen within the primate lineage. Comprehensive analysis of their expression in multiple human organs and brain regions shows that lncRNAs are generally lower expressed than protein-coding genes, and display more tissue-specific expression patterns, with a large fraction of tissue-specific lncRNAs expressed in the brain. Expression correlation analysis indicates that lncRNAs show particularly striking positive correlation with the expression of antisense coding genes. This GENCODE annotation represents a valuable resource for future studies of lncRNAs. PMID:22955988

  5. Structure and catalytic mechanism of the evolutionarily unique bacterial chalcone isomerase.

    PubMed

    Thomsen, Maren; Tuukkanen, Anne; Dickerhoff, Jonathan; Palm, Gottfried J; Kratzat, Hanna; Svergun, Dmitri I; Weisz, Klaus; Bornscheuer, Uwe T; Hinrichs, Winfried

    2015-04-01

    Flavonoids represent a large class of secondary metabolites produced by plants. These polyphenolic compounds are well known for their antioxidative abilities, are antimicrobial phytoalexins responsible for flower pigmentation to attract pollinators and, in addition to other properties, are also specific bacterial regulators governing the expression of Rhizobium genes involved in root nodulation (Firmin et al., 1986). The bacterial chalcone isomerase (CHI) from Eubacterium ramulus catalyses the first step in a flavanone-degradation pathway by ring opening of (2S)-naringenin to form naringenin chalcone. The structural biology and enzymology of plant CHIs have been well documented, whereas the existence of bacterial CHIs has only recently been elucidated. This first determination of the structure of a bacterial CHI provides detailed structural insights into the key step of the flavonoid-degradation pathway. The active site could be confirmed by co-crystallization with the substrate (2S)-naringenin. The stereochemistry of the proposed mechanism of the isomerase reaction was verified by specific (1)H/(2)H isotope exchange observed by (1)H NMR experiments and was further supported by mutagenesis studies. The active site is shielded by a flexible lid, the varying structure of which could be modelled in different states of the catalytic cycle using small-angle X-ray scattering data together with the crystallographic structures. Comparison of bacterial CHI with the plant enzyme from Medicago sativa reveals that they have unrelated folds, suggesting that the enzyme activity evolved convergently from different ancestor proteins. Despite the lack of any functional relationship, the tertiary structure of the bacterial CHI shows similarities to the ferredoxin-like fold of a chlorite dismutase and the stress-related protein SP1. PMID:25849401

  6. Using Structural and Evolutionary Information to Detect and Correct Pyrosequencing Errors in Noncoding RNAs

    PubMed Central

    Reinharz, Vladimir

    2013-01-01

    Abstract The analysis of the sequence–structure relationship in RNA molecules is not only essential for evolutionary studies but also for concrete applications such as error-correction in next generation sequencing (NGS) technologies. The prohibitive sizes of the mutational and conformational landscapes, combined with the volume of data to process, require efficient algorithms to compute sequence–structure properties. In this article, we address the correction of NGS errors by calculating which mutations most increase the likelihood of a sequence to a given structure and RNA family. We introduce RNApyro, an efficient, linear time and space inside–outside algorithm that computes exact mutational probabilities under secondary structure and evolutionary constraints given as a multiple sequence alignment with a consensus structure. We develop a scoring scheme combining classical stacking base-pair energies to novel isostericity scores and apply our techniques to correct pointwise errors in 5s and 16s rRNA sequences. Our results suggest that RNApyro is a promising algorithm to complement existing tools in the NGS error-correction pipeline. PMID:24134390

  7. Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

    SciTech Connect

    Jansson, Janet; Edlund, Anna; Hardeman, Fredrik; Jansson, Janet K.; Sjoling, Sara

    2008-05-15

    Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities were most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.

  8. Exploring bacterial community structure and function associated with atrazine biodegradation in repeatedly treated soils.

    PubMed

    Fang, Hua; Lian, Jianjun; Wang, Huifang; Cai, Lin; Yu, Yunlong

    2015-04-01

    Substantial application of the herbicide atrazine in agriculture leads to persistent contamination, which may damage the succeeding crops and pose potential threats to soil ecology and environmental health. Here, the degradation characteristics of atrazine and dynamic change of soil bacterial community structure and function as well as their relations were studied during three repeated treatments at the recommended, double, and five-fold doses. The results showed that the degradation half-life of atrazine obviously decreased with increased treatment frequency. Soil microbial functional diversity displayed a variation trend of suppression-recovery-stimulation, which was associated with increased degradation rate of atrazine. 16S amplicon sequencing was conducted to explore bacterial community structure and correlate the genus to potential atrazine degradation. A total of seven potentially atrazine-degrading bacterial genera were found including Nocardioides, Arthrobacter, Bradyrhizobium, Burkholderia, Methylobacterium, Mycobacterium, and Clostridium. These bacterial genera showed almost complete atrazine degradation pathways including dechlorination, dealkylation, hydroxylation, and ring cleavage. Furthermore, the relative abundance of four of them (i.e., Nocardioides, Arthrobacter, Methylobacterium, and Bradyrhizobium) increased with treatment frequency and atrazine concentration, suggesting that they may participate in atrazine degradation during repeated treatments. Our findings reveal the potential relationship between atrazine degradation and soil bacterial community structure in repeatedly treated soils. PMID:25603295

  9. Spatial and Vertical Variability in Bacterial Community Structure in the Sediment of the South China Sea

    NASA Astrophysics Data System (ADS)

    Wang, P.; Xie, W.; Chen, S.; Zhang, C. L.

    2014-12-01

    The ocean subsurface contains one of the largest pools of reactive carbon and nitrogen on earth, and thus serves as the largest realm for microbial life. However, the microbial communities that drive deep-subsurface geochemical processes are vastly unexplored. In this study, the bacterial community structure in the subsurface of the South China Sea were examined using sediment cores collected from shelf (water depth 667 m) to slope (water depth 3840 m). High-throughput sequencing of the bacterial 16S rRNA genes from the sediment samples resulted in a total of 270,000 sequences with each sample averaging about 10,000 sequences. In all sediment cores, the 16S rRNA gene copies of bacteria were highest in the surface sediment and decreased with the core depth. The bacterial community was dominated by Proteobacteria, Bacteroidetes, Actinobacteria, and Firmicutes. In most of the sediment cores, Proteobacteria dominated surface sediment samples and decreased with depth. The community structure showed no significant difference among the stations at different water depths, which indicates that bacterial distribution in the sediment is not influenced by the water column above. However, stations along the transect from Pearl River canyon to the deep basin were grouped together by cluster analysis, which indicates that bacterial community structure at these stations may bear the same consequence of sedimentary processes of the deep South China Sea.

  10. Interaction of RNase P from Escherichia coli with pseudoknotted structures in viral RNAs.

    PubMed Central

    Mans, R M; Guerrier-Takada, C; Altman, S; Pleij, C W

    1990-01-01

    In a previous study it was shown that RNase P from E. coli cleaves the tRNA-like structure of turnip yellow mosaic virus (TYMV) RNA in vitro (Guerrier-Takada et al. (1988) Cell, 53, 267-272). Cleavage takes place at the 3' side of the loop that crosses the deep groove of the pseudoknot structure present in the aminoacyl acceptor domain. In the present study fragments of TYMV RNA with mutations in the pseudoknot, generated by transcription in vitro, were tested for susceptibility to cleavage by RNase P. Changes in the specificity with respect to the site of cleavage and decreases in the rate of cleavage were observed with most of these substrates. The behaviour of various mutants in the reaction catalyzed by RNase P is in agreement with the present model of the TYMV RNA pseudoknot (Dumas et al. (1987), J. Biomol. Struct. Dyn. 263, 652-657). Base substitutions in the loop that crosses the shallow groove of the pseudoknot structure resulted, however, in an unexpected decrease in the rate of cleavage, probably due to conformational changes in the substrates. Studies on other tRNA-like structures revealed an important role in the reaction with RNase P for both the nucleotide at the 3' side of the loop that spans the deep groove and the nucleotide at position 4, which correspond to positions--1 and 73, respectively, in tRNA precursors. Images PMID:2194161

  11. Structures of Arg- and Gln-type bacterial cysteine dioxygenase homologs: Arg- and Gln-type Bacterial CDO Homologs

    DOE PAGESBeta

    Driggers, Camden M.; Hartman, Steven J.; Karplus, P. Andrew

    2015-01-01

    In some bacteria, cysteine is converted to cysteine sulfinic acid by cysteine dioxygenases (CDO) that are only ~15–30% identical in sequence to mammalian CDOs. Among bacterial proteins having this range of sequence similarity to mammalian CDO are some that conserve an active site Arg residue (“Arg-type” enzymes) and some having a Gln substituted for this Arg (“Gln-type” enzymes). Here, we describe a structure from each of these enzyme types by analyzing structures originally solved by structural genomics groups but not published: a Bacillus subtilis “Arg-type” enzyme that has cysteine dioxygenase activity (BsCDO), and a Ralstonia eutropha “Gln-type” CDO homolog ofmore » uncharacterized activity (ReCDOhom). The BsCDO active site is well conserved with mammalian CDO, and a cysteine complex captured in the active site confirms that the cysteine binding mode is also similar. The ReCDOhom structure reveals a new active site Arg residue that is hydrogen bonding to an iron-bound diatomic molecule we have interpreted as dioxygen. Notably, the Arg position is not compatible with the mode of Cys binding seen in both rat CDO and BsCDO. As sequence alignments show that this newly discovered active site Arg is well conserved among “Gln-type” CDO enzymes, we conclude that the “Gln-type” CDO homologs are not authentic CDOs but will have substrate specificity more similar to 3-mercaptopropionate dioxygenases.« less

  12. Structures of Arg- and Gln-type bacterial cysteine dioxygenase homologs: Arg- and Gln-type Bacterial CDO Homologs

    SciTech Connect

    Driggers, Camden M.; Hartman, Steven J.; Karplus, P. Andrew

    2015-01-01

    In some bacteria, cysteine is converted to cysteine sulfinic acid by cysteine dioxygenases (CDO) that are only ~15–30% identical in sequence to mammalian CDOs. Among bacterial proteins having this range of sequence similarity to mammalian CDO are some that conserve an active site Arg residue (“Arg-type” enzymes) and some having a Gln substituted for this Arg (“Gln-type” enzymes). Here, we describe a structure from each of these enzyme types by analyzing structures originally solved by structural genomics groups but not published: a Bacillus subtilis “Arg-type” enzyme that has cysteine dioxygenase activity (BsCDO), and a Ralstonia eutropha “Gln-type” CDO homolog of uncharacterized activity (ReCDOhom). The BsCDO active site is well conserved with mammalian CDO, and a cysteine complex captured in the active site confirms that the cysteine binding mode is also similar. The ReCDOhom structure reveals a new active site Arg residue that is hydrogen bonding to an iron-bound diatomic molecule we have interpreted as dioxygen. Notably, the Arg position is not compatible with the mode of Cys binding seen in both rat CDO and BsCDO. As sequence alignments show that this newly discovered active site Arg is well conserved among “Gln-type” CDO enzymes, we conclude that the “Gln-type” CDO homologs are not authentic CDOs but will have substrate specificity more similar to 3-mercaptopropionate dioxygenases.

  13. Understanding Sodium Channel Function and Modulation Using Atomistic Simulations of Bacterial Channel Structures.

    PubMed

    Boiteux, C; Allen, T W

    2016-01-01

    Sodium channels are chief proteins involved in electrical signaling in the nervous system, enabling critical functions like heartbeat and brain activity. New high-resolution X-ray structures for bacterial sodium channels have created an opportunity to see how these proteins operate at the molecular level. An important challenge to overcome is establishing relationships between the structures and functions of mammalian and bacterial channels. Bacterial sodium channels are known to exhibit the main structural features of their mammalian counterparts, as well as several key functional characteristics, including selective ion conduction, voltage-dependent gating, pore-based inactivation and modulation by local anesthetic, antiarrhythmic and antiepileptic drugs. Simulations have begun to shed light on each of these features in the past few years. Despite deviations in selectivity signatures for bacterial and mammalian channels, simulations have uncovered the nature of the multiion conduction mechanism associated with Na(+) binding to a high-field strength site established by charged glutamate side chains. Simulations demonstrated a surprising level of flexibility of the protein, showing that these side chains are active participants in the permeation process. They have also uncovered changes in protein structure, leading to asymmetrical collapses of the activation gate that have been proposed to correspond to inactivated structures. These observations offer the potential to examine the mechanisms of state-dependent drug activity, focusing on pore-blocking and pore-based slow inactivation in bacterial channels, without the complexities of inactivation on multiple timescales seen in eukaryotic channels. Simulations have provided molecular views of the interactions of drugs, consistent with sites predicted in mammalian channels, as well as a wealth of other sites as potential new drug targets. In this chapter, we survey the new insights into sodium channel function that

  14. Multiple oligomeric structures of a bacterial small heat shock protein

    PubMed Central

    Mani, Nandini; Bhandari, Spraha; Moreno, Rodolfo; Hu, Liya; Prasad, B. V. Venkataram; Suguna, Kaza

    2016-01-01

    Small heat shock proteins are ubiquitous molecular chaperones that form the first line of defence against the detrimental effects of cellular stress. Under conditions of stress they undergo drastic conformational rearrangements in order to bind to misfolded substrate proteins and prevent cellular protein aggregation. Owing to the dynamic nature of small heat shock protein oligomers, elucidating the structural basis of chaperone action and oligomerization still remains a challenge. In order to understand the organization of sHSP oligomers, we have determined crystal structures of a small heat shock protein from Salmonella typhimurium in a dimeric form and two higher oligomeric forms: an 18-mer and a 24-mer. Though the core dimer structure is conserved in all the forms, structural heterogeneity arises due to variation in the terminal regions. PMID:27053150

  15. Characterisation of the bacterial community structures in the intestine of Lampetra morii.

    PubMed

    Li, Yingying; Xie, Wenfang; Li, Qingwei

    2016-07-01

    The metagenomic analysis and 16S rDNA sequencing method were used to investigate the bacterial community in the intestines of Lampetra morii. The bacterial community structure in L. morii intestine was relatively simple. Eight different operational taxonomic units were observed. Chitinophagaceae_unclassified (26.5 %) and Aeromonas spp. (69.6 %) were detected as dominant members at the genus level. The non-dominant genera were as follows: Acinetobacter spp. (1.4 %), Candidatus Bacilloplasma (2.5 %), Enterobacteria spp. (1.5 %), Shewanella spp. (0.04 %), Vibrio spp. (0.09 %), and Yersinia spp. (1.8 %). The Shannon-Wiener (H) and Simpson (1-D) indexes were 0.782339 and 0.5546, respectively. The rarefaction curve representing the bacterial community richness and Shannon-Wiener curve representing the bacterial community diversity reached asymptote, which indicated that the sequence depth were sufficient to represent the majority of species richness and bacterial community diversity. The number of Aeromonas in lamprey intestine was two times higher after stimulation by lipopolysaccharide than PBS. This study provides data for understanding the bacterial community harboured in lamprey intestines and exploring potential key intestinal symbiotic bacteria essential for the L. morii immune response. PMID:27180095

  16. A Dissolved Oxygen Threshold for Shifts in Bacterial Community Structure in a Seasonally Hypoxic Estuary.

    PubMed

    Spietz, Rachel L; Williams, Cheryl M; Rocap, Gabrielle; Horner-Devine, M Claire

    2015-01-01

    Pelagic ecosystems can become depleted of dissolved oxygen as a result of both natural processes and anthropogenic effects. As dissolved oxygen concentration decreases, energy shifts from macrofauna to microorganisms, which persist in these hypoxic zones. Oxygen-limited regions are rapidly expanding globally; however, patterns of microbial communities associated with dissolved oxygen gradients are not yet well understood. To assess the effects of decreasing dissolved oxygen on bacteria, we examined shifts in bacterial community structure over space and time in Hood Canal, Washington, USA-a glacial fjord-like water body that experiences seasonal low dissolved oxygen levels known to be detrimental to fish and other marine organisms. We found a strong negative association between bacterial richness and dissolved oxygen. Bacterial community composition across all samples was also strongly associated with the dissolved oxygen gradient, and significant changes in bacterial community composition occurred at a dissolved oxygen concentration between 5.18 and 7.12 mg O2 L(-1). This threshold value of dissolved oxygen is higher than classic definitions of hypoxia (<2.0 mg O2 L(-1)), suggesting that changes in bacterial communities may precede the detrimental effects on ecologically and economically important macrofauna. Furthermore, bacterial taxa responsible for driving whole community changes across the oxygen gradient are commonly detected in other oxygen-stressed ecosystems, suggesting that the patterns we uncovered in Hood Canal may be relevant in other low oxygen ecosystems. PMID:26270047

  17. A Dissolved Oxygen Threshold for Shifts in Bacterial Community Structure in a Seasonally Hypoxic Estuary

    PubMed Central

    Spietz, Rachel L.; Williams, Cheryl M.; Rocap, Gabrielle; Horner-Devine, M. Claire

    2015-01-01

    Pelagic ecosystems can become depleted of dissolved oxygen as a result of both natural processes and anthropogenic effects. As dissolved oxygen concentration decreases, energy shifts from macrofauna to microorganisms, which persist in these hypoxic zones. Oxygen-limited regions are rapidly expanding globally; however, patterns of microbial communities associated with dissolved oxygen gradients are not yet well understood. To assess the effects of decreasing dissolved oxygen on bacteria, we examined shifts in bacterial community structure over space and time in Hood Canal, Washington, USA−a glacial fjord-like water body that experiences seasonal low dissolved oxygen levels known to be detrimental to fish and other marine organisms. We found a strong negative association between bacterial richness and dissolved oxygen. Bacterial community composition across all samples was also strongly associated with the dissolved oxygen gradient, and significant changes in bacterial community composition occurred at a dissolved oxygen concentration between 5.18 and 7.12 mg O2 L-1. This threshold value of dissolved oxygen is higher than classic definitions of hypoxia (<2.0 mg O2 L-1), suggesting that changes in bacterial communities may precede the detrimental effects on ecologically and economically important macrofauna. Furthermore, bacterial taxa responsible for driving whole community changes across the oxygen gradient are commonly detected in other oxygen-stressed ecosystems, suggesting that the patterns we uncovered in Hood Canal may be relevant in other low oxygen ecosystems. PMID:26270047

  18. The ribonuclease polynucleotide phosphorylase can interact with small regulatory RNAs in both protective and degradative modes

    PubMed Central

    Bandyra, Katarzyna J.; Sinha, Dhriti; Syrjanen, Johanna; Luisi, Ben F.; De Lay, Nicholas R.

    2016-01-01

    In all bacterial species examined thus far, small regulatory RNAs (sRNAs) contribute to intricate patterns of dynamic genetic regulation. Many of the actions of these nucleic acids are mediated by well-characterized chaperones such as the Hfq protein, but genetic screens have also recently identified the 3′-to-5′ exoribonuclease polynucleotide phosphorylase (PNPase) as an unexpected stabilizer and facilitator of sRNAs in vivo. To understand how a ribonuclease might mediate these effects, we tested the interactions of PNPase with sRNAs and found that the enzyme can readily degrade these nucleic acids in vitro but, nonetheless, copurifies from cell extracts with the same sRNAs without discernible degradation or modification to their 3′ ends, suggesting that the associated RNA is protected against the destructive activity of the ribonuclease. In vitro, PNPase, Hfq, and sRNA can form a ternary complex in which the ribonuclease plays a nondestructive, structural role. Such ternary complexes might be formed transiently in vivo, but could help to stabilize particular sRNAs and remodel their population on Hfq. Taken together, our results indicate that PNPase can be programmed to act on RNA in either destructive or stabilizing modes in vivo and may form complex, protective ribonucleoprotein assemblies that shape the landscape of sRNAs available for action. PMID:26759452

  19. Group-specific structural features of the 5'-proximal sequences of coronavirus genomic RNAs.

    PubMed

    Chen, Shih-Cheng; Olsthoorn, René C L

    2010-05-25

    Global predictions of the secondary structure of coronavirus (CoV) 5' untranslated regions and adjacent coding sequences revealed the presence of conserved structural elements. Stem loops (SL) 1, 2, 4, and 5 were predicted in all CoVs, while the core leader transcription-regulating sequence (L-TRS) forms SL3 in only some CoVs. SL5 in group I and II CoVs, with the exception of group IIa CoVs, is characterized by the presence of a large sequence insertion capable of forming hairpins with the conserved 5'-UUYCGU-3' loop sequence. Structure probing confirmed the existence of these hairpins in the group I Human coronavirus-229E and the group II Severe acute respiratory syndrome coronavirus (SARS-CoV). In general, the pattern of the 5' cis-acting elements is highly related to the lineage of CoVs, including features of the conserved hairpins in SL5. The function of these conserved hairpins as a putative packaging signal is discussed. PMID:20202661

  20. Bacterial structures and ecosystem functions in glaciated floodplains: contemporary states and potential future shifts.

    PubMed

    Freimann, Remo; Bürgmann, Helmut; Findlay, Stuart E G; Robinson, Christopher T

    2013-12-01

    Glaciated alpine floodplains are responding quickly to climate change through shrinking ice masses. Given the expected future changes in their physicochemical environment, we anticipated variable shifts in structure and ecosystem functioning of hyporheic microbial communities in proglacial alpine streams, depending on present community characteristics and landscape structures. We examined microbial structure and functioning during different hydrologic periods in glacial (kryal) streams and, as contrasting systems, groundwater-fed (krenal) streams. Three catchments were chosen to cover an array of landscape features, including interconnected lakes, differences in local geology and degree of deglaciation. Community structure was assessed by automated ribosomal intergenic spacer analysis and microbial function by potential enzyme activities. We found each catchment to contain a distinct bacterial community structure and different degrees of separation in structure and functioning that were linked to the physicochemical properties of the waters within each catchment. Bacterial communities showed high functional plasticity, although achieved by different strategies in each system. Typical kryal communities showed a strong linkage of structure and function that indicated a major prevalence of specialists, whereas krenal sediments were dominated by generalists. With the rapid retreat of glaciers and therefore altered ecohydrological characteristics, lotic microbial structure and functioning are likely to change substantially in proglacial floodplains in the future. The trajectory of these changes will vary depending on contemporary bacterial community characteristics and landscape structures that ultimately determine the sustainability of ecosystem functioning. PMID:23842653

  1. Bacterial structures and ecosystem functions in glaciated floodplains: contemporary states and potential future shifts

    PubMed Central

    Freimann, Remo; Bürgmann, Helmut; Findlay, Stuart EG; Robinson, Christopher T

    2013-01-01

    Glaciated alpine floodplains are responding quickly to climate change through shrinking ice masses. Given the expected future changes in their physicochemical environment, we anticipated variable shifts in structure and ecosystem functioning of hyporheic microbial communities in proglacial alpine streams, depending on present community characteristics and landscape structures. We examined microbial structure and functioning during different hydrologic periods in glacial (kryal) streams and, as contrasting systems, groundwater-fed (krenal) streams. Three catchments were chosen to cover an array of landscape features, including interconnected lakes, differences in local geology and degree of deglaciation. Community structure was assessed by automated ribosomal intergenic spacer analysis and microbial function by potential enzyme activities. We found each catchment to contain a distinct bacterial community structure and different degrees of separation in structure and functioning that were linked to the physicochemical properties of the waters within each catchment. Bacterial communities showed high functional plasticity, although achieved by different strategies in each system. Typical kryal communities showed a strong linkage of structure and function that indicated a major prevalence of specialists, whereas krenal sediments were dominated by generalists. With the rapid retreat of glaciers and therefore altered ecohydrological characteristics, lotic microbial structure and functioning are likely to change substantially in proglacial floodplains in the future. The trajectory of these changes will vary depending on contemporary bacterial community characteristics and landscape structures that ultimately determine the sustainability of ecosystem functioning. PMID:23842653

  2. Hfq binding changes the structure of Escherichia coli small noncoding RNAs OxyS and RprA, which are involved in the riboregulation of rpoS.

    PubMed

    Henderson, Charlotte A; Vincent, Helen A; Casamento, Alessandra; Stone, Carlanne M; Phillips, Jack O; Cary, Peter D; Sobott, Frank; Gowers, Darren M; Taylor, James E; Callaghan, Anastasia J

    2013-08-01

    OxyS and RprA are two small noncoding RNAs (sRNAs) that modulate the expression of rpoS, encoding an alternative sigma factor that activates transcription of multiple Escherichia coli stress-response genes. While RprA activates rpoS for translation, OxyS down-regulates the transcript. Crucially, the RNA binding protein Hfq is required for both sRNAs to function, although the specific role played by Hfq remains unclear. We have investigated RprA and OxyS interactions with Hfq using biochemical and biophysical approaches. In particular, we have obtained the molecular envelopes of the Hfq-sRNA complexes using small-angle scattering methods, which reveal key molecular details. These data indicate that Hfq does not substantially change shape upon complex formation, whereas the sRNAs do. We link the impact of Hfq binding, and the sRNA structural changes induced, to transcript stability with respect to RNase E degradation. In light of these findings, we discuss the role of Hfq in the opposing regulatory functions played by RprA and OxyS in rpoS regulation. PMID:23804244

  3. Genetic Drift Suppresses Bacterial Conjugation in Spatially Structured Populations

    NASA Astrophysics Data System (ADS)

    Freese, Peter D.; Korolev, Kirill S.; Jiménez, José I.; Chen, Irene A.

    2014-02-01

    Conjugation is the primary mechanism of horizontal gene transfer that spreads antibiotic resistance among bacteria. Although conjugation normally occurs in surface-associated growth (e.g., biofilms), it has been traditionally studied in well-mixed liquid cultures lacking spatial structure, which is known to affect many evolutionary and ecological processes. Here we visualize spatial patterns of gene transfer mediated by F plasmid conjugation in a colony of Escherichia coli growing on solid agar, and we develop a quantitative understanding by spatial extension of traditional mass-action models. We found that spatial structure suppresses conjugation in surface-associated growth because strong genetic drift leads to spatial isolation of donor and recipient cells, restricting conjugation to rare boundaries between donor and recipient strains. These results suggest that ecological strategies, such as enforcement of spatial structure and enhancement of genetic drift, could complement molecular strategies in slowing the spread of antibiotic resistance genes.

  4. Structure of the basal components of a bacterial transporter

    SciTech Connect

    Meisner, Jeffrey; Maehigashi, Tatsuya; André, Ingemar; Dunham, Christine M.; Moran, Jr., Charles P.

    2012-12-10

    Proteins SpoIIQ and SpoIIIAH interact through two membranes to connect the forespore and the mother cell during endospore development in the bacterium Bacillus subtilis. SpoIIIAH consists of a transmembrane segment and an extracellular domain with similarity to YscJ proteins. YscJ proteins form large multimeric rings that are the structural scaffolds for the assembly of type III secretion systems in Gram-negative bacteria. The predicted ring-forming motif of SpoIIIAH and other evidence led to the model that SpoIIQ and SpoIIIAH form the core components of a channel or transporter through which the mother cell nurtures forespore development. Therefore, to understand the roles of SpoIIIAH and SpoIIQ in channel formation, it is critical to determine whether SpoIIIAH adopts a ring-forming structural motif, and whether interaction of SpoIIIAH with SpoIIQ would preclude ring formation. We report a 2.8-{angstrom} resolution structure of a complex of SpoIIQ and SpoIIIAH. SpoIIIAH folds into the ring-building structural motif, and modeling shows that the structure of the SpoIIQ-SpoIIIAH complex is compatible with forming a symmetrical oligomer that is similar to those in type III systems. The inner diameters of the two most likely ring models are large enough to accommodate several copies of other integral membrane proteins. SpoIIQ contains a LytM domain, which is found in metalloendopeptidases, but lacks residues important for metalloprotease activity. Other LytM domains appear to be involved in protein-protein interactions. We found that the LytM domain of SpoIIQ contains an accessory region that interacts with SpoIIIAH.

  5. Experimental approaches to identify small RNAs and their diverse roles in bacteria – what we have learnt in one decade of MicA research

    PubMed Central

    Van Puyvelde, Sandra; Vanderleyden, Jozef; De Keersmaecker, Sigrid C J

    2015-01-01

    Nowadays the identification of small RNAs (sRNAs) and characterization of their role within regulatory networks takes a prominent place in deciphering complex bacterial phenotypes. Compared to the study of other components of bacterial cells, this is a relatively new but fast-growing research field. Although reports on new sRNAs appear regularly, some sRNAs are already subject of research for a longer time. One of such sRNAs is MicA, a sRNA best described for its role in outer membrane remodeling, but probably having a much broader function than anticipated. An overview of what we have learnt from MicA led to the conclusion that even for this well-described sRNA, we still do not have the overall picture. More general, the story of MicA might become an experimental lead for unraveling the many sRNAs with unknown functions. In this review, three important topics in the sRNA field are covered, exemplified from the perspective of MicA: (i) identification of new sRNAs, (ii) target identification and unraveling the biological function, (iii) structural analysis. The complex mechanisms of action of MicA deliver some original insights in the sRNA field which includes the existence of dimer formation or simultaneous cis and trans regulation, and might further inspire the understanding of the function of other sRNAs. PMID:25974745

  6. Changes in bacterial community structure in a full-scale membrane bioreactor for municipal wastewater treatment.

    PubMed

    Hashimoto, Kurumi; Tsutsui, Hirofumi; Takada, Kazuki; Hamada, Hiroshi; Sakai, Kousuke; Inoue, Daisuke; Sei, Kazunari; Soda, Satoshi; Yamashita, Kyoko; Tsuji, Koji; Hashimoto, Toshikazu; Ike, Michihiko

    2016-07-01

    This study investigated changes in the structure and metabolic capabilities of the bacterial community in a full-scale membrane bioreactor (MBR) treating municipal wastewater. Microbial monitoring was also conducted for a parallel-running conventional activated sludge (CAS) process treating the same influent. The mixed-liquor suspended solid concentration in the MBR reached a steady-state on day 73 after the start-up. Then the MBR maintained higher rates of removal of organic compounds and nitrogen than the CAS process did. Terminal restriction fragment length polymorphism analysis revealed that the bacterial community structure in the MBR was similar to that in the CAS process at the start-up, but it became very different from that in the CAS process in the steady state. The bacterial community structure of the MBR continued to change dynamically even after 20 months of the steady-state operation, while that of the CAS process was maintained in a stable condition. By contrast, Biolog assay revealed that the carbon source utilization potential of the MBR resembled that of the CAS process as a whole, although it declined transiently. Overall, the results indicate that the bacterial community of the MBR has flexibility in terms of its phylogenetic structure and metabolic activity to maintain the high wastewater treatment capability. PMID:26811223

  7. Citrus huanglongbing shapes the structure of bacterial community associated with citrus roots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To examine the effect of pathogen on the diversity and structure of plant associated bacterial community, we carried out a molecular based analysis using citrus and huanglongbing as host-disease model. 16S rDNA clone library analysis of the citrus roots revealed shifts in the microbial diversity in ...

  8. Structure of a bacterial enzyme regulated by phosphorylation, isocitrate dehydrogenase.

    PubMed

    Hurley, J H; Thorsness, P E; Ramalingam, V; Helmers, N H; Koshland, D E; Stroud, R M

    1989-11-01

    The structure of isocitrate dehydrogenase [threo-DS-isocitrate: NADP+ oxidoreductase (decarboxylating), EC 1.1.1.42] from Escherichia coli has been solved and refined at 2.5 A resolution and is topologically different from that of any other dehydrogenase. This enzyme, a dimer of identical 416-residue subunits, is inactivated by phosphorylation at Ser-113, which lies at the edge of an interdomain pocket that also contains many residues conserved between isocitrate dehydrogenase and isopropylmalate dehydrogenase. Isocitrate dehydrogenase contains an unusual clasp-like domain in which both polypeptide chains in the dimer interlock. Based on the structure of isocitrate dehydrogenase and conservation with isopropylmalate dehydrogenase, we suggest that the active site lies in an interdomain pocket close to the phosphorylation site. PMID:2682654

  9. Structural insights into bacterial recognition of intestinal mucins.

    PubMed

    Etzold, Sabrina; Juge, Nathalie

    2014-10-01

    The mucosal layer covering our gut epithelium represents the first line of host defenses against the luminal content, while enabling contacts between the resident microbiota and the host. Mucus is mainly composed of mucins, large glycoproteins containing a protein core and a high number of O-linked oligosaccharides. Mucin glycans act as binding sites or carbon sources for the intestinal microbes, thereby functioning as a host-specific determinant affecting the microbiota composition and human health. Reflecting the structural diversity of mucin glycans and their prime location, commensal and pathogenic microbes have evolved a range of adhesins allowing their interaction with the host. However, despite the recognised importance of mucin glycans in modulating intestinal homeostasis, information on carbohydrate-binding proteins from gut bacteria is disparate. This review is focussed on recent structural insights into host-microbe interactions mediated by mucins. PMID:25106027

  10. Structural basis of interprotein electron transfer in bacterial sulfite oxidation

    PubMed Central

    McGrath, Aaron P; Laming, Elise L; Casas Garcia, G Patricia; Kvansakul, Marc; Guss, J Mitchell; Trewhella, Jill; Calmes, Benoit; Bernhardt, Paul V; Kappler, Ulrike; Maher, Megan J

    2015-01-01

    Interprotein electron transfer underpins the essential processes of life and relies on the formation of specific, yet transient protein-protein interactions. In biological systems, the detoxification of sulfite is catalyzed by the sulfite-oxidizing enzymes (SOEs), which interact with an electron acceptor for catalytic turnover. Here, we report the structural and functional analyses of the SOE SorT from Sinorhizobium meliloti and its cognate electron acceptor SorU. Kinetic and thermodynamic analyses of the SorT/SorU interaction show the complex is dynamic in solution, and that the proteins interact with Kd = 13.5 ± 0.8 μM. The crystal structures of the oxidized SorT and SorU, both in isolation and in complex, reveal the interface to be remarkably electrostatic, with an unusually large number of direct hydrogen bonding interactions. The assembly of the complex is accompanied by an adjustment in the structure of SorU, and conformational sampling provides a mechanism for dissociation of the SorT/SorU assembly. DOI: http://dx.doi.org/10.7554/eLife.09066.001 PMID:26687009

  11. Structural basis of interprotein electron transfer in bacterial sulfite oxidation.

    PubMed

    McGrath, Aaron P; Laming, Elise L; Casas Garcia, G Patricia; Kvansakul, Marc; Guss, J Mitchell; Trewhella, Jill; Calmes, Benoit; Bernhardt, Paul V; Hanson, Graeme R; Kappler, Ulrike; Maher, Megan J

    2015-01-01

    Interprotein electron transfer underpins the essential processes of life and relies on the formation of specific, yet transient protein-protein interactions. In biological systems, the detoxification of sulfite is catalyzed by the sulfite-oxidizing enzymes (SOEs), which interact with an electron acceptor for catalytic turnover. Here, we report the structural and functional analyses of the SOE SorT from Sinorhizobium meliloti and its cognate electron acceptor SorU. Kinetic and thermodynamic analyses of the SorT/SorU interaction show the complex is dynamic in solution, and that the proteins interact with Kd = 13.5 ± 0.8 μM. The crystal structures of the oxidized SorT and SorU, both in isolation and in complex, reveal the interface to be remarkably electrostatic, with an unusually large number of direct hydrogen bonding interactions. The assembly of the complex is accompanied by an adjustment in the structure of SorU, and conformational sampling provides a mechanism for dissociation of the SorT/SorU assembly. PMID:26687009

  12. Crystal structure of the RNA component of bacterial ribonuclease P

    SciTech Connect

    Torres-Larios, Alfredo; Swinger, Kerren K.; Krasilnikov, Andrey S.; Pan, Tao; Mondragon, Alfonso

    2010-03-08

    Transfer RNA (tRNA) is produced as a precursor molecule that needs to be processed at its 3' and 5' ends. Ribonuclease P is the sole endonuclease responsible for processing the 5' end of tRNA by cleaving the precursor and leading to tRNA maturation. It was one of the first catalytic RNA molecules identified and consists of a single RNA component in all organisms and only one protein component in bacteria. It is a true multi-turnover ribozyme and one of only two ribozymes (the other being the ribosome) that are conserved in all kingdoms of life. Here we show the crystal structure at 3.85 {angstrom} resolution of the RNA component of Thermotoga maritima ribonuclease P. The entire RNA catalytic component is revealed, as well as the arrangement of the two structural domains. The structure shows the general architecture of the RNA molecule, the inter- and intra-domain interactions, the location of the universally conserved regions, the regions involved in pre-tRNA recognition and the location of the active site. A model with bound tRNA is in agreement with all existing data and suggests the general basis for RNA-RNA recognition by this ribozyme.

  13. Structural investigations into the interaction of hemoglobin and part structures with bacterial endotoxins.

    PubMed

    Howe, Jörg; Garidel, Patrick; Roessle, Manfred; Richter, Walter; Alexander, Christian; Fournier, Karin; Mach, Jean Pierre; Waelli, Thierry; Gorczynski, Reginald M; Ulmer, Artur J; Zähringer, Ulrich; Hartmann, Alfred; Rietschel, Ernst Th; Brandenburg, Klaus

    2008-02-01

    An understanding of details of the interaction mechanisms of bacterial endotoxins (lipopolysaccharide, LPS) with the oxygen transport protein hemoglobin is still lacking, despite its high biological relevance. Here, a biophysical investigation into the endotoxin:hemoglobin interaction is presented which comprises the use of various rough mutant LPS as well as free lipid A; in addition to the complete hemoglobin molecule from fetal sheep extract, also the partial structure alpha-chain and the heme-free sample are studied. The investigations comprise the determination of the gel-to-liquid crystalline phase behaviour of the acyl chains of LPS, the ultrastructure (type of aggregate structure and morphology) of the endotoxins, and the incorporation of the hemoglobins into artificial immune cell membranes and into LPS. Our data suggest a model for the interaction between Hb and LPS in which hemoglobins do not react strongly with the hydrophilic or with the hydrophobic moiety of LPS, but with the complete endotoxin aggregate. Hb is able to incorporate into LPS with the longitudinal direction parallel to the lipid A double-layer. Although this does not lead to a strong disturbance of the LPS acyl chain packing, the change of the curvature leads to a slightly conical molecular shape with a change of the three-dimensional arrangement from unilamellar into cubic LPS aggregates. Our previous results show that cubic LPS structures exhibit strong endotoxic activity. The property of Hb on the physical state of LPS described here may explain the observation of an increase in LPS-mediating endotoxicity due to the action of Hb. PMID:18387918

  14. The K-loop, a general feature of the Pyrococcus C/D guide RNAs, is an RNA structural motif related to the K-turn

    PubMed Central

    Nolivos, Sophie; Carpousis, Agamemnon J.; Clouet-d'Orval, Béatrice

    2005-01-01

    The C/D guide RNAs predicted from the genomic sequences of three species of Pyrococcus delineate a family of small non-coding archaeal RNAs involved in the methylation of rRNA and tRNA. The C/D guides assemble into ribonucleoprotein (RNP) that contains the methyltransferase. The protein L7Ae, a key structural component of the RNP, binds to a Kink-turn (K-turn) formed by the C/D motif. The K-turn is a structure that consists of two RNA stems separated by a short asymmetric loop with a characteristic sharp bend (kink) between the two stems. The majority of the pyrococcal C/D guides contain a short 3 nt-spacer between the C′/D′ motifs. We show here that conserved terminal stem–loops formed by the C′/D′ motif of the Pyrococcus C/D RNAs are also L7Ae-binding sites. These stem–loops are related to the K-turn by sequence and structure, but they consist of a single stem closed by a terminal loop. We have named this structure the K-loop. We show that conserved non-canonical base pairs in the stem of the K-loop are necessary for L7Ae binding. For the C/D guides with a 3 nt-spacer we show that the sequence and length is also important. The K-loop could improve the stability of the C/D guide RNAs in Pyrococcal species, which are extreme hyperthermophiles. PMID:16293637

  15. The Crystal Structures of EAP Domains from Staphylococcus aureus Reveal an Unexpected Homology to Bacterial Superantigens

    SciTech Connect

    Geisbrecht, B V; Hamaoka, B Y; Perman, B; Zemla, A; Leahy, D J

    2005-10-14

    The Eap (extracellular adherence protein) of Staphylococcus aureus functions as a secreted virulence factor by mediating interactions between the bacterial cell surface and several extracellular host proteins. Eap proteins from different Staphylococcal strains consist of four to six tandem repeats of a structurally uncharacterized domain (EAP domain). We have determined the three-dimensional structures of three different EAP domains to 1.8, 2.2, and 1.35 {angstrom} resolution, respectively. These structures reveal a core fold that is comprised of an {alpha}-helix lying diagonally across a five-stranded, mixed {beta}-sheet. Comparison of EAP domains with known structures reveals an unexpected homology with the C-terminal domain of bacterial superantigens. Examination of the structure of the superantigen SEC2 bound to the {beta}-chain of a T-cell receptor suggests a possible ligand-binding site within the EAP domain (Fields, B. A., Malchiodi, E. L., Li, H., Ysern, X., Stauffacher, C. V., Schlievert, P. M., Karjalainen, K., and Mariuzza, R. (1996) Nature 384, 188-192). These results provide the first structural characterization of EAP domains, relate EAP domains to a large class of bacterial toxins, and will guide the design of future experiments to analyze EAP domain structure/function relationships.

  16. Pulse-based non-thermal plasma (NTP) disrupts the structural characteristics of bacterial biofilms.

    PubMed

    Ferrell, James R; Shen, Fan; Grey, Scott F; Woolverton, Christopher J

    2013-01-01

    Bacterial biofilms were constructed in vitro with two pathogenic strains of Pseudomonas aeruginosa and Staphylococcus aureus using a modified, novel sequential bioreactor system. The structure and stability of bacterial biofilms were evaluated following exposure to non-thermal plasma (NTP) discharge. Mathematical software was used to determine structural changes as biofilms grew over the course of 7 days. Statistical modeling was also performed to assess the ability of NTP to affect the development of the biofilms over different periods of time. Several structural characteristics were significantly affected by NTP discharge whereas others were unaffected. Changes in the three-dimensional structure of the biofilm following introduction of NTP was not limited to one period of development. The mechanism for this phenomenon is not understood but is likely to be a dual, synergistic effect due to the composition of the reactive species and other plasma-associated molecules isolated previously in the NTP discharge used in this study. PMID:23682750

  17. Crystal Structures of the SpoIID Lytic Transglycosylases Essential for Bacterial Sporulation.

    PubMed

    Nocadello, Salvatore; Minasov, George; Shuvalova, Ludmilla S; Dubrovska, Ievgeniia; Sabini, Elisabetta; Anderson, Wayne F

    2016-07-15

    Bacterial spores are the most resistant form of life known on Earth and represent a serious problem for (i) bioterrorism attack, (ii) horizontal transmission of microbial pathogens in the community, and (iii) persistence in patients and in a nosocomial environment. Stage II sporulation protein D (SpoIID) is a lytic transglycosylase (LT) essential for sporulation. The LT superfamily is a potential drug target because it is active in essential bacterial processes involving the peptidoglycan, which is unique to bacteria. However, the absence of structural information for the sporulation-specific LT enzymes has hindered mechanistic understanding of SpoIID. Here, we report the first crystal structures with and without ligands of the SpoIID family from two community relevant spore-forming pathogens, Bacillus anthracis and Clostridium difficile. The structures allow us to visualize the overall architecture, characterize the substrate recognition model, identify critical residues, and provide the structural basis for catalysis by this new family of enzymes. PMID:27226615

  18. Deterministic assembly processes govern bacterial community structure in the Fynbos, South Africa.

    PubMed

    Moroenyane, I; Chimphango, S B M; Wang, J; Kim, H-K; Adams, Jonathan Miles

    2016-08-01

    The Mediterranean Fynbos vegetation of South Africa is well known for its high levels of diversity, endemism, and the existence of very distinct plant communities on different soil types. Studies have documented the broad taxonomic classification and diversity patterns of soil microbial diversity, but none has focused on the community assembly processes. We hypothesised that bacterial phylogenetic community structure in the Fynbos is highly governed by deterministic processes. We sampled soils in four Fynbos vegetation types and examined bacterial communities using Illumina HiSeq platform with the 16S rRNA gene marker. UniFrac analysis showed that the community clustered strongly by vegetation type, suggesting a history of evolutionary specialisation in relation to habitats or plant communities. The standardised beta mean nearest taxon distance (ses. β NTD) index showed no association with vegetation type. However, the overall phylogenetic signal indicates that distantly related OTUs do tend to co-occur. Both NTI (nearest taxon index) and ses. β NTD deviated significantly from null models, indicating that deterministic processes were important in the assembly of bacterial communities. Furthermore, ses. β NTD was significantly higher than that of null expectations, indicating that co-occurrence of related bacterial lineages (over-dispersion in phylogenetic beta diversity) is determined by the differences in environmental conditions among the sites, even though the co-occurrence pattern did not correlate with any measured environmental parameter, except for a weak correlation with soil texture. We suggest that in the Fynbos, there are frequent shifts of niches by bacterial lineages, which then become constrained and evolutionary conserved in their new environments. Overall, this study sheds light on the relative roles of both deterministic and neutral processes in governing bacterial communities in the Fynbos. It seems that deterministic processes play a major

  19. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    SciTech Connect

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; Landick, Robert; Darst, Seth A.

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstream of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.

  20. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    DOE PAGESBeta

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; Landick, Robert; Darst, Seth A.

    2015-09-08

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less

  1. Structural insights into the bacterial carbon-phosphorus lyase machinery

    PubMed Central

    Seweryn, Paulina; Van, Lan Bich; Kjeldgaard, Morten; Russo, Christopher J.; Passmore, Lori A.; Hove-Jensen, Bjarne; Jochimsen, Bjarne; Brodersen, Ditlev E.

    2015-01-01

    Summary Phosphorous is required for all life and microorganisms can extract it from their environment through several metabolic pathways. When phosphate is in limited supply, some bacteria are able to use organic phosphonate compounds, which require specialised enzymatic machinery for breaking the stable carbon-phosphorus (C-P) bond. Despite its importance, the details of how this machinery catabolises phosphonate remain unknown. Here we determine the crystal structure of the 240 kDa Escherichia coli C-P lyase core complex (PhnGHIJ) and show that it is a two-fold symmetric hetero-octamer comprising an intertwined network of subunits with unexpected self-homologies. It contains two potential active sites that likely couple organic phosphonate compounds to ATP and subsequently hydrolyse the C-P bond. We map the binding site of PhnK on the complex using electron microscopy and show that it binds to PhnJ via a conserved insertion domain. Our results provide a structural basis for understanding microbial phosphonate breakdown. PMID:26280334

  2. Priming and polymerization of a bacterial contractile tail structure.

    PubMed

    Zoued, Abdelrahim; Durand, Eric; Brunet, Yannick R; Spinelli, Silvia; Douzi, Badreddine; Guzzo, Mathilde; Flaugnatti, Nicolas; Legrand, Pierre; Journet, Laure; Fronzes, Rémi; Mignot, Tâm; Cambillau, Christian; Cascales, Eric

    2016-03-01

    Contractile tails are composed of an inner tube wrapped by an outer sheath assembled in an extended, metastable conformation that stores mechanical energy necessary for its contraction. Contraction is used to propel the rigid inner tube towards target cells for DNA or toxin delivery. Although recent studies have revealed the structure of the contractile sheath of the type VI secretion system, the mechanisms by which its polymerization is controlled and coordinated with the assembly of the inner tube remain unknown. Here we show that the starfish-like TssA dodecameric complex interacts with tube and sheath components. Fluorescence microscopy experiments in enteroaggregative Escherichia coli reveal that TssA binds first to the type VI secretion system membrane core complex and then initiates tail polymerization. TssA remains at the tip of the growing structure and incorporates new tube and sheath blocks. On the basis of these results, we propose that TssA primes and coordinates tail tube and sheath biogenesis. PMID:26909579

  3. Structure of a bacterial RNA polymerase holoenzyme open promoter complex

    PubMed Central

    Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; Landick, Robert; Darst, Seth A

    2015-01-01

    Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the −10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstream of the −10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation. DOI: http://dx.doi.org/10.7554/eLife.08504.001 PMID:26349032

  4. Bacterial Diversity and Community Structure in Two Bornean Nepenthes Species with Differences in Nitrogen Acquisition Strategies.

    PubMed

    Sickel, Wiebke; Grafe, T Ulmar; Meuche, Ivonne; Steffan-Dewenter, Ingolf; Keller, Alexander

    2016-05-01

    Carnivorous plants of the genus Nepenthes have been studied for over a century, but surprisingly little is known about associations with microorganisms. The two species Nepenthes rafflesiana and Nepenthes hemsleyana differ in their pitcher-mediated nutrient sources, sequestering nitrogen from arthropod prey and arthropods as well as bat faeces, respectively. We expected bacterial communities living in the pitchers to resemble this diet difference. Samples were taken from different parts of the pitchers (leaf, peristome, inside, outside, digestive fluid) of both species. Bacterial communities were determined using culture-independent high-throughput amplicon sequencing. Bacterial richness and community structure were similar in leaves, peristomes, inside and outside walls of both plant species. Regarding digestive fluids, bacterial richness was higher in N. hemsleyana than in N. rafflesiana. Additionally, digestive fluid communities were highly variable in structure, with strain-specific differences in community composition between replicates. Acidophilic taxa were mostly of low abundance, except the genus Acidocella, which strikingly reached extremely high levels in two N. rafflesiana fluids. In N. hemsleyana fluid, some taxa classified as vertebrate gut symbionts as well as saprophytes were enriched compared to N. rafflesiana, with saprophytes constituting potential competitors for nutrients. The high variation in community structure might be caused by a number of biotic and abiotic factors. Nitrogen-fixing bacteria were present in both study species, which might provide essential nutrients to the plant at times of low prey capture and/or rare encounters with bats. PMID:26790863

  5. Insights into metalloregulation by M-box riboswitch RNAs via structural analysis of manganese-bound complexes

    PubMed Central

    Ramesh, Arati; Wakeman, Catherine A.; Winkler, Wade C.

    2011-01-01

    The M-box riboswitch couples intracellular magnesium levels to expression of bacterial metal transport genes. Structural analyses of other riboswitch RNA classes, which typically respond to a small organic metabolite, have revealed that ligand recognition occurs through a combination of base stacking, electrostatic, and hydrogen bonding interactions. In contrast, the M-box RNA triggers a change in gene expression upon association with an undefined population of metals, rather than responding to only a single ligand. Prior biophysical experimentation suggested that divalent ions associate with the M-box RNA to promote a compacted tertiary conformation, resulting in sequestration of a short sequence tract otherwise required for downstream gene expression. Electrostatic shielding from loosely associated metals is undoubtedly an important influence during this metal-mediated compaction pathway. However, it is also likely that a subset of divalent ions specifically occupies cation-binding sites and promotes proper positioning of functional groups for tertiary structure stabilization. To better elucidate the role of these metal-binding sites a manganese-chelated M-box RNA complex was resolved to 1.86 angstroms by X-ray crystallography. These data support the presence of at least 8 well-ordered cation binding pockets, including several sites that had been predicted by biochemical studies but were not observed in prior structural analysis. Overall, these data support the presence of three metal binding cores within the M-box RNA that facilitate a network of long range interactions within the metal-bound, compacted conformation. PMID:21315082

  6. Insights into Metalloregulation by M-box Riboswitch RNAs via Structural Analysis of Manganese-Bound Complexes

    SciTech Connect

    Ramesh, Arati; Wakeman, Catherine A.; Winkler, Wade C.

    2011-12-09

    The M-box riboswitch couples intracellular magnesium levels to expression of bacterial metal transport genes. Structural analyses on other riboswitch RNA classes, which typically respond to a small organic metabolite, have revealed that ligand recognition occurs through a combination of base-stacking, electrostatic, and hydrogen-bonding interactions. In contrast, the M-box RNA triggers a change in gene expression upon association with an undefined population of metals, rather than responding to only a single ligand. Prior biophysical experimentation suggested that divalent ions associate with the M-box RNA to promote a compacted tertiary conformation, resulting in sequestration of a short sequence tract otherwise required for downstream gene expression. Electrostatic shielding from loosely associated metals is undoubtedly an important influence during this metal-mediated compaction pathway. However, it is also likely that a subset of divalent ions specifically occupies cation binding sites and promotes proper positioning of functional groups for tertiary structure stabilization. To better elucidate the role of these metal binding sites, we resolved a manganese-chelated M-box RNA complex to 1.86 {angstrom} by X-ray crystallography. These data support the presence of at least eight well-ordered cation binding pockets, including several sites that had been predicted by biochemical studies but were not observed in prior structural analysis. Overall, these data support the presence of three metal-binding cores within the M-box RNA that facilitate a network of long-range interactions within the metal-bound, compacted conformation.

  7. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants

    PubMed Central

    Khraiwesh, Basel; Zhu, Jian-Kang; Zhu, Jianhua

    2011-01-01

    Small, non-coding RNAs are a distinct class of regulatory RNAs in plants and animals that control a variety of biological processes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved through a series of pathways. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs control the expression of cognate target genes by binding to reverse complementary sequences, resulting in cleavage or translational inhibition of the target RNAs. siRNAs have a similar structure, function, and biogenesis as miRNAs but are derived from long double-stranded RNAs and can often direct DNA methylation at target sequences. Besides their roles in growth and development and maintenance of genome integrity, small RNAs are also important components in plant stress responses. One way in which plants respond to environmental stress is by modifying their gene expression through the activity of small RNAs. Thus, understanding how small RNAs regulate gene expression will enable researchers to explore the role of small RNAs in biotic and abiotic stress responses. This review focuses on the regulatory roles of plant small RNAs in the adaptive response to stresses. PMID:21605713

  8. Bacterial Cellular Engineering by Genome Editing and Gene Silencing

    PubMed Central

    Nakashima, Nobutaka; Miyazaki, Kentaro

    2014-01-01

    Genome editing is an important technology for bacterial cellular engineering, which is commonly conducted by homologous recombination-based procedures, including gene knockout (disruption), knock-in (insertion), and allelic exchange. In addition, some new recombination-independent approaches have emerged that utilize catalytic RNAs, artificial nucleases, nucleic acid analogs, and peptide nucleic acids. Apart from these methods, which directly modify the genomic structure, an alternative approach is to conditionally modify the gene expression profile at the posttranscriptional level without altering the genomes. This is performed by expressing antisense RNAs to knock down (silence) target mRNAs in vivo. This review describes the features and recent advances on methods used in genomic engineering and silencing technologies that are advantageously used for bacterial cellular engineering. PMID:24552876

  9. Structural Basis for Alginate Secretion Across the Bacterial Outer Membrane

    SciTech Connect

    J Whitney; I Hay; C Li; P Eckford; H Robinson; M Amaya; L Wood; D Ohman; C Bear; et al.

    2011-12-31

    Pseudomonas aeruginosa is the predominant pathogen associated with chronic lung infection among cystic fibrosis patients. During colonization of the lung, P. aeruginosa converts to a mucoid phenotype characterized by the overproduction of the exopolysaccharide alginate. Secretion of newly synthesized alginate across the outer membrane is believed to occur through the outer membrane protein AlgE. Here we report the 2.3 {angstrom} crystal structure of AlgE, which reveals a monomeric 18-stranded {beta}-barrel characterized by a highly electropositive pore constriction formed by an arginine-rich conduit that likely acts as a selectivity filter for the negatively charged alginate polymer. Interestingly, the pore constriction is occluded on either side by extracellular loop L2 and an unusually long periplasmic loop, T8. In halide efflux assays, deletion of loop T8 ({Delta}T8-AlgE) resulted in a threefold increase in anion flux compared to the wild-type or {Delta}L2-AlgE supporting the idea that AlgE forms a transport pathway through the membrane and suggesting that transport is regulated by T8. This model is further supported by in vivo experiments showing that complementation of an algE deletion mutant with {Delta}T8-AlgE impairs alginate production. Taken together, these studies support a mechanism for exopolysaccharide export across the outer membrane that is distinct from the Wza-mediated translocation observed in canonical capsular polysaccharide export systems.

  10. Structural basis for alginate secretion across the bacterial outer membrane

    SciTech Connect

    Whitney, J.C.; Robinson, H.; Hay, I. D.; Li, C.; Eckford, P. D. W.; Amaya, M. F.; Wood, L. F.; Ohman, D. E.; Bear, C. E.; Rehm, B. H.; Howell, P. L.

    2011-08-09

    Pseudomonas aeruginosa is the predominant pathogen associated with chronic lung infection among cystic fibrosis patients. During colonization of the lung, P. aeruginosa converts to a mucoid phenotype characterized by the overproduction of the exopolysaccharide alginate. Secretion of newly synthesized alginate across the outer membrane is believed to occur through the outer membrane protein AlgE. Here we report the 2.3 {angstrom} crystal structure of AlgE, which reveals a monomeric 18-stranded {beta}-barrel characterized by a highly electropositive pore constriction formed by an arginine-rich conduit that likely acts as a selectivity filter for the negatively charged alginate polymer. Interestingly, the pore constriction is occluded on either side by extracellular loop L2 and an unusually long periplasmic loop, T8. In halide efflux assays, deletion of loop T8 ({Delta}T8-AlgE) resulted in a threefold increase in anion flux compared to the wild-type or {Delta}L2-AlgE supporting the idea that AlgE forms a transport pathway through the membrane and suggesting that transport is regulated by T8. This model is further supported by in vivo experiments showing that complementation of an algE deletion mutant with {Delta}T8-AlgE impairs alginate production. Taken together, these studies support a mechanism for exopolysaccharide export across the outer membrane that is distinct from the Wza-mediated translocation observed in canonical capsular polysaccharide export systems.

  11. Host species and developmental stage, but not host social structure, affects bacterial community structure in socially polymorphic bees.

    PubMed

    McFrederick, Quinn S; Wcislo, William T; Hout, Michael C; Mueller, Ulrich G

    2014-05-01

    Social transmission and host developmental stage are thought to profoundly affect the structure of bacterial communities associated with honey bees and bumble bees, but these ideas have not been explored in other bee species. The halictid bees Megalopta centralis and M. genalis exhibit intrapopulation social polymorphism, which we exploit to test whether bacterial communities differ by host social structure, developmental stage, or host species. We collected social and solitary Megalopta nests and sampled bees and nest contents from all stages of host development. To survey these bacterial communities, we used 16S rRNA gene 454 pyrosequencing. We found no effect of social structure, but found differences by host species and developmental stage. Wolbachia prevalence differed between the two host species. Bacterial communities associated with different developmental stages appeared to be driven by environmentally acquired bacteria. A Lactobacillus kunkeei clade bacterium that is consistently associated with other bee species was dominant in pollen provisions and larval samples, but less abundant in mature larvae and pupae. Foraging adults appeared to often reacquire L. kunkeei clade bacteria, likely while foraging at flowers. Environmental transmission appears to be more important than social transmission for Megalopta bees at the cusp between social and solitary behavior. PMID:24579829

  12. Crystal structure of MraY, an essential membrane enzyme for bacterial cell wall synthesis.

    PubMed

    Chung, Ben C; Zhao, Jinshi; Gillespie, Robert A; Kwon, Do-Yeon; Guan, Ziqiang; Hong, Jiyong; Zhou, Pei; Lee, Seok-Yong

    2013-08-30

    MraY (phospho-MurNAc-pentapeptide translocase) is an integral membrane enzyme that catalyzes an essential step of bacterial cell wall biosynthesis: the transfer of the peptidoglycan precursor phospho-MurNAc-pentapeptide to the lipid carrier undecaprenyl phosphate. MraY has long been considered a promising target for the development of antibiotics, but the lack of a structure has hindered mechanistic understanding of this critical enzyme and the enzyme superfamily in general. The superfamily includes enzymes involved in bacterial lipopolysaccharide/teichoic acid formation and eukaryotic N-linked glycosylation, modifications that are central in many biological processes. We present the crystal structure of MraY from Aquifex aeolicus (MraYAA) at 3.3 Å resolution, which allows us to visualize the overall architecture, locate Mg(2+) within the active site, and provide a structural basis of catalysis for this class of enzyme. PMID:23990562

  13. Light Structures Phototroph, Bacterial and Fungal Communities at the Soil Surface

    PubMed Central

    Davies, Lawrence O.; Schäfer, Hendrik; Marshall, Samantha; Bramke, Irene; Oliver, Robin G.; Bending, Gary D.

    2013-01-01

    The upper few millimeters of soil harbour photosynthetic microbial communities that are structurally distinct from those of underlying bulk soil due to the presence of light. Previous studies in arid zones have demonstrated functional importance of these communities in reducing soil erosion, and enhancing carbon and nitrogen fixation. Despite being widely distributed, comparative understanding of the biodiversity of the soil surface and underlying soil is lacking, particularly in temperate zones. We investigated the establishment of soil surface communities on pasture soil in microcosms exposed to light or dark conditions, focusing on changes in phototroph, bacterial and fungal communities at the soil surface (0–3 mm) and bulk soil (3–12 mm) using ribosomal marker gene analyses. Microbial community structure changed with time and structurally similar phototrophic communities were found at the soil surface and in bulk soil in the light exposed microcosms suggesting that light can influence phototroph community structure even in the underlying bulk soil. 454 pyrosequencing showed a significant selection for diazotrophic cyanobacteria such as Nostoc punctiforme and Anabaena spp., in addition to the green alga Scenedesmus obliquus. The soil surface also harboured distinct heterotrophic bacterial and fungal communities in the presence of light, in particular, the selection for the phylum Firmicutes. However, these light driven changes in bacterial community structure did not extend to the underlying soil suggesting a discrete zone of influence, analogous to the rhizosphere. PMID:23894406

  14. Comparative Structural and Functional Analysis of Staphylococcus aureus Glucokinase with other Bacterial Glucokinases

    PubMed Central

    Kumar, P. S.; Kumar, Y. N.; Prasad, U. V.; Yeswanth, S.; Swarupa, V.; Vasu, D.; Venkatesh, K.; Srikanth, L.; Rao, V. K.; Sarma, P. V. G. K.

    2014-01-01

    Glucokinase is classified in bacteria based upon having ATP binding site and ‘repressor/open reading frames of unknown function/sugar kinases’ motif, the sequence of glucokinase gene (JN645812) of Staphylococcus aureus ATCC12600 showed presence of ATP binding site and ‘repressor/open reading frames of unknown function/sugar kinases’ motif. We have earlier observed glucokinase of S. aureus has higher affinity towards the substrate compared to other bacterial glucokinase and under anaerobic condition with increased glucose concentration S. aureus exhibited higher rate of biofilm formation. To establish this, 3D structure of glucokinase was built using homology modeling method, the PROCHECK and ProSA-Web analysis indicated this built glucokinase structure was close to the crystal structure. This structure was superimposed with different bacterial glucokinase structures and from the root-mean-square deviation values, it is concluded that S. aureus glucokinase exhibited very close homology with Enterococcus faecalis and Clostridium difficle while with other bacteria it showed high degree of variations both in domain and nondomain regions. Glucose docking results indicated -12.3697 kcal/mol for S. aureus glucokinase compared with other bacterial glucokinase suggesting higher affinity of glucose which correlates with enzyme kinetics and higher rate of biofilm formation. PMID:25425757

  15. Acquisition and structuring of midgut bacterial communities in gypsy moth (Lepidoptera: Erebidae) larvae.

    PubMed

    Mason, Charles J; Raffa, Kenneth F

    2014-06-01

    Insects are associated with a diversity of bacteria that colonize their midguts. The extent to which these communities reflect maternal transmission, environmental acquisition, and subsequent structuring by the extreme conditions within the insect gut are poorly understood in many species. We used gypsy moth (Lymantria dispar L.) as a model to investigate interactions between egg mass and environmental sources of bacteria on larval midgut communities. Egg masses were collected from several wild and laboratory populations, and the effects of diet, initial egg mass community, and internal host environment were evaluated using 454 16S-rRNA gene pyrosequencing. Wild populations were highly diverse, while laboratory-maintained egg masses were associated with few operational taxonomic units. As larvae developed, their midgut bacterial communities became more similar to each other and the consumed diet despite initial differences in egg mass-associated bacteria. Subsequent experiments revealed that while midgut membership was more similar to bacteria associated with diet than with egg mass-associated bacteria, we were unable to detect distinct, persistent differences attributable to specific host plants. The differences between foliar communities and midgut communities of larvae that ingested them were owing to relative changes in populations of several bacteria phylotypes. We conclude that gypsy moth has a relatively characteristic midgut bacterial community that is reflective of, but ultimately distinct from, its foliar diet. This work demonstrates that environmental acquisition of diverse microbes can lead to similar midgut bacterial assemblages, underscoring the importance of host physiological environment in structuring bacterial communities. PMID:24780292

  16. Comprehensive Structural Characterization of the Bacterial Homospermidine Synthase–an Essential Enzyme of the Polyamine Metabolism

    PubMed Central

    Krossa, Sebastian; Faust, Annette; Ober, Dietrich; Scheidig, Axel J.

    2016-01-01

    The highly conserved bacterial homospermidine synthase (HSS) is a key enzyme of the polyamine metabolism of many proteobacteria including pathogenic strains such as Legionella pneumophila and Pseudomonas aeruginosa; The unique usage of NAD(H) as a prosthetic group is a common feature of bacterial HSS, eukaryotic HSS and deoxyhypusine synthase (DHS). The structure of the bacterial enzyme does not possess a lysine residue in the active center and thus does not form an enzyme-substrate Schiff base intermediate as observed for the DHS. In contrast to the DHS the active site is not formed by the interface of two subunits but resides within one subunit of the bacterial HSS. Crystal structures of Blastochloris viridis HSS (BvHSS) reveal two distinct substrate binding sites, one of which is highly specific for putrescine. BvHSS features a side pocket in the direct vicinity of the active site formed by conserved amino acids and a potential substrate discrimination, guiding, and sensing mechanism. The proposed reaction steps for the catalysis of BvHSS emphasize cation-π interaction through a conserved Trp residue as a key stabilizer of high energetic transition states. PMID:26776105

  17. Infectious long non-coding RNAs.

    PubMed

    Katsarou, Konstantina; Rao, A L N; Tsagris, Mina; Kalantidis, Kriton

    2015-10-01

    Long non protein coding RNAs (lncRNAs) constitute a large category of the RNA world, able to regulate different biological processes. In this review we are focusing on infectious lncRNAs, their classification, pathogenesis and impact on the infected organisms. Here they are presented in two separate groups: 'dependent lncRNAs' (comprising satellites RNA, Hepatitis D virus and lncRNAs of viral origin) which need a helper virus and 'independent lncRNAs' (viroids) that can self-replicate. Even though these lncRNA do not encode any protein, their structure and/or sequence comprise all the necessary information to drive specific interactions with host factors and regulate several cellular functions. These new data that have emerged during the last few years concerning lncRNAs modify the way we understand molecular biology's 'central dogma' and give new perspectives for applications and potential therapeutic strategies. PMID:25986218

  18. Soil Bacterial Community Structure Responses to Precipitation Reduction and Forest Management in Forest Ecosystems across Germany

    PubMed Central

    Felsmann, Katja; Baudis, Mathias; Gimbel, Katharina; Kayler, Zachary E.; Ellerbrock, Ruth; Bruehlheide, Helge; Bruckhoff, Johannes; Welk, Erik; Puhlmann, Heike; Weiler, Markus; Gessler, Arthur; Ulrich, Andreas

    2015-01-01

    Soil microbial communities play an important role in forest ecosystem functioning, but how climate change will affect the community composition and consequently bacterial functions is poorly understood. We assessed the effects of reduced precipitation with the aim of simulating realistic future drought conditions for one growing season on the bacterial community and its relation to soil properties and forest management. We manipulated precipitation in beech and conifer forest plots managed at different levels of intensity in three different regions across Germany. The precipitation reduction decreased soil water content across the growing season by between 2 to 8% depending on plot and region. T-RFLP analysis and pyrosequencing of the 16S rRNA gene were used to study the total soil bacterial community and its active members after six months of precipitation reduction. The effect of reduced precipitation on the total bacterial community structure was negligible while significant effects could be observed for the active bacteria. However, the effect was secondary to the stronger influence of specific soil characteristics across the three regions and management selection of overstorey tree species and their respective understorey vegetation. The impact of reduced precipitation differed between the studied plots; however, we could not determine the particular parameters being able to modify the response of the active bacterial community among plots. We conclude that the moderate drought induced by the precipitation manipulation treatment started to affect the active but not the total bacterial community, which points to an adequate resistance of the soil microbial system over one growing season. PMID:25875835

  19. Carbohydrate structure database merged from bacterial, archaeal, plant and fungal parts.

    PubMed

    Toukach, Philip V; Egorova, Ksenia S

    2016-01-01

    The Carbohydrate Structure Databases (CSDBs, http://csdb.glycoscience.ru) store structural, bibliographic, taxonomic, NMR spectroscopic, and other data on natural carbohydrates and their derivatives published in the scientific literature. The CSDB project was launched in 2005 for bacterial saccharides (as BCSDB). Currently, it includes two parts, the Bacterial CSDB and the Plant&Fungal CSDB. In March 2015, these databases were merged to the single CSDB. The combined CSDB includes information on bacterial and archaeal glycans and derivatives (the coverage is close to complete), as well as on plant and fungal glycans and glycoconjugates (almost all structures published up to 1998). CSDB is regularly updated via manual expert annotation of original publications. Both newly annotated data and data imported from other databases are manually curated. The CSDB data are exportable in a number of modern formats, such as GlycoRDF. CSDB provides additional services for simulation of (1)H, (13)C and 2D NMR spectra of saccharides, NMR-based structure prediction, glycan-based taxon clustering and other. PMID:26286194

  20. Carbohydrate structure database merged from bacterial, archaeal, plant and fungal parts

    PubMed Central

    Toukach, Philip V.; Egorova, Ksenia S.

    2016-01-01

    The Carbohydrate Structure Databases (CSDBs, http://csdb.glycoscience.ru) store structural, bibliographic, taxonomic, NMR spectroscopic, and other data on natural carbohydrates and their derivatives published in the scientific literature. The CSDB project was launched in 2005 for bacterial saccharides (as BCSDB). Currently, it includes two parts, the Bacterial CSDB and the Plant&Fungal CSDB. In March 2015, these databases were merged to the single CSDB. The combined CSDB includes information on bacterial and archaeal glycans and derivatives (the coverage is close to complete), as well as on plant and fungal glycans and glycoconjugates (almost all structures published up to 1998). CSDB is regularly updated via manual expert annotation of original publications. Both newly annotated data and data imported from other databases are manually curated. The CSDB data are exportable in a number of modern formats, such as GlycoRDF. CSDB provides additional services for simulation of 1H, 13C and 2D NMR spectra of saccharides, NMR-based structure prediction, glycan-based taxon clustering and other. PMID:26286194

  1. Effect of Sugarcane Burning or Green Harvest Methods on the Brazilian Cerrado Soil Bacterial Community Structure

    PubMed Central

    Rachid, Caio T. C. C.; Santos, Adriana L.; Piccolo, Marisa C.; Balieiro, Fabiano C.; Coutinho, Heitor L. C.; Peixoto, Raquel S.; Tiedje, James M.; Rosado, Alexandre S.

    2013-01-01

    Background The Brazilian Cerrado is one of the most important biodiversity reservoirs in the world. The sugarcane cultivation is expanding in this biome and necessitates the study of how it may impact the soil properties of the Cerrado. There is a lack of information especially about the impacts of different sugarcane management on the native bacterial communities of Cerrado soil. Therefore, our objective was to evaluate and compare the soil bacterial community structure of the Cerrado vegetation with two sugarcane systems. Methods We evaluated samples under native vegetation and the impact of the two most commonly used management strategies for sugarcane cultivation (burnt cane and green cane) on this diversity using pyrosequencing and quantitative PCR of the rrs gene (16S rRNA). Results and Conclusions Nineteen different phyla were identified, with Acidobacteria (≈35%), Proteobacteria (≈24%) and Actinobacteria (≈21%) being the most abundant. Many of the sequences were represented by few operational taxonomic units (OTUs, 3% of dissimilarity), which were found in all treatments. In contrast, there were very strong patterns of local selection, with many OTUs occurring only in one sample. Our results reveal a complex bacterial diversity, with a large fraction of microorganisms not yet described, reinforcing the importance of this biome. As possible sign of threat, the qPCR detected a reduction of the bacterial population in agricultural soils compared with native Cerrado soil communities. We conclude that sugarcane cultivation promoted significant structural changes in the soil bacterial community, with Firmicutes phylum and Acidobacteria classes being the groups most affected. PMID:23533619

  2. Algal exudates and stream organic matter influence the structure and function of denitrifying bacterial communities.

    PubMed

    Kalscheur, Kathryn N; Rojas, Miguel; Peterson, Christopher G; Kelly, John J; Gray, Kimberly A

    2012-11-01

    Within aquatic ecosystems, periphytic biofilms can be hot spots of denitrification, and previous work has suggested that algal taxa within periphyton can influence the species composition and activity of resident denitrifying bacteria. This study tested the hypothesis that algal species composition within biofilms influences the structure and function of associated denitrifying bacterial communities through the composition of organic exudates. A mixed population of bacteria was incubated with organic carbon isolated from one of seven algal species or from one of two streams that differed in anthropogenic inputs. Pyrolysis-gas chromatography-mass spectrometry (Py-GC/MS) revealed differences in the organic composition of algal exudates and stream waters, which, in turn, selected for distinct bacterial communities. Organic carbon source had a significant effect on potential denitrification rates (DNP) of the communities, with organics isolated from a stream with high anthropogenic inputs resulting in a bacterial community with the highest DNP. There was no correlation between DNP and numbers of denitrifiers (based on nirS copy numbers), but there was a strong relationship between the species composition of denitrifier communities (as indicated by tag pyrosequencing of nosZ genes) and DNP. Specifically, the relative abundance of Pseudomonas stutzeri-like nosZ sequences across treatments correlated significantly with DNP, and bacterial communities incubated with organic carbon from the stream with high anthropogenic inputs had the highest relative abundance of P. stutzeri-like nosZ sequences. These results demonstrate a significant relationship between bacterial community composition and function and provide evidence of the potential impacts of anthropogenic inputs on the structure and function of stream microbial communities. PMID:22828897

  3. Two Classes of Bacterial IMPDHs according to Their Quaternary Structures and Catalytic Properties

    PubMed Central

    Alexandre, Thomas; Rayna, Bertrand; Munier-Lehmann, Hélène

    2015-01-01

    Inosine-5′-monophosphate dehydrogenase (IMPDH) occupies a key position in purine nucleotide metabolism. In this study, we have performed the biochemical and physico-chemical characterization of eight bacterial IMPDHs, among which six were totally unexplored. This study led to a classification of bacterial IMPDHs according to the regulation of their catalytic properties and their quaternary structures. Class I IMPDHs are cooperative enzymes for IMP, which are activated by MgATP and are octameric in all tested conditions. On the other hand, class II IMPDHs behave as Michaelis-Menten enzymes for both substrates and are tetramers in their apo state or in the presence of IMP, which are shifted to octamers in the presence of NAD or MgATP. Our work provides new insights into the IMPDH functional regulation and a model for the quaternary structure modulation is proposed. PMID:25706619

  4. Dalbavancin for the treatment of acute bacterial skin and skin structure infections.

    PubMed

    Esposito, Silvano; Noviello, Silvana; Leone, Sebastiano

    2015-12-01

    Dalbavancin is a novel parenteral lipoglycopeptide antibiotic approved for the treatment of acute bacterial skin and skin structure infections (ABSSSIs) in adults. Dalbavancin is highly active against common Gram-positive pathogens, including methicillin-resistant Staphylococcus aureus (MRSA). Dalbavancin has a prolonged half-life that allows for once weekly dosing. Phase III trials have demonstrated non-inferiority compared with vancomycin/linezolid in the treatment of ABSSSIs, including those sustained by MRSA. PMID:26700080

  5. Bacterial community structure in freshwater springs infested with the invasive plant species Hydrilla verticillata

    PubMed Central

    Gordon-Bradley, N.; Li, N.

    2015-01-01

    The phylogenetic composition and physiological profiles of bacterial communities in freshwater springs were evaluated during the blooming and non-blooming stages of the invasive plant species, Hydrilla verticillata. Community-level physiological profiles (CLPPs) and pyrosequencing of 16S rRNA gene amplicons were used to study potential Hydrilla mediated shifts in the physiological potential and phylogenetic composition of the bacterial community in infested systems. The results of CLPP revealed that the microbes in the Hydrilla invaded sites utilized less substrates during blooming periods than during nonblooming periods of the plant. Spearman’s rank correlation analysis showed some relationships between the relative abundances of bacterial taxa and the Biolog substrate utilization pattern. The relative abundance of the identified taxa showed some striking differences based on the blooming status of Hydrilla and to a lesser extent on site variation. The relative abundance of Actinobacteria, Bacteriodetes, and Verrucomicrobia was generally higher during Hydrilla blooms, while Deltaproteobacteria was generally higher during non-blooming stages of Hydrilla. The detected genera also varied based on the blooming stages of the plant. Based on the findings, it appears that Hydrilla alters the phylogenetic composition and structure of the bacterial community during the blooming stage. PMID:26207069

  6. Molecular monitoring of the bacterial community structure in foal feces pre- and post-weaning.

    PubMed

    Faubladier, Céline; Sadet-Bourgeteau, Sophie; Philippeau, Christelle; Jacotot, Emmanuel; Julliand, Véronique

    2014-02-01

    This study assessed the time-scale variability of bacterial community structure in foal feces from birth to 365 days of age using Automated Ribosomal Intergenic Spacer Analysis (ARISA). Fecal samples were collected from five foals 2 h after birth (meconium) and in the morning at days 1, 2, 5, 10, 30, 60, 120, 179, 183, 194 and 365. The ARISA profiles were compared using an analysis of similarity (ANOSIM). Although both the age effect and the foal effect were highly significant (P < 0.010), the R-ANOSIM value for the foal effect was very low (R-ANOSIM = 0.089), while that of the age effect was much higher (R-ANOSIM = 0.309). Significant age-related changes were detected between days 0 and 2 (R-ANOSIM = 0.500), days 2 and 10 (R-ANOSIM = 0.475) and days 10 and 30 (R-ANOSIM = 0.519). No further shifts between consecutive times of sampling were detected in the bacterial community after day 30 and no changes were observed at weaning (day 180). These results show that the establishment of the intestinal bacterial community in foals is a sequential process, which reaches its climax state at around one month of age. Further studies using new generation sequencing based methods could be conducted to identify which bacterial genera are establishing in foals during the first month of life. PMID:24315809

  7. TMV mutants with poly(A) tracts of different lengths demonstrate structural variations in 3′UTR affecting viral RNAs accumulation and symptom expression

    PubMed Central

    Guo, Song; Kierzek, Elzbieta; Chen, Gang; Zhou, Yi-Jun; Wong, Sek-Man

    2015-01-01

    The upstream pseudoknots domain (UPD) of Tobacco mosaic virus (TMV) is located at the 3′-untranslated region (UTR). It plays an important role in virus replication and translation. To determine the importance of UPD and 3′-UTR, and the effects of introduced RNA elements in TMV 3′-UTR, a series of TMV mutants with internal poly(A) tract upstream of UPD was constructed for structural analysis by selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE). TMV(24A+UPD) and TMV(42A+UPD) formed a similar structure as that of TMV 3′-UTR, but TMV(62A+UPD) structures altered by the introduced poly(A) tract. In addition, TMV(24A+UPD) had a higher viral RNAs accumulation than TMV in N. benthamiana protoplasts, and induced lethal symptoms in the infected plants. TMV(62A+UPD) showed a drastically reduced accumulation, its coat protein was undetectable in protoplasts, and the inoculated plants remained symptomless. This study analyzed the structures of 3′-UTR of TMV and found that the longer poly(A) tract introduced upstream of UPD reduced viral RNAs accumulation and induced milder symptoms in N. benthamiana. In conclusion, different lengths of the internal poly(A) tract introduced into the TMV 3′UTR lead to structural variations that affect virus accumulation and symptom expression. PMID:26678425

  8. Predicting sRNAs and their targets in bacteria.

    PubMed

    Li, Wuju; Ying, Xiaomin; Lu, Qixuan; Chen, Linxi

    2012-10-01

    Bacterial small RNAs (sRNAs) are an emerging class of regulatory RNAs of about 40-500 nucleotides in length and, by binding to their target mRNAs or proteins, get involved in many biological processes such as sensing environmental changes and regulating gene expression. Thus, identification of bacterial sRNAs and their targets has become an important part of sRNA biology. Current strategies for discovery of sRNAs and their targets usually involve bioinformatics prediction followed by experimental validation, emphasizing a key role for bioinformatics prediction. Here, therefore, we provided an overview on prediction methods, focusing on the merits and limitations of each class of models. Finally, we will present our thinking on developing related bioinformatics models in future. PMID:23200137

  9. Structural Studies of Bacterial Enzymes and their Relation to Antibiotic Resistance Mechanisms - Final Paper

    SciTech Connect

    Maltz, Lauren

    2015-08-27

    By using protein crystallography and X-ray diffraction, structures of bacterial enzymes were solved to gain a better understanding of how enzymatic modification acts as an antibacterial resistance mechanism. Aminoglycoside phosphotransferases (APHs) are one of three aminoglycoside modifying enzymes that confer resistance to the aminoglycoside antibiotics via enzymatic modification, rendering many drugs obsolete. Specifically, the APH(2”) family vary in their substrate specificities and also in their preference for the phosphate donor (ADP versus GDP). By solving the structures of members of the APH(2”) family of enzymes, we can see how domain movements are important to their substrate specificity. Our structure of the ternary complex of APH(2”)-IIIa with GDP and kanamycin, when compared to the known structures of APH(2”)-IVa, reveals that there are real physical differences between these two enzymes, a structural finding that explains why the two enzymes differ in their preferences for certain aminoglycosides. Another important group of bacterial resistance enzymes are the Class D β- lactamases. Oxacillinase carbapenemases (OXAs) are part of this enzyme class and have begun to confer resistance to ‘last resort’ drugs, most notably carbapenems. Our structure of OXA-143 shows that the conformational flexibility of a conserved hydrophobic residue in the active site (Val130) serves to control the entry of a transient water molecule responsible for a key step in the enzyme’s mechanism. Our results provide insight into the structural mechanisms of these two different enzymes

  10. Ecological structuring of bacterial and archaeal taxa in surface ocean waters.

    PubMed

    Yilmaz, Pelin; Iversen, Morten H; Hankeln, Wolfgang; Kottmann, Renzo; Quast, Christian; Glöckner, Frank O

    2012-08-01

    The Global Ocean Sampling (GOS) expedition is currently the largest and geographically most comprehensive metagenomic dataset, including samples from the Atlantic, Pacific, and Indian Oceans. This study makes use of the wide range of environmental conditions and habitats encompassed within the GOS sites in order to investigate the ecological structuring of bacterial and archaeal taxon ranks. Community structures based on taxonomically classified 16S ribosomal RNA (rRNA) gene fragments at phylum, class, order, family, and genus rank levels were examined using multivariate statistical analysis, and the results were inspected in the context of oceanographic environmental variables and structured habitat classifications. At all taxon rank levels, community structures of neritic, oceanic, estuarine biomes, as well as other exotic biomes (salt marsh, lake, mangrove), were readily distinguishable from each other. A strong structuring of the communities with chlorophyll a concentration and a weaker yet significant structuring with temperature and salinity were observed. Furthermore, there were significant correlations between community structures and habitat classification. These results were used for further investigation of one-to-one relationships between taxa and environment and provided indications for ecological preferences shaped by primary production for both cultured and uncultured bacterial and archaeal clades. PMID:22416918

  11. Inhibition of Bacterial RNase P RNA by Phenothiazine Derivatives.

    PubMed

    Wu, Shiying; Mao, Guanzhong; Kirsebom, Leif A

    2016-01-01

    There is a need to identify novel scaffolds and targets to develop new antibiotics. Methylene blue is a phenothiazine derivative, and it has been shown to possess anti-malarial and anti-trypanosomal activities. Here, we show that different phenothiazine derivatives and pyronine G inhibited the activities of three structurally different bacterial RNase P RNAs (RPRs), including that from Mycobacterium tuberculosis, with Ki values in the lower μM range. Interestingly, three antipsychotic phenothiazines (chlorpromazine, thioridazine, and trifluoperazine), which are known to have antibacterial activities, also inhibited the activity of bacterial RPRs, albeit with higher Ki values than methylene blue. Phenothiazines also affected lead(II)-induced cleavage of bacterial RPR and inhibited yeast tRNA(Phe), indicating binding of these drugs to functionally important regions. Collectively, our findings provide the first experimental data showing that long, noncoding RNAs could be targeted by different phenothiazine derivatives. PMID:27618117

  12. Two novel members of the LhrC family of small RNAs in Listeria monocytogenes with overlapping regulatory functions but distinctive expression profiles.

    PubMed

    Mollerup, Maria Storm; Ross, Joseph Andrew; Helfer, Anne-Catherine; Meistrup, Kristine; Romby, Pascale; Kallipolitis, Birgitte Haahr

    2016-09-01

    Multicopy small RNAs (sRNAs) have gained recognition as an important feature of bacterial gene regulation. In the human pathogen Listeria monocytogenes, 5 homologous sRNAs, called LhrC1-5, control gene expression by base pairing to target mRNAs though 3 conserved UCCC motifs common to all 5 LhrCs. We show here that the sRNAs Rli22 and Rli33-1 are structurally and functionally related to LhrC1-5, expanding the LhrC family to 7 members, which makes it the largest multicopy sRNA family reported so far. Rli22 and Rli33-1 both contain 2 UCCC motifs important for post-transcriptional repression of 3 LhrC target genes. One such target, oppA, encodes a virulence-associated oligo-peptide binding protein. Like LhrC1-5, Rli22 and Rli33-1 employ their UCCC motifs to recognize the Shine-Dalgarno region of oppA mRNA and prevent formation of the ribosomal complex, demonstrating that the 7 sRNAs act in a functionally redundant manner. However, differential expression profiles of the sRNAs under infection-relevant conditions suggest that they might also possess non-overlapping functions. Collectively, this makes the LhrC family a unique case for studying the purpose of sRNA multiplicity in the context of bacterial virulence. PMID:27400116

  13. miRNAs in brain development

    SciTech Connect

    Petri, Rebecca; Malmevik, Josephine; Fasching, Liana; Åkerblom, Malin; Jakobsson, Johan

    2014-02-01

    MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the post-transcriptional level. In the brain, a large number of miRNAs are expressed and there is a growing body of evidence demonstrating that miRNAs are essential for brain development and neuronal function. Conditional knockout studies of the core components in the miRNA biogenesis pathway, such as Dicer and DGCR8, have demonstrated a crucial role for miRNAs during the development of the central nervous system. Furthermore, mice deleted for specific miRNAs and miRNA-clusters demonstrate diverse functional roles for different miRNAs during the development of different brain structures. miRNAs have been proposed to regulate cellular functions such as differentiation, proliferation and fate-determination of neural progenitors. In this review we summarise the findings from recent studies that highlight the importance of miRNAs in brain development with a focus on the mouse model. We also discuss the technical limitations of current miRNA studies that still limit our understanding of this family of non-coding RNAs and propose the use of novel and refined technologies that are needed in order to fully determine the impact of specific miRNAs in brain development. - Highlights: • miRNAs are essential for brain development and neuronal function. • KO of Dicer is embryonically lethal. • Conditional Dicer KO results in defective proliferation or increased apoptosis. • KO of individual miRNAs or miRNA families is necessary to determine function.

  14. Wheat and Rice Growth Stages and Fertilization Regimes Alter Soil Bacterial Community Structure, But Not Diversity

    PubMed Central

    Wang, Jichen; Xue, Chao; Song, Yang; Wang, Lei; Huang, Qiwei; Shen, Qirong

    2016-01-01

    Maintaining soil fertility and the microbial communities that determine fertility is critical to sustainable agricultural strategies, and the use of different organic fertilizer (OF) regimes represents an important practice in attempts to preserve soil quality. However, little is known about the dynamic response of bacterial communities to fertilization regimes across crop growth stages. In this study, we examined microbial community structure and diversity across eight representative growth stages of wheat-rice rotation under four different fertilization treatments: no nitrogen fertilizer (NNF), chemical fertilizer (CF), organic–inorganic mixed fertilizer (OIMF), and OF. Quantitative PCR (QPCR) and high-throughput sequencing of bacterial 16S rRNA gene fragments revealed that growth stage as the best predictor of bacterial community abundance and structure. Additionally, bacterial community compositions differed between wheat and rice rotations. Relative to soils under wheat rotation, soils under rice rotation contained higher relative abundances (RA) of anaerobic and mesophilic microbes and lower RA of aerophilic microbes. With respect to fertilization regime, NNF plots had a higher abundance of nitrogen–fixing Cyanobacteria. OIMF had a lower abundance of ammonia-oxidizing Thaumarchaeota compared with CF. Application of chemical fertilizers (CF and OIMF treatments) significantly increased the abundance of some generally oligotrophic bacteria such those belonging to the Acidobacteria, while more copiotrophic of the phylum Proteobacteria increased with OF application. A high correlation coefficient was found when comparing RA of Acidobacteria based upon QPCR vs. sequence analysis, yet poor correlations were found for the α- and β- Proteobacteria, highlighting the caution required when interpreting these molecular data. In total, crop, fertilization scheme and plant developmental stage all influenced soil microbial community structure, but not total levels of

  15. Wheat and Rice Growth Stages and Fertilization Regimes Alter Soil Bacterial Community Structure, But Not Diversity.

    PubMed

    Wang, Jichen; Xue, Chao; Song, Yang; Wang, Lei; Huang, Qiwei; Shen, Qirong

    2016-01-01

    Maintaining soil fertility and the microbial communities that determine fertility is critical to sustainable agricultural strategies, and the use of different organic fertilizer (OF) regimes represents an important practice in attempts to preserve soil quality. However, little is known about the dynamic response of bacterial communities to fertilization regimes across crop growth stages. In this study, we examined microbial community structure and diversity across eight representative growth stages of wheat-rice rotation under four different fertilization treatments: no nitrogen fertilizer (NNF), chemical fertilizer (CF), organic-inorganic mixed fertilizer (OIMF), and OF. Quantitative PCR (QPCR) and high-throughput sequencing of bacterial 16S rRNA gene fragments revealed that growth stage as the best predictor of bacterial community abundance and structure. Additionally, bacterial community compositions differed between wheat and rice rotations. Relative to soils under wheat rotation, soils under rice rotation contained higher relative abundances (RA) of anaerobic and mesophilic microbes and lower RA of aerophilic microbes. With respect to fertilization regime, NNF plots had a higher abundance of nitrogen-fixing Cyanobacteria. OIMF had a lower abundance of ammonia-oxidizing Thaumarchaeota compared with CF. Application of chemical fertilizers (CF and OIMF treatments) significantly increased the abundance of some generally oligotrophic bacteria such those belonging to the Acidobacteria, while more copiotrophic of the phylum Proteobacteria increased with OF application. A high correlation coefficient was found when comparing RA of Acidobacteria based upon QPCR vs. sequence analysis, yet poor correlations were found for the α- and β- Proteobacteria, highlighting the caution required when interpreting these molecular data. In total, crop, fertilization scheme and plant developmental stage all influenced soil microbial community structure, but not total levels of alpha

  16. Interaction of polyphemusin I and structural analogs with bacterial membranes, lipopolysaccharide, and lipid monolayers.

    PubMed

    Zhang, L; Scott, M G; Yan, H; Mayer, L D; Hancock, R E

    2000-11-28

    Three structural variants (PV5, PV7, and PV8) of the horseshoe crab cationic antimicrobial peptide polyphemusin I were designed with improved amphipathic profiles. Circular dichroism spectroscopy analysis indicated that in phosphate buffer polyphemusin I, PV7, and PV8 displayed the spectrum of a type II beta-turn-rich structure, but, like polyphemusin I, all three variants adopted a typical beta-sheet structure in an anionic lipid environment. Both polyphemusin I and variants were potent broad spectrum antimicrobials that were clearly bactericidal at their minimal inhibitory concentrations. The variants were moderately less active in vitro but more effective in animal models. Moreover, these variants exhibited delayed bacterial killing, whereas polyphemusin I killed Escherichia coli UB1005 within 5 min at 2.5 microg/mL. All the peptides showed similar abilities to bind to bacterial lipopolysaccharide (LPS) and permeabilize bacterial outer membranes. Consistent with this was the observation that all peptides significantly inhibited cytokine production by LPS-stimulated macrophages and penetrated polyanionic LPS monolayers to similar extents. None of the peptides had affinity for neutral lipids as evident from both tryptophan fluorescence spectroscopy and Langmuir monolayer analysis. As compared to polyphemusin I, all variants showed reduced ability to interact with anionic lipids, and the hemolytic activity of the variants was decreased by 2-4-fold. In contrast, polyphemusin I efficiently depolarized the cytoplasmic membrane of E. coli, as assessed using a membrane potential sensitive fluorescent dye 3,3-dipropylthiacarbocyanine (diSC(3)5) assay, but the variants showed a substantially delayed and decreased depolarizing ability. The coincident assessment of cell viability indicated that depolarization of the bacterial cytoplasmic membrane potential by polyphemusin I occurred prior to lethal damage to cells. Our data suggest that increase of amphipathicity of beta

  17. Effect of streptomycin treatment on bacterial community structure in the apple phyllosphere.

    PubMed

    Yashiro, Erika; McManus, Patricia S

    2012-01-01

    We studied the effect of many years of streptomycin use in apple orchards on the proportion of phyllosphere bacteria resistant to streptomycin and bacterial community structure. Leaf samples were collected during early July through early September from four orchards that had been sprayed with streptomycin during spring of most years for at least 10 years and four orchards that had not been sprayed. The percentage of cultured phyllosphere bacteria resistant to streptomycin at non-sprayed orchards (mean of 65%) was greater than at sprayed orchards (mean of 50%) (P = 0.0271). For each orchard, a 16S rRNA gene clone library was constructed from leaf samples. Proteobacteria dominated the bacterial communities at all orchards, accounting for 71 of 104 OTUs (determined at 97% sequence similarity) and 93% of all sequences. The genera Massilia, Methylobacterium, Pantoea, Pseudomonas, and Sphingomonas were shared across all sites. Shannon and Simpson's diversity indices and Pielou's evenness index were similar among orchards regardless of streptomycin use. Analysis of Similarity (ANOSIM) indicated that long-term streptomycin treatment did not account for the observed variability in community structure among orchards (R = -0.104, P = 0.655). Other variables, including time of summer, temperature and time at sampling, and relative distance of the orchards from each other, also had no significant effect on bacterial community structure. We conclude that factors other than streptomycin exposure drive both the proportion of streptomycin-resistant bacteria and phylogenetic makeup of bacterial communities in the apple phyllosphere in middle to late summer. PMID:22629357

  18. Bacterial community structure in treated sewage sludge with mesophilic and thermophilic anaerobic digestion.

    PubMed

    Stiborova, Hana; Wolfram, Jan; Demnerova, Katerina; Macek, Tomas; Uhlik, Ondrej

    2015-11-01

    Stabilized sewage sludge is applied to agricultural fields and farmland due to its high organic matter content. The aim of this study was to investigate the effects of two types of sludge stabilization, mesophilic anaerobic digestion (MAD) and thermophilic anaerobic digestion (TAD), on bacterial communities in sludge, including the presence of pathogenic microorganisms. Bacterial community structure and phylogenetic diversity were analyzed in four sewage sludge samples from the Czech Republic. Analysis of 16S ribosomal RNA (rRNA) genes showed that investigated sludge samples harbor diverse bacterial populations with only a few taxa present across all samples. Bacterial diversity was higher in sludge samples after MAD versus TAD treatment, and communities in MAD-treated sludge shared the highest genetic similarities. In all samples, the bacterial community was dominated by reads affiliated with Proteobacteria. The sludge after TAD treatment had considerably higher number of reads of thermotolerant/thermophilic taxa, such as the phyla Deinococcus-Thermus and Thermotogae or the genus Coprothermobacter. Only one operational taxonomic unit (OTU), which clustered with Rhodanobacter, was detected in all communities at a relative abundance >1 %. All of the communities were screened for the presence of 16S rRNA gene sequences of pathogenic bacteria using a database of 122 pathogenic species and ≥98 % identity threshold. The abundance of such sequences ranged between 0.23 and 1.57 % of the total community, with lower numbers present after the TAD treatment, indicating its higher hygienization efficiency. Sequences clustering with nontuberculous mycobacteria were present in all samples. Other detected sequences of pathogenic bacteria included Streptomyces somaliensis, Acinetobacter calcoaceticus, Alcaligenes faecalis, Gordonia spp., Legionella anisa, Bordetella bronchiseptica, Enterobacter aerogenes, Brucella melitensis, and Staphylococcus aureus. PMID:25921720

  19. Bacterial community structure on two alpine debris-covered glaciers and biogeography of Polaromonas phylotypes

    PubMed Central

    Franzetti, Andrea; Tatangelo, Valeria; Gandolfi, Isabella; Bertolini, Valentina; Bestetti, Giuseppina; Diolaiuti, Guglielmina; D'Agata, Carlo; Mihalcea, Claudia; Smiraglia, Claudio; Ambrosini, Roberto

    2013-01-01

    High-elevation cold environments are considered ideal places to test hypotheses about mechanisms of bacterial colonization and succession, and about bacterial biogeography. Debris-covered glaciers (glaciers whose ablation area is mainly covered by a continuous layer of rock debris fallen from the surrounding mountains) have never been investigated in this respect so far. We used the Illumina technology to analyse the V5 and V6 hypervariable regions of the bacterial 16S rRNA gene amplified from 38 samples collected in July and September 2009 at different distances from the terminus on two debris-covered glaciers (Miage and Belvedere—Italian Alps). Heterotrophic taxa-dominated communities and bacterial community structure changed according to ice ablation rate, organic carbon content of the debris and distance from the glacier terminus. Bacterial communities therefore change during downwards debris transport, and organic carbon of these recently exposed substrates is probably provided more by allochthonous deposition of organic matter than by primary production by autotrophic organisms. We also investigated whether phylotypes of the genus Polaromonas, which is ubiquitous in cold environments, do present a biogeographical distribution by analysing the sequences retrieved in this study together with others available in the literature. We found that the genetic distance among phylotypes increased with geographic distance; however, more focused analyses using discrete distance classes revealed that both sequences collected at sites <100 km and at sites 9400–13 500 km to each other were more similar than those collected at other distance classes. Evidences of biogeographic distribution of Polaromonas phylotypes were therefore contrasting. PMID:23535918

  20. Impact of Arsenite on the Bacterial Community Structure and Diversity in Soil

    PubMed Central

    Dong, Dian-Tao; Yamamura, Shigeki; Amachi, Seigo

    2016-01-01

    The impact of arsenite (As[III]) on the bacterial community structure and diversity in soil was determined by incubating soil slurries with 50, 500, and 5,000 μM As(III). As(III) was oxidized to arsenate (As[V]), and the microbial contribution to As(III) oxidation was 70–100%. PCR-denaturing gradient gel electrophoresis revealed that soil bacterial diversity decreased in the presence of As(III). Bacteria closely related to the family Bacillaceae were predominant in slurry spiked with 5,000 μM As(III). The population size of culturable As(III)-resistant bacteria was 37-fold higher in this slurry than in unspiked slurry (p < 0.01), indicating that high levels of As(III) stimulate the emergence of As(III)-resistant bacteria. As(III)-resistant bacteria isolated from slurry spiked with 5,000 μM As(III) were mainly affiliated with the genus Bacillus; however, no strains showed As(III)-oxidizing capacity. An As(III)-oxidizing bacterial community analysis based on As(III) oxidase gene (aioA) sequences demonstrated that diversity was the lowest in slurry spiked with 5,000 μM As(III). The deduced AioA sequences affiliated with Alphaproteobacteria accounted for 91–93% of all sequences in this slurry, among which those closely related to Bosea spp. were predominant (48–86%). These results suggest that exposure to high levels of As(III) has a significant impact on the composition and diversity of the soil bacterial community, including the As(III)-oxidizing bacterial community. Certain As(III)-oxidizing bacteria with strong As(III) resistance may be enriched under high As(III) levels, while more sensitive As(III) oxidizers are eliminated under these conditions. PMID:26903368

  1. Phaeocystis antarctica blooms strongly influence bacterial community structures in the Amundsen Sea polynya

    PubMed Central

    Delmont, Tom O.; Hammar, Katherine M.; Ducklow, Hugh W.; Yager, Patricia L.; Post, Anton F.

    2014-01-01

    Rising temperatures and changing winds drive the expansion of the highly productive polynyas (open water areas surrounded by sea ice) abutting the Antarctic continent. Phytoplankton blooms in polynyas are often dominated by the haptophyte Phaeocystis antarctica, and they generate the organic carbon that enters the resident microbial food web. Yet, little is known about how Phaeocystis blooms shape bacterial community structures and carbon fluxes in these systems. We identified the bacterial communities that accompanied a Phaeocystis bloom in the Amundsen Sea polynya during the austral summers of 2007–2008 and 2010–2011. These communities are distinct from those determined for the Antarctic Circumpolar Current (ACC) and off the Palmer Peninsula. Diversity patterns for most microbial taxa in the Amundsen Sea depended on location (e.g., waters abutting the pack ice near the shelf break and at the edge of the Dotson glacier) and depth, reflecting different niche adaptations within the confines of this isolated ecosystem. Inside the polynya, P. antarctica coexisted with the bacterial taxa Polaribacter sensu lato, a cryptic Oceanospirillum, SAR92 and Pelagibacter. These taxa were dominated by a single oligotype (genotypes partitioned by Shannon entropy analysis) and together contributed up to 73% of the bacterial community. Size fractionation of the bacterial community [<3 μm (free-living bacteria) vs. >3 μm (particle-associated bacteria)] identified several taxa (especially SAR92) that were preferentially associated with Phaeocystis colonies, indicative of a distinct role in Phaeocystis bloom ecology. In contrast, particle-associated bacteria at 250 m depth were enriched in Colwellia and members of the Cryomorphaceae suggesting that they play important roles in the decay of Phaeocystis blooms. PMID:25566197

  2. Experimental RNomics in Aquifex aeolicus: identification of small non-coding RNAs and the putative 6S RNA homolog

    PubMed Central

    Willkomm, Dagmar K.; Minnerup, Jens; Hüttenhofer, Alexander; Hartmann, Roland K.

    2005-01-01

    By an experimental RNomics approach, we have generated a cDNA library from small RNAs expressed from the genome of the hyperthermophilic bacterium Aquifex aeolicus. The library included RNAs that were antisense to mRNAs and tRNAs as well as RNAs encoded in intergenic regions. Substantial steady-state levels in A.aeolicus cells were confirmed for several of the cloned RNAs by northern blot analysis. The most abundant intergenic RNA of the library was identified as the 6S RNA homolog of A.aeolicus. Although shorter in size (150 nt) than its γ-proteobacterial homologs (∼185 nt), it is predicted to have the most stable structure among known 6S RNAs. As in the γ-proteobacteria, the A.aeolicus 6S RNA gene (ssrS) is located immediately upstream of the ygfA gene encoding a widely conserved 5-formyltetrahydrofolate cyclo-ligase. We identifed novel 6S RNA candidates within the γ-proteobacteria but were unable to identify reasonable 6S RNA candidates in other bacterial branches, utilizing mfold analyses of the region immediately upstream of ygfA combined with 6S RNA blastn searches. By RACE experiments, we mapped the major transcription initiation site of A.aeolicus 6S RNA primary transcripts, located within the pheT gene preceding ygfA, as well as three processing sites. PMID:15814812

  3. Diet is the primary determinant of bacterial community structure in the guts of higher termites.

    PubMed

    Mikaelyan, Aram; Dietrich, Carsten; Köhler, Tim; Poulsen, Michael; Sillam-Dussès, David; Brune, Andreas

    2015-10-01

    The gut microbiota of termites plays critical roles in the symbiotic digestion of lignocellulose. While phylogenetically 'lower termites' are characterized by a unique association with cellulolytic flagellates, higher termites (family Termitidae) harbour exclusively prokaryotic communities in their dilated hindguts. Unlike the more primitive termite families, which primarily feed on wood, they have adapted to a variety of lignocellulosic food sources in different stages of humification, ranging from sound wood to soil organic matter. In this study, we comparatively analysed representatives of different taxonomic lineages and feeding groups of higher termites to identify the major drivers of bacterial community structure in the termite gut, using amplicon libraries of 16S rRNA genes from 18 species of higher termites. In all analyses, the wood-feeding species were clearly separated from humus and soil feeders, irrespective of their taxonomic affiliation, offering compelling evidence that diet is the primary determinant of bacterial community structure. Within each diet group, however, gut communities of termites from the same subfamily were more similar than those of distantly related species. A highly resolved classification using a curated reference database revealed only few genus-level taxa whose distribution patterns indicated specificity for certain host lineages, limiting any possible cospeciation between the gut microbiota and host to short evolutionary timescales. Rather, the observed patterns in the host-specific distribution of the bacterial lineages in termite guts are best explained by diet-related differences in the availability of microhabitats and functional niches. PMID:26348261

  4. The Structure of Resting Bacterial Populations in Soil and Subsoil Permafrost

    NASA Astrophysics Data System (ADS)

    Soina, Vera S.; Mulyukin, Andrei L.; Demkina, Elena V.; Vorobyova, Elena A.; El-Registan, Galina I.

    2004-09-01

    The structure of individual cells in microbial populations in situ of the Arctic and Antarctic permafrost was studied by scanning and transmission electron microscopy methods and compared with that of cyst-like resting forms generated under special conditions by the non-sporeforming bacteria Arthrobacter and Micrococcus isolated from the permafrost. Electron microscopy examination of microorganisms in situ revealed several types of bacterial cells having no signs of damage, including "dwarf" curved forms similar to nanoforms. Intact bacterial cells in situ and frozen cultures of the permafrost isolates differed from vegetative cells by thickened cell walls, the altered structure of cytoplasm, and the compact nucleoid, and were similar in these features to cyst-like resting forms of non-spore-forming "permafrost" bacterial strains of Arthrobacter and Micrococcus spp. Cyst-like cells, being resistant to adverse external factors, are regarded as being responsible for survival of the non-spore-formers under prolonged exposure to subzero temperatures and can be a target to search for living microorganisms in natural environments both on the Earth and on extraterrestrial bodies.

  5. Small RNAs in Xylella fastidiosa and their epidemiological applications

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial non-coding small RNAs (sRNAs) have attracted considerable attention due to their roles in regulating numerous cellular processes including survival, adaptation and pathogenesis. Sequence variation in sRNA genes reflect a previously unrecognized source of genomic diversity in bacteria. Xy...

  6. In vivo deuteration of a native bacterial biopolymer for structural elucidation using SANS

    NASA Astrophysics Data System (ADS)

    Holden, P. J.; Russell, R. A.; Stone, D. J. M.; Garvey, C. J.; Foster, L. J. R.

    2004-07-01

    In order to facilitate future structural studies, biodeuteration of bacterial polyhydroxyalkanoates (PHAs) was investigated. We report here the in vivo deuteration of poly 3-hydroxyoctanoate (PHO) produced by its native host, the bacterium Pseudomonas oleovorans. Bacterial biomass was produced in bioreactor studies by growth on hydrogenated substrates and PHO was subsequently produced intracellularly (10-20% w/w) during batch fed growth on deuterated octanoic acid under oxygen limitation. GC-MS analyses of the PHO demonstrated that 13 of the 15 hydrogen atoms had been replaced with deuterium (except in position 3), the remaining two hydrogen presumably being derived from water. A SANS contrast variation study was conducted on whole cells and the results indicate the potential to discriminate inclusion bodies formed from deuterated precursor from an otherwise hydrogenated background.

  7. Layered structure of bacterial aggregates produced in an upflow anaerobic sludge bed and filter reactor

    SciTech Connect

    MacLeod, F.A.; Guiot, S.R.; Costerton, J.W. )

    1990-06-01

    The ultrastructure of bacterial granules that were maintained in an upflow anaerobic sludge bed and filter reactor was examined. The reactor was fed a sucrose medium, and it was operated at 35{degrees}C. Scanning and transmission electron microscopy revealed that the granular aggregates were three-layered structures. The exterior layer of the granule contained a very heterogeneous population that included rods, cocci, and filaments of various sizes. The middle layer consisted of a slightly less heterogeneous population than the exterior layer. A more ordered arrangement, made up predominantly of bacterial rods, was evident in this second layer. The third layer formed the internal core of the granules. It consisted of large numbers of Methanothrix-like cells. Large cavities, indicative of vigorous gas production, were evident in the third layer. On the basis of these ultrastructural results, a model that presents a possible explanation of granule development is offered.

  8. MinION nanopore sequencing identifies the position and structure of a bacterial antibiotic resistance island.

    PubMed

    Ashton, Philip M; Nair, Satheesh; Dallman, Tim; Rubino, Salvatore; Rabsch, Wolfgang; Mwaigwisya, Solomon; Wain, John; O'Grady, Justin

    2015-03-01

    Short-read, high-throughput sequencing technology cannot identify the chromosomal position of repetitive insertion sequences that typically flank horizontally acquired genes such as bacterial virulence genes and antibiotic resistance genes. The MinION nanopore sequencer can produce long sequencing reads on a device similar in size to a USB memory stick. Here we apply a MinION sequencer to resolve the structure and chromosomal insertion site of a composite antibiotic resistance island in Salmonella Typhi Haplotype 58. Nanopore sequencing data from a single 18-h run was used to create a scaffold for an assembly generated from short-read Illumina data. Our results demonstrate the potential of the MinION device in clinical laboratories to fully characterize the epidemic spread of bacterial pathogens. PMID:25485618

  9. Soil Respiration and Bacterial Structure and Function after 17 Years of a Reciprocal Soil Transplant Experiment

    PubMed Central

    Bond-Lamberty, Ben; Bolton, Harvey; Fansler, Sarah; Heredia-Langner, Alejandro; Liu, Chongxuan; McCue, Lee Ann; Bailey, Vanessa

    2016-01-01

    The effects of climate change on soil organic matter—its structure, microbial community, carbon storage, and respiration response—remain uncertain and widely debated. In addition, the effects of climate changes on ecosystem structure and function are often modulated or delayed, meaning that short-term experiments are not sufficient to characterize ecosystem responses. This study capitalized on a long-term reciprocal soil transplant experiment to examine the response of dryland soils to climate change. The two transplant sites were separated by 500 m of elevation on the same mountain slope in eastern Washington state, USA, and had similar plant species and soil types. We resampled the original 1994 soil transplants and controls, measuring CO2 production, temperature response, enzyme activity, and bacterial community structure after 17 years. Over a laboratory incubation of 100 days, reciprocally transplanted soils respired roughly equal cumulative amounts of carbon as non-transplanted controls from the same site. Soils transplanted from the hot, dry, lower site to the cooler and wetter (difference of -5°C monthly maximum air temperature, +50 mm yr-1 precipitation) upper site exhibited almost no respiratory response to temperature (Q10 of 1.1), but soils originally from the upper, cooler site had generally higher respiration rates. The bacterial community structure of transplants did not differ significantly from that of untransplanted controls, however. Slight differences in local climate between the upper and lower Rattlesnake locations, simulated with environmental control chambers during the incubation, thus prompted significant differences in microbial activity, with no observed change to bacterial structure. These results support the idea that environmental shifts can influence soil C through metabolic changes, and suggest that microbial populations responsible for soil heterotrophic respiration may be constrained in surprising ways, even as shorter- and

  10. Soil Respiration and Bacterial Structure and Function after 17 Years of a Reciprocal Soil Transplant Experiment.

    PubMed

    Bond-Lamberty, Ben; Bolton, Harvey; Fansler, Sarah; Heredia-Langner, Alejandro; Liu, Chongxuan; McCue, Lee Ann; Smith, Jeffrey; Bailey, Vanessa

    2016-01-01

    The effects of climate change on soil organic matter-its structure, microbial community, carbon storage, and respiration response-remain uncertain and widely debated. In addition, the effects of climate changes on ecosystem structure and function are often modulated or delayed, meaning that short-term experiments are not sufficient to characterize ecosystem responses. This study capitalized on a long-term reciprocal soil transplant experiment to examine the response of dryland soils to climate change. The two transplant sites were separated by 500 m of elevation on the same mountain slope in eastern Washington state, USA, and had similar plant species and soil types. We resampled the original 1994 soil transplants and controls, measuring CO2 production, temperature response, enzyme activity, and bacterial community structure after 17 years. Over a laboratory incubation of 100 days, reciprocally transplanted soils respired roughly equal cumulative amounts of carbon as non-transplanted controls from the same site. Soils transplanted from the hot, dry, lower site to the cooler and wetter (difference of -5°C monthly maximum air temperature, +50 mm yr-1 precipitation) upper site exhibited almost no respiratory response to temperature (Q10 of 1.1), but soils originally from the upper, cooler site had generally higher respiration rates. The bacterial community structure of transplants did not differ significantly from that of untransplanted controls, however. Slight differences in local climate between the upper and lower Rattlesnake locations, simulated with environmental control chambers during the incubation, thus prompted significant differences in microbial activity, with no observed change to bacterial structure. These results support the idea that environmental shifts can influence soil C through metabolic changes, and suggest that microbial populations responsible for soil heterotrophic respiration may be constrained in surprising ways, even as shorter- and

  11. Soil respiration and bacterial structure and function after 17 years of a reciprocal soil transplant experiment

    DOE PAGESBeta

    Bond-Lamberty, Benjamin; Bolton, Harvey; Fansler, Sarah J.; Heredia-Langner, Alejandro; Liu, Chongxuan; McCue, Lee Ann; Smith, Jeff L.; Bailey, Vanessa L.

    2016-03-02

    The effects of climate change on soil organic matter—its structure, microbial community, carbon storage, and respiration response—remain uncertain and widely debated. In addition, the effects of climate changes on ecosystem structure and function are often modulated or delayed, meaning that short-term experiments are not sufficient to characterize ecosystem responses. This study capitalized on a long-term reciprocal soil transplant experiment to examine the response of dryland soils to climate change. The two transplant sites were separated by 500 m of elevation on the same mountain slope in eastern Washington state, USA, and had similar plant species and soil types. We resampledmore » the original 1994 soil transplants and controls, measuring CO2 production, temperature response, enzyme activity, and bacterial community structure after 17 years. Over a laboratory incubation of 100 days, reciprocally transplanted soils respired roughly equal cumulative amounts of carbon as non-transplanted controls from the same site. Soils transplanted from the hot, dry, lower site to the cooler and wetter (difference of -5 °C monthly maximum air temperature, +50 mm yr-1precipitation) upper site exhibited almost no respiratory response to temperature (Q10 of 1.1), but soils originally from the upper, cooler site had generally higher respiration rates. The bacterial community structure of transplants did not differ significantly from that of untransplanted controls, however. Slight differences in local climate between the upper and lower Rattlesnake locations, simulated with environmental control chambers during the incubation, thus prompted significant differences in microbial activity, with no observed change to bacterial structure. Lastly, these results support the idea that environmental shifts can influence soil C through metabolic changes, and suggest that microbial populations responsible for soil heterotrophic respiration may be constrained in surprising ways, even

  12. Effect of physical sediments reworking on hydrocarbon degradation and bacterial community structure in marine coastal sediments.

    PubMed

    Duran, Robert; Bonin, Patricia; Jezequel, Ronan; Dubosc, Karine; Gassie, Claire; Terrisse, Fanny; Abella, Justine; Cagnon, Christine; Militon, Cecile; Michotey, Valérie; Gilbert, Franck; Cuny, Philippe; Cravo-Laureau, Cristiana

    2015-10-01

    The present study aimed to examine whether the physical reworking of sediments by harrowing would be suitable for favouring the hydrocarbon degradation in coastal marine sediments. Mudflat sediments were maintained in mesocosms under conditions as closer as possible to those prevailing in natural environments with tidal cycles. Sediments were contaminated with Ural blend crude oil, and in half of them, harrowing treatment was applied in order to mimic physical reworking of surface sediments. Hydrocarbon distribution within the sediment and its removal was followed during 286 days. The harrowing treatment allowed hydrocarbon compounds to penetrate the first 6 cm of the sediments, and biodegradation indexes (such as n-C18/phytane) indicated that biodegradation started 90 days before that observed in untreated control mesocosms. However, the harrowing treatment had a severe impact on benthic organisms reducing drastically the macrofaunal abundance and diversity. In the harrowing-treated mesocosms, the bacterial abundance, determined by 16S rRNA gene Q-PCR, was slightly increased; and terminal restriction fragment length polymorphism (T-RFLP) analyses of 16S rRNA genes showed distinct and specific bacterial community structure. Co-occurrence network and canonical correspondence analyses (CCA) based on T-RFLP data indicated the main correlations between bacterial operational taxonomic units (OTUs) as well as the associations between OTUs and hydrocarbon compound contents further supported by clustered correlation (ClusCor) analysis. The analyses highlighted the OTUs constituting the network structural bases involved in hydrocarbon degradation. Negative correlations indicated the possible shifts in bacterial communities that occurred during the ecological succession. PMID:25847440

  13. Structural Basis for Translocation of a Biofilm-supporting Exopolysaccharide across the Bacterial Outer Membrane.

    PubMed

    Wang, Yan; Andole Pannuri, Archana; Ni, Dongchun; Zhou, Haizhen; Cao, Xiou; Lu, Xiaomei; Romeo, Tony; Huang, Yihua

    2016-05-01

    The partially de-N-acetylated poly-β-1,6-N-acetyl-d-glucosamine (dPNAG) polymer serves as an intercellular biofilm adhesin that plays an essential role for the development and maintenance of integrity of biofilms of diverse bacterial species. Translocation of dPNAG across the bacterial outer membrane is mediated by a tetratricopeptide repeat-containing outer membrane protein, PgaA. To understand the molecular basis of dPNAG translocation, we determined the crystal structure of the C-terminal transmembrane domain of PgaA (residues 513-807). The structure reveals that PgaA forms a 16-strand transmembrane β-barrel, closed by four loops on the extracellular surface. Half of the interior surface of the barrel that lies parallel to the translocation pathway is electronegative, suggesting that the corresponding negatively charged residues may assist the secretion of the positively charged dPNAG polymer. In vivo complementation assays in a pgaA deletion bacterial strain showed that a cluster of negatively charged residues proximal to the periplasm is necessary for biofilm formation. Biochemical analyses further revealed that the tetratricopeptide repeat domain of PgaA binds directly to the N-deacetylase PgaB and is critical for biofilm formation. Our studies support a model in which the positively charged PgaB-bound dPNAG polymer is delivered to PgaA through the PgaA-PgaB interaction and is further targeted to the β-barrel lumen of PgaA potentially via a charge complementarity mechanism, thus priming the translocation of dPNAG across the bacterial outer membrane. PMID:26957546

  14. Bacterial Community Structure and Physiological State within an Industrial Phenol Bioremediation System

    PubMed Central

    Whiteley, Andrew S.; Bailey, Mark J.

    2000-01-01

    The structure of bacterial populations in specific compartments of an operational industrial phenol remediation system was assessed to examine bacterial community diversity, distribution, and physiological state with respect to the remediation of phenolic polluted wastewater. Rapid community fingerprinting by PCR-based denaturing gradient gel electrophoresis (DGGE) of 16S rDNA indicated highly structured bacterial communities residing in all nine compartments of the treatment plant and not exclusively within the Vitox biological reactor. Whole-cell targeting by fluorescent in situ hybridization with specific oligonucleotides (directed to the α, β and γ subclasses of the class Proteobacteria [α-, β-, and γ-Proteobacteria, respectively], the Cytophaga-Flavobacterium group, and the Pseudomonas group) tended to mirror gross changes in bacterial community composition when compared with DGGE community fingerprinting. At the whole-cell level, the treatment compartments were numerically dominated by cells assigned to the Cytophaga-Flavobacterium group and to the γ-Proteobacteria. The α subclass Proteobacteria were of low relative abundance throughout the treatment system whilst the β subclass of the Proteobacteria exhibited local dominance in several of the processing compartments. Quantitative image analyses of cellular fluorescence was used as an indicator of physiological state within the populations probed with rDNA. For cells hybridized with EUB338, the mean fluorescence per cell decreased with increasing phenolic concentration, indicating the strong influence of the primary pollutant upon cellular rRNA content. The γ subclass of the Proteobacteria had a ribosome content which correlated positively with total phenolics and thiocyanate. While members of the Cytophaga-Flavobacterium group were numerically dominant in the processing system, their abundance and ribosome content data for individual populations did not correlate with any of the measured chemical

  15. Genetic control of bacterial biofilms.

    PubMed

    Wolska, Krystyna I; Grudniak, Anna M; Rudnicka, Zofia; Markowska, Katarzyna

    2016-05-01

    Nearly all bacterial species, including pathogens, have the ability to form biofilms. Biofilms are defined as structured ecosystems in which microbes are attached to surfaces and embedded in a matrix composed of polysaccharides, eDNA, and proteins, and their development is a multistep process. Bacterial biofilms constitute a large medical problem due to their extremely high resistance to various types of therapeutics, including conventional antibiotics. Several environmental and genetic signals control every step of biofilm development and dispersal. From among the latter, quorum sensing, cyclic diguanosine-5'-monophosphate, and small RNAs are considered as the main regulators. The present review describes the control role of these three regulators in the life cycles of biofilms built by Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella enterica serovar Typhimurium, and Vibrio cholerae. The interconnections between their activities are shown. Compounds and strategies which target the activity of these regulators, mainly quorum sensing inhibitors, and their potential role in therapy are also assessed. PMID:26294280

  16. Expansion of Noncanonical V-Arm-Containing tRNAs in Eukaryotes.

    PubMed

    Hamashima, Kiyofumi; Tomita, Masaru; Kanai, Akio

    2016-02-01

    Transfer RNA (tRNA) is essential for the translation of genetic information into proteins, and understanding its molecular evolution is important if we are to understand the genetic code. In general, long variable-arm (V-arm) structures form in tRNA(Leu), tRNA(Ser), and bacterial and organellar tRNA(Tyr). However, as we have previously reported, noncanonical V-arms occur in nematode tRNA(Gly) and tRNA(Ile), and potentially affect translational fidelity. Here, we comprehensively analyzed 69 eukaryotic genome sequences and examined the evolutionary divergence of the V-arm-containing tRNAs. In total, 253 V-arm-containing tRNAs, with neither leucine nor serine anticodons, were identified in organisms ranging from nematodes to fungi, plants, and vertebrates. We defined them as "noncanonical V-arm-containing tRNAs" (nov-tRNAs). Moreover, 2,415 nov-tRNA-like sequences lacking some of the conserved features of tRNAs were also identified, largely in vertebrate genomes. These nov-tRNA/nov-tRNA-like sequences can be categorized into three types, based on differences in their possible evolutionary origins. The type A nov-tRNAs in nematodes probably evolved not only from tRNA(Leu) but also from tRNA(Ser) and other isotypes on several independent occasions. The type B nov-tRNAs are dispersed abundantly throughout vertebrate genomes, and seem to have originated from retrotransposable elements. The type C nov-tRNAs may have been acquired from plant chloroplasts or from bacteria through horizontal transfer. Our findings provide unexpected insight into the evolution of the tRNA molecule, which was diverse and occurred independently in nematodes, vertebrates, and plants. PMID:26545920

  17. Functional roles of non-coding Y RNAs

    PubMed Central

    Kowalski, Madzia P.; Krude, Torsten

    2015-01-01

    Non-coding RNAs are involved in a multitude of cellular processes but the biochemical function of many small non-coding RNAs remains unclear. The family of small non-coding Y RNAs is conserved in vertebrates and related RNAs are present in some prokaryotic species. Y RNAs are also homologous to the newly identified family of non-coding stem-bulge RNAs (sbRNAs) in nematodes, for which potential physiological functions are only now emerging. Y RNAs are essential for the initiation of chromosomal DNA replication in vertebrates and, when bound to the Ro60 protein, they are involved in RNA stability and cellular responses to stress in several eukaryotic and prokaryotic species. Additionally, short fragments of Y RNAs have recently been identified as abundant components in the blood and tissues of humans and other mammals, with potential diagnostic value. While the number of functional roles of Y RNAs is growing, it is becoming increasingly clear that the conserved structural domains of Y RNAs are essential for distinct cellular functions. Here, we review the biochemical functions associated with these structural RNA domains, as well as the functional conservation of Y RNAs in different species. The existing biochemical and structural evidence supports a domain model for these small non-coding RNAs that has direct implications for the modular evolution of functional non-coding RNAs. PMID:26159929

  18. Structural characterizations of phage antitoxin Dmd and its interactions with bacterial toxin RnlA.

    PubMed

    Wei, Yong; Gao, Zengqiang; Zhang, Heng; Dong, Yuhui

    2016-04-15

    Toxin-antitoxin (TA) loci are widespread in bacteria plasmids and chromosomes, and target various cellular functions to regulate cell growth and death. A type II TA system RnlA-RnlB from Escherichia coli is associated with phage-resistance. After the infection of bacteriophage T4 with Dmd defection, RnlA is activated by the disappearance of RnlB, resulting in the rapid degradation of T4 mRNAs. Dmd can bind to RnlA directly and neutralize RnlA toxicity to allow phage reproduction. Dmd represent a heterogenous antitoxin of RnlA replacing antitoxin RnlB. Here, we reported two structures of Dmd from T4 phage and RB69 phage. Both Dmd structures are high similar with a compacted domain composed of a four-stranded anti-parallel β-sheet and an α-helix. Chromatography and SAXS suggest Dmd forms a dimer in solution consistent with that in crystal. Structure-based mutagenesis of Dmd reveals key residues involved in RnlA-binding. Possibility cavities in Dmd used for compounds design were modeled. Our structural study revealed the recognition and inhibition mechanism of RnlA by Dmd and providing a potential laboratory phage prevention target for drug design. PMID:26972252

  19. Crystal structure of the Campylobacter jejuni Cj0090 protein reveals a novel variant of the immunoglobulin fold among bacterial lipoproteins

    PubMed Central

    Paek, Seonghee; Kawai, Fumihiro; Choi, Kyoung-Jae; Yeo, Hye-Jeong

    2012-01-01

    Bacterial lipoproteins play an important role in bacterial pathogenesis and physiology. The genome of Campylobacter jejuni, a major foodborn pathogen, is predicted to contain over 20 lipoproteins. However, the functions of the majority of C. jejuni lipoproteins remain unknown. The Cj0090 protein is encoded by a lipoprotein operon composed of cj0089, cj0090, and cj0091. Here, we report the crystal structure of Cj0090 at 1.9 Å resolution, revealing a novel variant of the immunoglobulin fold with β-sandwich architecture. The structure suggests that Cj0090 may be involved in protein-protein interactions, consistent with a possible role for bacterial lipoproteins. PMID:22987763

  20. Crystal structure of the Campylobacter jejuni Cj0090 protein reveals a novel variant of the immunoglobulin fold among bacterial lipoproteins.

    PubMed

    Paek, Seonghee; Kawai, Fumihiro; Choi, Kyoung-Jae; Yeo, Hye-Jeong

    2012-12-01

    Bacterial lipoproteins play an important role in bacterial pathogenesis and physiology. The genome of Campylobacter jejuni, a major foodborn pathogen, is predicted to contain over 20 lipoproteins. However, the functions of the majority of C. jejuni lipoproteins remain unknown. The Cj0090 protein is encoded by a lipoprotein operon composed of cj0089, cj0090, and cj0091. Here, we report the crystal structure of Cj0090 at 1.9 Å resolution, revealing a novel variant of the immunoglobulin fold with β-sandwich architecture. The structure suggests that Cj0090 may be involved in protein-protein interactions, consistent with a possible role for bacterial lipoproteins. PMID:22987763

  1. PCR Biases Distort Bacterial and Archaeal Community Structure in Pyrosequencing Datasets

    PubMed Central

    Pinto, Ameet J.; Raskin, Lutgarde

    2012-01-01

    As 16S rRNA gene targeted massively parallel sequencing has become a common tool for microbial diversity investigations, numerous advances have been made to minimize the influence of sequencing and chimeric PCR artifacts through rigorous quality control measures. However, there has been little effort towards understanding the effect of multi-template PCR biases on microbial community structure. In this study, we used three bacterial and three archaeal mock communities consisting of, respectively, 33 bacterial and 24 archaeal 16S rRNA gene sequences combined in different proportions to compare the influences of (1) sequencing depth, (2) sequencing artifacts (sequencing errors and chimeric PCR artifacts), and (3) biases in multi-template PCR, towards the interpretation of community structure in pyrosequencing datasets. We also assessed the influence of each of these three variables on α- and β-diversity metrics that rely on the number of OTUs alone (richness) and those that include both membership and the relative abundance of detected OTUs (diversity). As part of this study, we redesigned bacterial and archaeal primer sets that target the V3–V5 region of the 16S rRNA gene, along with multiplexing barcodes, to permit simultaneous sequencing of PCR products from the two domains. We conclude that the benefits of deeper sequencing efforts extend beyond greater OTU detection and result in higher precision in β-diversity analyses by reducing the variability between replicate libraries, despite the presence of more sequencing artifacts. Additionally, spurious OTUs resulting from sequencing errors have a significant impact on richness or shared-richness based α- and β-diversity metrics, whereas metrics that utilize community structure (including both richness and relative abundance of OTUs) are minimally affected by spurious OTUs. However, the greatest obstacle towards accurately evaluating community structure are the errors in estimated mean relative abundance of

  2. Creation of a S1P Lyase bacterial surrogate for structure-based drug design.

    PubMed

    Argiriadi, Maria A; Banach, David; Radziejewska, Elzbieta; Marchie, Susan; DiMauro, Jennifer; Dinges, Jurgen; Dominguez, Eric; Hutchins, Charles; Judge, Russell A; Queeney, Kara; Wallace, Grier; Harris, Christopher M

    2016-05-01

    S1P Lyase (SPL) has been described as a drug target in the treatment of autoimmune diseases. It plays an important role in maintaining intracellular levels of S1P thereby affecting T cell egress from lymphoid tissues. Several groups have already published approaches to inhibit S1P Lyase with small molecules, which in turn increase endogenous S1P concentrations resulting in immunosuppression. The use of structural biology has previously aided SPL inhibitor design. Novel construct design is at times necessary to provide a reagent for protein crystallography. Here we present a chimeric bacterial protein scaffold used for protein X-ray structures in the presence of early small molecule inhibitors. Mutations were introduced to the bacterial SPL from Symbiobacterium thermophilum which mimic the human enzyme. As a result, two mutant StSPL crystal structures resolved to 2.8Å and 2.2Å resolutions were solved and provide initial structural hypotheses for an isoxazole chemical series, whose optimization is discussed in the accompanying paper. PMID:27013389

  3. Structure and Function of the Bi-Directional Bacterial Flagellar Motor

    PubMed Central

    Morimoto, Yusuke V.; Minamino, Tohru

    2014-01-01

    The bacterial flagellum is a locomotive organelle that propels the bacterial cell body in liquid environments. The flagellum is a supramolecular complex composed of about 30 different proteins and consists of at least three parts: a rotary motor, a universal joint, and a helical filament. The flagellar motor of Escherichia coli and Salmonella enterica is powered by an inward-directed electrochemical potential difference of protons across the cytoplasmic membrane. The flagellar motor consists of a rotor made of FliF, FliG, FliM and FliN and a dozen stators consisting of MotA and MotB. FliG, FliM and FliN also act as a molecular switch, enabling the motor to spin in both counterclockwise and clockwise directions. Each stator is anchored to the peptidoglycan layer through the C-terminal periplasmic domain of MotB and acts as a proton channel to couple the proton flow through the channel with torque generation. Highly conserved charged residues at the rotor–stator interface are required not only for torque generation but also for stator assembly around the rotor. In this review, we will summarize our current understanding of the structure and function of the proton-driven bacterial flagellar motor. PMID:24970213

  4. EBV Noncoding RNAs.

    PubMed

    Skalsky, Rebecca L; Cullen, Bryan R

    2015-01-01

    EBV expresses a number of viral noncoding RNAs (ncRNAs) during latent infection, many of which have known regulatory functions and can post-transcriptionally regulate viral and/or cellular gene expression. With recent advances in RNA sequencing technologies, the list of identified EBV ncRNAs continues to grow. EBV-encoded RNAs (EBERs) , the BamHI-A rightward transcripts (BARTs) , a small nucleolar RNA (snoRNA) , and viral microRNAs (miRNAs) are all expressed during EBV infection in a variety of cell types and tumors. Recently, additional novel EBV ncRNAs have been identified. Viral miRNAs, in particular, have been under extensive investigation since their initial identification over ten years ago. High-throughput studies to capture miRNA targets have revealed a number of miRNA-regulated viral and cellular transcripts that tie into important biological networks. Functions for many EBV ncRNAs are still unknown; however, roles for many EBV miRNAs in latency and in tumorigenesis have begun to emerge. Ongoing mechanistic studies to elucidate the functions of EBV ncRNAs should unravel additional roles for ncRNAs in the viral life cycle. In this chapter, we will discuss our current knowledge of the types of ncRNAs expressed by EBV, their potential roles in viral latency, and their potential involvement in viral pathogenesis. PMID:26428375

  5. Bacterial Proteasomes

    PubMed Central

    Jastrab, Jordan B.; Darwin, K. Heran

    2015-01-01

    Interest in bacterial proteasomes was sparked by the discovery that proteasomal degradation is required for the pathogenesis of Mycobacterium tuberculosis, one of the world's deadliest pathogens. Although bacterial proteasomes are structurally similar to their eukaryotic and archaeal homologs, there are key differences in their mechanisms of assembly, activation, and substrate targeting for degradation. In this article, we compare and contrast bacterial proteasomes with their archaeal and eukaryotic counterparts, and we discuss recent advances in our understanding of how bacterial proteasomes function to influence microbial physiology. PMID:26488274

  6. Mercury and other heavy metals influence bacterial community structure in contaminated Tennessee streams

    SciTech Connect

    Vishnivetskaya, Tatiana A; Mosher, Jennifer J; Palumbo, Anthony Vito; Yang, Zamin; Podar, Mircea; Brown, Steven D; Brooks, Scott C; Gu, Baohua; Southworth, George R; Drake, Meghan M; Brandt, Craig C; Elias, Dwayne A

    2011-01-01

    High concentrations of uranium, inorganic mercury [Hg(II)], and methylmercury (MeHg) have been detected in streams located in the Department of Energy reservation in Oak Ridge, TN. To determine the potential effects of the surface water contamination on the microbial community composition, surface stream sediments were collected 7 times during the year, from 5 contaminated locations and 1 control stream. Fifty-nine samples were analyzed for bacterial community composition and geochemistry. Community characterization was based on GS 454 FLX pyrosequencing with 235 Mb of 16S rRNA gene sequence targeting the V4 region. Sorting and filtering of the raw reads resulted in 588,699 high-quality sequences with lengths of >200 bp. The bacterial community consisted of 23 phyla, including Proteobacteria (ranging from 22.9 to 58.5% per sample), Cyanobacteria (0.2 to 32.0%), Acidobacteria (1.6 to 30.6%), Verrucomicrobia (3.4 to 31.0%), and unclassified bacteria. Redundancy analysis indicated no significant differences in the bacterial community structure between midchannel and near-bank samples. Significant correlations were found between the bacterial community and seasonal as well as geochemical factors. Furthermore, several community members within the Proteobacteria group that includes sulfate-reducing bacteria and within the Verrucomicrobia group appeared to be associated positively with Hg and MeHg. This study is the first to indicate an influence of MeHg on the in situ microbial community and suggests possible roles of these bacteria in the Hg/MeHg cycle.

  7. Mercury and other heavy metals influence bacterial community structure in low-order Tennessee streams

    SciTech Connect

    Vishnivetskaya, Tatiana A; Mosher, Jennifer J; Palumbo, Anthony Vito; Podar, Mircea; Brown, Steven D; Brooks, Scott C; Southworth, George R; Drake, Meghan M; Brandt, Craig C

    2011-01-01

    High concentrations of the heavy metals U(VI) and Hg(II) as well as inorganic compounds including nitrate have contaminated streams located in the Department of Energy reservation in Oak Ridge, TN. Of particular concern is methylmercury (MeHg) as it is more neurotoxic than Hg0. Deltaproteobacteria including sulfate reducing bacteria (SRB) and iron reducing bacteria (IRB) have been generally identified as the primary methylators. In order to determine potential effects on microbial community composition by the contamination, surface stream sediments were collected 7 times during the year from 5 contaminated sites and 1 control site. Sixty samples were analyzed for bacterial community composition and geochemistry. Community characterization used GS 454 FLX pyrosequencing with 235 Mb of 16S rDNA sequence targeting the V4 region. Sorting and filtering of the raw reads resulted in 588,699 high quality sequences with lengths of >200 bp. The bacterial community was represented by 24 phyla and unclassified Bacteria including Proteobacteria (22.9-58.5%), Cyanobacteria (0.2-32.0%), Acidobacteria (1.6-30.6%), and Verrucomicrobia (3.4-31.0%). Redundancy analysis indicated there were no significant differences in the bacterial community structure between midchannel and near bank samples. However, significant correlations existed between the bacterial community and seasonal as well as geochemical variation. Further, several members of the community appear to be positively associated with MeHg including the Proteobacteria group that includes SRBs as well as Verrucomicrobia. This study is the first to indicate the influence of MeHg on an in-situ microbial community and suggests possible roles for each of these phyla in the Hg/MeHg cycle.

  8. Resistance of mRNAs with AUG-proximal nonsense mutations to nonsense-mediated decay reflects variables of mRNA structure and translational activity

    PubMed Central

    Pereira, Francisco J.C.; Teixeira, Alexandre; Kong, Jian; Barbosa, Cristina; Silva, Ana Luísa; Marques-Ramos, Ana; Liebhaber, Stephen A.; Romão, Luísa

    2015-01-01

    Nonsense-mediated mRNA decay (NMD) is a surveillance pathway that recognizes and selectively degrades mRNAs carrying premature termination codons (PTCs). The level of sensitivity of a PTC-containing mRNA to NMD is multifactorial. We have previously shown that human β-globin mRNAs carrying PTCs in close proximity to the translation initiation AUG codon escape NMD. This was called the ‘AUG-proximity effect’. The present analysis of nonsense codons in the human α-globin mRNA illustrates that the determinants of the AUG-proximity effect are in fact quite complex, reflecting the ability of the ribosome to re-initiate translation 3′ to the PTC and the specific sequence and secondary structure of the translated ORF. These data support a model in which the time taken to translate the short ORF, impacted by distance, sequence, and structure, not only modulates translation re-initiation, but also impacts on the exact boundary of AUG-proximity protection from NMD. PMID:26068473

  9. Influence of environmental variables on the structure and composition of soil bacterial communities in natural and constructed wetlands.

    PubMed

    Arroyo, Paula; Sáenz de Miera, Luis E; Ansola, Gemma

    2015-02-15

    Bacteria are key players in wetland ecosystems, however many essential aspects regarding the ecology of wetland bacterial communities remain unknown. The present study characterizes soil bacterial communities from natural and constructed wetlands through the pyrosequencing of 16S rDNA genes in order to evaluate the influence of wetland variables on bacterial community composition and structure. The results show that the composition of soil bacterial communities was significantly associated with the wetland type (natural or constructed wetland), the type of environment (lagoon, Typha or Salix) and three continuous parameters (SOM, COD and TKN). However, no clear associations were observed with soil pH. Bacterial diversity values were significantly lower in the constructed wetland with the highest inlet nutrient concentrations. The abundances of particular metabolic groups were also related to wetland characteristics. PMID:25460973

  10. Bacterial Community Structure and Dynamics During Corn-Based Bioethanol Fermentation.

    PubMed

    Li, Qing; Heist, E Patrick; Moe, Luke A

    2016-02-01

    Corn-based fuel ethanol facilities mix enzymatically treated, gelatinized corn starch with water to generate a "mash" that is used as the substrate in large-scale (∼500,000 gallon) yeast-based fermentations. In contrast to other food and beverage fermentations (e.g., cheese, wine), bioethanol production is presumed to be optimal when bacteria are absent from the fermentation-thus maximizing conversion of glucose to ethanol-yet the facilities are not sterilized. Culture-based analysis has suggested that lactic acid bacteria occupy this niche and, under certain circumstances, can outcompete the dedicated fermentation yeast for nutrients. Here, we use 16S rRNA gene amplicon sequencing to probe bacterial community structure during bioethanol fermentation. Nineteen total batches from five corn-based fuel ethanol fermentation facilities were analyzed. From each batch, five samples were taken. This includes the contents of the yeast propagation tank at inoculation, three samples taken at intervals during the fermentation, and a sample taken at the end of fermentation. Bacterial community structure was compared with time, between facility, between fermentor, between batches from the same fermentor, and against environmental variables within each fermentation. Communities were dominated by members of the Firmicutes and Proteobacteria phyla, with lactic acid bacteria dominating the communities in two of the five facilities. In the other facilities, Proteobacteria (largely members of the Pseudomonas and Escherichia-Shigella genera) outcompete the lactic acid bacteria. In most cases, the yeast propagation tank inoculum imparted a rich bacterial community, but the batches vary regarding whether this inoculum was the primary driver of the fermentation community structure. PMID:26381538

  11. Investigating the role of two iron-regulated small RNAs of Pseudomonas syringae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Small RNAs (sRNAs) have emerged as important components of many regulatory pathways and have been shown to have key roles in the regulation of iron homeostasis in a number of bacteria. To date, only a few sRNAs have been described for the bacterial plant pathogen Pseudomonas syringae pathovar tomat...

  12. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures

    PubMed Central

    Slinger, Betty L.; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M.

    2015-01-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition. PMID:26675164

  13. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures.

    PubMed

    Slinger, Betty L; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M

    2015-12-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition. PMID:26675164

  14. Effects of heavy metals and soil physicochemical properties on wetland soil microbial biomass and bacterial community structure.

    PubMed

    Zhang, Chang; Nie, Shuang; Liang, Jie; Zeng, Guangming; Wu, Haipeng; Hua, Shanshan; Liu, Jiayu; Yuan, Yujie; Xiao, Haibing; Deng, Linjing; Xiang, Hongyu

    2016-07-01

    Heavy metals (HMs) contamination is a serious environmental issue in wetland soil. Understanding the micro ecological characteristic of HMs polluted wetland soil has become a public concern. The goal of this study was to identify the effects of HMs and soil physicochemical properties on soil microorganisms and prioritize some parameters that contributed significantly to soil microbial biomass (SMB) and bacterial community structure. Bacterial community structure was analyzed by polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). Relationships between soil environment and microorganisms were analyzed by correlation analysis and redundancy analysis (RDA). The result indicated relationship between SMB and HMs was weaker than SMB and physicochemical properties. The RDA showed all eight parameters explained 74.9% of the variation in the bacterial DGGE profiles. 43.4% (contain the variation shared by Cr, Cd, Pb and Cu) of the variation for bacteria was explained by the four kinds of HMs, demonstrating HMs contamination had a significant influence on the changes of bacterial community structure. Cr solely explained 19.4% (p<0.05) of the variation for bacterial community structure, and Cd explained 17.5% (p<0.05), indicating Cr and Cd were the major factors related to bacterial community structure changes. PMID:27046142

  15. Recombination structure and genetic relatedness among members of the family Bromoviridae based on their RNAs 1 and 2 sequence analyses.

    PubMed

    Boulila, Moncef

    2009-06-01

    In determining putative recombination events and their evolution rates in the RNAs 1 and 2 of currently the known members of the family Bromoviridae, a detailed study comprising 107 accessions retrieved from the international databases, has been carried out by using RECCO and RDP v3.31beta algorithms. These programs allowed the detection of potential recombination sites in all the five virus genera composing the family Bromoviridae with various degrees of consistency. The RNAs 1 and 2 showed inferred phylogenies fully congruent and clearly delineated five clusters representing the five studied virus genera. In this respect, we proposed to classify the Ilarviruses in three distinct subgroups instead of 10 as mentioned in several reports of the International Committee on Taxonomy of Viruses where its suggestions were based on antigenic differences. Moreover, we confirmed that Alfalfa mosaic virus should be considered as a component of the Ilarvirus genus instead of being the unique representative of Alfamovirus genus. In addition, Pelargonium zonate spot and Olive latent 2 viruses fully deserve their affiliation to the family Bromoviridae. PMID:19255837

  16. Splitsville: structural and functional insights into the dynamic bacterial Z ring.

    PubMed

    Haeusser, Daniel P; Margolin, William

    2016-05-01

    Bacteria must divide to increase in number and colonize their niche. Binary fission is the most widespread means of bacterial cell division, but even this relatively simple mechanism has many variations on a theme. In most bacteria, the tubulin homologue FtsZ assembles into a ring structure, termed the Z ring, at the site of cytokinesis and recruits additional proteins to form a large protein machine - the divisome - that spans the membrane. In this Review, we discuss current insights into the regulation of the assembly of the Z ring and how the divisome drives membrane invagination and septal cell wall growth while flexibly responding to various cellular inputs. PMID:27040757

  17. Bacterial community structure in the hyperarid core of the Atacama Desert, Chile

    USGS Publications Warehouse

    Drees, Kevin P.; Neilson, Julia W.; Betancourt, Julio L.; Quade, Jay; Henderson, David A.; Pryor, Barry M.; Maier, Raina M.

    2006-01-01

    Soils from the hyperarid Atacama Desert of northern Chile were sampled along an east-west elevational transect (23.75 to 24.70 degrees S) through the driest sector to compare the relative structure of bacterial communities. Analysis of denaturing gradient gel electrophoresis (DGGE) profiles from each of the samples revealed that microbial communities from the extreme hyperarid core of the desert clustered separately from all of the remaining communities. Bands sequenced from DGGE profiles of two samples taken at a 22-month interval from this core region revealed the presence of similar populations dominated by bacteria from the Gemmatimonadetes and Planctomycetes phyla.

  18. Bacterial Community Structure in the Hyperarid Core of the Atacama Desert, Chile▿

    PubMed Central

    Drees, Kevin P.; Neilson, Julia W.; Betancourt, Julio L.; Quade, Jay; Henderson, David A.; Pryor, Barry M.; Maier, Raina M.

    2006-01-01

    Soils from the hyperarid Atacama Desert of northern Chile were sampled along an east-west elevational transect (23.75 to 24.70°S) through the driest sector to compare the relative structure of bacterial communities. Analysis of denaturing gradient gel electrophoresis (DGGE) profiles from each of the samples revealed that microbial communities from the extreme hyperarid core of the desert clustered separately from all of the remaining communities. Bands sequenced from DGGE profiles of two samples taken at a 22-month interval from this core region revealed the presence of similar populations dominated by bacteria from the Gemmatimonadetes and Planctomycetes phyla. PMID:17028238

  19. Profile of oritavancin and its potential in the treatment of acute bacterial skin structure infections

    PubMed Central

    Mitra, Subhashis; Saeed, Usman; Havlichek, Daniel H; Stein, Gary E

    2015-01-01

    Oritavancin, a semisynthetic derivative of the glycopeptide antibiotic chloroeremomycin, received the US Food and Drug Administration approval for the treatment of acute bacterial skin and skin structure infections caused by susceptible Gram-positive bacteria in adults in August 2014. This novel second-generation semisynthetic lipoglycopeptide antibiotic has activity against a broad spectrum of Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-intermediate S. aureus (VISA), and vancomycin-resistant Enterococcus. Oritavancin inhibits bacterial cell wall synthesis and is rapidly bactericidal against many Gram-positive pathogens. The long half-life of this drug enables a single-dose administration. Oritavancin is not metabolized in the body, and the unchanged drug is slowly excreted by the kidneys. In two large Phase III randomized, double-blind, clinical trials, oritavancin was found to be non-inferior to vancomycin in achieving the primary composite end point in the treatment of acute Gram-positive skin and skin structure infections. Adverse effects noted were mostly mild with nausea, headache, and vomiting being the most common reported side effects. Oritavancin has emerged as another useful antimicrobial agent for treatment of acute Gram-positive skin and skin structure infections, including those caused by MRSA and VISA. PMID:26185459

  20. Structure of a bacterial type III secretion system in contact with a host membrane in situ

    NASA Astrophysics Data System (ADS)

    Nans, Andrea; Kudryashev, Mikhail; Saibil, Helen R.; Hayward, Richard D.

    2015-12-01

    Many bacterial pathogens of animals and plants use a conserved type III secretion system (T3SS) to inject virulence effector proteins directly into eukaryotic cells to subvert host functions. Contact with host membranes is critical for T3SS activation, yet little is known about T3SS architecture in this state or the conformational changes that drive effector translocation. Here we use cryo-electron tomography and sub-tomogram averaging to derive the intact structure of the primordial Chlamydia trachomatis T3SS in the presence and absence of host membrane contact. Comparison of the averaged structures demonstrates a marked compaction of the basal body (4 nm) occurs when the needle tip contacts the host cell membrane. This compaction is coupled to a stabilization of the cytosolic sorting platform-ATPase. Our findings reveal the first structure of a bacterial T3SS from a major human pathogen engaged with a eukaryotic host, and reveal striking `pump-action' conformational changes that underpin effector injection.

  1. A structural mechanism for bacterial autotransporter glycosylation by a dodecameric heptosyltransferase family

    PubMed Central

    Yao, Qing; Lu, Qiuhe; Wan, Xiaobo; Song, Feng; Xu, Yue; Hu, Mo; Zamyatina, Alla; Liu, Xiaoyun; Huang, Niu; Zhu, Ping; Shao, Feng

    2014-01-01

    A large group of bacterial virulence autotransporters including AIDA-I from diffusely adhering E. coli (DAEC) and TibA from enterotoxigenic E. coli (ETEC) require hyperglycosylation for functioning. Here we demonstrate that TibC from ETEC harbors a heptosyltransferase activity on TibA and AIDA-I, defining a large family of bacterial autotransporter heptosyltransferases (BAHTs). The crystal structure of TibC reveals a characteristic ring-shape dodecamer. The protomer features an N-terminal β-barrel, a catalytic domain, a β-hairpin thumb, and a unique iron-finger motif. The iron-finger motif contributes to back-to-back dimerization; six dimers form the ring through β-hairpin thumb-mediated hand-in-hand contact. The structure of ADP-D-glycero-β-D-manno-heptose (ADP-D,D-heptose)-bound TibC reveals a sugar transfer mechanism and also the ligand stereoselectivity determinant. Electron-cryomicroscopy analyses uncover a TibC–TibA dodecamer/hexamer assembly with two enzyme molecules binding to one TibA substrate. The complex structure also highlights a high efficient hyperglycosylation of six autotransporter substrates simultaneously by the dodecamer enzyme complex. DOI: http://dx.doi.org/10.7554/eLife.03714.001 PMID:25310236

  2. Structure of a bacterial type III secretion system in contact with a host membrane in situ

    PubMed Central

    Nans, Andrea; Kudryashev, Mikhail; Saibil, Helen R.; Hayward, Richard D.

    2015-01-01

    Many bacterial pathogens of animals and plants use a conserved type III secretion system (T3SS) to inject virulence effector proteins directly into eukaryotic cells to subvert host functions. Contact with host membranes is critical for T3SS activation, yet little is known about T3SS architecture in this state or the conformational changes that drive effector translocation. Here we use cryo-electron tomography and sub-tomogram averaging to derive the intact structure of the primordial Chlamydia trachomatis T3SS in the presence and absence of host membrane contact. Comparison of the averaged structures demonstrates a marked compaction of the basal body (4 nm) occurs when the needle tip contacts the host cell membrane. This compaction is coupled to a stabilization of the cytosolic sorting platform–ATPase. Our findings reveal the first structure of a bacterial T3SS from a major human pathogen engaged with a eukaryotic host, and reveal striking ‘pump-action' conformational changes that underpin effector injection. PMID:26656452

  3. Structural modification and characterization of bacterial cellulose-alginate composite scaffolds for tissue engineering.

    PubMed

    Kirdponpattara, Suchata; Khamkeaw, Arnon; Sanchavanakit, Neeracha; Pavasant, Prasit; Phisalaphong, Muenduen

    2015-11-01

    A novel bacterial cellulose-alginate composite scaffold (N-BCA) was fabricated by freeze drying and subsequent crosslinking with Ca(2+). The N-BCA then underwent a second freeze drying step to remove water without altering the physical structure. A stable structure of N-BCA with open and highly interconnected pores in the range of 90-160 μm was constructed. The N-BCA was stable in both water and PBS. The swelling ability of N-BCA in water was approximately 50 times its weight, which was about 6.5 times that of the freeze dried bacterial cellulose pellicles. N-BCA demonstrated no cytotoxicity against L929 mouse fibroblast cells. For long-term culture, N-BCA supported attachment, spreading, and proliferation of human gingival fibroblast (GF) on the surface. However, under static conditions, the cell migration and growth inside the scaffold were limited. Because of its biocompatibility and open macroporous structure, N-BCA could potentially be used as a scaffold for tissue engineering. PMID:26256335

  4. A structural mechanism for bacterial autotransporter glycosylation by a dodecameric heptosyltransferase family.

    PubMed

    Yao, Qing; Lu, Qiuhe; Wan, Xiaobo; Song, Feng; Xu, Yue; Hu, Mo; Zamyatina, Alla; Liu, Xiaoyun; Huang, Niu; Zhu, Ping; Shao, Feng

    2014-01-01

    A large group of bacterial virulence autotransporters including AIDA-I from diffusely adhering E. coli (DAEC) and TibA from enterotoxigenic E. coli (ETEC) require hyperglycosylation for functioning. Here we demonstrate that TibC from ETEC harbors a heptosyltransferase activity on TibA and AIDA-I, defining a large family of bacterial autotransporter heptosyltransferases (BAHTs). The crystal structure of TibC reveals a characteristic ring-shape dodecamer. The protomer features an N-terminal β-barrel, a catalytic domain, a β-hairpin thumb, and a unique iron-finger motif. The iron-finger motif contributes to back-to-back dimerization; six dimers form the ring through β-hairpin thumb-mediated hand-in-hand contact. The structure of ADP-D-glycero-β-D-manno-heptose (ADP-D,D-heptose)-bound TibC reveals a sugar transfer mechanism and also the ligand stereoselectivity determinant. Electron-cryomicroscopy analyses uncover a TibC-TibA dodecamer/hexamer assembly with two enzyme molecules binding to one TibA substrate. The complex structure also highlights a high efficient hyperglycosylation of six autotransporter substrates simultaneously by the dodecamer enzyme complex. PMID:25310236

  5. Structural basis of substrate recognition by a bacterial deubiquitinase important for dynamics of phagosome ubiquitination

    PubMed Central

    Sheedlo, Michael J.; Qiu, Jiazhang; Tan, Yunhao; Paul, Lake N.; Luo, Zhao-Qing; Das, Chittaranjan

    2015-01-01

    Manipulation of the host’s ubiquitin network is emerging as an important strategy for counteracting and repurposing the posttranslational modification machineries of the host by pathogens. Ubiquitin E3 ligases encoded by infectious agents are well known, as are a variety of viral deubiquitinases (DUBs). Bacterial DUBs have been discovered, but little is known about the structure and mechanism underlying their ubiquitin recognition. In this report, we found that members of the Legionella pneumophila SidE effector family harbor a DUB module important for ubiquitin dynamics on the bacterial phagosome. Structural analysis of this domain alone and in complex with ubiquitin vinyl methyl ester (Ub-VME) reveals unique molecular contacts used in ubiquitin recognition. Instead of relying on the Ile44 patch of ubiquitin, as commonly used in eukaryotic counterparts, the SdeADub module engages Gln40 of ubiquitin. The architecture of the active-site cleft presents an open arrangement with conformational plasticity, permitting deubiquitination of three of the most abundant polyubiquitin chains, with a distinct preference for Lys63 linkages. We have shown that this preference enables efficient removal of Lys63 linkages from the phagosomal surface. Remarkably, the structure reveals by far the most parsimonious use of molecular contacts to achieve deubiquitination, with less than 1,000 Å2 of accessible surface area buried upon complex formation with ubiquitin. This type of molecular recognition appears to enable dual specificity toward ubiquitin and the ubiquitin-like modifier NEDD8. PMID:26598703

  6. Structure of Ristocetin A in Complex with a Bacterial Cell-wall Mimetic

    SciTech Connect

    Nahoum, V.; Spector, S; Loll, P

    2009-01-01

    Antimicrobial drug resistance is a serious public health problem and the development of new antibiotics has become an important priority. Ristocetin A is a class III glycopeptide antibiotic that is used in the diagnosis of von Willebrand disease and which has served as a lead compound for the development of new antimicrobial therapeutics. The 1.0 A resolution crystal structure of the complex between ristocetin A and a bacterial cell-wall peptide has been determined. As is observed for most other glycopeptide antibiotics, it is shown that ristocetin A forms a back-to-back dimer containing concave binding pockets that recognize the cell-wall peptide. A comparison of the structure of ristocetin A with those of class I glycopeptide antibiotics such as vancomycin and balhimycin identifies differences in the details of dimerization and ligand binding. The structure of the ligand-binding site reveals a likely explanation for ristocetin A's unique anticooperativity between dimerization and ligand binding.

  7. A Common Structural Motif in the Binding of Virulence Factors to Bacterial Secretion Chaperones

    SciTech Connect

    Lilic,M.; Vujanac, M.; Stebbins, C.

    2006-01-01

    Salmonella invasion protein A (SipA) is translocated into host cells by a type III secretion system (T3SS) and comprises two regions: one domain binds its cognate type III secretion chaperone, InvB, in the bacterium to facilitate translocation, while a second domain functions in the host cell, contributing to bacterial uptake by polymerizing actin. We present here the crystal structures of the SipA chaperone binding domain (CBD) alone and in complex with InvB. The SipA CBD is found to consist of a nonglobular polypeptide as well as a large globular domain, both of which are necessary for binding to InvB. We also identify a structural motif that may direct virulence factors to their cognate chaperones in a diverse range of pathogenic bacteria. Disruption of this structural motif leads to a destabilization of several chaperone-substrate complexes from different species, as well as an impairment of secretion in Salmonella.

  8. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    SciTech Connect

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  9. Stabilizing isopeptide bonds revealed in gram-positive bacterial pilus structure.

    PubMed

    Kang, Hae Joo; Coulibaly, Fasséli; Clow, Fiona; Proft, Thomas; Baker, Edward N

    2007-12-01

    Many bacterial pathogens have long, slender pili through which they adhere to host cells. The crystal structure of the major pilin subunit from the Gram-positive human pathogen Streptococcus pyogenes at 2.2 angstroms resolution reveals an extended structure comprising two all-beta domains. The molecules associate in columns through the crystal, with each carboxyl terminus adjacent to a conserved lysine of the next molecule. This lysine forms the isopeptide bonds that link the subunits in native pili, validating the relevance of the crystal assembly. Each subunit contains two lysine-asparagine isopeptide bonds generated by an intramolecular reaction, and we find evidence for similar isopeptide bonds in other cell surface proteins of Gram-positive bacteria. The present structure explains the strength and stability of such Gram-positive pili and could facilitate vaccine development. PMID:18063798

  10. Secondary Structure across the Bacterial Transcriptome Reveals Versatile Roles in mRNA Regulation and Function.

    PubMed

    Del Campo, Cristian; Bartholomäus, Alexander; Fedyunin, Ivan; Ignatova, Zoya

    2015-10-01

    Messenger RNA acts as an informational molecule between DNA and translating ribosomes. Emerging evidence places mRNA in central cellular processes beyond its major function as informational entity. Although individual examples show that specific structural features of mRNA regulate translation and transcript stability, their role and function throughout the bacterial transcriptome remains unknown. Combining three sequencing approaches to provide a high resolution view of global mRNA secondary structure, translation efficiency and mRNA abundance, we unraveled structural features in E. coli mRNA with implications in translation and mRNA degradation. A poorly structured site upstream of the coding sequence serves as an additional unspecific binding site of the ribosomes and the degree of its secondary structure propensity negatively correlates with gene expression. Secondary structures within coding sequences are highly dynamic and influence translation only within a very small subset of positions. A secondary structure upstream of the stop codon is enriched in genes terminated by UAA codon with likely implications in translation termination. The global analysis further substantiates a common recognition signature of RNase E to initiate endonucleolytic cleavage. This work determines for the first time the E. coli RNA structurome, highlighting the contribution of mRNA secondary structure as a direct effector of a variety of processes, including translation and mRNA degradation. PMID:26495981

  11. Secondary Structure across the Bacterial Transcriptome Reveals Versatile Roles in mRNA Regulation and Function

    PubMed Central

    Fedyunin, Ivan; Ignatova, Zoya

    2015-01-01

    Messenger RNA acts as an informational molecule between DNA and translating ribosomes. Emerging evidence places mRNA in central cellular processes beyond its major function as informational entity. Although individual examples show that specific structural features of mRNA regulate translation and transcript stability, their role and function throughout the bacterial transcriptome remains unknown. Combining three sequencing approaches to provide a high resolution view of global mRNA secondary structure, translation efficiency and mRNA abundance, we unraveled structural features in E. coli mRNA with implications in translation and mRNA degradation. A poorly structured site upstream of the coding sequence serves as an additional unspecific binding site of the ribosomes and the degree of its secondary structure propensity negatively correlates with gene expression. Secondary structures within coding sequences are highly dynamic and influence translation only within a very small subset of positions. A secondary structure upstream of the stop codon is enriched in genes terminated by UAA codon with likely implications in translation termination. The global analysis further substantiates a common recognition signature of RNase E to initiate endonucleolytic cleavage. This work determines for the first time the E. coli RNA structurome, highlighting the contribution of mRNA secondary structure as a direct effector of a variety of processes, including translation and mRNA degradation. PMID:26495981

  12. Non-coding small (micro) RNAs of Pseudomonas aeruginosa isolated from clinical isolates from adult patients with cystic fibrosis.

    PubMed

    Rao, J R; Nelson, D; Moore, J E; Millar, B C; Goldsmith, C E; Rendall, J; Elborn, J S

    2010-01-01

    MicroRNAs are a class of small non-coding RNAs widely reported in eukaryotic multicellular organisms. In this study, a number of small non-coding micro (mi)RNA species in clinical isolates of prokaryote Pseudomonas aeruginosa were obtained from the sputum of adult patients with cystic fibrosis (CF) utilising a DynaExpress miRNA cloning kit, and five miRNAs of 16-47 nucleotides that were smaller than those encountered or described (80-100 nucleotides) previously in bacterial systems were described. This report presents data on these unknown cellular miRNAs cloned from P. aeruginosa isolates from CF patients. Adapting a computational miRNA prediction model that takes advantage of the highly conserved known miRNA hair pin stems regions, the results revealed that the fold structure of the microRNAs had a high homology to the recently reported human bacterial infection response (BiR)-related microRNA, mi-146, associated with the Toll-like receptor (TLR) family, which is the primary evolutionarily conserved sensors of pathogen-associated molecular patterns (PAMPs), and known to trigger host inflammatory and immune responses. PMID:20973407

  13. Temporal distribution of bacterial community structure in the Changjiang Estuary hypoxia area and the adjacent East China Sea

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xiao, Tian; Wu, Ying; Zhou, Feng; Huang, Huiqin; Bao, Shixiang; Zhang, Wuchang

    2012-06-01

    Bacterial community structure and the effects of environmental factors on the microbial community distribution were investigated in the Changjiang Estuary hypoxia area and its adjacent area in the East China Sea (ECS) in June, August and October, 2006. Profiles of bacterial communities were generated by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes followed by DNA sequence analysis. The dominant bacterial groups were affiliated to Gammaproteobacteria, Cytophaga-Flavobacteria-Bacteroides (CFB), Deltaproteobacteria, Cyanobacteria and Firmicutes, which were mostly from the marine seawater ecosystem. Effects of environmental factors on the bacterial community distribution were analyzed by the ordination technique of canonical correspondence analysis (CCA). The environmental factors significantly influencing bacterial community structure were different in the three months; dissolved organic carbon (DOC) and temperature in June and nitrite in August. No environmental variables displayed significant influence on the bacterial community at the 5% level in October. The seasonal environmental heterogeneity in the Changjiang Estuary and the adjacent ECS, such as seasonal hydrodynamic conditions and riverine input of nutrients, might be the reason for the difference in the key environmental factors determining the bacterial community in the three months.

  14. Residual Structure of Streptococcus mutans Biofilm following Complete Disinfection Favors Secondary Bacterial Adhesion and Biofilm Re-Development

    PubMed Central

    Ohsumi, Tatsuya; Takenaka, Shoji; Wakamatsu, Rika; Sakaue, Yuuki; Narisawa, Naoki; Senpuku, Hidenobu; Ohshima, Hayato; Terao, Yutaka; Okiji, Takashi

    2015-01-01

    Chemical disinfection of oral biofilms often leaves biofilm structures intact. This study aimed to examine whether the residual structure promotes secondary bacterial adhesion. Streptococcus mutans biofilms generated on resin-composite disks in a rotating disc reactor were disinfected completely with 70% isopropyl alcohol, and were again cultured in the same reactor after resupplying with the same bacterial solution. Specimens were subjected to fluorescence confocal laser scanning microscopy, viable cell counts and PCR-Invader assay in order to observe and quantify secondarily adhered cells. Fluorescence microscopic analysis, particularly after longitudinal cryosectioning, demonstrated stratified patterns of viable cells on the disinfected biofilm structure. Viable cell counts of test specimens were significantly higher than those of controls, and increased according to the amount of residual structure and culture period. Linear regression analysis exhibited a high correlation between viable and total cell counts. It was concluded that disinfected biofilm structures favored secondary bacterial adhesion. PMID:25635770

  15. Shifts in Fungal and Bacterial Community Structure During Tallgrass Prairie Restoration

    NASA Astrophysics Data System (ADS)

    Shutthanandan, J.; Bailey, V. L.; Bolton, H.; Brockman, F. J.

    2002-12-01

    The cycling of carbon through the microbial community of soils results in both the storage of freshly added carbon in the soil and the release of greenhouse gases such as carbon dioxide to the atmosphere. It is hypothesized that fungi and bacteria cycle carbon differently, and result in different proportions of carbon stored and evolved. The intensive management of a soil will affect these proportions and thus, may also affect the terrestrial carbon cycle. The soil microbial community was monitored in four soils that form a tallgrass prairie restoration chronosequence. The chronosequence was composed of: 1) native tallgrass prairie, 2) farmland restored to tallgrass prairie in 1979, 3) farmland restored to prairie in 1993, and 4) farmland still in production with row crops. The structure of the microbial community was determined by terminal restriction fragment length analysis (T-RFLP) and we focus here on comparing bacterial and fungal domains from agriculture to native conditions. Shifts in the fungal and bacterial communities were detected that indicate that the bacteria recovered faster from changing the land use from farmland back to prairie, while the fungi are more sensitive to the perturbations of invasive agriculture and appear to be taking longer to revert to their original prairie composition. However, it must also be considered that assays of the activities of these two communities indicate that as the restoration progresses, the fungi dominate the degradation of freshly added carbon (the ratio of fungal-to-bacterial activity was 13.5:1 in the 1979 restoration, but only 0.85:1 in the farmland). Identification of this shift in community structure offers insights into monitoring ecosystem restoration and may also suggest opportunities for enhancing carbon storage by allowing marginal lands to revert to a natural condition.

  16. Evidence for alternative quaternary structure in a bacterial Type III secretion system chaperone

    SciTech Connect

    Barta, Michael L.; Zhang, Lingling; Picking, Wendy L.; Geisbrecht, Brian V.

    2010-10-05

    Type III secretion systems are a common virulence mechanism in many Gram-negative bacterial pathogens. These systems use a nanomachine resembling a molecular needle and syringe to provide an energized conduit for the translocation of effector proteins from the bacterial cytoplasm to the host cell cytoplasm for the benefit of the pathogen. Prior to translocation specialized chaperones maintain proper effector protein conformation. The class II chaperone, Invasion plasmid gene (Ipg) C, stabilizes two pore forming translocator proteins. IpgC exists as a functional dimer to facilitate the mutually exclusive binding of both translocators. In this study, we present the 3.3 {angstrom} crystal structure of an amino-terminally truncated form (residues 10-155, denoted IpgC10-155) of the class II chaperone IpgC from Shigella flexneri. Our structure demonstrates an alternative quaternary arrangement to that previously described for a carboxy-terminally truncated variant of IpgC (IpgC{sup 1-151}). Specifically, we observe a rotationally-symmetric 'head-to-head' dimerization interface that is far more similar to that previously described for SycD from Yersinia enterocolitica than to IpgC1-151. The IpgC structure presented here displays major differences in the amino terminal region, where extended coil-like structures are seen, as opposed to the short, ordered alpha helices and asymmetric dimerization interface seen within IpgC{sup 1-151}. Despite these differences, however, both modes of dimerization support chaperone activity, as judged by a copurification assay with a recombinant form of the translocator protein, IpaB. Conclusions: From primary to quaternary structure, these results presented here suggest that a symmetric dimerization interface is conserved across bacterial class II chaperones. In light of previous data which have described the structure and function of asymmetric dimerization, our results raise the possibility that class II chaperones may transition between

  17. Bacterial Transcription Inhibitor of RNA Polymerase Holoenzyme Formation by Structure-Based Drug Design: From in Silico Screening to Validation.

    PubMed

    Ma, Cong; Yang, Xiao; Lewis, Peter J

    2016-01-01

    Bacterial transcription is a proven target for antibacterial research. However, most of the known inhibitors targeting transcription are from natural extracts or are hits from screens where the binding site remains unidentified. Using an RNA polymerase holoenzyme homology structure from the model Gram-positive organism Bacillus subtilis, we created a pharmacophore model and used it for in silico screening of a publicly available library for compounds able to inhibit holoenzyme formation. The hits demonstrated specific affinity to bacterial RNA polymerase and excellent activity using in vitro assays and showed no binding to the equivalent structure from human RNA polymerase II. The target specificity in live cells and antibacterial activity was demonstrated in microscopy and growth inhibition experiments. This is the first example of targeted inhibitor development for a bacterial RNA polymerase, outlining a complete discovery process from virtual screening to biochemical validation. This approach could serve as an appropriate platform for the future identification of inhibitors of bacterial transcription. PMID:27622946

  18. Complex structure of a bacterial class 2 histone deacetylase homologue with a trifluoromethylketone inhibitor

    SciTech Connect

    Nielsen, Tine Kragh; Hildmann, Christian; Riester, Daniel; Wegener, Dennis; Schwienhorst, Andreas; Ficner, Ralf

    2007-04-01

    The crystal structure of HDAH FB188 in complex with a trifluoromethylketone at 2.2 Å resolution is reported and compared to a previously determined inhibitor complex. Histone deacetylases (HDACs) have emerged as attractive targets in anticancer drug development. To date, a number of HDAC inhibitors have been developed and most of them are hydroxamic acid derivatives, typified by suberoylanilide hydroxamic acid (SAHA). Not surprisingly, structural information that can greatly enhance the design of novel HDAC inhibitors is so far only available for hydroxamic acids in complex with HDAC or HDAC-like enzymes. Here, the first structure of an enzyme complex with a nonhydroxamate HDAC inhibitor is presented. The structure of the trifluoromethyl ketone inhibitor 9,9,9-trifluoro-8-oxo-N-phenylnonanamide in complex with bacterial FB188 HDAH (histone deacetylase-like amidohydrolase from Bordetella/Alcaligenes strain FB188) has been determined. HDAH reveals high sequential and functional homology to human class 2 HDACs and a high structural homology to human class 1 HDACs. Comparison with the structure of HDAH in complex with SAHA reveals that the two inhibitors superimpose well. However, significant differences in binding to the active site of HDAH were observed. In the presented structure the O atom of the trifluoromethyl ketone moiety is within binding distance of the Zn atom of the enzyme and the F atoms participate in interactions with the enzyme, thereby involving more amino acids in enzyme–inhibitor binding.

  19. Structure of the Bacterial Cytoskeleton Protein Bactofilin by NMR Chemical Shifts and Sequence Variation.

    PubMed

    Kassem, Maher M; Wang, Yong; Boomsma, Wouter; Lindorff-Larsen, Kresten

    2016-06-01

    Bactofilins constitute a recently discovered class of bacterial proteins that form cytoskeletal filaments. They share a highly conserved domain (DUF583) of which the structure remains unknown, in part due to the large size and noncrystalline nature of the filaments. Here, we describe the atomic structure of a bactofilin domain from Caulobacter crescentus. To determine the structure, we developed an approach that combines a biophysical model for proteins with recently obtained solid-state NMR spectroscopy data and amino acid contacts predicted from a detailed analysis of the evolutionary history of bactofilins. Our structure reveals a triangular β-helical (solenoid) conformation with conserved residues forming the tightly packed core and polar residues lining the surface. The repetitive structure explains the presence of internal repeats as well as strongly conserved positions, and is reminiscent of other fibrillar proteins. Our work provides a structural basis for future studies of bactofilin biology and for designing molecules that target them, as well as a starting point for determining the organization of the entire bactofilin filament. Finally, our approach presents new avenues for determining structures that are difficult to obtain by traditional means. PMID:27276252

  20. Structural and Sequence Analysis of Imelysin-Like Proteins Implicated in Bacterial Iron Uptake

    PubMed Central

    Xu, Qingping; Rawlings, Neil D.; Farr, Carol L.; Chiu, Hsiu-Ju; Grant, Joanna C.; Jaroszewski, Lukasz; Klock, Heath E.; Knuth, Mark W.; Miller, Mitchell D.; Weekes, Dana; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

    2011-01-01

    Imelysin-like proteins define a superfamily of bacterial proteins that are likely involved in iron uptake. Members of this superfamily were previously thought to be peptidases and were included in the MEROPS family M75. We determined the first crystal structures of two remotely related, imelysin-like proteins. The Psychrobacter arcticus structure was determined at 2.15 Å resolution and contains the canonical imelysin fold, while higher resolution structures from the gut bacteria Bacteroides ovatus, in two crystal forms (at 1.25 Å and 1.44 Å resolution), have a circularly permuted topology. Both structures are highly similar to each other despite low sequence similarity and circular permutation. The all-helical structure can be divided into two similar four-helix bundle domains. The overall structure and the GxHxxE motif region differ from known HxxE metallopeptidases, suggesting that imelysin-like proteins are not peptidases. A putative functional site is located at the domain interface. We have now organized the known homologous proteins into a superfamily, which can be separated into four families. These families share a similar functional site, but each has family-specific structural and sequence features. These results indicate that imelysin-like proteins have evolved from a common ancestor, and likely have a conserved function. PMID:21799754

  1. Revisiting the structures of several antibiotics bound to the bacterial ribosome

    SciTech Connect

    Bulkley, David; Innis, C. Axel; Blaha, Gregor; Steitz, Thomas A.

    2010-10-08

    The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model. Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.

  2. Revisiting the Structures of Several Antibiotics Bound to the Bacterial Ribosome

    SciTech Connect

    D Bulkley; C Innis; G Blaha; T Steitz

    2011-12-31

    The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model. Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.

  3. Progressive structural changes of Avicel, bleached softwood, and bacterial cellulose during enzymatic hydrolysis

    SciTech Connect

    Kafle, Kabindra; Shin, Heenae; Lee, Christopher M.; Park, Sunkyu; Kim, Seong H.

    2015-10-14

    A comprehensive picture of structural changes of cellulosic biomass during enzymatic hydrolysis is essential for a better understanding of enzymatic actions and development of more efficient enzymes. In this study, a suite of analytical techniques including sum frequency generation (SFG) spectroscopy, infrared (IR) spectroscopy, x-ray diffraction (XRD), and x-ray photoelectron spectroscopy (XPS) were employed for lignin-free model biomass samples—Avicel, bleached softwood, and bacterial cellulose—to find correlations between the decrease in hydrolysis rate over time and the structural or chemical changes of biomass during the hydrolysis reaction. The results showed that the decrease in hydrolysis rate over time appears to correlate with the irreversible deposition of non-cellulosic species (either reaction side products or denatured enzymes, or both) on the cellulosic substrate surface. The crystallinity, degree of polymerization, and meso-scale packing of cellulose do not seem to positively correlate with the decrease in hydrolysis rate observed for all three substrates tested in this study. Moreover, it was also found that the cellulose Iα component of the bacterial cellulose is preferentially hydrolyzed by the enzyme than the cellulose Iβ component.

  4. Structural Insights into Protein-Protein Interactions Involved in Bacterial Cell Wall Biogenesis

    PubMed Central

    Laddomada, Federica; Miyachiro, Mayara M.; Dessen, Andréa

    2016-01-01

    The bacterial cell wall is essential for survival, and proteins that participate in its biosynthesis have been the targets of antibiotic development efforts for decades. The biosynthesis of its main component, the peptidoglycan, involves the coordinated action of proteins that are involved in multi-member complexes which are essential for cell division (the “divisome”) and/or cell wall elongation (the “elongasome”), in the case of rod-shaped cells. Our knowledge regarding these interactions has greatly benefitted from the visualization of different aspects of the bacterial cell wall and its cytoskeleton by cryoelectron microscopy and tomography, as well as genetic and biochemical screens that have complemented information from high resolution crystal structures of protein complexes involved in divisome or elongasome formation. This review summarizes structural and functional aspects of protein complexes involved in the cytoplasmic and membrane-related steps of peptidoglycan biosynthesis, with a particular focus on protein-protein interactions whereby disruption could lead to the development of novel antibacterial strategies. PMID:27136593

  5. Structural insights into the inhibition mechanism of bacterial toxin LsoA by bacteriophage antitoxin Dmd.

    PubMed

    Wan, Hua; Otsuka, Yuichi; Gao, Zeng-Qiang; Wei, Yong; Chen, Zhen; Masuda, Michiaki; Yonesaki, Tetsuro; Zhang, Heng; Dong, Yu-Hui

    2016-09-01

    Bacteria have obtained a variety of resistance mechanisms including toxin-antitoxin (TA) systems against bacteriophages (phages), whereas phages have also evolved to overcome bacterial anti-phage mechanisms. Dmd from T4 phage can suppress the toxicities of homologous toxins LsoA and RnlA from Escherichia coli, representing the first example of a phage antitoxin against multiple bacterial toxins in known TA systems. Here, the crystal structure of LsoA-Dmd complex showed Dmd is inserted into the deep groove between the N-terminal repeated domain (NRD) and the Dmd-binding domain (DBD) of LsoA. The NRD shifts significantly from a 'closed' to an 'open' conformation upon Dmd binding. Site-directed mutagenesis of Dmd revealed the conserved residues (W31 and N40) are necessary for LsoA binding and the toxicity suppression as determined by pull-down and cell toxicity assays. Further mutagenesis identified the conserved Dmd-binding residues (R243, E246 and R305) of LsoA are vital for its toxicity, and suggested Dmd and LsoB may possess different inhibitory mechanisms against LsoA toxicity. Our structure-function studies demonstrate Dmd can recognize LsoA and inhibit its toxicity by occupying the active site possibly via substrate mimicry. These findings have provided unique insights into the defense and counter-defense mechanisms between bacteria and phages in their co-evolution. PMID:27169810

  6. Structure of the Type IVa Major Pilin from the Electrically Conductive Bacterial Nanowires of Geobacter sulfurreducens

    SciTech Connect

    Reardon, Patrick N.; Mueller, Karl T.

    2013-10-11

    Several species of bacteria are capable of reducing insoluble metal oxides as well as other extracellular electron acceptors. These bacteria play a critical role in the cycling of minerals in subsurface environments, sediments, and groundwater. In some species of bacteria, such as Geobacter sulfurreducens, the transport of electrons is facilitated by filamentous fibers that are referred to as bacterial nanowires. These nanowires belong to the type IVa family of pilin proteins and are mainly comprised of one subunit protein, PilA. Here, we report the high resolution solution nuclear magnetic resonance (NMR) structure of the PilA protein from G. sulfurreducens determined in detergent micelles. The protein is over 85% α-helical and exhibits similar architecture to the N-terminal regions of other non-conductive type IVa pilins. The detergent micelle interacts with the first 21 amino acids of the protein, indicating that this region likely associates with the bacterial inner membrane prior to fiber formation. A model of the G. sulfurreducens pilus fiber is proposed based on docking of this structure into the fiber model of the type IVa pilin from Neisseria gonorrhoeae. This model provides insight into the organization of aromatic amino acids that are important for electrical conduction.

  7. Structure and function of a spectrin-like regulator of bacterial cytokinesis.

    PubMed

    Cleverley, Robert M; Barrett, Jeffrey R; Baslé, Arnaud; Bui, Nhat Khai; Hewitt, Lorraine; Solovyova, Alexandra; Xu, Zhi-Qiang; Daniel, Richard A; Dixon, Nicholas E; Harry, Elizabeth J; Oakley, Aaron J; Vollmer, Waldemar; Lewis, Richard J

    2014-01-01

    Bacterial cell division is facilitated by a molecular machine--the divisome--that assembles at mid-cell in dividing cells. The formation of the cytokinetic Z-ring by the tubulin homologue FtsZ is regulated by several factors, including the divisome component EzrA. Here we describe the structure of the 60-kDa cytoplasmic domain of EzrA, which comprises five linear repeats of an unusual triple helical bundle. The EzrA structure is bent into a semicircle, providing the protein with the potential to interact at both N- and C-termini with adjacent membrane-bound divisome components. We also identify at least two binding sites for FtsZ on EzrA and map regions of EzrA that are responsible for regulating FtsZ assembly. The individual repeats, and their linear organization, are homologous to the spectrin proteins that connect actin filaments to the membrane in eukaryotes, and we thus propose that EzrA is the founding member of the bacterial spectrin family. PMID:25403286

  8. Structure and function of a spectrin-like regulator of bacterial cytokinesis

    NASA Astrophysics Data System (ADS)

    Cleverley, Robert M.; Barrett, Jeffrey R.; Baslé, Arnaud; Bui, Nhat Khai; Hewitt, Lorraine; Solovyova, Alexandra; Xu, Zhi-Qiang; Daniel, Richard A.; Dixon, Nicholas E.; Harry, Elizabeth J.; Oakley, Aaron J.; Vollmer, Waldemar; Lewis, Richard J.

    2014-11-01

    Bacterial cell division is facilitated by a molecular machine—the divisome—that assembles at mid-cell in dividing cells. The formation of the cytokinetic Z-ring by the tubulin homologue FtsZ is regulated by several factors, including the divisome component EzrA. Here we describe the structure of the 60-kDa cytoplasmic domain of EzrA, which comprises five linear repeats of an unusual triple helical bundle. The EzrA structure is bent into a semicircle, providing the protein with the potential to interact at both N- and C-termini with adjacent membrane-bound divisome components. We also identify at least two binding sites for FtsZ on EzrA and map regions of EzrA that are responsible for regulating FtsZ assembly. The individual repeats, and their linear organization, are homologous to the spectrin proteins that connect actin filaments to the membrane in eukaryotes, and we thus propose that EzrA is the founding member of the bacterial spectrin family.

  9. Top-Down Strategies for the Structural Elucidation of Intact Gram-negative Bacterial Endotoxins

    PubMed Central

    O’Brien, John P.; Needham, Brittany D.; Brown, Dusty B.; Trent, M. Stephen

    2014-01-01

    Re-modelling of lipopolysaccharides, which are the primary constituent of the outer cell membrane of Gram-negative bacteria, modulates pathogenesis and resistance to microbials. Reported herein is the characterization of intact Gram-negative bacterial lipooligosaccharides (LOS) via a new strategy utilizing online liquid chromatography (LC) coupled with ultraviolet photodissociation (UVPD) mass spectrometry. Compared to collision-based MS/MS methods, UVPD and UVPD/HCD promoted a greater array of cleavages within both the glycan and lipid moieties, including C-C, C-N, C-O cleavages in the acyl chains as well as glycosidic and cross-ring cleavages, thus providing the most far-reaching structural characterization of LOS. This LC-MS/MS strategy affords a robust analytical method to structurally characterize complex mixtures of bacterial endotoxins that maintains the integrity of the core oligosaccharide and lipid A domains of LOS, providing direct feedback about the cell envelope architectures and LOS modification strategies involved in resistance host innate immune defense. PMID:25386333

  10. Temporal and spatial influences incur reconfiguration of Arctic heathland soil bacterial community structure.

    PubMed

    Hill, Richard; Saetnan, Eli R; Scullion, John; Gwynn-Jones, Dylan; Ostle, Nick; Edwards, Arwyn

    2016-06-01

    Microbial responses to Arctic climate change could radically alter the stability of major stores of soil carbon. However, the sensitivity of plot-scale experiments simulating climate change effects on Arctic heathland soils to potential confounding effects of spatial and temporal changes in soil microbial communities is unknown. Here, the variation in heathland soil bacterial communities at two survey sites in Sweden between spring and summer 2013 and at scales between 0-1 m and, 1-100 m and between sites (> 100 m) were investigated in parallel using 16S rRNA gene T-RFLP and amplicon sequencing. T-RFLP did not reveal spatial structuring of communities at scales < 100 m in any site or season. However, temporal changes were striking. Amplicon sequencing corroborated shifts from r- to K-selected taxon-dominated communities, influencing in silico predictions of functional potential. Network analyses reveal temporal keystone taxa, with a spring betaproteobacterial sub-network centred upon a Burkholderia operational taxonomic unit (OTU) and a reconfiguration to a summer sub-network centred upon an alphaproteobacterial OTU. Although spatial structuring effects may not confound comparison between plot-scale treatments, temporal change is a significant influence. Moreover, the prominence of two temporally exclusive keystone taxa suggests that the stability of Arctic heathland soil bacterial communities could be disproportionally influenced by seasonal perturbations affecting individual taxa. PMID:26259508

  11. Progressive structural changes of Avicel, bleached softwood, and bacterial cellulose during enzymatic hydrolysis

    DOE PAGESBeta

    Kafle, Kabindra; Shin, Heenae; Lee, Christopher M.; Park, Sunkyu; Kim, Seong H.

    2015-10-14

    A comprehensive picture of structural changes of cellulosic biomass during enzymatic hydrolysis is essential for a better understanding of enzymatic actions and development of more efficient enzymes. In this study, a suite of analytical techniques including sum frequency generation (SFG) spectroscopy, infrared (IR) spectroscopy, x-ray diffraction (XRD), and x-ray photoelectron spectroscopy (XPS) were employed for lignin-free model biomass samples—Avicel, bleached softwood, and bacterial cellulose—to find correlations between the decrease in hydrolysis rate over time and the structural or chemical changes of biomass during the hydrolysis reaction. The results showed that the decrease in hydrolysis rate over time appears to correlatemore » with the irreversible deposition of non-cellulosic species (either reaction side products or denatured enzymes, or both) on the cellulosic substrate surface. The crystallinity, degree of polymerization, and meso-scale packing of cellulose do not seem to positively correlate with the decrease in hydrolysis rate observed for all three substrates tested in this study. Moreover, it was also found that the cellulose Iα component of the bacterial cellulose is preferentially hydrolyzed by the enzyme than the cellulose Iβ component.« less

  12. Structure and function of a spectrin-like regulator of bacterial cytokinesis

    PubMed Central

    Cleverley, Robert M.; Barrett, Jeffrey R.; Baslé, Arnaud; Bui, Nhat Khai; Hewitt, Lorraine; Solovyova, Alexandra; Xu, Zhi-Qiang; Daniel, Richard A.; Dixon, Nicholas E.; Harry, Elizabeth J.; Oakley, Aaron J.; Vollmer, Waldemar; Lewis, Richard J.

    2014-01-01

    Bacterial cell division is facilitated by a molecular machine—the divisome—that assembles at mid-cell in dividing cells. The formation of the cytokinetic Z-ring by the tubulin homologue FtsZ is regulated by several factors, including the divisome component EzrA. Here we describe the structure of the 60-kDa cytoplasmic domain of EzrA, which comprises five linear repeats of an unusual triple helical bundle. The EzrA structure is bent into a semicircle, providing the protein with the potential to interact at both N- and C-termini with adjacent membrane-bound divisome components. We also identify at least two binding sites for FtsZ on EzrA and map regions of EzrA that are responsible for regulating FtsZ assembly. The individual repeats, and their linear organization, are homologous to the spectrin proteins that connect actin filaments to the membrane in eukaryotes, and we thus propose that EzrA is the founding member of the bacterial spectrin family. PMID:25403286

  13. Progressive structural changes of Avicel, bleached softwood, and bacterial cellulose during enzymatic hydrolysis

    NASA Astrophysics Data System (ADS)

    Kafle, Kabindra; Shin, Heenae; Lee, Christopher M.; Park, Sunkyu; Kim, Seong H.

    2015-10-01

    A comprehensive picture of structural changes of cellulosic biomass during enzymatic hydrolysis is essential for a better understanding of enzymatic actions and development of more efficient enzymes. In this study, a suite of analytical techniques including sum frequency generation (SFG) spectroscopy, infrared (IR) spectroscopy, x-ray diffraction (XRD), and x-ray photoelectron spectroscopy (XPS) were employed for lignin-free model biomass samples—Avicel, bleached softwood, and bacterial cellulose—to find correlations between the decrease in hydrolysis rate over time and the structural or chemical changes of biomass during the hydrolysis reaction. The results showed that the decrease in hydrolysis rate over time appears to correlate with the irreversible deposition of non-cellulosic species (either reaction side products or denatured enzymes, or both) on the cellulosic substrate surface. The crystallinity, degree of polymerization, and meso-scale packing of cellulose do not seem to positively correlate with the decrease in hydrolysis rate observed for all three substrates tested in this study. It was also found that the cellulose Iα component of the bacterial cellulose is preferentially hydrolyzed by the enzyme than the cellulose Iβ component.

  14. Structure, Function, and Evolution of Bacterial ATP-Binding Cassette Systems

    PubMed Central

    Davidson, Amy L.; Dassa, Elie; Orelle, Cedric; Chen, Jue

    2008-01-01

    Summary: ATP-binding cassette (ABC) systems are universally distributed among living organisms and function in many different aspects of bacterial physiology. ABC transporters are best known for their role in the import of essential nutrients and the export of toxic molecules, but they can also mediate the transport of many other physiological substrates. In a classical transport reaction, two highly conserved ATP-binding domains or subunits couple the binding/hydrolysis of ATP to the translocation of particular substrates across the membrane, through interactions with membrane-spanning domains of the transporter. Variations on this basic theme involve soluble ABC ATP-binding proteins that couple ATP hydrolysis to nontransport processes, such as DNA repair and gene expression regulation. Insights into the structure, function, and mechanism of action of bacterial ABC proteins are reported, based on phylogenetic comparisons as well as classic biochemical and genetic approaches. The availability of an increasing number of high-resolution structures has provided a valuable framework for interpretation of recent studies, and realistic models have been proposed to explain how these fascinating molecular machines use complex dynamic processes to fulfill their numerous biological functions. These advances are also important for elucidating the mechanism of action of eukaryotic ABC proteins, because functional defects in many of them are responsible for severe human inherited diseases. PMID:18535149

  15. Progressive structural changes of Avicel, bleached softwood, and bacterial cellulose during enzymatic hydrolysis

    PubMed Central

    Kafle, Kabindra; Shin, Heenae; Lee, Christopher M.; Park, Sunkyu; Kim, Seong H.

    2015-01-01

    A comprehensive picture of structural changes of cellulosic biomass during enzymatic hydrolysis is essential for a better understanding of enzymatic actions and development of more efficient enzymes. In this study, a suite of analytical techniques including sum frequency generation (SFG) spectroscopy, infrared (IR) spectroscopy, x-ray diffraction (XRD), and x-ray photoelectron spectroscopy (XPS) were employed for lignin-free model biomass samples—Avicel, bleached softwood, and bacterial cellulose—to find correlations between the decrease in hydrolysis rate over time and the structural or chemical changes of biomass during the hydrolysis reaction. The results showed that the decrease in hydrolysis rate over time appears to correlate with the irreversible deposition of non-cellulosic species (either reaction side products or denatured enzymes, or both) on the cellulosic substrate surface. The crystallinity, degree of polymerization, and meso-scale packing of cellulose do not seem to positively correlate with the decrease in hydrolysis rate observed for all three substrates tested in this study. It was also found that the cellulose Iα component of the bacterial cellulose is preferentially hydrolyzed by the enzyme than the cellulose Iβ component. PMID:26463274

  16. Bacterial community structure and variation in a full-scale seawater desalination plant for drinking water production.

    PubMed

    Belila, A; El-Chakhtoura, J; Otaibi, N; Muyzer, G; Gonzalez-Gil, G; Saikaly, P E; van Loosdrecht, M C M; Vrouwenvelder, J S

    2016-05-01

    Microbial processes inevitably play a role in membrane-based desalination plants, mainly recognized as membrane biofouling. We assessed the bacterial community structure and diversity during different treatment steps in a full-scale seawater desalination plant producing 40,000 m(3)/d of drinking water. Water samples were taken over the full treatment train consisting of chlorination, spruce media and cartridge filters, de-chlorination, first and second pass reverse osmosis (RO) membranes and final chlorine dosage for drinking water distribution. The water samples were analyzed for water quality parameters (total bacterial cell number, total organic carbon, conductivity, pH, etc.) and microbial community composition by 16S rRNA gene pyrosequencing. The planktonic microbial community was dominated by Proteobacteria (48.6%) followed by Bacteroidetes (15%), Firmicutes (9.3%) and Cyanobacteria (4.9%). During the pretreatment step, the spruce media filter did not impact the bacterial community composition dominated by Proteobacteria. In contrast, the RO and final chlorination treatment steps reduced the Proteobacterial relative abundance in the produced water where Firmicutes constituted the most dominant bacterial group. Shannon and Chao1 diversity indices showed that bacterial species richness and diversity decreased during the seawater desalination process. The two-stage RO filtration strongly reduced the water conductivity (>99%), TOC concentration (98.5%) and total bacterial cell number (>99%), albeit some bacterial DNA was found in the water after RO filtration. About 0.25% of the total bacterial operational taxonomic units (OTUs) were present in all stages of the desalination plant: the seawater, the RO permeates and the chlorinated drinking water, suggesting that these bacterial strains can survive in different environments such as high/low salt concentration and with/without residual disinfectant. These bacterial strains were not caused by contamination during

  17. High-resolution structures of bacterially expressed soluble human CD59

    PubMed Central

    Leath, Kirstin J.; Johnson, Steven; Roversi, Pietro; Hughes, Timothy R.; Smith, Richard A. G.; Mackenzie, Lloyd; Morgan, B. Paul; Lea, Susan M.

    2007-01-01

    CD59 is a membrane-bound glycoprotein that protects host cells from lysis by inhibiting the terminal pathway of complement, preventing the formation and insertion of the membrane attack complex (MAC). Crystals of bacterially expressed and nonglycosylated recombinant soluble human CD59 have been obtained from three crystallization conditions, each of which gave rise to a distinct crystal form. Each crystal form led to a crystal structure at high resolution (1.15, 1.35 and 1.8 Å). In one of these structures the electron-density map shows an as yet unidentified small molecule in the predicted C8/C9-binding site. The presence/absence of this ligand is linked to alternate conformations of the amino acids implicated in C8/C9 binding. PMID:17671359

  18. Crystal structure analysis of a bacterial aryl acylamidase belonging to the amidase signature enzyme family.

    PubMed

    Lee, Saeyoung; Park, Eun-Hye; Ko, Hyeok-Jin; Bang, Won Gi; Kim, Hye-Yeon; Kim, Kyoung Heon; Choi, In-Geol

    2015-11-13

    The atomic structure of a bacterial aryl acylamidase (EC 3.5.1.13; AAA) is reported and structural features are investigated to better understand the catalytic profile of this enzyme. Structures of AAA were determined in its native form and in complex with the analgesic acetanilide, p-acetaminophenol, at 1.70 Å and 1.73 Å resolutions, respectively. The overall structural fold of AAA was identified as an α/β fold class, exhibiting an open twisted β-sheet core surrounded by α-helices. The asymmetric unit contains one AAA molecule and the monomeric form is functionally active. The core structure enclosing the signature sequence region, including the canonical Ser-cisSer-Lys catalytic triad, is conserved in all members of the Amidase Signature enzyme family. The structure of AAA in a complex with its ligand reveals a unique organization in the substrate-binding pocket. The binding pocket consists of two loops (loop1 and loop2) in the amidase signature sequence and one helix (α10) in the non-amidase signature sequence. We identified two residues (Tyr(136) and Thr(330)) that interact with the ligand via water molecules, and a hydrogen-bonding network that explains the catalytic affinity over various aryl acyl compounds. The optimum activity of AAA at pH > 10 suggests that the reaction mechanism employs Lys(84) as the catalytic base to polarize the Ser(187) nucleophile in the catalytic triad. PMID:26454172

  19. Exploiting tRNAs to Boost Virulence

    PubMed Central

    Albers, Suki; Czech, Andreas

    2016-01-01

    Transfer RNAs (tRNAs) are powerful small RNA entities that are used to translate nucleotide language of genes into the amino acid language of proteins. Their near-uniform length and tertiary structure as well as their high nucleotide similarity and post-transcriptional modifications have made it difficult to characterize individual species quantitatively. However, due to the central role of the tRNA pool in protein biosynthesis as well as newly emerging roles played by tRNAs, their quantitative assessment yields important information, particularly relevant for virus research. Viruses which depend on the host protein expression machinery have evolved various strategies to optimize tRNA usage—either by adapting to the host codon usage or encoding their own tRNAs. Additionally, several viruses bear tRNA-like elements (TLE) in the 5′- and 3′-UTR of their mRNAs. There are different hypotheses concerning the manner in which such structures boost viral protein expression. Furthermore, retroviruses use special tRNAs for packaging and initiating reverse transcription of their genetic material. Since there is a strong specificity of different viruses towards certain tRNAs, different strategies for recruitment are employed. Interestingly, modifications on tRNAs strongly impact their functionality in viruses. Here, we review those intersection points between virus and tRNA research and describe methods for assessing the tRNA pool in terms of concentration, aminoacylation and modification. PMID:26797637

  20. Effect of cow slurry amendment on atrazine dissipation and bacterial community structure in an agricultural Andisol.

    PubMed

    Briceño, G; Jorquera, M A; Demanet, R; Mora, M L; Durán, N; Palma, G

    2010-06-15

    Atrazine is a commonly used herbicide for maize production in Chile, but it has recently been shown to be ineffective in soils that receive applications of cow slurries generated from the dairy industry. This effect may be caused either by the sorption of the pesticide to organic matter or more rapid degradation in slurry-amended soils. The objectives of this study were to evaluate the effects of cow slurry on atrazine dissipation, the formation of atrazine metabolites and the modification of bacterial community in Andisol. The cow slurry was applied at doses of 100,000-300,000 Lha(-1). After 4 weeks, atrazine was applied to the slurry-amended soils at concentrations of 1-3 mg kg(-1). The amounts of atrazine and its metabolites were determined by high performance liquid chromatography (HPLC). The soil microbial community was monitored by measurement of CO(2) evolution and changes in bacterial community using PCR-DGGE of 16S rRNA genes. The results show that cow slurry applications had no effect on atrazine dissipation, which had a half-life of 15-19 days. The atrazine metabolites were detected after 20 days and were significantly higher in soils amended with the slurry at both 20 and 40 days after application of the herbicide. Respiration rates were elevated after 10 days in all soils with atrazine addition. Both the atrazine and slurry amendments altered the bacterial community structures, indicated by the appearance of specific bands in the DGGE gels after 10 days. Cloning and sequencing of the 16S rRNA genes from the DGGE gels showed that the bands represented various genera of beta-proteobacteria that appeared in response to atrazine. According to our results, further field studies are required to explain the lower effectiveness of atrazine in weed control. These studies may include the effect of dissolved organic carbon on the atrazine mobility. PMID:20388570

  1. Bacterial community structure across environmental gradients in permafrost thaw ponds: methanotroph-rich ecosystems

    PubMed Central

    Crevecoeur, Sophie; Vincent, Warwick F.; Comte, Jérôme; Lovejoy, Connie

    2015-01-01

    Permafrost thawing leads to the formation of thermokarst ponds that potentially emit CO2 and CH4 to the atmosphere. In the Nunavik subarctic region (northern Québec, Canada), these numerous, shallow ponds become well-stratified during summer. This creates a physico-chemical gradient of temperature and oxygen, with an upper oxic layer and a bottom low oxygen or anoxic layer. Our objective was to determine the influence of stratification and related limnological and landscape properties on the community structure of potentially active bacteria in these waters. Samples for RNA analysis were taken from ponds in three contrasting valleys across a gradient of permafrost degradation. A total of 1296 operational taxonomic units were identified by high throughput amplicon sequencing, targeting bacterial 16S rRNA that was reverse transcribed to cDNA. β-proteobacteria were the dominant group in all ponds, with highest representation by the genera Variovorax and Polynucleobacter. Methanotrophs were also among the most abundant sequences at most sites. They accounted for up to 27% of the total sequences (median of 4.9% for all samples), indicating the importance of methane as a bacterial energy source in these waters. Both oxygenic (cyanobacteria) and anoxygenic (Chlorobi) phototrophs were also well-represented, the latter in the low oxygen bottom waters. Ordination analyses showed that the communities clustered according to valley and depth, with significant effects attributed to dissolved oxygen, pH, dissolved organic carbon, and total suspended solids. These results indicate that the bacterial assemblages of permafrost thaw ponds are filtered by environmental gradients, and are complex consortia of functionally diverse taxa that likely affect the composition as well as magnitude of greenhouse gas emissions from these abundant waters. PMID:25926816

  2. Pyrosequencing-Based Assessment of Bacterial Community Structure Along Different Management Types in German Forest and Grassland Soils

    PubMed Central

    Nacke, Heiko; Thürmer, Andrea; Wollherr, Antje; Will, Christiane; Hodac, Ladislav; Herold, Nadine; Schöning, Ingo; Schrumpf, Marion; Daniel, Rolf

    2011-01-01

    Background Soil bacteria are important drivers for nearly all biogeochemical cycles in terrestrial ecosystems and participate in most nutrient transformations in soil. In contrast to the importance of soil bacteria for ecosystem functioning, we understand little how different management types affect the soil bacterial community composition. Methodology/Principal Findings We used pyrosequencing-based analysis of the V2-V3 16S rRNA gene region to identify changes in bacterial diversity and community structure in nine forest and nine grassland soils from the Schwäbische Alb that covered six different management types. The dataset comprised 598,962 sequences that were affiliated to the domain Bacteria. The number of classified sequences per sample ranged from 23,515 to 39,259. Bacterial diversity was more phylum rich in grassland soils than in forest soils. The dominant taxonomic groups across all samples (>1% of all sequences) were Acidobacteria, Alphaproteobacteria, Actinobacteria, Betaproteobacteria, Deltaproteobacteria, Gammaproteobacteria, and Firmicutes. Significant variations in relative abundances of bacterial phyla and proteobacterial classes, including Actinobacteria, Firmicutes, Verrucomicrobia, Cyanobacteria, Gemmatimonadetes and Alphaproteobacteria, between the land use types forest and grassland were observed. At the genus level, significant differences were also recorded for the dominant genera Phenylobacter, Bacillus, Kribbella, Streptomyces, Agromyces, and Defluviicoccus. In addition, soil bacterial community structure showed significant differences between beech and spruce forest soils. The relative abundances of bacterial groups at different taxonomic levels correlated with soil pH, but little or no relationships to management type and other soil properties were found. Conclusions/Significance Soil bacterial community composition and diversity of the six analyzed management types showed significant differences between the land use types grassland

  3. Structure and RNA-binding properties of the bacterial LSm protein Hfq

    PubMed Central

    2013-01-01

    Over the past years, small non-coding RNAs (sRNAs) emerged as important modulators of gene expression in bacteria. Guided by partial sequence complementarity, these sRNAs interact with target mRNAs and eventually affect transcript stability and translation. The physiological function of sRNAs depends on the protein Hfq, which binds sRNAs in the cell and promotes the interaction with their mRNA targets. This important physiological function of Hfq as a central hub of sRNA-mediated regulation made it one of the most intensely studied proteins in bacteria. Recently, a new model for sRNA binding by Hfq has been proposed that involves the direct recognition of the sRNA 3′ end and interactions of the sRNA body with the lateral RNA-binding surface of Hfq. This review summarizes the current understanding of the RNA binding properties of Hfq and its (s)RNA complexes. Moreover, the implications of the new binding model for sRNA-mediated regulation are discussed. PMID:23535768

  4. Diversity and biogeochemical structuring of bacterial communities across the Porangahau ridge accretionary prism, New Zealand

    USGS Publications Warehouse

    Hamdan, L.J.; Gillevet, P.M.; Pohlman, J.W.; Sikaroodi, M.; Greinert, J.; Coffin, R.B.

    2011-01-01

    Sediments from the Porangahau ridge, located off the northeastern coast of New Zealand, were studied to describe bacterial community structure in conjunction with differing biogeochemical regimes across the ridge. Low diversity was observed in sediments from an eroded basin seaward of the ridge and the community was dominated by uncultured members of the Burkholderiales. Chloroflexi/GNS and Deltaproteobacteria were abundant in sediments from a methane seep located landward of the ridge. Gas-charged and organic-rich sediments further landward had the highest overall diversity. Surface sediments, with the exception of those from the basin, were dominated by Rhodobacterales sequences associated with organic matter deposition. Taxa related to the Desulfosarcina/Desulfococcus and the JS1 candidates were highly abundant at the sulfate-methane transition zone (SMTZ) at three sites. To determine how community structure was influenced by terrestrial, pelagic and in situ substrates, sequence data were statistically analyzed against geochemical data (e.g. sulfate, chloride, nitrogen, phosphorous, methane, bulk inorganic and organic carbon pools) using the Biota-Environmental matching procedure. Landward of the ridge, sulfate was among the most significant structuring factors. Seaward of the ridge, silica and ammonium were important structuring factors. Regardless of the transect location, methane was the principal structuring factor on SMTZ communities. FEMS Microbiology Ecology ?? 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. No claim to original US government works.

  5. Structure and dynamics of a polysaccharide matrix: aqueous solutions of bacterial levan.

    PubMed

    Benigar, Elizabeta; Dogsa, Iztok; Stopar, David; Jamnik, Andrej; Kralj Cigić, Irena; Tomšič, Matija

    2014-04-15

    The polysaccharide levan is a homopolymer of fructose and appears in nature as an important structural component of some bacterial biofilms. This paper reports the structural and dynamic properties of aqueous solutions of levan of various origin obtained from dynamic rheological, small-angle X-ray scattering, static and dynamic light scattering, as well as density and sound velocity measurements, determination of polymer branching after per-O-methylation, and microscopy. Besides samples of commercially available levan from Zymomonas mobilis and Erwinia herbicola, we also isolated, purified, and studied a levan sample from the biofilm of Bacillus subtilis. The results of dynamic rheological and light scattering measurements revealed very interesting viscoelastic properties of levan solutions even at very low polymer concentrations. The findings were complemented by small-angle X-ray scattering data that revealed some important differences in the structure of the aqueous levan solutions at the molecular level. Besides presenting detailed dynamic and structural results on the polysaccharide systems of various levans, one of the essential goals of this work was to point out the level of structural information that may be obtained for such polymer systems by combining basic physicochemical, rheological, and various light scattering techniques. PMID:24654746

  6. Relationship between model bacterial peptidoglycan network structures and AFM force-distance curves

    NASA Astrophysics Data System (ADS)

    Brown, Aidan; Wickham, Robert; Touhami, Ahmed; Dutcher, John

    2010-03-01

    Recent atomic force microscopy (AFM) measurements have involved pulling on Gram-negative bacterial sacculi with the AFM tip as a means of distinguishing between different proposed structures of the peptidoglycan network. The goal of the present study is to provide the theoretical connection between a given network structure and its response to the pulling force. We model the glycan strands as hinged rods, and the peptide cross-links as wormlike chains. Using Monte Carlo simulation to equilibrate the three-dimensional network, subject to a fixed AFM tip-to-substrate distance, we can compute the force exerted by the network on the AFM tip. The effects of adhesion of the sacculi to the substrate and enzymatic action on the network are included. We have modeled both the layered and the scaffold model for the peptidoglycan network structure. We have compared our theoretical force-distance curves for each network structure with experimental curves to determine which structure provides the best agreement with experiment.

  7. Structural Basis of the Stereospecificity of Bacterial B12-dependent 2-Hydroxyisobutyryl-CoA Mutase

    PubMed Central

    Kurteva-Yaneva, Nadya; Zahn, Michael; Weichler, M.-Teresa; Starke, Robert; Harms, Hauke; Müller, Roland H.; Sträter, Norbert; Rohwerder, Thore

    2015-01-01

    Bacterial coenzyme B12-dependent 2-hydroxyisobutyryl-CoA mutase (HCM) is a radical enzyme catalyzing the stereospecific interconversion of (S)-3-hydroxybutyryl- and 2-hydroxyisobutyryl-CoA. It consists of two subunits, HcmA and HcmB. To characterize the determinants of substrate specificity, we have analyzed the crystal structure of HCM from Aquincola tertiaricarbonis in complex with coenzyme B12 and the substrates (S)-3-hydroxybutyryl- and 2-hydroxyisobutyryl-CoA in alternative binding. When compared with the well studied structure of bacterial and mitochondrial B12-dependent methylmalonyl-CoA mutase (MCM), HCM has a highly conserved domain architecture. However, inspection of the substrate binding site identified amino acid residues not present in MCM, namely HcmA IleA90 and AspA117. AspA117 determines the orientation of the hydroxyl group of the acyl-CoA esters by H-bond formation, thus determining stereospecificity of catalysis. Accordingly, HcmA D117A and D117V mutations resulted in significantly increased activity toward (R)-3-hydroxybutyryl-CoA. Besides interconversion of hydroxylated acyl-CoA esters, wild-type HCM as well as HcmA I90V and I90A mutant enzymes could also isomerize pivalyl- and isovaleryl-CoA, albeit at >10 times lower rates than the favorite substrate (S)-3-hydroxybutyryl-CoA. The nonconservative mutation HcmA D117V, however, resulted in an enzyme showing high activity toward pivalyl-CoA. Structural requirements for binding and isomerization of highly branched acyl-CoA substrates such as 2-hydroxyisobutyryl- and pivalyl-CoA, possessing tertiary and quaternary carbon atoms, respectively, are discussed. PMID:25720495

  8. Bacterial Community Structure of Acid-Impacted Lakes: What Controls Diversity?▿ †

    PubMed Central

    Percent, Sascha F.; Frischer, Marc E.; Vescio, Paul A.; Duffy, Ellen B.; Milano, Vincenzo; McLellan, Maggie; Stevens, Brett M.; Boylen, Charles W.; Nierzwicki-Bauer, Sandra A.

    2008-01-01

    Although it is recognized that acidification of freshwater systems results in decreased overall species richness of plants and animals, little is known about the response of aquatic microbial communities to acidification. In this study we examined bacterioplankton community diversity and structure in 18 lakes located in the Adirondack Park (in the state of New York in the United States) that were affected to various degrees by acidic deposition and assessed correlations with 31 physical and chemical parameters. The pH of these lakes ranged from 4.9 to 7.8. These studies were conducted as a component of the Adirondack Effects Assessment Program supported by the U.S. Environmental Protection Agency. Thirty-one independent 16S rRNA gene libraries consisting of 2,135 clones were constructed from epilimnion and hypolimnion water samples. Bacterioplankton community composition was determined by sequencing and amplified ribosomal DNA restriction analysis of the clone libraries. Nineteen bacterial classes representing 95 subclasses were observed, but clone libraries were dominated by representatives of the Actinobacteria and Betaproteobacteria classes. Although the diversity and richness of bacterioplankton communities were positively correlated with pH, the overall community composition assessed by principal component analysis was not. The strongest correlations were observed between bacterioplankton communities and lake depth, hydraulic retention time, dissolved inorganic carbon, and nonlabile monomeric aluminum concentrations. While there was not an overall correlation between bacterioplankton community structure and pH, several bacterial classes, including the Alphaproteobacteria, were directly correlated with acidity. These results indicate that unlike more identifiable correlations between acidity and species richness for higher trophic levels, controls on bacterioplankton community structure are likely more complex, involving both direct and indirect processes. PMID

  9. Structure and Function of the Bacterial Root Microbiota in Wild and Domesticated Barley

    PubMed Central

    Bulgarelli, Davide; Garrido-Oter, Ruben; Münch, Philipp C.; Weiman, Aaron; Dröge, Johannes; Pan, Yao; McHardy, Alice C.; Schulze-Lefert, Paul

    2015-01-01

    Summary The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial families Comamonadaceae, Flavobacteriaceae, and Rhizobiaceae dominate the barley root-enriched microbiota. Host genotype has a small, but significant, effect on the diversity of root-associated bacterial communities, possibly representing a footprint of barley domestication. Traits related to pathogenesis, secretion, phage interactions, and nutrient mobilization are enriched in the barley root-associated microbiota. Strikingly, protein families assigned to these same traits showed evidence of positive selection. Our results indicate that the combined action of microbe-microbe and host-microbe interactions drives microbiota differentiation at the root-soil interface. PMID:25732064

  10. Structure and function of the bacterial root microbiota in wild and domesticated barley.

    PubMed

    Bulgarelli, Davide; Garrido-Oter, Ruben; Münch, Philipp C; Weiman, Aaron; Dröge, Johannes; Pan, Yao; McHardy, Alice C; Schulze-Lefert, Paul

    2015-03-11

    The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial families Comamonadaceae, Flavobacteriaceae, and Rhizobiaceae dominate the barley root-enriched microbiota. Host genotype has a small, but significant, effect on the diversity of root-associated bacterial communities, possibly representing a footprint of barley domestication. Traits related to pathogenesis, secretion, phage interactions, and nutrient mobilization are enriched in the barley root-associated microbiota. Strikingly, protein families assigned to these same traits showed evidence of positive selection. Our results indicate that the combined action of microbe-microbe and host-microbe interactions drives microbiota differentiation at the root-soil interface. PMID:25732064

  11. Streptomycin application has no detectable effect on bacterial community structure in apple orchard soil.

    PubMed

    Shade, Ashley; Klimowicz, Amy K; Spear, Russell N; Linske, Matthew; Donato, Justin J; Hogan, Clifford S; McManus, Patricia S; Handelsman, Jo

    2013-11-01

    Streptomycin is commonly used to control fire blight disease on apple trees. Although the practice has incited controversy, little is known about its nontarget effects in the environment. We investigated the impact of aerial application of streptomycin on nontarget bacterial communities in soil beneath streptomycin-treated and untreated trees in a commercial apple orchard. Soil samples were collected in two consecutive years at 4 or 10 days before spraying streptomycin and 8 or 9 days after the final spray. Three sources of microbial DNA were profiled using tag-pyrosequencing of 16S rRNA genes: uncultured bacteria from the soil (culture independent) and bacteria cultured on unamended or streptomycin-amended (15 μg/ml) media. Multivariate tests for differences in community structure, Shannon diversity, and Pielou's evenness test results showed no evidence of community response to streptomycin. The results indicate that use of streptomycin for disease management has minimal, if any, immediate effect on apple orchard soil bacterial communities. This study contributes to the profile of an agroecosystem in which antibiotic use for disease prevention appears to have minimal consequences for nontarget bacteria. PMID:23974143

  12. Bacterial Community Structure after a 17-year Reciprocal Soil Transplant Simulating Climate Change with Elevation

    NASA Astrophysics Data System (ADS)

    Bailey, V. L.; McCue, L.; Fansler, S.; Bond-Lamberty, B. P.; Hess, N. J.; Smith, J. L.

    2013-12-01

    In 1994, a reciprocal soil transplant experiment was initiated between two elevations (310 m, warmer and drier, and 844 m, cooler and wetter) on Rattlesnake Mountain in southeastern Washington, USA. In March 2012 we resampled the original transplanted soils, control cores transplanted in situ, and native soils from each elevation, to study longer-term changes in microbial community composition, soil C and N dynamics, and soil physical structure. Our studies of these soils suggested that climate change has significantly altered the C dynamics in these soils, and that even after 17 years of adaptation, the soil microbial communities have not recovered to a condition similar to their new environment. To more thoroughly define the response of the native bacterial communities to this long-term transplant, we sequenced the V4 region of the 16S genes for all the treatments in this study, broken into 0-5, 5-10, and 10-15-cm depth intervals. Non-metric multidimensional scaling analyses of the sequence data reveal a strong surface influence, with some separation of the 5-10 and 10-15-cm depths. We are investigating these data, and companion metagenomic data, for signatures of the bacterial community's response to simulated climate change.

  13. Macromolecular crowding can account for RNase-sensitive constraint of bacterial nucleoid structure

    SciTech Connect

    Foley, Patricia L.; Wilson, David B.; Shuler, Michael L.

    2010-04-23

    The shape and compaction of the bacterial nucleoid may affect the accessibility of genetic material to the transcriptional machinery in natural and synthetic systems. To investigate this phenomenon, the nature and contribution of RNA and protein to the compaction of nucleoids that had been gently released from Escherichia coli cells were investigated using fluorescent and transmission electron microscopy. We propose that the removal of RNA from the bacterial nucleoid affects nucleoid compaction by altering the branching density and molecular weight of the nucleoid. We show that a common detergent in nucleoid preparations, Brij 58, plays a previously unrecognized role as a macromolecular crowding agent. RNA-free nucleoids adopt a compact structure similar in size to exponential-phase nucleoids when the concentration of Brij 58 is increased, consistent with our hypothesis. We present evidence that control and protein-free nucleoids behave similarly in solutions containing a macromolecular crowding agent. These results show that the contribution to DNA compaction by nucleoid-associated proteins is small when compared to macromolecular crowding effects.

  14. Petroleum-influenced beach sediments of the Campeche Bank, Mexico: diversity and bacterial community structure assessment.

    PubMed

    Rosano-Hernández, María C; Ramírez-Saad, Hugo; Fernández-Linares, Luis

    2012-03-01

    The bacterial diversity and community structure were surveyed in intertidal petroleum-influenced sediments of ≈ 100 km of a beach, in the southern Gulf of Mexico. The beach was divided in twenty sampling sites according to high, moderate and low petroleum influence. Densities of cultured heterotrophic (HAB) and hydrocarbon degrading bacteria (HDB) were highly variable in sediments, with little morphological assortment in colonies. PCR-RISA banding patterns differentiated distinct communities along the beach, and the bacterial diversity changed inversely to the degree of petroleum hydrocarbon influence: the higher TPH concentration, the lower genotype diversity. Seven DNA sequences (Genbank EF191394 -EF191396 and EF191398 -EF191401) were affiliated to uncultured members of Gemmatimonas, Acidobacterium, Desulfobacteraceae, Rubrobacterales, Actinobacterium and the Fibrobacteres/Acidobacteria group; all the above taxa are known for having members with active roles in biogeochemical transformations. The remaining sequences (EF191388 - EF191393 and EF191397) affiliated to Pseudoalteromonas, and to oil-degrading genera such as Pseudomonas, Vibrio and Marinobacter, being the last one an obligate oil-degrading bacterium. An exchange of bacteria between the beach and the oil seep environment, and the potential cleaning-up role of bacteria at the southern Gulf of Mexico are discussed. PMID:21802196

  15. Clinical efficacy of dalbavancin for the treatment of acute bacterial skin and skin structure infections (ABSSSI)

    PubMed Central

    Leuthner, Kimberly D; Buechler, Kristin A; Kogan, David; Saguros, Agafe; Lee, H Stephen

    2016-01-01

    Acute bacterial skin and skin structure infections (ABSSSI) are a common disease causing patients to seek treatment through the health care system. With the continued increase of drug-resistant bacterial pathogens, these infections are becoming more difficult to successfully cure. Lipoglycopeptides have unique properties that allow the drug to remain active toward both common and challenging pathogens at the infected site for lengthy periods of time. Dalbavancin, a new lipoglycopeptide, provides two unique dosing regimens for the treatment of ABSSSI. The original regimen of 1,000 mg intravenous infusion followed by a 500 mg intravenous infusion after a week has been shown as safe and effective in multiple, randomized noninferiority trials. These studies also demonstrated that dalbavancin was similar to standard regimens in terms of both safety and tolerability. Recently a single 1,500 mg dose was demonstrated to be equivalent to the dalbavancin two-dose regimen for treating ABSSSI. With the introduction of dalbavancin, clinicians have the option to provide an intravenous antimicrobial agent shown to be as effective as traditional therapies, without requiring admission into the hospitals or prescribing a medication which may not be utilized optimally. Further understanding of dalbavancin and its unusual properties can provide unique treatment situations with potential benefits for both the patient and the overall health care system, which should be further explored. PMID:27354809

  16. Structure-Based Drug Design and Optimization of Mannoside Bacterial FimH Antagonists

    PubMed Central

    Han, Zhenfu; Pinkner, Jerome S.; Ford, Bradley; Obermann, Robert; Nolan, William; Wildman, Scott A.; Hobbs, Doug; Ellenberger, Tom; Cusumano, Corinne K.; Hultgren, Scott J.; Janetka, James W.

    2010-01-01

    FimH-mediated cellular adhesion to mannosylated proteins is critical in the ability of uropathogenic E. coli (UPEC) to colonize and invade the bladder epithelium during urinary tract infection. We describe the discovery and optimization of potent small-molecule FimH bacterial adhesion antagonists based on α-D-mannose 1-position anomeric glycosides using X-ray structure-guided drug design. Optimized biaryl mannosides display low nanomolar binding affinity for FimH in a fluorescence polarization assay and sub micromolar cellular activity in a hemagglutination (HA) functional cell assay of bacterial adhesion. X-ray crystallography demonstrates that the biphenyl moiety makes several key interactions with the outer surface of FimH including π-π interactions with Tyr-48 and an H-bonding electrostatic interaction with the Arg-98/Glu-50 salt-bridge. Dimeric analogs linked through the biaryl ring show an impressive 8-fold increase in potency relative to monomeric matched pairs and represent the most potent FimH antagonists identified to date. The FimH antagonists described herein hold great potential for development as novel therapeutics for the effective treatment of urinary tract infections. PMID:20507142

  17. Streptomycin Application Has No Detectable Effect on Bacterial Community Structure in Apple Orchard Soil

    PubMed Central

    Shade, Ashley; Klimowicz, Amy K.; Spear, Russell N.; Linske, Matthew; Donato, Justin J.; Hogan, Clifford S.; McManus, Patricia S.

    2013-01-01

    Streptomycin is commonly used to control fire blight disease on apple trees. Although the practice has incited controversy, little is known about its nontarget effects in the environment. We investigated the impact of aerial application of streptomycin on nontarget bacterial communities in soil beneath streptomycin-treated and untreated trees in a commercial apple orchard. Soil samples were collected in two consecutive years at 4 or 10 days before spraying streptomycin and 8 or 9 days after the final spray. Three sources of microbial DNA were profiled using tag-pyrosequencing of 16S rRNA genes: uncultured bacteria from the soil (culture independent) and bacteria cultured on unamended or streptomycin-amended (15 μg/ml) media. Multivariate tests for differences in community structure, Shannon diversity, and Pielou's evenness test results showed no evidence of community response to streptomycin. The results indicate that use of streptomycin for disease management has minimal, if any, immediate effect on apple orchard soil bacterial communities. This study contributes to the profile of an agroecosystem in which antibiotic use for disease prevention appears to have minimal consequences for nontarget bacteria. PMID:23974143

  18. Sensing the Structural Differences in Cellulose from Apple and Bacterial Cell Wall Materials by Raman and FT-IR Spectroscopy

    PubMed Central

    Szymańska-Chargot, Monika; Cybulska, Justyna; Zdunek, Artur

    2011-01-01

    Raman and Fourier Transform Infrared (FT-IR) spectroscopy was used for assessment of structural differences of celluloses of various origins. Investigated celluloses were: bacterial celluloses cultured in presence of pectin and/or xyloglucan, as well as commercial celluloses and cellulose extracted from apple parenchyma. FT-IR spectra were used to estimate of the Iβ content, whereas Raman spectra were used to evaluate the degree of crystallinity of the cellulose. The crystallinity index (XCRAMAN%) varied from −25% for apple cellulose to 53% for microcrystalline commercial cellulose. Considering bacterial cellulose, addition of xyloglucan has an impact on the percentage content of cellulose Iβ. However, addition of only xyloglucan or only pectins to pure bacterial cellulose both resulted in a slight decrease of crystallinity. However, culturing bacterial cellulose in the presence of mixtures of xyloglucan and pectins results in an increase of crystallinity. The results confirmed that the higher degree of crystallinity, the broader the peak around 913 cm−1. Among all bacterial celluloses the bacterial cellulose cultured in presence of xyloglucan and pectin (BCPX) has the most similar structure to those observed in natural primary cell walls. PMID:22163913

  19. Comparison of the bacterial community structure within the equine hindgut and faeces using Automated Ribosomal Intergenic Spacer Analysis (ARISA).

    PubMed

    Sadet-Bourgeteau, S; Philippeau, C; Dequiedt, S; Julliand, V

    2014-12-01

    The horse's hindgut bacterial ecosystem has often been studied using faecal samples. However few studies compared both bacterial ecosystems and the validity of using faecal samples may be questionable. Hence, the present study aimed to compare the structure of the equine bacterial community in the hindgut (caecum, right ventral colon) and faeces using a fingerprint technique known as Automated Ribosomal Intergenic Spacer Analysis (ARISA). Two DNA extraction methods were also assessed. Intestinal contents and faeces were sampled 3 h after the morning meal on four adult fistulated horses fed meadow hay and pelleted concentrate. Irrespective of the intestinal segment, Principal Component Analysis of ARISA profiles showed a strong individual effect (P<0.0001). However, across the study, faecal bacterial community structure significantly (P<0.001) differed from those of the caecum and colon, while there was no difference between the two hindgut communities. The use of a QIAamp(®) DNA Stool Mini kit increased the quality of DNA extracted irrespective of sample type. The differences observed between faecal and hindgut bacterial communities challenge the use of faeces as a representative for hindgut activity. Further investigations are necessary to compare bacterial activity between the hindgut and faeces in order to understand the validity of using faecal samples. PMID:25075719

  20. The Host RNAs in Retroviral Particles.

    PubMed

    Telesnitsky, Alice; Wolin, Sandra L

    2016-01-01

    As they assemble, retroviruses encapsidate both their genomic RNAs and several types of host RNA. Whereas limited amounts of messenger RNA (mRNA) are detectable within virion populations, the predominant classes of encapsidated host RNAs do not encode proteins, but instead include endogenous retroelements and several classes of non-coding RNA (ncRNA), some of which are packaged in significant molar excess to the viral genome. Surprisingly, although the most abundant host RNAs in retroviruses are also abundant in cells, unusual forms of these RNAs are packaged preferentially, suggesting that these RNAs are recruited early in their biogenesis: before associating with their cognate protein partners, and/or from transient or rare RNA populations. These RNAs' packaging determinants differ from the viral genome's, and several of the abundantly packaged host ncRNAs serve cells as the scaffolds of ribonucleoprotein particles. Because virion assembly is equally efficient whether or not genomic RNA is available, yet RNA appears critical to the structural integrity of retroviral particles, it seems possible that the selectively encapsidated host ncRNAs might play roles in assembly. Indeed, some host ncRNAs appear to act during replication, as some transfer RNA (tRNA) species may contribute to nuclear import of human immunodeficiency virus 1 (HIV-1) reverse transcription complexes, and other tRNA interactions with the viral Gag protein aid correct trafficking to plasma membrane assembly sites. However, despite high conservation of packaging for certain host RNAs, replication roles for most of these selectively encapsidated RNAs-if any-have remained elusive. PMID:27548206

  1. Soil phosphorus depletion and shifts in plant communities change bacterial community structure in a long-term grassland management trial.

    PubMed

    Adair, Karen L; Wratten, Steve; Lear, Gavin

    2013-06-01

    Agricultural systems rely on healthy soils and their sustainability requires understanding the long-term impacts of agricultural practices on soils, including microbial communities. We examined the impact of 17 years of land management on soil bacterial communities in a New Zealand randomized-block pasture trial. Significant variation in bacterial community structure related to mowing and plant biomass removal, while nitrogen fertilizer had no effect. Changes in soil chemistry and legume abundance described 52% of the observed variation in the bacterial community structure. Legumes (Trifolium species) were absent in unmanaged plots but increased in abundance with management intensity; 11% of the variation in soil bacterial community structure was attributed to this shift in the plant community. Olsen P explained 10% of the observed heterogeneity, which is likely due to persistent biomass removal resulting in P limitation; Olsen P was significantly lower in plots with biomass removed (14 mg kg(-1) ± 1.3SE) compared with plots that were not mown, or where biomass was left after mowing (32 mg kg(-1) ± 1.6SE). Our results suggest that removal of plant biomass and associated phosphorus, as well as shifts in the plant community, have greater long-term impacts on soil bacterial community structure than application of nitrogen fertilizers. PMID:23754721

  2. Environmental context shapes the bacterial community structure associated to Peltigera cyanolichens growing in Tierra del Fuego, Chile.

    PubMed

    Ramírez-Fernández, Lía; Zúñiga, Catalina; Carú, Margarita; Orlando, Julieta

    2014-03-01

    The structure of the associated bacterial community of bipartite cyanolichens of the genus Peltigera from three different environmental contexts in the Karukinka Natural Park, Tierra del Fuego, Chile, was assessed. The sampling sites represent different habitat contexts: mature native forest, young native forest and grassland. Recently it has been determined that the bacterial community associated to lichens could be highly structured according to the mycobiont or photobiont identities, to the environmental context and/or to the geographic scale. However, there are some inconsistencies in defining which of these factors would be the most significant on determining the structure of the microbial communities associated with lichens, mainly because most studies compare the bacterial communities between different lichen species and/or with different photobiont types (algae vs. cyanobacteria). In this work bipartite lichens belonging to the same genus (Peltigera) symbiotically associated with cyanobacteria (Nostoc) were analyzed by TRFLP to determine the structure of the bacterial community intimately associated with the lichen thalli and the one present in the substrate where they grow. The results indicate that the bacterial community intimately associated differs from the one of the substrate, being the former more influenced by the environmental context where the lichen grows. PMID:24165746

  3. Pyrosequencing reveals contrasting soil bacterial diversity and community structure of two main winter wheat cropping systems in China.

    PubMed

    Zhao, Jun; Zhang, Ruifu; Xue, Chao; Xun, Weibing; Sun, Li; Xu, Yangchun; Shen, Qirong

    2014-02-01

    Microbes are key components of the soil environment, playing an important role in maintaining soil health, sustainability, and productivity. The composition and structure of soil bacterial communities were examined in winter wheat-rice (WR) and winter wheat-maize (WM) cropping systems derived from five locations in the Low-Middle Yangtze River plain and the Huang-Huai-Hai plain by pyrosequencing of the 16S ribosomal RNA gene amplicons. A total of 102,367 high quality sequences were used for multivariate statistical analysis and to test for correlation between community structure and environmental variables such as crop rotations, soil properties, and locations. The most abundant phyla across all soil samples were Proteobacteria, Acidobacteria, and Bacteroidetes. Similar patterns of bacterial diversity and community structure were observed within the same cropping systems, and a higher relative abundance of anaerobic bacteria was found in WR compared to WM cropping systems. Variance partitioning analysis revealed complex relationships between bacterial community and environmental variables. The effect of crop rotations was low but significant, and interactions among soil properties, locations, and crop rotations accounted for most of the explained variation in the structure of bacterial communities. Soil properties such as pH, available P, and available K showed higher correlations (positive or negative) with the majority of the abundant taxa. Bacterial diversity (the Shannon index) and richness (Chao1 and ACE) were higher under WR than WM cropping systems. PMID:24276539

  4. Modifications to toxic CUG RNAs induce structural stability, rescue mis-splicing in a myotonic dystrophy cell model and reduce toxicity in a myotonic dystrophy zebrafish model

    SciTech Connect

    deLorimier, Elaine; Coonrod, Leslie A.; Copperman, Jeremy; Taber, Alex; Reister, Emily E.; Sharma, Kush; Todd, Peter K.; Guenza, Marina G.; Berglund, J. Andrew

    2014-10-10

    In this study, CUG repeat expansions in the 3' UTR of dystrophia myotonica protein kinase (DMPK) cause myotonic dystrophy type 1 (DM1). As RNA, these repeats elicit toxicity by sequestering splicing proteins, such as MBNL1, into protein–RNA aggregates. Structural studies demonstrate that CUG repeats can form A-form helices, suggesting that repeat secondary structure could be important in pathogenicity. To evaluate this hypothesis, we utilized structure-stabilizing RNA modifications pseudouridine (Ψ) and 2'-O-methylation to determine if stabilization of CUG helical conformations affected toxicity. CUG repeats modified with Ψ or 2'-O-methyl groups exhibited enhanced structural stability and reduced affinity for MBNL1. Molecular dynamics and X-ray crystallography suggest a potential water-bridging mechanism for Ψ-mediated CUG repeat stabilization. Ψ modification of CUG repeats rescued mis-splicing in a DM1 cell model and prevented CUG repeat toxicity in zebrafish embryos. This study indicates that the structure of toxic RNAs has a significant role in controlling the onset of neuromuscular diseases.

  5. Modifications to toxic CUG RNAs induce structural stability, rescue mis-splicing in a myotonic dystrophy cell model and reduce toxicity in a myotonic dystrophy zebrafish model

    DOE PAGESBeta

    deLorimier, Elaine; Coonrod, Leslie A.; Copperman, Jeremy; Taber, Alex; Reister, Emily E.; Sharma, Kush; Todd, Peter K.; Guenza, Marina G.; Berglund, J. Andrew

    2014-10-10

    In this study, CUG repeat expansions in the 3' UTR of dystrophia myotonica protein kinase (DMPK) cause myotonic dystrophy type 1 (DM1). As RNA, these repeats elicit toxicity by sequestering splicing proteins, such as MBNL1, into protein–RNA aggregates. Structural studies demonstrate that CUG repeats can form A-form helices, suggesting that repeat secondary structure could be important in pathogenicity. To evaluate this hypothesis, we utilized structure-stabilizing RNA modifications pseudouridine (Ψ) and 2'-O-methylation to determine if stabilization of CUG helical conformations affected toxicity. CUG repeats modified with Ψ or 2'-O-methyl groups exhibited enhanced structural stability and reduced affinity for MBNL1. Molecular dynamicsmore » and X-ray crystallography suggest a potential water-bridging mechanism for Ψ-mediated CUG repeat stabilization. Ψ modification of CUG repeats rescued mis-splicing in a DM1 cell model and prevented CUG repeat toxicity in zebrafish embryos. This study indicates that the structure of toxic RNAs has a significant role in controlling the onset of neuromuscular diseases.« less

  6. Modifications to toxic CUG RNAs induce structural stability, rescue mis-splicing in a myotonic dystrophy cell model and reduce toxicity in a myotonic dystrophy zebrafish model.

    PubMed

    deLorimier, Elaine; Coonrod, Leslie A; Copperman, Jeremy; Taber, Alex; Reister, Emily E; Sharma, Kush; Todd, Peter K; Guenza, Marina G; Berglund, J Andrew

    2014-11-10

    CUG repeat expansions in the 3' UTR of dystrophia myotonica protein kinase (DMPK) cause myotonic dystrophy type 1 (DM1). As RNA, these repeats elicit toxicity by sequestering splicing proteins, such as MBNL1, into protein-RNA aggregates. Structural studies demonstrate that CUG repeats can form A-form helices, suggesting that repeat secondary structure could be important in pathogenicity. To evaluate this hypothesis, we utilized structure-stabilizing RNA modifications pseudouridine (Ψ) and 2'-O-methylation to determine if stabilization of CUG helical conformations affected toxicity. CUG repeats modified with Ψ or 2'-O-methyl groups exhibited enhanced structural stability and reduced affinity for MBNL1. Molecular dynamics and X-ray crystallography suggest a potential water-bridging mechanism for Ψ-mediated CUG repeat stabilization. Ψ modification of CUG repeats rescued mis-splicing in a DM1 cell model and prevented CUG repeat toxicity in zebrafish embryos. This study indicates that the structure of toxic RNAs has a significant role in controlling the onset of neuromuscular diseases. PMID:25303993

  7. Modifications to toxic CUG RNAs induce structural stability, rescue mis-splicing in a myotonic dystrophy cell model and reduce toxicity in a myotonic dystrophy zebrafish model

    PubMed Central

    deLorimier, Elaine; Coonrod, Leslie A.; Copperman, Jeremy; Taber, Alex; Reister, Emily E.; Sharma, Kush; Todd, Peter K.; Guenza, Marina G.; Berglund, J. Andrew

    2014-01-01

    CUG repeat expansions in the 3′ UTR of dystrophia myotonica protein kinase (DMPK) cause myotonic dystrophy type 1 (DM1). As RNA, these repeats elicit toxicity by sequestering splicing proteins, such as MBNL1, into protein–RNA aggregates. Structural studies demonstrate that CUG repeats can form A-form helices, suggesting that repeat secondary structure could be important in pathogenicity. To evaluate this hypothesis, we utilized structure-stabilizing RNA modifications pseudouridine (Ψ) and 2′-O-methylation to determine if stabilization of CUG helical conformations affected toxicity. CUG repeats modified with Ψ or 2′-O-methyl groups exhibited enhanced structural stability and reduced affinity for MBNL1. Molecular dynamics and X-ray crystallography suggest a potential water-bridging mechanism for Ψ-mediated CUG repeat stabilization. Ψ modification of CUG repeats rescued mis-splicing in a DM1 cell model and prevented CUG repeat toxicity in zebrafish embryos. This study indicates that the structure of toxic RNAs has a significant role in controlling the onset of neuromuscular diseases. PMID:25303993

  8. Composition, Reactivity and Regulation of Extracellular Metal-Reducing Structures (Bacterial Nanowires) Produced by Dissimilatory Metal - Reducing Bacteria

    SciTech Connect

    Beveridge, Terrance J.

    2004-06-01

    Approach. Previously, using conventional and cryoTEM techniques, surface physicochemistry assays, NMR structural analysis, etc., we showed that the structure and composition of Shewanella's lipopolysaccharide (LPS) and capsular polysaccharide (PS) significantly determined overall cell surface physicochemistry. In our study a strong correlation between such macroscopic parameters as surface electronegativity, hydrophobicity or hydrophilicity, and bacterial adhesion to hematite was observed. Rough LPS strains exhibited more than an order higher affinity and maximal sorption capacity to hematite when compared to encapsulated strains. These general trends, however, characterize bacterial adhesion only as a bulk process, being unable to reveal finer mechanisms taking place at the level of an individual cell. Cell surface physicochemical and structural heterogeneity suggests much more complex interactions at the bacterial-mineral interface than predicted by such approaches operating within macroscopic parameters.

  9. The Structural Basis of Coenzyme A Recycling in a Bacterial Organelle

    PubMed Central

    Kerfeld, Cheryl A.

    2016-01-01

    Bacterial Microcompartments (BMCs) are proteinaceous organelles that encapsulate critical segments of autotrophic and heterotrophic metabolic pathways; they are functionally diverse and are found across 23 different phyla. The majority of catabolic BMCs (metabolosomes) compartmentalize a common core of enzymes to metabolize compounds via a toxic and/or volatile aldehyde intermediate. The core enzyme phosphotransacylase (PTAC) recycles Coenzyme A and generates an acyl phosphate that can serve as an energy source. The PTAC predominantly associated with metabolosomes (PduL) has no sequence homology to the PTAC ubiquitous among fermentative bacteria (Pta). Here, we report two high-resolution PduL crystal structures with bound substrates. The PduL fold is unrelated to that of Pta; it contains a dimetal active site involved in a catalytic mechanism distinct from that of the housekeeping PTAC. Accordingly, PduL and Pta exemplify functional, but not structural, convergent evolution. The PduL structure, in the context of the catalytic core, completes our understanding of the structural basis of cofactor recycling in the metabolosome lumen. PMID:26959993

  10. Structure-based design and screening of inhibitors for an essential bacterial GTPase, Der.

    PubMed

    Hwang, Jihwan; Tseitin, Vladimir; Ramnarayan, Kal; Shenderovich, Mark D; Inouye, Masayori

    2012-05-01

    Der is an essential and widely conserved GTPase that assists assembly of a large ribosomal subunit in bacteria. Der associates specifically with the 50S subunit in a GTP-dependent manner and the cells depleted of Der accumulate the structurally unstable 50S subunit, which dissociates into an aberrant subunit at a lower Mg(2+) concentration. As Der is an essential and ubiquitous protein in bacteria, it may prove to be an ideal cellular target against which new antibiotics can be developed. In the present study, we describe our attempts to identify novel antibiotics specifically targeting Der GTPase. We performed the structure-based design of Der inhibitors using the X-ray crystal structure of Thermotoga maritima Der (TmDer). Virtual screening of commercially available chemical library retrieved 257 small molecules that potentially inhibit Der GTPase activity. These 257 chemicals were tested for their in vitro effects on TmDer GTPase and in vivo antibacterial activities. We identified three structurally diverse compounds, SBI-34462, -34566 and -34612, that are both biologically active against bacterial cells and putative enzymatic inhibitors of Der GTPase homologs. We also presented the possible interactions of each compound with the Der GTP-binding site to understand the mechanism of inhibition. Therefore, our lead compounds inhibiting Der GTPase provide scaffolds for the development of novel antibiotics against antibiotic-resistant pathogenic bacteria. PMID:22377538

  11. Decameric SelA•tRNA(Sec) ring structure reveals mechanism of bacterial selenocysteine formation.

    PubMed

    Itoh, Yuzuru; Bröcker, Markus J; Sekine, Shun-ichi; Hammond, Gifty; Suetsugu, Shiro; Söll, Dieter; Yokoyama, Shigeyuki

    2013-04-01

    The 21st amino acid, selenocysteine (Sec), is synthesized on its cognate transfer RNA (tRNA(Sec)). In bacteria, SelA synthesizes Sec from Ser-tRNA(Sec), whereas in archaea and eukaryotes SepSecS forms Sec from phosphoserine (Sep) acylated to tRNA(Sec). We determined the crystal structures of Aquifex aeolicus SelA complexes, which revealed a ring-shaped homodecamer that binds 10 tRNA(Sec) molecules, each interacting with four SelA subunits. The SelA N-terminal domain binds the tRNA(Sec)-specific D-arm structure, thereby discriminating Ser-tRNA(Sec) from Ser-tRNA(Ser). A large cleft is created between two subunits and accommodates the 3'-terminal region of Ser-tRNA(Sec). The SelA structures together with in vivo and in vitro enzyme assays show decamerization to be essential for SelA function. SelA catalyzes pyridoxal 5'-phosphate-dependent Sec formation involving Arg residues nonhomologous to those in SepSecS. Different protein architecture and substrate coordination of the bacterial enzyme provide structural evidence for independent evolution of the two Sec synthesis systems present in nature. PMID:23559248

  12. Structures of Arg- and Gln-type bacterial cysteine dioxygenase homologs

    PubMed Central

    Driggers, Camden M; Hartman, Steven J; Karplus, P Andrew

    2015-01-01

    In some bacteria, cysteine is converted to cysteine sulfinic acid by cysteine dioxygenases (CDO) that are only ∼15–30% identical in sequence to mammalian CDOs. Among bacterial proteins having this range of sequence similarity to mammalian CDO are some that conserve an active site Arg residue (“Arg-type” enzymes) and some having a Gln substituted for this Arg (“Gln-type” enzymes). Here, we describe a structure from each of these enzyme types by analyzing structures originally solved by structural genomics groups but not published: a Bacillus subtilis “Arg-type” enzyme that has cysteine dioxygenase activity (BsCDO), and a Ralstonia eutropha “Gln-type” CDO homolog of uncharacterized activity (ReCDOhom). The BsCDO active site is well conserved with mammalian CDO, and a cysteine complex captured in the active site confirms that the cysteine binding mode is also similar. The ReCDOhom structure reveals a new active site Arg residue that is hydrogen bonding to an iron-bound diatomic molecule we have interpreted as dioxygen. Notably, the Arg position is not compatible with the mode of Cys binding seen in both rat CDO and BsCDO. As sequence alignments show that this newly discovered active site Arg is well conserved among “Gln-type” CDO enzymes, we conclude that the “Gln-type” CDO homologs are not authentic CDOs but will have substrate specificity more similar to 3-mercaptopropionate dioxygenases. PMID:25307852

  13. The Structural Basis of Coenzyme A Recycling in a Bacterial Organelle.

    PubMed

    Erbilgin, Onur; Sutter, Markus; Kerfeld, Cheryl A

    2016-03-01

    Bacterial Microcompartments (BMCs) are proteinaceous organelles that encapsulate critical segments of autotrophic and heterotrophic metabolic pathways; they are functionally diverse and are found across 23 different phyla. The majority of catabolic BMCs (metabolosomes) compartmentalize a common core of enzymes to metabolize compounds via a toxic and/or volatile aldehyde intermediate. The core enzyme phosphotransacylase (PTAC) recycles Coenzyme A and generates an acyl phosphate that can serve as an energy source. The PTAC predominantly associated with metabolosomes (PduL) has no sequence homology to the PTAC ubiquitous among fermentative bacteria (Pta). Here, we report two high-resolution PduL crystal structures with bound substrates. The PduL fold is unrelated to that of Pta; it contains a dimetal active site involved in a catalytic mechanism distinct from that of the housekeeping PTAC. Accordingly, PduL and Pta exemplify functional, but not structural, convergent evolution. The PduL structure, in the context of the catalytic core, completes our understanding of the structural basis of cofactor recycling in the metabolosome lumen. PMID:26959993

  14. Acute bacterial skin and skin structure infections in internal medicine wards: old and new drugs.

    PubMed

    Falcone, Marco; Concia, Ercole; Giusti, Massimo; Mazzone, Antonino; Santini, Claudio; Stefani, Stefania; Violi, Francesco

    2016-08-01

    Skin and soft tissue infections (SSTIs) are a common cause of hospital admission among elderly patients, and traditionally have been divided into complicated and uncomplicated SSTIs. In 2010, the FDA provided a new classification of these infections, and a new category of disease, named acute bacterial skin and skin structure infections (ABSSSIs), has been proposed as an independent clinical entity. ABSSSIs include three entities: cellulitis and erysipelas, wound infections, and major cutaneous abscesses This paper revises the epidemiology of SSTIs and ABSSSIs with regard to etiologies, diagnostic techniques, and clinical presentation in the hospital settings. Particular attention is owed to frail patients with multiple comorbidities and underlying significant disease states, hospitalized on internal medicine wards or residing in nursing homes, who appear to be at increased risk of infection due to multi-drug resistant pathogens and treatment failures. Management of ABSSSIs and SSTIs, including evaluation of the hemodynamic state, surgical intervention and treatment with appropriate antibiotic therapy are extensively discussed. PMID:27084183

  15. Predicting effects of structural stress in a genome-reduced model bacterial metabolism

    NASA Astrophysics Data System (ADS)

    Güell, Oriol; Sagués, Francesc; Serrano, M. Ángeles

    2012-08-01

    Mycoplasma pneumoniae is a human pathogen recently proposed as a genome-reduced model for bacterial systems biology. Here, we study the response of its metabolic network to different forms of structural stress, including removal of individual and pairs of reactions and knockout of genes and clusters of co-expressed genes. Our results reveal a network architecture as robust as that of other model bacteria regarding multiple failures, although less robust against individual reaction inactivation. Interestingly, metabolite motifs associated to reactions can predict the propagation of inactivation cascades and damage amplification effects arising in double knockouts. We also detect a significant correlation between gene essentiality and damages produced by single gene knockouts, and find that genes controlling high-damage reactions tend to be expressed independently of each other, a functional switch mechanism that, simultaneously, acts as a genetic firewall to protect metabolism. Prediction of failure propagation is crucial for metabolic engineering or disease treatment.

  16. Gaining mass: the structure of respiratory complex I-from bacterial towards mitochondrial versions.

    PubMed

    Letts, James A; Sazanov, Leonid A

    2015-08-01

    The 1MDa, 45-subunit proton-pumping NADH-ubiquinone oxidoreductase (complex I) is the largest complex of the mitochondrial electron transport chain. The molecular mechanism of complex I is central to the metabolism of cells, but has yet to be fully characterized. The last two years have seen steady progress towards this goal with the first atomic-resolution structure of the entire bacterial complex I, a 5Å cryo-electron microscopy map of bovine mitochondrial complex I and a ∼3.8Å resolution X-ray crystallographic study of mitochondrial complex I from yeast Yarrowia lipotytica. In this review we will discuss what we have learned from these studies and what remains to be elucidated. PMID:26387075

  17. Structure of Bacterial LigD -phosphoesterase Unveils a DNA Repair Superfamily

    SciTech Connect

    Nair, P.; Smith, P; Shuman, S

    2010-01-01

    The DNA ligase D (LigD) 3{prime}-phosphoesterase (PE) module is a conserved component of the bacterial nonhomologous end-joining (NHEJ) apparatus that performs 3{prime} end-healing reactions at DNA double-strand breaks. Here we report the 1.9 {angstrom} crystal structure of Pseudomonas aeruginosa PE, which reveals that PE exemplifies a unique class of DNA repair enzyme. PE has a distinctive fold in which an eight stranded {beta} barrel with a hydrophobic interior supports a crescent-shaped hydrophilic active site on its outer surface. Six essential side chains coordinate manganese and a sulfate mimetic of the scissile phosphate. The PE active site and mechanism are unique vis a vis other end-healing enzymes. We find PE homologs in archaeal and eukaryal proteomes, signifying that PEs comprise a DNA repair superfamily.

  18. [Effect of mechanical grinding of Sphagnum on the structure and physiological state of bacterial communities].

    PubMed

    Dobrovol'skaya, T G; Golovchenko, A V; Yakushev, A V; Manucharova, N A; Yurchenko, E N

    2014-01-01

    The microcosm method was used to demonstrate an increase in bacterial numbers and drastic changes in the taxonomic structure of saprotrophic bacteria as a result of mechanical grinding of Sphagnum moss. Ekkrisotrophic agrobacteria predominant in untreated moss were replaced by hydrolytic bacteria. Molecular biological approaches revealed such specific hydrolytic bacteria as Janthinobacterium agaricum and Streptomyces purpurascens among the dominant taxa. The application of kinetic technique for determination of the physiological state of bacteria in situ revealed higher functional diversity of hydrolytic bacteria in ground moss than in untreated samples. A considerable decrease of the C/N ratio in ground samples of living Sphagnum incubated using the microcosm technique indicated decomposition of this substrate. PMID:25941721

  19. MicroRNAs and cardiac regeneration

    PubMed Central

    Hodgkinson, Conrad P.; Kang, Martin H.; Dal-Pra, Sophie; Mirotsou, Maria; Dzau, Victor J.

    2015-01-01

    The human heart has a very limited capacity to regenerate lost or damaged cardiomyocytes following cardiac insult. Instead, myocardial injury is characterized by extensive cardiac remodeling by fibroblasts, resulting in the eventual deterioration of cardiac structure and function. Cardiac function would be improved if these fibroblasts could be converted into cardiomyocytes. MicroRNAs (miRNAs), small non-coding RNAs that promote mRNA degradation and inhibit mRNA translation, have been shown to be important in cardiac development. Using this information various researchers have utilized miRNAs to promote the formation of cardiomyocytes through a number of approaches. Several miRNAs acting in combination promote the direct conversion of cardiac fibroblasts into cardiomyocytes. Moreover, a number of miRNAs have been identified that aid the formation of iPS cells and miRNAs also induce these cells to adopt a cardiac fate. MiRNAs have also been implicated in resident cardiac progenitor cell differentiation. In this review we will discuss the current literature as it pertains to these processes as well as discussing the therapeutic implications of these findings. PMID:25953925

  20. Shift of anammox bacterial community structure along the Pearl Estuary and the impact of environmental factors

    NASA Astrophysics Data System (ADS)

    Fu, Bingbing; Liu, Jiwen; Yang, Hongmei; Hsu, Ting Chang; He, Biyan; Dai, Minhan; Kao, Shuh Ji; Zhao, Meixun; Zhang, Xiao-Hua

    2015-04-01

    Anaerobic ammonium oxidation (anammox) plays an important role in the marine nitrogen cycle. The Pearl Estuary, a typical subtropical estuary characterized by hypoxia upstream and high loads of organic matter and inorganic nutrients caused by anthropogenic activities, has received extensive attention. In this study, anammox bacterial community structures in surface sediments along the Pearl Estuary were investigated using 16S rRNA and hydrazine oxidoreductase (HZO) genes. In addition, abundance of anammox bacteria in both water and surface sediments was investigated by quantitative PCR. Obvious anammox bacterial community structure shift was observed in surface sediments, in which the dominant genus changed from "Candidatus Brocadia" or "Candidatus Anammoxoglobus" to "Candidatus Scalindua" along the salinity gradient from freshwater to the open ocean based on 16S rRNA gene and HZO amino acid phylotypes. This distribution pattern was associated with salinity, temperature, pH of overlying water, and particularly C/N ratio. Phylogenetic analysis unraveled a rich diversity of anammox bacteria including four novel clusters provisionally named "Candidatus Jugangensis," "Candidatus Oceanicum," "Candidatus Anammoxidans," and "Candidatus Aestuarianus." The abundance of anammox bacteria in surface sediments, bottom and surface waters ranged from 4.22 × 105 to 2.55 × 106 copies g-1, 1.24 × 104 to 1.01×105 copies L-1, and 8.07×103 to 8.86×105 copies L-1, respectively. The abundance of anammox bacteria in the water column was positively correlated with NO2- and NO3-, and negatively correlated with dissolved oxygen, although an autochthonous source might contribute to the observed abundance of anammox bacteria.

  1. Denitrification in Agriculturally Impacted Streams: Seasonal Changes in Structure and Function of the Bacterial Community

    PubMed Central

    Manis, Erin; Royer, Todd V.; Johnson, Laura T.; Leff, Laura G.

    2014-01-01

    Denitrifiers remove fixed nitrogen from aquatic environments and hydrologic conditions are one potential driver of denitrification rate and denitrifier community composition. In this study, two agriculturally impacted streams in the Sugar Creek watershed in Indiana, USA with different hydrologic regimes were examined; one stream is seasonally ephemeral because of its source (tile drainage), whereas the other stream has permanent flow. Additionally, a simulated flooding experiment was performed on the riparian benches of the ephemeral stream during a dry period. Denitrification activity was assayed using the chloramphenicol amended acetylene block method and bacterial communities were examined based on quantitative PCR and terminal restriction length polymorphisms of the nitrous oxide reductase (nosZ) and 16S rRNA genes. In the stream channel, hydrology had a substantial impact on denitrification rates, likely by significantly lowering water potential in sediments. Clear patterns in denitrification rates were observed among pre-drying, dry, and post-drying dates; however, a less clear scenario was apparent when analyzing bacterial community structure suggesting that denitrifier community structure and denitrification rate were not strongly coupled. This implies that the nature of the response to short-term hydrologic changes was physiological rather than increases in abundance of denitrifiers or changes in composition of the denitrifier community. Flooding of riparian bench soils had a short-term, transient effect on denitrification rate. Our results imply that brief flooding of riparian zones is unlikely to contribute substantially to removal of nitrate (NO3-) and that seasonal drying of stream channels has a negative impact on NO3- removal, particularly because of the time lag required for denitrification to rebound. This time lag is presumably attributable to the time required for the denitrifiers to respond physiologically rather than a change in abundance or

  2. Viral miRNAs.

    PubMed

    Plaisance-Bonstaff, Karlie; Renne, Rolf

    2011-01-01

    Since 2004, more than 200 microRNAs (miRNAs) have been discovered in double-stranded DNA viruses, mainly herpesviruses and polyomaviruses (Nucleic Acids Res 32:D109-D111, 2004). miRNAs are short 22  ±  3 nt RNA molecules that posttranscriptionally regulate gene expression by binding to 3'-untranslated regions (3'UTR) of target mRNAs, thereby inducing translational silencing and/or transcript degradation (Nature 431:350-355, 2004; Cell 116:281-297, 2004). Since miRNAs require only limited complementarity for binding, miRNA targets are difficult to determine (Mol Cell 27:91-105, 2007). To date, targets have only been experimentally verified for relatively few viral miRNAs, which either target viral or host cellular gene expression: For example, SV40 and related polyomaviruses encode miRNAs which target viral large T antigen expression (Nature 435:682-686, 2005; J Virol 79:13094-13104, 2005; Virology 383:183-187, 2009; J Virol 82:9823-9828, 2008) and miRNAs of α-, β-, and γ-herpesviruses have been implicated in regulating the transition from latent to lytic gene expression, a key step in the herpesvirus life cycle. Viral miRNAs have also been shown to target various host cellular genes. Although this field is just beginning to unravel the multiple roles of viral miRNA in biology and pathogenesis, the current data strongly suggest that virally encoded miRNAs are able to regulate fundamental biological processes such as immune recognition, promotion of cell survival, angiogenesis, proliferation, and cell differentiation. This chapter aims to summarize our current knowledge of viral miRNAs, their targets and function, and the challenges lying ahead to decipher their role in viral biology, pathogenesis, and for γ-herepsvirus-encoded miRNAs, potentially tumorigenesis. PMID:21431678

  3. Identification of small Hfq-binding RNAs in Listeria monocytogenes

    PubMed Central

    Christiansen, Janne K.; Nielsen, Jesper S.; Ebersbach, Tine; Valentin-Hansen, Poul; Søgaard-Andersen, Lotte; Kallipolitis, Birgitte H.

    2006-01-01

    The RNA-binding protein Hfq plays important roles in bacterial physiology and is required for the activity of many small regulatory RNAs in prokaryotes. We have previously shown that Hfq contributes to stress tolerance and virulence in the Gram-positive human pathogen Listeria monocytogenes. In the present study, we performed coimmunoprecipitations followed by enzymatic RNA sequencing to identify Hfq-binding RNA molecules in L. monocytogenes. The approach resulted in the discovery of three small RNAs (sRNAs). The sRNAs are conserved between Listeria species, but were not identified in other bacterial species. The initial characterization revealed a number of unique features displayed by each individual sRNA. The first sRNA is encoded from within an annotated gene in the L. monocytogenes EGD-e genome. Analogous to most regulatory sRNAs in Escherichia coli, the stability of this sRNA is highly dependent on the presence of Hfq. The second sRNA appears to be produced by a transcription attenuation mechanism, and the third sRNA is present in five copies at two different locations within the L. monocytogenes EGD-e genome. The cellular levels of the sRNAs are growth phase dependent and vary in response to growth medium. All three sRNAs are expressed when L. monocytogenes multiplies within mammalian cells. This study represents the first attempt to identify sRNAs in L. monocytogenes. PMID:16682563

  4. Structural studies of bacterial transcriptional regulatory proteins by multidimensional heteronuclear NMR

    SciTech Connect

    Volkman, B.F.

    1995-02-01

    Nuclear magnetic resonance spectroscopy was used to elucidate detailed structural information for peptide and protein molecules. A small peptide was designed and synthesized, and its three-dimensional structure was calculated using distance information derived from two-dimensional NMR measurements. The peptide was used to induce antibodies in mice, and the cross-reactivity of the antibodies with a related protein was analyzed with enzyme-linked immunosorbent assays. Two proteins which are involved in regulation of transcription in bacteria were also studied. The ferric uptake regulation (Fur) protein is a metal-dependent repressor which controls iron uptake in bacteria. Two- and three-dimensional NMR techniques, coupled with uniform and selective isotope labeling allowed the nearly complete assignment of the resonances of the metal-binding domain of the Fur protein. NTRC is a transcriptional enhancer binding protein whose N-terminal domain is a {open_quote}receiver domain{close_quote} in the family of {open_quote}two-component{close_quote} regulatory systems. Phosphorylation of the N-terminal domain of NTRC activates the initiation of transcription of aeries encoding proteins involved in nitrogen regulation. Three- and four-dimensional NMR spectroscopy methods have been used to complete the resonance assignments and determine the solution structure of the N-terminal receiver domain of the NTRC protein. Comparison of the solution structure of the NTRC receiver domain with the crystal structures of the homologous protein CheY reveals a very similar fold, with the only significant difference being the position of helix 4 relative to the rest of the protein. The determination of the structure of the NTRC receiver domain is the first step toward understanding a mechanism of signal transduction which is common to many bacterial regulatory systems.

  5. Structural Basis for Promoter ;#8722;10 Element Recognition by the Bacterial RNA Polymerase [sigma] Subunit

    SciTech Connect

    Feklistov, Andrey; Darst, Seth A.

    2011-12-15

    The key step in bacterial promoter opening is recognition of the -10 promoter element (T-{sub 12}A-{sub 11}T-{sub 10}A-{sub 9}A-{sub 8}T{sub -7} consensus sequence) by the RNA polymerase {alpha} subunit. We determined crystal structures of {alpha} domain 2 bound to single-stranded DNA bearing -10 element sequences. Extensive interactions occur between the protein and the DNA backbone of every -10 element nucleotide. Base-specific interactions occur primarily with A{sub -11} and T{sub -7}, which are flipped out of the single-stranded DNA base stack and buried deep in protein pockets. The structures, along with biochemical data, support a model where the recognition of the -10 element sequence drives initial promoter opening as the bases of the nontemplate strand are extruded from the DNA double-helix and captured by {alpha}. These results provide a detailed structural basis for the critical roles of A{sub -11} and T{sub -7} in promoter melting and reveal important insights into the initiation of transcription bubble formation.

  6. Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases

    PubMed Central

    Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

    2016-01-01

    Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the ‘reverse' prenylation of (−)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5–C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (−)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed ‘reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams. PMID:26952246

  7. Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases

    NASA Astrophysics Data System (ADS)

    Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

    2016-03-01

    Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the `reverse' prenylation of (-)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5-C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (-)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed `reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams.

  8. Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases.

    PubMed

    Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

    2016-01-01

    Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the 'reverse' prenylation of (-)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5-C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (-)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed 'reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams. PMID:26952246

  9. Structural basis for promoter –10 element recognition by the bacterial RNA polymerase σ subunit

    PubMed Central

    Feklistov, Andrey; Darst, Seth A.

    2011-01-01

    SUMMARY The key step in bacterial promoter opening is recognition of the -10 promoter element (T-12A-11T-10A-9A-8T-7 consensus sequence) by the RNA polymerase σ subunit. We determined crystal structures of σ domain 2 bound to single-stranded DNA bearing -10 element sequences. Extensive interactions occur between the protein and the DNA backbone of every -10 element nucleotide. Base-specific interactions occur primarily with A-11, and T-7, which are flipped out of the single-stranded DNA base-stack and buried deep in protein pockets. The structures, along with biochemical data, support a model where the recognition of the -10 element sequence drives initial promoter opening as the bases of the non-template strand are extruded from the DNA double-helix and captured by σ. These results provide a detailed structural basis for the critical roles of A-11 and T-7 in promoter melting, and reveal important insights into the initiation of transcription bubble formation. PMID:22136875

  10. Structure of the complex between teicoplanin and a bacterial cell-wall peptide: use of a carrier-protein approach

    SciTech Connect

    Economou, Nicoleta J.; Zentner, Isaac J.; Lazo, Edwin; Jakoncic, Jean; Stojanoff, Vivian; Weeks, Stephen D.; Grasty, Kimberly C.; Cocklin, Simon; Loll, Patrick J.

    2013-04-01

    Using a carrier-protein strategy, the structure of teicoplanin bound to its bacterial cell-wall target has been determined. The structure reveals the molecular determinants of target recognition, flexibility in the antibiotic backbone and intrinsic radiation sensitivity of teicoplanin. Multidrug-resistant bacterial infections are commonly treated with glycopeptide antibiotics such as teicoplanin. This drug inhibits bacterial cell-wall biosynthesis by binding and sequestering a cell-wall precursor: a d-alanine-containing peptide. A carrier-protein strategy was used to crystallize the complex of teicoplanin and its target peptide by fusing the cell-wall peptide to either MBP or ubiquitin via native chemical ligation and subsequently crystallizing the protein–peptide–antibiotic complex. The 2.05 Å resolution MBP–peptide–teicoplanin structure shows that teicoplanin recognizes its ligand through a combination of five hydrogen bonds and multiple van der Waals interactions. Comparison of this teicoplanin structure with that of unliganded teicoplanin reveals a flexibility in the antibiotic peptide backbone that has significant implications for ligand recognition. Diffraction experiments revealed an X-ray-induced dechlorination of the sixth amino acid of the antibiotic; it is shown that teicoplanin is significantly more radiation-sensitive than other similar antibiotics and that ligand binding increases radiosensitivity. Insights derived from this new teicoplanin structure may contribute to the development of next-generation antibacterials designed to overcome bacterial resistance.

  11. Differences in Bacterial Community Structure in Two Color Morphs of the Hawaiian Reef Coral Montipora capitata.

    PubMed

    Shore-Maggio, Amanda; Runyon, Christina M; Ushijima, Blake; Aeby, Greta S; Callahan, Sean M

    2015-10-01

    Corals harbor diverse bacterial associations that contribute to the health of the host. Using 16S rRNA pyrosequencing, we compared the bacterial communities of red and orange morphs of the Hawaiian coral Montipora capitata. Although both color morphs shared dominant bacterial genera, weighted and unweighted UniFrac analyses showed distinct bacterial communities. A single operational taxonomic unit (OTU), classified as Vibrio, represented the largest driver of differences between the color morphs. This OTU comprised 35.4% (±5.5%) of the orange morph bacterial community yet comprised 1.1% (±0.6%) of the red morph bacterial community. Cultivable bacteria from the two color morphs were also compared and tested for antibacterial activity. Cultured isolates represented 14 genera (7% of the total genera identified from sequencing data), and all but two cultured isolates had a matching OTU from the sequencing data. Half of the isolates tested (8 out of 16) displayed antibacterial activity against other cultured isolates but not against two known bacterial pathogens of M. capitata. The results from this study demonstrate that the specificity of coral-bacterial associations extends beyond the level of coral species. In addition, culture-dependent methods captured bacterial diversity that was representative of both rare and abundant members of the associated bacterial community, as characterized by culture-independent methods. PMID:26253663

  12. Differences in Bacterial Community Structure in Two Color Morphs of the Hawaiian Reef Coral Montipora capitata

    PubMed Central

    Shore-Maggio, Amanda; Runyon, Christina M.; Ushijima, Blake; Aeby, Greta S.

    2015-01-01

    Corals harbor diverse bacterial associations that contribute to the health of the host. Using 16S rRNA pyrosequencing, we compared the bacterial communities of red and orange morphs of the Hawaiian coral Montipora capitata. Although both color morphs shared dominant bacterial genera, weighted and unweighted UniFrac analyses showed distinct bacterial communities. A single operational taxonomic unit (OTU), classified as Vibrio, represented the largest driver of differences between the color morphs. This OTU comprised 35.4% (±5.5%) of the orange morph bacterial community yet comprised 1.1% (±0.6%) of the red morph bacterial community. Cultivable bacteria from the two color morphs were also compared and tested for antibacterial activity. Cultured isolates represented 14 genera (7% of the total genera identified from sequencing data), and all but two cultured isolates had a matching OTU from the sequencing data. Half of the isolates tested (8 out of 16) displayed antibacterial activity against other cultured isolates but not against two known bacterial pathogens of M. capitata. The results from this study demonstrate that the specificity of coral-bacterial associations extends beyond the level of coral species. In addition, culture-dependent methods captured bacterial diversity that was representative of both rare and abundant members of the associated bacterial community, as characterized by culture-independent methods. PMID:26253663

  13. Bacterial community structures are unique and resilient in full-scale bioenergy systems

    PubMed Central

    Werner, Jeffrey J.; Knights, Dan; Garcia, Marcelo L.; Scalfone, Nicholas B.; Smith, Samual; Yarasheski, Kevin; Cummings, Theresa A.; Beers, Allen R.; Knight, Rob; Angenent, Largus T.

    2011-01-01

    Anaerobic digestion is the most successful bioenergy technology worldwide with, at its core, undefined microbial communities that have poorly understood dynamics. Here, we investigated the relationships of bacterial community structure (>400,000 16S rRNA gene sequences for 112 samples) with function (i.e., bioreactor performance) and environment (i.e., operating conditions) in a yearlong monthly time series of nine full-scale bioreactor facilities treating brewery wastewater (>20,000 measurements). Each of the nine facilities had a unique community structure with an unprecedented level of stability. Using machine learning, we identified a small subset of operational taxonomic units (OTUs; 145 out of 4,962), which predicted the location of the facility of origin for almost every sample (96.4% accuracy). Of these 145 OTUs, syntrophic bacteria were systematically overrepresented, demonstrating that syntrophs rebounded following disturbances. This indicates that resilience, rather than dynamic competition, played an important role in maintaining the necessary syntrophic populations. In addition, we explained the observed phylogenetic differences between all samples on the basis of a subset of environmental gradients (using constrained ordination) and found stronger relationships between community structure and its function rather than its environment. These relationships were strongest for two performance variables—methanogenic activity and substrate removal efficiency—both of which were also affected by microbial ecology because these variables were correlated with community evenness (at any given time) and variability in phylogenetic structure (over time), respectively. Thus, we quantified relationships between community structure and function, which opens the door to engineer communities with superior functions. PMID:21368115

  14. Complexes of Bacterial Nicotinate Mononucleotide Adenylyltransferase with Inhibitors: Implication for Structure-Based Drug Design and Improvement

    SciTech Connect

    Huang, Nian; Kolhatkar, Rohit; Eyobo, Yvonne; Sorci, Leonardo; Rodionova, Irina; Osterman, Andrei L.; MacKerell, Jr., Alexander D.; Zhang, Hong

    2010-12-07

    Bacterial nicotinate mononucleotide adenylyltransferase encoded by the essential gene nadD plays a central role in the synthesis of the redox cofactor NAD{sup +}. The NadD enzyme is conserved in the majority of bacterial species and has been recognized as a novel target for developing new and potentially broad-spectrum antibacterial therapeutics. Here we report the crystal structures of Bacillus anthracis NadD in complex with three NadD inhibitors, including two analogues synthesized in the present study. These structures revealed a common binding site shared by different classes of NadD inhibitors and explored the chemical environment surrounding this site. The structural data obtained here also showed that the subtle changes in ligand structure can lead to significant changes in the binding mode, information that will be useful for future structure-based optimization and design of high affinity inhibitors.

  15. Effect of Divalent Cation Removal on the Structure of Gram-Negative Bacterial Outer Membrane Models

    DOE PAGESBeta

    Clifton, Luke A.; Skoda, Maximilian W. A.; Le Brun, Anton P.; Ciesielski, Filip; Kuzmenko, Ivan; Holt, Stephen A.; Lakey, Jeremy H.

    2014-12-09

    The Gram-negative bacterial outer membrane (GNB-OM) is asymmetric in its lipid composition with a phospholipid-rich inner leaflet and an outer leaflet predominantly composed of lipopolysaccharides (LPS). LPS are polyanionic molecules, with numerous phosphate groups present in the lipid A and core oligosaccharide regions. The repulsive forces due to accumulation of the negative charges are screened and bridged by the divalent cations (Mg2+ and Ca2+) that are known to be crucial for the integrity of the bacterial OM. Indeed, chelation of divalent cations is a well-established method to permeabilize Gram-negative bacteria such as Escherichia coli. Here, we use X-ray and neutronmore » reflectivity (XRR and NR, respectively) techniques to examine the role of calcium ions in the stability of a model GNB-OM. Using XRR we show that Ca2+ binds to the core region of the rough mutant LPS (RaLPS) films, producing more ordered structures in comparison to divalent cation free monolayers. Using recently developed solid-supported models of the GNB-OM, we study the effect of calcium removal on the asymmetry of DPPC:RaLPS bilayers. We show that without the charge screening effect of divalent cations, the LPS is forced to overcome the thermodynamically unfavorable energy barrier and flip across the hydrophobic bilayer to minimize the repulsive electrostatic forces, resulting in about 20% mixing of LPS and DPPC between the inner and outer bilayer leaflets. These results reveal for the first time the molecular details behind the well-known mechanism of outer membrane stabilization by divalent cations. This confirms the relevance of the asymmetric models for future studies of outer membrane stability and antibiotic penetration.« less

  16. Effect of Divalent Cation Removal on the Structure of Gram-Negative Bacterial Outer Membrane Models

    SciTech Connect

    Clifton, Luke A.; Skoda, Maximilian W. A.; Le Brun, Anton P.; Ciesielski, Filip; Kuzmenko, Ivan; Holt, Stephen A.; Lakey, Jeremy H.

    2014-12-09

    The Gram-negative bacterial outer membrane (GNB-OM) is asymmetric in its lipid composition with a phospholipid-rich inner leaflet and an outer leaflet predominantly composed of lipopolysaccharides (LPS). LPS are polyanionic molecules, with numerous phosphate groups present in the lipid A and core oligosaccharide regions. The repulsive forces due to accumulation of the negative charges are screened and bridged by the divalent cations (Mg2+ and Ca2+) that are known to be crucial for the integrity of the bacterial OM. Indeed, chelation of divalent cations is a well-established method to permeabilize Gram-negative bacteria such as Escherichia coli. Here, we use X-ray and neutron reflectivity (XRR and NR, respectively) techniques to examine the role of calcium ions in the stability of a model GNB-OM. Using XRR we show that Ca2+ binds to the core region of the rough mutant LPS (RaLPS) films, producing more ordered structures in comparison to divalent cation free monolayers. Using recently developed solid-supported models of the GNB-OM, we study the effect of calcium removal on the asymmetry of DPPC:RaLPS bilayers. We show that without the charge screening effect of divalent cations, the LPS is forced to overcome the thermodynamically unfavorable energy barrier and flip across the hydrophobic bilayer to minimize the repulsive electrostatic forces, resulting in about 20% mixing of LPS and DPPC between the inner and outer bilayer leaflets. These results reveal for the first time the molecular details behind the well-known mechanism of outer membrane stabilization by divalent cations. This confirms the relevance of the asymmetric models for future studies of outer membrane stability and antibiotic penetration.

  17. Effect of Divalent Cation Removal on the Structure of Gram-Negative Bacterial Outer Membrane Models

    PubMed Central

    2014-01-01

    The Gram-negative bacterial outer membrane (GNB-OM) is asymmetric in its lipid composition with a phospholipid-rich inner leaflet and an outer leaflet predominantly composed of lipopolysaccharides (LPS). LPS are polyanionic molecules, with numerous phosphate groups present in the lipid A and core oligosaccharide regions. The repulsive forces due to accumulation of the negative charges are screened and bridged by the divalent cations (Mg2+ and Ca2+) that are known to be crucial for the integrity of the bacterial OM. Indeed, chelation of divalent cations is a well-established method to permeabilize Gram-negative bacteria such as Escherichia coli. Here, we use X-ray and neutron reflectivity (XRR and NR, respectively) techniques to examine the role of calcium ions in the stability of a model GNB-OM. Using XRR we show that Ca2+ binds to the core region of the rough mutant LPS (RaLPS) films, producing more ordered structures in comparison to divalent cation free monolayers. Using recently developed solid-supported models of the GNB-OM, we study the effect of calcium removal on the asymmetry of DPPC:RaLPS bilayers. We show that without the charge screening effect of divalent cations, the LPS is forced to overcome the thermodynamically unfavorable energy barrier and flip across the hydrophobic bilayer to minimize the repulsive electrostatic forces, resulting in about 20% mixing of LPS and DPPC between the inner and outer bilayer leaflets. These results reveal for the first time the molecular details behind the well-known mechanism of outer membrane stabilization by divalent cations. This confirms the relevance of the asymmetric models for future studies of outer membrane stability and antibiotic penetration. PMID:25489959

  18. Time-scales of hydrological forcing on the geochemistry and bacterial community structure of temperate peat soils

    NASA Astrophysics Data System (ADS)

    Nunes, Flavia L. D.; Aquilina, Luc; De Ridder, Jo; Francez, André-Jean; Quaiser, Achim; Caudal, Jean-Pierre; Vandenkoornhuyse, Philippe; Dufresne, Alexis

    2015-10-01

    Peatlands are an important global carbon reservoir. The continued accumulation of carbon in peatlands depends on the persistence of anoxic conditions, in part induced by water saturation, which prevents oxidation of organic matter, and slows down decomposition. Here we investigate how and over what time scales the hydrological regime impacts the geochemistry and the bacterial community structure of temperate peat soils. Peat cores from two sites having contrasting groundwater budgets were subjected to four controlled drought-rewetting cycles. Pore water geochemistry and metagenomic profiling of bacterial communities showed that frequent water table drawdown induced lower concentrations of dissolved carbon, higher concentrations of sulfate and iron and reduced bacterial richness and diversity in the peat soil and water. Short-term drought cycles (3-9 day frequency) resulted in different communities from continuously saturated environments. Furthermore, the site that has more frequently experienced water table drawdown during the last two decades presented the most striking shifts in bacterial community structure, altering biogeochemical functioning of peat soils. Our results suggest that the increase in frequency and duration of drought conditions under changing climatic conditions or water resource use can induce profound changes in bacterial communities, with potentially severe consequences for carbon storage in temperate peatlands.

  19. Structure and diversity of bacterial, eukaryotic and archaeal communities in glacial cryoconite holes from the Arctic and the Antarctic.

    PubMed

    Cameron, Karen A; Hodson, Andrew J; Osborn, A Mark

    2012-11-01

    The cryosphere presents some of the most challenging conditions for life on earth. Nevertheless, (micro)biota survive in a range of niches in glacial systems, including water-filled depressions on glacial surfaces termed cryoconite holes (centimetre to metre in diameter and up to 0.5 m deep) that contain dark granular material (cryoconite). In this study, the structure of bacterial and eukaryotic cryoconite communities from ten different locations in the Arctic and Antarctica was compared using T-RFLP analysis of rRNA genes. Community structure varied with geography, with greatest differences seen between communities from the Arctic and the Antarctic. DNA sequencing of rRNA genes revealed considerable diversity, with individual cryoconite hole communities containing between six and eight bacterial phyla and five and eight eukaryotic 'first-rank' taxa and including both bacterial and eukaryotic photoautotrophs. Bacterial Firmicutes and Deltaproteobacteria and Epsilonproteobacteria, eukaryotic Rhizaria, Haptophyta, Choanomonada and Centroheliozoa, and archaea were identified for the first time in cryoconite ecosystems. Archaea were only found within Antarctic locations, with the majority of sequences (77%) related to members of the Thaumarchaeota. In conclusion, this research has revealed that Antarctic and Arctic cryoconite holes harbour geographically distinct highly diverse communities and has identified hitherto unknown bacterial, eukaryotic and archaeal taxa, therein. PMID:22168226

  20. Structure of the mammalian antimicrobial peptide Bac7(1-16) bound within the exit tunnel of a bacterial ribosome.

    PubMed

    Seefeldt, A Carolin; Graf, Michael; Pérébaskine, Natacha; Nguyen, Fabian; Arenz, Stefan; Mardirossian, Mario; Scocchi, Marco; Wilson, Daniel N; Innis, C Axel

    2016-03-18

    Proline-rich antimicrobial peptides (PrAMPs) produced as part of the innate immune response of animals, insects and plants represent a vast, untapped resource for the treatment of multidrug-resistant bacterial infections. PrAMPs such as oncocin or bactenecin-7 (Bac7) interact with the bacterial ribosome to inhibit translation, but their supposed specificity as inhibitors of bacterial rather than mammalian protein synthesis remains unclear, despite being key to developing drugs with low toxicity. Here, we present crystal structures of the Thermus thermophilus 70S ribosome in complex with the first 16 residues of mammalian Bac7, as well as the insect-derived PrAMPs metalnikowin I and pyrrhocoricin. The structures reveal that the mammalian Bac7 interacts with a similar region of the ribosome as insect-derived PrAMPs. Consistently, Bac7 and the oncocin derivative Onc112 compete effectively with antibiotics, such as erythromycin, which target the ribosomal exit tunnel. Moreover, we demonstrate that Bac7 allows initiation complex formation but prevents entry into the elongation phase of translation, and show that it inhibits translation on both mammalian and bacterial ribosomes, explaining why this peptide needs to be stored as an inactive pro-peptide. These findings highlight the need to consider the specificity of PrAMP derivatives for the bacterial ribosome in future drug development efforts. PMID:26792896

  1. Time-scales of hydrological forcing on the geochemistry and bacterial community structure of temperate peat soils

    PubMed Central

    Nunes, Flavia L. D.; Aquilina, Luc; de Ridder, Jo; Francez, André-Jean; Quaiser, Achim; Caudal, Jean-Pierre; Vandenkoornhuyse, Philippe; Dufresne, Alexis

    2015-01-01

    Peatlands are an important global carbon reservoir. The continued accumulation of carbon in peatlands depends on the persistence of anoxic conditions, in part induced by water saturation, which prevents oxidation of organic matter, and slows down decomposition. Here we investigate how and over what time scales the hydrological regime impacts the geochemistry and the bacterial community structure of temperate peat soils. Peat cores from two sites having contrasting groundwater budgets were subjected to four controlled drought-rewetting cycles. Pore water geochemistry and metagenomic profiling of bacterial communities showed that frequent water table drawdown induced lower concentrations of dissolved carbon, higher concentrations of sulfate and iron and reduced bacterial richness and diversity in the peat soil and water. Short-term drought cycles (3–9 day frequency) resulted in different communities from continuously saturated environments. Furthermore, the site that has more frequently experienced water table drawdown during the last two decades presented the most striking shifts in bacterial community structure, altering biogeochemical functioning of peat soils. Our results suggest that the increase in frequency and duration of drought conditions under changing climatic conditions or water resource use can induce profound changes in bacterial communities, with potentially severe consequences for carbon storage in temperate peatlands. PMID:26440376

  2. Time-scales of hydrological forcing on the geochemistry and bacterial community structure of temperate peat soils.

    PubMed

    Nunes, Flavia L D; Aquilina, Luc; de Ridder, Jo; Francez, André-Jean; Quaiser, Achim; Caudal, Jean-Pierre; Vandenkoornhuyse, Philippe; Dufresne, Alexis

    2015-01-01

    Peatlands are an important global carbon reservoir. The continued accumulation of carbon in peatlands depends on the persistence of anoxic conditions, in part induced by water saturation, which prevents oxidation of organic matter, and slows down decomposition. Here we investigate how and over what time scales the hydrological regime impacts the geochemistry and the bacterial community structure of temperate peat soils. Peat cores from two sites having contrasting groundwater budgets were subjected to four controlled drought-rewetting cycles. Pore water geochemistry and metagenomic profiling of bacterial communities showed that frequent water table drawdown induced lower concentrations of dissolved carbon, higher concentrations of sulfate and iron and reduced bacterial richness and diversity in the peat soil and water. Short-term drought cycles (3-9 day frequency) resulted in different communities from continuously saturated environments. Furthermore, the site that has more frequently experienced water table drawdown during the last two decades presented the most striking shifts in bacterial community structure, altering biogeochemical functioning of peat soils. Our results suggest that the increase in frequency and duration of drought conditions under changing climatic conditions or water resource use can induce profound changes in bacterial communities, with potentially severe consequences for carbon storage in temperate peatlands. PMID:26440376

  3. Characterization of specificity of bacterial community structure within the burrow environment of the marine polychaete Hediste (Nereis) diversicolor.

    PubMed

    Pischedda, Laura; Militon, Cécile; Gilbert, Franck; Cuny, Philippe

    2011-12-01

    Bioturbation is known to stimulate microbial communities, especially in macrofaunal burrows where the abundance and activities of bacteria are increased. Until now, these microbial communities have been poorly characterized and an important ecological question remains: do burrow walls harbor similar or specific communities compared with anoxic and surface sediments? The bacterial community structure of coastal sediments inhabited by the polychaete worm Hediste diversicolor was investigated. Surface, burrow wall and anoxic sediments were collected at the Carteau beach (Gulf of Fos, Mediterranean Sea). Bacterial diversity was determined by analyzing small subunit ribosomal RNA (16S rRNA) sequences from three clone libraries (168, 179 and 129 sequences for the surface, burrow wall and anoxic sediments, respectively). Libraries revealed 306 different operational taxonomic units (OTUs) belonging to at least 15 bacterial phyla. Bioinformatic analyses and comparisons between the three clone libraries showed that the burrow walls harbored a specific bacterial community structure which differed from the surface and anoxic environments. More similarities were nevertheless found with the surface assemblage. Inside the burrow walls, the bacterial community was characterized by high biodiversity, which probably results from the biogeochemical heterogeneity of the burrow system. PMID:21946148

  4. Adenovirus Virus-Associated RNA Is Processed to Functional Interfering RNAs Involved in Virus Production

    PubMed Central

    Aparicio, Oscar; Razquin, Nerea; Zaratiegui, Mikel; Narvaiza, Iñigo; Fortes, Puri

    2006-01-01

    Posttranscriptional gene silencing allows sequence-specific control of gene expression. Specificity is guaranteed by small antisense RNAs such as microRNAs (miRNAs) or small interfering RNAs (siRNAs). Functional miRNAs derive from longer double-stranded RNA (dsRNA) molecules that are cleaved to pre-miRNAs in the nucleus and are transported by exportin 5 (Exp 5) to the cytoplasm. Adenovirus-infected cells express virus-associated (VA) RNAs, which are dsRNA molecules similar in structure to pre-miRNAs. VA RNAs are also transported by Exp 5 to the cytoplasm, where they accumulate. Here we show that small RNAs derived from VA RNAs (svaRNAs), similar to miRNAs, can be found in adenovirus-infected cells. VA RNA processing to svaRNAs requires neither viral replication nor viral protein expression, as evidenced by the fact that svaRNA accumulation can be detected in cells transfected with VA sequences. svaRNAs are efficiently bound by Argonaute 2, the endonuclease of the RNA-induced silencing complex, and behave as functional siRNAs, in that they inhibit the expression of reporter genes with complementary sequences. Blocking svaRNA-mediated inhibition affects efficient adenovirus production, indicating that svaRNAs are required for virus viability. Thus, svaRNA-mediated silencing could represent a novel mechanism used by adenoviruses to control cellular or viral gene expression. PMID:16415015

  5. Bacteriophages with Potential for Inactivation of Fish Pathogenic Bacteria: Survival, Host Specificity and Effect on Bacterial Community Structure

    PubMed Central

    Pereira, Carla; Silva, Yolanda J.; Santos, Ana L.; Cunha, Ângela; Gomes, Newton C. M.; Almeida, Adelaide

    2011-01-01

    Phage therapy may represent a viable alternative to antibiotics to inactivate fish pathogenic bacteria. Its use, however, requires the awareness of novel kinetics phenomena not applied to conventional drug treatments. The main objective of this work was to isolate bacteriophages with potential to inactivate fish pathogenic bacteria, without major effects on the structure of natural bacterial communities of aquaculture waters. The survival was determined in marine water, through quantification by the soft agar overlay technique. The host specificity was evaluated by cross infection. The ecological impact of phage addition on the structure of the bacterial community was evaluated by DGGE of PCR amplified 16S rRNA gene fragments. The survival period varied between 12 and 91 days, with a higher viability for Aeromonas salmonicida phages. The phages of Vibrio parahaemolyticus and of A. salmonicida infected bacteria of different families with a high efficacy of plating. The specific phages of pathogenic bacteria had no detectable impact on the structure of the bacterial community. In conclusion, V. parahaemolyticus and A. salmonicida phages show good survival time in marine water, have only a moderated impact on the overall bacterial community structure and the desired specificity for host pathogenic bacteria, being potential candidates for therapy of fish infectious diseases in marine aquaculture systems. PMID:22163184

  6. Long Non-Coding RNAs in Haematological Malignancies

    PubMed Central

    Garitano-Trojaola, Andoni; Agirre, Xabier; Prósper, Felipe; Fortes, Puri

    2013-01-01

    Long non-coding RNAs (lncRNAs) are functional RNAs longer than 200 nucleotides in length. LncRNAs are as diverse as mRNAs and they normally share the same biosynthetic machinery based on RNA polymerase II, splicing and polyadenylation. However, lncRNAs have low coding potential. Compared to mRNAs, lncRNAs are preferentially nuclear, more tissue specific and expressed at lower levels. Most of the lncRNAs described to date modulate the expression of specific genes by guiding chromatin remodelling factors; inducing chromosomal loopings; affecting transcription, splicing, translation or mRNA stability; or serving as scaffolds for the organization of cellular structures. They can function in cis, cotranscriptionally, or in trans, acting as decoys, scaffolds or guides. These functions seem essential to allow cell differentiation and growth. In fact, many lncRNAs have been shown to exert oncogenic or tumor suppressor properties in several cancers including haematological malignancies. In this review, we summarize what is known about lncRNAs, the mechanisms for their regulation in cancer and their role in leukemogenesis, lymphomagenesis and hematopoiesis. Furthermore, we discuss the potential of lncRNAs in diagnosis, prognosis and therapy in cancer, with special attention to haematological malignancies. PMID:23887658

  7. Pyrosequencing analysis of aerobic anoxygenic phototrophic bacterial community structure in the oligotrophic western Pacific Ocean.

    PubMed

    Zheng, Qiang; Liu, Yanting; Steindler, Laura; Jiao, Nianzhi

    2015-04-01

    Aerobic anoxygenic phototrophic bacteria (AAPB) represent a widespread functional bacterial group defined by their obligate aerobic and facultative photoheterotrophic abilities. They are an active part of the marine microbial community as revealed by a large number of previous investigations. Here, we made an in-depth comparison of AAPB community structures in the subsurface water and the upper twilight zone of the western Pacific Ocean using high-throughput sequencing based on the pufM gene. Approximately, 100 000 sequences, grouped into 159 OTUs (94% cut-off value), included 44 and 24 OTUs unique to the subsurface and the upper twilight zone, respectively; 92 OTUs were common to both subsurface and twilight zone, and 3 OTUs were found in all samples. Consistent with previous studies, AAPB belonging to the Gammaproteobacteria were the dominant group in the whole water column, followed by the alphaproteobacterial AAPB. Comparing the relative abundance distribution patterns of different clades, an obvious community-structure separation according to deeper or shallower environment could be observed. Sulfitobacter-like, Loktanella-like, Erythrobacter-like, Dinoroseobacter-like and Gamma-HIMB55-like AAPB preferred the high-light subsurface water, while Methylobacterium-like, 'Citromicrobium'-like, Roseovarius-like and Bradyrhizobium-like AAPB, the dim light environment. PMID:25724533

  8. Bacterial Sigma Factors and Anti-Sigma Factors: Structure, Function and Distribution

    PubMed Central

    Paget, Mark S.

    2015-01-01

    Sigma factors are multi-domain subunits of bacterial RNA polymerase (RNAP) that play critical roles in transcription initiation, including the recognition and opening of promoters as well as the initial steps in RNA synthesis. This review focuses on the structure and function of the major sigma-70 class that includes the housekeeping sigma factor (Group 1) that directs the bulk of transcription during active growth, and structurally-related alternative sigma factors (Groups 2–4) that control a wide variety of adaptive responses such as morphological development and the management of stress. A recurring theme in sigma factor control is their sequestration by anti-sigma factors that occlude their RNAP-binding determinants. Sigma factors are then released through a wide variety of mechanisms, often involving branched signal transduction pathways that allow the integration of distinct signals. Three major strategies for sigma release are discussed: regulated proteolysis, partner-switching, and direct sensing by the anti-sigma factor. PMID:26131973

  9. Structure and primase-mediated activation of a bacterial dodecameric replicative helicase

    PubMed Central

    Bazin, Alexandre; Cherrier, Mickaël V.; Gutsche, Irina; Timmins, Joanna; Terradot, Laurent

    2015-01-01

    Replicative helicases are essential ATPases that unwind DNA to initiate chromosomal replication. While bacterial replicative DnaB helicases are hexameric, Helicobacter pylori DnaB (HpDnaB) was found to form double hexamers, similar to some archaeal and eukaryotic replicative helicases. Here we present a structural and functional analysis of HpDnaB protein during primosome formation. The crystal structure of the HpDnaB at 6.7 Å resolution reveals a dodecameric organization consisting of two hexamers assembled via their N-terminal rings in a stack-twisted mode. Using fluorescence anisotropy we show that HpDnaB dodecamer interacts with single-stranded DNA in the presence of ATP but has a low DNA unwinding activity. Multi-angle light scattering and small angle X-ray scattering demonstrate that interaction with the DnaG primase helicase-binding domain dissociates the helicase dodecamer into single ringed primosomes. Functional assays on the proteins and associated complexes indicate that these single ringed primosomes are the most active form of the helicase for ATP hydrolysis, DNA binding and unwinding. These findings shed light onto an activation mechanism of HpDnaB by the primase that might be relevant in other bacteria and possibly other organisms exploiting dodecameric helicases for DNA replication. PMID:26264665

  10. Discovery and structural characterization of an allosteric inhibitor of bacterial cis-prenyltransferase

    PubMed Central

    Danley, Dennis E; Baima, Eric T; Mansour, Mahmoud; Fennell, Kimberly F; Chrunyk, Boris A; Mueller, John P; Liu, Shenping; Qiu, Xiayang

    2015-01-01

    Undecaprenyl pyrophosphate synthase (UPPs) is an essential enzyme in a key bacterial cell wall synthesis pathway. It catalyzes the consecutive condensations of isopentenyl pyrophosphate (IPP) groups on to a trans-farnesyl pyrophosphate (FPP) to produce a C55 isoprenoid, undecaprenyl pyrophosphate (UPP). Here we report the discovery and co-crystal structures of a drug-like UPPs inhibitor in complex with Streptococcus pneumoniae UPPs, with and without substrate FPP, at resolutions of 2.2 and 2.1 Å, respectively. The UPPs inhibitor has a low molecular weight (355 Da), but displays potent inhibition of UPP synthesis in vitro (IC50 50 nM) that translates into excellent whole cell antimicrobial activity against pathogenic strains of Streptococcal species (MIC90 0.4 µg mL−1). Interestingly, the inhibitor does not compete with the substrates but rather binds at a site adjacent to the FPP binding site and interacts with the tail of the substrate. Based on the structures, an allosteric inhibition mechanism of UPPs is proposed for this inhibitor. This inhibition mechanism is supported by biochemical and biophysical experiments, and provides a basis for the development of novel antibiotics targeting Streptococcus pneumoniae. PMID:25287857

  11. Peptidoglycan at its peaks: how chromatographic analyses can reveal bacterial cell-wall structure and assembly

    PubMed Central

    Desmarais, Samantha M.; De Pedro, Miguel A.; Cava, Felipe; Huang, Kerwyn Casey

    2013-01-01

    The peptidoglycan (PG) cell wall is a unique macromolecule responsible for both shape determination and cellular integrity under osmotic stress in virtually all bacteria. A quantitative understanding of the relationships between PG architecture, morphogenesis, immune system activation, and pathogenesis can provide molecular-scale insights into the function of proteins involved in cell-wall synthesis and cell growth. High Performance Liquid Chromatography (HPLC) has played an important role in our understanding of the structural and chemical complexity of the cell wall by providing an analytical method to quantify differences in chemical composition. Here, we present a primer on the basic chemical features of wall structure that can be revealed through HPLC, along with a description of the applications of HPLC PG analyses for interpreting the effects of genetic and chemical perturbations to a variety of bacterial species in different environments. We describe the physical consequences of different PG compositions on cell shape, and review complementary experimental and computational methodologies for PG analysis. Finally, we present a partial list of future targets of development for HPLC and related techniques. PMID:23679048

  12. Structural Analysis of Multi-Helical RNAs by NMR-SAXS/WAXS: Application to the U4/U6 di-snRNA.

    PubMed

    Cornilescu, Gabriel; Didychuk, Allison L; Rodgers, Margaret L; Michael, Lauren A; Burke, Jordan E; Montemayor, Eric J; Hoskins, Aaron A; Butcher, Samuel E

    2016-02-27

    NMR and SAXS (small-angle X-ray scattering)/WAXS (wide-angle X-ray scattering) are highly complementary approaches for the analysis of RNA structure in solution. Here we describe an efficient NMR-SAXS/WAXS approach for structural investigation of multi-helical RNAs. We illustrate this approach by determining the overall fold of a 92-nt 3-helix junction from the U4/U6 di-snRNA. The U4/U6 di-snRNA is conserved in eukaryotes and is part of the U4/U6.U5 tri-snRNP, a large ribonucleoprotein complex that comprises a major subunit of the assembled spliceosome. Helical orientations can be determined by X-ray scattering data alone, but the addition of NMR RDC (residual dipolar coupling) restraints improves the structure models. RDCs were measured in two different external alignment media and also by magnetic susceptibility anisotropy. The resulting alignment tensors are collinear, which is a previously noted problem for nucleic acids. Including WAXS data in the calculations produces models with significantly better fits to the scattering data. In solution, the U4/U6 di-snRNA forms a 3-helix junction with a planar Y-shaped structure and has no detectable tertiary interactions. Single-molecule Förster resonance energy transfer data support the observed topology. A comparison with the recently determined cryo-electron microscopy structure of the U4/U6.U5 tri-snRNP illustrates how proteins scaffold the RNA and dramatically alter the geometry of the U4/U6 3-helix junction. PMID:26655855

  13. Structural basis for recognition of intron branchpoint RNA by yeast Msl5 and selective effects of interfacial mutations on splicing of yeast pre-mRNAs

    PubMed Central

    Jacewicz, Agata; Chico, Lidia; Smith, Paul

    2015-01-01

    Saccharomyces cerevisiae Msl5 orchestrates spliceosome assembly by binding the intron branchpoint sequence 5′-UACUAAC and, with its heterodimer partner protein Mud2, establishing cross intron-bridging interactions with the U1 snRNP at the 5′ splice site. Here we define the central Msl5 KH-QUA2 domain as sufficient for branchpoint RNA recognition. The 1.8 Å crystal structure of Msl5-(KH-QUA2) bound to the branchpoint highlights an extensive network of direct and water-mediated protein–RNA and intra-RNA atomic contacts at the interface that illuminate how Msl5 recognizes each nucleobase of the UACUAAC element. The Msl5 structure rationalizes a large body of mutational data and inspires new functional studies herein, which reveal how perturbations of the Msl5·RNA interface impede the splicing of specific yeast pre-mRNAs. We also identify interfacial mutations in Msl5 that bypass the essentiality of Sub2, a DExD-box ATPase implicated in displacing Msl5 from the branchpoint in exchange for the U2 snRNP. These studies establish an atomic resolution framework for understanding splice site selection and early spliceosome dynamics. PMID:25587180

  14. Contrasting soil bacterial community structure between the phyla Acidobacteria and Proteobacteria in tropical Southeast Asian and temperate Japanese forests.

    PubMed

    Miyashita, Naohiko T

    2015-01-01

    Soil bacterial community structures of six dominant phyla (Acidobacteria, Proteobacteria, Verrucomicrobia, Planctomycetes, Bacteroidetes and Actinobacteria) and unclassified bacteria detected in tropical Sarawakian and temperate Japanese forests were compared based on 16S rRNA gene sequence variation. The class composition in each phylum was similar among the studied forests; however, significant heterogeneities of class frequencies were detected. Acidobacteria and Proteobacteria were the most dominant phyla in all six forests, but differed in the level of bacterial species diversity, pattern of species occurrence and association pattern of species composition with physicochemical properties in soil. Species diversity among Acidobacteria was approximately half that among Proteobacteria, based on the number of clusters and the Chao1 index, even though a similar number of sequence reads were obtained for these two phyla. In contrast, species diversity within Planctomycetes and Bacteroidetes was nearly as high as within Acidobacteria, despite many fewer sequence reads. The density of species (the number of sequence reads per cluster) correlated negatively with species diversity, and species density within Acidobacteria was approximately twice that within Proteobacteria. Although the percentage of forest-specific species was high for all bacterial groups, sampling site-specific species varied among bacterial groups, indicating limited inter-forest migration and differential movement of bacteria in forest soil. For five of the seven bacterial groups, including Acidobacteria, soil pH appeared to strongly influence species composition, but this association was not observed for Proteobacterial species. Topology of UPGMA trees and pattern of NMDS plots among the forests differed among the bacterial groups, suggesting that each bacterial group has adapted and evolved independently in each forest. PMID:26399766

  15. Bacterial Diversity and Community Structure in Korean Ginseng Field Soil Are Shifted by Cultivation Time

    PubMed Central

    Hoang, Van-An; Subramaniyam, Sathiyamoorthy; Kang, Jong-Pyo; Kang, Chang Ho; Yang, Deok-Chun

    2016-01-01

    Traditional molecular methods have been used to examine bacterial communities in ginseng-cultivated soil samples in a time-dependent manner. Despite these efforts, our understanding of the bacterial community is still inadequate. Therefore, in this study, a high-throughput sequencing approach was employed to investigate bacterial diversity in various ginseng field soil samples over cultivation times of 2, 4, and 6 years in the first and second rounds of cultivation. We used non-cultivated soil samples to perform a comparative study. Moreover, this study assessed changes in the bacterial community associated with soil depth and the health state of the ginseng. Bacterial richness decreased through years of cultivation. This study detected differences in relative abundance of bacterial populations between the first and second rounds of cultivation, years of cultivation, and health states of ginseng. These bacterial populations were mainly distributed in the classes Acidobacteria, Alphaproteobacteria, Deltaproteobacteria, Gammaproteobacteria, and Sphingobacteria. In addition, we found that pH, available phosphorus, and exchangeable Ca+ seemed to have high correlations with bacterial class in ginseng cultivated soil. PMID:27187071

  16. Bacterial population structure and dynamics during the development of almond drupes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aims: To describe the bacterial populations and their dynamics during the development of almond drupes. Methods and Results: We examined 16S rRNA gene libraries derived from the bacterial populations on almond drupes at three stages of development: 1) when the drupes were full sized, but before embr...

  17. Structural insights into inhibition of lipid I production in bacterial cell wall synthesis.

    PubMed

    Chung, Ben C; Mashalidis, Ellene H; Tanino, Tetsuya; Kim, Mijung; Matsuda, Akira; Hong, Jiyong; Ichikawa, Satoshi; Lee, Seok-Yong

    2016-05-26

    Antibiotic-resistant bacterial infection is a serious threat to public health. Peptidoglycan biosynthesis is a well-established target for antibiotic development. MraY (phospho-MurNAc-pentapeptide translocase) catalyses the first and an essential membrane step of peptidoglycan biosynthesis. It is considered a very promising target for the development of new antibiotics, as many naturally occurring nucleoside inhibitors with antibacterial activity target this enzyme. However, antibiotics targeting MraY have not been developed for clinical use, mainly owing to a lack of structural insight into inhibition of this enzyme. Here we present the crystal structure of MraY from Aquifex aeolicus (MraYAA) in complex with its naturally occurring inhibitor, muraymycin D2 (MD2). We show that after binding MD2, MraYAA undergoes remarkably large conformational rearrangements near the active site, which lead to the formation of a nucleoside-binding pocket and a peptide-binding site. MD2 binds the nucleoside-binding pocket like a two-pronged plug inserting into a socket. Further interactions it makes in the adjacent peptide-binding site anchor MD2 to and enhance its affinity for MraYAA. Surprisingly, MD2 does not interact with three acidic residues or the Mg(2+) cofactor required for catalysis, suggesting that MD2 binds to MraYAA in a manner that overlaps with, but is distinct from, its natural substrate, UDP-MurNAc-pentapeptide. We have determined the principles of MD2 binding to MraYAA, including how it avoids the need for pyrophosphate and sugar moieties, which are essential features for substrate binding. The conformational plasticity of MraY could be the reason that it is the target of many structurally distinct inhibitors. These findings can inform the design of new inhibitors targeting MraY as well as its paralogues, WecA and TarO. PMID:27088606

  18. Crystal structure of the full-length bacterial selenocysteine-specific elongation factor SelB

    PubMed Central

    Itoh, Yuzuru; Sekine, Shun-ichi; Yokoyama, Shigeyuki

    2015-01-01

    Selenocysteine (Sec), the 21st amino acid in translation, uses its specific tRNA (tRNASec) to recognize the UGA codon. The Sec-specific elongation factor SelB brings the selenocysteinyl-tRNASec (Sec-tRNASec) to the ribosome, dependent on both an in-frame UGA and a Sec-insertion sequence (SECIS) in the mRNA. The bacterial SelB binds mRNA through its C-terminal region, for which crystal structures have been reported. In this study, we determined the crystal structure of the full-length SelB from the bacterium Aquifex aeolicus, in complex with a GTP analog, at 3.2-Å resolution. SelB consists of three EF-Tu-like domains (D1–3), followed by four winged-helix domains (WHD1–4). The spacer region, connecting the N- and C-terminal halves, fixes the position of WHD1 relative to D3. The binding site for the Sec moiety of Sec-tRNASec is located on the interface between D1 and D2, where a cysteine molecule from the crystallization solution is coordinated by Arg residues, which may mimic Sec binding. The Sec-binding site is smaller and more exposed than the corresponding site of EF-Tu. Complex models of Sec-tRNASec, SECIS RNA, and the 70S ribosome suggest that the unique secondary structure of tRNASec allows SelB to specifically recognize tRNASec and characteristically place it at the ribosomal A-site. PMID:26304550

  19. Crystal structure of the full-length bacterial selenocysteine-specific elongation factor SelB.

    PubMed

    Itoh, Yuzuru; Sekine, Shun-Ichi; Yokoyama, Shigeyuki

    2015-10-15

    Selenocysteine (Sec), the 21(st) amino acid in translation, uses its specific tRNA (tRNA(Sec)) to recognize the UGA codon. The Sec-specific elongation factor SelB brings the selenocysteinyl-tRNA(Sec) (Sec-tRNA(Sec)) to the ribosome, dependent on both an in-frame UGA and a Sec-insertion sequence (SECIS) in the mRNA. The bacterial SelB binds mRNA through its C-terminal region, for which crystal structures have been reported. In this study, we determined the crystal structure of the full-length SelB from the bacterium Aquifex aeolicus, in complex with a GTP analog, at 3.2-Å resolution. SelB consists of three EF-Tu-like domains (D1-3), followed by four winged-helix domains (WHD1-4). The spacer region, connecting the N- and C-terminal halves, fixes the position of WHD1 relative to D3. The binding site for the Sec moiety of Sec-tRNA(Sec) is located on the interface between D1 and D2, where a cysteine molecule from the crystallization solution is coordinated by Arg residues, which may mimic Sec binding. The Sec-binding site is smaller and more exposed than the corresponding site of EF-Tu. Complex models of Sec-tRNA(Sec), SECIS RNA, and the 70S ribosome suggest that the unique secondary structure of tRNA(Sec) allows SelB to specifically recognize tRNA(Sec) and characteristically place it at the ribosomal A-site. PMID:26304550

  20. Diversity and geochemical structuring of bacterial communities along a salinity gradient in a carbonate aquifer subject to seawater intrusion.

    PubMed

    Héry, Marina; Volant, Aurélie; Garing, Charlotte; Luquot, Linda; Elbaz Poulichet, Françoise; Gouze, Philippe

    2014-12-01

    In aquifers subject to saline water intrusion, the mixing zone between freshwater and saltwater displays strong physico-chemical gradients. Although the microbial component of these specific environments has been largely disregarded, the contribution of micro-organisms to biogeochemical reactions impacting water geochemistry has previously been conjectured. The objective of this study was to characterize and compare bacterial community diversity and composition along a vertical saline gradient in a carbonate coastal aquifer using high throughput sequencing of 16S rRNA genes. At different depths of the mixing zone, stable geochemical and hydrological conditions were associated with autochthonous bacterial communities harboring clearly distinct structures. Diversity pattern did not follow the salinity gradient, although multivariate analysis indicated that salinity was one of the major drivers of bacterial community composition, with organic carbon, pH and CO2 partial pressure. Correlation analyses between the relative abundance of bacterial taxa and geochemical parameters suggested that rare taxa may contribute to biogeochemical processes taking place at the interface between freshwater and saltwater. Bacterial respiration or alternative metabolisms such as sulfide oxidation or organic acids production may be responsible for the acidification and the resulting induced calcite dissolution observed at a specific depth of the mixing zone. PMID:25348057

  1. Carbon, Metals, and Grain Size Correlate with Bacterial Community Structure in Sediments of a High Arsenic Aquifer

    PubMed Central

    Legg, Teresa M.; Zheng, Yan; Simone, Bailey; Radloff, Kathleen A.; Mladenov, Natalie; González, Antonio; Knights, Dan; Siu, Ho Chit; Rahman, M. Moshiur; Ahmed, K. Matin; McKnight, Diane M.; Nemergut, Diana R.

    2011-01-01

    Bacterial communities can exert significant influence on the biogeochemical cycling of arsenic (As). This has globally important implications since As in drinking water affects the health of over 100 million people worldwide, including in the Ganges–Brahmaputra Delta region of Bangladesh where geogenic arsenic in groundwater can reach concentrations of more than 10 times the World Health Organization’s limit. Thus, the goal of this research was to investigate patterns in bacterial community composition across gradients in sediment texture and chemistry in an aquifer with elevated groundwater As concentrations in Araihazar, Bangladesh. We characterized the bacterial community by pyrosequencing 16S rRNA genes from aquifer sediment samples collected at three locations along a groundwater flow path at a range of depths between 1.5 and 15 m. We identified significant differences in bacterial community composition between locations in the aquifer. In addition, we found that bacterial community structure was significantly related to sediment grain size, and sediment carbon (C), manganese (Mn), and iron (Fe) concentrations. Deltaproteobacteria and Chloroflexi were found in higher proportions in silty sediments with higher concentrations of C, Fe, and Mn. By contrast, Alphaproteobacteria and Betaproteobacteria were in higher proportions in sandy sediments with lower concentrations of C and metals. Based on the phylogenetic affiliations of these taxa, these results may indicate a shift to more Fe-, Mn-, and humic substance-reducers in the high C and metal sediments. It is well-documented that C, Mn, and Fe may influence the mobility of groundwater arsenic, and it is intriguing that these constituents may also structure the bacterial community. PMID:22470368

  2. Soil bacterial community structure remains stable over a 5-year chronosequence of insect-induced tree mortality

    PubMed Central

    Ferrenberg, Scott; Knelman, Joseph E.; Jones, Jennifer M.; Beals, Stower C.; Bowman, William D.; Nemergut, Diana R.

    2014-01-01

    Extensive tree mortality from insect epidemics has raised concern over possible effects on soil biogeochemical processes. Yet despite the importance of microbes in nutrient cycling, how soil bacterial communities respond to insect-induced tree mortality is largely unknown. We examined soil bacterial community structure (via 16S rRNA gene pyrosequencing) and community assembly processes (via null deviation analysis) along a 5-year chronosequence (substituting space for time) of bark beetle-induced tree mortality in the southern Rocky Mountains, USA. We also measured microbial biomass and soil chemistry, and used in situ experiments to assess inorganic nitrogen mineralization rates. We found that bacterial community structure and assembly—which was strongly influenced by stochastic processes—were largely unaffected by tree mortality despite increased soil ammonium (NH4+) pools and reductions in soil nitrate (NO3−) pools and net nitrogen mineralization rates after tree mortality. Linear models suggested that microbial biomass and bacterial phylogenetic diversity are significantly correlated with nitrogen mineralization rates of this forested ecosystem. However, given the overall resistance of the bacterial community to disturbance from tree mortality, soil nitrogen processes likely remained relatively stable following tree mortality when considered at larger spatial and longer temporal scales—a supposition supported by the majority of available studies regarding biogeochemical effects of bark beetle infestations in this region. Our results suggest that soil bacterial community resistance to disturbance helps to explain the relatively weak effects of insect-induced tree mortality on soil N and C pools reported across the Rocky Mountains, USA. PMID:25566204

  3. Soil bacterial community structure remains stable over a 5-year chronosequence of insect-induced tree mortality.

    PubMed

    Ferrenberg, Scott; Knelman, Joseph E; Jones, Jennifer M; Beals, Stower C; Bowman, William D; Nemergut, Diana R

    2014-01-01

    Extensive tree mortality from insect epidemics has raised concern over possible effects on soil biogeochemical processes. Yet despite the importance of microbes in nutrient cycling, how soil bacterial communities respond to insect-induced tree mortality is largely unknown. We examined soil bacterial community structure (via 16S rRNA gene pyrosequencing) and community assembly processes (via null deviation analysis) along a 5-year chronosequence (substituting space for time) of bark beetle-induced tree mortality in the southern Rocky Mountains, USA. We also measured microbial biomass and soil chemistry, and used in situ experiments to assess inorganic nitrogen mineralization rates. We found that bacterial community structure and assembly-which was strongly influenced by stochastic processes-were largely unaffected by tree mortality despite increased soil ammonium ([Formula: see text]) pools and reductions in soil nitrate ([Formula: see text]) pools and net nitrogen mineralization rates after tree mortality. Linear models suggested that microbial biomass and bacterial phylogenetic diversity are significantly correlated with nitrogen mineralization rates of this forested ecosystem. However, given the overall resistance of the bacterial community to disturbance from tree mortality, soil nitrogen processes likely remained relatively stable following tree mortality when considered at larger spatial and longer temporal scales-a supposition supported by the majority of available studies regarding biogeochemical effects of bark beetle infestations in this region. Our results suggest that soil bacterial community resistance to disturbance helps to explain the relatively weak effects of insect-induced tree mortality on soil N and C pools reported across the Rocky Mountains, USA. PMID:25566204

  4. Assessment of bacterial community structure in a long-term copper-polluted ex-vineyard soil.

    PubMed

    Dell'Amico, Elena; Mazzocchi, Manuela; Cavalca, Lucia; Allievi, Luigi; Andreoni, Vincenza

    2008-01-01

    The influence of long-term copper contamination on the diversity of bacterial communities was investigated in an ex-vineyard soil. Two sites of the same area but exhibiting different 3-fold exchangeable copper (Ex-Cu) concentrations were analysed. Culturable bacterial community structure was assessed using a variety of approaches: determination of culturable bacteria number, analyses of 132 isolates, and denaturing gradient gel lectrophoresis (DGGE) patterns of bacterial biomass grown on agar plates and of soil DNA. There was no significant difference in the number of total heterotrophs at the two sites, whereas the percentage of fast-growing bacteria growing in 1 day, was lower at the site with the higher Ex-Cu content. A high percentage of Cu-tolerant bacteria was found in both sites (63-70%) and it was relatively independent of the Cu content. Shifts in species composition of the culturable bacterial community were detected by analysing isolates from the two soils, Gram-positive bacteria prevailed in the less-polluted soil while Gram-negative bacteria in the more-polluted soil. Each sample site had a community with a different metal resistance pattern. Our study seems to indicate that in this soil ecosystem, copper influenced the culturable bacterial communities, affecting the structural diversity and altering some of the metal resistance of the microorganisms. The Sorensen similarity index calculated on DGGE profiles of 16S rDNA of total and culturable bacterial communities indicated a different species composition at the two sites, although both sites had the same biodiversity degree and different dominance. PMID:17207985

  5. Focus on JNJ-Q2, a novel fluoroquinolone, for the management of community-acquired bacterial pneumonia and acute bacterial skin and skin structure infections

    PubMed Central

    Jones, Travis M; Johnson, Steven W; DiMondi, V Paul; Wilson, Dustin T

    2016-01-01

    JNJ-Q2 is a novel, fifth-generation fluoroquinolone that has excellent in vitro and in vivo activity against a variety of Gram-positive and Gram-negative organisms. In vitro studies indicate that JNJ-Q2 has potent activity against pathogens responsible for acute bacterial skin and skin structure infections (ABSSSI) and community-acquired bacterial pneumonia (CABP), such as Staphylococcus aureus and Streptococcus pneumoniae. JNJ-Q2 also has been shown to have a higher barrier to resistance compared to other agents in the class and it remains highly active against drug-resistant organisms, including methicillin-resistant S. aureus, ciprofloxacin-resistant methicillin-resistant S. aureus, and drug-resistant S. pneumoniae. In two Phase II studies, the efficacy of JNJ-Q2 was comparable to linezolid for ABSSSI and moxifloxacin for CABP. Furthermore, JNJ-Q2 was well tolerated, with adverse event rates similar to or less than other fluoroquinolones. With an expanded spectrum of activity and low potential for resistance, JNJ-Q2 shows promise as an effective treatment option for ABSSSI and CABP. Considering its early stage of development, the definitive role of JNJ-Q2 against these infections and its safety profile will be determined in future Phase III studies. PMID:27354817

  6. Ceftaroline fosamil as first-line versus second-line treatment for acute bacterial skin and skin structure infections (ABSSSI) or community-acquired bacterial pneumonia (CABP).

    PubMed

    Guervil, David J; Kaye, Keith S; Hassoun, Ali; Cole, Phillip; Huang, Xing-Yue; Friedland, H David

    2016-06-01

    The Clinical Assessment Program and Teflaro(®) Utilization Registry (CAPTURE) is a multicenter registry study of acute bacterial skin and skin structure infection (ABSSSI) and community-acquired bacterial pneumonia (CABP) patients treated with ceftaroline fosamil in the US. Data for this analysis were collected between August 2011 and February 2013 at US study centres by randomly ordered chart review. Clinical success rates among ABSSSI patients were >81% when ceftaroline fosamil was used as first- or second-line therapy, including monotherapy and concurrent therapy. Among CABP patients, clinical success rates were >77% among first-line and second-line patients and patients who received first-line concurrent therapy or second line monotherapy or concurrent therapy. For CABP patients treated with ceftaroline fosamil as first-line monotherapy, the clinical success rate was 70%. Ceftaroline fosamil is an effective treatment option for patients with ABSSSI or CABP with similar clinical success rates when used as first-line or second-line treatment. PMID:25817579

  7. Focus on JNJ-Q2, a novel fluoroquinolone, for the management of community-acquired bacterial pneumonia and acute bacterial skin and skin structure infections.

    PubMed

    Jones, Travis M; Johnson, Steven W; DiMondi, V Paul; Wilson, Dustin T

    2016-01-01

    JNJ-Q2 is a novel, fifth-generation fluoroquinolone that has excellent in vitro and in vivo activity against a variety of Gram-positive and Gram-negative organisms. In vitro studies indicate that JNJ-Q2 has potent activity against pathogens responsible for acute bacterial skin and skin structure infections (ABSSSI) and community-acquired bacterial pneumonia (CABP), such as Staphylococcus aureus and Streptococcus pneumoniae. JNJ-Q2 also has been shown to have a higher barrier to resistance compared to other agents in the class and it remains highly active against drug-resistant organisms, including methicillin-resistant S. aureus, ciprofloxacin-resistant methicillin-resistant S. aureus, and drug-resistant S. pneumoniae. In two Phase II studies, the efficacy of JNJ-Q2 was comparable to linezolid for ABSSSI and moxifloxacin for CABP. Furthermore, JNJ-Q2 was well tolerated, with adverse event rates similar to or less than other fluoroquinolones. With an expanded spectrum of activity and low potential for resistance, JNJ-Q2 shows promise as an effective treatment option for ABSSSI and CABP. Considering its early stage of development, the definitive role of JNJ-Q2 against these infections and its safety profile will be determined in future Phase III studies. PMID:27354817

  8. Plant pathogenic RNAs and RNA catalysis.

    PubMed Central

    Symons, R H

    1997-01-01

    The rolling circle replication of small circular plant pathogenic RNAs requires a processing step to convert multimeric intermediates to monomers which are then circularized. Eleven such RNAs are known so far, two are viroids, one is viroid-like and the remainder are satellite RNAs dependent on a helper virus for replication. The processing step is RNA-catalysed in all cases, at least in vitro. All plus forms of these RNAs self-cleave via the hammerhead structure whereas only eight of the minus RNAs self-cleave, five via the hammerhead structure and three via the hairpin structure. There are about 20 other viroids where the processing mechanism has yet to be determined but they are likely candidates for a new type of self-cleavage reaction which is predicted to be conserved in all these viroids. Hepatitis delta RNA is the only circular pathogenic RNA known to self-cleave in the animal kingdom. It is feasible that more single-stranded circular pathogenic RNAs are waiting to be discovered and these could be prospective for new types of self-cleavage reactions. PMID:9207012

  9. MicroRNAs Constitute a Negative Feedback Loop in Streptococcus pneumoniae-Induced Macrophage Activation.

    PubMed

    Griss, Kathrin; Bertrams, Wilhelm; Sittka-Stark, Alexandra; Seidel, Kerstin; Stielow, Christina; Hippenstiel, Stefan; Suttorp, Norbert; Eberhardt, Martin; Wilhelm, Jochen; Vera, Julio; Schmeck, Bernd

    2016-07-15

    Streptococcus pneumoniae causes high mortality as a major pneumonia-inducing pathogen. In pneumonia, control of innate immunity is necessary to prevent organ damage. We assessed the role of microRNAs (miRNAs) as regulators in pneumococcal infection of human macrophages. Exposure of primary blood-derived human macrophages with pneumococci resulted in transcriptional changes in several gene clusters and a significant deregulation of 10 microRNAs. Computational network analysis retrieved miRNA-146a as one putatively important regulator of pneumococci-induced host cell activation. Its induction depended on bacterial structural integrity and was completely inhibited by blocking Toll-like receptor 2 (TLR-2) or depleting its mediator MyD88. Furthermore, induction of miRNA-146a release did not require the autocrine feedback of interleukin 1β and tumor necrosis factor α released from infected macrophages, and it repressed the TLR-2 downstream mediators IRAK-1 and TRAF-6, as well as the inflammatory factors cyclooxygenase 2 and interleukin 1β. In summary, pneumococci recognition induces a negative feedback loop, preventing excessive inflammation via miR-146a and potentially other miRNAs. PMID:26984146

  10. Influence of hydraulic regimes on bacterial community structure and composition in an experimental drinking water distribution system.

    PubMed

    Douterelo, I; Sharpe, R L; Boxall, J B

    2013-02-01

    Microbial biofilms formed on the inner-pipe surfaces of drinking water distribution systems (DWDS) can alter drinking water quality, particularly if they are mechanically detached from the pipe wall to the bulk water, such as due to changes in hydraulic conditions. Results are presented here from applying 454 pyrosequencing of the 16S ribosomal RNA (rRNA) gene to investigate the influence of different hydrological regimes on bacterial community structure and to study the potential mobilisation of material from the pipe walls to the network using a full scale, temperature-controlled experimental pipeline facility accurately representative of live DWDS. Analysis of pyrosequencing and water physico-chemical data showed that habitat type (water vs. biofilm) and hydraulic conditions influenced bacterial community structure and composition in our experimental DWDS. Bacterial community composition clearly differed between biofilms and bulk water samples. Gammaproteobacteria and Betaproteobacteria were the most abundant phyla in biofilms while Alphaproteobacteria was predominant in bulk water samples. This suggests that bacteria inhabiting biofilms, predominantly species belonging to genera Pseudomonas, Zooglea and Janthinobacterium, have an enhanced ability to express extracellular polymeric substances to adhere to surfaces and to favour co-aggregation between cells than those found in the bulk water. Highest species richness and diversity were detected in 28 days old biofilms with this being accentuated at highly varied flow conditions. Flushing altered the pipe-wall bacterial community structure but did not completely remove bacteria from the pipe walls, particularly under highly varied flow conditions, suggesting that under these conditions more compact biofilms were generated. This research brings new knowledge regarding the influence of different hydraulic regimes on the composition and structure of bacterial communities within DWDS and the implication that this

  11. The presence, role and clinical use of spermatozoal RNAs

    PubMed Central

    Jodar, Meritxell; Selvaraju, Sellappan; Sendler, Edward; Diamond, Michael P.; Krawetz, Stephen A.

    2013-01-01

    BACKGROUND Spermatozoa are highly differentiated, transcriptionally inert cells characterized by a compact nucleus with minimal cytoplasm. Nevertheless they contain a suite of unique RNAs that are delivered to oocyte upon fertilization. They are likely integrated as part of many different processes including genome recognition, consolidation-confrontation, early embryonic development and epigenetic transgenerational inherence. Spermatozoal RNAs also provide a window into the developmental history of each sperm thereby providing biomarkers of fertility and pregnancy outcome which are being intensely studied. METHODS Literature searches were performed to review the majority of spermatozoal RNA studies that described potential functions and clinical applications with emphasis on Next-Generation Sequencing. Human, mouse, bovine and stallion were compared as their distribution and composition of spermatozoal RNAs, using these techniques, have been described. RESULTS Comparisons highlighted the complexity of the population of spermatozoal RNAs that comprises rRNA, mRNA and both large and small non-coding RNAs. RNA-seq analysis has revealed that only a fraction of the larger RNAs retain their structure. While rRNAs are the most abundant and are highly fragmented, ensuring a translationally quiescent state, other RNAs including some mRNAs retain their functional potential, thereby increasing the opportunity for regulatory interactions. Abundant small non-coding RNAs retained in spermatozoa include miRNAs and piRNAs. Some, like miR-34c are essential to the early embryo development required for the first cellular division. Others like the piRNAs are likely part of the genomic dance of confrontation and consolidation. Other non-coding spermatozoal RNAs include transposable elements, annotated lnc-RNAs, intronic retained elements, exonic elements, chromatin-associated RNAs, small-nuclear ILF3/NF30 associated RNAs, quiescent RNAs, mse-tRNAs and YRNAs. Some non-coding RNAs are

  12. The presence, role and clinical use of spermatozoal RNAs.

    PubMed

    Jodar, Meritxell; Selvaraju, Sellappan; Sendler, Edward; Diamond, Michael P; Krawetz, Stephen A

    2013-01-01

    BACKGROUND Spermatozoa are highly differentiated, transcriptionally inert cells characterized by a compact nucleus with minimal cytoplasm. Nevertheless they contain a suite of unique RNAs that are delivered to oocyte upon fertilization. They are likely integrated as part of many different processes including genome recognition, consolidation-confrontation, early embryonic development and epigenetic transgenerational inherence. Spermatozoal RNAs also provide a window into the developmental history of each sperm thereby providing biomarkers of fertility and pregnancy outcome which are being intensely studied. METHODS Literature searches were performed to review the majority of spermatozoal RNA studies that described potential functions and clinical applications with emphasis on Next-Generation Sequencing. Human, mouse, bovine and stallion were compared as their distribution and composition of spermatozoal RNAs, using these techniques, have been described. RESULTS Comparisons highlighted the complexity of the population of spermatozoal RNAs that comprises rRNA, mRNA and both large and small non-coding RNAs. RNA-seq analysis has revealed that only a fraction of the larger RNAs retain their structure. While rRNAs are the most abundant and are highly fragmented, ensuring a translationally quiescent state, other RNAs including some mRNAs retain their functional potential, thereby increasing the opportunity for regulatory interactions. Abundant small non-coding RNAs retained in spermatozoa include miRNAs and piRNAs. Some, like miR-34c are essential to the early embryo development required for the first cellular division. Others like the piRNAs are likely part of the genomic dance of confrontation and consolidation. Other non-coding spermatozoal RNAs include transposable elements, annotated lnc-RNAs, intronic retained elements, exonic elements, chromatin-associated RNAs, small-nuclear ILF3/NF30 associated RNAs, quiescent RNAs, mse-tRNAs and YRNAs. Some non-coding RNAs are

  13. Noncoding RNAs and Cancer

    PubMed Central

    Naeini, Mozhgan Moslemi; Ardekani, Ali M.

    2009-01-01

    The eukaryotic complexity involves the expression and regulation of genes via RNA-DNA, RNA-RNA, DNA-protein and RNA-protein interactions. Recently, the role of RNA molecules in the regulation of genes in higher organisms has become more evident, especially with the discovery that about 97% of the transcriptional output in higher organisms are represented as noncoding RNAs: rRNA, snoRNAs, tRNA, transposable elements, 5’ and 3’ untranslated regions, introns, intergenic regions and microRNAs. MicroRNAs function by negatively regulating gene expression via degradation or translational inhibition of their target mRNAs and thus participate in a wide variety of physiological and pathological cellular processes including: development, cell proliferation, differentiation, and apoptosis pathways. MicroRNA expression profiles in many types of cancers have been identified. Recent reports have revealed that the expression profiles of microRNAs change in various human cancers and appear to function as oncogenes or tumor suppressors. Abnormal microRNA expression has increasingly become a common feature of human cancers. In this review, we summarize the latest progress on the involvement of microRNAs in different types of cancer and their potential use as potential diagnostic and prognostic tumor biomarkers in the future. PMID:23407615

  14. Automated Structure- and Sequence-Based Design of Proteins for High Bacterial Expression and Stability.

    PubMed

    Goldenzweig, Adi; Goldsmith, Moshe; Hill, Shannon E; Gertman, Or; Laurino, Paola; Ashani, Yacov; Dym, Orly; Unger, Tamar; Albeck, Shira; Prilusky, Jaime; Lieberman, Raquel L; Aharoni, Amir; Silman, Israel; Sussman, Joel L; Tawfik, Dan S; Fleishman, Sarel J

    2016-07-21

    Upon heterologous overexpression, many proteins misfold or aggregate, thus resulting in low functional yields. Human acetylcholinesterase (hAChE), an enzyme mediating synaptic transmission, is a typical case of a human protein that necessitates mammalian systems to obtain functional expression. We developed a computational strategy and designed an AChE variant bearing 51 mutations that improved core packing, surface polarity, and backbone rigidity. This variant expressed at ∼2,000-fold higher levels in E. coli compared to wild-type hAChE and exhibited 20°C higher thermostability with no change in enzymatic properties or in the active-site configuration as determined by crystallography. To demonstrate broad utility, we similarly designed four other human and bacterial proteins. Testing at most three designs per protein, we obtained enhanced stability and/or higher yields of soluble and active protein in E. coli. Our algorithm requires only a 3D structure and several dozen sequences of naturally occurring homologs, and is available at http://pross.weizmann.ac.il. PMID:27425410

  15. Oritavancin: a review in acute bacterial skin and skin structure infections.

    PubMed

    Syed, Yahiya Y; Scott, Lesley J

    2015-11-01

    Oritavancin (Orbactiv(®)) is a new generation lipoglycopeptide approved for use in adult patients with acute bacterial skin and skin structure infections (ABSSSI). It is administered as a single 1200 mg intravenous infusion over 3 h. In phase 3 trials in adult patients with ABSSSI, oritavancin was noninferior to vancomycin in terms of a composite outcome (cessation of spreading or reduction in the size of the baseline lesion, absence of fever and no rescue antibacterials required; primary endpoint) assessed at an US FDA-recommended early timepoint of 48-72 h after initiation of treatment. Oritavancin was also noninferior to vancomycin in terms of a ≥20 % reduction in the baseline lesion size at the early timepoint and clinical cure rate 7-14 days after the end of treatment. Oritavancin was generally well tolerated in the phase 3 trials, with most treatment-emergent adverse reactions being mild in severity. The most common adverse events occurring in oritavancin recipients were nausea, headache, vomiting, limb and subcutaneous abscesses, and diarrhoea. Oritavancin offers a number of potential advantages, including a convenient single dose treatment that may shorten or eliminate hospital stays, a reduction in healthcare resource utilization and cost, no need for dosage adjustment in patients with mild to moderate hepatic or renal impairment, no need for therapeutic drug monitoring, and elimination of compliance concerns. Therefore, oritavancin is a useful treatment option for adults with ABSSSI. PMID:26464319

  16. Bacterial pathogen gene regulation: a DNA-structure-centred view of a protein-dominated domain.

    PubMed

    Dorman, Charles J; Colgan, Aoife; Dorman, Matthew J

    2016-07-01

    The mechanisms used by bacterial pathogens to regulate the expression of their genes, especially their virulence genes, have been the subject of intense investigation for several decades. Whole genome sequencing projects, together with more targeted studies, have identified hundreds of DNA-binding proteins that contribute to the patterns of gene expression observed during infection as well as providing important insights into the nature of the gene products whose expression is being controlled by these proteins. Themes that have emerged include the importance of horizontal gene transfer to the evolution of pathogens, the need to impose regulatory discipline upon these imported genes and the important roles played by factors normally associated with the organization of genome architecture as regulatory principles in the control of virulence gene expression. Among these architectural elements is the structure of DNA itself, its variable nature at a topological rather than just at a base-sequence level and its ability to play an active (as well as a passive) part in the gene regulation process. PMID:27252403

  17. Nucleotide and partner-protein control of bacterial replicative helicase structure and function

    PubMed Central

    Strycharska, Melania S.; Arias-Palomo, Ernesto; Lyubimov, Artem Y.; Erzberger, Jan P.; O’Shea, Valerie; Bustamante, Carlos J.; Berger, James M.

    2014-01-01

    Cellular replication forks are powered by ring-shaped, hexameric helicases that encircle and unwind DNA. To better understand the molecular mechanisms and control of these enzymes, we used multiple methods to investigate the bacterial replicative helicase, DnaB. A 3.3 Å crystal structure of Aquifex aeolicus DnaB complexed with nucleotide reveals a new conformational state for this motor protein. Electron microscopy and small angle X-ray scattering studies confirm the state seen crystallographically, showing that the DnaB ATPase domains and an associated N-terminal collar transition between two physical states in a nucleotide-dependent manner. Mutant helicases locked in either collar state are active, but display different capacities to support critical activities such as duplex translocation and primase-dependent RNA synthesis. Our findings establish the DnaB collar as an auto-regulatory hub that controls the ability of the helicase to transition between different functional states in response to nucleotide and both replication initiation and elongation factors. PMID:24373746

  18. Nucleotide and partner-protein control of bacterial replicative helicase structure and function.

    PubMed

    Strycharska, Melania S; Arias-Palomo, Ernesto; Lyubimov, Artem Y; Erzberger, Jan P; O'Shea, Valerie L; Bustamante, Carlos J; Berger, James M

    2013-12-26

    Cellular replication forks are powered by ring-shaped, hexameric helicases that encircle and unwind DNA. To better understand the molecular mechanisms and control of these enzymes, we used multiple methods to investigate the bacterial replicative helicase, DnaB. A 3.3 Å crystal structure of Aquifex aeolicus DnaB, complexed with nucleotide, reveals a newly discovered conformational state for this motor protein. Electron microscopy and small angle X-ray scattering studies confirm the state seen crystallographically, showing that the DnaB ATPase domains and an associated N-terminal collar transition between two physical states in a nucleotide-dependent manner. Mutant helicases locked in either collar state are active but display different capacities to support critical activities such as duplex translocation and primase-dependent RNA synthesis. Our findings establish the DnaB collar as an autoregulatory hub that controls the ability of the helicase to transition between different functional states in response to both nucleotide and replication initiation/elongation factors. PMID:24373746

  19. Manure Refinement Affects Apple Rhizosphere Bacterial Community Structure: A Study in Sandy Soil

    PubMed Central

    Zhang, Qiang; Sun, Jian; Liu, Songzhong; Wei, Qinping

    2013-01-01

    We used DNA-based pyrosequencing to characterize the bacterial community structure of the sandy soil of an apple orchard with different manure ratios. Five manure percentages (5%, 10%, 15%, 20% and 25%) were examined. More than 10,000 valid reads were obtained for each replicate. The communities were composed of five dominant groups (Proteobacteria, Actinobacteria, Chloroflexi, Acidobacteria and Bacteroidetes), of which Proteobacteria content gradually decreased from 41.38% to 37.29% as manure ratio increased from 0% to 25%, respectively. Redundancy analysis showed that 37 classes were highly correlated with manure ratio, 18 of which were positively correlated. Clustering revealed that the rhizosphere samples were grouped into three components: low manure (control, 5%) treatment, medium manure (10%, 15%) treatment and high manure (20%, 25%) treatment. Venn analysis of species types of these three groups revealed that the bacteria community difference was primarily reflected by quantity ratio rather than species variety. Although greater manure content led to higher soil organic matter content, the medium manure improved soil showed the highest urease activity and saccharase activity, while 5% to 20% manure ratio improvement also resulted in higher bacteria diversity than control and 25% manure ratio treatment. Our experimental results suggest that the use of a proper manure ratio results in significantly higher soil enzyme activity and different bacteria community patterns, whereas the use of excessive manure amounts has negative effect on soil quality. PMID:24155909

  20. Morpho-structural variations of bacterial spores after treatment in steam vacuum assisted autoclave.

    PubMed

    Fonzi, M; Montomoli, E; Gasparini, R; Devanna, D; Fonzi, L

    1999-01-01

    This study intended to verify, through microbiological techniques and TEM investigations, the killing of bacterial spores after treatment in steam autoclave, and to propose strictly morphological considerations about the target of this sterilisation process. Autoclave is the most common device for sterilising instruments in order to prevent cross infections in dental offices. The autoclave efficiency has been improved in the last years and part of this improvement is related to both a better and more correct use of the autoclave system and to the technological innovations introduced in the last generation of devices. However, associations as ADA or CDC suggest to regularly verify the process of 'autoclaving' through biological indicators (BI). The most commonly used BI are made of spores strips or suspensions of Bacillus Subtilis (pb 168) and Bacillus Stearothermophilus (ATCC 10149). They visually prove, changing colours on enzymatic base, the death of micro-organism and if the physical parameters, necessary for sterilisation, have been achieved. These two strains of endospore-forming bacteria were processed and prepared following two different techniques: Karnovsky fixed and epon embedded--phosphotungstic acid fixed for direct observation. The kind and the extent of analysed modifications are extremely various: from deep lacerations, which changed the spore structure, to little clefts which let the cytoplasm go out. PMID:11799742

  1. Dalbavancin for the treatment of acute bacterial skin and skin structure infections

    PubMed Central

    Ramdeen, Sheena; Boucher, Helen W

    2015-01-01

    Introduction Acute bacterial skin and skin structure infections (ABSSSI) have increased in incidence and severity. The involvement of resistant organisms, particularly methicillin-resistant Staphylococcus aureus, presents additional challenges. The lipoglycopeptide dalbavancin has a prolonged half-life, high protein binding, and excellent tissue levels which led to its development as a once-weekly treatment for ABSSSI. In the pivotal DISCOVER 1 and DISCOVER 2 trials, dalbavancin proved non-inferior to vancomycin followed by linezolid when used sequentially for ABSSSI, forming the basis for its recent approval in the US and Europe for ABSSSI. Areas covered A literature search of published pharmacologic and clinical data was conducted to review the chemistry, pharmacodynamics, and pharmacokinetics of dalbavancin. We also discuss its development process, highlighting efficacy and safety data from pertinent clinical trials and the role it could play in the current clinical landscape. Expert opinion DISCOVER 1 and DISCOVER 2 demonstrated dalbavancin’s non-inferiority to vancomycin followed by linezolid for ABSSSI and confirmed its safety and tolerability. They were among the first trials to use new, early primary efficacy endpoints, and dalbavancin was among the first agents designated a Qualified Infectious Disease Product for expedited review. Dalbavancin may prove to be a valuable option for ABSSSI patients in whom conventional therapy is limited. PMID:26239321

  2. The Host RNAs in Retroviral Particles

    PubMed Central

    Telesnitsky, Alice; Wolin, Sandra L.

    2016-01-01

    As they assemble, retroviruses encapsidate both their genomic RNAs and several types of host RNA. Whereas limited amounts of messenger RNA (mRNA) are detectable within virion populations, the predominant classes of encapsidated host RNAs do not encode proteins, but instead include endogenous retroelements and several classes of non-coding RNA (ncRNA), some of which are packaged in significant molar excess to the viral genome. Surprisingly, although the most abundant host RNAs in retroviruses are also abundant in cells, unusual forms of these RNAs are packaged preferentially, suggesting that these RNAs are recruited early in their biogenesis: before associating with their cognate protein partners, and/or from transient or rare RNA populations. These RNAs’ packaging determinants differ from the viral genome’s, and several of the abundantly packaged host ncRNAs serve cells as the scaffolds of ribonucleoprotein particles. Because virion assembly is equally efficient whether or not genomic RNA is available, yet RNA appears critical to the structural integrity of retroviral particles, it seems possible that the selectively encapsidated host ncRNAs might play roles in assembly. Indeed, some host ncRNAs appear to act during replication, as some transfer RNA (tRNA) species may contribute to nuclear import of human immunodeficiency virus 1 (HIV-1) reverse transcription complexes, and other tRNA interactions with the viral Gag protein aid correct trafficking to plasma membrane assembly sites. However, despite high conservation of packaging for certain host RNAs, replication roles for most of these selectively encapsidated RNAs—if any—have remained elusive. PMID:27548206

  3. Identification of differentially expressed small non-coding RNAs in the legume endosymbiont Sinorhizobium meliloti by comparative genomics.

    PubMed

    del Val, Coral; Rivas, Elena; Torres-Quesada, Omar; Toro, Nicolás; Jiménez-Zurdo, José I

    2007-12-01

    Bacterial small non-coding RNAs (sRNAs) are being recognized as novel widespread regulators of gene expression in response to environmental signals. Here, we present the first search for sRNA-encoding genes in the nitrogen-fixing endosymbiont Sinorhizobium meliloti, performed by a genome-wide computational analysis of its intergenic regions. Comparative sequence data from eight related alpha-proteobacteria were obtained, and the interspecies pairwise alignments were scored with the programs eQRNA and RNAz as complementary predictive tools to identify conserved and stable secondary structures corresponding to putative non-coding RNAs. Northern experiments confirmed that eight of the predicted loci, selected among the original 32 candidates as most probable sRNA genes, expressed small transcripts. This result supports the combined use of eQRNA and RNAz as a robust strategy to identify novel sRNAs in bacteria. Furthermore, seven of the transcripts accumulated differentially in free-living and symbiotic conditions. Experimental mapping of the 5'-ends of the detected transcripts revealed that their encoding genes are organized in autonomous transcription units with recognizable promoter and, in most cases, termination signatures. These findings suggest novel regulatory functions for sRNAs related to the interactions of alpha-proteobacteria with their eukaryotic hosts. PMID:17971083

  4. Identification of differentially expressed small non-coding RNAs in the legume endosymbiont Sinorhizobium meliloti by comparative genomics

    PubMed Central

    del Val, Coral; Rivas, Elena; Torres-Quesada, Omar; Toro, Nicolás; Jiménez-Zurdo, José I

    2007-01-01

    Bacterial small non-coding RNAs (sRNAs) are being recognized as novel widespread regulators of gene expression in response to environmental signals. Here, we present the first search for sRNA-encoding genes in the nitrogen-fixing endosymbiont Sinorhizobium meliloti, performed by a genome-wide computational analysis of its intergenic regions. Comparative sequence data from eight related α-proteobacteria were obtained, and the interspecies pairwise alignments were scored with the programs eQRNA and RNAz as complementary predictive tools to identify conserved and stable secondary structures corresponding to putative non-coding RNAs. Northern experiments confirmed that eight of the predicted loci, selected among the original 32 candidates as most probable sRNA genes, expressed small transcripts. This result supports the combined use of eQRNA and RNAz as a robust strategy to identify novel sRNAs in bacteria. Furthermore, seven of the transcripts accumulated differentially in free-living and symbiotic conditions. Experimental mapping of the 5′-ends of the detected transcripts revealed that their encoding genes are organized in autonomous transcription units with recognizable promoter and, in most cases, termination signatures. These findings suggest novel regulatory functions for sRNAs related to the interactions of α-proteobacteria with their eukaryotic hosts. PMID:17971083

  5. Noncoding RNAs in breast cancer.

    PubMed

    Lo, Pang-Kuo; Wolfson, Benjamin; Zhou, Xipeng; Duru, Nadire; Gernapudi, Ramkishore; Zhou, Qun

    2016-05-01

    The mammalian transcriptome has recently been revealed to encompass a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. MicroRNAs (miRNAs), the best studied of the short noncoding RNAs (sncRNAs), have been extensively characterized with regard to their biogenesis, function and importance in tumorigenesis. Another class of sncRNAs called piwi-interacting RNAs (piRNAs) has also gained attention recently in cancer research owing to their critical role in stem cell regulation. Long noncoding RNAs (lncRNAs) of >200 nucleotides in length have recently emerged as key regulators of developmental processes, including mammary gland development. lncRNA dysregulation has also been implicated in the development of various cancers, including breast cancer. In this review, we describe and discuss the roles of sncRNAs (including miRNAs and piRNAs) and lncRNAs in the initiation and progression of breast tumorigenesis, with a focus on outlining the molecular mechanisms of oncogenic and tumor-suppressor ncRNAs. Moreover, the current and potential future applications of ncRNAs to clinical breast cancer research are also discussed, with an emphasis on ncRNA-based diagnosis, prognosis and future therapeutics. PMID:26685283

  6. Novel microRNAs and microsatellite-like small RNAs in sexual and apomictic Boechera species.

    PubMed

    Amiteye, Samuel; Corral, Jose M; Vogel, Heiko; Kuhlmann, Markus; Mette, Michael F; Sharbel, Timothy F

    2013-01-01

    Apomixis refers to plant asexual reproduction through seeds that give rise to progeny which are genotypically identical to the maternal parent. It has evolved from many different sexual taxa although the underlying genetic factors remain unknown. Previous analyses of the over-representation of transcription factors, in a comparison of microdissected ovules from apomictic and sexual Boechera, showed that many transcription factor mRNAs possessed microRNA (miRNAs) binding sites, thus pointing to miRNAs as potentially important factors that may be involved in the regulatory switch from sexual to apomictic reproduction. A microarray-based approach was used to identify (1) 673 microsatellitelike small RNAs (misRNAs) containing predominantly 2-7 repeats of (GAA)n/(CUU)n, (GCA)n/(CGU)n, (GGA)n/(CCU)n, (GGU)n/(CCA)n and (UGA)n/(ACU)n, and (2) 166 mo