These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

The Arabidopsis Basic\\/Helix-Loop-Helix Transcription Factor Family  

Microsoft Academic Search

The basic\\/helix-loop-helix (bHLH) proteins are a superfamily of transcription factors that bind as dimers to specific DNA tar- get sites and that have been well characterized in nonplant eukaryotes as important regulatory components in diverse bio- logical processes. Based on evidence that the bHLH protein PIF3 is a direct phytochrome reaction partner in the photore- ceptor's signaling network, we have

Gabriela Toledo-Ortiz; Enamul Huq; Peter H. Quail

2003-01-01

2

Phylogenetic Analysis of Plant Basic Helix-Loop-Helix Proteins  

Microsoft Academic Search

The basic helix-loop-helix (bHLH) family of proteins is a group of functionally diverse transcription factors found in both plants and animals. These proteins evolved early in eukaryotic cells before the split of animals and plants, but appear to function in ‘plant-specific’ or ‘animal-specific’ processes. In animals bHLH proteins are involved in regulation of a wide variety of essential developmental processes.

Michael J. Buck; William R. Atchley

2003-01-01

3

Phylogenetic analysis of the human basic helix-loop-helix proteins  

Microsoft Academic Search

BACKGROUND: The basic helix-loop-helix (bHLH) proteins are a large and complex multigene family of transcription factors with important roles in animal development, including that of fruitflies, nematodes and vertebrates. The identification of orthologous relationships among the bHLH genes from these widely divergent taxa allows reconstruction of the putative complement of bHLH genes present in the genome of their last common

Valérie Ledent; Odier Paquet; Michel Vervoort

2002-01-01

4

Gene Replacement Strategies to Test the Functional Redundancy of Basic Helix–Loop–Helix Transcription Factor  

Microsoft Academic Search

Basic helix–loop–helix (bHLH) transcription factors control developmental decisions for a wide range of embryonic cell types.\\u000a Hand1 and Hand2 are closely related bHLH proteins that control cardiac, craniofacial, and limb development. Within the developing\\u000a heart, Hand1 expression becomes restricted predominantly to the left ventricle, whereas Hand2 becomes restricted predominantly to the left ventricle, for which findings have shown each Hand

Anthony B. FirulliBeth; Beth A. Firulli; Jian Wang; Rhonda H. Rogers; Simon J. Conway

2010-01-01

5

Helix–loop–helix/basic helix–loop–helix transcription factor network represses cell elongation in Arabidopsis through an apparent incoherent feed-forward loop  

PubMed Central

Cell elongation is promoted by different environmental and hormonal signals, involving light, temperature, brassinosteroid (BR), and gibberellin, that inhibit the atypical basic helix–loop–helix (bHLH) transcription factor INCREASED LEAF INCLINATION1 BINDING bHLH1 (IBH1). Ectopic accumulation of IBH1 causes a severe dwarf phenotype, but the cell elongation suppression mechanism is still not well understood. Here, we identified a close homolog of IBH1, IBH1-LIKE1 (IBL1), that also antagonized BR responses and cell elongation. Genome-wide expression analyses showed that IBH1 and IBL1 act interdependently downstream of the BRASSINAZOLE-RESISTANT1 (BZR1)–PHYTOCHROME-INTERACTING FACTOR 4 (PIF4)–DELLA module. Although characterized as non-DNA binding, IBH1 repressed direct IBL1 transcription, and they both acted in tandem to suppress the expression of a common downstream helix–loop–helix (HLH)/bHLH network, thus forming an incoherent feed-forward loop. IBH1 and IBL1 together repressed the expression of PIF4, known to stimulate skotomorphogenesis synergistically with BZR1. Strikingly, PIF4 bound all direct and down-regulated HLH/bHLH targets of IBH1 and IBL1. Additional genome-wide comparisons suggested a model in which IBH1 antagonized PIF4 but not the PIF4–BZR1 dimer. PMID:24505057

Zhiponova, Miroslava K.; Morohashi, Kengo; Vanhoutte, Isabelle; Machemer-Noonan, Katja; Revalska, Miglena; Van Montagu, Marc; Grotewold, Erich; Russinova, Eugenia

2014-01-01

6

A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis.  

PubMed

Environmental and endogenous signals, including light, temperature, brassinosteroid (BR), and gibberellin (GA), regulate cell elongation largely by influencing the expression of the paclobutrazol-resistant (PRE) family helix-loop-helix (HLH) factors, which promote cell elongation by interacting antagonistically with another HLH factor, IBH1. However, the molecular mechanism by which PREs and IBH1 regulate gene expression has remained unknown. Here, we show that IBH1 interacts with and inhibits a DNA binding basic helix-loop-helix (bHLH) protein, HBI1, in Arabidopsis thaliana. Overexpression of HBI1 increased hypocotyl and petiole elongation, whereas dominant inactivation of HBI1 and its homologs caused a dwarf phenotype, indicating that HBI1 is a positive regulator of cell elongation. In vitro and in vivo experiments showed that HBI1 directly bound to the promoters and activated two EXPANSIN genes encoding cell wall-loosening enzymes; HBI1's DNA binding and transcriptional activities were inhibited by IBH1, but the inhibitory effects of IBH1 were abolished by PRE1. The results indicate that PREs activate the DNA binding bHLH factor HBI1 by sequestering its inhibitor IBH1. Altering each of the three factors affected plant sensitivities to BR, GA, temperature, and light. Our study demonstrates that PREs, IBH1, and HBI1 form a chain of antagonistic switches that regulates cell elongation downstream of multiple external and endogenous signals. PMID:23221598

Bai, Ming-Yi; Fan, Min; Oh, Eunkyoo; Wang, Zhi-Yong

2012-12-01

7

A Classification of Basic Helix-Loop-Helix Transcription Factors of Soybean  

PubMed Central

The complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits. In particular, the potential functions of regulatory genes are a priority for analysis. The basic helix-loop-helix (bHLH) family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality, including photosynthesis, light signalling, pigment biosynthesis, and seed pod development. Using a hidden Markov model search algorithm, 319 genes with basic helix-loop-helix transcription factor domains were identified within the soybean genome sequence. These were classified with respect to their predicted DNA binding potential, intron/exon structure, and the phylogeny of the bHLH domain. Evidence is presented that the vast majority (281) of these 319 soybean bHLH genes are expressed at the mRNA level. Of these soybean bHLH genes, 67% were found to exist in two or more homeologous copies. This dataset provides a framework for future studies on bHLH gene function in soybean. The challenge for future research remains to define functions for the bHLH factors encoded in the soybean genome, which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop.

Hudson, Karen A.; Hudson, Matthew E.

2015-01-01

8

A classification of basic helix-loop-helix transcription factors of soybean.  

PubMed

The complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits. In particular, the potential functions of regulatory genes are a priority for analysis. The basic helix-loop-helix (bHLH) family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality, including photosynthesis, light signalling, pigment biosynthesis, and seed pod development. Using a hidden Markov model search algorithm, 319 genes with basic helix-loop-helix transcription factor domains were identified within the soybean genome sequence. These were classified with respect to their predicted DNA binding potential, intron/exon structure, and the phylogeny of the bHLH domain. Evidence is presented that the vast majority (281) of these 319 soybean bHLH genes are expressed at the mRNA level. Of these soybean bHLH genes, 67% were found to exist in two or more homeologous copies. This dataset provides a framework for future studies on bHLH gene function in soybean. The challenge for future research remains to define functions for the bHLH factors encoded in the soybean genome, which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop. PMID:25763382

Hudson, Karen A; Hudson, Matthew E

2015-01-01

9

A genome-wide survey on basic helix-loop-helix transcription factors in giant panda.  

PubMed

The giant panda (Ailuropoda melanoleuca) is a critically endangered mammalian species. Studies on functions of regulatory proteins involved in developmental processes would facilitate understanding of specific behavior in giant panda. The basic helix-loop-helix (bHLH) proteins play essential roles in a wide range of developmental processes in higher organisms. bHLH family members have been identified in over 20 organisms, including fruit fly, zebrafish, mouse and human. Our present study identified 107 bHLH family members being encoded in giant panda genome. Phylogenetic analyses revealed that they belong to 44 bHLH families with 46, 25, 15, 4, 11 and 3 members in group A, B, C, D, E and F, respectively, while the remaining 3 members were assigned into "orphan". Compared to mouse, the giant panda does not encode seven bHLH proteins namely Beta3a, Mesp2, Sclerax, S-Myc, Hes5 (or Hes6), EBF4 and Orphan 1. These results provide useful background information for future studies on structure and function of bHLH proteins in the regulation of giant panda development. PMID:22096504

Dang, Chunwang; Wang, Yong; Zhang, Debao; Yao, Qin; Chen, Keping

2011-01-01

10

An exploration of alternative visualisations of the basic helix-loop-helix protein interaction network  

PubMed Central

Background Alternative representations of biochemical networks emphasise different aspects of the data and contribute to the understanding of complex biological systems. In this study we present a variety of automated methods for visualisation of a protein-protein interaction network, using the basic helix-loop-helix (bHLH) family of transcription factors as an example. Results Network representations that arrange nodes (proteins) according to either continuous or discrete information are investigated, revealing the existence of protein sub-families and the retention of interactions following gene duplication events. Methods of network visualisation in conjunction with a phylogenetic tree are presented, highlighting the evolutionary relationships between proteins, and clarifying the context of network hubs and interaction clusters. Finally, an optimisation technique is used to create a three-dimensional layout of the phylogenetic tree upon which the protein-protein interactions may be projected. Conclusion We show that by incorporating secondary genomic, functional or phylogenetic information into network visualisation, it is possible to move beyond simple layout algorithms based on network topology towards more biologically meaningful representations. These new visualisations can give structure to complex networks and will greatly help in interpreting their evolutionary origins and functional implications. Three open source software packages (InterView, TVi and OptiMage) implementing our methods are available. PMID:17683601

Holden, Brian J; Pinney, John W; Lovell, Simon C; Amoutzias, Grigoris D; Robertson, David L

2007-01-01

11

Origin and Diversification of Basic-Helix-Loop-Helix Proteins in Plants  

PubMed Central

Basic helix-loop-helix (bHLH) proteins are a class of transcription factors found throughout eukaryotic organisms. Classification of the complete sets of bHLH proteins in the sequenced genomes of Arabidopsis thaliana and Oryza sativa (rice) has defined the diversity of these proteins among flowering plants. However, the evolutionary relationships of different plant bHLH groups and the diversity of bHLH proteins in more ancestral groups of plants are currently unknown. In this study, we use whole-genome sequences from nine species of land plants and algae to define the relationships between these proteins in plants. We show that few (less than 5) bHLH proteins are encoded in the genomes of chlorophytes and red algae. In contrast, many bHLH proteins (100–170) are encoded in the genomes of land plants (embryophytes). Phylogenetic analyses suggest that plant bHLH proteins are monophyletic and constitute 26 subfamilies. Twenty of these subfamilies existed in the common ancestors of extant mosses and vascular plants, whereas six further subfamilies evolved among the vascular plants. In addition to the conserved bHLH domains, most subfamilies are characterized by the presence of highly conserved short amino acid motifs. We conclude that much of the diversity of plant bHLH proteins was established in early land plants, over 440 million years ago. PMID:19942615

Pires, Nuno; Dolan, Liam

2010-01-01

12

Identification of a Novel Family of Oligodendrocyte Lineage-Specific Basic Helix–Loop–Helix Transcription Factors  

Microsoft Academic Search

Basic helix–loop–helix (bHLH) transcription factors have been identified for neurons and their precursors but not for glial cells. We have identified two bHLH factors, Oligo1 and Oligo2, that are specifically expressed in zones of neuroepithelium from which oligodendrocyte precursors emerge, as well as in the precursors themselves. Expression of Oligo2 in the spinal cord precedes that of platelet-derived growth factor

Qiao Zhou; Songli Wang; David J. Anderson

2000-01-01

13

The basic-helix-loop-helix-PAS orphan MOP3 forms transcriptionally active complexes with circadian and hypoxia factors  

Microsoft Academic Search

We report that MOP3 is a general dimeriza- tion partner for a subset of the basic-helix-loop- helix (bHLH)-PER-ARNT-SIM (PAS) superfamily of transcrip- tional regulators. We demonstrated that MOP3 interacts with MOP4, CLOCK, hypoxia-inducible factor 1a (HIF1a), and HIF2a. A DNA selection protocol revealed that the MOP3- MOP4 heterodimer bound a CACGTGA-containing DNA el- ement. Transient transfection experiments demonstrated that the

JOHN B. HOGENESCH; Y I-ZHONG GU; S ANJAY JAIN; CHRISTOPHER A. BRADFIELD

1998-01-01

14

The Basic Helix-Loop-Helix Transcription Factor PIF5 Acts on Ethylene Biosynthesis and Phytochrome Signaling by Distinct Mechanisms  

Microsoft Academic Search

PHYTOCHROME-INTERACTING FACTOR5 (PIF5), a basic helix-loop-helix transcription factor, interacts specifically with the photoactivated form of phytochrome B (phyB). Here, we report that dark-grown Arabidopsis thaliana seedlings over- expressing PIF5 (PIF5-OX) exhibit exaggerated apical hooks and short hypocotyls, reminiscent of the triple response induced by elevated ethylene levels, whereas pif5 mutants fail to maintain tight hooks like those of wild-type seedlings.

Rajnish Khanna; Yu Shen; Colleen M. Marion; Atsunari Tsuchisaka; Athanasios Theologis; Eberhard Schafer; P. H. Quail

2007-01-01

15

Iron-binding E3 ligase mediates iron response in plants by targeting basic helix-loop-helix transcription factors.  

PubMed

Iron uptake and metabolism are tightly regulated in both plants and animals. In Arabidopsis (Arabidopsis thaliana), BRUTUS (BTS), which contains three hemerythrin (HHE) domains and a Really Interesting New Gene (RING) domain, interacts with basic helix-loop-helix transcription factors that are capable of forming heterodimers with POPEYE (PYE), a positive regulator of the iron deficiency response. BTS has been shown to have E3 ligase capacity and to play a role in root growth, rhizosphere acidification, and iron reductase activity in response to iron deprivation. To further characterize the function of this protein, we examined the expression pattern of recombinant ProBTS::?-GLUCURONIDASE and found that it is expressed in developing embryos and other reproductive tissues, corresponding with its apparent role in reproductive growth and development. Our findings also indicate that the interactions between BTS and PYE-like (PYEL) basic helix-loop-helix transcription factors occur within the nucleus and are dependent on the presence of the RING domain. We provide evidence that BTS facilitates 26S proteasome-mediated degradation of PYEL proteins in the absence of iron. We also determined that, upon binding iron at the HHE domains, BTS is destabilized and that this destabilization relies on specific residues within the HHE domains. This study reveals an important and unique mechanism for plant iron homeostasis whereby an E3 ubiquitin ligase may posttranslationally control components of the transcriptional regulatory network involved in the iron deficiency response. PMID:25452667

Selote, Devarshi; Samira, Rozalynne; Matthiadis, Anna; Gillikin, Jeffrey W; Long, Terri A

2015-01-01

16

Molecular Distinction between Specification and Differentiation in the Myogenic Basic Helix-Loop-Helix Transcription Factor Family  

PubMed Central

The myogenic basic helix-loop-helix (bHLH) proteins regulate both skeletal muscle specification and differentiation: MyoD and Myf5 establish the muscle lineage, whereas myogenin mediates differentiation. Previously, we demonstrated that MyoD was more efficient than myogenin at initiating the expression of skeletal muscle genes, and in this study we present the molecular basis for this difference. A conserved amphipathic alpha-helix in the carboxy terminus of the myogenic bHLH proteins has distinct activities in MyoD and myogenin: the MyoD helix facilitates the initiation of endogenous gene expression, whereas the myogenin helix functions as a general transcriptional activation domain. Thus, the alternate use of a similar motif for gene initiation and activation provides a molecular basis for the distinction between specification and differentiation within the myogenic bHLH gene family. PMID:11259589

Bergstrom, Donald A.; Tapscott, Stephen J.

2001-01-01

17

The basic helix-loop-helix leucine zipper transcription factor Mitf is conserved in Drosophila and functions in eye development.  

PubMed Central

The MITF protein is a member of the MYC family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors and is most closely related to the TFE3, TFEC, and TFEB proteins. In the mouse, MITF is required for the development of several different cell types, including the retinal pigment epithelial (RPE) cells of the eye. In Mitf mutant mice, the presumptive RPE cells hyperproliferate, abnormally express the retinal transcriptional regulator Pax6, and form an ectopic neural retina. Here we report the structure of the Mitf gene in Drosophila and demonstrate expression during embryonic development and in the eye-antennal imaginal disc. In vitro, transcriptional regulation by Drosophila Mitf, like its mouse counterpart, is modified by the Eyeless (Drosophila Pax6) transcription factor. In vivo, targeted expression of wild-type or dominant-negative Drosophila Mitf results in developmental abnormalities reminiscent of Mitf function in mouse eye development. Our results suggest that the Mitf gene is the original member of the Mitf-Tfe subfamily of bHLH-Zip proteins and that its developmental function is at least partially conserved between vertebrates and invertebrates. These findings further support the common origin of the vertebrate and invertebrate eyes. PMID:15166150

Hallsson, Jón H; Haflidadóttir, Benedikta S; Stivers, Chad; Odenwald, Ward; Arnheiter, Heinz; Pignoni, Francesca; Steingrímsson, Eiríkur

2004-01-01

18

Phylogeny, Functional Annotation, and Protein Interaction Network Analyses of the Xenopus tropicalis Basic Helix-Loop-Helix Transcription Factors  

PubMed Central

The previous survey identified 70 basic helix-loop-helix (bHLH) proteins, but it was proved to be incomplete, and the functional information and regulatory networks of frog bHLH transcription factors were not fully known. Therefore, we conducted an updated genome-wide survey in the Xenopus tropicalis genome project databases and identified 105 bHLH sequences. Among the retrieved 105 sequences, phylogenetic analyses revealed that 103 bHLH proteins belonged to 43 families or subfamilies with 46, 26, 11, 3, 15, and 4 members in the corresponding supergroups. Next, gene ontology (GO) enrichment analyses showed 65 significant GO annotations of biological processes and molecular functions and KEGG pathways counted in frequency. To explore the functional pathways, regulatory gene networks, and/or related gene groups coding for Xenopus tropicalis bHLH proteins, the identified bHLH genes were put into the databases KOBAS and STRING to get the signaling information of pathways and protein interaction networks according to available public databases and known protein interactions. From the genome annotation and pathway analysis using KOBAS, we identified 16 pathways in the Xenopus tropicalis genome. From the STRING interaction analysis, 68 hub proteins were identified, and many hub proteins created a tight network or a functional module within the protein families. PMID:24312906

Chen, Deyu

2013-01-01

19

Basic helix–loop–helix transcription factor Tcfl5 interacts with the Calmegin gene promoter in mouse spermatogenesis  

PubMed Central

In mouse spermatogenesis, differentiating germ line cells initiate expression of specific genes at subsequent developmental steps. The Calmegin (Clgn) gene is first expressed in meiotic prophase, in primary spermatocytes, and encodes a protein that acts as a chaperone. To identify testis-specific transcription factors that control expression of the Clgn gene in spermatogenesis, we performed a yeast one-hybrid screening with a Clgn promoter sequence as bait DNA. This screening resulted in the identification of mouse Tcfl5 as a candidate Clgn promoter-binding protein. Tcfl5 is a member of the basic helix–loop–helix (bHLH) family of transcription factors, and mouse Tcfl5 shows 83% amino acid sequence identity with human TCFL5. Gel-shift and yeast one-hybrid experiments showed that Tcfl5 interacts with a non-canonical CACGCG site that is present in the Clgn promoter. By using northern blot, RT–PCR and in situ hybridization, mouse Tcfl5 mRNA was detected only in testis, with the highest expression level in primary spermatocytes and round spermatids. The highest level of Tcfl5 protein was found in primary spermatocytes at the diplotene stage of meiotic prophase, where the protein colocalizes with transcriptionally active chromatin. PMID:15585666

Siep, Michel; Sleddens-Linkels, Esther; Mulders, Sabine; van Eenennaam, Hans; Wassenaar, Evelyne; Van Cappellen, Wiggert A.; Hoogerbrugge, Jos; Grootegoed, J. Anton; Baarends, Willy M.

2004-01-01

20

A genome-wide survey on basic helix-loop-helix transcription factors in rat and mouse.  

PubMed

The basic helix-loop-helix (bHLH) proteins play essential roles in a wide range of developmental processes in higher organisms. bHLH family members have been identified in over 20 organisms, including nematode, fruit fly, and human. Our study identified 114 rat and 14 additional mouse bHLH members in rat and mouse genomes, respectively. Phylogenetic analyses revealed that both rat and mouse had 49, 26, 15, 4, 12, and 4 bHLH members in groups A, B, C, D, E, and F, respectively. Only the rat Mxi1 gene has two copies in the genome. All other rat bHLH genes and all mouse bHLH genes are single-copy genes. The chromosomal distribution pattern of mouse, rat, and human bHLH genes suggests the emergence of some bHLH genes through gene duplication, which probably happened at least before the divergence of vertebrates from invertebrates. The present study provides useful information for future studies using rat as a model animal for mammalian development. PMID:19306043

Zheng, Xiaodong; Zheng, X; Wang, Yong; Wang, Y; Yao, Qin; Yao, Q; Yang, Zhe; Yang, Z; Chen, Keping; Chen, K

2009-04-01

21

Genome-wide features of neuroendocrine regulation in Drosophila by the basic helix-loop-helix transcription factor DIMMED  

PubMed Central

Neuroendocrine (NE) cells use large dense core vesicles (LDCVs) to traffic, process, store and secrete neuropeptide hormones through the regulated secretory pathway. The dimmed (DIMM) basic helix-loop-helix transcription factor of Drosophila controls the level of regulated secretory activity in NE cells. To pursue its mechanisms, we have performed two independent genome-wide analyses of DIMM's activities: (i) in vivo chromatin immunoprecipitation (ChIP) to define genomic sites of DIMM occupancy and (ii) deep sequencing of purified DIMM neurons to characterize their transcriptional profile. By this combined approach, we showed that DIMM binds to conserved E-boxes in enhancers of 212 genes whose expression is enriched in DIMM-expressing NE cells. DIMM binds preferentially to certain E-boxes within first introns of specific gene isoforms. Statistical machine learning revealed that flanking regions of putative DIMM binding sites contribute to its DNA binding specificity. DIMM's transcriptional repertoire features at least 20 LDCV constituents. In addition, DIMM notably targets the pro-secretory transcription factor, creb-A, but significantly, DIMM does not target any neuropeptide genes. DIMM therefore prescribes the scale of secretory activity in NE neurons, by a systematic control of both proximal and distal points in the regulated secretory pathway. PMID:25634895

Hadži?, Tarik; Park, Dongkook; Abruzzi, Katharine C.; Yang, Lin; Trigg, Jennifer S.; Rohs, Remo; Rosbash, Michael; Taghert, Paul H.

2015-01-01

22

Cloning and characterization of a basic helix-loop-helix protein expressed in early mesoderm and the developing somites.  

PubMed Central

Basic helix-loop-helix (bHLH) heterodimer protein complexes regulate transcription of genes during the processes of differentiation and development. To study the molecular basis of early mesodermal differentiation, we sought to identify bHLH proteins from cells of mesodermal origin. By using an interaction cloning strategy with a radiolabled recombinant bHLH protein, E12, a clone encoding a potential heterodimer partner was isolated from an endothelial cell library. This gene (bHLH-EC2) is most homologous to Twist but shares similarity within the bHLH domain with TAL1 and other members of this family. bHLH-EC2 is expressed in cultured endothelial cells and in embryonic stem cell, erythroleukemia, and muscle cell lines in a differentiation-dependent manner. In situ hybridization studies of mouse embryos reveal that bHLH-EC2 is expressed throughout the primitive mesoderm as early as 7.5 days postcoitum. Expression then becomes restricted to the paraxial mesoderm and to the dermamyotome of the developing somite. Expression of bHLH-EC2 in cells destined to become myoblasts thus predates expression of myogenic bHLH factors. bHLH-EC2 is expressed in early endothelial and hematopoietic cells in vivo, as shown by RNA studies of embryonic yolk sac and cultured cells derived from yolk sac explants. These findings suggest that bHLH-EC2 plays a role in the development of multiple cell types derived from the primitive mesoderm. Images PMID:8041747

Quertermous, E E; Hidai, H; Blanar, M A; Quertermous, T

1994-01-01

23

Selective utilization of basic helix-loop-helix-leucine zipper proteins at the immunoglobulin heavy-chain enhancer.  

PubMed Central

The microE3 E box within the immunoglobulin heavy-chain (IgH) enhancer binds several proteins of the basic helix-loop-helix-leucine zipper (bHLHzip) class, including TFE3, USF1, and Max. Both TFE3 and USF have been described as transcriptional activators, and so we investigated their possible roles in activating the IgH enhancer in vivo. Although TFE3 activated various enhancer-based reporters, both USF1 and Max effectively inhibited transcription. Inhibition by USF correlated with the lack of a strong activation domain and was the result of the protein neutralizing the microE3 site. The effects of dominant-negative derivatives of TFE3 and USF1 confirmed that TFE3, or a TFE3-like protein, is the primary cellular bHLHzip protein that activates the IgH enhancer. In addition to providing a physiological role for TFE3, our results call into question the traditional view of USF1 as an obligate transcriptional activator. PMID:8972181

Carter, R S; Ordentlich, P; Kadesch, T

1997-01-01

24

A basic helix-loop-helix transcription factor DvIVS determines flower color intensity in cyanic dahlia cultivars.  

PubMed

The study was aimed to identify the factors that regulate the intensity of flower color in cyanic dahlia (Dahlia variabilis), using fifteen cultivars with different color intensities in their petals. The cultivars were classified into three groups based on their flavonoid composition: ivory white cultivars with flavones; purple and pink cultivars with flavones and anthocyanins; and red cultivars with flavones, anthocyanins, and chalcones. Among the purple, pink, and ivory white cultivars, an inverse relationship was detected between lightness, which was used as an indicator for color intensity and anthocyanin content. A positive correlation was detected between anthocyanin contents and the expression of some structural genes in the anthocyanin synthesis pathway that are regulated by DvIVS, a basic helix-loop-helix transcription factor. A positive correlation between anthocyanin content and expression of DvIVS was also found. The promoter region of DvIVS was classified into three types, with cultivars carrying Type 1 promoter exhibited deep coloring, those carrying Type 2 and/or Type 3 exhibited pale coloring, and those carrying Type 1 and Type 2 and/or Type 3 exhibited medium coloring. The transcripts of the genes from these promoters encoded full-length predicted proteins. These results suggested that the genotype of the promoter region in DvIVS is one of the key factors determining the flower color intensity. PMID:23689377

Ohno, Sho; Deguchi, Ayumi; Hosokawa, Munetaka; Tatsuzawa, Fumi; Doi, Motoaki

2013-08-01

25

Genome-wide identification and analysis of basic helix-loop-helix domains in dog, Canis lupus familiaris.  

PubMed

The basic helix-loop-helix (bHLH) domain is a highly conserved amino acid motif that defines a group of DNA-binding transcription factors. bHLH proteins play essential regulatory roles in a variety of biological processes in animal, plant, and fungus. The domestic dog, Canis lupus familiaris, is a good model organism for genetic, physiological, and behavioral studies. In this study, we identified 115 putative bHLH genes in the dog genome. Based on a phylogenetic analysis, 51, 26, 14, 4, 12, and 4 dog bHLH genes were assigned to six separate groups (A-F); four bHLH genes were categorized as ''orphans''. Within-group evolutionary relationships inferred from the phylogenetic analysis were consistent with positional conservation, other conserved domains flanking the bHLH motif, and highly conserved intron/exon patterns in other vertebrates. Our analytical results confirmed the GenBank annotations of 89 dog bHLH proteins and provided information that could be used to update the annotations of the remaining 26 dog bHLH proteins. These data will provide good references for further studies on the structures and regulatory functions of bHLH proteins in the growth and development of dogs, which may help in understanding the mechanisms that underlie the physical and behavioral differences between dogs and wolves. PMID:25403511

Wang, Xu-Hua; Wang, Yong; Liu, A-Ke; Liu, Xiao-Ting; Zhou, Yang; Yao, Qin; Chen, Ke-Ping

2015-04-01

26

The basic helix-loop-helix transcription factor Mist1 functions as a transcriptional repressor of myoD.  

PubMed Central

A good model system to examine aspects of positive and negative transcriptional regulation is the muscle-specific regulatory factor, MyoD, which is a basic helix-loop-helix (bHLH) transcription factor. Although MyoD has the ability to induce skeletal muscle terminal differentiation in a variety of non-muscle cell types, MyoD activity itself is highly regulated through protein-protein interactions involving several different co-factors. Here we describe the characterization of a novel bHLH protein, Mist1, and how it influences MyoD function. We show that Mist1 accumulates in myogenic stem cells (myoblasts) and then decreases as myoblasts differentiate into myotubes. Mist1 functions as a negative regulator of MyoD activity, preventing muscle differentiation and the concomitant expression of muscle-specific genes. Mist1-induced inhibition occurs through a combination of mechanisms, including the formation of inactive MyoD-Mist1 heterodimers and occupancy of specific E-box target sites by Mist1 homodimers. Mist1 lacks a classic transcription activation domain and instead possesses an N-terminal repressor region capable of inhibiting heterologous activators. Thus, Mist1 may represent a new class of repressor molecules that play a role in controlling the transcriptional activity of MyoD, ensuring that expanding myoblast populations remain undifferentiated during early embryonic muscle formation. PMID:9482738

Lemercier, C; To, R Q; Carrasco, R A; Konieczny, S F

1998-01-01

27

Differentiation of Arabidopsis Guard Cells: Analysis of the Networks Incorporating the Basic Helix-Loop-Helix Transcription Factor, FAMA1[C][W][OA  

PubMed Central

Nearly all extant land plants possess stomata, the epidermal structures that mediate gas exchange between the plant and the environment. The developmental pathways, cell division patterns, and molecules employed in the generation of these structures are simple examples of processes used in many developmental contexts. One specific module is a set of “master regulator” basic helix-loop-helix transcription factors that regulate individual consecutive steps in stomatal development. Here, we profile transcriptional changes in response to inducible expression of Arabidopsis (Arabidopsis thaliana) FAMA, a basic helix-loop-helix protein whose actions during the final stage in stomatal development regulate both cell division and cell fate. Genes identified by microarray and candidate approaches were then further analyzed to test specific hypothesis about the activity of FAMA, the shape of its regulatory network, and to create a new set of stomata-specific or stomata-enriched reporters. PMID:21245191

Hachez, Charles; Ohashi-Ito, Kyoko; Dong, Juan; Bergmann, Dominique C.

2011-01-01

28

PIF3, a Phytochrome-Interacting Factor Necessary for Normal Photoinduced Signal Transduction, Is a Novel Basic Helix-Loop-Helix Protein  

Microsoft Academic Search

The mechanism by which the phytochrome (phy) photoreceptor family transduces informational light signals to photoresponsive genes is unknown. Using a yeast two-hybrid screen, we have identified a phytochrome-interacting factor, PIF3, a basic helix-loop-helix protein containing a PAS domain. PIF3 binds to wild-type C-terminal domains of both phyA and phyB, but less strongly to signaling-defective, missense mutant–containing domains. Expression of sense

Min Ni; James M Tepperman; Peter H Quail

1998-01-01

29

Synergistic activation of the human orphan nuclear receptor SHP gene promoter by basic helix-loop-helix protein E2A and orphan nuclear receptor SF1  

Microsoft Academic Search

The orphan nuclear receptor small heterodimer partner (SHP; NR0B2) is an unusual orphan nuclear receptor that lacks a conventional DNA-binding domain and acts as a modulator of transcriptional activities of a number of nuclear receptors. We have previously reported that the orphan nuclear receptor ERRg activates the SHP promoter. In this study, we have found that basic helix-loop-helix (bHLH) transcription

Han-Jong Kim; Joon-Young Kim; Yun-Yong Park; Hueng-Sik Choi

2003-01-01

30

Hey Basic Helix-Loop-Helix Transcription Factors Are Repressors of GATA4 and GATA6 and Restrict Expression of the GATA Target Gene ANF in Fetal Hearts  

Microsoft Academic Search

The Hey basic helix-loop-helix transcription factors are downstream effectors of Notch signaling in the cardiovascular system. Mice lacking Hey2 develop cardiac hypertrophy, often associated with congenital heart defects, whereas combined Hey1\\/Hey2 deficiency leads to severe vascular defects and embryonic lethality around embryonic day E9.5. The molecular basis of these disorders is poorly understood, however, since target genes of Hey transcription

Andreas Fischer; Jurgen Klattig; Burkhard Kneitz; Holger Diez; Manfred Maier; Bettina Holtmann; Christoph Englert; Manfred Gessler

2005-01-01

31

A cellular factor stimulates ligand-dependent release of hsp90 from the basic helix-loop-helix dioxin receptor.  

PubMed Central

In response to dioxin, the nuclear basic helix-loop-helix (bHLH) dioxin receptor forms a complex with the bHLH partner factor Arnt that regulates target gene transcription by binding to dioxin-responsive sequence motifs. Previously, we have demonstrated that the latent form of dioxin receptor present in extracts from untreated cells is stably associated with molecular chaperone protein hsp90, and Arnt is not a component of this complex. Here, we used a coimmunoprecipitation assay to demonstrate that the in vitro-translated dioxin receptor, but not Arnt, is stably associated with hsp90. Although it showed ligand-binding activity, the in vitro-translated dioxin receptor failed to dissociate from hsp90 upon exposure to ligand. Addition of a specific fraction from wild-type hepatoma cells, however, to the in vitro-expressed receptor promoted dioxin-dependent release of hsp90. This stimulatory effect was mediated via the bHLH dimerization and DNA-binding motif of the receptor. Moreover, ligand-dependent release of hsp90 from the receptor was not promoted by fractionated cytosolic extracts from mutant hepatoma cells which are deficient in the function of bHLH dioxin receptor partner factor Arnt. Thus, our results provide a novel model for regulation of bHLH factor activity and suggest that derepression of the dioxin receptor by ligand-induced release of hsp90 may require bHLH-mediated concomitant recruitment of an additional cellular factor, possibly the structurally related bHLH dimerization partner factor Arnt. In support of this model, addition of in vitro-expressed wild-type Arnt, but not a mutated form of Arnt lacking the bHLH motif, promoted release of hsp90 from the dioxin receptor in the presence of dioxin. Images PMID:8139547

McGuire, J; Whitelaw, M L; Pongratz, I; Gustafsson, J A; Poellinger, L

1994-01-01

32

The basic helix-loop-helix differentiation factor Nex1/MATH-2 functions as a key activator of the GAP-43 gene.  

PubMed

Nex1/MATH-2 is a neurogenic basic Helix-Loop-Helix (bHLH) transcription factor that belongs to the NeuroD subfamily. Its expression parallels that of the GAP-43 gene and peaks during brain development, when neurite outgrowth and synaptogenesis are highly active. We previously observed a direct correlation between the levels of expression of Nex1 and GAP-43 proteins, which resulted in extensive neurite outgrowth and neuronal differentiation of PC12 cells in the absence of nerve growth factor. Since the GAP-43 gene is a target for bHLH regulation, we investigated whether Nex1 could regulate the activity of the GAP-43 promoter. We found that among the members of the NeuroD subfamily, Nex1 promoted maximal activity of the GAP-43 promoter. The Nex1-mediated activity is restricted to the conserved E1-E2 cluster located near the major transcription start sites. By electrophoretic mobility shift assay and site-directed mutagenesis, we showed that Nex1 binds as homodimers and that the E1 E-box is a high affinity binding site. We further found that Nex1 released the ME1 E-protein-mediated repression in a concentration dependent manner. Thus, the E1-E2 cluster has a dual function: it can mediate activation or repression depending on the interacting bHLH proteins. Finally, a series of N-terminal and C-terminal deletions revealed that Nex1 transcriptional activity is linked to two distinct transactivation domains, TAD1 and TAD2, with TAD1 being unique to Nex1. Together, our results suggest that Nex1 may engage in selective interactions with components of the core transcriptional machinery whose assembly is dictated by the architecture of the GAP-43 promoter and cellular environment. PMID:12562512

Uittenbogaard, Martine; Martinka, Debra L; Chiaramello, Anne

2003-02-01

33

The basic helix-loop-helix differentiation factor Nex1/MATH-2 functions as a key activator of the GAP-43 gene  

PubMed Central

Nex1/MATH-2 is a neurogenic basic Helix-Loop-Helix (bHLH) transcription factor that belongs to the NeuroD subfamily. Its expression parallels that of the GAP-43 gene and peaks during brain development, when neurite outgrowth and synaptogenesis are highly active. We previously observed a direct correlation between the levels of expression of Nex1 and GAP-43 proteins, which resulted in extensive neurite outgrowth and neuronal differentiation of PC12 cells in the absence of nerve growth factor. Since the GAP-43 gene is a target for bHLH regulation, we investigated whether Nex1 could regulate the activity of the GAP-43 promoter. We found that among the members of the NeuroD subfamily, Nex1 promoted maximal activity of the GAP-43 promoter. The Nex1-mediated activity is restricted to the conserved E1–E2 cluster located near the major transcription start sites. By electrophoretic mobility shift assay and site-directed mutagenesis, we showed that Nex1 binds as homodimers and that the E1 E-box is a high affinity binding site. We further found that Nex1 released the ME1 E-protein-mediated repression in a concentration dependent manner. Thus, the E1–E2 cluster has a dual function: it can mediate activation or repression depending on the interacting bHLH proteins. Finally, a series of N-terminal and C-terminal deletions revealed that Nex1 transcriptional activity is linked to two distinct transactivation domains, TAD1 and TAD2, with TAD1 being unique to Nex1. Together, our results suggest that Nex1 may engage in selective interactions with components of the core transcriptional machinery whose assembly is dictated by the architecture of the GAP-43 promoter and cellular environment. PMID:12562512

Uittenbogaard, Martine; Martinka, Debra L.; Chiaramello, Anne

2006-01-01

34

Iron-Binding E3 Ligase Mediates Iron Response in Plants by Targeting Basic Helix-Loop-Helix Transcription Factors1[OPEN  

PubMed Central

Iron uptake and metabolism are tightly regulated in both plants and animals. In Arabidopsis (Arabidopsis thaliana), BRUTUS (BTS), which contains three hemerythrin (HHE) domains and a Really Interesting New Gene (RING) domain, interacts with basic helix-loop-helix transcription factors that are capable of forming heterodimers with POPEYE (PYE), a positive regulator of the iron deficiency response. BTS has been shown to have E3 ligase capacity and to play a role in root growth, rhizosphere acidification, and iron reductase activity in response to iron deprivation. To further characterize the function of this protein, we examined the expression pattern of recombinant ProBTS::?-GLUCURONIDASE and found that it is expressed in developing embryos and other reproductive tissues, corresponding with its apparent role in reproductive growth and development. Our findings also indicate that the interactions between BTS and PYE-like (PYEL) basic helix-loop-helix transcription factors occur within the nucleus and are dependent on the presence of the RING domain. We provide evidence that BTS facilitates 26S proteasome-mediated degradation of PYEL proteins in the absence of iron. We also determined that, upon binding iron at the HHE domains, BTS is destabilized and that this destabilization relies on specific residues within the HHE domains. This study reveals an important and unique mechanism for plant iron homeostasis whereby an E3 ubiquitin ligase may posttranslationally control components of the transcriptional regulatory network involved in the iron deficiency response. PMID:25452667

Selote, Devarshi; Samira, Rozalynne; Matthiadis, Anna; Gillikin, Jeffrey W.; Long, Terri A.

2015-01-01

35

The Drosophila dysfusion basic helix-loop-helix (bHLH)-PAS gene controls tracheal fusion and levels of the trachealess bHLH-PAS protein.  

PubMed

The development of the mature insect trachea requires a complex series of cellular events, including tracheal cell specification, cell migration, tubule branching, and tubule fusion. Here we describe the identification of the Drosophila melanogaster dysfusion gene, which encodes a novel basic helix-loop-helix (bHLH)-PAS protein conserved between Caenorhabditis elegans, insects, and humans, and controls tracheal fusion events. The Dysfusion protein functions as a heterodimer with the Tango bHLH-PAS protein in vivo to form a putative DNA-binding complex. The dysfusion gene is expressed in a variety of embryonic cell types, including tracheal-fusion, leading-edge, foregut atrium cells, nervous system, hindgut, and anal pad cells. RNAi experiments indicate that dysfusion is required for dorsal branch, lateral trunk, and ganglionic branch fusion but not for fusion of the dorsal trunk. The escargot gene, which is also expressed in fusion cells and is required for tracheal fusion, precedes dysfusion expression. Analysis of escargot mutants indicates a complex pattern of dysfusion regulation, such that dysfusion expression is dependent on escargot in the dorsal and ganglionic branches but not the dorsal trunk. Early in tracheal development, the Trachealess bHLH-PAS protein is present at uniformly high levels in all tracheal cells, but since the levels of Dysfusion rise in wild-type fusion cells, the levels of Trachealess in fusion cells decline. The downregulation of Trachealess is dependent on dysfusion function. These results suggest the possibility that competitive interactions between basic helix-loop-helix-PAS proteins (Dysfusion, Trachealess, and possibly Similar) may be important for the proper development of the trachea. PMID:12897136

Jiang, Lan; Crews, Stephen T

2003-08-01

36

Arabidopsis Basic Helix-Loop-Helix Transcription Factors MYC2, MYC3, and MYC4 Regulate Glucosinolate Biosynthesis, Insect Performance, and Feeding Behavior[W][OPEN  

PubMed Central

Arabidopsis thaliana plants fend off insect attack by constitutive and inducible production of toxic metabolites, such as glucosinolates (GSs). A triple mutant lacking MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that are known to additively control jasmonate-related defense responses, was shown to have a highly reduced expression of GS biosynthesis genes. The myc2 myc3 myc4 (myc234) triple mutant was almost completely devoid of GS and was extremely susceptible to the generalist herbivore Spodoptera littoralis. On the contrary, the specialist Pieris brassicae was unaffected by the presence of GS and preferred to feed on wild-type plants. In addition, lack of GS in myc234 drastically modified S. littoralis feeding behavior. Surprisingly, the expression of MYB factors known to regulate GS biosynthesis genes was not altered in myc234, suggesting that MYC2/MYC3/MYC4 are necessary for direct transcriptional activation of GS biosynthesis genes. To support this, chromatin immunoprecipitation analysis showed that MYC2 binds directly to the promoter of several GS biosynthesis genes in vivo. Furthermore, yeast two-hybrid and pull-down experiments indicated that MYC2/MYC3/MYC4 interact directly with GS-related MYBs. This specific MYC–MYB interaction plays a crucial role in the regulation of defense secondary metabolite production and underlines the importance of GS in shaping plant interactions with adapted and nonadapted herbivores. PMID:23943862

Schweizer, Fabian; Fernández-Calvo, Patricia; Zander, Mark; Diez-Diaz, Monica; Fonseca, Sandra; Glauser, Gaétan; Lewsey, Mathew G.; Ecker, Joseph R.; Solano, Roberto; Reymond, Philippe

2013-01-01

37

Gene expression of MASH-1, MATH-1, neuroD and NSCL-2, basic helix-loop-helix proteins, during neural differentiation in P19 embryonal carcinoma cells.  

PubMed

We examined the gene expression of MASH-1, MATH-1, neuroD and NSCL-2 during neural differentiation of P19 embryonal carcinoma cells using reverse transcription-polymerase chain reaction and high performance liquid chromatography. These proteins are members of basic helix-loop-helix transcription factor family and their expressions are reported to be transient and restricted in the nervous system during early neurogenesis. Retinoic acid (RA-, 1 microM)-treatment and aggregation for 4 days induced and greatly increased MASH-1, neuroD and NSCL-2 mRNA in P19 cells. The increases peaked at day 3, 4 and 5, respectively. RA-treatment increased MATH-1 mRNA slightly. mRNA of MAP2, a neural differentiation marker, were increased by RA-treatment and the increases reached to the plateau at day 5. The results indicate that the gene expression of MASH-1, MATH-1, neuroD and NSCL-2 during neural differentiation in P19 cells is transient and the order is similar to that in the mouse embryo nervous system as previously reported. PMID:9352625

Itoh, F; Nakane, T; Chiba, S

1997-08-01

38

Endosperm breakdown in Arabidopsis requires heterodimers of the basic helix-loop-helix proteins ZHOUPI and INDUCER OF CBP EXPRESSION 1.  

PubMed

In Arabidopsis seeds, embryo growth is coordinated with endosperm breakdown. Mutants in the endosperm-specific gene ZHOUPI (ZOU), which encodes a unique basic helix-loop-helix (bHLH) transcription factor, have an abnormal endosperm that persists throughout seed development, significantly impeding embryo growth. Here we show that loss of function of the bHLH-encoding gene INDUCER OF CBP EXPRESSION 1 (ICE1) causes an identical endosperm persistence phenotype. We show that ZOU and ICE1 are co-expressed in the endosperm and interact in yeast via their bHLH domains. We show both genetically and in a heterologous plant system that, despite the fact that both ZOU and ICE1 can form homodimers in yeast, their role in endosperm breakdown requires their heterodimerization. Consistent with this conclusion, we confirm that ZOU and ICE1 regulate the expression of common target genes in the developing endosperm. Finally, we show that heterodimerization of ZOU and ICE1 is likely to be necessary for their binding to specific targets, rather than for their nuclear localization in the endosperm. By comparing our results with paradigms of bHLH function and evolution in animal systems we propose that the ZOU/ICE1 complex might have ancient origins, acquiring novel megagametophyte-specific functions in heterosporous land plants that were conserved in the angiosperm endosperm. PMID:24553285

Denay, Grégoire; Creff, Audrey; Moussu, Steven; Wagnon, Pauline; Thévenin, Johanne; Gérentes, Marie-France; Chambrier, Pierre; Dubreucq, Bertrand; Ingram, Gwyneth

2014-03-01

39

The LIM protein RBTN2 and the basic helix-loop-helix protein TAL1 are present in a complex in erythroid cells.  

PubMed

Chromosomal translocations in T-cell acute leukemias can activate genes encoding putative transcription factors such as the LIM proteins RBTN1 and RBTN2 and the DNA-binding basic helix-loop-helix transcription factor TAL1 associated with T-cell acute lymphocytic leukemia. While not expressed in normal T cells, RBTN2 and TAL1 are coexpressed in erythroid cells and are both important for erythroid differentiation. We demonstrate, using anti-RBTN2 and anti-TAL1 antisera, that the LIM protein RBTN2 is not phosphorylated and is complexed with the TAL1 phosphoprotein in the nucleus of erythroid cells. A complex containing both RBTN1 and TAL1 also occurs in a T-cell acute leukemia cell line. Since both RBTN2 and TAL1 are crucial for normal erythropoiesis, these data have important implications for transcription networks therein. Further, since both proteins can be involved in leukemogenesis, these data provide a direct link between proteins activated by chromosomal translocations in T-cell acute leukemia. PMID:8078932

Valge-Archer, V E; Osada, H; Warren, A J; Forster, A; Li, J; Baer, R; Rabbitts, T H

1994-08-30

40

Phytochrome B binds with greater apparent affinity than phytochrome A to the basic helix-loop-helix factor PIF3 in a reaction requiring the PAS domain of PIF3  

Microsoft Academic Search

The signaling pathways by which the phytochrome (phy) family of photoreceptors transmits sensory information to light-regulated genes remain to be fully defined. Evidence for a relatively direct pathway has been provided by the binding of one member of the family, phyB, to a promoter-element-bound, basic helix-loop-helix protein, PIF3, specifically upon light-induced conversion of the photoreceptor molecule to its biologically active

Yuxian Zhu; James M. Tepperman; Craig D. Fairchild; Peter H. Quail

2000-01-01

41

A basic helix-loop-helix-leucine zipper transcription complex in yeast functions in a signaling pathway from mitochondria to the nucleus.  

PubMed Central

The expression of some nuclear genes in Saccharomyces cerevisiae, such as the CIT2 gene, which encodes a glyoxylate cycle isoform of citrate synthase, is responsive to the functional state of mitochondria. Previous studies identified a basic helix-loop-helix-leucine zipper (bHLH/Zip) transcription factor encoded by the RTG1 gene that is required for both basal expression of the CIT2 gene and its increased expression in respiratory-deficient cells. Here, we describe the cloning and characterization of RTG3, a gene encoding a 54-kDa bHLH/Zip protein that is also required for CIT2 expression. Rtg3p binds together with Rtg1p to two identical sites oriented as inverted repeats 28 bp apart in a regulatory upstream activation sequence element (UASr) in the CIT2 promoter. The core binding site for the Rtg1p-Rtg3p heterodimer is 5'-GGTCAC-3', which differs from the canonical E-box site, CANNTG, to which most other bHLH proteins bind. We demonstrate that both of the Rtg1p-Rtg3p binding sites in the UAS(r) element are required in vivo and act synergistically for CIT2 expression. The basic region of Rtg3p conforms well to the basic region of most bHLH proteins, whereas the basic region of Rtg1p does not. These findings suggest that the Rtg1p-Rtg3p complex interacts in a novel way with its DNA target sites. PMID:9032238

Jia, Y; Rothermel, B; Thornton, J; Butow, R A

1997-01-01

42

Basic Helix-Loop-Helix Transcription Factor Bmsage Is Involved in Regulation of fibroin H-chain Gene via Interaction with SGF1 in Bombyx mori  

PubMed Central

Silk glands are specialized in the synthesis of several secretory proteins. Expression of genes encoding the silk proteins in Bombyx mori silk glands with strict territorial and developmental specificities is regulated by many transcription factors. In this study, we have characterized B. mori sage, which is closely related to sage in the fruitfly Drosophila melanogaster. It is termed Bmsage; it encodes transcription factor Bmsage, which belongs to the Mesp subfamily, containing a basic helix–loop–helix motif. Bmsage transcripts were detected specifically in the silk glands of B. mori larvae through RT-PCR analysis. Immunoblotting analysis confirmed the Bmsage protein existed exclusively in B. mori middle and posterior silk gland cells. Bmsage has a low level of expression in the 4th instar molting stages, which increases gradually in the 5th instar feeding stages and then declines from the wandering to the pupation stages. Quantitative PCR analysis suggested the expression level of Bmsage in a high silk strain was higher compared to a lower silk strain on day 3 of the larval 5th instar. Furthermore, far western blotting and co-immunoprecipitation assays showed the Bmsage protein interacted with the fork head transcription factor silk gland factor 1 (SGF1). An electrophoretic mobility shift assay showed the complex of Bmsage and SGF1 proteins bound to the A and B elements in the promoter of fibroin H-chain gene(fib-H), respectively. Luciferase reporter gene assays confirmed the complex of Bmsage and SGF1 proteins increased the expression of fib-H. Together, these results suggest Bmsage is involved in the regulation of the expression of fib-H by being together with SGF1 in B. mori PSG cells. PMID:24740008

Li, Qiong-Yan; Hu, Wen-Bo; Zhou, Meng-Ting; Nie, Hong-Yi; Zhang, Yin-Xia; Peng, Zhang-Chuan; Zhao, Ping; Xia, Qing-You

2014-01-01

43

PIAS1 activates the expression of smooth muscle cell differentiation marker genes by interacting with serum response factor and class I basic helix-loop-helix proteins.  

PubMed

Although a critical component of vascular disease is modulation of the differentiated state of vascular smooth muscle cells (SMC), the mechanisms governing SMC differentiation are relatively poorly understood. We have previously shown that E-boxes and the ubiquitously expressed class I basic helix-loop-helix (bHLH) proteins, including E2-2 and E12, are important in regulation of the SMC differentiation marker gene, the SM alpha-actin gene. The aim of the present study was to identify proteins that bind to class I bHLH proteins in SMC and modulate transcriptional regulation of SMC differentiation marker genes. Herein we report that members of the protein inhibitor of activated STAT (PIAS) family interact with class I bHLH factors as well as serum response factor (SRF). PIAS1 interacted with E2-2 and E12 based on yeast two-hybrid screens, mammalian two-hybrid assays, and/or coimmunoprecipitation assays. Overexpression of PIAS1 significantly activated the SM alpha-actin promoter and mRNA expression, as well as SM myosin heavy chain and SM22alpha, whereas a small interfering RNA for PIAS1 decreased activity of these promoters, as well as endogenous mRNA expression, and SRF binding to SM alpha-actin promoter within intact chromatin in cultured SMC. Of significance, PIAS1 bound to SRF and activated SM alpha-actin promoter expression in wild-type but not SRF(-/-) embryonic stem cells. These results provide novel evidence that PIAS1 modulates transcriptional activation of SMC marker genes through cooperative interactions with both SRF and class I bHLH proteins. PMID:16135793

Kawai-Kowase, Keiko; Kumar, Meena S; Hoofnagle, Mark H; Yoshida, Tadashi; Owens, Gary K

2005-09-01

44

MicroRNA-212 Post-Transcriptionally Regulates Oocyte-Specific Basic-Helix-Loop-Helix Transcription Factor, Factor in the Germline Alpha (FIGLA), during Bovine Early Embryogenesis  

PubMed Central

Factor in the germline alpha (FIGLA) is an oocyte-specific basic helix-loop-helix transcription factor essential for primordial follicle formation and expression of many genes required for folliculogenesis, fertilization and early embryonic survival. Here we report the characterization of bovine FIGLA gene and its regulation during early embryogenesis. Bovine FIGLA mRNA expression is restricted to gonads and is detected in fetal ovaries harvested as early as 90 days of gestation. FIGLA mRNA and protein are abundant in germinal vesicle and metaphase II stage oocytes, as well as in embryos from pronuclear to eight-cell stage but barely detectable at morula and blastocyst stages, suggesting that FIGLA might be a maternal effect gene. Recent studies in zebrafish and mice have highlighted the importance of non-coding small RNAs (microRNAs) as key regulatory molecules targeting maternal mRNAs for degradation during embryonic development. We hypothesized that FIGLA, as a maternal transcript, is regulated by microRNAs during early embryogenesis. Computational predictions identified a potential microRNA recognition element (MRE) for miR-212 in the 3’ UTR of the bovine FIGLA mRNA. Bovine miR-212 is expressed in oocytes and tends to increase in four-cell and eight-cell stage embryos followed by a decline at morula and blastocyst stages. Transient transfection and reporter assays revealed that miR-212 represses the expression of FIGLA in a MRE dependent manner. In addition, ectopic expression of miR-212 mimic in bovine early embryos dramatically reduced the expression of FIGLA protein. Collectively, our results demonstrate that FIGLA is temporally regulated during bovine early embryogenesis and miR-212 is an important negative regulator of FIGLA during the maternal to zygotic transition in bovine embryos. PMID:24086699

Tripurani, Swamy K.; Wee, Gabbine; Lee, Kyung-Bon; Smith, George W.; Wang, Lei; JianboYao

2013-01-01

45

The grapevine basic helix-loop-helix (bHLH) transcription factor positively modulates CBF-pathway and confers tolerance to cold-stress in Arabidopsis.  

PubMed

Basic helix-loop-helix (bHLH)-type transcription factors play diverse roles in plant physiological response and stress-adaptive regulation network. Here, we identified one grapevine bHLH transcription factor from a cold-tolerant accession 'Heilongjiang seedling' of Chinese wild Vitis amurensis (VabHLH1) as a transcriptional activator involved in cold stress. We also compared with its counterpart from a cold-sensitive Vitis vinifera cv. Cabernet Sauvignon (VvbHLH1). These two putative proteins are characterized by the presence of the identically conserved regions of 54 amino acid residues of bHLH signature domain, and shared 99.1% amino acid identity, whereas several stress-related cis-regulatory elements located in both promoter regions differed in types and positions. Expressions of two bHLHs in grapevine leaves were induced by cold stress, but evidently differ between two grapevine genotypes upon cold exposure. Two grapevine bHLH proteins were exclusively localized to the nucleus and exhibited strong transcriptional activation activities in yeast cells. Overexpression of either VabHLH1 or VvbHLH1 transcription factor did not affect the growth and development of transgenic Arabidopsis plants, but enhanced tolerance to cold stress. The improved tolerance in VabHLH1- or VvbHLH1-overexpressing Arabidopsis plants is associated with multiple physiological and biochemical changes that occurred during the time-course cold stress. These most common changes include the evaluated levels of proline, decreased amounts of malondialdehyde and reduced membrane injury as reflected by electrolyte leakage. VabHLH1 and VvbHLH1 displayed overlapping, but not identical, roles in activating the corresponding CBF cold signaling pathway, especially in regulating the expression of CBF3 and RD29A. Our findings demonstrated that two grapevine bHLHs act as positive regulators of the cold stress response, modulating the level of COR gene expression, which in turn confer tolerance to cold stress. PMID:24859977

Xu, Weirong; Zhang, Ningbo; Jiao, Yuntong; Li, Ruimin; Xiao, Dongming; Wang, Zhenping

2014-08-01

46

Constitutive Overexpression of the Basic Helix-Loop-Helix Nex1/MATH-2 Transcription Factor Promotes Neuronal Differentiation of PC12 Cells and Neurite Regeneration  

PubMed Central

Elucidation of the intricate transcriptional pathways leading to neural differentiation and the establishment of neuronal identity is critical to the understanding and design of therapeutic approaches. Among the important players, the basic helix-loop-helix (bHLH) transcription factors have been found to be pivotal regulators of neurogenesis. In this study, we investigate the role of the bHLH differentiation factor Nex1/MATH-2 in conjunction with the nerve growth factor (NGF) signaling pathway using the rat phenochromocytoma PC12 cell line. We report that the expression of Nex1 protein is induced after 5 hr of NGF treatment and reaches maximal levels at 24 hr, when very few PC12 cells have begun extending neurites and ceased cell division. Furthermore, our study demonstrates that Nex1 has the ability to trigger neuronal differentiation of PC12 cells in the absence of neurotrophic factor. We show that Nex1 plays an important role in neurite outgrowth and has the capacity to regenerate neurite outgrowth in the absence of NGF. These results are corroborated by the fact that Nex1 targets a repertoire of distinct types of genes associated with neuronal differentiation, such as GAP-43, ?III-tubulin, and NeuroD. In addition, our findings show that Nex1 up-regulates the expression of the mitotic inhibitor p21WAF1, thus linking neuronal differentiation to cell cycle withdrawal. Finally, our studies show that overexpression of a Nex1 mutant has the ability to block the execution of NGF-induced differentiation program, suggesting that Nex1 may be an important effector of the NGF signaling pathway. PMID:11782967

Uittenbogaard, Martine; Chiaramello, Anne

2009-01-01

47

Constitutive overexpression of the basic helix-loop-helix Nex1/MATH-2 transcription factor promotes neuronal differentiation of PC12 cells and neurite regeneration.  

PubMed

Elucidation of the intricate transcriptional pathways leading to neural differentiation and the establishment of neuronal identity is critical to the understanding and design of therapeutic approaches. Among the important players, the basic helix-loop-helix (bHLH) transcription factors have been found to be pivotal regulators of neurogenesis. In this study, we investigate the role of the bHLH differentiation factor Nex1/MATH-2 in conjunction with the nerve growth factor (NGF) signaling pathway using the rat phenochromocytoma PC12 cell line. We report that the expression of Nex1 protein is induced after 5 hr of NGF treatment and reaches maximal levels at 24 hr, when very few PC12 cells have begun extending neurites and ceased cell division. Furthermore, our study demonstrates that Nex1 has the ability to trigger neuronal differentiation of PC12 cells in the absence of neurotrophic factor. We show that Nex1 plays an important role in neurite outgrowth and has the capacity to regenerate neurite outgrowth in the absence of NGF. These results are corroborated by the fact that Nex1 targets a repertoire of distinct types of genes associated with neuronal differentiation, such as GAP-43, betaIII-tubulin, and NeuroD. In addition, our findings show that Nex1 up-regulates the expression of the mitotic inhibitor p21(WAF1), thus linking neuronal differentiation to cell cycle withdrawal. Finally, our studies show that overexpression of a Nex1 mutant has the ability to block the execution of NGF-induced differentiation program, suggesting that Nex1 may be an important effector of the NGF signaling pathway. PMID:11782967

Uittenbogaard, Martine; Chiaramello, Anne

2002-01-15

48

Anti-apoptotic effect of the basic helix-loop-helix (bHLH) transcription factor DEC2 in human breast cancer cells.  

PubMed

DEC1 (BHLHB2/Stra13/Sharp2) and DEC2 (BHLHB3/Sharp1) are basic helix-loop-helix (bHLH) transcription factors that are involved in circadian rhythms, differentiation and the responses to hypoxia. We examined whether DEC1 and DEC2 are involved in apoptosis regulation, in human breast cancer MCF-7 cells. We found that siRNA-mediated knockdown of DEC2 resulted in marked enhancement of apoptosis compared with that in control cells transfected with nonspecific siRNA. However, knockdown of DEC1 by siRNA did not affect cell survival. Knockdown of DEC2 affected the expression of mRNA or proteins related to apoptosis, such as Fas, c-Myc, caspase-8, poly (ADP-ribose) polymerase (PARP) and Bax. We also showed that tumor necrosis factor-alpha (TNF-alpha) up-regulates the expression of DEC1 and DEC2. DEC2 over-expression caused by the transfection of an expression vector reduced the amounts of cleaved PARP and caspase-8 induced by TNF-alpha treatment, whereas DEC1 over-expression increased it. Finally, we revealed that treatment with double knockdown against both DEC1 and DEC2 decreased the amounts of cleaved PARP and caspase-8 induced by DEC2 siRNA with or without TNF-alpha. These data indicate that DEC2 has an anti-apoptotic effect, whereas DEC1 has a pro-apoptotic effect, which are involved in the balance of survival of human breast cancer MCF-7 cells. PMID:20236182

Liu, Yang; Sato, Fuyuki; Kawamoto, Takeshi; Fujimoto, Katsumi; Morohashi, Satoko; Akasaka, Harue; Kondo, Jun; Wu, Yunyan; Noshiro, Mitsuhide; Kato, Yukio; Kijima, Hiroshi

2010-04-01

49

The basic helix-loop-helix protein upstream stimulating factor regulates the cardiac ventricular myosin light-chain 2 gene via independent cis regulatory elements.  

PubMed Central

Previous studies have documented that 250 bp of the rat cardiac ventricular myosin light-chain 2 (MLC-2v) promoter is sufficient to confer cardiac muscle-specific expression on a luciferase reporter gene in both transgenic mice and primary cultured neonatal rat myocardial cells. Utilizing ligation-mediated PCR to perform in vivo dimethyl sulfate footprinting, the present study has identified protein-DNA interaction within the position from -176 to -165. This region, identified as MLE1, contains a core sequence, CACGTG, which conforms to the consensus E-box site and is identical to the upstream stimulating factor (USF)-binding site of the adenovirus major late promoter. Transient assays of luciferase reporter genes containing point mutations of the site demonstrate the importance of this cis regulatory element in the transcriptional activation of this cardiac muscle gene in ventricular muscle cells. The protein complex that occupies this site is capable of binding to HF-1a and PRE B sites which are known to be required for cardiac muscle-specific expression of rat MLC-2v and alpha-myosin heavy-chain genes, respectively. This study provides direct evidence that USF, a member of the basic helix-loop-helix leucine zipper family, binds to MLE1, HF-1a, and PRE B sites and suggests that it is a component of protein complexes that may coordinately control the expression of MLC-2v and alpha-myosin heavy-chain genes. The current study also provides evidence that USF can positively and negatively regulate the MLC-2v gene via independent cis regulatory elements. Images PMID:7935447

Navankasattusas, S; Sawadogo, M; van Bilsen, M; Dang, C V; Chien, K R

1994-01-01

50

Identification of transactivation and repression functions of the dioxin receptor and its basic helix-loop-helix/PAS partner factor Arnt: inducible versus constitutive modes of regulation.  

PubMed Central

Gene regulation by dioxins is mediated via the dioxin receptor, a ligand-dependent basic helix-loop-helix (bHLH)/PAS transcription factor. The latent dioxin receptor responds to dioxin signalling by forming an activated heterodimeric complex with a specific bHLH partner, Arnt, an essential process for target DNA recognition. We have analyzed the transactivating potential within this heterodimeric complex by dissecting it into individual subunits, replacing the dimerization and DNA-binding bHLH motifs with heterologous zinc finger DNA-binding domains. The uncoupled Arnt chimera, maintaining 84% of Arnt residues, forms a potent and constitutive transcription factor. Chimeric proteins show that the dioxin receptor also harbors a strong transactivation domain in the C terminus, although this activity was silenced by inclusion of 82 amino acids from the central ligand-binding portion of the dioxin receptor. This central repression region conferred binding of the molecular chaperone hsp90 upon otherwise constitutive chimeras in vitro, indicating that hsp90 has the ability to mediate a cis-repressive function on distant transactivation domains. Importantly, when the ligand-binding domain of the dioxin receptor remained intact, the ability of this hsp90-binding activity to confer repression became conditional rather than irreversible. Our data are consistent with a model in which crucial activities of the dioxin receptor, such as dimerization with Arnt and transactivation, are conditionally repressed by the central ligand- and-hsp90-binding region of the receptor. In contrast, the Arnt protein appears to be free from any repressive activity. Moreover, within the context of the dioxin response element (xenobiotic response element), the C terminus of Arnt conferred a potent, dominating transactivation function onto the native bHLH heterodimeric complex. Finally, the relative transactivation potencies of the individual dioxin receptor and Arnt chimeras varied with cell type and promoter architecture, indicating that the mechanisms for transcriptional activation may differ between these two subunits and that in the native complex the transactivation pathway may be dependent upon cell-specific and promoter contexts. Images PMID:7969169

Whitelaw, M L; Gustafsson, J A; Poellinger, L

1994-01-01

51

The basic helix-loop-helix transcription factor Nex-1/Math-2 promotes neuronal survival of PC12 cells by modulating the dynamic expression of anti-apoptotic and cell cycle regulators.  

PubMed

The basic helix-loop-helix transcription factor Nex1/Math-2 belongs to the NeuroD subfamily, which plays a critical role during neuronal differentiation and maintenance of the differentiated state. Previously, we demonstrated that Nex1 is a key regulatory component of the nerve growth factor (NGF) pathway. Further supporting this hypothesis, this study shows that Nex1 has survival-inducing properties similar to NGF, as Nex1-overexpressing PC12 cells survive in the absence of trophic factors. We dissected the molecular mechanism by which Nex1 confers neuroprotection upon serum removal and found that constitutive expression of Nex1 maintained the expression of specific G1 phase cyclin-dependent kinase inhibitors and concomitantly induced a dynamic expression profile of key anti-apoptotic regulators. This study provides the first evidence of the underlying mechanism by which a member of the NeuroD-subfamily promotes an active anti-apoptotic program essential to the survival of neurons. Our results suggest that the survival program may be viewed as an integral component of the intrinsic programming of the differentiated state. PMID:15659228

Uittenbogaard, Martine; Chiaramello, Anne

2005-02-01

52

The basic helix-loop-helix transcription factor Nex-1/Math-2 promotes neuronal survival of PC12 cells by modulating the dynamic expression of anti-apoptotic and cell cycle regulators  

PubMed Central

The basic helix-loop-helix transcription factor Nex1/Math-2 belongs to the NeuroD subfamily, which plays a critical role during neuronal differentiation and maintenance of the differentiated state. Previously, we demonstrated that Nex1 is a key regulatory component of the nerve growth factor (NGF) pathway. Further supporting this hypothesis, this study shows that Nex1 has survival-inducing properties similar to NGF, as Nex1-overexpressing PC12 cells survive in the absence of trophic factors. We dissected the molecular mechanism by which Nex1 confers neuroprotection upon serum removal and found that constitutive expression of Nex1 maintained the expression of specific G1 phase cyclin-dependent kinase inhibitors and concomitantly induced a dynamic expression profile of key anti-apoptotic regulators. This study provides the first evidence of the underlying mechanism by which a member of the NeuroD-subfamily promotes an active anti-apoptotic program essential to the survival of neurons. Our results suggest that the survival program may be viewed as an integral component of the intrinsic programming of the differ entiated state. PMID:15659228

Uittenbogaard, Martine; Chiaramello, Anne

2006-01-01

53

The Neurogenic Basic Helix-Loop-Helix Transcription Factor NeuroD6 Enhances Mitochondrial Biogenesis and Bioenergetics to Confer Tolerance of Neuronal PC12-NeuroD6 Cells to the Mitochondrial Stressor Rotenone  

PubMed Central

The fundamental question of how and which neuronal specific transcription factors tailor mitochondrial bioenergetics to the need of developing neuronal cells has remained largely unexplored. In this study, we report that the neurogenic basic helix-loop-helix transcription factor NeuroD6 possesses mitochondrial biogenic properties by amplifying the mitochondrial DNA content and TFAM expression levels, a key regulator for mitochondrial biogenesis. NeuroD6-mediated increase in mitochondrial biogenesis in the neuronal progenitor-like PC12-NEUROD6 cells is concomitant with enhanced mitochondrial bioenergetic functions, including increased expression levels of specific subunits of respiratory complexes of the electron transport chain, elevated mitochondrial membrane potential and ATP levels produced by oxidative phosphorylation. Thus, NeuroD6 augments the bioenergetic capacity of PC12-NEUROD6 cells to generate an energetic reserve, which confers tolerance to the mitochondrial stressor, rotenone. We found that NeuroD6 induces an adaptive bioenergetic response throughout rotenone treatment involving maintenance of the mitochondrial membrane potential and ATP levels in conjunction with preservation of the actin network. In conclusion, our results support the concept that NeuroD6 plays an integrative role in regulating and coordinating the onset of neuronal differentiation with acquisition of adequate mitochondrial mass and energetic capacity to ensure energy demanding events, such as cytoskeletal remodeling, plasmalemmal expansion, and growth cone formation. PMID:22814253

Baxter, Kristin Kathleen; Uittenbogaard, Martine; Chiaramello, Anne

2012-01-01

54

PH4 of Petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic-helix-loop-helix transcription factors of the anthocyanin pathway.  

PubMed

The Petunia hybrida genes ANTHOCYANIN1 (AN1) and AN2 encode transcription factors with a basic-helix-loop-helix (BHLH) and a MYB domain, respectively, that are required for anthocyanin synthesis and acidification of the vacuole in petal cells. Mutation of PH4 results in a bluer flower color, increased pH of petal extracts, and, in certain genetic backgrounds, the disappearance of anthocyanins and fading of the flower color. PH4 encodes a MYB domain protein that is expressed in the petal epidermis and that can interact, like AN2, with AN1 and the related BHLH protein JAF13 in yeast two-hybrid assays. Mutation of PH4 has little or no effect on the expression of structural anthocyanin genes but strongly downregulates the expression of CAC16.5, encoding a protease-like protein of unknown biological function. Constitutive expression of PH4 and AN1 in transgenic plants is sufficient to activate CAC16.5 ectopically. Together with the previous finding that AN1 domains required for anthocyanin synthesis and vacuolar acidification can be partially separated, this suggests that AN1 activates different pathways through interactions with distinct MYB proteins. PMID:16603655

Quattrocchio, Francesca; Verweij, Walter; Kroon, Arthur; Spelt, Cornelis; Mol, Joseph; Koes, Ronald

2006-05-01

55

The WRPW motif of the hairy-related basic helix-loop-helix repressor proteins acts as a 4-amino-acid transcription repression and protein-protein interaction domain.  

PubMed Central

Hairy-related proteins include the Drosophila Hairy and Enhancer of Split proteins and mammalian Hes proteins. These proteins are basic helix-loop-helix (bHLH) transcriptional repressors that control cell fate decisions such as neurogenesis or myogenesis in both Drosophila melanogaster and mammals. Hairy-related proteins are site-specific DNA-binding proteins defined by the presence of both a repressor-specific bHLH DNA binding domain and a carboxyl-terminal WRPW (Trp-Arg-Pro-Trp) motif. These proteins act as repressors by binding to DNA sites in target gene promoters and not by interfering with activator proteins, indicating that these proteins are active repressors which should therefore have specific repression domains. Here we show the WRPW motif to be a functional transcriptional repression domain sufficient to confer active repression to Hairy-related proteins or a heterologous DNA-binding protein, Ga14. This motif was previously shown to be necessary for interactions with Groucho, a genetically defined corepressor for Drosophila Hairy-related proteins. Here we show that the WRPW motif is sufficient to recruit Groucho or the TLE mammalian homologs to target gene promoters. We also show that Groucho and TLE proteins actively repress transcription when directly bound to a target gene promoter and identify a novel, highly conserved transcriptional repression domain in these proteins. These results directly demonstrate that Groucho family proteins are active transcriptional corepressors for Hairy-related proteins and are recruited by the 4-amino acid protein-protein interaction domain, WRPW. PMID:8649374

Fisher, A L; Ohsako, S; Caudy, M

1996-01-01

56

A Basic Helix-Loop-Helix Transcription Factor, PtrbHLH, of Poncirus trifoliata Confers Cold Tolerance and Modulates Peroxidase-Mediated Scavenging of Hydrogen Peroxide1[C][W  

PubMed Central

The basic helix-loop-helix (bHLH) transcription factors are involved in a variety of physiological processes. However, plant bHLHs functioning in cold tolerance and the underlying mechanisms remain poorly understood. Here, we report the identification and functional characterization of PtrbHLH isolated from trifoliate orange (Poncirus trifoliata). The transcript levels of PtrbHLH were up-regulated under various abiotic stresses, particularly cold. PtrbHLH was localized in the nucleus with transactivation activity. Overexpression of PtrbHLH in tobacco (Nicotiana tabacum) or lemon (Citrus limon) conferred enhanced tolerance to cold under chilling or freezing temperatures, whereas down-regulation of PtrbHLH in trifoliate orange by RNA interference (RNAi) resulted in elevated cold sensitivity. A range of stress-responsive genes was up-regulated or down-regulated in the transgenic lemon. Of special note, several peroxidase (POD) genes were induced after cold treatment. Compared with the wild type, POD activity was increased in the overexpression plants but decreased in the RNAi plants, which was inversely correlated with the hydrogen peroxide (H2O2) levels in the tested lines. Treatment of the transgenic tobacco plants with POD inhibitors elevated the H2O2 levels and greatly compromised their cold tolerance, while exogenous replenishment of POD enhanced cold tolerance of the RNAi line. In addition, transgenic tobacco and lemon plants were more tolerant to oxidative stresses. Yeast one-hybrid assay and transient expression analysis demonstrated that PtrbHLH could bind to the E-box elements in the promoter region of a POD gene. Taken together, these results demonstrate that PtrbHLH plays an important role in cold tolerance, at least in part, by positively regulating POD-mediated reactive oxygen species removal. PMID:23624854

Huang, Xiao-San; Wang, Wei; Zhang, Qian; Liu, Ji-Hong

2013-01-01

57

The neurogenic basic helix-loop-helix transcription factor NeuroD6 enhances mitochondrial biogenesis and bioenergetics to confer tolerance of neuronal PC12-NeuroD6 cells to the mitochondrial stressor rotenone  

SciTech Connect

The fundamental question of how and which neuronal specific transcription factors tailor mitochondrial biogenesis and bioenergetics to the need of developing neuronal cells has remained largely unexplored. In this study, we report that the neurogenic basic helix-loop-helix transcription factor NeuroD6 possesses mitochondrial biogenic properties by amplifying the mitochondrial DNA content and TFAM expression levels, a key regulator for mitochondrial biogenesis. NeuroD6-mediated increase in mitochondrial biogenesis in the neuronal progenitor-like PC12-NEUROD6 cells is concomitant with enhanced mitochondrial bioenergetic functions, including increased expression levels of specific subunits of respiratory complexes of the electron transport chain, elevated mitochondrial membrane potential and ATP levels produced by oxidative phosphorylation. Thus, NeuroD6 augments the bioenergetic capacity of PC12-NEUROD6 cells to generate an energetic reserve, which confers tolerance to the mitochondrial stressor, rotenone. We found that NeuroD6 induces an adaptive bioenergetic response throughout rotenone treatment involving maintenance of the mitochondrial membrane potential and ATP levels in conjunction with preservation of the actin network. In conclusion, our results support the concept that NeuroD6 plays an integrative role in regulating and coordinating the onset of neuronal differentiation with acquisition of adequate mitochondrial mass and energetic capacity to ensure energy demanding events, such as cytoskeletal remodeling, plasmalemmal expansion, and growth cone formation. -- Highlights: Black-Right-Pointing-Pointer NeuroD6 induces mitochondrial biogenesis in neuroprogenitor-like cells. Black-Right-Pointing-Pointer NeuroD6 augments the bioenergetic reserve of the neuronal PC12-NeuroD6 cells. Black-Right-Pointing-Pointer NeuroD6 increases the mitochondrial membrane potential and ATP levels. Black-Right-Pointing-Pointer NeuroD6 confers tolerance to rotenone via an adaptive mitochondrial response.

Baxter, Kristin Kathleen; Uittenbogaard, Martine [Department of Anatomy and Regenerative Biology, George Washington University Medical Center, Washington, DC (United States)] [Department of Anatomy and Regenerative Biology, George Washington University Medical Center, Washington, DC (United States); Chiaramello, Anne, E-mail: achiaram@gwu.edu [Department of Anatomy and Regenerative Biology, George Washington University Medical Center, Washington, DC (United States)] [Department of Anatomy and Regenerative Biology, George Washington University Medical Center, Washington, DC (United States)

2012-10-15

58

Antagonistic Regulation of Growth and Immunity by the Arabidopsis Basic Helix-Loop-Helix Transcription Factor HOMOLOG OF BRASSINOSTEROID ENHANCED EXPRESSION2 INTERACTING WITH INCREASED LEAF INCLINATION1 BINDING bHLH11[W][OPEN  

PubMed Central

Plants need to finely balance resources allocated to growth and immunity to achieve optimal fitness. A tradeoff between pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and brassinosteroid (BR)-mediated growth was recently reported, but more information about the underlying mechanisms is needed. Here, we identify the basic helix-loop-helix (bHLH) transcription factor HOMOLOG OF BRASSINOSTEROID ENHANCED EXPRESSION2 INTERACTING WITH IBH1 (HBI1) as a negative regulator of PTI signaling in Arabidopsis (Arabidopsis thaliana). HBI1 expression is down-regulated in response to different PAMPs. HBI1 overexpression leads to reduced PAMP-triggered responses. This inhibition correlates with reduced steady-state expression of immune marker genes, leading to increased susceptibility to the bacterium Pseudomonas syringae. Overexpression of the HBI1-related bHLHs BRASSINOSTEROID ENHANCED EXPRESSION2 (BEE2) and CRYPTOCHROME-INTERACTING bHLH (CIB1) partially inhibits immunity, indicating that BEE2 and CIB1 may act redundantly with HBI1. In contrast to its expression pattern upon PAMP treatment, HBI1 expression is enhanced by BR treatment. Also, HBI1-overexpressing plants are hyperresponsive to BR and more resistant to the BR biosynthetic inhibitor brassinazole. HBI1 is nucleus localized, and a mutation in a conserved leucine residue within the first helix of the protein interaction domain impairs its function in BR signaling. Interestingly, HBI1 interacts with several inhibitory atypical bHLHs, which likely keep HBI1 under negative control. Hence, HBI1 is a positive regulator of BR-triggered responses, and the negative effect of PTI is likely due to the antagonism between BR and PTI signaling. This study identifies a novel component involved in the complex tradeoff between innate immunity and BR-regulated growth. PMID:24443525

Malinovsky, Frederikke Gro; Batoux, Martine; Schwessinger, Benjamin; Youn, Ji Hyun; Stransfeld, Lena; Win, Joe; Kim, Seong-Ki; Zipfel, Cyril

2014-01-01

59

A Novel Molecular Recognition Motif Necessary for Targeting Photoactivated Phytochrom eS ignaling to Specif ic Basic Helix-Loop-Helix Transcription Factors  

Microsoft Academic Search

The phytochrome (phy) family of sensory photoreceptors (phyA to phyE) in Arabidopsis thaliana control plant developmental transitions in response to informational light signals throughout the life cycle. The photoactivated conformer of the photo- receptor Pfr has been shown to translocate into the nucleus where it induces changes in gene expression by an unknown mechanism. Here, we have identified two basic

Rajnish Khanna; Enamul Huq; Elise A. Kikis; Bassem Al-Sady; Christina Lanzatella; Peter H. Quaila

60

Evolutionary aspects of developmentally regulated helix-loop-helix transcription factors in striated muscle of jellyfish  

Microsoft Academic Search

The function of basic helix-loop-helix (bHLH) proteins in cell differentiation was shown to be conserved from Drosophila to vertebrates, exemplified by the function of MyoD in striated muscle differentiation. In phylogeny striated muscle tissue appears first in jellyfish and the question of its evolutionary position is controversially discussed. For this reason we have studied the developmental role of myogenic bHLH

Peter Müller; Katja Seipel; Nathalie Yanze; Susanne Reber-Müller; Ruth Streitwolf-Engel; Michael Stierwald; J. ürg Spring; Volker Schmid

2003-01-01

61

Myocardial activation of the human cardiac alpha-actin promoter by helix-loop-helix proteins.  

PubMed Central

The cardiac alpha-actin gene is expressed in both heart and skeletal muscle. In skeletal myogenic cells, the 177-base-pair promoter of the human cardiac alpha-actin (HCA) gene requires three transcription factors for activation: Sp1, serum response factor (SRF), and MyoD. However, MyoD is undetectable in heart. To search for a functional equivalent of MyoD, we analyzed the transcriptional regulation of the HCA promoter in primary cultures of rat cardiac myocytes. The same DNA sequence elements recognized by SRF, Sp1, and MyoD and required for HCA transcription in skeletal muscle cells were also found to be necessary for expression in cardiomyocytes. Overexpression of Id, a negative regulator of basic helix-loop-helix proteins, selectively attenuated expression of the HCA promoter. Cardiomyocyte nuclei contain a protein complex that specifically interacts with the same required sequence (E box) in the HCA promoter that is bound by MyoD in skeletal myogenic cells. Furthermore, these complexes contain a peptide that is a member of the E2A family of basic helix-loop-helix proteins. Cardiomyocyte nuclei appear to be enriched for a protein that can bind to the E-box site as dimers with the E12 protein. These results suggest that a member of the basic helix-loop-helix family, together with SRF and Sp1, activates the HCA promoter in heart. Alternative strategies for myocardial transcription of HCA are discussed. Images PMID:1570331

Sartorelli, V; Hong, N A; Bishopric, N H; Kedes, L

1992-01-01

62

A helix-loop-helix protein related to the immunoglobulin E box-binding proteins.  

PubMed Central

A human cDNA encoding a novel protein in the helix-loop-helix family has been isolated by screening a bacteriophage expression library with a probe containing the binding site for major late transcription factor. The protein encoded by this cDNA, TFEB, probably recognizes E-box sequences in the heavy-chain immunoglobulin enhancer. Images PMID:2115126

Carr, C S; Sharp, P A

1990-01-01

63

Evolutionary aspects of developmentally regulated helix-loop-helix transcription factors in striated muscle of jellyfish.  

PubMed

The function of basic helix-loop-helix (bHLH) proteins in cell differentiation was shown to be conserved from Drosophila to vertebrates, exemplified by the function of MyoD in striated muscle differentiation. In phylogeny striated muscle tissue appears first in jellyfish and the question of its evolutionary position is controversially discussed. For this reason we have studied the developmental role of myogenic bHLH genes in medusa development. Based on their dimerization ability, four genes of the bHLH family of transcription factors were isolated from the hydrozoan jellyfish Podocoryne carnea. While the proteins Id and Ash group with cognate family members from bilaterians, Net-like and JellyD1 could not be unequivocally classified. Id is expressed during the medusa budding process and in the adult medusa, Ash and Net-like are expressed in all life cycle stages from egg to adult medusa and JellyD1 is expressed in the blastula and gastrula stages, the planula larva, and in late medusa bud stages. The dimerization specificity, the expression pattern, and the conservation of two residues specific for a MyoD bHLH domain suggest that JellyD1 is related to an ancestral MyoD gene. Id, Net-like, and JellyD1 are either expressed in the entocodon or its derived tissues, the striated and smooth muscle of the bell. These findings strengthen the hypothesis that the entocodon is a mesoderm-like structure and that the common ancestor of Cnidaria and Bilateria was more complex in cell-type architecture and body organization than commonly thought. PMID:12648485

Müller, Peter; Seipel, Katja; Yanze, Nathalie; Reber-Müller, Susanne; Streitwolf-Engel, Ruth; Stierwald, Michael; Spring, Jürg; Schmid, Volker

2003-03-15

64

Antiproliferative properties of the USF family of helix-loop-helix transcription factors.  

PubMed Central

USF is a family of transcription factors characterized by a highly conserved basic-helix-loop-helix-leucine zipper (bHLH-zip) DNA-binding domain. Two different USF genes, termed USF1 and USF2, are ubiquitously expressed in both humans and mice. The USF1 and USF2 proteins contain highly divergent transcriptional activation domains but share extensive homologies in the bHLH-zip region and recognize the same CACGTG DNA motifs. Although the DNA-binding and transcriptional activities of these proteins have been characterized, the biological function of USF is not well understood. Here, focus- and colony-formation assays were used to investigate the potential involvement of USF in the regulation of cellular transformation and proliferation. Both USF1 and USF2 inhibited the transformation of rat embryo fibroblasts mediated by Ras and c-Myc, a bHLH-zip transcription factor that also binds CACGTG motifs. DNA binding was required but not fully sufficient for inhibition of Myc-dependent transformation by USF, since deletion mutants containing only the DNA-binding domains of USF1 or USF2 produced partial inhibition. While the effect of USF1 was selective for Myc-dependent transformation, wild-type USF2 exerted in addition a strong inhibition of E1A-mediated transformation and a strong suppression of HeLa cell colony formation. These results suggest that members of the USF family may serve as negative regulators of cellular proliferation in two ways, one by antagonizing the transforming function of Myc, the other through a more general growth-inhibitory effect. Images Fig. 1 Fig. 2 PMID:8577760

Luo, X; Sawadogo, M

1996-01-01

65

CHUK, a Conserved Helix-Loop-Helix Ubiquitous Kinase, Maps to Human Chromosome 10 and Mouse Chromosome 19  

Microsoft Academic Search

Helix-loop-helix proteins contain stretches of DNA that encode two amphipathic ?-helices joined by a loop structure and are involved in protein dimerization and transcriptional regulation essential to a variety of cellular processes. CHUK, a newly described conserved helix-loop-helix ubiquitos kinase, was mapped by somatic cell hybrid analyses to human Chr 10q24-q25. Chuk and a related sequence, Chuk-rs1, were mapped to

Beverly A. Mock; Margery A. Connelly; O. Wesley McBride; Christine A. Kozak; Kenneth B. Marcu

1995-01-01

66

BuD, a helix–loop–helix DNA-binding domain for genome modification  

PubMed Central

DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19?bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin ? (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing. PMID:25004980

Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo

2014-01-01

67

Leptin signaling regulates hypothalamic expression of nescient helix-loop-helix 2 (Nhlh2) through signal transducer and activator 3 (Stat3).  

PubMed

Mice with a deletion of the hypothalamic basic helix-loop-helix transcription factor Nhlh2 display adult onset obesity. We have previously shown that Nhlh2 expression is induced by leptin. In this study, we identify a small proximal leptin-responsive promoter region in the Nhlh2 gene. This 163bp promoter contains five putative binding sites for the leptin-activated Stat3 transcription factor, and two putative binding sites for the NF?B transcription factor. Results of mutagenesis studies reveal that deletion of the NF?B sites have little effect, mutagenesis of the third Stat3 site eliminates both leptin-induced and basal expression of Nhlh2. Mutagenesis of the 4th and 5th sites eliminates leptin-induced expression, and increases basal expression above the WT promoter. Stat3 can be preferentially pulled down from leptin-treated mouse hypothalamic chromatin extracts. This study identifies leptin-induced Stat3 transcription factor as the major transcriptional regulator of Nhlh2. As Nhlh2 transcriptionally regulates genes within the melanocortin pathway, these findings have implications for human body weight control. PMID:24486192

Al Rayyan, Numan; Zhang, Jinhua; Burnside, Amy S; Good, Deborah J

2014-03-25

68

Leptin Signaling Regulates Hypothalamic Expression of Nescient helix-loop-helix 2 (Nhlh2) Through Signal Transducer and Activator 3 (Stat3)  

PubMed Central

Mice with a deletion of the hypothalamic basic helix-loop-helix transcription factor Nhlh2 display adult onset obesity. We have previously shown that Nhlh2 expression is induced by leptin. In this study, we identify a small proximal leptin-responsive promoter region in the Nhlh2 gene. This 163 bp promoter contains five putative binding sites for the leptin-activated Stat3 transcription factor, and two putative binding sites for the NF?B transcription factor. Results of mutagenesis studies reveal that deletion of the NF?B sites have little effect, mutagenesis of the third Stat3 site eliminates both leptin-induced and basal expression of Nhlh2. Mutagenesis of the 4th and 5th sites eliminates leptin-induced expression, and increases basal expression above the WT promoter. Stat3 can be preferentially pulled down from leptin-treated mouse hypothalamic chromatin extracts. This study identifies leptin-induced Stat3 transcription factor as the major transcriptional regulator of Nhlh2. As Nhlh2 transcriptionally regulates genes within the melanocortin pathway, these findings have implications for human body weight control. PMID:24486192

Rayyan, Numan AL; Zhang, Jinhua; Burnside, Amy S.; Good, Deborah J.

2014-01-01

69

The basic helix-loop-helix transcription factor family in the sacred lotus, Nelumbo nucifera  

Technology Transfer Automated Retrieval System (TEKTRAN)

Nelumbo nucifera (Sacred Lotus) is a basal eudicot with exceptional physiological and metabolic properties including seed longevity, adaptations for an aquatic habit, and floral thermiogenesis. It also occupies a unique position in the phylogeny of land plants and can be a useful species for studies...

70

The basic helix-loop-helix transcription factor scleraxis regulates fibroblast collagen synthesis.  

PubMed

The transcription factor scleraxis has been implicated in regulating the development of collagen-rich tissues such as tendons and cardiac valves, but its role in general collagen synthesis in the heart is unknown. Scleraxis expression in cardiac fibroblasts was examined, and its ability to regulate gene expression of collagen I alpha 2, the predominant cardiac collagen isoform, was assayed. Using real-time PCR, we demonstrate here that scleraxis mRNA is up-regulated by the profibrotic agonist TGF-beta(1) in rat cardiac myofibroblasts, and that phenoconversion of fibroblasts to myofibroblasts similarly increases scleraxis expression. Over-expression of scleraxis in NIH-3T3 or primary rat cardiac fibroblasts by adenoviral gene delivery is sufficient to significantly increase collagen I alpha 2 gene expression. Using luciferase reporter assays, we demonstrate that scleraxis transactivates the human collagen I alpha 2 promoter in a DNA- and protein-binding dependent manner. Intriguingly, examination of infarcted rat hearts reveals a nearly four-fold increase in scleraxis expression in the infarct scar, but not in non-infarcted tissue. These data support a novel and previously unknown role for scleraxis in the regulation of collagen gene expression in the heart, including in post-infarct scar formation. PMID:19362560

Espira, Leon; Lamoureux, Lise; Jones, Stephen C; Gerard, Robert D; Dixon, Ian M C; Czubryt, Michael P

2009-08-01

71

Molecular cloning and chromosomal localization of the murine homolog of the human helix-loop-helix gene SCL  

SciTech Connect

The human SCL gene is a member of the family of genes that encode the helix-loop-helix (HLH) class of DNA-binding proteins. A murine SCL cDNA was isolated from a normal macrophage cDNA library by using HLH-specific oligonucleotides as hybridiazation probes. The coding region is 987 base pairs and encodes a predicted protein of 34 kDa. The nucleotide sequence of the coding region shows 88% identity to the human SCL gene, and the amino acid sequence is 94% identical. The LHL motif and upstream hydrophilic region are entirely conserved in the murine and human proteins. The identity between the mouse and human sequences was less marked in the 5{prime} and 3{prime} untranslated regions. Two murine SCL transcripts that differ in the 3{prime} noncoding region have been detected in fetal liver and various cell lines. Variation was also observed in the 5{prime} untranslated region. Interestingly, immediately downstream of the protein-termination codon, both the human SCL sequence and the murine homolog share an E-box element - the suggested target site for DNA binding of HLH proteins. The murine SCL homolog was mapped to the central part of chromosome 4.

Begley, C.G.; Visvader, J.; Green, A.R.; Metcalf, D.; Gough, N.M. (Royal Melbourne Hospital, Victoria (Australia)); Aplan, P.D.; Kirsch, I.R. (National Cancer Inst., Bethesda, MD (United States))

1991-02-01

72

Helix-Loop-Helix Factor Inhibitor of Differentiation 3 Regulates Interleukin-5 Expression and B-1a B Cell Proliferation  

PubMed Central

Objective Natural immunity is emerging as an important mediator of protection from atherogenesis. Natural IgM antibodies that recognize oxidation-specific epitopes on low-density lipoprotein or phospholipids and the B-1a B cells that produce them attenuate atherosclerosis. We previously demonstrated that Apoe?/? mice globally deficient in the helix-loop-helix protein inhibitor of differentiation 3 (Id3) develop early diet-induced atherosclerosis. Furthermore, B cell–mediated attenuation of atherosclerosis in B cell–deficient mice was dependent on Id3. Here, we sought to determine whether Id3 regulates B-1a B cells and the natural antibodies that they produce and identify mechanisms mediating these effects. Approach and Results Mice lacking Id3 had significantly fewer B-1a B cells in the spleen and peritoneal cavity and reduced serum levels of the natural antibody E06. B cell–specific deletion of Id3 revealed that this effect was not because of the loss of Id3 in B cells. Interleukin (IL)-33 induced abundant, Id3-dependent IL-5 production in the recently identified innate lymphoid cell, the natural helper (NH) cell, but not Th2 or mast cells. In addition, delivery of IL-5 to Id3-deficient mice restored B-1a B cell proliferation. B-1a B cells were present in aortic samples also containing NH cells. Aortic NH cells produced IL-5, a B-1a B cell mitogen in response to IL-33 stimulation. Conclusions These studies are the first to identify NH and B-1a B cells in the aorta and provide evidence that Id3 is a key regulator of NH cell IL-5 production and B-1a B cell homeostasis. PMID:24115031

Perry, Heather M.; Oldham, Stephanie N.; Fahl, Shawn P.; Que, Xuchu; Gonen, Ayelet; Harmon, Daniel B.; Tsimikas, Sotirios; Witztum, Joseph L.; Bender, Timothy P.; McNamara, Coleen A.

2014-01-01

73

Cell-specific helix-loop-helix factor required for pituitary expression of the pro-opiomelanocortin gene.  

PubMed Central

Pro-opiomelanocortin (POMC)-expressing cells appear to be the first pituitary cells committed to hormone production. In this work, we have identified an element of the POMC promoter which confers cell-specific activity. This element did not exhibit any activity on its own and required at least one other element of the promoter to manifest its cell-specific activity. Fine mutagenesis of this element indicated that a CANNTG motif is responsible for activity. This E-box motif is typical of binding sites for helix-loop-helix (HLH) transcription factors; however, the POMC cell-specific E box cannot be replaced by other E boxes like the kappa E2 site of the immunoglobulin gene or a muscle-specific E box. Similar E boxes which are present in the insulin gene promoter were shown to contribute to the pancreatic specificity of the insulin promoter. However, E-box-binding proteins found in nuclear extracts from POMC-expressing AtT-20 cells and from insulin-expressing cells have different electrophoretic mobilities. The AtT-20 proteins were named CUTE (for corticotroph upstream transcription element-binding) proteins, and they were not found in any other cells. CUTE proteins have DNA-binding properties characteristic of HLH transcription factors. Overexpression of the dominant negative HLH protein Id or of the ubiquitous positive HLH factor rat Pan-2 decreased or augmented POMC promoter activity, respectively. These observations are consistent with the hypothesis that CUTE factors might be heterodimers. This hypothesis was further supported by antibody shift experiments and by abrogation of DNA binding in the presence of bacterially expressed Id protein. Thus, the cell-specific CUTE proteins and their binding site in the POMC promoter appear to be important determinants for cell specificity of this promoter. The requirement for HLH factors in POMC transcription also presents the possibility that these factors are involved in differentiation of pituitary cells, in analogy with the role of HLH factors in muscle development. Images PMID:8455616

Therrien, M; Drouin, J

1993-01-01

74

A NOVEL MOLECULAR RECOGNITION MOTIF NECESSARY FOR TARGETING PHOTOACTIVATED PHYTOCHROME SIGNALING TO SPECIFIC BASIC HELIX-LOOP-HELIX TRANSCRIPTION FACTORS  

Technology Transfer Automated Retrieval System (TEKTRAN)

The phytochrome (phy) family of sensory photoreceptors (phyA to phyE) in Arabidopsis thaliana control plant developmental transitions in response to informational light signals throughout the life cycle. The photoactivated conformer of the photoreceptor Pfr has been shown to translocate into the nuc...

75

Anthocyanin1 of petunia encodes a basic helix-loop-helix protein that directly activates transcription of structural anthocyanin genes  

Microsoft Academic Search

The petunia loci anthocyanin1 ( an1 ), an2 , an4 , and an11 are required for the transcription of anthocyanin biosynthetic genes in floral organs. The an2 and an11 loci were recently cloned and shown to encode a MYB-domain transcriptional activator and a cytosolic WD40 protein, respectively. Here, we report the isolation of an1 by transposon tagging. an1 encodes a

Cornelis Spelt; Francesca Quattrocchio; Joseph N. M. Mol; Ronald Koes

2000-01-01

76

A Divalent Ion Is Crucial in the Structure and Dominant-Negative Function of ID Proteins, a Class of Helix-Loop-Helix Transcription Regulators  

PubMed Central

Inhibitors of DNA binding and differentiation (ID) proteins, a dominant-negative group of helix-loop-helix (HLH) transcription regulators, are well-characterized key players in cellular fate determination during development in mammals as well as Drosophila. Although not oncogenes themselves, their upregulation by various oncogenic proteins (such as Ras, Myc) and their inhibitory effects on cell cycle proteins (such as pRb) hint at their possible roles in tumorigenesis. Furthermore, their potency as inhibitors of cellular differentiation, through their heterodimerization with subsequent inactivation of the ubiquitous E proteins, suggest possible novel roles in engineering induced pluripotent stem cells (iPSCs). We present the high-resolution 2.1Å crystal structure of ID2 (HLH domain), coupled with novel biochemical insights in the presence of a divalent ion, possibly calcium (Ca2+), in the loop of ID proteins, which appear to be crucial for the structure and activity of ID proteins. These new insights will pave the way for new rational drug designs, in addition to current synthetic peptide options, against this potent player in tumorigenesis as well as more efficient ways for stem cells reprogramming. PMID:23119064

Palasingam, Paaventhan; Kolatkar, Prasanna R.

2012-01-01

77

In vivo characterization of the Saccharomyces cerevisiae centromere DNA element I, a binding site for the helix-loop-helix protein CPF1.  

PubMed Central

The centromere DNA element I (CDEI) is an important component of Saccharomyces cerevisiae centromere DNA and carries the palindromic sequence CACRTG (R = purine) as a characteristic feature. In vivo, CDEI is bound by the helix-loop-helix protein CPF1. This article describes the in vivo analysis of all single-base-pair substitutions in CDEI in the centromere of an artificial chromosome and demonstrates the importance of the palindromic sequence for faithful chromosome segregation, supporting the notion that CPF1 binds as a dimer to this binding site. Mutational analysis of two conserved base pairs on the left and two nonconserved base pairs on the right of the CDEI palindrome revealed that these are also relevant for mitotic CEN function. Symmetrical mutations in either half-site of the palindrome affect centromere activity to a different extent, indicating nonidentical sequence requirements for binding by the CPF1 homodimer. Analysis of double point mutations in CDEI and in CDEIII, an additional centromere element, indicate synergistic effects between the DNA-protein complexes at these sites. Images PMID:2046668

Niedenthal, R; Stoll, R; Hegemann, J H

1991-01-01

78

Identification of a DNA sequence involved in osteoblast-specific gene expression via interaction with helix-loop-helix (HLH)-type transcription factors  

PubMed Central

To elucidate regulatory mechanism(s) underlying differentiation of osteoblasts, we examined involvement of helix-loop-helix (HLH)-type transcription factors in osteoblast-specific expression of a phenotypic marker gene which encodes osteocalcin, a major noncollagenous bone matrix protein, exclusively expressed in osteoblasts. Overexpression of a dominant negative HLH protein, Id-1, decreased the activity of the 1.1-kb osteocalcin gene promoter cotransfected into rat osteoblastic osteosarcoma ROS17/2.8 cells. Analysis of deletion mutants revealed that a 264-bp fragment of osteocalcin promoter (-198 to +66) was sufficient for the Id-1-dependent suppression. Furthermore, the activity of the same promoter fragment (-198 to +66) was enhanced when antisense Id-1 expression vector was cotransfected. This osteocalcin gene promoter region contains two sites of an E-box motif, a consensus binding site for HLH proteins, which we refer to as OCE1 (CACATG, at - 102) and OCE2 (CAGCTG, at -149), respectively. Mutagenesis in OCE1 but not OCE2 led to greater than 50% reduction in transcriptional activity of the osteocalcin gene promoter. Electrophoresis mobility shift assay indicated that factors in nuclear extracts prepared from ROS17/2.8 cells bound to the 30-bp oligonucleotide probe containing the E-box motif of OCE1. This binding was competed out by OCE1 oligonucleotide but neither by OCmE1 oligonucleotide in which E-box motif was mutated nor by OCE2. The OCE1-binding activity in the nuclear extracts of ROS17/2.8 cells was reduced by 70% when bacterially expressed Id-1 protein was added to the reaction mixture, suggesting the involvement of HLH proteins in the DNA/protein complex formation. In contrast to the osteoblast-like cells, OCE1-binding activity in the nuclear extracts of C3H10T1/2 fibroblasts was very low. However, when these fibroblasts were treated with recombinant human bone morphogenetic protein-2 which induced expression of osteocalcin as well as other phenotypic markers of osteoblasts, OCE1-binding activity was increased approximately 40-fold, indicating that OCE1 would be involved in the tissue-specific expression of the osteocalcin gene. These findings indicated for the first time that osteoblast-specific gene transcription is regulated via the interaction between certain E-box binding transcription factor(s) in osteoblasts and the OCE1 sequence in the promoter region of the osteocalcin gene. PMID:8045940

1994-01-01

79

Sumoylation of the basic helix-loop-helix transcription factor sharp-1 regulates recruitment of the histone methyltransferase G9a and function in myogenesis.  

PubMed

Sumoylation is an important post-translational modification that alters the activity of many transcription factors. However, the mechanisms that link sumoylation to alterations in chromatin structure, which culminate in tissue specific gene expression, are not fully understood. In this study, we demonstrate that SUMO modification of the transcription factor Sharp-1 is required for its full transcriptional repression activity and function as an inhibitor of skeletal muscle differentiation. Sharp-1 is modified by sumoylation at two conserved lysine residues 240 and 255. Mutation of these SUMO acceptor sites in Sharp-1 does not impact its subcellular localization but attenuates its ability to act as a transcriptional repressor and inhibit myogenic differentiation. Consistently, co-expression of the SUMO protease SENP1 with wild type Sharp-1 abrogates Sharp-1-dependent inhibition of myogenesis. Interestingly, sumoylation acts as a signal for recruitment of the co-repressor G9a. Thus, enrichment of G9a, and histone H3 lysine 9 dimethylation (H3K9me2), a signature of G9a activity, is dramatically reduced at muscle promoters in cells expressing sumoylation-defective Sharp-1. Our findings demonstrate how sumoylation of Sharp-1 exerts an impact on chromatin structure and transcriptional repression of muscle gene expression through recruitment of G9a. PMID:23637228

Wang, Yaju; Shankar, Shilpa Rani; Kher, Devaki; Ling, Belinda Mei Tze; Taneja, Reshma

2013-06-14

80

Sumoylation of the Basic Helix-Loop-Helix Transcription Factor Sharp-1 Regulates Recruitment of the Histone Methyltransferase G9a and Function in Myogenesis*  

PubMed Central

Sumoylation is an important post-translational modification that alters the activity of many transcription factors. However, the mechanisms that link sumoylation to alterations in chromatin structure, which culminate in tissue specific gene expression, are not fully understood. In this study, we demonstrate that SUMO modification of the transcription factor Sharp-1 is required for its full transcriptional repression activity and function as an inhibitor of skeletal muscle differentiation. Sharp-1 is modified by sumoylation at two conserved lysine residues 240 and 255. Mutation of these SUMO acceptor sites in Sharp-1 does not impact its subcellular localization but attenuates its ability to act as a transcriptional repressor and inhibit myogenic differentiation. Consistently, co-expression of the SUMO protease SENP1 with wild type Sharp-1 abrogates Sharp-1-dependent inhibition of myogenesis. Interestingly, sumoylation acts as a signal for recruitment of the co-repressor G9a. Thus, enrichment of G9a, and histone H3 lysine 9 dimethylation (H3K9me2), a signature of G9a activity, is dramatically reduced at muscle promoters in cells expressing sumoylation-defective Sharp-1. Our findings demonstrate how sumoylation of Sharp-1 exerts an impact on chromatin structure and transcriptional repression of muscle gene expression through recruitment of G9a. PMID:23637228

Wang, Yaju; Shankar, Shilpa Rani; Kher, Devaki; Ling, Belinda Mei Tze; Taneja, Reshma

2013-01-01

81

High AN1 variability and interaction with basic helix-loop-helix co-factors related to anthocyanin biosynthesis in potato leaves.  

PubMed

AN1 is a regulatory gene that promotes anthocyanin biosynthesis in potato tubers and encodes a R2R3 MYB transcription factor. However, no clear evidence implicates AN1 in anthocyanin production in leaves, where these pigments might enhance environmental stress tolerance. In our study we found that AN1 displays intraspecific sequence variability in both coding/non-coding regions and in the promoter, and that its expression is associated with high anthocyanin content in leaves of commercial potatoes. Expression analysis provided evidence that leaf pigmentation is associated to AN1 expression and that StJAF13 acts as putative AN1 co-regulator for anthocyanin gene expression in leaves of the red leaf variety 'Magenta Love,' while a concomitant expression of StbHLH1 may contribute to anthocyanin accumulation in leaves of 'Double Fun.' Yeast two-hybrid experiments confirmed that AN1 interacts with StbHLH1 and StJAF13 and the latter interaction was verified and localized in the cell nucleus by bimolecular fluorescence complementation assays. In addition, transgenic tobacco (Nicotiana tabacum) overexpressing a combination of either AN1 with StJAF13 or AN1 with StbHLH1 showed deeper purple pigmentation with respect to AN1 alone. This further confirmed AN1/StJAF13 and AN1/StbHLH1 interactions. Our findings demonstrate that the classical loci identified for potato leaf anthocyanin accumulation correspond to AN1 and may represent an important step to expand our knowledge on the molecular mechanisms underlying anthocyanin biosynthesis in different plant tissues. PMID:25159050

D'Amelia, Vincenzo; Aversano, Riccardo; Batelli, Giorgia; Caruso, Immacolata; Castellano Moreno, Mar; Castro-Sanz, Ana Beatriz; Chiaiese, Pasquale; Fasano, Carlo; Palomba, Francesca; Carputo, Domenico

2014-11-01

82

Amino-terminal domains of c-myc and N-myc proteins mediate binding to the retinoblastoma gene product  

NASA Astrophysics Data System (ADS)

THE proteins encoded by the myc gene family are involved in the control of cell proliferation and differentiation, and aberrant expression of myc proteins has been implicated in the genesis of a variety of neoplasms1. In the carboxyl terminus, myc proteins have two domains that encode a basic domain/helix-loop-helix and a leucine zipper motif, respectively. These motifs are involved both in DNA binding and in protein dimerization2-5. In addition, myc protein family members share several regions of highly conserved amino acids in their amino termini that are essential for transformation6,7. We report here that an N-terminal domain present in both the c-myc and N-myc proteins mediates binding to the retinoblastoma gene product, pRb. We show that the human papilloma virus E7 protein competes with c-myc for binding to pRb, indicating that these proteins share overlapping binding sites on pRb. Furthermore, a mutant Rb protein from a human tumour cell line that carried a 35-amino-acid deletion in its C terminus failed to bind to c-myc. Our results suggest that c-myc and pRb cooperate through direct binding to control cell proliferation.

Rustgi, Anil K.; Dyson, Nicholas; Bernards, Rene

1991-08-01

83

Contribution of NAD(P)H:quinone oxidoreductase 1 to protection against carcinogenesis, and regulation of its gene by the Nrf2 basic-region leucine zipper and the arylhydrocarbon receptor basic helix-loop-helix transcription factors  

Microsoft Academic Search

NAD(P)H:quinone oxidoreductase 1 (NQO1) is a key enzyme involved in defence against reactive forms of oxygen and inhibition of neoplasia. Under conditions of oxidative stress, expression of NQO1 is induced, and the resulting increase in oxidoreductase protein provides the cell with multiple layers of protection against environmental insults. Firstly, the catalytic activity of NQO1 is directed towards the complete reduction

Paul Nioi; John D. Hayes

2004-01-01

84

Responses of a Triple Mutant Defective in Three Iron Deficiency-Induced BASIC HELIX-LOOP-HELIX Genes of the Subgroup Ib(2) to Iron Deficiency and Salicylic Acid  

PubMed Central

Plants are sessile organisms that adapt to external stress by inducing molecular and physiological responses that serve to better cope with the adverse growth condition. Upon low supply of the micronutrient iron, plants actively increase the acquisition of soil iron into the root and its mobilization from internal stores. The subgroup Ib(2) BHLH genes function as regulators in this response, however their concrete functions are not fully understood. Here, we analyzed a triple loss of function mutant of BHLH39, BHLH100 and BHLH101 (3xbhlh mutant). We found that this mutant did not have any iron uptake phenotype if iron was provided. However, under iron deficiency the mutant displayed a more severe leaf chlorosis than the wild type. Microarray-based transcriptome analysis revealed that this mutant phenotype resulted in the mis-regulation of 198 genes, out of which only 15% were associated with iron deficiency regulation itself. A detailed analysis revealed potential targets of the bHLH transcription factors as well as genes reflecting an exaggerated iron deficiency response phenotype. Since the BHLH genes of this subgroup have been brought into the context of the plant hormone salicylic acid, we investigated whether the 3xbhlh mutant might have been affected by this plant signaling molecule. Although a very high number of genes responded to SA, also in a differential manner between mutant and wild type, we did not find any indication for an association of the BHLH gene functions in SA responses upon iron deficiency. In summary, our study indicates that the bHLH subgroup Ib(2) transcription factors do not only act in iron acquisition into roots but in other aspects of the adaptation to iron deficiency in roots and leaves. PMID:24919188

Maurer, Felix; Naranjo Arcos, Maria Augusta; Bauer, Petra

2014-01-01

85

The Basic Helix-Loop-Helix, Leucine Zipper Transcription Factor, USF (Upstream Stimulatory Factor), Is a Key Regulator of SF1 (Steroidogenic Factor1) Gene Expression in Pituitary Gonadotrope and Steroidogenic Cells  

Microsoft Academic Search

Tissue-specific expression of the mammalian FTZ-F1 gene is essential for adrenal and gonadal development and sexual differentiation. The FTZ-F1 gene encodes an orphan nuclear receptor, termed SF-1 (steroidogenic factor-1) or Ad4BP, which is a primary transcriptional regulator of sev- eral hormone and steroidogenic enzyme genes that are critical for normal physiological function of the hypothalamic-pituitary-gonadal axis in repro- duction. The

Adrienne N. Harris; Pamela L. Mellon

1998-01-01

86

Basic pentacysteine proteins mediate MADS domain complex binding to the DNA for tissue-specific expression of target genes in Arabidopsis.  

PubMed

Basic pentacysteine (BPC) transcription factors have been identified in a large variety of plant species. In Arabidopsis thaliana there are seven BPC genes, which, except for BPC5, are expressed ubiquitously. BPC genes are functionally redundant in a wide range of developmental processes. Recently, we reported that BPC1 binds to guanine and adenine (GA)-rich consensus sequences in the seedstick (STK) promoter in vitro and induces conformational changes. Here we show by chromatin immunoprecipitation experiments that in vivo BPCs also bind to the consensus boxes, and when these were mutated, expression from the STK promoter was derepressed, resulting in ectopic expression in the inflorescence. We also reveal that short vegetative phase (SVP) is a direct regulator of STK. SVP is a floral meristem identity gene belonging to the MADS box gene family. The SVP-APETALA1 (AP1) dimer recruits the SEUSS (SEU)-LEUNIG (LUG) transcriptional cosuppressor to repress floral homeotic gene expression in the floral meristem. Interestingly, we found that GA consensus sequences in the STK promoter to which BPCs bind are essential for recruitment of the corepressor complex to this promoter. Our data suggest that we have identified a new regulatory mechanism controlling plant gene expression that is probably generally used, when considering BPCs' wide expression profile and the frequent presence of consensus binding sites in plant promoters. PMID:23054472

Simonini, Sara; Roig-Villanova, Irma; Gregis, Veronica; Colombo, Bilitis; Colombo, Lucia; Kater, Martin M

2012-10-01

87

Identifying Novel Helix-Loop-Helix Genes in "Caenorhabditis elegans" through a Classroom Demonstration of Functional Genomics  

ERIC Educational Resources Information Center

A 14-week, undergraduate-level Genetics and Population Biology course at Morgan State University was modified to include a demonstration of functional genomics in the research laboratory. Students performed a rudimentary sequence analysis of the "Caenorhabditis elegans" genome and further characterized three sequences that were predicted to encode…

Griffin, Vernetta; McMiller, Tracee; Jones, Erika; Johnson, Casonya M.

2003-01-01

88

Antagonistic Regulation of  Globin Gene Expression by Helix-Loop-Helix Proteins USF and TFII-I  

Microsoft Academic Search

The human -globin genes are expressed in a developmental stage-specific manner in erythroid cells. Gene-proximal cis-regulatory DNA elements and interacting proteins restrict the expression of the genes to the embryonic, fetal, or adult stage of erythropoiesis. In addition, the relative order of the genes with respect to the locus control region contributes to the temporal regulation of the genes. We

Valerie J. Crusselle-Davis; Karen F. Vieira; Zhuo Zhou; Archana Anantharaman; Jorg Bungert

2006-01-01

89

The helix-loop-helix protein id1 controls stem cell proliferation during regenerative neurogenesis in the adult zebrafish telencephalon.  

PubMed

The teleost brain has the remarkable ability to generate new neurons and to repair injuries during adult life stages. Maintaining life-long neurogenesis requires careful management of neural stem cell pools. In a genome-wide expression screen for transcription regulators, the id1 gene, encoding a negative regulator of E-proteins, was found to be upregulated in response to injury. id1 expression was mapped to quiescent type I neural stem cells in the adult telencephalic stem cell niche. Gain and loss of id1 function in vivo demonstrated that Id1 promotes stem cell quiescence. The increased id1 expression observed in neural stem cells in response to injury appeared independent of inflammatory signals, suggesting multiple antagonistic pathways in the regulation of reactive neurogenesis. Together, we propose that Id1 acts to maintain the neural stem cell pool by counteracting neurogenesis-promoting signals. Stem Cells 2015;33:892-903. PMID:25376791

Viales, Rebecca Rodriguez; Diotel, Nicolas; Ferg, Marco; Armant, Olivier; Eich, Julia; Alunni, Alessandro; März, Martin; Bally-Cuif, Laure; Rastegar, Sepand; Strähle, Uwe

2015-03-01

90

Proper expression of helix-loop-helix protein Id2 is important to chondrogenic differentiation of ATDC5 cells.  

PubMed

The process of chondrogenesis can be mimicked in vitro by insulin treatment of mouse ATDC5 chondroprogenitor cells. To identify novel factors that are involved in the control of chondrogenesis, we carried out a large-scale screening through retroviral insertion mutagenesis and isolated a fast-growing ATDC5 clone incapable of chondrogenic differentiation. Inverse-PCR analysis of this clone revealed that the retroviral DNA was inserted into the promoter region of mouse Id2 (inhibitor of DNA-binding protein 2) gene. This retroviral insertion increased Id2 protein levels to twice those found in normal ATDC5 cells. To investigate whether an elevated level of Id2 protein was responsible for inhibition of chondrogenic differentiation, ATDC5 cells were infected with a retrovirus to stably express Id2. ATDC5 cells expressing ectopic Id2 exhibited signs of de-differentiation, such as rapid growth, and insulin failed to induce expression of Sox9 (Sry-type high-mobility-group box 9) or matrix genes such as type II collagen (COL2) in these cells. When endogenous Id2 was knocked down by siRNA (small interfering RNA) in ATDC5 cells, expression of Sox9 and COL2 was increased and chondrogenic differentiation was accelerated. To examine how Id2 is expressed in chondrocytes in vivo, we carried out immunostaining of E16.5 mouse embryos and found that Id2 is expressed in articular chondrocytes and proliferating chondrocytes, but barely detectable in hypertrophic chondrocytes. Our results suggest that proper expression of Id2 is important to achieving a fine balance between growth and differentiation during chondrogenesis. PMID:19175360

Yang, Liu; Ma, Xiaoyun; Lyone, Anne; Zou, Junhui; Blackburn, Michael L; Pan, Jing; Yang, Dingqiao; Matsushita, Hiroshi; Mei, Bin; Zielinska-Kwiatkowska, Anna; Chansky, Howard A

2009-05-01

91

Role of the ubiquitin-proteasome pathway in the inner ear : identification of an E3 ubiquitin ligase for Atoh1  

E-print Network

Atoh1, the proneural basic-helix-loop-helix transcription factor, is critical for the differentiation of inner ear hair cells. Hair cells do not develop in mice that lack Atoh1, and overexpression of the transcription ...

Cheng, Yen-Fu

2014-01-01

92

Transcriptional regulation of neurodevelopmental and metabolic pathways by the psychiatric illness candidate gene NPAS3   

E-print Network

The basic helix-loop-helix PAS domain transcription factor gene NPAS3 is a risk factor for psychiatric disorders. A knockout mouse model also exhibits behavioural and adult neurogenesis deficits consistent with human ...

Sha, Li

2011-07-05

93

Protein- mediated enamel mineralization  

PubMed Central

Enamel is a hard nanocomposite bioceramic with significant resilience that protects the mammalian tooth from external physical and chemical damages. The remarkable mechanical properties of enamel are associated with its hierarchical structural organization and its thorough connection with underlying dentin. This dynamic mineralizing system offers scientists a wealth of information that allows the study of basic principals of organic matrix-mediated biomineralization and can potentially be utilized in the fields of material science and engineering for development and design of biomimetic materials. This chapter will provide a brief overview of enamel hierarchical structure and properties as well as the process and stages of amelogenesis. Particular emphasis is given to current knowledge of extracellular matrix protein and proteinases, and the structural chemistry of the matrix components and their putative functions. The chapter will conclude by discussing the potential of enamel for regrowth. PMID:22652761

Moradian-Oldak, Janet

2012-01-01

94

Metamorphic proteins mediate evolutionary transitions of structure  

E-print Network

Metamorphic proteins mediate evolutionary transitions of structure Itamar Yadida , Noam. Such metamorphic proteins provide a means of facilitating the evolution of new folds and ar- chitectures. However, because natural folds emerged at the early stages of evolution, the potential role of metamorphic

Tawfik, Dan S.

95

FASTING AND REFEEDING EFFECTS THE EXPRESSION OF THE INHIBITOR OF DNA BINDING (ID)GENES IN RAINBOW TROUT (ONCORHYNCHUS MYKISS) MUSCLE  

Technology Transfer Automated Retrieval System (TEKTRAN)

The ID (Inhibitor of DNA Binding/Differentiation) proteins are a family of dominant negative regulators of the basic helix-loop-helix (bHLH) transcription factors, shown in mammals to delay cell differentiation and prolong proliferation. In the current study we investigated the effects of fasting a...

96

Phytochrome Phosphorylation Modulates Light Signaling by Influencing the ProteinProtein Interaction W  

E-print Network

interaction with putative signal transducers, Nucleoside Diphosphate Kinase-2 and Phytochrome two-hybrid screens have revealed several phytochrome-interacting proteins (PIPs) as potential primary Diphosphate Kinase-2 (NDPK2; Choi et al., 1999). PIF3 is a basic helix-loop helix transcription factor

Schäfer, Eberhard

97

Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin  

E-print Network

Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development

Richardson, William D.

98

NEUROD2 and NEUROD3 genes map to human chromosomes 17q12 and 5q23-q31 and mouse chromosomes 11 and 13, respectively  

SciTech Connect

NEUROD2 and NEUROD3 are transcription factors involved in neurogenesis that are related to the basic helix-loop-helix protein NEUROD. NEUROD2 maps to human chromosome 17q12 and mouse chromosome 11. NEUROD3 maps to human chromosome 5q23-q31 and mouse chromosome 13. 16 refs., 2 figs.

Tamimi, R.M.; Montgomery-Dyer, K.; Tapscott, S.J. [Fred Hutchinson Cancer Research Center, Seattle, WA (United States)] [and others] [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); and others

1997-03-01

99

The NEURODGene Maps to Human Chromosome 2q32 and Mouse Chromosome 2  

Microsoft Academic Search

TheNeurodgene is a basic–helix–loop–helix gene that regulates neurogenesis and is identical to the hamsterbeta2gene that was cloned as a regulator of insulin transcription. Here we report the cloning of humanNEURODand mapping of the gene to human chromosome 2q32 and to mouse chromosome 2.

Rulla Tamimi; Eirikur Steingrimsson; Neal G. Copeland; Karen Dyer-Montgomery; Jacqueline E. Lee; Rachel Hernandez; Nancy A. Jenkins; Stephen J. Tapscott

1996-01-01

100

The NEUROD gene maps to human chromosome 2q32 and mouse chromosome 2  

SciTech Connect

The Neurod gene is a basic-helix-loop-helix gene that regulates neurogenesis and is identical to the hamster beta2 gene that was cloned as a regulator of insulin transcription. Here we report the cloning of human NEUROD and mapping of the gene to human chromosome 2q32 and to mouse chromosome 2. 12 refs., 1 fig.

Tamimi, R.; Dyer-Montgomery, K.; Hernandez, R.; Tapscott, S.J. [Fred Hutchinson Cancer Research Center, Seattle, WA (United States)] [and others] [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); and others

1996-06-15

101

Phytochrome Induces Rapid PIF5 Phosphorylation and Degradation in Response to Red-Light Activation  

Technology Transfer Automated Retrieval System (TEKTRAN)

The phytochrome (phy) family of sensory photoreceptors (phyA–phyE in Arabidopsis thaliana) induces changes in target-gene expression upon light-induced translocation to the nucleus, where certain members interact with selected members of the constitutively nuclear basic helix-loop-helix transcriptio...

102

Of worms and men: HLH-30 and TFEB regulate tolerance to infection.  

PubMed

In this issue of Immunity, Visvikis et al. (2014) use the model host Caenorhabditis elegans to discover a role in innate immunity for the basic helix-loop-helix transcription factor, HLH-30. The finding inspires study of the mammalian ortholog TFEB, in which a similar role in immune response is ascertained. PMID:24950206

Tiller, George R; Garsin, Danielle A

2014-06-19

103

Functional profiling identifies genes involved in organ specific branches of the PIF3 regulatory network in Arabidopsis  

Technology Transfer Automated Retrieval System (TEKTRAN)

The phytochrome (phy)-interacting basic helix-loop-helix transcription factors (PIFs) constitutively sustain the etiolated state of dark-germinated seedlings by actively repressing deetiolation in darkness. This action is rapidly reversed upon light exposure by phy-induced proteolytic degradation of...

104

Two Forms of Aryl Hydrocarbon Receptor Type 2 in Rainbow Trout (Oncorhynchus mykiss)  

E-print Network

clones were expressed by in vitro transcription/ translation and proteins of approximately 125 kDa were, Woods Hole, Massachusetts 02543 Two aryl hydrocarbon receptors (AhRs), rtAhR2 and rtAhR2 , were cloned similarity with AhRs cloned from mammalian species, especially in the basic helix-loop-helix and PAS

Tullos, Desiree

105

In cancer cells, monoallelic expression of oncogenes can occur through a variety of mechanisms including chromo-  

E-print Network

Reports In cancer cells, monoallelic expression of oncogenes can occur through a variety in overexpression of TAL1, an oncogene coding for a basic helix-loop-helix transcription factor, by mediating fu at oncogenes critical for the malig- nant cell state (11­17). The super- enhancer encompassing TAL1 in Jurkat

Napp, Nils

106

Cannabidiol as a novel inhibitor of Id1 gene expression in aggressive breast cancer cells  

Microsoft Academic Search

Invasion and metastasis of aggressive breast cancer cells is the final and fatal step during cancer progression, and is the least understood genetically. Clinically, there are still limited therapeutic interventions for aggressive and meta- static breast cancers available. Clearly, effective and non- toxic therapies are urgently required. Id-1, an inhibitor of basic helix-loop-helix transcription factors, has recently been shown to

Sean D. McAllister; Rigel T. Christian; Maxx P. Horowitz; Amaia Garcia; Pierre-Yves Desprez

2007-01-01

107

Protein Mediators of Sterol Transport Across Intestinal Brush Border Membrane  

PubMed Central

Dysregulation of cholesterol balance contributes significantly to atherosclerotic cardiovascular disease (ASCVD), the leading cause of death in the United States. The intestine has the unique capability to act as a gatekeeper for entry of cholesterol into the body, and inhibition of intestinal cholesterol absorption is now widely regarded as an attractive non-statin therapeutic strategy for ASCVD prevention. In this chapter we discuss the current state of knowledge regarding sterol transport across the intestinal brush border membrane. The purpose of this work is to summarize substantial progress made in the last decade in regards to protein-mediated sterol trafficking, and to discuss this in the context of human disease. PMID:20213550

Brown, J. Mark; Yu, Liqing

2012-01-01

108

Bcl-XL/Bax Proteins Direct the Fate of Embryonic Cortical Precursor Cells? †  

PubMed Central

In the developing mouse brain, the highest Bcl-XL expression is seen at the peak of neurogenesis, whereas the peak of Bax expression coincides with the astrogenic period. While such observations suggest an active role of the Bcl-2 family proteins in the generation of neurons and astrocytes, no definitive demonstration has been provided to date. Using combinations of gain- and loss-of-function assays in vivo and in vitro, we provide evidence for instructive roles of these proteins in neuronal and astrocytic fate specification. Specifically, in Bax knockout mice, astrocyte formation was decreased in the developing cortices. Overexpression of Bcl-XL and Bax in embryonic cortical precursors induced neural and astrocytic differentiation, respectively, while inhibitory RNAs led to the opposite results. Importantly, inhibition of caspase activity, dimerization, or mitochondrial localization of Bcl-XL/Bax proteins indicated that the differentiation effects of Bcl-XL/Bax are separable from their roles in cell survival and apoptosis. Lastly, we describe activation of intracellular signaling pathways and expression of basic helix-loop-helix transcriptional factors specific for the Bcl-2 protein-mediated differentiation. PMID:17438128

Chang, Mi-Yoon; Sun, Woong; Ochiai, Wataru; Nakashima, Kinichi; Kim, Soo-Young; Park, Chang-Hwan; Kang, Jin Sun; Shim, Jae-Won; Jo, A-Young; Kang, Chun-Sik; Lee, Yong-Sung; Kim, Jae-Sang; Lee, Sang-Hun

2007-01-01

109

The myoD Gene Family: Nodal Point During Specification of the Muscle Cell Lineage  

Microsoft Academic Search

The myoD gene converts many differentiated cell types into muscle. MyoD is a member of the basic-helix-loophelix family of proteins; this 68-amino acid domain in MyoD is necessary and sufficient for myogenesis. MyoD binds cooperatively to muscle-specific enhancers and activates transcription. The helix-loop-helix motif is responsible for dimerization, and, depending on its dimerization partner, MyoD activity can be controlled. MyoD

Harold Weintraub; Robert Davis; Stephen Tapscott; Matthew Thayer; Michael Krause; Robert Benezra; T. Keith Blackwell; David Turner; Ralph Rupp; Stanley Hollenberg; Yuan Zhuang; Andrew Lassar

1991-01-01

110

Transcriptional Link between Blood and Bone: the Stem Cell Leukemia Gene and Its +19 Stem Cell Enhancer Are Active in Bone Cells  

Microsoft Academic Search

Blood and vascular cells are generated during early embryogenesis from a common precursor, the heman- gioblast. The stem cell leukemia gene (SCL\\/tal 1) encodes a basic helix-loop-helix transcription factor that is essential for the normal development of blood progenitors and blood vessels. We have previously characterized a panel of SCL enhancers including the 19 element, which directs expression to hematopoietic

John E. Pimanda; Lev Silberstein; Massimo Dominici; Benjamin Dekel; Mark Bowen; Scott Oldham; Asha Kallianpur; Stephen J. Brandt; David Tannahill; Berthold Gottgens; Anthony R. Green

2006-01-01

111

Early B Cell Factor Promotes B Lymphopoiesis with Reduced Interleukin 7 Responsiveness in the Absence of E2A  

Microsoft Academic Search

The basic helix-loop-helix transcription factors encoded by the E2A gene function at the apex of a transcriptional hierarchy involving E2A, early B cell factor (EBF), and Pax5, which is essen- tial for B lymphopoiesis. In committed B lineage progenitors, E2A proteins have also been shown to regulate many lineage-associated genes. Herein, we demonstrate that the block in B lymphopoiesis imposed

Christopher S. Seet; Rachel L. Brumbaugh; Barbara L. Kee

2004-01-01

112

Genomic organization, chromosomal assignment, and expression analysis of the mouse Suppressor of fused gene ( Sufu ) coding a Gli protein partner  

Microsoft Academic Search

.  \\u000a Suppressor of fused (Sufu) is a negative regulator of the Hedgehog pathway both in Drosophila and vertebrates. Here, we report the genomic organization of the mouse Sufu gene (mSufu). This gene comprises 11 exons spanning more than 30 kb and encodes a protein with a putative PEST sequence. DNA-consensus\\u000a sequences recognized by basic helix-loop-helix (bHLH) proteins, referred to as

Dominique Simon-Chazottes; Mélanie Paces-Fessy; Claudie Lamour-Isnard; Jean-Louis Guénet; Marie-Françoise Blanchet-Tournier

2000-01-01

113

Different regulatory elements within the MyoD promoter control its expression in the brain and inhibit its functional consequences in neurogenesis  

Microsoft Academic Search

MyoD is a key basic helix-loop-helix (bHLH) transcription factor capable of converting many cells into skeletal muscle. Together with Myf5 it is essential for initiating skeletal myogenesis. In this report, the restricted domains of MyoD-lacZ expression have been revealed in the embryonic mouse brain by the analysis of transgenic mice with reporter genes driven by MyoD regulatory elements. The MD6.0-lacZ

Boris Kablar

2002-01-01

114

Musculin\\/MyoR is expressed in kidney side population cells and can regulate their function  

Microsoft Academic Search

usculin\\/MyoR is a new member of basic helix- loop-helix transcription factors, and its expres- sion is limited to skeletal muscle precursors. Here, we report that musculin\\/MyoR is expressed in adult kidney side population (SP) cells and can regulate their function. SP phenotype can be used to purify stem cell- rich fractions. Microarray analysis clarified that musculin\\/ MyoR was exclusively expressed

Keiichi Hishikawa; Takeshi Marumo; Shigeki Miura; Asato Nakanishi; Yumi Matsuzaki; Katsunori Shibata; Tomoko Ichiyanagi; Hiroko Kohike; Takuya Komori; Ichiro Takahashi; Osamu Takase; Naohiko Imai; Masahiro Yoshikawa; Toshihiko Inowa; Matsuhiko Hayashi; Toshio Nakaki; Hiromitsu Nakauchi; Hideyuki Okano; Toshiro Fujita

2005-01-01

115

Anthocyanini of petunia controls pigment synthesis, vacuolar pH, and seed coat development by genetically distinct mechanisms  

Microsoft Academic Search

ANTHOCYANIN1 (AN1) of petunia is a transcription factor of the basic helix-loop-helix (bHLH) family that is required for the synthesis of anthocyanin pigments. Here, we show that AN1 controls additional aspects of cell differentiation: the acidification of vacuoles in petal cells, and the size and morphology of cells in the seed coat epidermis. We identified an1 alleles, formerly known as

Cornelis Spelt; Francesca Quattrocchio; Joseph Mol; Ronald Koes

2002-01-01

116

Signalling downstream of activated mammalian Notch  

Microsoft Academic Search

NOTCH belongs to a family of transmembrane proteins that are widely conserved from flies to vertebrates and are thought to be involved in cell-fate decisions. In Drosophila, the Suppressor of hairless (Su(H)) gene1,2 and genes of the Enhancer of split (E(Spl)) complex, which encode proteins of the basic helix-loop-helix type3,4 have been implicated in the Notch signalling pathway. Mammalian homologues

Sophie Jarriault; Christel Brou; Frédérique Logeat; Eric H. Schroeter; Raphael Kopan; Alain Israel

1995-01-01

117

Expression of Id1 mRNA and Protein in the Post-Ischemic Regenerating Rat Kidney  

Microsoft Academic Search

The basic helix-loop-helix (bHLH) class of proteins are of major importance in controlling tissue-specific gene expression. The actions of the bHLH proteins are inhibited by a related class of proteins, inhibitors of differentiation (Id). We have studied the expression of one of these latter proteins, Id-1, in the normal and post-ischemic regenerating rat kidney by immunocytochemistry, Western blot and RNase

Göran L. Matejka; Maria Thornemo; Annika Kernholt; Anders Lindahl

1998-01-01

118

Math 1 target genes are enriched with evolutionarily conserved clustered e-box binding sites  

Microsoft Academic Search

The basic helix-loop-helix (bHLH) transcription factor Math1 and its orthologs are fundamental for proper development of various neuronal subpopulations, such as cerebellar granule cells,\\u000a D1 interneurons in the spinal cord, and inner ear hair cells. Although crucial for neurogenesis, the mechanisms by which Math1 specifically recognizes its direct targets are not fully understood. To search for direct and indirect target

Valery Krizhanovsky; Lilach Soreq; Vitaly Kliminski; Nissim Ben-Arie

2006-01-01

119

Structural and functional characterization of the polled interval on bovine chromosome 1  

E-print Network

what is currently known, the following are candidate genes: 13 13 Oligodendrocyte Lineage Transcription Factors 1 and 2 (OLIG1 and OLIG2) Each of these genes encodes a basic helix-loop-helix transcription factor expresed in the brain... (Jakovcevski and Zecevic, 2005). These transcription factors are involved in the diferentiation of the oligodendrocyte lineage, are an esential regulator of neuroectodermal cel fate and may have a role in the learning deficits asociated with Down syndrome...

Wunderlich, Kris Rakowitz

2008-10-10

120

The bHLH Transcription Factor Olig2 Promotes Oligodendrocyte Differentiation in Collaboration with Nkx2.2  

Microsoft Academic Search

Olig2, a basic helix-loop-helix (bHLH) transcription factor, is expressed in a restricted domain of the spinal cord ventricular zone that sequentially generates motoneurons and oligodendrocytes. Just prior to oligo-dendrocyte precursor formation, the domains of Olig2 and Nkx2.2 expression switch from being mutually exclusive to overlapping, and Neurogenins1 and 2 are extinguished within this region. Coexpression of Olig2 with Nkx2.2 in

Qiao Zhou; Gloria Choi; David J. Anderson

2001-01-01

121

Sonic Hedgehog–Regulated Oligodendrocyte Lineage Genes Encoding bHLH Proteins in the Mammalian Central Nervous System  

Microsoft Academic Search

During development, basic helix–loop–helix (bHLH) proteins regulate formation of neurons from multipotent progenitor cells. However, bHLH factors linked to gliogenesis have not been described. We have isolated a pair of oligodendrocyte lineage genes (Olg-1 and Olg-2) that encode bHLH proteins and are tightly associated with development of oligodendrocytes in the vertebrate central nervous system (CNS). Ectopic expression of Olg-1 in

Q. Richard Lu; Dong-in Yuk; John A Alberta; Zhimin Zhu; Inka Pawlitzky; Joanne Chan; Andrew P McMahon; Charles D Stiles; David H Rowitch

2000-01-01

122

Twist expression promotes migration and invasion in hepatocellular carcinoma  

Microsoft Academic Search

BACKGROUND: Twist, a transcription factor of the basic helix-loop-helix class, is reported to regulate cancer metastasis. It is known to induce epithelial-mesenchymal transition (EMT). In this study, we evaluated the expression of twist and its effect on cell migration in hepatocellular carcinoma (HCC). METHODS: We examined twist expression using immunohistochemistry in 20 tissue samples of hepatocellular carcinoma, and assessed twist

Noriyuki Matsuo; Hidenori Shiraha; Tatsuya Fujikawa; Nobuyuki Takaoka; Naoki Ueda; Shigetomi Tanaka; Shinichi Nishina; Yutaka Nakanishi; Masayuki Uemura; Akinobu Takaki; Shinichiro Nakamura; Yoshiyuki Kobayashi; Kazuhiro Nouso; Takahito Yagi; Kazuhide Yamamoto

2009-01-01

123

Hypoxia-inducible factor-1? induces Twist expression in tubular epithelial cells subjected to hypoxia, leading to epithelial-to-mesenchymal transition  

Microsoft Academic Search

Epithelial-to-mesenchymal transition (EMT) induced by chronic hypoxia is one of the critical causes of renal fibrosis. Twist, a basic helix-loop-helix transcription factor, is believed to be important in promoting EMT. We found that the expression of Twist was increased in human tubule cell lines (HK-2 and HKC) grown under hypoxic conditions. This was accompanied by reduced expression of the epithelial

Shiren Sun; Xiaoxuan Ning; Yanqi Zhang; Yuanyuan Lu; Yongzhan Nie; Shuang Han; Lili Liu; Rui Du; Lin Xia; Lijie He; Daiming Fan

2009-01-01

124

Daughterless dictates Twist activity in a context-dependent manner during somatic myogenesis  

Microsoft Academic Search

Somatic myogenesis in Drosophila relies on the reiterative activity of the basic helix–loop–helix transcriptional regulator, Twist (Twi). How Twi directs multiple cell fate decisions over the course of mesoderm and muscle development is unclear. Previous work has shown that Twi is regulated by its dimerization partner: Twi homodimers activate genes necessary for somatic myogenesis, whereas Twi\\/Daughterless (Da) heterodimers lead to

Ming-Ching Wong; Irinka Castanon; Mary K. Baylies

2008-01-01

125

Significance of Twist expression and its association with E-cadherin in esophageal squamous cell carcinoma  

Microsoft Academic Search

BACKGROUND: Twist is a basic helix-loop-helix (bHLH) transcriptional factor that has been identified to play an important role in epithelial-mesenchymal transition (EMT)-mediated metastasis through the regulation of E-cadherin expression. However, few authors have examined the expression of Twist and E-cadherin and their prognostic value in patients with esophageal squamous cell carcinoma (ESCC). The purpose of this study is to evaluate

Ken Sasaki; Shoji Natsugoe; Sumiya Ishigami; Masataka Matsumoto; Hiroshi Okumura; Tetsuro Setoyama; Yasuto Uchikado; Yoshiaki Kita; Kiyokazu Tamotsu; Akihiko Sakamoto; Tetsuhiro Owaki; Takashi Aikou

2009-01-01

126

Twist Expression Predicts Poor Clinical Outcome of Patients with Clear Cell Carcinoma of the Ovary  

Microsoft Academic Search

Objectives: Twist is a highly conserved basic helix-loop-helix transcription factor that regulates the expression of E-cadherin and promotes the epithelial-mesenchymal transition, which is critical for tumor infiltration. We examined the distribution and expression of this molecule in clear cell carcinoma of the ovary (CCC) to elucidate their clinical significance. Methods: Paraffin sections from CCC tissues (n = 27) were immunostained

Hiroaki Kajiyama; Satoyo Hosono; Mikio Terauchi; Kiyosumi Shibata; Kazuhiko Ino; Eiko Yamamoto; Seiji Nomura; Akihiro Nawa; Fumitaka Kikkawa; M. Singh; S. Prasad

2006-01-01

127

Metastasis-induction and apoptosis-protection by TWIST in gastric cancer cells  

Microsoft Academic Search

TWIST, a basic helix-loop-helix transcription factor, has been recently reported to play an important role in tumorigenesis\\u000a of human cancer through converting the early stage tumors into invasive malignancies. Upregulation of TWIST is often found\\u000a in cancer patients, especially those with shorter survival period and poor response to chemotherapy. Here we studied the functions\\u000a of TWIST on regulating migration rate,

Mei-yan Feng; Kuan Wang; Hong-tao Song; Hong-wei Yu; Yu Qin; Qing-tao Shi; Jing-shu Geng

2009-01-01

128

Upregulation of Twist in Gastric Carcinoma Associated with Tumor Invasion and Poor Prognosis  

Microsoft Academic Search

Tumor invasion and metastasis are the most common causes of death in gastric carcinoma. Twist, a transcription factor of the\\u000a basic helix-loop-helix class, reportedly regulates cancer metastasis and induces epithelial-mesenchymal transition (EMT).\\u000a We evaluated the expression of Twist and its effect on cell migration in gastric carcinoma (GC). Twist expression was detected\\u000a by real-time quantitative RT-PCR in gastric tumor tissue,

Guo-Qing Ru; Hui-Ju Wang; Wen-Jun Xu; Zhong-Sheng Zhao

2011-01-01

129

Olig2-positive progenitors in the embryonic spinal cord give rise not only to motoneurons and oligodendrocytes, but also to a subset of astrocytes and ependymal cells  

Microsoft Academic Search

Motoneurons and oligodendrocytes in the embryonic spinal cord are produced from a restricted domain of the ventral ventricular zone, termed the pMN domain. The pMN domain is the site of expression of two basic helix–loop–helix transcription factors, Olig1 and Olig2, which are essential for motoneuron and oligodendrocyte development. Previous lineage-tracing experiments using Olig1-Cre and Olig2-GFP mice suggested that motoneurons and

Noritaka Masahira; Hirohide Takebayashi; Katsuhiko Ono; Keisuke Watanabe; Lei Ding; Miki Furusho; Yasuhiro Ogawa; Yo-ichi Nabeshima; Arturo Alvarez-Buylla; Keiji Shimizu; Kazuhiro Ikenaka

2006-01-01

130

NeuroD-null mice are deaf due to a severe loss of the inner ear sensory neurons during development  

Microsoft Academic Search

A key factor in the genetically programmed development of the nervous system is the death of massive numbers of neurons. Therefore, genetic mechanisms governing cell survival are of fundamental importance to developmental neuroscience. We report that inner ear sensory neurons are dependent on a basic helix-loop-helix transcription factor called NeuroD for survival during differentiation. Mice lacking NeuroD protein exhibit no

Woo-Young Kim; Bernd Fritzsch; Amanda Serls; Leigh Anne Bakel; Eric J. Huang; Louis F. Reichardt; Daniel S. Barth; Jacqueline E. Lee

2001-01-01

131

The Mesoderm Specification Factor Twist in the Life Cycle of Jellyfish  

Microsoft Academic Search

The basic helix-loop-helix (bHLH) transcription factor Twist is highly conserved from Drosophila to vertebrates and plays a major role in mesoderm specification of triploblasts. The presence of a Twist homologue in diploblasts such as the cnidarian Podocoryne carnea raises questions on the evolution of mesoderm, the third cell layer characteristic for triploblasts. Podocoryne Twist is expressed in the early embryo

Jürg Spring; Nathalie Yanze; Arnoud M. Middel; Michael Stierwald; Hans Gröger; Volker Schmid

2000-01-01

132

A Subclass of bHLH Proteins Required for Cardiac Morphogenesis  

Microsoft Academic Search

Skeletal muscle development is controlled by a family of muscle-specific basic helix-loop-helix (bHLH) transcription factors. Two bHLH genes, dHAND and eHAND, have now been isolated that are expressed in the bilateral heart primordia and subsequently throughout the primitive tubular heart and its derivatives during chick and mouse embryogenesis. Incubation of stage 8 chick embryos with dHAND and eHAND antisense oligonucleotides

Deepak Srivastava; Peter Cserjesi; Eric N. Olson

1995-01-01

133

FGF signaling delineates the cardiac progenitor field in the simple chordate, Ciona intestinalis  

Microsoft Academic Search

Comprehensive gene networks in Ciona intestinalis embryos provide a foundation for characterizing complex developmental processes, such as the initial phases of chordate heart development. The basic helix-loop-helix regulatory gene Ci-Mesp is required for activation of cardiac transcription factors. Evidence is presented that Ci-Ets1\\/2, a transcriptional effector of receptor tyrosine kinase (RTK) signaling, acts downstream from Mesp to establish the heart

Brad Davidson; Weiyang Shi; Jeni Beh; Lionel Christiaen; Mike Levine

2006-01-01

134

Atonal homolog 1 Is a Tumor Suppressor Gene  

Microsoft Academic Search

Colon cancer accounts for more than 10% of all cancer deaths annually. Our genetic evidence from Drosophila and previous in vitro studies of mammalian Atonal homolog 1 (Atoh1, also called Math1 or Hath1) suggest an anti-oncogenic function for the Atonal group of proneural basic helix-loop-helix transcription factors. We asked whether mouse Atoh1 and human ATOH1 act as tumor suppressor genes

Wouter Bossuyt; Avedis Kazanjian; Natalie De Geest; Sofie Van Kelst; Gert De Hertogh; Karel Geboes; Greg P Boivin; Judith Luciani; Francois Fuks; Marinee Chuah; Thierry VandenDriessche; Peter Marynen; Jan Cools; Noah F Shroyer; Bassem A Hassan

2009-01-01

135

A New Turn (or Two) for Twist  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Two reports in this week's issue of Science [Baylies (p. 1481) and Spicer (p. 1476)] describe new functions in muscle development for the gene twist, a basic helix-loop-helix transcription factor. In his Perspective, Michelson explains how these two seemingly contradictory functions of twist (specification of mesodermal cell fate in fruit flies and inhibition of muscle differentiation in vertebrates) can be reconciled.

Alan M. Michelson (Brigham and Women's Hospital; Howard Hughes Medical Institute and the Department of Medicine)

1996-06-07

136

Down-regulation of achaete-scute complex homolog 1 (ASCL1) in neuroblastoma cells induces up-regulation of insulin-like growth factor 2 (IGF2)  

Microsoft Academic Search

Neuroblastoma (NB) is the most common extra-cranial solid pediatric tumor. The prognosis of patients with NB has been improved\\u000a during the last decades. However, treatment results for patients with advanced tumor stages are still unsatisfying. NB cells\\u000a are characterized by a high tendency for spontaneous or induced differentiation. During differentiation, down-regulation of\\u000a the basic helix-loop-helix transcription factor achaete-scute complex homolog

Jialing Li; Ingo Neumann; Ines Volkmer; Martin Sebastian Staege

2011-01-01

137

Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype?  

Microsoft Academic Search

The molecular mechanisms that underlie tumour progression are still poorly understood, but recently our knowledge of particular aspects of some of these processes has increased. Specifically, the identification of Snail, ZEB and some basic helix-loop-helix (bHLH) factors as inducers of epithelial–mesenchymal transition (EMT) and potent repressors of E-cadherin expression has opened new avenues of research with potential clinical implications.

Héctor Peinado; David Olmeda; Amparo Cano

2007-01-01

138

Ventricular septal defect and cardiomyopathy in mice lacking the transcription factor CHF1\\/Hey2  

Microsoft Academic Search

Ventricular septal defects are common in human infants, but the genetic programs that control ventricular septation are poorly understood. Here we report that mice with a targeted disruption of the cardiovascular basic helix-loop-helix factor (CHF)1\\/Hey2 gene show isolated ventricular septal defects. These defects result primarily in failure to thrive. Mice often succumbed within the first 3 wk after birth and

Yasuhiko Sakata; Caramai N. Kamei; Hironori Nakagami; Roderick Bronson; James K. Liao; Michael T. Chin

2002-01-01

139

Modeling an Evolutionary Conserved Circadian Cis-Element  

Microsoft Academic Search

Circadian oscillator networks rely on a transcriptional activator called CLOCK\\/CYCLE (CLK\\/CYC) in insects and CLOCK\\/BMAL1 or NPAS2\\/BMAL1 in mammals. Identifying the targets of this heterodimeric basic-helix-loop-helix (bHLH) transcription factor poses challenges and it has been difficult to decipher its specific sequence affinity beyond a canonical E-box motif, except perhaps for some flanking bases contributing weakly to the binding energy. Thus,

Eric R. Paquet; Guillaume Rey; Felix Naef

2008-01-01

140

Neurogenin1 is a determinant of zebrafish basal forebrain dopaminergic neurons and is regulated by the conserved zinc finger protein Tof\\/Fezl  

Microsoft Academic Search

The development of vertebrate basal forebrain dopaminergic (DA) neurons requires the conserved zinc finger protein Too Few (Tof\\/Fezl) in zebrafish. However, how Tof\\/Fezl regulates the commitment and differentiation of these DA neurons is not known. Proneural genes encoding basic helix-loop-helix transcription factors regulate the development of multiple neuronal lineages, but their involvement in vertebrate DA neuron determination is unclear. Here

Jae-Yeon Jeong; Zev Einhorn; Sara Mercurio; Susie Lee; Billy Lau; Marina Mione; Stephen W. Wilson; Su Guo

2006-01-01

141

HAND transcription factors are required for neonatal sympathetic neuron survival  

Microsoft Academic Search

Expression of the basic helix–loop–helix transcription factor HAND2 begins early in sympathetic neuron development and is essential for the differentiation of noradrenergic neurons. Here, we show that the expression of HAND2 and related HAND1 are maintained in sympathetic neurons throughout fetal and postnatal development when these neurons depend on target-derived nerve growth factor (NGF) for survival. Short interfering RNA knockdown

Epaminondas Doxakis; Laura Howard; Hermann Rohrer; Alun M Davies

2008-01-01

142

SCL: From the origin of hematopoiesis to stem cells and leukemia  

Microsoft Academic Search

In the hematopoietic system, lineage commitment and differentiation is controlled by the combinatorial action of transcription factors from diverse families. SCL is a basic helix-loop-helix transcription factor that is an essential regulator at several levels in the hematopoietic hierarchy and whose inappropriate regulation frequently contributes to the development of pediatric T-cell acute lymphoblastic leukemia. This review discusses advances that have

Eric Lécuyer; Trang Hoang

2004-01-01

143

SCL Assembles a Multifactorial Complex That Determines Glycophorin A Expression  

Microsoft Academic Search

SCL\\/TAL1 is a hematopoietic-specific transcription factor of the basic helix-loop-helix (bHLH) family that is essential for erythropoiesis. Here we identify the erythroid cell-specific glycophorin A gene (GPA) as a target of SCL in primary hematopoietic cells and show that SCL occupies the GPA locus in vivo. GPA promoter activation is dependent on the assembly of a multifactorial complex containing SCL

Rachid Lahlil; Eric Lecuyer; Sabine Herblot; Trang Hoang

2004-01-01

144

OLIG2 (BHLHB1), a bHLH Transcription Factor, Contributes to Leukemogenesis in Concert with LMO1  

Microsoft Academic Search

OLIG2 (originally designated BHLHB1) encodes a transcrip- tion factor that contains the basic helix-loop-helix motif. Although expression of OLIG2 is normally restricted to neural tissues, overexpression of OLIG2 has been shown in patients with precursor T-cell lymphoblastic lymphoma\\/leukemia (pre-T LBL). In the current study, we found that over- expression of OLIG2 was not only found in oligodendroglioma samples and normal

Ying-Wei Lin; Ramona Deveney; Mary Barbara; Norman N. Iscove; Stephen D. Nimer; Christopher Slape; Peter D. Aplan

2005-01-01

145

Inhibition of the hTERT promoter by the proto-oncogenic protein TAL1  

Microsoft Academic Search

Telomerase activity, which has fundamental roles in development and carcinogenesis, strongly depends on the expression of human telomerase reverse transcriptase (hTERT), its catalytic subunit. In this report, we show that the basic helix-loop-helix factor, TAL1 (T-cell acute lymphoblastic leukemia 1), is a negative regulator of the hTERT promoter. Indeed, TAL1 overexpression leads to a decrease in hTERT mRNA abundance and

J-M Terme; V Mocquet; A-S Kuhlmann; L Zane; F Mortreux; E Wattel; M Duc Dodon; P Jalinot

2009-01-01

146

Overexpression of a transcription factor LYL1 induces T- and B-cell lymphoma in mice  

Microsoft Academic Search

LYL1, a member of the class II basic helix–loop–helix transcription factors, is aberrantly expressed in a fraction of human T-cell acute lymphoblastic leukemia. Here, we generated transgenic mice ubiquitously overexpressing LYL1 using a construct expressing full-length cDNA driven by a human elongation factor 1? promoter. Four independent lines exhibiting high LYL1 expression were established. Of these transgenic mice, 96% displayed

Y Zhong; L Jiang; H Hiai; S Toyokuni; Y Yamada

2007-01-01

147

The Arabidopsis Phytochrome-Interacting Factor PIF7, Together with PIF3 and PIF4, Regulates Responses to Prolonged Red Light by Modulating phyB Levels  

Microsoft Academic Search

We show that a previously uncharacterized Arabidopsis thaliana basic helix-loop-helix (bHLH) phytochrome interacting factor (PIF), designated PIF7, interacts specifically with the far-red light-absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Similar to PIF3, upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. However, in striking contrast to PIF3,

Pablo Leivar; Elena Monte; Bassem Al-Sady; Christine Carle; Alyssa Storer; Jose M. Alonso; Joseph R. Ecker; P. H. Quail

2008-01-01

148

Pathways mediating the effects of cannabidiol on the reduction of breast cancer cell proliferation, invasion, and metastasis  

Microsoft Academic Search

Invasion and metastasis of aggressive breast cancer cells are the final and fatal steps during cancer progression. Clinically,\\u000a there are still limited therapeutic interventions for aggressive and metastatic breast cancers available. Therefore, effective,\\u000a targeted, and non-toxic therapies are urgently required. Id-1, an inhibitor of basic helix-loop-helix transcription factors,\\u000a has recently been shown to be a key regulator of the metastatic

Sean D. McAllister; Ryuichi Murase; Rigel T. Christian; Darryl Lau; Anne J. Zielinski; Juanita Allison; Carolina Almanza; Arash Pakdel; Jasmine Lee; Chandani Limbad; Yong Liu; Robert J. Debs; Dan H. Moore; Pierre-Yves Desprez

2011-01-01

149

Out of the dark: how the PIFs are unmasking a dual temporal mechanism of phytochrome signalling  

Microsoft Academic Search

Following light-induced nuclear translocation, the phyto- chromes induce changes in gene expression to regulate plant development. PIF3 and other PIFs (phytochrome-interacting factors), members of the bHLH (basic helix-loop-helix) family of transcriptional regulators, interact specifically with the active Pfr conformer of the phytochrome molecule, suggesting that the PIFs are key components of phytochrome signal transduction. The mechanism by which the PIFs

Elena Monte; Bassem Al-Sady; Pablo Leivar; Peter H. Quail

2007-01-01

150

Prostacyclin-induced hyperthermia - Implication of a protein mediator  

NASA Technical Reports Server (NTRS)

The mechanism of the prostacyclin-linked hyperthermia is studied in rabbits. Results show that intracerebroventricular administration of prostacyclin (PGI2) induces dose-related hyperthermia at room temperature (21 C), as well as at low (4 C) and high (30 C) ambient temperatures. It is found that this PGI2-induced hyperthermia is not mediated by its stable metabolite 6-keto prostaglandin F-1(alpha). Only one of the three anion transport systems, the liver transport system, appears to be important to the central inactivation of pyrogen, prostaglandin E2, and PGI2. Phenoxybenzamine and pimozide have no thermolytic effect on PGI2-induced hyperthermia, while PGI2 still induces hyperthermia after norepinephrine (NE) and dopamine levels are depleted by 6-hydroxydopamine. Indomethacin and SC-19220 (a PG antagonist) do not antagonize PGI2 induced hyperthermia, while theophylline does not accentuate the PGI2-induced hyperthermia. However, the hyperthermic response to PGI2 is attenuated by central administration of the protein synthesis inhibitor, anisomycin. It is concluded that PGI2-induced hyperthermia is not induced by NE, dopamine, or cyclic AMP, but rather that a protein mediator is implicated in the induction of fever by PG12.

Kandasamy, S. B.; Williams, B. A.

1982-01-01

151

ATG proteins mediate efferocytosis and suppress inflammation in mammary involution  

PubMed Central

Involution is the process of post-lactational mammary gland regression to quiescence and it involves secretory epithelial cell death, stroma remodeling and gland repopulation by adipocytes. Though reportedly accompanying apoptosis, the role of autophagy in involution has not yet been determined. We now report that autophagy-related (ATG) proteins mediate dead cell clearance and suppress inflammation during mammary involution. In vivo, Becn1+/? and Atg7-deficient mammary epithelial cells (MECs) produced ‘competent’ apoptotic bodies, but were defective phagocytes in association with reduced expression of the MERTK and ITGB5 receptors, thus pointing to defective apoptotic body engulfment. Atg-deficient tissues exhibited higher levels of involution-associated inflammation, which could be indicative of a tumor-modulating microenvironment, and developed ductal ectasia, a manifestation of deregulated post-involution gland remodeling. In vitro, ATG (BECN1 or ATG7) knockdown compromised MEC-mediated apoptotic body clearance in association with decreased RAC1 activation, thus confirming that, in addition to the defective phagocytic processing reported by other studies, ATG protein defects also impair dead cell engulfment.   Using two different mouse models with mammary gland-associated Atg deficiencies, our studies shed light on the essential role of ATG proteins in MEC-mediated efferocytosis during mammary involution and provide novel insights into this important developmental process. This work also raises the possibility that a regulatory feedback loop exists, by which the efficacy of phagocytic cargo processing in turn regulates the rate of engulfment and ultimately determines the kinetics of phagocytosis and dead cell clearance. PMID:23380905

Teplova, Irina; Lozy, Fred; Price, Sandy; Singh, Sukhwinder; Barnard, Nicola; Cardiff, Robert D.; Birge, Raymond B.; Karantza, Vassiliki

2013-01-01

152

Maintenance of meiotic prophase arrest in vertebrate oocytes by a Gs protein-mediated pathway  

E-print Network

Maintenance of meiotic prophase arrest in vertebrate oocytes by a Gs protein-mediated pathway, accepted 12 November 2003 Abstract Maintenance of meiotic prophase arrest in fully grown vertebrate oocytes, is required to maintain meiotic arrest. Microinjection of a dominant negative form of Gs into Xenopus

Terasaki, Mark

153

Shape transitions in lipid membranes and protein mediated vesicle fusion and fission  

E-print Network

Shape transitions in lipid membranes and protein mediated vesicle fusion and fission Erdinç Atilgan. DOI: 10.1063/1.2483862 I. INTRODUCTION Budding, fusion, and fission of membranes are essential, fusion and fission of membranes are never spontaneous, and always catalyzed by proteins. A number

Sun, Sean

154

Nucleic Acid Conformational Changes Essential for HIV-1 Nucleocapsid Protein-mediated Inhibition of  

E-print Network

Nucleic Acid Conformational Changes Essential for HIV-1 Nucleocapsid Protein-mediated Inhibition) is a nucleic acid chaperone protein that has been shown to greatly facilitate the nucleic acid rearrangements and a TAR-containing acceptor RNA molecule, we find that when both nucleic acids are present, NC facilitates

Levin, Judith G.

155

Olig1 and ID4 interactions in living cells visualized by bimolecular fluorescence complementation technique  

Microsoft Academic Search

Olig1, a member of class B basic-helix-loop-helix (bHLH), plays key roles in early oligodendrocyte specification. Inhibitors\\u000a of DNA binding (Id) is another sub-class of HLH proteins, act as dominant-negative regulators of bHLH proteins, which can\\u000a form heterodimers with class A or B bHLH proteins, but lack the critical basic DNA binding domain. Id4 was recently found\\u000a to interact with olig1

Shu-Jun Guo; Jian-Guo Hu; Bao-Ming Zhao; Lin Shen; Rui Wang; Jian-Sheng Zhou; He-Zuo Lü

156

Calcium binding protein-mediated regulation of voltage-gated calcium channels linked to human diseases  

Microsoft Academic Search

Calcium ion entry through voltage-gated calcium channels is essential for cellular signalling in a wide variety of cells and multiple physiological processes. Perturbations of voltage-gated calcium channel function can lead to pathophysiological consequences. Calcium binding proteins serve as calcium sensors and regulate the calcium channel properties via feedback mechanisms. This review highlights the current evidences of calcium binding protein-mediated channel

Nasrin Nejatbakhsh; Zhong-ping Feng

2011-01-01

157

Calcium binding protein-mediated regulation of voltage-gated calcium channels linked to human diseases  

PubMed Central

Calcium ion entry through voltage-gated calcium channels is essential for cellular signalling in a wide variety of cells and multiple physiological processes. Perturbations of voltage-gated calcium channel function can lead to pathophysiological consequences. Calcium binding proteins serve as calcium sensors and regulate the calcium channel properties via feedback mechanisms. This review highlights the current evidences of calcium binding protein-mediated channel regulation in human diseases. PMID:21642945

Nejatbakhsh, Nasrin; Feng, Zhong-ping

2011-01-01

158

Myomaker is essential for muscle regeneration  

PubMed Central

Regeneration of injured adult skeletal muscle involves fusion of activated satellite cells to form new myofibers. Myomaker is a muscle-specific membrane protein required for fusion of embryonic myoblasts, but its potential involvement in adult muscle regeneration has not been explored. We show that myogenic basic helix–loop–helix (bHLH) transcription factors induce myomaker expression in satellite cells during acute and chronic muscle regeneration. Moreover, genetic deletion of myomaker in adult satellite cells completely abolishes muscle regeneration, resulting in severe muscle destruction after injury. Myomaker is the only muscle-specific protein known to be absolutely essential for fusion of embryonic and adult myoblasts. PMID:25085416

Millay, Douglas P.; Sutherland, Lillian B.; Bassel-Duby, Rhonda

2014-01-01

159

amos, a proneural gene for Drosophila olfactory sense organs that is regulated by lozenge.  

PubMed

In a variety of organisms, early neurogenesis requires the function of basic-helix-loop-helix (bHLH) transcription factors. For the Drosophila PNS, such transcription factors are encoded by the proneural genes (atonal and the achaete-scute complex, AS-C). We have identified a proneural gene, amos, that has strong similarity with atonal in its bHLH domain. We present evidence that amos is required for olfactory sensilla and is regulated by the prepattern gene lozenge. Between them, amos, atonal, and the AS-C can potentially account for the origin of the entire PNS. PMID:10707973

Goulding, S E; zur Lage, P; Jarman, A P

2000-01-01

160

Molecular cloning and its expression of trachealess gene ( As - trh ) during development in brine shrimp, Artemia sinica  

Microsoft Academic Search

Basic helix-loop-helix-PAS (bHLH-PAS) family transcription factors are implicated in multiple developmental and physiological\\u000a regulatory processes. Herein, a full-length cDNA encoding a bHLH-PAS domain transcription factor trachealess gene (designated\\u000a as As-trh) was cloned and characterized from brine shrimp (Artemia sinica) for the first time. The full-length cDNA of As-trh was 2,698 bp with a 2,319 bp open reading frame encoding a deduced protein

Jia-Qing WangLin; Lin Hou; Nan Yi; Riu-Feng Zhang; Xiang-Yang Zou; Qin Xiao; Ran Guo

161

Association of TWIST1 gene polymorphisms with bone mineral density in postmenopausal women  

Microsoft Academic Search

Summary  A novel polymorphism (+1871A>G) in the 3? flanking region and haplotypes were significantly associated with reduced osteoporosis risk and enhanced bone\\u000a mineral density (BMD). These results suggest that TWIST1 may be a useful genetic marker for osteoporosis. Our results provide preliminary evidence supporting an association of TWIST1 with osteoporosis in postmenopausal women.\\u000a \\u000a \\u000a \\u000a \\u000a Introduction  \\u000a TWIST1, a basic helix–loop–helix (bHLH) transcription factor,

J.-Y. Hwang; S.-Y. Kim; S. H. Lee; G. S. Kim; M. J. Go; S. E. Kim; H.-C. Kim; H.-D. Shin; B. L. Park; T.-H. Kim; J. M. Hong; E. K. Park; H.-L. Kim; J.-Y. Lee; J.-M. Koh

2010-01-01

162

neuroD2andneuroD3: Distinct Expression Patterns and Transcriptional Activation Potentials within the neuroDGene Family  

Microsoft Academic Search

We have identified two new genes,neuroD2andneuroD3, on the basis of their similarity to the neurogenic basic-helix-loop-helix (bHLH) gene neuroD. The predicted amino acid sequence of neuroD2 shows a high degree of homology to neuroD and MATH-2\\/NEX-1 in the bHLH region, whereas neuroD3 is a more distantly relatedfamilymember.neuroD3isexpressedtransientlyduringembryonicdevelopment,withthehighestlevels of expression between days 10 and 12. neuroD2 is initially expressed at embryonic

MARY B. MCCORMICK; RULLA M. TAMIMI; LAUREN SNIDER; ATSUSHI ASAKURA

1996-01-01

163

The role of Atonal transcription factors in the development of mechanosensitive cells  

PubMed Central

Mechanosensation is an evolutionarily ancient sensory modality seen in allmain animal groups. Mechanosensation can be mediated by sensory neurons or by dedicated receptor cells that form synapses with sensory neurons. Evidence over the last 15–20 years suggests that both classes of mechanosensory cells can be specified by the atonal class of basic helix-loop-helix transcription factors. In this review we discuss recent work addressing how atonal factors specify mechanosensitive cells in vertebrates and invertebrates, and how the redeployment of these factors underlies the regeneration of mechanosensitive cells in some vertebrate groups. PMID:23548731

Jarman, Andrew P.; Groves, Andrew K.

2013-01-01

164

The role of Atonal transcription factors in the development of mechanosensitive cells.  

PubMed

Mechanosensation is an evolutionarily ancient sensory modality seen in all main animal groups. Mechanosensation can be mediated by sensory neurons or by dedicated receptor cells that form synapses with sensory neurons. Evidence over the last 15-20 years suggests that both classes of mechanosensory cells can be specified by the atonal class of basic helix-loop-helix transcription factors. In this review we discuss recent work addressing how atonal factors specify mechanosensitive cells in vertebrates and invertebrates, and how the redeployment of these factors underlies the regeneration of mechanosensitive cells in some vertebrate groups. PMID:23548731

Jarman, Andrew P; Groves, Andrew K

2013-05-01

165

Photosynthetic entrainment of the Arabidopsis thaliana circadian clock  

E-print Network

. & Quail, P. H. PIF3, a phytochrome-interacting factor necessary for normal photoinduced signal transduction, is a novel basic helix-loop-helix protein. Cell 95, 657–67 (1998). 42. Jacobsen, S. E., Binkowski, K. A. & Olszewski, N. E. SPINDLY, a... 3 (pif3-3)41, spindly (spy-3)42 by crossing. Ler/CCA1:LUC and gin2-1/CCA1:LUC were backcrossed to Ler or CCA1:LUC, respectively, two times. The gin2-1(Col-0) line was used for sugar-insensitivity experiments to allow direct comparison to prr...

Haydon, Michael J.; Mielczarek, Olga; Robertson, Fiona C.; Hubbard, Katherine E.; Webb, Alex A. R.

2013-10-23

166

Protein-mediated Loops and Phase Transition in Nonthermal Denaturation of DNA  

E-print Network

We use a statistical mechanical model to study nonthermal denaturation of DNA in the presence of protein-mediated loops. We find that looping proteins which randomly link DNA bases located at a distance along the chain could cause a first-order phase transition. We estimate the denaturation transition time near the phase transition, which can be compared with experimental data. The model describes the formation of multiple loops via dynamical (fluctuational) linking between looping proteins, that is essential in many cellular biological processes.

K. G. Petrosyan; Chin-Kun Hu

2009-12-21

167

Mechanisms and Regulation of Protein-Mediated Cellular Fatty Acid Uptake: Molecular, Biochemical, and Physiological Evidence  

NSDL National Science Digital Library

In recent years, there has been considerable debate as to whether fatty acid is transported into cells or diffuses rapidly into the cell. It now appears that this debate is less strident, as it has been acknowledged recently that evidence supporting passive diffusion as the main mechanism for fatty acid uptake is apparently in error, since "previous reports for rapid flip-flop were based on an incorrect interpretation of the measurements" (79), Because of this (79) and other experiments (78), it has been concluded that "the lipid bilayer portion of biological membranes may present a significant barrier to transport of FFA across cell membranes" (36) and that "flip-flop is the rate limiting step for FFA transport across lipid vesicles" (78). Furthermore, "this implies that at least certain biological membranes may require protein-mediated transporters to catalyze the flip-flop step" (78). Since we (13, 27Â?29, 73, 97, 98, 100) and others (32, 45, 54) have previously provided considerable support for the protein-mediated entry of long-chain fatty acids into the cell, especially in metabolically important tissues such as heart and skeletal muscle, we concur with these recent conclusions (36, 78, 79) that (membrane-associated) proteins are involved in cellular fatty acid uptake.

2007-02-01

168

Down-Regulation of Ubiquitin Ligase Cbl Induced by Twist Haploinsufficiency in Saethre-Chotzen Syndrome Results in Increased PI3K/Akt Signaling and Osteoblast Proliferation  

PubMed Central

Genetic mutations of Twist, a basic helix-loop-helix transcription factor, induce premature fusion of cranial sutures in Saethre-Chotzen syndrome (SCS). We report here a previously undescribed mechanism involved in the altered osteoblastogenesis in SCS. Cranial osteoblasts from an SCS patient with a Twist mutation causing basic helix-loop-helix deletion exhibited decreased expression of E3 ubiquitin ligase Cbl compared with wild-type osteoblasts. This was associated with decreased ubiquitin-mediated degradation of phosphatidyl inositol 3 kinase (PI3K) and increased PI3K expression and PI3K/Akt signaling. Increased PI3K immunoreactivity was also found in osteoblasts in histological sections of affected cranial sutures from SCS patients. Transfection with Twist or Cbl abolished the increased PI3K/Akt signaling in Twist mutant osteoblasts. Forced overexpression of Cbl did not correct the altered expression of osteoblast differentiation markers in Twist mutant cells. In contrast, pharmacological inhibition of PI3K/Akt, but not ERK signaling, corrected the increased cell growth in Twist mutant osteoblasts. The results show that Twist haploinsufficiency results in decreased Cbl-mediated PI3K degradation in osteoblasts, causing PI3K accumulation and activation of PI3K/Akt-dependent osteoblast growth. This provides genetic and biochemical evidence for a role for Cbl-mediated PI3K signaling in the altered osteoblast phenotype induced by Twist haploinsufficiency in SCS. PMID:17003487

Guenou, Hind; Kaabeche, Karim; Dufour, Cécilie; Miraoui, Hichem; Marie, Pierre J.

2006-01-01

169

Mixed Lineage Kinase Phosphorylates Transcription Factor E47 and Inhibits TrkB Expression to Link Neuronal Death and Survival Pathways*  

PubMed Central

E47 is a basic helix-loop-helix transcription factor involved in neuronal differentiation and survival. We had previously shown that the basic helix-loop-helix protein E47 binds to E-box sequences within the promoter of the TrkB gene and activates its transcription. Proper expression of the TrkB receptor plays a key role in development and function of the vertebrate nervous system, and altered levels of TrkB have been associated with important human diseases. Here we show that E47 interacts with MLK2, a mixed lineage kinase (MLK) involved in JNK-mediated activation of programmed cell death. MLK2 enhances phosphorylation of the AD2 activation domain of E47 in vivo in a JNK-independent manner and phosphorylates in vitro defined serine and threonine residues within a loop-helix structure of AD2 that also contains a putative MLK docking site. Although these residues are essential for MLK2-mediated inactivation of E47, inhibition of MLKs by CEP11004 causes up-regulation of TrkB at a transcriptional level in cerebellar granule neurons and differentiating neuroblastoma cells. These findings allow us to propose a novel mechanism by which MLK regulates TrkB expression through phosphorylation of an activation domain of E47. This molecular link would explain why MLK inhibitors not only prevent activation of cell death processes but also enhance cell survival signaling as a key aspect of their neuroprotective potential. PMID:19801649

Pedraza, Neus; Rafel, Marta; Navarro, Isis; Encinas, Mario; Aldea, Martí; Gallego, Carme

2009-01-01

170

The MYB182 Protein Down-Regulates Proanthocyanidin and Anthocyanin Biosynthesis in Poplar by Repressing Both Structural and Regulatory Flavonoid Genes1[OPEN  

PubMed Central

Trees in the genus Populus (poplar) contain phenolic secondary metabolites including the proanthocyanidins (PAs), which help to adapt these widespread trees to diverse environments. The transcriptional activation of PA biosynthesis in response to herbivory and ultraviolet light stress has been documented in poplar leaves, and a regulator of this process, the R2R3-MYB transcription factor MYB134, has been identified. MYB134-overexpressing transgenic plants show a strong high-PA phenotype. Analysis of these transgenic plants suggested the involvement of additional MYB transcription factors, including repressor-like MYB factors. Here, MYB182, a subgroup 4 MYB factor, was found to act as a negative regulator of the flavonoid pathway. Overexpression of MYB182 in hairy root culture and whole poplar plants led to reduced PA and anthocyanin levels as well as a reduction in the expression of key flavonoid genes. Similarly, a reduced accumulation of transcripts of a MYB PA activator and a basic helix-loop-helix cofactor was observed in MYB182-overexpressing hairy roots. Transient promoter activation assays in poplar cell culture demonstrated that MYB182 can disrupt transcriptional activation by MYB134 and that the basic helix-loop-helix-binding motif of MYB182 was essential for repression. Microarray analysis of transgenic plants demonstrated that down-regulated targets of MYB182 also include shikimate pathway genes. This work shows that MYB182 plays an important role in the fine-tuning of MYB134-mediated flavonoid metabolism. PMID:25624398

Yoshida, Kazuko; Ma, Dawei; Constabel, C. Peter

2015-01-01

171

The MYB182 Protein Down-Regulates Proanthocyanidin and Anthocyanin Biosynthesis in Poplar by Repressing Both Structural and Regulatory Flavonoid Genes.  

PubMed

Trees in the genus Populus (poplar) contain phenolic secondary metabolites including the proanthocyanidins (PAs), which help to adapt these widespread trees to diverse environments. The transcriptional activation of PA biosynthesis in response to herbivory and ultraviolet light stress has been documented in poplar leaves, and a regulator of this process, the R2R3-MYB transcription factor MYB134, has been identified. MYB134-overexpressing transgenic plants show a strong high-PA phenotype. Analysis of these transgenic plants suggested the involvement of additional MYB transcription factors, including repressor-like MYB factors. Here, MYB182, a subgroup 4 MYB factor, was found to act as a negative regulator of the flavonoid pathway. Overexpression of MYB182 in hairy root culture and whole poplar plants led to reduced PA and anthocyanin levels as well as a reduction in the expression of key flavonoid genes. Similarly, a reduced accumulation of transcripts of a MYB PA activator and a basic helix-loop-helix cofactor was observed in MYB182-overexpressing hairy roots. Transient promoter activation assays in poplar cell culture demonstrated that MYB182 can disrupt transcriptional activation by MYB134 and that the basic helix-loop-helix-binding motif of MYB182 was essential for repression. Microarray analysis of transgenic plants demonstrated that down-regulated targets of MYB182 also include shikimate pathway genes. This work shows that MYB182 plays an important role in the fine-tuning of MYB134-mediated flavonoid metabolism. PMID:25624398

Yoshida, Kazuko; Ma, Dawei; Constabel, C Peter

2015-03-01

172

The Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 Locus Encodes a Novel Protein Mediating Abscisic Acid and Sugar  

E-print Network

ABA response have been cloned and found to encode proteins that affect processes includingThe Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 Locus Encodes a Novel Protein Mediating loci. ABI8 encodes a protein with no domains of known function but belongs to a small plant

Wurtele, Eve Syrkin

173

Overexpression of Inhibitor of DNA-Binding 2 Attenuates Pulmonary Fibrosis through Regulation of c-Abl and Twist.  

PubMed

Fibrosis is a multicellular process leading to excessive extracellular matrix deposition. Factors that affect lung epithelial cell proliferation and activation may be important regulators of the extent of fibrosis after injury. We and others have shown that activated alveolar epithelial cells (AECs) directly contribute to fibrogenesis by secreting mesenchymal proteins, such as type I collagen. Recent evidence suggests that epithelial cell acquisition of mesenchymal features during carcinogenesis and fibrogenesis is regulated by several mesenchymal transcription factors. Induced expression of direct inhibitors to these mesenchymal transcription factors offers a potentially novel therapeutic strategy. Inhibitor of DNA-binding 2 (Id2) is an inhibitory helix-loop-helix transcription factor that is highly expressed by lung epithelial cells during development and has been shown to coordinate cell proliferation and differentiation of cancer cells. We found that overexpression of Id2 in primary AECs promotes proliferation by inhibiting a retinoblastoma protein/c-Abl interaction leading to greater c-Abl activity. Id2 also blocks transforming growth factor ?1-mediated expression of type I collagen by inhibiting Twist, a prominent mesenchymal basic helix-loop-helix transcription factor. In vivo, Id2 induced AEC proliferation and protected mice from lung fibrosis. By using a high-throughput screen, we found that histone deacetylase inhibitors induce Id2 expression by adult AECs. Collectively, these findings suggest that Id2 expression by AECs can be induced, and overexpression of Id2 affects AEC phenotype, leading to protection from fibrosis. PMID:25661109

Yang, Jibing; Velikoff, Miranda; Agarwal, Manisha; Disayabutr, Supparerk; Wolters, Paul J; Kim, Kevin K

2015-04-01

174

The bHLH Transcription Factor HBI1 Mediates the Trade-Off between Growth and Pathogen-Associated Molecular Pattern–Triggered Immunity in Arabidopsis[W][OPEN  

PubMed Central

The trade-off between growth and immunity is crucial for survival in plants. However, the mechanism underlying growth-immunity balance has remained elusive. The PRE-IBH1-HBI1 tripartite helix-loop-helix/basic helix-loop-helix module is part of a central transcription network that mediates growth regulation by several hormonal and environmental signals. Here, genome-wide analyses of HBI1 target genes show that HBI1 regulates both overlapping and unique targets compared with other DNA binding components of the network in Arabidopsis thaliana, supporting a role in specifying network outputs and fine-tuning feedback regulation. Furthermore, HBI1 negatively regulates a subset of genes involved in immunity, and pathogen-associated molecular pattern (PAMP) signals repress HBI1 transcription. Constitutive overexpression and loss-of-function experiments show that HBI1 inhibits PAMP-induced growth arrest, defense gene expression, reactive oxygen species production, and resistance to pathogen. These results show that HBI1, as a component of the central growth regulation circuit, functions as a major node of crosstalk that mediates a trade-off between growth and immunity in plants. PMID:24550223

Fan, Min; Bai, Ming-Yi; Kim, Jung-Gun; Wang, Tina; Oh, Eunkyoo; Chen, Lawrence; Park, Chan Ho; Son, Seung-Hyun; Kim, Seong-Ki; Mudgett, Mary Beth; Wang, Zhi-Yong

2014-01-01

175

Dynamic expression of Notch-dependent neurogenic markers in the chick embryonic nervous system  

PubMed Central

The establishment of a functional nervous system requires a highly orchestrated process of neural proliferation and differentiation. The evolutionary conserved Notch signaling pathway is a key regulator of this process, regulating basic helix-loop-helix (bHLH) transcriptional repressors and proneural genes. However, little is known about downstream Notch targets and subsequently genes required for neuronal specification. In this report, the expression pattern of Transgelin 3 (Tagln3), Chromogranin A (Chga) and Contactin 2 (Cntn2) was described in detail during early chick embryogenesis. Expression of these genes was largely restricted to the nervous system including the early axon scaffold populations, cranial ganglia and spinal motor neurons. Their temporal and spatial expression were compared with the neuronal markers Nescient Helix-Loop-Helix 1 (Nhlh1), Stathmin 2 (Stmn2) and HuC/D. We show that Tagln3 is an early marker for post-mitotic neurons whereas Chga and Cntn2 are expressed in mature neurons. We demonstrate that inhibition of Notch signaling during spinal cord neurogenesis enhances expression of these markers. This data demonstrates that Tagln3, Chga and Cntn2 represent strong new candidates to contribute to the sequential progression of vertebrate neurogenesis. PMID:25565981

Ratié, Leslie; Ware, Michelle; Jagline, Hélène; David, Véronique; Dupé, Valérie

2014-01-01

176

Basic Stamp  

NSDL National Science Digital Library

This site from Parallax, Inc. gives some information about basic stamp microcontrollers. A Basic-Stamp microcontroller is a single-board computer. Parallax makes a variety of controllers; the BASIC Stamp II uses a PIC16C57microchip.

177

HIV-1 protein-mediated amyloidogenesis in rat hippocampal cell cultures  

PubMed Central

Since the beginning of the highly active antiretroviral therapy (HAART) era, epidemiological evidence indicates an increasing incidence of Alzheimer's (AD)-like brain pathology in aging HIV patients. Emerging evidence warns of potential convergent mechanisms underlying HIV- and A?-mediated neurodegeneration. We found that HIV-1 Tat and gp 120 promote the secretion of A? 1–42 in primary rat fetal hippocampal cell cultures. Our results demonstrate that the variant of Tat expressed by the neurotropic subtype of HIV-1 virus (HIV-1 clade B) specifically induces both the release of amyloidogenic A? 1–42 and the accumulation of cell-bound amyloid aggregates. The results of the research rationalize testing of the ability of ?-amyloid aggregation inhibitors to attenuate HIV protein-mediated cognitive deficits in animal models of NeuroAIDS. The long-term goal of the study is to evaluate the potential benefits of anti-amyloidogenic therapies for management of cognitive dysfunction in aging HIV-1 patients. PMID:20363291

Aksenov, M. Y.; Aksenova, M.V.; Mactutus, C. F; Booze, R.M.

2010-01-01

178

Disruption of Protein-Mediated DNA Looping by Tension in the Substrate DNA  

PubMed Central

Protein-mediated DNA looping is important in a variety of biological processes, including gene regulation and genetic transformation. Although the biochemistry of loop formation is well established, the mechanics of loop closure in a constrained cellular environment has received less attention. Recent single molecule measurements show that mechanical constraints have a significant impact on DNA looping and motivate the need for a more comprehensive characterization of the effects of tension. By modeling DNA as a wormlike chain, we calculate how continuous stretching of the substrate DNA affects the loop formation probability. We find that when the loop size is >100 bp, a tension of 500 fN can increase the time required for loop closure by two orders of magnitude. This force is small compared to the piconewton forces that are associated with RNA polymerases and other molecular motors, indicating that intracellular mechanical forces might affect transcriptional regulation. In contrast to existing theory, we find that for loops <200 bp, the effect of tension is partly dependent on the relative orientation of the DNA-binding domains in the linker protein. Our results provide perspective on recent DNA looping experiments and suggestions for future micromechanical studies. PMID:15653717

Blumberg, Seth; Tkachenko, Alexei V.; Meiners, Jens-Christian

2005-01-01

179

Effect of Reactor Turbulence on the Binding-Protein-Mediated Aspartate Transport System in Thin Wastewater Biofilms  

PubMed Central

This research documents an effect of reactor turbulence on the ability of gram-negative wastewater biofilm bacteria to actively transport l-aspartate via a binding-protein-mediated transport system. Biofilms which were not preadapted to turbulence and which possessed two separate and distinct aspartate transport systems (systems 1 and 2) were subjected to a turbulent flow condition in a hydrodynamically defined closed-loop reactor system. A shear stress treatment of 3.1 N · m?2 for 10 min at a turbulent Reynolds number (Re = 11,297) inactivated the low-affinity, high-capacity binding-protein-mediated transport system (system 2) and resolved the high-affinity, low-capacity membrane-bound proton symport system (system 1). The Kt and Vmax values for the resolved system were statistically similar to Kt and Vmax values for system 1 when system 2 was inactivated either by osmotic shock or arsenate, two treatments which are known to inactivate binding-protein-mediated transport systems. We hypothesize that shear stress disrupts system 2 by deforming the outer membranes of the firmly adhered gram-negative bacteria. PMID:16346830

Eighmy, T. Taylor; Bishop, P. L.

1985-01-01

180

What's Basic About Basic Emotions?  

Microsoft Academic Search

A widespread assumption in theories of emotion is that there exists a small set of basic emotions. From a biological perspective, this idea is manifested in the belief that there might be neurophysiological and anatomical substrates corresponding to the basic emotions. From a psychological perspective, basic emotions are often held to be the primitive building blocks of other, nonbasic emotions.

Andrew Ortony; Terence J. Turner

1990-01-01

181

Lysophosphatidic acid prevents apoptosis in fibroblasts via G(i)-protein-mediated activation of mitogen-activated protein kinase.  

PubMed Central

Lysophosphatidic acid (LPA) is a naturally occurring phospholipid with multiple biological functions. In the present study, we demonstrate that, besides its mitogenic activity, LPA is a potent survival factor, preventing serum-deprivation-induced apoptosis in fibroblasts and other cell types. Both the proliferative effect and survival activity of LPA are sensitive to the action of pertussis toxin (PTX), indicating that both processes are mediated by G(i) protein(s). We therefore focused on the role of G(i)-protein-mediated signalling events in the promotion of cell survival by LPA. In addition to activation of mitogen-activated protein kinase (MAPK), LPA stimulates a modest PTX-sensitive phosphorylation/activation of the serine/threonine kinase Akt, a survival mediator downstream of phosphoinositide 3-kinase (PI3K). Inhibition of PI3K with LY 294002 or wortmannin resulted in a marked inhibition of LPA-induced DNA synthesis, and yet the survival activity of LPA decreased by only 20-30%, suggesting a limited input of the PI3K-Akt cascade in LPA-induced cell survival. In contrast, inhibition of MAPK activation by the MEK-1 inhibitor, PD 98059, blocked both the proliferative and survival effects of LPA. These results indicate that LPA promotes cell survival largely via G(i)-protein-mediated activation of ERK1/ERK2, or other PD 98059-sensitive member(s) of the MAPK family. PMID:11062066

Fang, X; Yu, S; LaPushin, R; Lu, Y; Furui, T; Penn, L Z; Stokoe, D; Erickson, J R; Bast, R C; Mills, G B

2000-01-01

182

Basic Finance  

NASA Technical Reports Server (NTRS)

A discussion of the basic measures of corporate financial strength, and the sources of the information is reported. Considered are: balance sheet, income statement, funds and cash flow, and financial ratios.

Vittek, J. F.

1972-01-01

183

The Basics  

ERIC Educational Resources Information Center

These articles are presented as an aide in teaching basic subjects. This issue examines reading diagnosis, food preservation, prime numbers, electromagnets, acting out in language arts, self-directed spelling activities, and resources for environmental education. (Editor/RK)

Indrisano, Roselmina; And Others

1976-01-01

184

Energy Basics  

NSDL National Science Digital Library

Demos and activities in this lesson are intended to illustrate the basic concepts of energy science—work, force, energy, power etc., and the relationships among them. The "lecture" portion of the lesson includes many demonstrations to keep students engaged, yet has high expectations for students to perform energy-related calculations and convert units. A homework assignment and quiz are provided to reinforce and assess these basic engineering science concepts.

2014-09-18

185

Basic Electricity  

NSDL National Science Digital Library

This resource, created by National Aerospace Technical Education Center (SpaceTEC), is centered on basic electricity. The presentation focuses on standards for SpaceTEC certification. Safety when using electricity is the focal point of the slides. Basic diagrams and charts illustrate the do and donâ??ts when using electrical appliances. After the discussion of safety, the presentation shifts to the fundamental aspects of electricity. Such items as current, flow, voltage and other elements are discussed. Examples are used as representations of these basic processes. Overall, this is thorough presentation of this material. It totals nearly one-hundred twenty slides in length. Instructors could use this either as a presentation or simply to enhance existing curriculum.

186

CART peptide stimulation of G protein-mediated signaling in differentiated PC12 Cells: Identification of PACAP 638 as a CART receptor antagonist  

E-print Network

CART peptide stimulation of G protein-mediated signaling in differentiated PC12 Cells o Article history: Received 8 March 2011 Accepted 21 July 2011 Keywords: CART CART peptide CART receptor CART binding GPCR PC12 cells PACAP 6­38 a b s t r a c t CART peptides are peptide

Hall, Randy A

187

Basic Horticulture.  

ERIC Educational Resources Information Center

This learning packet contains teaching suggestions and student learning materials for a course in basic horticulture aimed at preparing students for employment in a number of horticulture areas. The packet includes nine sections and twenty instructional units. Following the standard format established for Oklahoma vocational education materials in…

Geer, Barbra Farabough

188

Basic Science.  

ERIC Educational Resources Information Center

Instructional materials are provided for a course that covers basic concepts of physics and chemistry. Designed for use in a workplace literacy project developed by Mercer County Community College (New Jersey) and its partners, the course describes applications of these concepts to real-life situations, with an emphasis on applications of…

Mercer County Community Coll., Trenton, NJ.

189

Dispersion Basics  

NSDL National Science Digital Library

A webcast presentation by Dr. Timothy Spangler (Director of the COMET Program and a former air quality consultant). This 25-minute lecture provides an overview of the basics of dispersion, the effects of different atmospheric conditions on dispersion, and how dispersion is commonly modeled after an accidental release of a hazardous material.

COMET

2002-11-12

190

Basic Skills.  

ERIC Educational Resources Information Center

These four articles focus on developing basic reading, science, and job search skills: "Reading Program for Vocational Classes" by Augustus Luparelli; "Why Teach Employability Skills?" by Larry Siefferman; "Improving Vocabulary and Reading Skills" by Edythe Conway; and "Science in Everyday Life" by Virginia Eleazer and George Carney. (SK)

Luparelli, Augustus N.; And Others

1981-01-01

191

Direct Detection of Transcription Factors in Cotyledons during Seedling Development Using Sensitive Silicon-Substrate Photonic Crystal Protein Arrays1[OPEN  

PubMed Central

Transcription factors control important gene networks, altering the expression of a wide variety of genes, including those of agronomic importance, despite often being expressed at low levels. Detecting transcription factor proteins is difficult, because current high-throughput methods may not be sensitive enough. One-dimensional, silicon-substrate photonic crystal (PC) arrays provide an alternative substrate for printing multiplexed protein microarrays that have greater sensitivity through an increased signal-to-noise ratio of the fluorescent signal compared with performing the same assay upon a traditional aminosilanized glass surface. As a model system to test proof of concept of the silicon-substrate PC arrays to directly detect rare proteins in crude plant extracts, we selected representatives of four different transcription factor families (zinc finger GATA, basic helix-loop-helix, BTF3/NAC [for basic transcription factor of the NAC family], and YABBY) that have increasing transcript levels during the stages of seedling cotyledon development. Antibodies to synthetic peptides representing the transcription factors were printed on both glass slides and silicon-substrate PC slides along with antibodies to abundant cotyledon proteins, seed lectin, and Kunitz trypsin inhibitor. The silicon-substrate PC arrays proved more sensitive than those performed on glass slides, detecting rare proteins that were below background on the glass slides. The zinc finger transcription factor was detected on the PC arrays in crude extracts of all stages of the seedling cotyledons, whereas YABBY seemed to be at the lower limit of their sensitivity. Interestingly, the basic helix-loop-helix and NAC proteins showed developmental profiles consistent with their transcript patterns, indicating proof of concept for detecting these low-abundance proteins in crude extracts. PMID:25635113

Jones, Sarah I.; Tan, Yafang; Shamimuzzaman, Md; George, Sherine; Cunningham, Brian T.; Vodkin, Lila

2015-01-01

192

Basic Immunology  

NSDL National Science Digital Library

Some individuals might blanch at the idea of a "basic" immunology overview, but Professor Vladimir V. Klimov provides just such a resource on this site. As the homepage notes, the site is designed to assist undergraduate students learning about the basics of immunology through essays, images, animations, quizzes, case histories, and external links. Visitors can begin by looking over the "Table of Contents" area, which includes seven complete chapters of information. These chapters include "The Immune Responses", "Effector Activity", and "Functional Organization of the Immune System". While some of the materials on the site require a paid subscription, there's enough free material here to get students on their way to learning more about this field of study.

Klimov, Vladimir V.

193

Contour Basics  

NSDL National Science Digital Library

Contour Basics is an exercise designed to introduce students to contour plots. The Contour Activity is a great on-line resource that starts slowly and increases in difficulty. It teaches students basic techniques for generating contours, introduces students to the subtleties of generating contour plots with sparse data, provides many opportunities for students to assess their own progress and understanding and has complete on-line drawing capabilities. The exercise is geared toward atmospheric and oceanic sciences but is beneficial for all geoscience students. In addition to the exercise, this site includes information on teaching materials, teaching notes and tips, assessment suggestions and additional references. This activity is part of the Starting Point Collection: http://serc.carleton.edu/introgeo/

Ackerman, Steve

194

Aryl Hydrocarbon Receptor Control of Adaptive Immunity  

PubMed Central

The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that belongs to the family of basic helix-loop-helix transcription factors. Although the AhR was initially recognized as the receptor mediating the pathologic effects of dioxins and other pollutants, the activation of AhR by endogenous and environmental factors has important physiologic effects, including the regulation of the immune response. Thus, the AhR provides a molecular pathway through which environmental factors modulate the immune response in health and disease. In this review, we discuss the role of AhR in the regulation of the immune response, the source and chemical nature of AhR ligands, factors controlling production and degradation of AhR ligands, and the potential to target the AhR for therapeutic immunomodulation. PMID:23908379

2013-01-01

195

Proprioceptor pathway development is dependent on Math1  

NASA Technical Reports Server (NTRS)

The proprioceptive system provides continuous positional information on the limbs and body to the thalamus, cortex, pontine nucleus, and cerebellum. We showed previously that the basic helix-loop-helix transcription factor Math1 is essential for the development of certain components of the proprioceptive pathway, including inner-ear hair cells, cerebellar granule neurons, and the pontine nuclei. Here, we demonstrate that Math1 null embryos lack the D1 interneurons and that these interneurons give rise to a subset of proprioceptor interneurons and the spinocerebellar and cuneocerebellar tracts. We also identify three downstream genes of Math1 (Lh2A, Lh2B, and Barhl1) and establish that Math1 governs the development of multiple components of the proprioceptive pathway.

Bermingham, N. A.; Hassan, B. A.; Wang, V. Y.; Fernandez, M.; Banfi, S.; Bellen, H. J.; Fritzsch, B.; Zoghbi, H. Y.

2001-01-01

196

Nuclear localized protein-1 (Nulp1) increases cell death of human osteosarcoma cells and binds the X-linked inhibitor of apoptosis protein  

SciTech Connect

Nuclear localized protein-1 (Nulp1) is a recently identified gene expressed in mouse and human tissues particularly during embryonic development. Nulp1 belongs to the family of basic helix-loop-helix (bHLH) proteins that are important in development. The precise function of Nulp1 in cells is however not known. We observed that overexpression of Nulp1 induces a large increase in cell death of human osteosarcoma Saos2 cells with DNA fragmentation. In mouse N2A neuroblastoma cells Nulp1 affected cell proliferation and sensitized cells towards death induced by staurosporine. Staining using a novel antibody localized Nulp1 mainly to the cell nucleus and to some extent to the cytoplasm. Nulp1 binds the X-linked inhibitor of apoptosis protein (XIAP) and this interaction was increased during cell death. These results indicate that Nulp1 plays a role in cell death control and may influence tumor growth.

Steen, Hakan [Department of Neuroscience, Uppsala University, Biomedical Centre, Box 587, Husargatan 3, SE-75123 Uppsala (Sweden); Lindholm, Dan [Department of Neuroscience, Uppsala University, Biomedical Centre, Box 587, Husargatan 3, SE-75123 Uppsala (Sweden); Minerva Institute for Medical Research, Biomedicum Helsinki, Helsinki (Finland)], E-mail: dan.lindholm@neuro.uu.se

2008-02-08

197

A conserved domain in the transcription factor ITF-2B attenuates its activity.  

PubMed

The immunoglobulin transcription factor-2B (ITF-2B) belongs to the basic helix-loop-helix (bHLH) family of transcription factors. It is ubiquitously expressed and plays a prominent role in the regulation of differentiation processes. Protein sequence alignment of the closely related bHLH transcription factors ITF-2B, HeLa E box protein (HITF4), and the E2A proteins E12 and E47 revealed the presence of a highly conserved protein domain. Functional analysis of this domain demonstrated that it plays an important role in repressing the transcriptional activity of the ITF-2B protein. Moreover, this domain comprises a self-contained transcriptional repressor whose activity depends on specific amino acid residues. PMID:18371301

Herbst, A; Kolligs, F T

2008-05-30

198

The proneural gene amos promotes multiple dendritic neuron formation in the Drosophila peripheral nervous system.  

PubMed

In the Drosophila peripheral nervous system, proneural genes direct the formation of different types of sensory organs. Here, we show that amos is a novel proneural gene that promotes multiple dendritic (MD) neuron formation. amos encodes a basic-helix-loop-helix (bHLH) protein of the Atonal family. During embryonic development, amos is expressed in patches of ectodermal cells, and the expression is quickly restricted to sensory organ precursors. Loss of amos function eliminates MD neurons that remain in ASC;atonal mutants. Misexpression of amos generates ectopic MD and other types of neurons. Amos interacts with the ubiquitously expressed Daughter-less protein in vivo and in vitro. Our final misexpression experiments suggest that a domain located outside the DNA-binding domain of Amos determines the MD neuronal specificity. PMID:10707972

Huang, M L; Hsu, C H; Chien, C T

2000-01-01

199

The Drosophila proneural gene amos promotes olfactory sensillum formation and suppresses bristle formation.  

PubMed

Proneural genes encode basic-helix-loop-helix (bHLH) transcription factors required for neural precursor specification. Recently amos was identified as a new candidate Drosophila proneural gene related to atonal. Having isolated the first specific amos loss-of-function mutations, we show definitively that amos is required to specify the precursors of two classes of olfactory sensilla. Unlike other known proneural mutations, a novel characteristic of amos loss of function is the appearance of ectopic sensory bristles in addition to loss of olfactory sensilla, owing to the inappropriate function of scute. This supports a model of inhibitory interactions between proneural genes, whereby ato-like genes (amos and ato) must suppress sensory bristle fate as well as promote alternative sense organ subtypes. PMID:12925594

zur Lage, Petra I; Prentice, David R A; Holohan, Eimear E; Jarman, Andrew P

2003-10-01

200

Direct roles of SPEECHLESS in the specification of stomatal self-renewing cells  

PubMed Central

Lineage-specific stem cells are critical for the production and maintenance of specific cell types and tissues in multicellular organisms. In Arabidopsis, the initiation and proliferation of stomatal lineage cells is controlled by the basic helix-loop-helix transcription factor SPEECHLESS (SPCH). SPCH-driven asymmetric and self-renewing divisions allow flexibility in stomatal production and overall organ growth. How SPCH directs stomatal lineage cell behaviors, however, is unclear. Here, we improved the chromatin immunoprecipitation (ChIP) assay and profiled the genome-wide targets of Arabidopsis SPCH in vivo. We found that SPCH controls key regulators of cell fate and asymmetric cell divisions and modulates responsiveness to peptide and phytohormone-mediated intercellular communication. Our results delineate the molecular pathways that regulate an essential adult stem cell lineage in plants. PMID:25190717

Lau, On Sun; Davies, Kelli A.; Chang, Jessica; Adrian, Jessika; Rowe, Matthew H.; Ballenger, Catherine E.; Bergmann, Dominique C.

2015-01-01

201

Flavonoids: biosynthesis, biological functions, and biotechnological applications  

PubMed Central

Flavonoids are widely distributed secondary metabolites with different metabolic functions in plants. The elucidation of the biosynthetic pathways, as well as their regulation by MYB, basic helix-loop-helix (bHLH), and WD40-type transcription factors, has allowed metabolic engineering of plants through the manipulation of the different final products with valuable applications. The present review describes the regulation of flavonoid biosynthesis, as well as the biological functions of flavonoids in plants, such as in defense against UV-B radiation and pathogen infection, nodulation, and pollen fertility. In addition, we discuss different strategies and achievements through the genetic engineering of flavonoid biosynthesis with implication in the industry and the combinatorial biosynthesis in microorganisms by the reconstruction of the pathway to obtain high amounts of specific compounds. PMID:23060891

Falcone Ferreyra, María L.; Rius, Sebastián P.; Casati, Paula

2012-01-01

202

Twist-BRD4 complex: potential drug target for basal-like breast cancer.  

PubMed

As an important basic helix-loop-helix (bHLH) transcription factor, Twist associates with several physiological processes such as mesodermal development, and pathological processes such as Saethre-Chotzen syndrome. During cancer progression, Twist induces epithelial-mesenchymal transition (EMT), potentiating cancer cell invasion and metastasis. Although many studies have revealed its multiple biological roles, it remained unclear how Twist transcriptionally activates targeted genes. Recently we discovered tip60-mediated Twist di-acetylation in the ''histone H4-mimic'' GK-X-GK motif. The di-acetylated Twist recruits BRD4 and related transcriptional components to super-enhancer of its targeted genes during progression of basal-like breast cancer (BLBC). Here, we review this new advance of regulation and functional mechanism of Twist. PMID:25506891

Shi, Jian; Cao, Jingying; Zhou, Binhua P

2015-01-01

203

TWIST and ovarian cancer stem cells: implications for chemoresistance and metastasis.  

PubMed

The transcription factor TWIST1 is a highly evolutionally conserved basic Helix-Loop-Helix (bHLH) transcription factor that functions as a master regulator of gastrulation and mesodermal development. Although TWIST1 was initially associated with embryo development, an increasing number of studies have shown TWIST1 role in the regulation of tissue homeostasis, primarily as a regulator of inflammation. More recently, TWIST1 has been found to be involved in the process of tumor metastasis through the regulation of Epithelial Mesenchymal Transition (EMT). The objective of this review is to examine the normal functions of TWIST1 and its role in tumor development, with a particular focus on ovarian cancer. We discuss the potential role of TWIST1 in the context of ovarian cancer stem cells and its influence in the process of tumor formation. PMID:25238494

Nuti, Sudhakar V; Mor, Gil; Li, Peiyao; Yin, Gang

2014-09-15

204

Id: A Target of BMP Signaling  

NSDL National Science Digital Library

Cytokines of the transforming growth factor-? (TGF-?) superfamily transduce their signals by activating receptor-regulated Smads (R-Smads). Distinct R-Smads or combinations of R-Smads are activated by TGF-?, activin, or bone morphogenetic proteins (BMPs). R-Smads activated by BMPs induce expression of Id proteins, which act as inhibitors of differentiation and stimulators of cell growth by inhibiting the function of basic helix-loop-helix transcription factors. In endothelial cells, TGF-? binds to two distinct type I receptor serine-threonine kinases, ALK-5 and ALK-1; the latter activates the same R-Smads that are activated by BMP and induces synthesis of Id (inhibitor of differentation or inhibitor of DNA binding) proteins. Growing evidence suggests that Id proteins may play crucial roles in angiogenesis, neurogenesis, and osteogenesis and act as key molecules in regulating biological responses induced by BMPs and TGF-?.

Kohei Miyazono (University of Tokyo; Department of Molecular Pathology, Graduate School of Medicine REV)

2002-09-24

205

Clockwork orange encodes a transcriptional repressor important for circadian-clock amplitude in Drosophila.  

PubMed

Gene transcription is a central timekeeping process in animal clocks. In Drosophila, the basic helix-loop helix (bHLH)-PAS transcription-factor heterodimer, CLOCK/CYCLE (CLK/CYC), transcriptionally activates the clock components period (per), timeless (tim), Par domain protein 1 (Pdp1), and vrille (vri), which feed back and regulate distinct features of CLK/CYC function. Microarray studies have identified numerous rhythmically expressed transcripts, some of which are potential direct CLK targets. Here we demonstrate a circadian function for one such target, a bHLH-Orange repressor, CG17100/CLOCKWORK ORANGE (CWO). cwo is rhythmically expressed, and levels are reduced in Clk mutants, suggesting that cwo is CLK activated in vivo. cwo mutants display reduced-amplitude molecular and behavioral rhythms with lengthened periods. Molecular analysis suggests that CWO acts, in part, by repressing CLK target genes. We propose that CWO acts as a transcriptional and behavioral rhythm amplifier. PMID:17555964

Lim, Chunghun; Chung, Brian Y; Pitman, Jena L; McGill, Jermaine J; Pradhan, Suraj; Lee, Jongbin; Keegan, Kevin P; Choe, Joonho; Allada, Ravi

2007-06-19

206

Evolutionary aspects of variability in bHLH orthologous families: insights from the pearl oyster, Pinctada fucata.  

PubMed

Basic helix-loop-helix (bHLH) transcription factors play significant roles in multiple biological processes in metazoan cells. In recent work, we showed that three orthologous HLH families, pearl, amber, and peridot, have apparently been lost in the Drosophila melanogaster, Caenorhabditis elegans, and Homo sapiens lineages. To further address the gain and loss of bHLH proteins during bilaterian evolution, we examined the genome of the pearl oyster, Pinctada fucata, which has recently been sequenced. We characterized the putative full set 65 bHLH genes and showed that genes previously categorized into the orthologous family PTFb, actually fall into two distinct orthologous families, 48-related-1 and 48-related-2. We also identified a novel orthologous family, clockwork orange. Based on these newly identified orthologous family members and on orphan bHLH factors, we propose that genes encoding bHLH factors in bilaterians are not as evolutionarily stable as previously thought. PMID:24125650

Gyoja, Fuki; Satoh, Nori

2013-10-01

207

Three redundant brassinosteroid early response genes encode putative bHLH transcription factors required for normal growth.  

PubMed Central

Brassinosteroids (BRs) are a class of polyhydroxylated steroids that are important regulators of plant growth and development. We have identified three closely related basic helix-loop-helix (bHLH) transcription factors, BEE1, BEE2, and BEE3, as products of early response genes required for full BR response. Comparison of the phenotypes of plants that overexpress BEE1 with bee1 bee2 bee3 triple-knockout mutant plants suggests that BEE1, BEE2, and BEE3 are functionally redundant positive regulators of BR signaling. Expression of BEE1, BEE2, and BEE3 is also regulated by other hormones, notably abscisic acid (ABA), a known antagonist of BR signaling. Reduced ABA response in plants overexpressing BEE1 suggests that BEE proteins may function as signaling intermediates in multiple pathways. PMID:12454087

Friedrichsen, Danielle M; Nemhauser, Jennifer; Muramitsu, Takamichi; Maloof, Julin N; Alonso, José; Ecker, Joseph R; Furuya, Masaki; Chory, Joanne

2002-01-01

208

Proteasome-dependent Degradation of Transcription Factor Activating Enhancer-binding Protein 4 (TFAP4) Controls Mitotic Division*  

PubMed Central

TFAP4, a basic helix-loop-helix transcription factor that regulates the expression of a multitude of genes involved in the regulation of cellular proliferation, stemness, and epithelial-mesenchymal transition, is up-regulated in colorectal cancer and a number of other human malignancies. We have found that, during the G2 phase of the cell division cycle, TFAP4 is targeted for proteasome-dependent degradation by the SCF?TrCP ubiquitin ligase. This event requires phosphorylation of TFAP4 on a conserved degron. Expression of a stable TFAP4 mutant unable to interact with ?TrCP results in a number of mitotic defects, including chromosome missegregation and multipolar spindles, which eventually lead to the activation of the DNA damage response. Our findings reveal that ?TrCP-dependent degradation of TFAP4 is required for the fidelity of mitotic division. PMID:24500709

D'Annibale, Sara; Kim, Jihoon; Magliozzi, Roberto; Low, Teck Yew; Mohammed, Shabaz; Heck, Albert J. R.; Guardavaccaro, Daniele

2014-01-01

209

The Notch pathway inhibits TGF? signaling in breast cancer through HEYL-mediated crosstalk.  

PubMed

Acquired resistance to TGF? is a key step in the early stages of tumorigenesis. Mutations in TGF? signaling components are rare, and little is known about the development of resistance in breast cancer. On the other hand, an activated Notch pathway is known to play a substantial role in promoting breast cancer development. Here, we present evidence of crosstalk between these two pathways through HEYL. HEYL, a basic helix-loop-helix transcription factor and a direct target of Notch signaling, is specifically overexpressed in breast cancer. HEYL represses TGF? activity by binding to TGF?-activated Smads. HeyL(-/-) mice have defective mammary gland development with fewer terminal end buds. On the other hand, HeyL transgenic mice show accelerated mammary gland epithelial proliferation and 24% of multiparous mice develop mammary gland cancer. Therefore, repression of TGF? signaling by Notch acting through HEYL may promote initiation of breast cancer. PMID:25217524

Han, Liangfeng; Diehl, Adam; Nguyen, Nguyen K; Korangath, Preethi; Teo, Weiwen; Cho, Soonweng; Kominsky, Scott; Huso, David L; Feigenbaum, Lionel; Rein, Alan; Argani, Pedram; Landberg, Goran; Gessler, Manfred; Sukumar, Saraswati

2014-11-15

210

Unique CCT repeats mediate transcription of the TWIST1 gene in mesenchymal cell lines  

SciTech Connect

TWIST1, a basic helix-loop-helix transcription factor, plays critical roles in embryo development, cancer metastasis and mesenchymal progenitor differentiation. Little is known about transcriptional regulation of TWIST1 expression. Here we identified DNA sequences responsible for TWIST1 expression in mesenchymal lineage cell lines. Reporter assays with TWIST1 promoter mutants defined the -102 to -74 sequences that are essential for TWIST1 expression in human and mouse mesenchymal cell lines. Tandem repeats of CCT, but not putative CREB and NF-{kappa}B sites in the sequences substantially supported activity of the TWIST1 promoter. Electrophoretic mobility shift assay demonstrated that the DNA sequences with the CCT repeats formed complexes with nuclear factors, containing, at least, Sp1 and Sp3. These results suggest critical implication of the CCT repeats in association with Sp1 and Sp3 factors in sustaining expression of the TWIST1 gene in mesenchymal cells.

Ohkuma, Mizue [Maxillofacial Orthognathics, Graduate School, Tokyo Medical and Dental University, Tokyo 113-8549 (Japan); Human Gene Sciences Center, Tokyo Medical and Dental University, Tokyo 113-8510 (Japan); Funato, Noriko [Maxillofacial Orthognathics, Graduate School, Tokyo Medical and Dental University, Tokyo 113-8549 (Japan); Higashihori, Norihisa [Maxillofacial Orthognathics, Graduate School, Tokyo Medical and Dental University, Tokyo 113-8549 (Japan); Murakami, Masanori [Human Gene Sciences Center, Tokyo Medical and Dental University, Tokyo 113-8510 (Japan); Ohyama, Kimie [Maxillofacial Orthognathics, Graduate School, Tokyo Medical and Dental University, Tokyo 113-8549 (Japan); Nakamura, Masataka [Human Gene Sciences Center, Tokyo Medical and Dental University, Tokyo 113-8510 (Japan)]. E-mail: naka.gene@cmn.tmd.ac.jp

2007-01-26

211

Mutated ?-catenin evades a microRNA-dependent regulatory loop  

PubMed Central

hsa-mir-483 is located within intron 2 of the IGF2 gene. We have previously shown oncogenic features of miR-483-3p through cooperation with IGF2 or by independently targeting the proapoptotic gene BBC3/PUMA. Here we demonstrate that expression of miR-483 can be induced independently of IGF2 by the oncoprotein ?-catenin through an interaction with the basic helix–loop–helix protein upstream stimulatory transcription factor 1. We also show that ?-catenin itself is a target of miR-483-3p, triggering a negative regulatory loop that becomes ineffective in cells harboring an activating mutation of ?-catenin. These results provide insights into the complex regulation of the IGF2/miR-483 locus, revealing players in the ?-catenin pathway. PMID:21383185

Veronese, Angelo; Visone, Rosa; Consiglio, Jessica; Acunzo, Mario; Lupini, Laura; Kim, Taewan; Ferracin, Manuela; Lovat, Francesca; Miotto, Elena; Balatti, Veronica; D'Abundo, Lucilla; Gramantieri, Laura; Bolondi, Luigi; Pekarsky, Yuri; Perrotti, Danilo; Negrini, Massimo; Croce, Carlo M.

2011-01-01

212

The conserved WRPW motif of Hes6 mediates proteasomal degradation  

SciTech Connect

Hes6 belongs to a subfamily of basic helix-loop-helix transcription factors that includes Drosophila Hairy and Enhancer of split genes. Like other members of the family, Hes6 features the WRPW motif which is consisted just of four amino acids at its C-terminus. Here, we show that WRPW motif deletion mutant protein is substantially stabilized in comparison to the full length protein and that the enhanced stability is due to its resistance to proteasomal degradation. The WRPW motif also appears to be sufficient for acceleration of proteolysis as its fusion to two heterologous proteins, the green fluorescent protein (GFP) of Aequoria victoria and Gal4 DNA binding domain of Saccharomyces cerevisiae, significantly destabilized the proteins. These findings demonstrate a novel function of this conserved motif as a degradation signal and raise the possibility of utilizing it for controlling the level of ectopically expressed gene products.

Kang, Seon Ah [Division of Molecular Life Sciences and Center for Cell Signaling Research, Ewha Womans University, 11-1 Daehyun-dong, Seodaemun-gu, Seoul 120-750 (Korea, Republic of); Seol, Jae Hong [Seoul National University School of Biological Sciences, San 56-1, Shillim-dong, Kwanak-gu, Seoul 151-742 (Korea, Republic of); Kim, Jaesang [Division of Molecular Life Sciences and Center for Cell Signaling Research, Ewha Womans University, 11-1 Daehyun-dong, Seodaemun-gu, Seoul 120-750 (Korea, Republic of)]. E-mail: jkim1964@ewha.ac.kr

2005-06-24

213

Identification of soybean MYC2-like transcription factors and overexpression of GmMYC1 could stimulate defense mechanism against common cutworm in transgenic tobacco.  

PubMed

MYC2 is a basic helix-loop-helix Leu zipper transcription factor (TF). Here, 22 putative soybean MYC-like TFs were identified bioinformatically. Of these TFs, seven MYC2-like genes without introns were isolated and characterized. All seven GmMYCs displayed transactivation activity in yeast cells. Six genes (excepting GmMYC3) were expressed in the roots, stems, leaves, flowers, and seed wall but not in the developing seeds and up-regulated after insect feeding. The GmMYC1 transgenic tobacco rejected common cutworm (CCW, Spodoptera litura Fabricius) more strongly and lost less leaf area than the control (2.94 ± 2.36 vs 7.84 ± 4.63 cm(2)). The average relative growth rate of CCW feeding on transgenic tobacco leaves was lower than on control tobacco leaves (136 ± 60 vs 271 ± 76 %). These results indicated that GmMYC could stimulate the defense mechanism against insects in plants. PMID:24863293

Wang, Hui; Ding, Changwen; Du, Haiping; Liu, Hailun; Wang, Yongli; Yu, Deyue

2014-09-01

214

Network Theory Inspired Analysis of Time-Resolved Expression Data Reveals Key Players Guiding P. patens Stem Cell Development  

PubMed Central

Transcription factors (TFs) often trigger developmental decisions, yet, their transcripts are often only moderately regulated and thus not easily detected by conventional statistics on expression data. Here we present a method that allows to determine such genes based on trajectory analysis of time-resolved transcriptome data. As a proof of principle, we have analysed apical stem cells of filamentous moss (P. patens) protonemata that develop from leaflets upon their detachment from the plant. By our novel correlation analysis of the post detachment transcriptome kinetics we predict five out of 1,058 TFs to be involved in the signaling leading to the establishment of pluripotency. Among the predicted regulators is the basic helix loop helix TF PpRSL1, which we show to be involved in the establishment of apical stem cells in P. patens. Our methodology is expected to aid analysis of key players of developmental decisions in complex plant and animal systems. PMID:23637751

Busch, Hauke; Boerries, Melanie; Rensing, Stefan A.

2013-01-01

215

Inhibition of Tcf3 Binding by I-mfa Domain Proteins  

PubMed Central

We have determined that I-mfa, an inhibitor of several basic helix-loop-helix (bHLH) proteins, and XIC, a Xenopus ortholog of human I-mf domain-containing protein that shares a highly conserved cysteine-rich C-terminal domain with I-mfa, inhibit the activity and DNA binding of the HMG box transcription factor XTcf3. Ectopic expression of I-mfa or XIC in early Xenopus embryos inhibited dorsal axis specification, the expression of the Tcf3/?-catenin-regulated genes siamois and Xnr3, and the ability of ?-catenin to activate reporter constructs driven by Lef/Tcf binding sites. I-mfa domain proteins can regulate both the Wnt signaling pathway and a subset of bHLH proteins, possibly coordinating the activities of these two critical developmental pathways. PMID:11238923

Snider, Lauren; Thirlwell, Hilary; Miller, Jeffrey R.; Moon, Randall T.; Groudine, Mark; Tapscott, Stephen J.

2001-01-01

216

Myc-Nick: The Force Behind c-Myc  

NSDL National Science Digital Library

In the field of molecular oncology, the Myc basic helix-loop-helix family of transcription factors has been extensively studied. The Myc proto-oncogene c-Myc binds DNA, activates or represses gene transcription, and consequently affects cellular proliferation. However, emerging evidence presents the existence of c-Myc variants that lack transcriptional activity. A cytoplasmic variant of c-Myc called “Myc-nick,” which arises from calpain-mediated cleavage of c-Myc, assists in stable microtubule assembly. Furthermore, Myc-nick promotes MyoD-mediated myogenic differentiation, thus antagonizing its precursor. These results provide exciting new opportunities in formulating molecular approaches for treatment of cancer and in our understanding of cell differentiation.

Kambiz Mousavi (Musculoskeletal and Skin Diseases; National Institute of Arthritis REV)

2010-12-14

217

A mutually assured destruction mechanism attenuates light signaling in Arabidopsis.  

PubMed

After light-induced nuclear translocation, phytochrome photoreceptors interact with and induce rapid phosphorylation and degradation of basic helix-loop-helix transcription factors, such as PHYTOCHROME-INTERACTING FACTOR 3 (PIF3), to regulate gene expression. Concomitantly, this interaction triggers feedback reduction of phytochrome B (phyB) levels. Light-induced phosphorylation of PIF3 is necessary for the degradation of both proteins. We report that this PIF3 phosphorylation induces, and is necessary for, recruitment of LRB [Light-Response Bric-a-Brack/Tramtrack/Broad (BTB)] E3 ubiquitin ligases to the PIF3-phyB complex. The recruited LRBs promote concurrent polyubiqutination and degradation of both PIF3 and phyB in vivo. These data reveal a linked signal-transmission and attenuation mechanism involving mutually assured destruction of the receptor and its immediate signaling partner. PMID:24904166

Ni, Weimin; Xu, Shou-Ling; Tepperman, James M; Stanley, David J; Maltby, Dave A; Gross, John D; Burlingame, Alma L; Wang, Zhi-Yong; Quail, Peter H

2014-06-01

218

Rat monoclonal antibody specific for MyoD.  

PubMed

Myogenic determination 1 (MyoD) is a myogenic regulatory factor (MRF) possessing a basic domain and a helix-loop-helix domain. MRFs play a critical role in myoblast fate and terminal differentiation. MyoD is a transcriptional factor that induces transcription by binding with gene regulatory factors expressed in skeletal muscle. As a master gene, MyoD also determines skeletal muscle differentiation. In this study, we established a monoclonal antibody specific for MyoD using the rat medial iliac lymph node method. Immunoblot analysis revealed that our monoclonal antibody against MyoD could identify full-length MyoD. Moreover, immunocytochemical staining revealed a change in the expression of MyoD at the skeletal muscle differentiation stage. This monoclonal antibody against MyoD allows for further studies to elucidate the mechanism by which MyoD influences skeletal muscle differentiation. PMID:20569002

Harada, Akihito; Ohkawa, Yasuyuki; Ao, Shinpei; Odawara, Jun; Okada, Seiji; Azuma, Masayuki; Nishiyama, Yuko; Nakamura, Mako; Tachibana, Taro

2010-06-01

219

Inubosins A, B, and C Are Acridine Alkaloids Isolated from a Culture of Streptomyces sp. IFM 11440 with Ngn2 Promoter Activity.  

PubMed

Three new acridine alkaloids, inubosins A (1), B (2), and C (3), were isolated from an extract of a culture of Streptomyces sp. IFM 11440 using bioassay-guided fractionation. Neurogenin2 (Ngn2) is an activator-type basic helix-loop-helix transcription factor that promotes neural stem cell differentiation. Using cell-based Ngn2 promoter activity-guided screening, Streptomyces sp. IFM 11440 was found to induce Ngn2 promoter activity. The structures of 1-3 were established using spectroscopic methods, including 1D- and 2D-NMR measurements. Inubosin B (2) showed potent Ngn2 promoter activity. Moreover, inubosin B (2) increased mRNA expression of genes related to neural stem cell differentiation. PMID:25621736

Arai, Midori A; Koryudzu, Kazune; Ishibashi, Masami

2015-02-27

220

Tremor (Beyond the Basics)  

MedlinePLUS

... Basics) Patient information: Myoclonus (The Basics) Patient information: Fragile X syndrome (The Basics) Beyond the Basics — Beyond the ... of Parkinson disease Overview of tremor Patient information: Fragile X syndrome (The Basics) Patient information: Myoclonus (The Basics) ...

221

Citrus tristeza virus p23: a unique protein mediating key virus–host interactions  

PubMed Central

The large RNA genome of Citrus tristeza virus (CTV; ca. 20 kb) contains 12 open reading frames, with the 3?-terminal one corresponding to a protein of 209 amino acids (p23) that is expressed from an abundant subgenomic RNA. p23, an RNA-binding protein with a putative zinc-finger domain and some basic motifs, is unique to CTV because no homologs have been found in other closteroviruses, including the type species of the genus Beet yellows virus (despite both viruses having many homologous genes). Consequently, p23 might have evolved for the specific interaction of CTV with its citrus hosts. From a functional perspective p23 has been involved in many roles: (i) regulation of the asymmetrical accumulation of CTV RNA strands, (ii) induction of the seedling yellows syndrome in sour orange and grapefruit, (iii) intracellular suppression of RNA silencing, (iv) elicitation of CTV-like symptoms when expressed ectopically as a transgene in several Citrus spp., and (v) enhancement of systemic infection (and virus accumulation) in sour orange and CTV release from the phloem in p23-expressing transgenic sweet and sour orange. Moreover, transformation of Mexican lime with intron-hairpin constructs designed for the co-inactivation of p23 and the two other CTV silencing suppressors results in complete resistance against the homologous virus. From a cellular point of view, recent data indicate that p23 accumulates preferentially in the nucleolus, being the first closterovirus protein with such a subcellular localization, as well as in plasmodesmata. These major accumulation sites most likely determine some of the functional roles of p23. PMID:23653624

Flores, Ricardo; Ruiz-Ruiz, Susana; Soler, Nuria; Sánchez-Navarro, Jesús; Fagoaga, Carmen; López, Carmelo; Navarro, Luis; Moreno, Pedro; Peña, Leandro

2013-01-01

222

Basically Acids  

NSDL National Science Digital Library

Students learn the basics of acid/base chemistry in a fun, interactive way by studying instances of acid/base chemistry found in popular films such as Harry Potter and the Prisoner of Azkaban and National Treasure. Students learn what acids, bases and indicators are and how they can be used, including invisible ink. They also learn how engineers use acids and bases every day to better our quality of life. Students' interest is piqued by the use of popular culture in the classroom.

2014-09-18

223

GPS Basics  

NSDL National Science Digital Library

The Federal Aviation Administration maintains the graphically impressive Global Positioning System (GPS) Basics Web site. From the history of the global positioning system and how it works to governmental policy that controls its use, this site does a good job of explaining all facets of what GPS is about without being overly technical. Interested visitors can explore some of the other links that cover satellite navigation topics as well, such as GPS programs; a library of documents, fact sheets, press releases, and news; frequently asked questions; links; and more. Anyone interested in mapping, navigation, or similar subjects will enjoy exploring the interesting information provided on this well designed site.

224

Id1 expression promotes T regulatory cell differentiation by facilitating TCR costimulation.  

PubMed

T regulatory (Treg) cells play crucial roles in the regulation of cellular immunity. The development of Treg cells depends on signals from TCRs and IL-2Rs and is influenced by a variety of transcription factors. The basic helix-loop-helix proteins are known to influence TCR signaling thresholds. Whether this property impacts Treg differentiation is not understood. In this study, we interrogated the role of basic helix-loop-helix proteins in the production of Treg cells using the CD4 promoter-driven Id1 transgene. We found that Treg cells continued to accumulate as Id1 transgenic mice aged, resulting in a significant increase in Treg cell counts in the thymus as well as in the periphery compared with wild-type controls. Data from mixed bone marrow assays suggest that Id1 acts intrinsically on developing Treg cells. We made a connection between Id1 expression and CD28 costimulatory signaling because Id1 transgene expression facilitated the formation of Treg precursors in CD28(-/-) mice and the in vitro differentiation of Treg cells on thymic dendritic cells despite the blockade of costimulation by anti-CD80/CD86. Id1 expression also allowed in vitro Treg differentiation without anti-CD28 costimulation, which was at least in part due to enhanced production of IL-2. Notably, with full strength of costimulatory signals, however, Id1 expression caused modest but significant suppression of Treg induction. Finally, we demonstrate that Id1 transgenic mice were less susceptible to the induction of experimental autoimmune encephalomyelitis, thus illustrating the impact of Id1-mediated augmentation of Treg cell levels on cellular immunity. PMID:24920844

Liu, Chen; Wang, Hong-Cheng; Yu, Sen; Jin, Rong; Tang, Hui; Liu, Yuan-Feng; Ge, Qing; Sun, Xiao-Hong; Zhang, Yu

2014-07-15

225

Characterization of msim, a murine homologue of the Drosophila sim transcription factor  

SciTech Connect

Mutations in the Drosophila single-minded (sim) gene result in loss of precursor cells that give rise to midline cells of the embryonic central nervous system. During the course of an exon-trapping strategy aimed at identifying transcripts that contribute to the etiology and pathophysiology of Down syndrome, we identified a human exon from the Down syndrome, we identified a human exon from the Down syndrome critical region showing significantly homology to the Drosophila sim gene. Using a cross-hybridization approach, we have isolated a murine homolog of Drosophila sim gene, which we designated msim. Nucleotide and predicted amino acid sequence analyses of msim cDNA clones indicate the this gene encodes a member of the basic-helix-loop-helix class of transcription factors. The murine and Drosophila proteins share 88% residues within the basic-helix-loop helix domain, with an overall homology of 92%. In addition, the N-terminal domain of MSIM contains two PAS dimerization motifs also featured in the Drosophila sim gene product, as well as a small number of other transcription factors. Northern blot analysis of adult murine tissues revealed that the msim gene produces a single mRNA species of {approximately}4 kb expressed in a small number of tissues, with the highest levels in the kidneys and lower levels present in skeletal muscle, lung, testis, brain, and heart. In situ hybridization experiments demonstrate that msim is also expressed in early fetal development in the central nervous system and in cartilage primordia. The characteristics of the msim gene are consistent with its putative function as a transcriptional regulator. 51 refs., 6 figs., 1 tab.

Moffett, P.; Reece, M.; Pelletier, J. [McGill Univ., Quebec (Canada)] [and others] [McGill Univ., Quebec (Canada); and others

1996-07-01

226

The delta-crystallin enhancer-binding protein delta EF1 is a repressor of E2-box-mediated gene activation.  

PubMed Central

The repressor delta EF1 was discovered by its action on the DC5 fragment of the lens-specific delta 1-crystallin enhancer. C-proximal zinc fingers of delta EF1 were found responsible for binding to the DC5 fragment and had specificity to CACCT as revealed by selection of high-affinity binding sequences from a random oligonucleotide pool. CACCT is present not only in DC5 but also in the E2 box (CACCTG) elements which are the binding sites of various basic helix-loop-helix activators and also the target of an unidentified repressor, raising the possibility that delta EF1 accounts for the E2 box repressor activity. delta EF1 competed with E47 for binding to an E2 box sequence in vitro. In lymphoid cells, endogenous delta EF1 activity as a repressor was detectable, and exogenous delta EF1 repressed immunoglobulin kappa enhancer by binding to the kappa E2 site. Moreover, delta EF1 repressed MyoD-dependent activation of the muscle creatine kinase enhancer and MyoD-induced myogenesis of 10T1/2 cells. Thus, delta EF1 counteracts basic helix-loop-helix activators through binding site competition and fulfills the conditions of the E2 box repressor. In embryonic tissues, the most prominent site of delta EF1 expression is the myotome. Myotomal expression as well as the above results argues for a significant contribution of delta EF1 in regulation of embryonic myogenesis through the modulation of the actions of MyoD family proteins. Images PMID:8065305

Sekido, R; Murai, K; Funahashi, J; Kamachi, Y; Fujisawa-Sehara, A; Nabeshima, Y; Kondoh, H

1994-01-01

227

Cloning of an Alpha-TFEB fusion in renal tumors harboring the t(6;11)(p21;q13) chromosome translocation  

PubMed Central

MITF, TFE3, TFEB, and TFEC comprise a transcription factor family (MiT) that regulates key developmental pathways in several cell lineages. Like MYC, MiT members are basic helix-loop-helix-leucine zipper transcription factors. MiT members share virtually perfect homology in their DNA binding domains and bind a common DNA motif. Translocations of TFE3 occur in specific subsets of human renal cell carcinomas and in alveolar soft part sarcomas. Although multiple translocation partners are fused to TFE3, each translocation product retains TFE3's basic helix–loop–helix leucine zipper. We have identified the genes fused by the chromosomal translocation t(6;11)(p21.1;q13), characteristic of another subset of renal neoplasms. In two primary tumors we found that Alpha, an intronless gene, rearranges with the first intron of TFEB, just upstream of TFEB's initiation ATG, preserving the entire TFEB coding sequence. Fluorescence in situ hybridization confirmed the involvement of both TFEB and Alpha in this translocation. Although the Alpha promoter drives expression of this fusion gene, the Alpha gene does not contribute to the ORF. Whereas TFE3 is typically fused to partner proteins in subsets of renal tumors, we found that wild-type, unfused TFE3 stimulates clonogenic growth in a cell-based assay, suggesting that dysregulated expression, rather than altered function of TFEB or TFE3 fusions, may confer neoplastic properties, a mechanism reminiscent of MYC activation by promoter substitution in Burkitt's lymphoma. Alpha-TFEB is thus identified as a fusion gene in a subset of pediatric renal neoplasms. PMID:12719541

Davis, Ian J.; Hsi, Bae-Li; Arroyo, Jason D.; Vargas, Sara O.; Yeh, Y. Albert; Motyckova, Gabriela; Valencia, Patricia; Perez-Atayde, Antonio R.; Argani, Pedram; Ladanyi, Marc; Fletcher, Jonathan A.; Fisher, David E.

2003-01-01

228

Transcriptional activity of TAL1 in T cell acute lymphoblastic leukemia (T-ALL) requires RBTN1 or -2 and induces TALLA1, a highly specific tumor marker of T-ALL.  

PubMed

TAL1, which is frequently activated in T cell acute lymphoblastic leukemia (T-ALL), encodes lineage-specific basic helix-loop-helix (bHLH) proteins that bind specifically to E-box DNA motif upon dimerization with ubiquitous basic helix-loop-helix proteins E47 or E12. RBTN1 and RBTN2, also frequently activated in T-ALL, encode proteins only with tandem cysteine-rich LIM domains. We found that aberrant expression of TAL1 detected in 11 out of 14 T-ALL cell lines was invariably accompanied by that of either RBTN1 or RBTN2. Forced expression of TAL1 together with RBTN1 or RBTN2, but not TAL1 alone, strongly induced artificial reporter genes in a TAL1/RBTN-negative T-ALL cell line, HPB-ALL. Such collaborative transcriptional activity of TAL1 and RBTN was not, however, observed in non-T cell lines, suggesting further involvement of some T cell-specific cofactors. In this context, we carried out preliminary evaluation of a potential role of the T cell-specific GATA-binding protein, GATA3, in the transcriptional activity of TAL1 and RBTN. We also showed that coexpression of TAL1 and RBTN1 in HPB-ALL strongly induced TALLA1, a highly specific T-ALL marker whose positivity correlated 100% with ectopic expression of TAL1 among various T-ALL cell lines. Collectively, ectopic TAL1 and RBTN1 or -2, together with some endogenous T cell-specific cofactors like GATA3, constitute a highly collaborative set of transcription factors whose aberrant activity in T cells may lead to leukemogenesis by modulating expression of downstream genes such as TALLA1. PMID:9020185

Ono, Y; Fukuhara, N; Yoshie, O

1997-02-14

229

Differentiated embryo-chondrocyte expressed gene 1 regulates p53-dependent cell survival versus cell death through macrophage inhibitory cytokine-1  

PubMed Central

Activation of p53 upon DNA damage induces an array of target genes, leading to cell cycle arrest and/or apoptosis. However, the mechanism by which the cell fate is controlled by p53 remains to be clarified. Previously, we showed that DEC1, a basic helix–loop–helix transcription factor and a target of p53, is capable of inducing cell cycle arrest and mediating DNA damage-induced premature senescence. Here, we found that ectopic expression of DEC1 inhibits, whereas knockdown of DEC1 enhances, DNA damage-induced cell death. Surprisingly, we showed that the anti–cell-death activity of DEC1 is p53 dependent, but DEC1 does not directly modulate p53 expression. Instead, we showed that DEC1 inhibits the ability of p53 to induce macrophage inhibitory cytokine-1 (MIC-1), but not other prosurvival/proapoptotic targets, including p21 and Puma. Importantly, we showed that upon binding to their respective response elements on the MIC-1 promoter, DEC1 and p53 physically interact on the MIC-1 promoter via the basic helix–loop–helix domain in DEC1 and the tetramerization domain in p53, which likely weakens the DNA-binding activity of p53 to the MIC-1 promoter. Finally, we found that depletion of MIC-1 abrogates the ability of DEC1 to attenuate DNA damage-induced cell death. Together, we hypothesize that DEC1 controls the response of p53-dependent cell survival vs. cell death to a stress signal through MIC-1. PMID:22723347

Qian, Yingjuan; Jung, Yong-Sam; Chen, Xinbin

2012-01-01

230

Barometer Basics  

NSDL National Science Digital Library

This experimental activity is designed to develop a basic understanding of the interrelationship between temperature and pressure and the structure of a device made to examine this relationship. Resources needed to conduct this activity include two canning jars, two large rubber balloons, a heat lamp or lamp with 150 watt bulb, and access to freezer or water and ice. The resource includes background information, teaching tips and questions to guide student discussion. This is chapter 5 of Meteorology: An Educator's Resource for Inquiry-Based Learning for Grades 5-9. The guide includes a discussion of learning science, the use of inquiry in the classroom, instructions for making simple weather instruments, and more than 20 weather investigations ranging from teacher-centered to guided and open inquiry investigations.

2012-08-03

231

Sunspace basics  

SciTech Connect

Anyone who lives in a home with a sunspace will tell you that the sunspace is the most enjoyable room in the house. Many times the homeowner`s only regret is that the sunspace is not larger. Although aesthetics often drive the decision to add a sunspace or include one in a new home design, sunspaces can also provide supplemental space heating and a healthy environment for plants and people. In fact, a well-designed sunspace can provide up to 60% of a home`s winter heating requirements. This publication addresses basic elements of sunspace design; design considerations for supplemental space heating, growing plants, and use as a living space; design guidelines including siting, heat distribution, and glazing angles; and major sunspace components including glazing options, thermal mass, insulation, and climate controls. A list of sources for more information is also provided.

Not Available

1994-11-01

232

Mutations affecting the BHLHA9 DNA-binding domain cause MSSD, mesoaxial synostotic syndactyly with phalangeal reduction, Malik-Percin type.  

PubMed

Mesoaxial synostotic syndactyly, Malik-Percin type (MSSD) (syndactyly type IX) is a rare autosomal-recessive nonsyndromic digit anomaly with only two affected families reported so far. We previously showed that the trait is genetically distinct from other syndactyly types, and through autozygosity mapping we had identified a locus on chromosome 17p13.3 for this unique limb malformation. Here, we extend the number of independent pedigrees from various geographic regions segregating MSSD to a total of six. We demonstrate that three neighboring missense mutations affecting the highly conserved DNA-binding region of the basic helix-loop-helix A9 transcription factor (BHLHA9) are associated with this phenotype. Recombinant BHLHA9 generated by transient gene expression is shown to be located in the cytoplasm and the cell nucleus. Transcription factors 3, 4, and 12, members of the E protein (class I) family of helix-loop-helix transcription factors, are highlighted in yeast two-hybrid analysis as potential dimerization partners for BHLHA9. In the presence of BHLHA9, the potential of these three proteins to activate expression of an E-box-regulated target gene is reduced considerably. BHLHA9 harboring one of the three substitutions detected in MSSD-affected individuals eliminates entirely the transcription activation by these class I bHLH proteins. We conclude that by dimerizing with other bHLH protein monomers, BHLHA9 could fine tune the expression of regulatory factors governing determination of central limb mesenchyme cells, a function made impossible by altering critical amino acids in the DNA binding domain. These findings identify BHLHA9 as an essential player in the regulatory network governing limb morphogenesis in humans. PMID:25466284

Malik, Sajid; Percin, Ferda E; Bornholdt, Dorothea; Albrecht, Beate; Percesepe, Antonio; Koch, Manuela C; Landi, Antonio; Fritz, Barbara; Khan, Rizwan; Mumtaz, Sara; Akarsu, Nurten A; Grzeschik, Karl-Heinz

2014-12-01

233

Functional characterization of PAS and HES family bHLH transcription factors during the metamorphosis of the red flour beetle, Tribolium castaneum  

PubMed Central

The basic helix-loop-helix transcription factors are present in animals, plants and fungi and play important roles in the control of cellular proliferation, tissue differentiation, development and detoxification. Although insect genomes contain more than 50 Helix-Loop-Helix transcription factors, the functions of only a few are known. RNAi has become a widely used tool to knockdown the expression to analyze the function of genes. As RNAi works well in Tribolium castaneum, we utilized this insect and RNAi to determine functions of 19 bHLH transcription factors belonging to PAS and HES families during the larval stages of the red flour beetle, T. castaneum. We searched the genome sequence of T. castaneum and identified 53 bHLH genes. Phylogenetic analyses classified these 53 genes into ten families; PAS, HES, Myc/USF, Hand, Mesp, Shout, p48, NeuroD/Neurogenin, Atonal and AS-C. In RNAi studies, knocking-down the expression of seven members of the PAS and HES families affected the growth and development of T. castaneum. An inability to grow to reach critical weight to undergo metamorphosis, failure to complete larval-pupal or pupal-adult ecdysis and abnormal wing development are among the most common phenotypes observed in RNAi insects. Among the bHLH transcription factors studied, the steroid receptor coactivator (SRC) showed the most severe phenotypes. Knock-down in the expression of the gene coding for SRC caused growth arrest by affecting the regulation of lipid metabolism. These studies demonstrate the power of RNAi for functional characterization of members of the multigene families in this model insect. PMID:19683038

Bitra, Kavita; Tan, Anjiang; Dowling, Ashley; Palli, Subba R.

2009-01-01

234

Granulysin-Derived Peptides Demonstrate Antimicrobial and Anti-Inflammatory Effects Against Propionibacterium acnes  

Microsoft Academic Search

Propionibacterium acnes is a key therapeutic target in acne, yet this bacterium has become resistant to standard antibiotic agents. We investigated whether the human antimicrobial protein granulysin is a potential candidate for the treatment of acne. Granulysin and synthetic granulysin-derived peptides possessing a helix–loop–helix motif killed P. acnes in vitro. Modification of a helix–loop–helix peptide, 31–50, by substitution of a

Jamie E McInturff; Shyh-Jeun Wang; Thomas Machleidt; T Richard Lin; Ami Oren; Cheryl J Hertz; Stephan R Krutzik; Scott Hart; Karin Zeh; Daniel H Anderson; Richard L Gallo; Robert L Modlin; Jenny Kim

2005-01-01

235

Basic MAPLE Reference Basic syntax and symbols  

E-print Network

1 Basic MAPLE Reference Basic syntax and symbols := Assigns a name to a string of symbols a:=3*x " ;"? `;' unexpected Syntax error, such as unbalanced parenthesis. MAPLE was expecting more input. Help Click on Help

Hart, Gus

236

Basics of Photometry Photometry: Basic Questions  

E-print Network

Basics of Photometry #12;Photometry: Basic Questions · How do you identify objects in your image type of object you're studying? #12;#12;#12;Topics 1. General Considerations 2. Stellar Photometry 3. Galaxy Photometry #12;I: General Considerations 1. Garbage in, garbage out... 2. Object Detection 3

Masci, Frank

237

BASIC Tools: Structured Programming Techniques in BASIC.  

ERIC Educational Resources Information Center

Structured programing is an attempt to formalize the logic and structure of computer programs. Examples of structured programing techniques in BASIC are provided. Two major disadvantages of this style of programing for the personal user are noted. (JN)

Moyer, Patrick C.

1985-01-01

238

Familial Hemiplegic Migraine type 1 mutations W1684R and V1696I alter G protein-mediated regulation of CaV2.1 voltage-gated calcium channels  

E-print Network

Familial Hemiplegic Migraine type 1 mutations W1684R and V1696I alter G protein- mediated 2012;1822(8):1238-46" DOI : 10.1016/j.bbadis.2012.04.008 #12;Abstract Familial hemiplegic migraine type 1 (FHM-1) is a monogenic form of migraine with aura that is characterized by recurrent attacks

Paris-Sud XI, Université de

239

PASCAL vs BASIC  

ERIC Educational Resources Information Center

A comparison between PASCAL and BASIC as general purpose microprocessor languages rates PASCAL above BASIC in such points as program structure, data types, structuring methods, control structures, procedures and functions, and ease in learning. (CMV)

Mundie, David A.

1978-01-01

240

Asthma: The Basics  

MedlinePLUS Videos and Cool Tools

... Lessons? Visit KidsHealth in the Classroom What Other Parents Are Reading Measles: What to Know Vaccines: FAQs ... What to Expect Asthma: The Basics (Video) KidsHealth > Parents > KH Misc. > Asthma: The Basics (Video) Print A ...

241

HIV/AIDS Basics  

MedlinePLUS

... About CDC.gov . Act Against AIDS Share Compartir HIV/AIDS Basics Before we can stop any epidemic, ... before, AIDS is still a significant health issue. HIV 101 HIV/AIDS Basic Statistics Transmission Testing Prevention ...

242

Stem Cell Basics  

MedlinePLUS

... Info Center Stem Cell Basics Stem Cell Basics Stem Cell Information Frequently Asked Questions What are stem cells? ... U.S. policy? More FAQs Links to related resources Stem Cell Research Center for Regenerative Medicine NIH Stem Cell ...

243

Relocating Basic Writing  

ERIC Educational Resources Information Center

I frame the continuing value of basic writing as part of a long tradition in composition studies challenging dominant beliefs about literacy and language abilities, and I link basic writing to emerging--e.g."translingual"--approaches to language. I identify basic writing as vital to the field of composition in its rejection of simplistic notions…

Horner, Bruce

2011-01-01

244

Basic Cake Decorating Workbook.  

ERIC Educational Resources Information Center

Included in this student workbook for basic cake decorating are the following: (1) Drawings of steps in a basic way to ice a layer cake, how to make a paper cone, various sizes of flower nails, various sizes and types of tin pastry tubes, and special rose tubes; (2) recipes for basic decorating icings (buttercream, rose paste, and royal icing);…

Bogdany, Mel

245

Basic Chemistry Review  

NSDL National Science Digital Library

This assignment reviews basic of chemistry for students who should have had 2 introductory semesters of basic chemistry prior to enrolling in the Fundamental of Water Quality course for which the assignment is used. Assignment reviews basic equation balancing and questions about valence and concentration conversion that students will confront regularly in any geochemistry course.

Thomas Meixner

246

Basic Algebra Review  

NSDL National Science Digital Library

Provides a fun review of basic algebra Basic Algebra Review Let\\'s face it nobody likes to do homework, but it\\'s true what they say: \\"If you don\\'t use it you loose it.\\" This statement is absolutely true when it comes to math. Even basic algebra skills start to slip when you don\\'t practice them. Homework is ...

Mike Young

2007-10-04

247

Whose Basics? Whose Competencies?  

ERIC Educational Resources Information Center

Among the advocates of the "Back to Basics" trend there seems to be little concensus as to what exactly constitutes the "basics." It is clear, however, that what most people mean by "basics" is mechanical skills, punctuation, spelling and grammar. The task of teachers of language is to foster an understanding of how language can be and has been…

Squires, Robert

248

CSF myelin basic protein  

MedlinePLUS

CSF myelin basic protein is a test to measure the level of myelin basic protein (MBP) in the cerebrospinal fluid (CSF). The CSF ... less than 4 ng/mL of myelin basic protein in the CSF. Note: ng/mL = nanogram per ...

249

Mussel inspired protein-mediated surface functionalization of electrospun nanofibers for pH-responsive drug delivery  

PubMed Central

pH-responsive drug delivery systems could mediate drug releasing rate by changing pH values at specific time as per the pathophysiological need of the disease. Herein, we demonstrated a mussel inspired protein polydopamine coating can tune the loading and releasing rate of charged molecules from electrospun poly (?-caprolactone) (PCL) nanofibers in solutions with different pH values. In vitro release profiles showed that the positive charged molecules released significantly faster in acidic than those in neutral and basic environments within the same incubation time. The results of fluorescein diacetate staining and 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays showed the viability of cancer cells after treatment with doxorubicin released media at different pH values qualitatively and quantitatively, indicating the media contained doxorubicin which was released in solutions at low pH values could kill significantly higher number of cells than that released in solutions at high pH values. Together, the pH-responsive drug delivery systems based on polydopamine-coated PCL nanofibers could have potential applications in oral delivery of anticancer drugs for treating gastric cancer and vaginal delivery of anti-viral drugs or anti-inflammatory drugs, which could raise their efficacy, deliver them to the specific target, and minimize their toxic side effects. PMID:24287161

Jiang, Jiang; Xie, Jingwei; Ma, Bing; Bartlett, David E.; Xu, An; Wang, Chi-Hwa

2014-01-01

250

"Back to Basics" or "Forward to Basics"?  

ERIC Educational Resources Information Center

Politicians have used the promise of "back to basics in our schools" as an educational platform for some time now, possibly in recognition that this is something the general population perceives as an issue they might just vote for. In the various positions the author has held, both professional and in community service, she has been required to…

Perso, Thelma

2007-01-01

251

Visual Basic Web Directory  

NSDL National Science Digital Library

The Visual Basic Web Directory is a highly useful collection of categorized and annotated links to Websites containing information about Visual Basic. The site contains a fairly complete and easy-to-use hierarchy of resources for the Visual Basic user that range from tutorials to job listings. Beyond the resources, the site also provides summaries of recent Visual Basic news, an online bookstore linked to Amazon.com, and other interesting tidbits. In addition to the hierarchical organization of records, the site provides a simple mechanism for searching the collection. The Visual Basic Web Directory is a nicely organized Website that should prove to be a useful resource for anyone interested in Visual Basic.

252

Fiber Optics Basics  

NSDL National Science Digital Library

This pdf from OP-TEC, the National Center for Optics and Photonics Education, addresses basic concepts underlying the operation of fiber lasers. This free 26 page document supplements the fiber laser material presented in an Elements of Photonics Course by provided a more current and detailed description of how lasers operate. This course covers basic laser operations, basic structure of fiber lasers, pulsing methods, output characteristics of fiber lasers, and advanced structures.

253

Basics of Weight Control  

MedlinePLUS

... The basic required nutrients are: water, carbohydrates, proteins, fats, dietary fibers, vitamins, and minerals. Carbohydrates, proteins, and fats provide energy in the form of calories. Alcohol ( ...

254

Protein-Mediated Adhesion of the Dissimilatory Fe(III)-Reducing Bacterium Shewanella alga BrY to Hydrous Ferric Oxide  

PubMed Central

The rate and extent of bacterial Fe(III) mineral reduction are governed by molecular-scale interactions between the bacterial cell surface and the mineral surface. These interactions are poorly understood. This study examined the role of surface proteins in the adhesion of Shewanella alga BrY to hydrous ferric oxide (HFO). Enzymatic degradation of cell surface polysaccharides had no effect on cell adhesion to HFO. The proteolytic enzymes Streptomyces griseus protease and chymotrypsin inhibited the adhesion of S. alga BrY cells to HFO through catalytic degradation of surface proteins. Trypsin inhibited S. alga BrY adhesion solely through surface-coating effects. Protease and chymotrypsin also mediated desorption of adhered S. alga BrY cells from HFO while trypsin did not mediate cell desorption. Protease removed a single peptide band that represented a protein with an apparent molecular mass of 50 kDa. Chymotrypsin removed two peptide bands that represented proteins with apparent molecular masses of 60 and 31 kDa. These proteins represent putative HFO adhesion molecules. S. alga BrY adhesion was inhibited by up to 46% when cells were cultured at sub-MICs of chloramphenicol, suggesting that protein synthesis is necessary for adhesion. Proteins extracted from the surface of S. alga BrY cells inhibited adhesion to HFO by up to 41%. A number of these proteins bound specifically to HFO, suggesting that a complex system of surface proteins mediates S. alga BrY adhesion to HFO. PMID:10543817

Caccavo, Frank

1999-01-01

255

Gq protein mediates UVB-induced cyclooxygenase-2 expression by stimulating HB-EGF secretion from HaCaT human keratinocytes  

SciTech Connect

Ultraviolet (UV) radiation induces cyclooxygenase-2 expression to produce cellular responses including aging and carcinogenesis in skin. We hypothesised that heterotrimeric G proteins mediate UV-induced COX-2 expression by stimulating secretion of soluble HB-EGF (sHB-EGF). In this study, we aimed to elucidate the role and underlying mechanism of the {alpha} subunit of Gq protein (G{alpha}q) in UVB-induced HB-EGF secretion and COX-2 induction. We found that expression of constitutively active G{alpha}q (G{alpha}qQL) augmented UVB-induced HB-EGF secretion, which was abolished by knockdown of G{alpha}q with shRNA in HaCaT human keratinocytes. G{alpha}q was found to mediate the UVB-induced HB-EGF secretion by sequential activation of phospholipase C (PLC), protein kinase C{delta} (PKC{delta}), and matrix metaloprotease-2 (MMP-2). Moreover, G{alpha}qQL mediated UVB-induced COX-2 expression in an HB-EGF-, EGFR-, and p38-dependent manner. From these results, we concluded that G{alpha}q mediates UV-induced COX-2 expression through activation of EGFR by HB-EGF, of which ectodomain shedding was stimulated through sequential activation of PLC, PKC{delta} and MMP-2 in HaCaT cells.

Seo, MiRan [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of)] [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Juhnn, Yong-Sung, E-mail: juhnn@snu.ac.kr [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of)] [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of)

2010-03-05

256

Protein-mediated adhesion of the dissimilatory Fe(III)-reducing bacterium Shewanella alga BrY to hydrous ferric oxide  

SciTech Connect

The rate and extent of bacterial Fe(III) mineral reduction are governed by molecular-scale interactions between the bacterial cell surface and the mineral surface. These interactions are poorly understood. This study examined the role of surface proteins in the adhesion of Shewanella alga BrY to hydrous ferric oxide (HFO). Enzymatic degradation of cell surface polysaccharides had no effect on cell adhesion to HFO. The proteolytic enzymes Streptomyces griseus protease and chymotrypsin inhibited the adhesion of S. alga BrY cells to HFO through catalytic degradation of surface proteins. Trypsin inhibited S. alga BrY adhesion solely through surface-coating effects. Protease and chymotrypsin also mediated desorption of adhered S. alga BrY cells from HFO while trypsin did not mediate cell desorption. Protease removed a single peptide band that represented a protein with an apparent molecular mass of 50 kDa. Chymotrypsin removed two peptide bands that represented proteins with apparent molecular masses of 60 and 31 kDa. These proteins represent putative HGO adhesion molecules. A. alga BrY adhesion was inhibited by up to 46% when cells were cultured at sub-MICs of chloramphenicol, suggesting that protein synthesis is necessary for adhesion. Proteins extracted from the surface of S. alga BrY cells inhibited adhesion to HFO by up to 41%. A number of these proteins bound specifically to HFO, suggesting that a complex system of surface proteins mediates S. alga BrY adhesion to HFO.

Caccavo, F. Jr.

1999-11-01

257

Supernova basics Supernova types  

E-print Network

1 Supernovae · Supernova basics · Supernova types · Light Curves · SN Spectra ­ after explosion · Supernova Remnants (SNRs) · Collisional Ionization #12;2 Supernova Basics · Supernova (SN) explosions in our) · Typical SN rates ~ 1/Galaxy/century · Recent local supernovae: 1006 AD, 1054 AD (produced Crab nebula

Crenshaw, Michael

258

Basic Electronics I.  

ERIC Educational Resources Information Center

Designed for use in basic electronics programs, this curriculum guide is comprised of twenty-nine units of instruction in five major content areas: Orientation, Basic Principles of Electricity/Electronics, Fundamentals of Direct Current, Fundamentals of Alternating Current, and Applying for a Job. Each instructional unit includes some or all of…

Robertson, L. Paul

259

Basic Terminal Forecast Strategies  

NSDL National Science Digital Library

"Basic Terminal Forecast Strategies" is the first component of the Distance Learning Course 2, Producing Customer-Focused TAFs. Basic Terminal Forecast Strategies is comprised of two lessons that provide 1) an introduction to understanding aviation customers and their needs and 2) a technique to meet those needs by producing clear, concise, and consistent terminal aerodrome forecasts (TAFs).

COMET

2006-09-22

260

Basic principle of superconductivity  

E-print Network

The basic principle of superconductivity is suggested in this paper. There have been two vital wrong suggestions on the basic principle, one is the relation between superconductivity and the Bose-Einstein condensation (BEC), and another is the relation between superconductivity and pseudogap.

Tian De Cao

2009-11-10

261

Basic Microfluidic Lithographic  

E-print Network

CHAPTER 2 Basic Microfluidic and Soft Lithographic Techniques Sindy K.Y. Tang and George M in these devices are based on those developed for microfluidics used in biochemical anal- ysis. This chapter describes the basic ideas of microfluidics. We first summarize the materials most commonly used

Prentiss, Mara

262

BASIC artificial intelligence  

SciTech Connect

Although artificial intelligence is usually associated with special computer languages, this introductory book will give a firm foundation to this fascinating subject to users who are familiar with BASIC. Topics considered include introduction to BASIC, varieties of logic and reasoning, strategy and analysis, relationships and the role of memory, natural language, and learning from experience.

James, M.

1986-01-01

263

Human Body Basics  

NSDL National Science Digital Library

The purpose of this assessment probe is to elicit students' ideas about levels of organization in living organisms. The probe is designed to determine whether students recognize cells as the basic unit of both structure and function for carrying out basic life processes.

Francis Eberle

2005-01-01

264

Basic Science Training Program.  

ERIC Educational Resources Information Center

These six learning modules were developed for Lake Michigan College's Basic Science Training Program, a workshop to develop good study skills while reviewing basic science. The first module, which was designed to provide students with the necessary skills to study efficiently, covers the following topics: time management; an overview of a study…

Brummel, Clete

265

Bambara Basic Course.  

ERIC Educational Resources Information Center

This text is a preliminary version of a basic course in the Bambara language. It is one of a series of short basic courses in African languages. Tutors' instructions appear in both English and French. Sixteen units make up the text; each consists of pattern drills in English and Bambara on a particular point of grammar. (CHK)

Stevick, Earl W.

266

Fluency with Basic Addition  

ERIC Educational Resources Information Center

Traditionally, learning basic facts has focused on rote memorization of isolated facts, typically through the use of flash cards, repeated drilling, and timed testing. However, as many experienced teachers have seen, "drill alone does not develop mastery of single-digit combinations." In contrast, a fluency approach to learning basic addition…

Garza-Kling, Gina

2011-01-01

267

Solar Electric System Basics  

NSDL National Science Digital Library

The Advanced Technology Environmental and Energy Center (ATEEC) provides this sheet on the basics of solar electric systems. The document describes how photovoltaic cells work, basic energy terminology, photovoltaic materials and other related information. Users must download this resource for viewing, which requires a free log-in. There is no cost to download the item.

Gordes, Joel N.

268

Romanian Basic Course.  

ERIC Educational Resources Information Center

The "Romanian Basic Course," consisting of 89 lesson units in eight volumes, is designed to train native English language speakers to Level 3 proficiency in comprehension, speaking, reading, and writing Romanian (based on a 1-5 scale in which Level 5 is native speaker proficiency). Volume 1, which introduces basic sentences in dialog form with…

Defense Language Inst., Washington, DC.

269

Prognostic Significance of the Lymphoblastic Leukemia-Derived Sequence 1 (LYL1) GeneExpression in Egyptian Patients with AcuteMyeloid Leukemia  

PubMed Central

Objective: Aberrant activation of transcription factor genes is the most frequent target of genetic alteration in lymphoid malignancies. The lymphoblastic leukemia-derived sequence 1 (LYL1) gene, which encodes a basic helix-loop helix, was first identified with human T-cell acute leukemia. Recent studies suggest its involvement in myeloid malignancies. We aimed to study the expression percent of oncogene LYL1 in primary and secondary high-risk myeloid leukemia and the impact on prognostic significance in those patients. Materials and Methods: Using quantitative real-time polymerase chain reaction for detection of LYL1 oncogenes, our study was carried out on 39 myeloid leukemia patients including de novo cases, myelodysplastic syndrome (MDS) with transformation, and chronic myelogenous leukemia (CML) in accelerated and blast crisis, in addition to 10 healthy individuals as the reference control. Results: LYL1 expression was increased at least 2 times compared to the controls. The highest expression of this transcription factor was observed in the MDS cases transformed to acute leukemia at 7.3±3.1, p=0.0011. LYL1 expression was found in 68.2%, 75%, and 77.8% of cases of acute myeloid leukemia, CML crisis, and MDS, respectively. Significant correlation of LYL1 overexpression with some subtypes of French-American-British classification was found. There was, for the first time, significant correlation between the blood count at diagnosis and LYL1 expression (p=0.023, 0.002, and 0.031 for white blood cells, hemoglobin, and platelets, respectively). The rate of complete remission was lower with very high levels of LYL1 expression and the risk of relapse increased with higher levels of LYL1 expression, suggesting an unfavorable prognosis for cases with enhanced expression. Conclusion: Overexpression of LYL1 is highly associated with acute myeloid leukemia and shows more expression in MDS with unfavorable prognosis in response to induction chemotherapy. These observations could signal a promising tool for a therapeutic target to basic helix–loop helix protein related to transcription factors, which may improve patient outcome in acute myeloid leukemia, MDS, and CML in blast crisis. PMID:25035669

El-Menshawy, Nadia; Shahin, Doaa; Ghazi, Hayam Fathi

2014-01-01

270

Powassan (POW) Virus Basics  

MedlinePLUS

Powassan (POW) Virus Basics Powassan (POW) virus is related to some mosquito-borne viruses, including West Nile virus. The virus is ... concerns? How do people get infected with POW virus? POW virus is passed to people by ticks: ...

271

Brain Basics: Preventing Stroke  

MedlinePLUS

Brain Basics: Preventing Stroke Request free mailed brochure Table of Contents Introduction What is a Stroke? What ... Americans are protecting their most important asset—their brain. Are you? Stroke ranks as the fourth leading ...

272

Kidney Disease Basics  

MedlinePLUS

... Disease Children and Kidney Disease Additional Kidney Information Kidney Disease Basics Your kidneys filter extra water and ... blood pressure are the most common causes of kidney disease. These conditions can slowly damage the kidneys ...

273

Basics of Health Insurance  

MedlinePLUS

Basics of Health Insurance The Cystic Fibrosis Foundation is committed to providing the information you need to make the best health care ... Here, you can learn about different types of health insurance and important questions to ask when choosing a ...

274

Basic space science  

SciTech Connect

This report contains papers on the following topics: basic space science; a challenge and opportunity; solar-terrestrial interaction; solar system science; space astronomy; and astrophysics. The individual paper have been cataloged separately. (LSP)

Haubold, H.J. [United Nations, New York, NY (USA); Khanna, R.K. [Maryland Univ., College Park, MD (United States). Dept. of Chemistry and Biochemistry] [eds.

1992-05-01

275

Basic space science  

SciTech Connect

This report contains papers on the following topics: basic space science; a challenge and opportunity; solar-terrestrial interaction; solar system science; space astronomy; and astrophysics. The individual paper have been cataloged separately. (LSP)

Haubold, H.J. (United Nations, New York, NY (USA)); Khanna, R.K. (Maryland Univ., College Park, MD (United States). Dept. of Chemistry and Biochemistry) (eds.)

1992-01-01

276

Ed's Basic Histology Gallery  

NSDL National Science Digital Library

This website introduces the basic concepts of histology. The site is organized by different anatomical structures and provides a tutorial, histology slices and quiz for students for each structure presented.

2010-03-02

277

Video Screen Capture Basics  

ERIC Educational Resources Information Center

This article is an introduction to video screen capture. Basic information of two software programs, QuickTime for Mac and BlueBerry Flashback Express for PC, are also discussed. Practical applications for video screen capture are given.

Dunbar, Laura

2014-01-01

278

Basic Electricity Materials  

NSDL National Science Digital Library

This site from SpaceTEC National Aerospace Technical Education Center presents basic materials electricity. Topics include safety, metric notations, atomic structure, instruments, electrical concepts, resistor and AC circuits, power supplies, circuit protection, relays, connections, and electrostatic states.

279

Basic Electronics Tutorials  

NSDL National Science Digital Library

This site gives a number of tutorials and information to help students and instructors develop a knowledge and understanding of the basics of Electronics. Topics include amplifiers, inductors, capacitors, electromagnetism, transformers, transistors and more.

Storr, Wayne

280

Skywarn Spotter Convective Basics  

NSDL National Science Digital Library

The "SKYWARN® Spotter Convective Basics" module will guide users to a basic understanding of convective storms. Through three different scenarios, you will cover reporting and proper communication of local storm reports to the National Weather Service (NWS), personal safety during these events, and field identification of convective storm hazards. After completing the scenarios, you will be given the opportunity to practice identifying storm features from a spectrum of photos.

COMET

2011-04-22

281

Basic Principles of Ultrasound  

NSDL National Science Digital Library

Created by a team of medical professionals and health-care specialists, the main Echo Web site contains a wide range of resources dealing primarily with diagnostic ultrasounds, sonography, and the field of echocardiography. One of the most helpful of these resources is the Basic Principles of Ultrasound online course, which is available here at no cost. The course itself is divided into six different sections, along with a bibliography and FAQ area. Visitors can use the online course to learn about the basic principles of ultrasound, the basic science behind related devices and instruments, and the ways to use these devices safely. Instructors might also do well to use this website in conjunction with lectures on the subject, or as away to give students an additional resource to consult at their leisure.

2004-01-01

282

A novel enhancer, the pro-B enhancer, regulates Id1 gene expression in progenitor B cells.  

PubMed Central

The helix-loop-helix (HLH) Id proteins have been reported to function as inhibitors of various differentiation programs. The HLH motif mediates dimer formation between Id and the basic HLH transcription factors. Since Id proteins lack the basic region responsible for DNA binding, the heterodimers cannot bind to DNA. Id proteins have also been found to be involved in early B-cell differentiation. They are expressed at high levels in progenitor B cells (pro-B cells), and the expression is diminished in pre-B cells and mature B cells. This expression pattern correlates inversely with basic HLH protein activity and immunoglobulin enhancer function in B-cell development. Regulation of Id expression may play an important role in transcriptional control of immunoglobulin genes and therefore in B-cell differentiation. We have characterized the regulatory elements of the Id1 gene. Using stable transfectants, transient transfection, and mobility shift assays, we have identified an 8-bp element designated PBE (pro-B enhancer) downstream of the Id1 gene that is responsible for a pro-B-cell-specific enhancer activity. A pro-B-cell-specific protein complex was found to bind to the 8-bp PBE element. Substitution mutagenesis at this binding site showed that it is indeed of functional importance in regulating the pro-B-cell-specific expression of the Id1 gene. PMID:7862144

Saisanit, S; Sun, X H

1995-01-01

283

Abdominal Hysterectomy (Beyond the Basics)  

MedlinePLUS

... to prevent pregnancy before surgery. (See "Patient information: Deep vein thrombosis (DVT) (Beyond the Basics)" .) Damage to ... Postmenopausal hormone therapy (Beyond the Basics) Patient information: Deep vein thrombosis (DVT) (Beyond the Basics) Patient information: ...

284

Antitumor effect and mechanism of action of a tumor-targeting recombinant human tumor necrosis factor-? fusion protein mediated by urokinase.  

PubMed

The aim of this study was to investigate the effect of the tumor?targeting recombinant human tumor necrosis factor (rhTNF)?? fusion protein mediated by urokinase on Sl80 tumor?bearing mice, as well as to explore its mechanisms of action. Furthermore, the study aimed to observe the effect of the protein on liver and kidney function. rhTNF?? fusion protein prokaryotic expression vectors were constructed using genetic engineering techniques, and were introduced into Escherichia coli. Expression of the fusion protein was induced, and it was then separated and purified in order to determine its cytotoxic activity on L929 cells. Kunming mice were randomly divided into four groups after being inoculated with S180 tumor cells. The groups were then injected with saline (control group, group S), or saline with 0.1 µg/ml fusion protein (low dose group, group L), 0.2 µg/ml fusion protein (middle dose group, group M) or 0.3 µg/ml (high dose group, group H). The mice were sacrificed after 12 days and liver [mg/kg; (liver weight/body weight) x 1,000] and kidney [mg/kg; (kidney weight/body weight) x 1,000] indices, tumor weight, the percentage reduction in mean tumor size, and the levels of alanine transaminase (ALT), albumin (ALB), creatinine (Cr) and blood urea nitrogen (BUN) in each group of mice were determined. In addition, the levels of urokinase?type plasminogen activator (uPA), the expression of bcl?2, bax and vascular endothelial growth factor (VEGF), and the percentage of apoptotic cells were measured with an enzyme?linked immunosorbent assay, streptavidin?biotin complex of immunohistochemistry and terminal deoxynucleotidyl transferase?mediated dUTP nick end labeling, respectively. The fusion protein significantly inhibited the growth of S180 tumor cells in vivo in a dose?dependent manner. With an increase in the dose of fusion protein, ALT, uPA, bcl?2 and VEGF levels decreased, and ALB levels increased. However, liver and kidney indices and bax expression were not significantly altered. Cr and BUN levels did not change significantly in the low and middle dose groups, but did increase in the high dose group. Compared with the control group, the percentage of apoptotic cells in the high?dose group was significantly higher. In conclusion, the fusion protein significantly inhibited S180 tumor growth in a mouse model, possibly by reducing the levels of uPA, bcl?2 and VEGF. There was a mildly toxic effect on the kidneys with the high dose, but a protective effect in the liver. PMID:25672264

Dai, You-Chao; Yang, Si-Min; Wang, Xin; Zhou, Yong-Jun; Hou, Gan; Huang, Di-Nan

2015-06-01

285

Basic Skills Assessment  

ERIC Educational Resources Information Center

After surveying 1,827 students in their final year at eighty randomly selected two-year and four-year public and private institutions, American Institutes for Research (2006) reported that approximately 30 percent of students in two-year institutions and nearly 20 percent of students in four-year institutions have only basic quantitative…

Yin, Alexander C.; Volkwein, J. Fredericks

2010-01-01

286

Focus on Basics, 1998.  

ERIC Educational Resources Information Center

This volume contains the four 1998 quarterly issues of this newsletter that present best practices, current research on adult learning and literacy, and information on how research is used by adult basic education teachers, counselors, program administrators, and policy makers. The following are among the major articles included: "Power, Literacy,…

Focus on Basics, 1998

1998-01-01

287

Cloud Physics: The Basics  

NSDL National Science Digital Library

This website from the Oklahoma Weather Modification Program encourages students to initiate a debate on the controversy surrounding the issue of inducing or enhancing precipitation. The exercise describes the two basic tenets of cloud seeding: the Static Phase Hypothesis and the Dynamic Phase Hypothesis. Also provided are links to a weather and climate glossary and further information about clouds and precipitation.

Klatt, Michael L.

288

Basic Soils. Revision.  

ERIC Educational Resources Information Center

This curriculum guide is designed for use in teaching a course in basic soils that is intended for college freshmen. Addressed in the individual lessons of the unit are the following topics: the way in which soil is formed, the physical properties of soil, the chemical properties of soil, the biotic properties of soil, plant-soil-water…

Montana State Univ., Bozeman. Dept. of Agricultural and Industrial Education.

289

Czech Basic Course: Folklore.  

ERIC Educational Resources Information Center

This booklet is designed for use in the advanced phase of the Defense Language Institute's "Basic Course" in Czech. It is used in the advanced phase as a part of cultural background information. Reading selections, with vocabulary lists, include: (1) ethnography; (2) incantations and spells; (3) proverbs, sayings, and weather lore; (4) fairy tales…

Defense Language Inst., Washington, DC.

290

Slide 1: Asthma Basics  

E-print Network

provide environmental professionals working in tribal communities with basic information on asthma. Certain factors in the indoor and outdoor environment can cause, trigger or exacerbate asthma symptoms. However, simple actions can reduce the impact of these environmental triggers, as well as reduce the burden of asthma in tribal communities. The presentation is divided into the following sections:

unknown authors

291

Sara Basic Course.  

ERIC Educational Resources Information Center

The basic plan of this course in Sara is modeled after "An Experimental Course in Hausa" (FSI 1965). The course uses short cycles consisting of mimicry followed by conversations built on the same vocabulary and syntactic pattern. The format has been condensed and altered. The course contains 95 cycles and would require approximately 50 hours to…

Thayer, James E.; Maraby, Julien

292

Intellectual Patent Basics  

E-print Network

Intellectual Property Patent Basics Roland W. Norris Pauley Petersen Kinne & Erickson 2800 W;Introduction Intellectual property: Patents Trademarks Copyrights Trade Secrets #12;What is a Patent? A right For the term of the patent 20 years from date of filing of earliest related patent or application #12;A

Heller, Barbara

293

Basic Electronics II.  

ERIC Educational Resources Information Center

Designed for use in basic electronics programs, this curriculum guide is comprised of 15 units of instruction. Unit titles are Review of the Nature of Matter and the P-N Junction, Rectifiers, Filters, Special Semiconductor Diodes, Bipolar-Junction Diodes, Bipolar Transistor Circuits, Transistor Amplifiers, Operational Amplifiers, Logic Devices,…

Willison, Neal A.; Shelton, James K.

294

Basic Electricity. Part 1.  

ERIC Educational Resources Information Center

A primarily illustrated introduction to the basics of electricity is presented in this guide, the first of a set of four designed for the student interested in a vocation in electrical work. This guide is intended for the first-year student and provides mostly diagrams with accompanying defintions/information in three units, each covering one of…

Kilmer, Donald C.

295

Basic Media in Education.  

ERIC Educational Resources Information Center

Intended as a guide to the use of different media for use in the classroom, this document demonstrates alternative approaches that may be taken to depicting and communicating images and concepts to others. Some basic tools and materials--including a ruler, matte knife, rubber cement, stapler, felt-tip pens, paint brushes, and lettering pens--are…

Harrell, John

296

Teaching Basic Caregiver Skills.  

ERIC Educational Resources Information Center

This instructor's guide provides materials for a nursing skills course designed to teach basic home nursing skills to families who plan to care for a chronically ill or elderly family member at home. It may be taught by a registered nurse with knowledge of all areas or by a team, with each instructor concentrating on his/her area of expertise.…

Schenk, Susan, Ed.; Harrah, Doris, Ed.

297

Analytical Electrochemistry: Basic Concepts  

NSDL National Science Digital Library

This module focuses on the basic concepts involved in dynamic electrochemistry when the net current is not zero - the combination of mass transfer and electrochemical reactions at the interface between solids and fluids. It is at an introductory level appropriate for undergraduates in their sophomore or junior years.

Kelly, Richard S.

298

Basic Association Rules  

Microsoft Academic Search

Previous approaches for mining association rules generate large sets of association rules. Such sets are difficult for users to understand and manage. Here, the concept of a restricted conditional probability distribution is used to explain an association rule. Based on this concept, a new type of association rules, called basic association rules, is defined. We propose the GenBR algorithm to

Guichong Li; Howard J. Hamilton

2004-01-01

299

Reading for Basic Understanding.  

ERIC Educational Resources Information Center

This document offers materials for a year-long course on general basic reading skills that was part of a workplace literacy project developed by Mercer County Community College (New Jersey), and its partners. The document contains the following: (1) outlines (each of which contains objectives, a topical outline, and list of textbooks) for two…

Mercer County Community Coll., Trenton, NJ.

300

FULA BASIC COURSE.  

ERIC Educational Resources Information Center

THIS BEGINNING COURSE IS AN INTRODUCTION TO FULA (KNOWN VARIOUSLY AS FULANI, FUL, PEUL, OR PHEUL), A NIGER-CONGO LANGUAGE SPOKEN THROUGHOUT THE GRASSLAND AREAS OF WEST AFRICA FROM THE ATLANTIC TO CAMEROUN. THE TEXT IS ONE OF A SERIES OF SHORT BASIC COURSES IN SELECTED AFRICAN LANGUAGES BEING PREPARED BY THE FOREIGN SERVICE INSTITUTE. IT IS…

SWIFT, LLOYD B.; AND OTHERS

301

Press Release Basic Design  

E-print Network

the mid 1950's Leeds College of Art led the way in the Basic Design movement, which was a new and radical of some of the key teachers in the movement including our then Head of Painting Harry Thubron, as well of research and enquiry led to the total reform and restructuring of the whole College, and art education

Stell, John

302

Basic Math I.  

ERIC Educational Resources Information Center

This document offers instructional materials for a 60-hour course on basic math operations involving decimals, fractions, and proportions as applied in the workplace. The course, part of a workplace literacy project developed by Mercer County Community College (New Jersey) and its partners, contains the following: course outline; 17 lesson…

Mercer County Community Coll., Trenton, NJ.

303

Projectable Basic Electronics Kit.  

ERIC Educational Resources Information Center

Outlines advantages derived from constructing and using a Projectable Basic Electronics Kit and provides: (1) list of components; (2) diagrams of 10 finished components (resistor; capacitor; diode; switch; bulb; transistor; meter; variable capacitor; coil; connecting terminal); and (3) diode and transistor activities. (JN)

H'ng, John; And Others

1982-01-01

304

GPS Receiver Basics  

NSDL National Science Digital Library

Students familiarize themselves — through trial and error — with the basics of GPS receiver operation. They view a receiver's satellite visibility screen as they walk in various directions and monitor their progress on the receiver's map. Students may enter waypoints and use the GPS information to guide them back to specific locations.

2014-09-18

305

Canadian Adult Basic Education.  

ERIC Educational Resources Information Center

"Trends," a publication of the Canadian Association for Adult Education, is a collection of abstracts on selected subjects affecting adult education; this issue is on adult basic education (ABE). It covers teachers and teacher training, psychological factors relating to the ABE teacher and students, manuals for teachers, instructional materials,…

Brooke, W. Michael, Comp.

306

Weed Management -The Basics  

E-print Network

/3 of the seedbank turns over annually #12;William Beal Buried Seed Study · Botanist at Michigan State University (Then Michigan Agricultural College) · Buried seeds in 1879 - 20 glass bottles - 50 seeds of each of 20Weed Management - The Basics Anthony Cortilet Minnesota Department of Agriculture Roger Becker

Minnesota, University of

307

Navajo Adult Basic Education.  

ERIC Educational Resources Information Center

The objectives of this Special Experimental Demonstration Project in Adult Basic Education for the Navajo were: (1) to raise the educational and social level of Navajo adult students who are unable to read, write, and speak English; (2) to assist the Navajo adult students to take advantage of occupational and vocational training programs; (3) to…

Navajo Community Coll., Tsaile, AZ.

308

Basic Engineer Equipment Mechanic.  

ERIC Educational Resources Information Center

This student guide, one of a series of correspondence training courses designed to improve the job performance of members of the Marine Corps, deals with the skills needed by basic engineer equipment mechanics. Addressed in the four individual units of the course are the following topics: mechanics and their tools (mechanics, hand tools, and power…

Marine Corps Inst., Washington, DC.

309

Korean Basic Course.  

ERIC Educational Resources Information Center

These 11 volumes of the Korean Basic Course comprise 112 lesson units designed to train native English language speakers to Level 3 proficiency in comprehension and speaking and Level 2 proficiency in reading and writing Korean. (Level 5 on this scale is native-speaker level.) Intended for classroom use in the Defense Language Institute intensive…

Defense Language Inst., Washington, DC.

310

EHR/PHR Basics  

MedlinePLUS

... Navigation Bar Home Current Issue Past Issues EHR EHR/PHR Basics Past Issues / Summer 2009 Table of Contents ... can be confusing. With a personal health record (PHR), you control who can ... health record (EHR) or electronic medical record (EMR), your doctor (or ...

311

Portuguese Basic Courses.  

ERIC Educational Resources Information Center

This basic course in Brazilian Portuguese consists of 75 lessons in six volumes. Volume I is in two parts, with the dialogs, questions and exercises presented in Portuguese in the first part, and the intonation patterns and English translations presented in the second. The general format follows the Defense Language Institute format, employing…

Defense Language Inst., Washington, DC.

312

Reflections on basic science.  

PubMed

After almost 50 years in science, I believe that there is an acceptable, often advantageous chasm between open-ended basic research-free exploration without a practical destination and in which the original ideas may fade into new concepts-and translational research or clinical research. My basic research on crystalline (proteins conferring the optical properties of the eye lens) led me down paths I never would have considered if I were conducting translational research. My investigations ranged from jellyfish to mice and resulted in the gene-sharing concept, which showed that the same protein can have distinct molecular functions depending upon its expression pattern and, conversely, that different proteins can serve similar functional roles. This essay portrays basic science as a creative narrative, comparable to literary and artistic endeavors. Preserving the autonomy of open-ended basic research and recognizing its artistic, narrative qualities will accelerate the development of innovative concepts, create a rich resource of information feeding translational research, and have a positive impact by attracting creative individuals to science. PMID:21037410

Piatigorsky, Joram

2010-01-01

313

Focus on Basics, 1997.  

ERIC Educational Resources Information Center

Together, these four newsletters contain 36 articles devoted to adult literacy research and practice and the relationship between them. The following articles are included: "A Productive Partnership" (Richard J. Murnane, Bob Bickerton); "Welcome to 'Focus on Basics'" (Barbara Garner); "Applying Research on the Last Frontier" (Karen Backlund, Kathy…

Focus on Basics, 1997

1997-01-01

314

BASIC COURSE IN MENDE.  

ERIC Educational Resources Information Center

THIS BASIC COURSE IN MENDE, A TONE LANGUAGE OF LIBERIA AND SIERRA LEONE, IS DESIGNED TO BE TAUGHT BY A LINGUIST AND AN INFORMANT TO LINGUISTICALLY ORIENTED STUDENTS. THE TEXT COMPRISES TWO SECTIONS, THE FIRST CONTAINING A VOCABULARY, USEFUL PHRASES AND "NARRATIVE DRILLS" TO ACCOMPANY THE 18 SLIDES PREPARED FOR THE COURSE. THE NARRATIVES ARE…

SPEARS, RICHARD A.

315

Basic Nuclear Physics.  

ERIC Educational Resources Information Center

Basic concepts of nuclear structures, radiation, nuclear reactions, and health physics are presented in this text, prepared for naval officers. Applications to the area of nuclear power are described in connection with pressurized water reactors, experimental boiling water reactors, homogeneous reactor experiments, and experimental breeder…

Bureau of Naval Personnel, Washington, DC.

316

Multilingualism Is Basic.  

ERIC Educational Resources Information Center

Demographic, economic, and social realities make linguistic and cross-cultural competence essential skills for today's students. This article discusses three innovative program types that build on basic education while enriching it through second languages: second-language immersion for native English-speaking students; developmental bilingual…

Genesee, Fred; Cloud, Nancy

1998-01-01

317

Basic Internet Software Toolkit.  

ERIC Educational Resources Information Center

Once schools are connected to the Internet, the next step is getting network workstations configured for Internet access. This article describes a basic toolkit comprising software currently available on the Internet for free or modest cost. Lists URLs for Web browser, Telnet, FTP, file decompression, portable document format (PDF) reader,…

Buchanan, Larry

1998-01-01

318

MONITORING DROUGHT Basic Climatology  

E-print Network

MONITORING DROUGHT Basic Climatology Colorado Climate Center Funding provided by NOAA Sectoral Applications Research Project #12;DEFINING DROUGHT #12;First off, just what is drought? Define a tornado the same for drought #12;First off, just what is drought? Precipitation deficits? Soil moisture

319

Turkish Basic Course.  

ERIC Educational Resources Information Center

These 14 volumes of the Defense Language Institute's basic course in Turkish consist of 112 lesson units designed to train native English language speakers to Level 3 proficiency in comprehending, speaking, reading, and writing Turkish. (Native-speaker fluency is Level 5.) An introduction to the sound system, vowel harmony, and syllable division…

Defense Language Inst., Washington, DC.

320

Swahili Basic Course.  

ERIC Educational Resources Information Center

This basic audiolingual course in standard Swahili appears in six volumes, Lesson Units 1-56. Units consist of a "blueprint" prefatory page outlining the phonological, morphological, and syntactic structures and new vocabulary to be presented; perception drills; Swahili dialog with cartoon guides and English translation; pattern and recombination…

Defense Language Inst., Washington, DC.

321

Ethanol Basics (Fact Sheet)  

SciTech Connect

Ethanol is a widely-used, domestically-produced renewable fuel made from corn and other plant materials. More than 96% of gasoline sold in the United States contains ethanol. Learn more about this alternative fuel in the Ethanol Basics Fact Sheet, produced by the U.S. Department of Energy's Clean Cities program.

Not Available

2015-01-01

322

Basic Pneumatics. Instructor's Guide.  

ERIC Educational Resources Information Center

This instructor's guide is designed for use by industrial vocational teachers in teaching a course on basic pneumatics. Covered in the individual units are the following topics: an introduction to pneumatics (including the operation of a service station hoist); fundamentals and physical laws; air compressors (positive displacement compressors;…

Fessehaye, Michael

323

Synergistic interactions of lipids and myelin basic protein  

NASA Astrophysics Data System (ADS)

This report describes force measurements and atomic force microscope imaging of lipid-protein interactions that determine the structure of a model membrane system that closely mimics the myelin sheath. Our results suggest that noncovalent, mainly electrostatic and hydrophobic, interactions are responsible for the multilamellar structure and stability of myelin. We find that myelin basic protein acts as a lipid coupler between two apposed bilayers and as a lipid "hole-filler," effectively preventing defect holes from developing. From our protein-mediated-adhesion and force-distance measurements, we develop a simple quantitative model that gives a reasonably accurate picture of the molecular mechanism and adhesion of bilayer-bridging proteins by means of noncovalent interactions. The results and model indicate that optimum myelin adhesion and stability depend on the difference between, rather than the product of, the opposite charges on the lipid bilayers and myelin basic protein, as well as on the repulsive forces associated with membrane fluidity, and that small changes in any of these parameters away from the synergistically optimum values can lead to large changes in the adhesion or even its total elimination. Our results also show that the often-asked question of which membrane species, the lipids or the proteins, are the "important ones" may be misplaced. Both components work synergistically to provide the adhesion and overall structure. A better appreciation of the mechanism of this synergy may allow for a better understanding of stacked and especially myelin membrane structures and may lead to better treatments for demyelinating diseases such as multiple sclerosis. lipid-protein interactions | myelin membrane structure | membrane adhesion | membrane regeneration/healing | demyelinating diseases

Hu, Yufang; Doudevski, Ivo; Wood, Denise; Moscarello, Mario; Husted, Cynthia; Genain, Claude; Zasadzinski, Joseph A.; Israelachvili, Jacob

2004-09-01

324

Mini review roles of the bZIP gene family in rice.  

PubMed

The basic leucine zipper (bZIP) genes encode transcription factors involved in the regulation of various biological processes. Similar to WRKY, basic helix-loop-helix, and several other groups of proteins, the bZIP proteins form a superfamily of transcription factors that mediate plant stress responses. In this review, we present the roles of bZIP proteins in multiple biological processes that include pathogen defense; responses to abiotic stresses; seed development and germination; senescence; and responses to salicylic, jasmonic, and abscisic acids in rice. We also examined the characteristics of the bZIP proteins and their genetic composition. To ascertain the evolutionary changes in and functions of this supergene family, we performed an exhaustive comparison among the 89 rice bZIP genes that were previously described and those more recently listed in the MSU Rice Genome Annotation Project Database using a Hidden Markov Model. We excluded 3 genes from the list, resulting in a total of 86 bZIP genes in japonica rice. PMID:24782137

E, Z G; Zhang, Y P; Zhou, J H; Wang, L

2014-01-01

325

Notch signaling can inhibit Xath5 function in the neural plate and developing retina.  

PubMed

Neuronal differentiation is regulated by both positive and negative regulatory factors; however, precisely how these factors interact to regulate retinogenesis is still unclear. We have examined the ability of the Notch pathway to modulate the function of the basic helix-loop-helix factor Xath5. Overexpression of Xath5 by RNA injection into cleavage-stage blastomeres promotes ectopic neurogenesis at neural plate stages and ganglion cell differentiation in the developing retina. We found that these activities of Xath5 could be inhibited by coexpression of activated Notch. Notch inhibition of Xath5 function was reversed by coexpression with the zinc finger protein X-MyT1. The Notch effector enhancer-of-split related 1 (ESR1) also blocked Xath5 activity but efficient inhibition by ESR1 required the DNA binding basic domain and the conserved WRPW motif. In addition, ESR1 inhibited the ability of Xath5 to directly activate the expression of XBrn3d, a transcription factor involved in retinal ganglion cell development. Xath5 could upregulate expression of X-Delta-1, ESR1, and ESR3, suggesting that Xath5 participates in a regulatory loop with the Notch pathway. PMID:11922138

Schneider, M L; Turner, D L; Vetter, M L

2001-11-01

326

DNA bending by bHLH charge variants  

PubMed Central

We wish to understand the role of electrostatics in DNA stiffness and bending. The DNA charge collapse model suggests that mutual electrostatic repulsions between neighboring phosphates significantly contribute to DNA stiffness. According to this model, placement of fixed charges near the negatively charged DNA surface should induce bending through asymmetric reduction or enhancement of these inter-phosphate repulsive forces. We have reported previously that charged variants of the elongated basic-leucine zipper (bZIP) domain of Gcn4p bend DNA in a manner consistent with this charge collapse model. To extend this result to a more globular protein, we present an investigation of the dimeric basic-helix–loop–helix (bHLH) domain of Pho4p. The 62 amino acid bHLH domain has been modified to position charged amino acid residues near one face of the DNA double helix. As observed for bZIP charge variants, DNA bending toward appended cations (away from the protein:DNA interface) is observed. However, unlike bZIP proteins, DNA is not bent away from bHLH anionic charges. This finding can be explained by the structure of the more globular bHLH domain which, in contrast to bZIP proteins, makes extensive DNA contacts along the binding face. PMID:16973898

McDonald, Robert J.; Kahn, Jason D.; Maher, L. James

2006-01-01

327

Neural Stem Cell Self-renewal  

PubMed Central

Two fundamental properties of stem cells are their ability to self-renew and to differentiate. Self-renewal is an integration of proliferation control with the maintenance of an undifferentiated state. Stem cell self-renewal is regulated by the dynamic interplay between transcription factors, epigenetic control, microRNA (miRNA) regulators, and cell-extrinsic signals from the microenvironment in which stem cells reside. Recent progress in defining specific roles for cell-intrinsic factors and extrinsic factors in regulating stem cell self-renewal starts to unfold the multilayered regulatory networks. This review focuses on cell-intrinsic regulators, including orphan nuclear receptor TLX, polycomb transcriptional repressor Bmi1, high-mobility-group DNA binding protein Sox2, basic helix-loop-helix Hes genes, histone modifying enzymes and chromatin remodeling proteins, and small RNA modulators, as well as cell-extrinsic signaling molecules, such as Wnt, Notch, Sonic hedgehog (Shh), TGF?, EGF, and FGF. Unraveling the mechanisms by which neural stem cells renew themselves will provide insights into both basic neurosciences and clinical applications of stem cell-based cell replacement therapies for neurodegenerative diseases. PMID:17644000

Shi, Yanhong; Sun, Guoqiang; Zhao, Chunnian; Stewart, Richard

2008-01-01

328

Cloning, purification and preliminary X-ray data analysis of the human ID2 homodimer  

PubMed Central

The ID proteins are named for their role as inhibitors of DNA binding and differentiation. They contain a helix–loop–helix (HLH) domain but lack a basic DNA-binding domain. In complex with basic HLH (bHLH) transcription factors, gene expression is regulated by DNA-binding inactivation. Although the HLH domain is highly conserved and shares a similar topology, the IDs preferentially bind class I bHLH-group members such as E47 (TCF3) but not the class III bHLH member Myc. A structure of an ID protein could potentially shed light on its mechanism. Owing to their short half-lives in vivo and reported in vitro instability, this paper describes the strategies that went into expressing sufficient soluble and stable ID2 to finally obtain diffraction-quality crystals. A 2.1?Å resolution data set was collected from a crystal belonging to space group P3121 with unit-cell parameters a = b = 51.622, c = 111.474?Å, ? = ? = 90, ? = 120° that was obtained by hanging-drop vapour diffusion in a precipitant solution consisting of 0.1?M MES pH 6.5, 2.0?M potassium acetate. The solvent content was consistent with the presence of one or two molecules in the asymmetric unit. PMID:23143248

Wong, Marie V.; Palasingam, Paaventhan; Kolatkar, Prasanna R.

2012-01-01

329

Regulation of the MiTF/TFE bHLH-LZ transcription factors through restricted spatial expression and alternative splicing of functional domains  

PubMed Central

The MiTF/TFE (MiT) family of basic helix–loop–helix leucine zipper transcription factors is composed of four closely related members, MiTF, TFE3, TFEB and TFEC, which can bind target DNA both as homo- or heterodimers. Using real-time RT–PCR, we have analyzed the relative expression levels of the four members in a broad range of human tissues, and found that their ratio of expression is tissue-dependent. We found that, similar to the MiTF gene, the genes for TFEB and TFEC contain multiple alternative first exons with restricted and differential tissue distributions. Seven alternative 5? exons were identified in the TFEB gene, of which three displayed specific expression in placenta and brain, respectively. A novel TFEC transcript (TFEC-C) encodes an N-terminally truncated TFEC isoform lacking the acidic activation domain (AAD), and is exclusively expressed in kidney and small intestine. Furthermore, we observed that a considerable proportion of the TFEC transcripts splice out protein-coding exons, resulting in transcription factor isoforms lacking one or more functional domains, primarily the basic region and/or the AAD. These isoforms were always co-expressed with the intact transcription factors and may act as negative regulators of MiTF/TFE proteins. Our data reveal that multiple levels of regulation exist for the MiTF/TFE family of transcription factors, which indicates how these transcription factors may participate in various cellular processes in different tissues. PMID:15118077

Kuiper, Roland P.; Schepens, Marga; Thijssen, José; Schoenmakers, Eric F. P. M.; van Kessel, Ad Geurts

2004-01-01

330

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development[C][W][OA  

PubMed Central

Transcriptomic adjustment plays an important role in Arabidopsis thaliana seed germination and deetiolation in response to environmental light signals. The G-box cis-element is commonly present in promoters of genes that respond positively or negatively to the light signal. In pursuing additional transcriptional regulators that modulate light-mediated transcriptome changes, we identified bZIP16, a basic region/Leu zipper motif transcription factor, by G-box DNA affinity chromatography. We confirmed that bZIP16 has G-box–specific binding activity. Analysis of bzip16 mutants revealed that bZIP16 is a negative regulator in light-mediated inhibition of cell elongation but a positive regulator in light-regulated seed germination. Transcriptome analysis supported that bZIP16 is primarily a transcriptional repressor regulating light-, gibberellic acid (GA)–, and abscisic acid (ABA)–responsive genes. Chromatin immunoprecipitation analysis revealed that bZIP16 could directly target ABA-responsive genes and RGA-LIKE2, a DELLA gene in the GA signaling pathway. bZIP16 could also indirectly repress the expression of PHYTOCHROME INTERACTING FACTOR3-LIKE5, which encodes a basic helix-loop-helix protein coordinating hormone responses during seed germination. By repressing the expression of these genes, bZIP16 functions to promote seed germination and hypocotyl elongation during the early stages of Arabidopsis seedling development. PMID:23104829

Hsieh, Wen-Ping; Hsieh, Hsu-Liang; Wu, Shu-Hsing

2012-01-01

331

Proneural genes in neocortical development.  

PubMed

Neurons, astrocytes and oligodendrocytes arise from CNS progenitor cells at defined times and locations during development, with transcription factors serving as key determinants of these different neural cell fates. An emerging theme is that the transcription factors that specify CNS cell fates function in a context-dependent manner, regulated by post-translational modifications and epigenetic alterations that partition the genome (and hence target genes) into active or silent domains. Here we profile the critical roles of the proneural genes, which encode basic-helix-loop-helix (bHLH) transcription factors, in specifying neural cell identities in the developing neocortex. In particular, we focus on the proneural genes Neurogenin 1 (Neurog1), Neurog2 and Achaete scute-like 1 (Ascl1), which are each expressed in a distinct fashion in the progenitor cell pools that give rise to all of the neuronal and glial cell types of the mature neocortex. Notably, while the basic functions of these proneural genes have been elucidated, it is becoming increasingly evident that tight regulatory controls dictate when, where and how they function. Current efforts to better understand how proneural gene function is regulated will not only improve our understanding of neocortical development, but are also critical to the future development of regenerative therapies for the treatment of neuronal degeneration or disease. PMID:23999125

Wilkinson, G; Dennis, D; Schuurmans, C

2013-12-01

332

Developmental expression of COE across the Metazoa supports a conserved role in neuronal cell-type specification and mesodermal development.  

PubMed

The transcription factor COE (collier/olfactory-1/early B cell factor) is an unusual basic helix-loop-helix transcription factor as it lacks a basic domain and is maintained as a single copy gene in the genomes of all currently analysed non-vertebrate Metazoan genomes. Given the unique features of the COE gene, its proposed ancestral role in the specification of chemosensory neurons and the wealth of functional data from vertebrates and Drosophila, the evolutionary history of the COE gene can be readily investigated. We have examined the ways in which COE expression has diversified among the Metazoa by analysing its expression from representatives of four disparate invertebrate phyla: Ctenophora (Mnemiopsis leidyi); Mollusca (Haliotis asinina); Annelida (Capitella teleta and Chaetopterus) and Echinodermata (Strongylocentrotus purpuratus). In addition, we have studied COE function with knockdown experiments in S. purpuratus, which indicate that COE is likely to be involved in repressing serotonergic cell fate in the apical ganglion of dipleurula larvae. These analyses suggest that COE has played an important role in the evolution of ectodermally derived tissues (likely primarily nervous tissues) and mesodermally derived tissues. Our results provide a broad evolutionary foundation from which further studies aimed at the functional characterisation and evolution of COE can be investigated. PMID:21069538

Jackson, Daniel J; Meyer, Néva P; Seaver, Elaine; Pang, Kevin; McDougall, Carmel; Moy, Vanessa N; Gordon, Kacy; Degnan, Bernard M; Martindale, Mark Q; Burke, Robert D; Peterson, Kevin J

2010-12-01

333

Contrasting patterns of expression of transcription factors in pancreatic ? and ? cells  

PubMed Central

Pancreatic ? and ? cells are derived from the same progenitors but play opposing roles in the control of glucose homeostasis. Disturbances in their function are associated with diabetes mellitus. To identify many of the proteins that define their unique pathways of differentiation and functional features, we have analyzed patterns of gene expression in ?TC1.6 vs. MIN6 cell lines by using oligonucleotide microarrays. Approximately 9–10% of >11,000 transcripts examined showed significant differences between the two cell types. Of >700 known transcripts enriched in either cell type, transcription factors and their regulators (TFR) was one of the most significantly different categories. Ninety-six members of the basic zipper, basic helix–loop–helix, homeodomain, zinc finger, high mobility group, and other transcription factor families were enriched in ? cells; in contrast, homeodomain proteins accounted for 51% of a total of 45 TFRs enriched in ? cells. Our analysis thus highlights fundamental differences in expression of TFR subtypes within these functionally distinct islet cell types. Interestingly, the ? cells appear to express a large proportion of factors associated with progenitor or stem-type cells, perhaps reflecting their earlier appearance during pancreatic development. The implications of these findings for a better understanding of ? and ? cell dysfunction in diabetes mellitus are also considered. PMID:14557546

Wang, Jie; Webb, Gene; Cao, Yun; Steiner, Donald F.

2003-01-01

334

Developmental expression of COE across the Metazoa supports a conserved role in neuronal cell-type specification and mesodermal development  

PubMed Central

The transcription factor COE (collier/olfactory-1/early B cell factor) is an unusual basic helix–loop–helix transcription factor as it lacks a basic domain and is maintained as a single copy gene in the genomes of all currently analysed non-vertebrate Metazoan genomes. Given the unique features of the COE gene, its proposed ancestral role in the specification of chemosensory neurons and the wealth of functional data from vertebrates and Drosophila, the evolutionary history of the COE gene can be readily investigated. We have examined the ways in which COE expression has diversified among the Metazoa by analysing its expression from representatives of four disparate invertebrate phyla: Ctenophora (Mnemiopsis leidyi); Mollusca (Haliotis asinina); Annelida (Capitella teleta and Chaetopterus) and Echinodermata (Strongylocentrotus purpuratus). In addition, we have studied COE function with knockdown experiments in S. purpuratus, which indicate that COE is likely to be involved in repressing serotonergic cell fate in the apical ganglion of dipleurula larvae. These analyses suggest that COE has played an important role in the evolution of ectodermally derived tissues (likely primarily nervous tissues) and mesodermally derived tissues. Our results provide a broad evolutionary foundation from which further studies aimed at the functional characterisation and evolution of COE can be investigated. Electronic supplementary material The online version of this article (doi:10.1007/s00427-010-0343-3) contains supplementary material, which is available to authorized users. PMID:21069538

Meyer, Néva P.; Seaver, Elaine; Pang, Kevin; McDougall, Carmel; Moy, Vanessa N.; Gordon, Kacy; Degnan, Bernard M.; Martindale, Mark Q.; Burke, Robert D.; Peterson, Kevin J.

2010-01-01

335

Assembly of a bZIP-bHLH transcription activation complex: formation of the yeast Cbf1-Met4-Met28 complex is regulated through Met28 stimulation of Cbf1 DNA binding.  

PubMed Central

Transcriptional activation of sulfur amino acid metabolism in yeast is dependent on a multi-functional factor, the centromere-binding factor 1 (Cbf1) and on two specific transcription factors, Met4 and Met28. Cbf1 belongs to the basic helix-loop-helix DNA-binding protein family while Met4 and Met28 are two basic leucine zipper (bZIP) factors. We have shown previously that in cell extracts, the three factors are found in a high molecular weight complex. By using mobility shift assays, we report here that the in vitro reconstitution of the Cbf1-Met4-Met28 complex on MET16UAS can be obtained with purified recombinant proteins. DNase I protection experiments confirm that the Cbf1-Met4-Met28 complex is formed over the TCACGTG sequence. The experiments also show that both Met4 and Met28 bind to DNA only in the presence of Cbf1. Moreover, Met28 is shown to enhance the DNA-binding activity of Cbf1. Analysis of MET28 gene regulation reveals that its expression requires Met4. Thus the biochemical activity of Met28 allows the establishment of a positive regulatory loop. The results thus provide evidence of a new functional relationship between bHLH and bZIP proteins and demonstrate that the association of such factors may serve to discriminate between the different TCACGTG sequences found in the chromosomes. PMID:9171357

Kuras, L; Barbey, R; Thomas, D

1997-01-01

336

Vacuum Basics & PumpsVacuum Basics & PumpsVacuum Basics & PumpsVacuum Basics & Pumps Ref: CLC notes (JHU)  

E-print Network

Vacuum Basics & PumpsVacuum Basics & PumpsVacuum Basics & PumpsVacuum Basics & Pumps Ref: CLC notes (JHU) Some graphs courtesy of KJLesker, Edwards, Veeco #12;I. VacuumI. Vacuum 1 atm= 760 torr = 1.0132 bar = 1.013x105 Pa = 14.7 psi Rough Vacuum (RV) 1 torr ­ 760 torrg ( ) Medium Vacuum (MV) 10-5 torr

Liu, Kai

337

Basics of Cell Culture  

NSDL National Science Digital Library

These manuals are used in the Stem Cell Culture Course at City College of San Francisco. This course is about general mammalian cell culture techniques but includes a laboratory exercise using stem cells (takes 3 weeks to complete). The course is taught to high school students but the materials are also used for college students. Laboratory exercises provide instruction in basic techniques of routine cell culture using common cell lines before progressing to differentiation of mouse embryonic stem cells. Photographs and explanations of common equipment (laminar flow hood, inverted microscope, etc.) and reagents are provided. Laboratory exercises include the following: Basic Aseptic Technique; Media Preparation; Plating cells from frozen stock; Cell counting and plating; Survival assay (UV); Live Cell Identification; Transfection; Freezing cells; Stem cell differentiation. A student lab manual and an instructor manual are provided.

Afshar, Golnar

338

Basic lubrication equations  

NASA Technical Reports Server (NTRS)

Lubricants, usually Newtonian fluids, are assumed to experience laminar flow. The basic equations used to describe the flow are the Navier-Stokes equation of motion. The study of hydrodynamic lubrication is, from a mathematical standpoint, the application of a reduced form of these Navier-Stokes equations in association with the continuity equation. The Reynolds equation can also be derived from first principles, provided of course that the same basic assumptions are adopted in each case. Both methods are used in deriving the Reynolds equation, and the assumptions inherent in reducing the Navier-Stokes equations are specified. Because the Reynolds equation contains viscosity and density terms and these properties depend on temperature and pressure, it is often necessary to couple the Reynolds with energy equation. The lubricant properties and the energy equation are presented. Film thickness, a parameter of the Reynolds equation, is a function of the elastic behavior of the bearing surface. The governing elasticity equation is therefore presented.

Hamrock, B. J.; Dowson, D.

1981-01-01

339

Basic Liquid Chromatography  

NSDL National Science Digital Library

The online textbook, Basic Liquid Chromatography, is provided by Dr. Yuri Kazakevich and Dr. Harold McNair of Seton Hall University. For those needing review or an introduction to the subject, the well designed and easily read document contains a wealth of information. Sections include an introduction, instrumentation, detectors, theory, adsorbents, reversed phase, gel permeation chromatography, column selection, pH effect, and even an online short course.

Kazakevich, Yuri.

1996-01-01

340

Superbug Survival is Basic  

NSDL National Science Digital Library

This on-line news article investigates the question: Can microbial life thrive in the caustic conditions common to floor strippers and baking soda? It reports samples near a landfill in south Chicago that reveal alkaline solutions are basic to certain bacterial superbugs. The article explores the habitat, genetic analysis, and close relatives of these microbial wonders while also conveying that much more research is needed in the area. Useful links are located at the end of the article.

2003-11-13

341

Basics of Developing Questionnaires  

NSDL National Science Digital Library

Whether developing questions for questionnaires or interviews or focus groups, there are certain guidelines that help to ensure that respondents provide information that is useful and can later be analyzed. This resource offers advice on developing questions for interviews or focus groups. It contains basics conducting the interviews, providing directions to respondents as well as guidelines for composing the content and wording of the questionnaire. This resource is aimed for use in workshops/conferences and is intended for novice evaluators.

Carter McNamara

342

Basics of Endocrine Function  

NSDL National Science Digital Library

This flash video presentation provides an introduction to the basics of the endocrine system. It defines the criteria for determining if a chemical is a hormone and compares the action of hormones with other signalling chemicals and with the way the nervous system functions. The last part of the presentation gives a preview of a flowchart homework activity that can be used by students as a way to learn the function of specific hormones.

Dr. Daniel Brouse (Human Anatomy and Physiology Society)

2008-08-09

343

Basics of asset protection.  

PubMed

Asset protection has become a hot topic for physicians because of the risk of high judgments in medical malpractice cases-judgments that often exceed their policy limits and can force a physician into bankruptcy. In this article we describe some of the background and basics of asset protection. In future articles we will detail some of the protection strategies that can be used. PMID:15779521

Stark, Blooma; Gilman, Paul A

2005-01-01

344

Basics of Space Flight  

NSDL National Science Digital Library

This training module was designed to help the user identify and grasp basic concepts associated with space travel and deep space missions. Separate sections deal with topics such as the physical environment of space (solar system, gravity, orbital mechanics), flight projects (mission concepts, system requirements, design, onboard systems and instruments), and flight operations (launch, cruise, encounter). Links to related topics are embedded in the text.

345

Population: Basic Statistics  

NSDL National Science Digital Library

This lesson reinforces the idea that Earth's population, including the population of the United States, is gowing at a dramatic rate. It discusses some of the basics of demography, the study of population and its changes, and introduces key terms used to describe a population. The lesson inlcudes an activity in which students use an online reference to look up some population statistics and answer questions related to them.

Ken Rhinehart

346

Superbug Survival is Basic  

NSDL National Science Digital Library

This on-line news article investigates the question: Can microbial life thrive in the caustic conditions common to floor strippers and baking soda? It reports samples near a landfill in south Chicago that reveal alkaline solutions are basic to certain bacterial superbugs. The article explores the habitat, genetic analysis, and close relatives of these microbial wonders while also conveying that much more research is needed in the area. Useful links are located at the end of the article.

Matsos, Helen

347

Basic plasma physics II  

Microsoft Academic Search

The basic physics of classical ideal plasmas is presented in reviews of recent theoretical and experimental investigations, with an emphasis on nonlinear interactions violating the assumptions of weak turbulence. Topics examined include Kolmogorov spectra, parametric instabilities in magnetoactive plasmas, collapse and self-focusing of Langmuir waves, collective dissipation and transport, spontaneous reconnection of magnetic-field lines in a collisionless plasma, collective-beam\\/plasma interaction,

A. A. Galeev; R. N. Sudan

1984-01-01

348

Basics of Biosafety  

NASA Technical Reports Server (NTRS)

This slide presentation reviews the basics of biosafety and the importance of assuring proper biosafety practices. The objectives of the presentation are to review regulations about biosafety, and the different biosafety levels; the biosafety facilities at Johnson Space Center; the usage and maintenance of the biosafety cabinet, the proper methods to handle biologically hazardous materials upon exposure, and the methods of cleanup in the event of a spill, and the training requirements that are mandated for personnel handling biologically hazardous materials.

Wong, Willy

2009-01-01

349

Transmission Electron Microscopy Basics  

NSDL National Science Digital Library

This extensive site from the University of Liverpool is a set of resources based on the textbook Transmission Electron Microscopy - Basics by D.B.Williams and C.B.Carter. The tutorial is designed to accompany an introductory course on transmission electron microscopy for students with an understanding of elementary physics. Topics include electron scattering, electron atom interactions, the electron gun, probe size, lenses, depth of field and depth of focus, and others. Each chapter includes interactive Java applets that facilitate understanding of the concepts presented.

Peter Goodhew

350

Basic Financial Statements  

NSDL National Science Digital Library

Dr. Sharon Garrison of the University of Arizona created this basic overview of financial statements for students. Concepts covered in this tutorial include the accounting equation, double entry accounting, debits and credits, balance sheets and income statements. The resources on this site are designed to equip users with the ability identify specific components of a balance sheet and what it says about a company, and the knowledge to put together an income statement. The information on financial statements introduces accounting students to general concepts, and serves as an excellent reference resource for finance fundamentals.

Garrison, Sharon Hatten

351

Career Basics Booklet  

NSDL National Science Digital Library

Struggling with your next career step? Science Careers' editorial team brings you "Career Basics: Advice and Resources for Scientists." The booklet provides advice and help on preparing CVs and resumes, writing grants and scientific papers, networking, and much more. Read each article in the booklet online, or download each chapter or the entire booklet as a PDF. All for free. It is one more tool Science Careers provides to help you jump-start your career, be it in academia or outside the ivory tower!

Science Careers (Science)

2009-01-01

352

Basic space payload fastener  

NASA Technical Reports Server (NTRS)

A new basic space fastener has been developed and tested by the GSFC. The purposes of this fastener are to permit assembly and servicing in space by astronauts and/or robots and to facilitate qualification of payloads on Earth prior to launch by saving time and money during the systems integration and component testing and qualification processes. The space fastener is a rework of the basic machine screw such that crossthreading is impossible; it is self-locking and will not work its way out during launch (vibration proof); it will not wear out despite repeated use; it occupies a small foot print which is comparable to its machine screw equivalent, and it provides force and exhibits strength comparable to its machine screw equivalent. Construction is ultra-simple and cost effective and the principle is applicable across the full range of screw sizes ranging from a #10 screw to 2.5 cm (1 in) or more. In this paper, the fastener principles of operation will be discussed along with test results and construction details. The new fastener also has considerable potential in the commercial sector. A few promising applications will be presented.

Vranish, J. M.; Gorevan, Stephen

1995-01-01

353

Basic and clinical immunology  

NASA Technical Reports Server (NTRS)

Progress in immunology continues to grow exponentially every year. New applications of this knowledge are being developed for a broad range of clinical conditions. Conversely, the study of primary and secondary immunodeficiencies is helping to elucidate the intricate mechanisms of the immune system. We have selected a few of the most significant contributions to the fields of basic and clinical immunology published between October 2001 and October 2002. Our choice of topics in basic immunology included the description of T-bet as a determinant factor for T(H)1 differentiation, the role of the activation-induced cytosine deaminase gene in B-cell development, the characterization of CD4(+)CD25(+) regulatory T cells, and the use of dynamic imaging to study MHC class II transport and T-cell and dendritic cell membrane interactions. Articles related to clinical immunology that were selected for review include the description of immunodeficiency caused by caspase 8 deficiency; a case series report on X-linked agammaglobulinemia; the mechanism of action, efficacy, and complications of intravenous immunoglobulin; mechanisms of autoimmunity diseases; and advances in HIV pathogenesis and vaccine development. We also reviewed two articles that explore the possible alterations of the immune system caused by spaceflights, a new field with increasing importance as human space expeditions become a reality in the 21st century.

Chinen, Javier; Shearer, William T.

2003-01-01

354

Interaction between the bHLH Transcription Factor FIT and ETHYLENE INSENSITIVE3/ETHYLENE INSENSITIVE3-LIKE1 Reveals Molecular Linkage between the Regulation of Iron Acquisition and Ethylene Signaling in Arabidopsis[C][W  

PubMed Central

Understanding the regulation of key genes involved in plant iron acquisition is of crucial importance for breeding of micronutrient-enriched crops. The basic helix-loop-helix protein FER-LIKE FE DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT), a central regulator of Fe acquisition in roots, is regulated by environmental cues and internal requirements for iron at the transcriptional and posttranscriptional levels. The plant stress hormone ethylene promotes iron acquisition, but the molecular basis for this remained unknown. Here, we demonstrate a direct molecular link between ethylene signaling and FIT. We identified ETHYLENE INSENSITIVE3 (EIN3) and ETHYLENE INSENSITIVE3-LIKE1 (EIL1) in a screen for direct FIT interaction partners and validated their physical interaction in planta. We demonstrate that the ein3 eil1 transcriptome was affected to a greater extent upon iron deficiency than normal iron compared with the wild type. Ethylene signaling by way of EIN3/EIL1 was required for full-level FIT accumulation. FIT levels were reduced upon application of aminoethoxyvinylglycine and in the ein3 eil1 background. MG132 could restore FIT levels. We propose that upon ethylene signaling, FIT is less susceptible to proteasomal degradation, presumably due to a physical interaction between FIT and EIN3/EIL1. Increased FIT abundance then leads to the high level of expression of genes required for Fe acquisition. This way, ethylene is one of the signals that triggers Fe deficiency responses at the transcriptional and posttranscriptional levels. PMID:21586684

Lingam, Sivasenkar; Mohrbacher, Julia; Brumbarova, Tzvetina; Potuschak, Thomas; Fink-Straube, Claudia; Blondet, Eddy; Genschik, Pascal; Bauer, Petra

2011-01-01

355

The rice RING finger E3 ligase, OsHCI1, drives nuclear export of multiple substrate proteins and its heterogeneous overexpression enhances acquired thermotolerance  

PubMed Central

Thermotolerance is very important for plant survival when plants are subjected to lethally high temperature. However, thus far little is known about the functions of RING E3 ligase in response to heat shock in plants. This study found that one rice gene encoding the RING finger protein was specifically induced by heat and cold stress treatments but not by salinity or dehydration and named it OsHCI1 (Oryza sativa heat and cold induced 1). Subcellular localization results showed that OsHCI1 was mainly associated with the Golgi apparatus and moved rapidly and extensively along the cytoskeleton. In contrast, OsHCI1 may have accumulated in the nucleus under high temperatures. OsHCI1 physically interacted with nuclear substrate proteins including a basic helix-loop-helix transcription factor. Transient co-overexpression of OsHCI1 and each of three nuclear proteins showed that their fluorescent signals moved into the cytoplasm as punctuate formations. Heterogeneous overexpression of OsHCI1 in Arabidopsis highly increased survival rate through acquired thermotolerance. It is proposed that OsHCI1 mediates nuclear–cytoplasmic trafficking of nuclear substrate proteins via monoubiquitination and drives an inactivation device for the nuclear proteins under heat shock. PMID:23698632

Jang, Cheol Seong

2013-01-01

356

CoCoA, a nuclear receptor coactivator which acts through an N-terminal activation domain of p160 coactivators.  

PubMed

The p160 coactivators bind to and potentiate transcriptional activation by nuclear receptors by recruiting secondary coactivators such as the histone acetyltransferases p300 and CBP and the protein methyltransferase CARM1. The function of the highly conserved N-terminal basic-helix-loop-helix/Per-Arnt-Sim (bHLH-PAS) domain of p160 coactivators is unknown. This region is required for coactivator synergy among p160, p300, and CARM1 coactivators. We identified a coactivator, coiled-coil coactivator (CoCoA), which binds to this domain and thereby enhances transcriptional activation by the estrogen receptor and other nuclear receptors. Endogenous CoCoA was found simultaneously with p160 coactivators on the promoter of an endogenous estrogen-responsive gene. Reduction of endogenous cellular CoCoA levels inhibited the estrogen-stimulated expression of transiently transfected and endogenous genes. Moreover, CoCoA cooperated synergistically with GRIP1, CARM1, and p300 to enhance ER-mediated transcription. Thus, the N-terminal region of p160 coactivators contains an additional activation domain which contributes to coactivator function by recruitment of CoCoA. PMID:14690606

Kim, Jeong Hoon; Li, Hongwei; Stallcup, Michael R

2003-12-01

357

Cell-based biological evaluations of 5-(3-bromo-4-phenethoxybenzylidene)thiazolidine-2,4-dione as promising wound healing agent.  

PubMed

Recent studies have focused on prostaglandin E2 (PGE2) because PGE2 regulates vertebrate hematopoietic stem cell induction and engraftment. PGE2 acts through EP2 and EP4 receptors to mediate regeneration and hematopoietic stem cell (HSC) development via the Wnt signaling pathway. Previously we reported that inhibitors of 15-PGDH can control the intracellular levels of PGE2. Therefore, we developed new potent 15-PGDH inhibitor, 5-(3-bromo-4-phenethoxybenzylidene)thiazolidine-2,4-dione (TD191), with an IC50 of 4nM and tested cell-based wound healing effects. This compound significantly increased the level of PGE2 (451pg/mL) in A549 cells, which was about 7-fold higher than that of control. HaCaT cells exposed to TD191 showed significantly improved wound healing after 48h in scratch wound healing test, whereas treatment of TD191 to the fibroblast Hs27 cells slightly decreased cell growth compared with control. SCL is a basic helix-loop-helix transcription factor that is an essential for HSC development. By qPCR, SCL expression in HaCaT cells was 2-fold enhanced after addition of TD191, while treatment of TD191 into fibroblast Hs27 cells was not significantly changed the expression levels of the gene. This data provides in vitro evidence that TD191 may have utility for the therapeutic management of wound healing without scar formation. PMID:25801150

Piao, Yu Lan; Ram Song, A; Cho, Hoon

2015-05-01

358

Brassinosteroid Signaling Pathway  

NSDL National Science Digital Library

Plant growth is regulated by an intricate network of hormonal signaling pathways. These small-molecule hormones cause changes in gene expression that are associated with cell expansion and division and changes in development. Paradoxically, six of these hormones appear to have largely overlapping functions, yet the loss of response to any one hormone cannot be compensated by the action of another plant hormone. Among these hormones are the brassinosteroids (BRs), the polyhydroxylated steroid hormones of plants. The emerging picture of BR signal transduction diverges radically from the paradigms of animal steroid signaling, which generally involve the action of members of the nuclear receptor superfamily. BRs bind the extracellular domain of a small family of leucine-rich-repeat receptor kinases to activate intracellular signal transduction cascades that regulate the expression of hundreds of genes. The signaling pathway involves a cell surface receptor complex, a glycogen synthase kinase 3, a kelch-containing serine/threonine phosphatase, and a novel family of basic helix-loop-helix and Myc-like plant specific transcription factors. The receptor and each of the signaling components were identified in Arabidopsis thaliana, and knowledge of their sequences allowed identification of orthologs in rice, tomato, barley, and pea.

Youssef Belkhadir (The Salk Institute; Plant Biology Laboratory REV)

2006-12-05

359

Modes of Retrotransposition of Long Interspersed Element-1 by Environmental Factors  

PubMed Central

Approximately 42% of the human genome is composed of endogenous retroelements, and the major retroelement component, long interspersed element-1 (L1), comprises ?17% of the total genome. A single human cell has more than 5?×?105 copies of L1, 80?100 copies of which are competent for retrotransposition (RTP). Notably, L1 can induce RTP of other retroelements, such as Alu and SVA, and is believed to function as a driving force of evolution. Although L1-RTP during early embryogenesis has been highlighted in the literature, recent observations revealed that L1-RTP also occurs in somatic cells. However, little is known about how environmental factors induce L1-RTP. Here, we summarize our current understanding of the mechanism of L1-RTP in somatic cells. We have focused on the mode of L1-RTP that is dependent on the basic helix–loop–helix/per–arnt–sim (bHLH/PAS) family of transcription factors. Along with the proposed function of bHLH/PAS proteins in environmental adaptation, we discuss the functional linking of L1-RTP and bHLH/PAS proteins for environmental adaptation and evolution. PMID:22666219

Ishizaka, Yukihito; Okudaira, Noriyuki; Tamura, Masato; Iijima, Kenta; Shimura, Mari; Goto, Motohito; Okamura, Tadashi

2012-01-01

360

?-Catenin Is Required for Hair-Cell Differentiation in the Cochlea  

PubMed Central

The development of hair cells in the auditory system can be separated into steps; first, the establishment of progenitors for the sensory epithelium, and second, the differentiation of hair cells. Although the differentiation of hair cells is known to require the expression of basic helix-loop-helix transcription factor, Atoh1, the control of cell proliferation in the region of the developing cochlea that will ultimately become the sensory epithelium and the cues that initiate Atoh1 expression remain obscure. We assessed the role of Wnt/?-catenin in both steps in gain- and loss-of-function models in mice. The canonical Wnt pathway mediator, ?-catenin, controls the expression of Atoh1. Knock-out of ?-catenin inhibited hair-cell, as well as pillar-cell, differentiation from sensory progenitors but was not required to maintain a hair-cell fate once specified. Constitutive activation of ?-catenin expanded sensory progenitors by inducing additional cell division and resulted in the differentiation of extra hair cells. Our data demonstrate that ?-catenin plays a role in cell division and differentiation in the cochlear sensory epithelium. PMID:24806673

Hu, Lingxiang; Jacques, Bonnie E.; Mulvaney, Joanna F.; Dabdoub, Alain

2014-01-01

361

Cloning, characterization, hypoxia and heat shock response of hypoxia inducible factor-1 (HIF-1) from the small abalone Haliotis diversicolor.  

PubMed

In this study, hypoxia inducible factor-1? (HIF-1?) and hypoxia inducible factor-1? (HIF-1?) from small abalone Haliotis diversicolor were cloned. The cDNA of H. diversicolor HIF-1? (HdHIF-1?) is 2,833 bp encoding a protein of 711aa and H. diversicolor HIF-1? (HdHIF-1?) is 1919 bp encoding a protein of 590aa. Similar to other species' HIF-1, HdHIF-1 has one basic helix-loop-helix (bHLH) domain and two Per-Arnt-Sim (PAS) domains, and HdHIF-1? has a oxygen-dependent degradation domain (ODDD) with two proline hydroxylation motifs and a C-terminal transactivation domain (C-TAD) with an asparagine hydroxylation motif. Under normoxic conditions, HdHIF-1? and HdHIF-1? mRNAs were constitutively present in all examined tissues. Under hypoxia (2.0mg/L DO at 25°C) stress, HdHIF-1? expression was up-regulated in gills at 4h, 24h and 96 h, and in hemocytes at 24h and 96 h, while HdHIF-1? remained relatively constant. Under thermal stress (31°C), HdHIF-1? expression was significantly increased in gills at 4h, and hemocytes at 0 h and 4 h, while HdHIF-1? expression still remained relatively constant. These results suggested that HIF-1? may play an important role in adaption to poor environment in H. diversicolor. PMID:24211325

Cai, Xiuhong; Huang, Yitao; Zhang, Xin; Wang, Shuhong; Zou, Zhihua; Wang, Guodong; Wang, Yilei; Zhang, Ziping

2014-01-25

362

The Zinc Finger Transcription Factor RP58 Negatively Regulates Rnd2 for the Control of Neuronal Migration During Cerebral Cortical Development.  

PubMed

The zinc finger transcription factor RP58 (also known as ZNF238) regulates neurogenesis of the mouse neocortex and cerebellum (Okado et al. 2009; Xiang et al. 2011; Baubet et al. 2012; Ohtaka-Maruyama et al. 2013), but its mechanism of action remains unclear. In this study, we report a cell-autonomous function for RP58 during the differentiation of embryonic cortical projection neurons via its activities as a transcriptional repressor. Disruption of RP58 expression alters the differentiation of immature neurons and impairs their migration and positioning within the mouse cerebral cortex. Loss of RP58 within the embryonic cortex also leads to elevated mRNA for Rnd2, a member of the Rnd family of atypical RhoA-like GTPase proteins important for cortical neuron migration (Heng et al. 2008). Mechanistically, RP58 represses transcription of Rnd2 via binding to a 3'-regulatory enhancer in a sequence-specific fashion. Using reporter assays, we found that RP58 repression of Rnd2 is competed by proneural basic helix-loop-helix transcriptional activators. Finally, our rescue experiments revealed that negative regulation of Rnd2 by RP58 was important for cortical cell migration in vivo. Taken together, these studies demonstrate that RP58 is a key player in the transcriptional control of cell migration in the developing cerebral cortex. PMID:24084125

Heng, Julian Ik-Tsen; Qu, Zhengdong; Ohtaka-Maruyama, Chiaki; Okado, Haruo; Kasai, Masataka; Castro, Diogo; Guillemot, François; Tan, Seong-Seng

2015-03-01

363

Roles of bHLH genes in neural stem cell differentiation  

SciTech Connect

Neural stem cells change their characteristics over time during development: they initially proliferate only and then give rise to neurons first and glial cells later. In the absence of the repressor-type basic helix-loop-helix (bHLH) genes Hes1, Hes3 and Hes5, neural stem cells do not proliferate sufficiently but prematurely differentiate into neurons and become depleted without making the later born cell types such as astrocytes and ependymal cells. Thus, Hes genes are essential for maintenance of neural stem cells to make cells not only in correct numbers but also in full diversity. Hes genes antagonize the activator-type bHLH genes, which include Mash1, Math and Neurogenin. The activator-type bHLH genes promote the neuronal fate determination and induce expression of Notch ligands such as Delta. These ligands activate Notch signaling and upregulate Hes1 and Hes5 expression in neighboring cells, thereby maintaining these cells undifferentiated. Thus, the activator-type and repressor-type bHLH genes regulate each other, allowing only subsets of cells to undergo differentiation while keeping others to stay neural stem cells. This regulation is essential for generation of complex brain structures of appropriate size, shape and cell arrangement.

Kageyama, Ryoichiro [Institute for Virus Research, Kyoto University, Shogoin-Kawahara, Sakyo-ku, Kyoto 606-8507 (Japan)]. E-mail: rkageyam@virus.kyoto-u.ac.jp; Ohtsuka, Toshiyuki [Institute for Virus Research, Kyoto University, Shogoin-Kawahara, Sakyo-ku, Kyoto 606-8507 (Japan); Hatakeyama, Jun [Institute for Virus Research, Kyoto University, Shogoin-Kawahara, Sakyo-ku, Kyoto 606-8507 (Japan); Ohsawa, Ryosuke [Institute for Virus Research, Kyoto University, Shogoin-Kawahara, Sakyo-ku, Kyoto 606-8507 (Japan)

2005-06-10

364

Metastasis-associated protein 1 (MTA1) is an essential downstream effector of the c-MYC oncoprotein.  

PubMed

The c-myc oncogene is among the most commonly overexpressed genes in human cancer. c-myc encodes a basic helix-loop-helix/leucine zipper (bHLH/LZ) transcription factor (c-MYC) that activates a cascade of downstream targets that ultimately mediate cellular transformation. Although a large number of genes are regulated by c-MYC, only a few have been functionally linked to c-MYC-mediated transformation. By expression profiling, the metastasis-associated protein 1 (MTA1) gene was identified here as a target of the c-MYC oncoprotein in primary human cells, a result confirmed in human cancer cells. MTA1 itself has been previously implicated in cellular transformation, in part through its ability to regulate the epithelial-to-mesenchymal transition and metastasis. MTA1 is a component of the Mi-2/nucleosome remodeling and deacetylating (NURD) complex that contains both histone deacetylase and nucleosome remodeling activity. The data reported here demonstrate that endogenous c-MYC binds to the genomic MTA1 locus and recruits transcriptional coactivators. Most importantly, short hairpin RNA (shRNA)-mediated knockdown of MTA1 blocks the ability of c-MYC to transform mammalian cells. These data implicate MTA1 and the Mi-2/NURD complex as one of the first downstream targets of c-MYC function that are essential for the transformation potential of c-MYC. PMID:16172399

Zhang, Xiao-Yong; DeSalle, Lauren M; Patel, Jagruti H; Capobianco, Anthony J; Yu, Duonan; Thomas-Tikhonenko, Andrei; McMahon, Steven B

2005-09-27

365

Enhancer mutations of Akv murine leukemia virus inhibit the induction of mature B-cell lymphomas and shift disease specificity towards the more differentiated plasma cell stage  

SciTech Connect

This study investigates the role of the proviral transcriptional enhancer for B-lymphoma induction by exogenous Akv murine leukemia virus. Infection of newborn inbred NMRI mice with Akv induced 35% plasma cell proliferations (PCPs) (consistent with plasmacytoma), 33% diffuse large B-cell lymphomas, 25% follicular B-cell lymphomas and few splenic marginal zone and small B-cell lymphomas. Deleting one copy of the 99-bp proviral enhancer sequence still allowed induction of multiple B-cell tumor types, although PCPs dominated (77%). Additional mutation of binding sites for the glucocorticoid receptor, Ets, Runx, or basic helix-loop-helix transcription factors in the proviral U3 region, however, shifted disease induction to almost exclusively PCPs, but had no major influence on tumor latency periods. Southern analysis of immunoglobulin rearrangements and ecotropic provirus integration patterns showed that many of the tumors/cell proliferations induced by each virus were polyclonal. Our results indicate that enhancer mutations weaken the ability of Akv to induce mature B-cell lymphomas prior to the plasma cell stage, whereas development of plasma cell proliferations is less dependent of viral enhancer strength.

Sorensen, Karina Dalsgaard [Department of Molecular Biology, University of Aarhus, C.F. Mollers Alle, Bldg. 130, DK-8000 Aarhus C (Denmark); Kunder, Sandra [Institute of Pathology, GSF-National Research Center for Environment and Health, Neuherberg (Germany); Quintanilla-Martinez, Leticia [Institute of Pathology, GSF-National Research Center for Environment and Health, Neuherberg (Germany); Sorensen, Jonna [Department of Comparative Medicine, GSF-National Research Center for Environment and Health, Neuherberg (Germany); Schmidt, Joerg [Department of Comparative Medicine, GSF-National Research Center for Environment and Health, Neuherberg (Germany); Pedersen, Finn Skou [Department of Molecular Biology, University of Aarhus, C.F. Mollers Alle, Bldg. 130, DK-8000 Aarhus C (Denmark)]. E-mail: fsp@mb.au.dk

2007-05-25

366

Development of inner ear afferent connections: forming primary neurons and connecting them to the developing sensory epithelia  

NASA Technical Reports Server (NTRS)

The molecular and cellular origin of the primary neurons of the inner ear, the vestibular and spiral neurons, is reviewed including how they connect to the specific sensory epithelia and what the molecular nature of their survival is. Primary neurons of the ear depend on a single basic Helix-Loop-Helix (bHLH) protein for their formation, neurogenin 1 (ngn1). An immediate downstream gene is the bHLH gene neuronal differentiation (NeuroD). Targeted null mutations of ngn1 results in absence of primary neuron formation; targeted null mutation of NeuroD results in loss of almost all spiral and many vestibular neurons. NeuroD and a later expressed gene, Brn3a, play a role in pathfinding to and within sensory epithelia. The molecular nature of this pathfinding property is unknown. Reduction of hair cells in ngn1 null mutations suggests a clonal relationship with primary neurons. This relationship may play some role in specifying the identity of hair cells and the primary neurons that connect with them. Primary neuron neurites growth to sensory epithelia is initially independent of trophic factors released from developing sensory epithelia, but becomes rapidly dependent on those factors. Null mutations of specific neurotrophic factors lose distinct primary neuron populations which undergo rapid embryonic cell death.

Fritzsch, Bernd

2003-01-01

367

The Clock gene clone and its circadian rhythms in Pelteobagrus vachelli  

NASA Astrophysics Data System (ADS)

The Clock gene, a key molecule in circadian systems, is widely distributed in the animal kingdom. We isolated a 936-bp partial cDNA sequence of the Clock gene (Pva-clock) from the darkbarbel catfish Pelteobagrus vachelli that exhibited high identity with Clock genes of other species of fish and animals (65%-88%). The putative domains included a basic helix-loop-helix (bHLH) domain and two period-ARNT-single-minded (PAS) domains, which were also similar to those in other species of fish and animals. Pva-Clock was primarily expressed in the brain, and was detected in all of the peripheral tissues sampled. Additionally, the pattern of Pva-Clock expression over a 24-h period exhibited a circadian rhythm in the brain, liver and intestine, with the acrophase at zeitgeber time 21:35, 23:00, and 23:23, respectively. Our results provide insight into the function of the molecular Clock of P. vachelli.

Qin, Chuanjie; Shao, Ting

2015-01-01

368

Discrete Levels of Twist Activity Are Required to Direct Distinct Cell Functions during Gastrulation and Somatic Myogenesis  

PubMed Central

Twist (Twi), a conserved basic helix-loop-helix transcriptional regulator, directs the epithelial-to-mesenchymal transition (EMT), and regulates changes in cell fate, cell polarity, cell division and cell migration in organisms from flies to humans. Analogous to its role in EMT, Twist has been implicated in metastasis in numerous cancer types, including breast, pancreatic and prostate. In the Drosophila embryo, Twist is essential for discrete events in gastrulation and mesodermal patterning. In this study, we derive a twi allelic series by examining the various cellular events required for gastrulation in Drosophila. By genetically manipulating the levels of Twi activity during gastrulation, we find that coordination of cell division is the most sensitive cellular event, whereas changes in cell shape are the least sensitive. Strikingly, we show that by increasing levels of Snail expression in a severe twi hypomorphic allelic background, but not a twi null background, we can reconstitute gastrulation and produce viable adult flies. Our results demonstrate that the level of Twi activity determines whether the cellular events of ventral furrow formation, EMT, cell division and mesodermal migration occur. PMID:24915423

Wong, Ming-Ching; Dobi, Krista C.; Baylies, Mary K.

2014-01-01

369

scratch, a pan-neural gene encoding a zinc finger protein related to snail, promotes neuronal development.  

PubMed

The Drosophila scratch (scrt) gene is expressed in most or all neuronal precursor cells and encodes a predicted zinc finger transcription factor closely related to the product of the mesoderm determination gene snail (sna). Adult flies homozygous for scrt null alleles have a reduced number of photoreceptors in the eye, and embryos lacking the function of both scrt and the pan-neural gene deadpan (dpn), which encodes a basic helix-loop-helix (bHLH) protein, exhibit a significant loss of neurons. Conversely, ectopic expression of a scrt transgene during embryonic and adult development leads to the production of supernumerary neurons. Consistent with scrt functioning as a transcription factor, various genes are more broadly expressed than normal in scrt null mutants. Reciprocally, these same genes are expressed at reduced levels in response to ectopic scrt expression. We propose that scrt promotes neuronal cell fates by suppressing expression of genes promoting non-neuronal cell fates. We discuss the similarities between the roles of the ancestrally related scrt, sna, and escargot (esc) genes in regulating cell fate choices. PMID:7557390

Roark, M; Sturtevant, M A; Emery, J; Vaessin, H; Grell, E; Bier, E

1995-10-01

370

Snail-type zinc finger proteins prevent neurogenesis in Scutoid and transgenic animals of Drosophila.  

PubMed

Scutoid is a classical dominant gain-of-function mutation of Drosophila, causing a loss of bristles and roughening of the compound eye. Previous genetic and molecular analyses have shown that Scutoid is associated with a chromosomal transposition resulting in a fusion of no-oceli and snail genes. How this gene fusion event leads to the defects in neurogenesis was not known until now. Here have found that snail is ectopically expressed in the eye-antennal and wing imaginal discs in Scutoid larvae, and that this expression is reduced in Scutoid revertants. We have also shown that the expressivity of Scutoid is enhanced by zeste mutations. snail and escargot encode evolutionarily conserved zinc-finger proteins involved in the development of mesoderm and limbs. Snail and Escargot proteins share a common target DNA sequence with the basic helix-loop-helix (bHLH) type proneural gene products. When expressed in the developing external sense organ precursors of the thorax and the eye, these proteins cause a loss of mechanosensory bristles in the thorax and perturbed the development of the compound eye. Such phenotypes resemble those associated with Scutoid. Furthermore, the effect of ectopic Escargot on bristle development is antagonized by coexpression of the bHLH gene asense. Thus, our results suggest that the Scutoid phenotype is due to an ectopic snail expression under the control of no-oceli enhancer, antagonizing neurogenesis through its inhibitory interaction with bHLH proteins. PMID:10552298

Fuse, N; Matakatsu, H; Taniguchi, M; Hayashi, S

1999-10-01

371

Diploidy of Drosophila imaginal cells is maintained by a transcriptional repressor encoded by escargot.  

PubMed

The Drosophila escargot (esg) gene encodes a C2-H2-type zinc finger protein that is expressed in the imaginal discs and histoblasts. In some esg mutants, the abdominal histoblasts become polyploid. It has therefore been suggested that the role of esg is to maintain diploidy of the imaginal cells. We show that esg encodes a DNA-binding protein with high affinity for G/ACAGGTG, the consensus-binding sequence for the basic helix-loop-helix (bHLH) family of transcription factors (E2 box). This DNA-binding activity is essential for esg function in vivo as the strong embryonic lethal allele esgVS8 is caused by an amino acid change within the zinc finger region, leading to reduced affinity for DNA. In cultured cells, a heterodimer of the bHLH proteins Scute and Daughterless activates transcription from promoters containing E2 boxes. The esg protein strongly inhibits this activation, suggesting that esg may regulate developmental processes dependent on bHLH proteins. In larvae, esg protein expressed by the heat shock promoter can rescue the polyploid phenotype of abdominal histoblasts, demonstrating that the phenotype is attributable to a loss of esg function. esg must be expressed continuously during the larval period for efficient rescue. Ectopic expression of esg in the salivary glands inhibits endoreplication of DNA. These results suggest that esg is involved in transcriptional inhibition of genes required for endoreplication. PMID:7958894

Fuse, N; Hirose, S; Hayashi, S

1994-10-01

372

Different regulatory elements within the MyoD promoter control its expression in the brain and inhibit its functional consequences in neurogenesis.  

PubMed

MyoD is a key basic helix-loop-helix (bHLH) transcription factor capable of converting many cells into skeletal muscle. Together with Myf5 it is essential for initiating skeletal myogenesis. In this report, the restricted domains of MyoD-lacZ expression have been revealed in the embryonic mouse brain by the analysis of transgenic mice with reporter genes driven by MyoD regulatory elements. The MD6.0-lacZ transgene was localized in the basal plate of pons, medulla oblongata (i.e. the medial longitudinal fasciculus) and spinal cord of wild-type and mutant mouse embryos at various stages of development, whereas the 258/-2.5lacZ transgene was not detected in the brain. In addition, MyoD RNA and MyoD protein accumulations were monitored in neurons expressing MD6.0-lacZ transgene. Although MyoD was detected in muscle myotomal cells, it was absent in MD6.0-lacZ-expressing neurons. This would account for the lack of myogenic conversion in brain structures and the absence of a neural phenotype in MyoD-/- embryos and mice. Together, these data indicate that within the promoter of MyoD different regulatory elements control its expression and prevent the functional consequences of MyoD in neurogenesis. PMID:12182809

Kablar, Boris

2002-06-01

373

pRb: master of differentiation. Coupling irreversible cell cycle withdrawal with induction of muscle-specific transcription.  

PubMed

The protein product of the retinoblastoma (RB) gene is necessary for the completion of the muscle differentiation program and for myogenic basic helix-loop-helix-dependent transcription. In fact, in addition to induction and maintenance of permanent cell cycle withdrawal through negative regulation of E2F-responsive genes involved in proliferation, pRb also plays a positive role in the activation of muscle-specific genes. In pRb-/- myocytes, the expression of late myogenic markers is defective and myoblast fusion into myotubes occurs without irreversible cell cycle exit. This evidence demonstrates only a partial functional redundancy between pRb and its relatives p107 and pRb2/p130, as these pRb-/- multinucleated cells, which display p107 levels higher than normal myotubes, respond to mitogens with cell cycle re-entry and DNA synthesis. At the molecular level, pRb myogenic functions are mediated by cooperation with MyoD, Myocyte enhancer factor 2 (MEF2), High mobility group box protein-1 (HBP1) and histone deacetylase1, affecting chromatin configuration and tissue-specific transcription, and by post-translational modification in response to intracellular signaling cascades. PMID:16936743

De Falco, G; Comes, F; Simone, C

2006-08-28

374

DNazyme-mediated cleavage of Twist transcripts and increase in cellular apoptosis.  

PubMed

DNazymes is a group of catalytic nucleic acids that can be designed to cleave target mRNA molecules in a base-specific way. Twist is a basic helix-loop-helix transcription factor that is involved in the regulation of cellular differentiation and apoptosis. Moreover, it was shown to function in skull development and cause craniosynostosis. DZ-TWT DNazyme was designed to down-regulate Twist expression. The ability of DZ-TWT to cleave mouse Twist mRNA was first shown in a cell-free environment against full-length Twist mRNA. Following transfections of the DZ-TWT in C3H10T1/2 cells, a significant reduction of Twist mRNA levels was observed. This was accompanied by a significant rise in p21 mRNA levels. Finally, DZ-TWT transfections resulted in an increase of cellular apoptosis, demonstrating the importance of Twist in apoptotic pathways. These results prove the usefulness of DNazymes to characterize Twist gene function and further experiments in animals should demonstrate its complete physiological role. PMID:12480539

Hjiantoniou, Eleni; Iseki, Sachiko; Uney, James B; Phylactou, Leonidas A

2003-01-01

375

Out of the Mouths of Plants: The Molecular Basis of the Evolution and Diversity of Stomatal Development[W  

PubMed Central

Stomata are microscopic valves on the plant epidermis that played a critical role in the evolution of land plants. Studies in the model dicot Arabidopsis thaliana have identified key transcription factors and signaling pathways controlling stomatal patterning and differentiation. Three paralogous Arabidopsis basic helix-loop-helix proteins, SPEECHLESS (SPCH), MUTE, and FAMA, mediate sequential steps of cell-state transitions together with their heterodimeric partners SCREAM (SCRM) and SCRM2. Cell–cell signaling components, including putative ligands, putative receptors, and mitogen-activated protein kinase cascades, orient asymmetric cell divisions and prevent overproduction and clustering of stomata. The recent availability of genome sequence and reverse genetics tools for model monocots and basal land plants allows for the examination of the conservation of genes important in stomatal patterning and differentiation. Studies in grasses have revealed that divergence of SPCH-MUTE-FAMA predates the evolutionary split of monocots and dicots and that these proteins show conserved and novel roles in stomatal differentiation. By contrast, specific asymmetric cell divisions in Arabidopsis and grasses require unique molecular components. Molecular phylogenetic analysis implies potential conservation of signaling pathways and prototypical functions of the transcription factors specifying stomatal differentiation. PMID:20179138

Peterson, Kylee M.; Rychel, Amanda L.; Torii, Keiko U.

2010-01-01

376

Sim1 inhibits bone formation by enhancing the sympathetic tone in male mice.  

PubMed

Single-minded 1 (Sim1) is a basic helix-loop-helix Per-Arnt-Sim transcription factor that is important for neuronal development in the hypothalamus. Loss-of-function mutation of Sim1 causes early-onset obesity. However, it is unknown whether and how Sim1 regulates bone remodeling. In this study, we found that adult-onset Sim1 deletion increases bone formation, leading to high bone mass. In contrast, Sim1-overexpressing transgenic mice exhibit decreased bone formation and low bone mass. Sim1 does not directly regulate osteoblastogenesis, because bone marrow mesenchymal stem cells from Sim1 mutant mice display a normal capacity for osteoblast differentiation. Instead, Sim1 inhibits bone formation via stimulating the sympathetic nervous system, because sympathetic tone is decreased by Sim1 deletion but increased by Sim1 overexpression. Treatment with the ?-adrenergic agonist isoproterenol effectively reverses the high bone mass in Sim1-knockout mice. These findings reveal Sim1 as a critical yet previously unrecognized modulator of skeletal homeostasis that functions through a central relay. PMID:25607894

Wang, Xunde; Wei, Wei; Zinn, Andrew R; Wan, Yihong

2015-04-01

377

Isolation, characterization and expression of the human Factor In the Germline alpha (FIGLA) gene in ovarian follicles and oocytes.  

PubMed

The Factor In the Germline alpha (FIGalpha) transcription factor regulates expression of the zona pellucida proteins ZP1, ZP2 and ZP3 and is essential for folliculogenesis in the mouse. Using the published mouse Figla sequence, BLAST searches identified a human chromosome 2 BAC clone with high sequence identity. Using PCR primers derived from this clone, amplicons derived from ovarian follicles and mature oocytes revealed 100% identity with the appropriate human BAC clone, the expected homology with the mouse Figla gene sequence, and homology on translation with the FIGalpha protein identified in the Japanese rice fish, medaka (Oryzias latipes). PCR expression profiling of this transcript revealed FIGLA mRNA expression in cDNA derived from ovarian follicles (5/5 samples from the primordial through to the secondary stage) mature oocytes (6/9 samples), and less frequently in preimplantation embryos (2/7 samples). Subsequent BLAST searches revealed the predicted full length coding sequence of the human FIGalpha protein which demonstrates 68 and 25% similarity overall to mouse and medaka proteins respectively, with 96 and 57% identity respectively within the basic helix-loop-helix region. This confirms our identification of the human homologue for this gene which maps to chromosome 2p12. Further work is required to understand its role in normal human oocyte development and the potential involvement in human infertility. PMID:12468641

Huntriss, J; Gosden, R; Hinkins, M; Oliver, B; Miller, D; Rutherford, A J; Picton, H M

2002-12-01

378

Molecular cloning and expression profile of sex-specific genes, Figla and Dmrt1, in the protogynous hermaphroditic fish, Halichoeres poecilopterus.  

PubMed

The genes folliculogenesis specific basic helix-loop-helix (facor in the germline alpha, Figla) and doublesex and mab-3 related transcription factor 1 (Dmrt1) are female- and male-specific genes that play key roles in sex differentiation. To obtain a better understanding of the molecular mechanisms underlying female-to-male sex change, we cloned the cDNAs of these genes from an ovary and a testis of the protogynus wrasse, Halichoeres poecilopterus. This fish has two isoforms of Dmrt1, Dmrt1a and Dmrt1b, caused by an alternative splicing. The Dmrt1b has an insertion of three nucleotides (CAG) in the open reading frame. Figla and Dmrt1 displayed gonadal-specific expression and abundant in the ovaries and in the testes, respectively. In particular, levels of Figla expression in the ovaries were higher in the spawning season than in the non-spawning season. Once sex change began, Figla mRNA decreased and Dmrt1 mRNA increased with progression of oocyte degeneration and spermatogenesis. These expression levels were maintained until the completion of the sex change. Low Figla and high Dmrt1 were also observed in testes of primary males, which functioned as a gonochoristic male throughout its life span in this wrasse. The results of this study suggest that these genes may regulate the gonadal transition from ovary to testis by the same mechanism as that of formation and maintenance of the primary testis in H. poecilopterus. PMID:23030342

Miyake, Yuko; Sakai, Yoichi; Kuniyoshi, Hisato

2012-10-01

379

Interhelical loops within the bHLH domain are determinant in maintaining TWIST1–DNA complexes  

PubMed Central

The basic helix-loop-helix (bHLH) transcription factor TWIST1 is essential to embryonic development, and hijacking of its function contributes to the development of numerous cancer types. It forms either a homodimer or a heterodimeric complex with an E2A or HAND partner. These functionally distinct complexes display sometimes antagonistic functions during development, so that alterations in the balance between them lead to pronounced morphological alterations, as observed in mice and in Saethre–Chotzen syndrome patients. We, here, describe the structures of TWIST1 bHLH–DNA complexes produced in silico through molecular dynamics simulations. We highlight the determinant role of the interhelical loops in maintaining the TWIST1–DNA complex structures and provide a structural explanation for the loss of function associated with several TWIST1 mutations/insertions observed in Saethre–Chotzen syndrome patients. An animated interactive 3D complement (I3DC) is available in Proteopedia at http://proteopedia.org/w/Journal:JBSD:27 PMID:23527594

Bouard, Charlotte; Terreux, Raphael; Hope, Jennifer; Chemelle, Julie Anne; Puisieux, Alain; Ansieau, Stéphane; Payen, Léa

2013-01-01

380

Twist1 Controls a Cell-Specification Switch Governing Cell Fate Decisions within the Cardiac Neural Crest  

PubMed Central

Neural crest cells are multipotent progenitor cells that can generate both ectodermal cell types, such as neurons, and mesodermal cell types, such as smooth muscle. The mechanisms controlling this cell fate choice are not known. The basic Helix-loop-Helix (bHLH) transcription factor Twist1 is expressed throughout the migratory and post-migratory cardiac neural crest. Twist1 ablation or mutation of the Twist-box causes differentiation of ectopic neuronal cells, which molecularly resemble sympathetic ganglia, in the cardiac outflow tract. Twist1 interacts with the pro-neural factor Sox10 via its Twist-box domain and binds to the Phox2b promoter to repress transcriptional activity. Mesodermal cardiac neural crest trans-differentiation into ectodermal sympathetic ganglia-like neurons is dependent upon Phox2b function. Ectopic Twist1 expression in neural crest precursors disrupts sympathetic neurogenesis. These data demonstrate that Twist1 functions in post-migratory neural crest cells to repress pro-neural factors and thereby regulate cell fate determination between ectodermal and mesodermal lineages. PMID:23555309

Vincentz, Joshua W.; Firulli, Beth A.; Lin, Andrea; Spicer, Douglas B.; Howard, Marthe J.; Firulli, Anthony B.

2013-01-01

381

Analysis of gene expression on ngn3 gene signaling pathway in endocrine pancreatic cancer  

PubMed Central

In order to define the undifferentiated transcriptional factors present in neurogenesis of pancreatic ?-islet cells, we studied the effect of Pdx1 in embryonic stem cell derived endocrine lineage. There are undifferentiated transcriptional progenitors Pdx1+/Ptf1a+/Cpa1+ tracking the growth of acini, ducts, ? and ?-islet cells. The upregulated transcriptional factors Pdx1 and ngn3 specify consequences of cell cycle regulation in early gut endocrine cells. The undifferentiated transcriptional factors basic helix loop helix (bHLH) protein regulate Ptf1a+/Cpa1+ in acini, ducts and it also regulate ngn3 to decrease expression of insulin and other pancreas secretions. The Pdx1+ and other unknown gene mutations show abnormal growth of neurogenesis in endocrine lineages. Using microarray based gene expression analysis to determine undifferential gene ontology in tissue specific gene regulation and disease progression that common in both metabolic and biological signaling pathways. The data expression profiles of ngn3 of wild- type pancreatic islet and islet derived tumor stem cells provide information on endocrine specific ngn3 genes. Therefore, 3755 genes were significantly regulated by Ngn3 induced pancreatic islet cell development. Moreover 317 upregulated and 175 downregulated, 757 genes deemed as undifferential expressions in endocrine cell. Furthermore to predict signaling pathways that associates with diabetes is highlighted. PMID:23976832

Nagaraja, Prashantha; Parashivamurthy, Kavya; Sidnal, Nandini; Mali, Siddappa; Nagaraja, Dakshyani; Reddy, Sivarami

2013-01-01

382

Distinct Functions for Different scl Isoforms in Zebrafish Primitive and Definitive Hematopoiesis  

PubMed Central

The stem-cell leukemia (SCL, also known as TAL1) gene encodes a basic helix-loop-helix transcription factor that is essential for the initiation of primitive and definitive hematopoiesis, erythrocyte and megakarocyte differentiation, angiogenesis, and astrocyte development. Here we report that the zebrafish produces, through an alternative promoter site, a novel truncated scl (tal1) isoform, scl-?, which manifests a temporal and spatial expression distinct from the previously described full-length scl-?. Functional analysis reveals that while scl-? and -? are redundant for the initiation of primitive hematopoiesis, these two isoforms exert distinct functions in the regulation of primitive erythroid differentiation and definitive hematopoietic stem cell specification. We further demonstrate that differences in the protein expression levels of scl-? and -?, by regulating their protein stability, are likely to give rise to their distinct functions. Our findings suggest that hematopoietic cells at different levels of hierarchy are likely governed by a gradient of the Scl protein established through temporal and spatial patterns of expression of the different isoforms. PMID:17472439

Xu, Jin; Huang, Mei; Li, Wanyu; Wen, Zilong

2007-01-01

383

Modes of retrotransposition of long interspersed element-1 by environmental factors.  

PubMed

Approximately 42% of the human genome is composed of endogenous retroelements, and the major retroelement component, long interspersed element-1 (L1), comprises ?17% of the total genome. A single human cell has more than 5?×?10(5) copies of L1, 80?100 copies of which are competent for retrotransposition (RTP). Notably, L1 can induce RTP of other retroelements, such as Alu and SVA, and is believed to function as a driving force of evolution. Although L1-RTP during early embryogenesis has been highlighted in the literature, recent observations revealed that L1-RTP also occurs in somatic cells. However, little is known about how environmental factors induce L1-RTP. Here, we summarize our current understanding of the mechanism of L1-RTP in somatic cells. We have focused on the mode of L1-RTP that is dependent on the basic helix-loop-helix/per-arnt-sim (bHLH/PAS) family of transcription factors. Along with the proposed function of bHLH/PAS proteins in environmental adaptation, we discuss the functional linking of L1-RTP and bHLH/PAS proteins for environmental adaptation and evolution. PMID:22666219

Ishizaka, Yukihito; Okudaira, Noriyuki; Tamura, Masato; Iijima, Kenta; Shimura, Mari; Goto, Motohito; Okamura, Tadashi

2012-01-01

384

Ascl1-induced neuronal differentiation of P19 cells requires expression of a specific inhibitor protein of cAMP-dependent protein kinase  

PubMed Central

cAMP-dependent protein kinase (PKA) plays a critical role in nervous system development by modulating sonic hedgehog and bone morphogenetic protein signaling. In the current studies, P19 embryonic carcinoma cells were neuronally differentiated by expression of the proneural basic helix-loop-helix transcription factor Ascl1. After expression of Ascl1, but prior to expression of neuronal markers such as microtubule associated protein 2 and neuronal ?-tubulin, P19 cells demonstrated a large, transient increase in both mRNA and protein for the endogenous protein kinase inhibitor (PKI)?. PKI?-targeted shRNA constructs both reduced the levels of PKI? expression and blocked the neuronal differentiation of P19 cells. This inhibition of differentiation was rescued by transfection of a shRNA-resistant expression vector for the PKI? protein, and this rescue required the PKA-specific inhibitory sequence of the PKI?protein. PKI? played a very specific role in the Ascl1-mediated differentiation process since other PKI isoforms were unable to rescue the deficit conferred by shRNA-mediated knockdown of PKI?. Our results define a novel requirement for PKI? and its inhibition of PKA during neuronal differentiation of P19 cells. PMID:21623794

Huang, Holly S.; Turner, David L.; Thompson, Robert C.; Uhler, Michael D.

2011-01-01

385

ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Arabidopsis gynoecium patterning.  

PubMed

Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin-remodeling factors contribute to plant organogenesis. We demonstrate that the trithorax group (trxG) gene ULTRAPETALA1 (ULT1) and the GARP transcription factor gene KANADI1 (KAN1) organize the Arabidopsis thaliana gynoecium along two distinct polarity axes. We show that ULT1 activity is required for the kan1 adaxialized polarity defect, indicating that ULT1 and KAN1 act oppositely to regulate the adaxial-abaxial axis. Conversely, ULT1 and KAN1 together establish apical-basal polarity by promoting basal cell fate in the gynoecium, restricting the expression domain of the basic helix-loop-helix transcription factor gene SPATULA. Finally, we show that ult alleles display dose-dependent genetic interactions with kan alleles and that ULT and KAN proteins can associate physically. Our findings identify a dual role for plant trxG factors in organ patterning, with ULT1 and KAN1 acting antagonistically to pattern the adaxial-abaxial polarity axis but jointly to pattern the apical-basal axis. Our data indicate that the ULT proteins function to link chromatin-remodeling factors with DNA binding transcription factors to regulate target gene expression. PMID:25381352

Pires, Helena R; Monfared, Mona M; Shemyakina, Elena A; Fletcher, Jennifer C

2014-11-01

386

Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.  

PubMed

The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo. PMID:7913462

Yoon, S O; Chikaraishi, D M

1994-07-15

387

ITF-2, a downstream target of the Wnt/TCF pathway, is activated in human cancers with beta-catenin defects and promotes neoplastic transformation.  

PubMed

In many cancers, inactivation of the adenomatous polyposis coli (APC) or Axin tumor suppressor proteins or activating mutations in beta-catenin lead to elevated beta-catenin levels, enhanced binding of beta-catenin to T cell factor (TCF) proteins, and increased expression of TCF-regulated genes. We found that the gene for the basic helix-loop-helix transcription factor ITF-2 (immunoglobulin transcription factor-2) was activated in rat E1A-immortalized RK3E cells following neoplastic transformation by beta-catenin or ligand-induced activation of a beta-catenin-estrogen receptor fusion protein. Human cancers with beta-catenin regulatory defects had elevated ITF-2 expression, and ITF-2 was repressed by restoring wild-type APC function or inhibiting TCF activity. Of note, ITF-2 promoted neoplastic transformation of RK3E cells. We propose that ITF-2 is a TCF-regulated gene, which functions in concert with other TCF target genes to promote growth and/or survival of cancer cells with defects in beta-catenin regulation. PMID:12086873

Kolligs, Frank T; Nieman, Marvin T; Winer, Ira; Hu, Gang; Van Mater, David; Feng, Ying; Smith, Ian M; Wu, Rong; Zhai, Yali; Cho, Kathleen R; Fearon, Eric R

2002-03-01

388

NOTCH Signaling and ATOH1 in Colorectal Cancers  

PubMed Central

The Notch receptor signaling pathway regulates expression of the basic helix-loop-helix transcription factor ATOH1 (Math1/Hath1) to determine cell fate in the intestine. In differentiating intestinal stem cells, high levels of Notch activity specify absorptive enterocyte/colonocyte differentiation, whereas high ATOH1 activity specifies secretory (goblet, enteroendocrine, and Paneth) cell differentiation. In colorectal cancer, ATOH1 is a tumor suppressor that is silenced in most tumors, while Notch is oncogenic and often highly active in human tumors. In other gastrointestinal malignancies with features of intestinal metaplasia, such as esophageal and gastric cancers, the Notch-ATOH1 pathway becomes activated. In cancers and preneoplastic tissues that retain the ability to activate ATOH1, therapeutic targeting of this pathway can be achieved by inhibiting Notch activity (with Notch-targeting antibodies or small-molecule inhibitors of ?-secretase). Thus, targeting the Notch-ATOH1 pathway represents a novel approach to differentiation therapy in gastrointestinal cancers. PMID:21980310

2011-01-01

389

Id-1 and Id-2 are markers for metastasis and prognosis in oesophageal squamous cell carcinoma  

PubMed Central

Id protein family consists of four members namely Id-1 to Id-4. Different from other basic helix–loop–helix transcription factors, they lack the DNA binding domain. Id proteins have been shown to be dysregulated in many different cancer types and their prognostic value has also been demonstrated. Recently, Id-1 has been shown to be upregulated in oesophageal squamous cell carcinoma (ESCC). However, the prognostic implications of Id proteins in ESCC have not been reported. We examined the expression of the Id proteins in ESCC cell lines and clinical ESCC specimens and found that Id protein expressions were dysregulated in both the ESCC cell lines and specimens. By correlating the expression levels of Id proteins and the clinicopathological data of our patient cohort, we found that M1 stage tumours had significantly higher nuclear Id-1 expression (P=0.012) while high nuclear Id-1 expression could predict development of distant metastasis within 1 year of oesophagectomy (P=0.005). In addition, high levels of Id-2 expression in both cytoplasmic and nuclear regions predicted longer patient survival (P=0.041). Multivariate analysis showed that high-level expression of Id-2 in both cytoplasmic and nuclear regions and lower level of nuclear Id-1 expression were independent favourable predictors of survival in our ESCC patients. Our results suggest that Id-1 may promote distant metastasis in ESCC, and both Id-1 and Id-2 may be used for prognostication for ESCC patients. PMID:18000500

Yuen, H-F; Chan, Y-P; Chan, K-K; Chu, Y-Y; Wong, M L-Y; Law, S Y-K; Srivastava, G; Wong, Y-C; Wang, X; Chan, K-W

2007-01-01

390

Structural basis for LMO2-driven recruitment of the SCL:E47bHLH heterodimer to hematopoietic-specific transcriptional targets.  

PubMed

Cell fate is governed by combinatorial actions of transcriptional regulators assembling into multiprotein complexes. However, the molecular details of how these complexes form are poorly understood. One such complex, which contains the basic-helix-loop-helix heterodimer SCL:E47 and bridging proteins LMO2:LDB1, critically regulates hematopoiesis and induces T cell leukemia. Here, we report the crystal structure of (SCL:E47)bHLH:LMO2:LDB1LID bound to DNA, providing a molecular account of the network of interactions assembling this complex. This reveals an unexpected role for LMO2. Upon binding to SCL, LMO2 induces new hydrogen bonds in SCL:E47, thereby strengthening heterodimer formation. This imposes a rotation movement onto E47 that weakens the heterodimer:DNA interaction, shifting the main DNA-binding activity onto additional protein partners. Along with biochemical analyses, this illustrates, at an atomic level, how hematopoietic-specific SCL sequesters ubiquitous E47 and associated cofactors and supports SCL's reported DNA-binding-independent functions. Importantly, this work will drive the design of small molecules inhibiting leukemogenic processes. PMID:23831025

El Omari, Kamel; Hoosdally, Sarah J; Tuladhar, Kapil; Karia, Dimple; Hall-Ponselé, Elisa; Platonova, Olga; Vyas, Paresh; Patient, Roger; Porcher, Catherine; Mancini, Erika J

2013-07-11

391

AP4 is a mediator of epithelial–mesenchymal transition and metastasis in colorectal cancer  

PubMed Central

The basic helix-loop-helix transcription factor AP4/TFAP4/AP-4 is encoded by a c-MYC target gene and displays up-regulation concomitantly with c-MYC in colorectal cancer (CRC) and numerous other tumor types. Here a genome-wide characterization of AP4 DNA binding and mRNA expression was performed using a combination of microarray, genome-wide chromatin immunoprecipitation, next-generation sequencing, and bioinformatic analyses. Thereby, hundreds of induced and repressed AP4 target genes were identified. Besides many genes involved in the control of proliferation, the AP4 target genes included markers of stemness (LGR5 and CD44) and epithelial–mesenchymal transition (EMT) such as SNAIL, E-cadherin/CDH1, OCLN, VIM, FN1, and the Claudins 1, 4, and 7. Accordingly, activation of AP4 induced EMT and enhanced migration and invasion of CRC cells. Conversely, down-regulation of AP4 resulted in mesenchymal–epithelial transition and inhibited migration and invasion. In addition, AP4 induction was required for EMT, migration, and invasion caused by ectopic expression of c-MYC. Inhibition of AP4 in CRC cells resulted in decreased lung metastasis in mice. Elevated AP4 expression in primary CRC significantly correlated with liver metastasis and poor patient survival. These findings imply AP4 as a new regulator of EMT that contributes to metastatic processes in CRC and presumably other carcinomas. PMID:23752226

Jackstadt, Rene; Röh, Simone; Neumann, Jens; Jung, Peter; Hoffmann, Reinhard; Horst, David; Berens, Christian; Bornkamm, Georg W.; Kirchner, Thomas; Menssen, Antje

2013-01-01

392

?-Catenin is required for hair-cell differentiation in the cochlea.  

PubMed

The development of hair cells in the auditory system can be separated into steps; first, the establishment of progenitors for the sensory epithelium, and second, the differentiation of hair cells. Although the differentiation of hair cells is known to require the expression of basic helix-loop-helix transcription factor, Atoh1, the control of cell proliferation in the region of the developing cochlea that will ultimately become the sensory epithelium and the cues that initiate Atoh1 expression remain obscure. We assessed the role of Wnt/?-catenin in both steps in gain- and loss-of-function models in mice. The canonical Wnt pathway mediator, ?-catenin, controls the expression of Atoh1. Knock-out of ?-catenin inhibited hair-cell, as well as pillar-cell, differentiation from sensory progenitors but was not required to maintain a hair-cell fate once specified. Constitutive activation of ?-catenin expanded sensory progenitors by inducing additional cell division and resulted in the differentiation of extra hair cells. Our data demonstrate that ?-catenin plays a role in cell division and differentiation in the cochlear sensory epithelium. PMID:24806673

Shi, Fuxin; Hu, Lingxiang; Jacques, Bonnie E; Mulvaney, Joanna F; Dabdoub, Alain; Edge, Albert S B

2014-05-01

393

Disease-Related Growth Factor and Embryonic Signaling Pathways Modulate an Enhancer of TCF21 Expression at the 6q23.2 Coronary Heart Disease Locus  

PubMed Central

Coronary heart disease (CHD) is the leading cause of mortality in both developed and developing countries worldwide. Genome-wide association studies (GWAS) have now identified 46 independent susceptibility loci for CHD, however, the biological and disease-relevant mechanisms for these associations remain elusive. The large-scale meta-analysis of GWAS recently identified in Caucasians a CHD-associated locus at chromosome 6q23.2, a region containing the transcription factor TCF21 gene. TCF21 (Capsulin/Pod1/Epicardin) is a member of the basic-helix-loop-helix (bHLH) transcription factor family, and regulates cell fate decisions and differentiation in the developing coronary vasculature. Herein, we characterize a cis-regulatory mechanism by which the lead polymorphism rs12190287 disrupts an atypical activator protein 1 (AP-1) element, as demonstrated by allele-specific transcriptional regulation, transcription factor binding, and chromatin organization, leading to altered TCF21 expression. Further, this element is shown to mediate signaling through platelet-derived growth factor receptor beta (PDGFR-?) and Wilms tumor 1 (WT1) pathways. A second disease allele identified in East Asians also appears to disrupt an AP-1-like element. Thus, both disease-related growth factor and embryonic signaling pathways may regulate CHD risk through two independent alleles at TCF21. PMID:23874238

Miller, Clint L.; Anderson, D. Ryan; Kundu, Ramendra K.; Raiesdana, Azad; Nürnberg, Sylvia T.; Diaz, Roxanne; Cheng, Karen; Leeper, Nicholas J.; Chen, Chung-Hsing; Chang, I-Shou; Schadt, Eric E.; Hsiung, Chao Agnes; Assimes, Themistocles L.; Quertermous, Thomas

2013-01-01

394

Molecular structure of the largemouth bass (Micropterus salmoides) Myf5 gene and its effect on skeletal muscle growth.  

PubMed

Myogenic Regulatory Factors (MRFs), a family of basic helix-loop-helix (bHLH) transcription factors, play important roles in regulating skeletal muscle development and growth. Myf5, the primary factor of MRFs, initiates myogenesis. Its expression pattern during somitomyogenesis in some fish has been revealed. To further study its effect on fish muscle during postembryonic growth, characterization and function analysis of myf5 cDNA were carried out in largemouth bass. The 1,093 bp cDNA sequence was identified by RT-PCR and 3'RACE, then the ORF of Myf5 cDNA was cloned into the expression vector pcDNA3.1(-)/mycHisB. The recombinant plasmid pcDNA3.1(-)/mycHisB-Myf5 was injected into the dorsal muscle of tilapias. RT-PCR and histochemical results showed that the exogenous gene was transcribed and translated in vivo. Its effect on muscle growth focused on myofiber hypertrophy in white muscle 60 days post injection. This indicated that overexpression of Myf5 can promote myogenesis during the fish muscle postembryonic growth period. PMID:18752038

Guo, Yuhan; Bai, Junjie; Chang, Ouqin; Lao, Haihua; Ye, Xing; Luo, Jianren

2009-07-01

395

The Arabidopsis floral homeotic proteins APETALA3 and PISTILLATA negatively regulate the BANQUO genes implicated in light signaling.  

PubMed

The Arabidopsis thaliana MADS box transcription factors APETALA3 (AP3) and PISTILLATA (PI) heterodimerize and are required to specify petal identity, yet many details of how this regulatory process is effected are unclear. We have identified three related genes, BHLH136/BANQUO1 (BNQ1), BHLH134/BANQUO2 (BNQ2), and BHLH161/BANQUO3 (BNQ3), as being directly and negatively regulated by AP3 and PI in petals. BNQ1, BNQ2, and BNQ3 encode products belonging to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. We show that bnq3 mutants have pale-green sepals and carpels and decreased chlorophyll levels, suggesting that BNQ3 has a role in regulating light responses. The ap3 bnq3 double mutant displays pale second-whorl organs, supporting the hypothesis that BNQ3 is downstream of AP3. Consistent with a role in light response, we show that the BNQ gene products regulate the function of HFR1 (for LONG HYPOCOTYL IN FAR-RED1), which encodes a bHLH protein that regulates photomorphogenesis through modulating phytochrome and cryptochrome signaling. The BNQ genes also are required for appropriate regulation of flowering time. Our results suggest that petal identity is specified in part through downregulation of BNQ-dependent photomorphogenic and developmental signaling pathways. PMID:20305124

Mara, Chloe D; Huang, Tengbo; Irish, Vivian F

2010-03-01

396

A bHLH transcription factor, DvIVS, is involved in regulation of anthocyanin synthesis in dahlia (Dahlia variabilis)  

PubMed Central

Dahlias (Dahlia variabilis) exhibit a wide range of flower colours because of accumulation of anthocyanin and other flavonoids in their ray florets. Two lateral mutants were used that spontaneously occurred in ‘Michael J’ (MJW) which has yellow ray florets with orange variegation. MJOr, a bud mutant producing completely orange ray florets, accumulates anthocyanins, flavones, and butein, and MJY, another mutant producing completely yellow ray florets, accumulates flavones and butein. Reverse transcription–PCR analysis showed that expression of chalcone synthase 1 (DvCHS1), flavanone 3-hydroxylase (DvF3H), dihydroflavonol 4-reductase (DvDFR), anthocyanidin synthase (DvANS), and DvIVS encoding a basic helix–loop–helix transcription factor were suppressed, whereas that of chalcone isomerase (DvCHI) and DvCHS2, another CHS with 69% nucleotide identity with DvCHS1, was not suppressed in the yellow ray florets of MJY. A 5.4?kb CACTA superfamily transposable element, transposable element of Dahlia variabilis 1 (Tdv1), was found in the fourth intron of the DvIVS gene of MJW and MJY, and footprints of Tdv1 were detected in the variegated flowers of MJW. It is shown that only one type of DvIVS gene was expressed in MJOr, whereas these plants are likely to have three types of the DvIVS gene. On the basis of these results, the mechanism regulating the formation of orange and yellow ray florets in dahlia is discussed. PMID:21765172

Ohno, Sho; Hosokawa, Munetaka; Hoshino, Atsushi; Kitamura, Yoshikuni; Morita, Yasumasa; Park, Kyeung-II; Nakashima, Akiko; Deguchi, Ayumi; Tatsuzawa, Fumi; Doi, Motoaki; Iida, Shigeru; Yazawa, Susumu

2011-01-01

397

The Purple Cauliflower Arises from Activation of a MYB Transcription Factor1[W][OA  

PubMed Central

Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3’-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal. PMID:20855520

Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L.; Li, Li

2010-01-01

398

The Role of GH/IGF-I Axis in Muscle Homeostasis During Weightlessness  

NASA Technical Reports Server (NTRS)

Exposure to reduced gravity during space travel profoundly alters the loads placed on bone and muscle. Astronauts suffer significant losses of muscle and bone strength during weightlessness. Exercise as a countermeasure is only partially effective in remedying severe muscle atrophy and bone demineralization. Similar wasting of muscles and bones affects people on Earth during prolonged bed rest or immobilization due to injury. In the absence of weight bearing activity, atrophy occurs primarily in the muscles that act in low power, routine movements and in maintaining posture. Hormonal disfunction could contribute in part to the loss of muscle and bone during spaceflight. Reduced levels of human Growth Hormone (hGH) were found in astronauts during space flight, as well as reduced GH secretory activity was observed from the anterior pituitary in 7-day space flight rats. Growth hormone has been shown to be required for maintenance of muscle mass and bone mineralization, in part by mediating the biosynthesis IGF-I, a small polypeptide growth factor. IGF biosynthesis and secretion plays an important role in potentiating muscle cell differentiation and has been shown to drive the expression of myogenin, a myogenic specific basic helix-loop-helix factor. IGF-I has also been shown to have an important role in potentiating muscle regeneration, repair and adult muscle hypertrophy.

Schwartz, Robert J.

1997-01-01

399

Tfe3 expression is closely associated to macrophage terminal differentiation of human hematopoietic myeloid precursors  

SciTech Connect

The MItf-Tfe family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors encodes four family members: MItf, Tfe3, TfeB and TfeC. In vitro, each protein of the family binds DNA in a homo- or heterodimeric form with other family members. Tfe3 is involved in chromosomal translocations recurrent in different tumors and it has been demonstrated, by in vivo studies, that it plays, redundantly with MItf, an important role in the process of osteoclast formation, in particular during the transition from mono-nucleated to multi-nucleated osteoclasts. Since mono-nucleated osteoclasts derive from macrophages we investigated whether Tfe3 might play a role upstream during hematopoietic differentiation. Here we show that Tfe3 is able to induce mono-macrophagic differentiation of U937 cells, in association with a decrease of cell proliferation and an increase of apoptosis. We also show that Tfe3 does not act physiologically during commitment of CD34+ hematopoietic stem cells (HSCs), since it is not able to direct HSCs toward a specific lineage as observed by clonogenic assay, but is a strong actor of terminal differentiation since it allows human primary myeloblasts' maturation toward the macrophage lineage.

Zanocco-Marani, Tommaso [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Vignudelli, Tatiana [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Gemelli, Claudia [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Pirondi, Sara [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Testa, Anna [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Montanari, Monica [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Parenti, Sandra [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Tenedini, Elena [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Grande, Alexis [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy); Ferrari, Sergio [Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita di Modena e Reggio Emilia, Via Campi 287, 41100, Modena (Italy)]. E-mail: sergio@unimo.it

2006-12-10

400

Nuclear translocation of Hand-1 acts as a molecular switch to regulate vascular radiosensitivity in medulloblastoma tumors: the protein uPAR is a cytoplasmic sequestration factor for Hand-1.  

PubMed

Urokinase-type plasminogen activator receptor (uPAR) is overexpressed in the tumor-stromal invasive microenvironment in many human cancers, including medulloblastoma. The role of uPAR in tumor progression and angiogenesis has been well characterized. Previously, in medulloblastoma cells, we showed that ionizing radiation (IR)-induced uPAR is a potent activator of cancer stem cell (CSC)-like properties and is associated with various transcription factors that are involved during embryonic development and cancer. In the present study, we show that uPAR protein acts as a cytoplasmic sequestration factor for a novel basic helix-loop-helix transcription factor, Hand-1. The Hand-1 protein plays an essential role in the differentiation of trophoblast giant cells and cardiac morphogenesis, and yet its precise cellular function and its contribution to cancer remain mostly unknown. We also observed that the Hand-1 protein is upregulated in uPAR short hairpin RNA-treated medulloblastoma cells and accompanies sustained cell growth and angiogenesis. Furthermore, IR-induced uPAR overexpression negatively regulates Hand-1 activity and results in the stabilization of angiogenesis-promoting molecules, including hypoxia-inducible factor-1?. Finally, uPAR overexpression and its association with Hand-1 after IR treatment indicate that uPAR is capable of regulating Hand-1 and that uPAR has a role in the process of IR-induced tumor angiogenesis. PMID:24623737

Asuthkar, Swapna; Gogineni, Venkateswara Rao; Rao, Jasti S; Velpula, Kiran Kumar

2014-05-01

401

Growth-promoting and tumourigenic activity of c-Myc is suppressed by Hhex.  

PubMed

c-Myc transcription factor is a key protein involved in cellular growth, proliferation and metabolism. c-Myc is one of the most frequently activated oncogenes, highlighting the need to identify intracellular molecules that interact directly with c-Myc to suppress its function. Here we show that Hhex is able to interact with the basic region/helix-loop-helix/leucine zipper of c-Myc. Knockdown of Hhex increases proliferation rate in hepatocellular carcinoma cells, whereas Hhex expression cell-autonomously reduces cell proliferation rate in multiple cell lines by increasing G1 phase length through a c-Myc-dependent mechanism. Global transcriptomic analysis shows that Hhex counter-regulates multiple c-Myc targets involved in cell proliferation and metabolism. Concomitantly, Hhex expression leads to reduced cell size, lower levels of cellular RNA, downregulation of metabolism-related genes, decreased sensitivity to methotrexate and severe reduction in the ability to form tumours in nude mouse xenografts, all indicative of decreased c-Myc activity. Our data suggest that Hhex is a novel regulator of c-Myc function that limits c-Myc activity in transformed cells.Oncogene advance online publication, 15 September 2014; doi:10.1038/onc.2014.240. PMID:25220416

Marfil, V; Blazquez, M; Serrano, F; Castell, J V; Bort, R

2014-09-15

402

Biological function and molecular mechanism of Twist2.  

PubMed

Twist2, one of the basic helix-loop-helix protein (bHLH) family members, is responsible for the transcriptional regulation in mesenchymal cell lineages during its development. Twist2 functions as a molecular switch to activate or repress target genes by direct or indirect mechanisms. Twist2 can directly bind with conserved E-box on DNA sequence, to recruit co-activators or repressors, and interfere with the activation or inhibition function through protein-protein interactions with E-protein modulators. Nonsense mutations of Twist2 cause Setleis syndrome. Early research on Twist2 focused on osteogenesis, and then expression differences were found in a wide variety of tumors. Further studies showed that Twist2 plays an important role in cancer epithelial-mesenchymal transition (EMT). Regulation function of Twist2 is controlled by temporal and spatial expression, phosphorylation, dimerization and cell positioning adjustment. The involvement of Twist2 in a broad spectrum of regulatory pathways highlights the importance of understanding its role in normal development, homeostasis and disease. In this review, we summarize the role of Twist2 in osteogenesis differentiation, tumor formation and EMT, and its molecular mechanism. It is helpful to have a thorough understanding of the biological functions of Twist2, and facilitate the transformation and application in diagnosis, development and therapy. PMID:25608809

Chengxiao, Zhao; Ze, Yang

2015-01-01

403

An evolutionarily conserved DNA architecture determines target specificity of the TWIST family bHLH transcription factors.  

PubMed

Basic helix-loop-helix (bHLH) transcription factors recognize the canonical E-box (CANNTG) to regulate gene transcription; however, given the prevalence of E-boxes in a genome, it has been puzzling how individual bHLH proteins selectively recognize E-box sequences on their targets. TWIST is a bHLH transcription factor that promotes epithelial-mesenchymal transition (EMT) during development and tumor metastasis. High-resolution mapping of TWIST occupancy in human and Drosophila genomes reveals that TWIST, but not other bHLH proteins, recognizes a unique double E-box motif with two E-boxes spaced preferentially by 5 nucleotides. Using molecular modeling and binding kinetic analyses, we found that the strict spatial configuration in the double E-box motif aligns two TWIST-E47 dimers on the same face of DNA, thus providing a high-affinity site for a highly stable intramolecular tetramer. Biochemical analyses showed that the WR domain of TWIST dimerizes to mediate tetramer formation, which is functionally required for TWIST-induced EMT. These results uncover a novel mechanism for a bHLH transcription factor to recognize a unique spatial configuration of E-boxes to achieve target specificity. The WR-WR domain interaction uncovered here sets an example of target gene specificity of a bHLH protein being controlled allosterically by a domain outside of the bHLH region. PMID:25762439

Chang, Andrew T; Liu, Yuanjie; Ayyanathan, Kasirajan; Benner, Chris; Jiang, Yike; Prokop, Jeremy W; Paz, Helicia; Wang, Dong; Li, Hai-Ri; Fu, Xiang-Dong; Rauscher, Frank J; Yang, Jing

2015-03-15

404

Pbx acts with Hand2 in early myocardial differentiation  

PubMed Central

Transcription factors of the basic helix-loop-helix (bHLH) family are critical regulators of muscle cell differentiation. For example, Myod drives skeletal muscle differentiation, and Hand2 potentiates cardiac muscle differentiation. Understanding how these bHLH factors regulate distinct transcriptional targets in a temporally and spatially controlled manner is critical for understanding their activity in cellular differentiation. We previously showed that Pbx homeodomain proteins modulate the activity of Myod to promote the differentiation of fast-twitch skeletal muscle. Here, we test the hypothesis that Pbx proteins are also necessary for cardiac muscle differentiation through interacting with Hand2. We show that Pbx proteins are required for the activation of cardiac muscle differentiation in zebrafish embryos. Loss of Pbx activity leads to delay of myocardial differentiation and subsequent defective cardiac morphogenesis, similar to reduced Hand2 activity. Genetic interaction experiments support the hypothesis that Pbx proteins modulate the activity of Hand2 in myocardial differentiation. Furthermore, we show that Pbx proteins directly bind the promoter of the myocardial differentiation gene myl7 in vitro, supporting a direct role for Pbx proteins in promoting cardiac muscle differentiation. Our findings demonstrate new roles for Pbx proteins in vertebrate cardiac development and also provide new insight into connections between the transcriptional regulation of skeletal and cardiac muscle differentiation programs. PMID:19607825

Maves, Lisa; Tyler, Ashlee; Moens, Cecilia B.; Tapscott, Stephen J.

2009-01-01

405

G9a mediates Sharp-1–dependent inhibition of skeletal muscle differentiation  

PubMed Central

Sharp-1, a basic helix-loop-helix transcription factor, is a potent repressor of skeletal muscle differentiation and is dysregulated in muscle pathologies. However, the mechanisms by which it inhibits myogenesis are not fully understood. Here we show that G9a, a lysine methyltransferase, is involved in Sharp-1–mediated inhibition of muscle differentiation. We demonstrate that G9a directly interacts with Sharp-1 and enhances its ability to transcriptionally repress the myogenin promoter. Concomitant with a differentiation block, G9a-dependent histone H3 lysine 9 dimethylation (H3K9me2) and MyoD methylation are apparent upon Sharp-1 overexpression in muscle cells. RNA interference–mediated reduction of G9a or pharmacological inhibition of its activity erases these repressive marks and rescues the differentiation defect imposed by Sharp-1. Our findings provide new insights into Sharp-1–dependent regulation of myogenesis and identify epigenetic mechanisms that could be targeted in myopathies characterized by elevated Sharp-1 levels. PMID:23087213

Ling, Belinda Mei Tze; Gopinadhan, Suma; Kok, Wai Kay; Shankar, Shilpa Rani; Gopal, Pooja; Bharathy, Narendra; Wang, Yaju; Taneja, Reshma

2012-01-01

406

The clockwork orange Drosophila protein functions as both an activator and a repressor of clock gene expression.  

PubMed

The Drosophila clock relies on transcriptional feedback loops that generate daily oscillations of the clock gene expression at mRNA and protein levels. In the evening, the CLOCK (CLK) and CYCLE (CYC) basic helix-loop-helix (bHLH) PAS-domain transcription factors activate the expression of the period (per) and timeless (tim) genes. Posttranslational modifications delay the accumulation of PER and TIM, which inhibit CLK/CYC activity in the late night. We show here that a null mutant of the clockwork orange (cwo) gene encoding a bHLH orange-domain putative transcription factor displays long-period activity rhythms. cwo loss of function increases cwo mRNA levels but reduces mRNA peak levels of the 4 described CLK/CYC targets, inducing an almost complete loss of their cycling. In addition, the absence of CWO induces alterations of PER and CLK phosphorylation cycles. Our results indicate that, in vivo, CWO modulates clock gene expression through both repressor and activator transcriptional functions. PMID:18375860

Richier, Benjamin; Michard-Vanhée, Christine; Lamouroux, Annie; Papin, Christian; Rouyer, François

2008-04-01

407

A functional genomics strategy reveals clockwork orange as a transcriptional regulator in the Drosophila circadian clock.  

PubMed

The Drosophila circadian clock consists of integrated autoregulatory feedback loops, making the clock difficult to elucidate without comprehensively identifying the network components in vivo. Previous studies have adopted genome-wide screening for clock-controlled genes using high-density oligonucleotide arrays that identified hundreds of clock-controlled genes. In an attempt to identify the core clock genes among these candidates, we applied genome-wide functional screening using an RNA interference (RNAi) system in vivo. Here we report the identification of novel clock gene candidates including clockwork orange (cwo), a transcriptional repressor belonging to the basic helix-loop-helix ORANGE family. cwo is rhythmically expressed and directly regulated by CLK-CYC through canonical E-box sequences. A genome-wide search for its target genes using the Drosophila genome tiling array revealed that cwo forms its own negative feedback loop and directly suppresses the expression of other clock genes through the E-box sequence. Furthermore, this negative transcriptional feedback loop contributes to sustaining a high-amplitude circadian oscillation in vivo. Based on these results, we propose that the competition between cyclic CLK-CYC activity and the adjustable threshold imposed by CWO keeps E-box-mediated transcription within the controllable range of its activity, thereby rendering a Drosophila circadian clock capable of generating high-amplitude oscillation. PMID:17578908

Matsumoto, Akira; Ukai-Tadenuma, Maki; Yamada, Rikuhiro G; Houl, Jerry; Uno, Kenichiro D; Kasukawa, Takeya; Dauwalder, Brigitte; Itoh, Taichi Q; Takahashi, Kuniaki; Ueda, Ryu; Hardin, Paul E; Tanimura, Teiichi; Ueda, Hiroki R

2007-07-01

408

Early specification of sensory neuron fate revealed by expression and function of neurogenins in the chick embryo.  

PubMed

The generation of sensory and autonomic neurons from the neural crest requires the functions of two classes of basic helix-loop-helix (bHLH) transcription factors, the Neurogenins (NGNs) and MASH-1, respectively (Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M., Goridis, C. and Guillemot, F. (1998) Neuron 20, 483-494; Guillemot, F., Lo, L.-C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L. (1993) Cell 75, 463-476; Ma, Q., Chen, Z. F., Barrantes, I. B., de la Pompa, J. L. and Anderson, D. J. (1998 Neuron 20, 469-482). We have cloned two chick NGNs and found that they are expressed in a subset of neural crest cells early in their migration. Ectopic expression of the NGNs in vivo biases migrating neural crest cells to localize in the sensory ganglia, and induces the expression of sensory neuron-appropriate markers in non-sensory crest derivatives. Surprisingly, the NGNs can also induce the expression of multiple pan-neuronal and sensory-specific markers in the dermomyotome, a mesodermal derivative. Taken together, these data suggest that a subset of neural crest cells may already be specified for a sensory neuron fate early in migration, as a consequence of NGN expression. PMID:10079233

Perez, S E; Rebelo, S; Anderson, D J

1999-04-01

409

Neuronatin, a Downstream Target of BETA2/NeuroD1 in the Pancreas, Is Involved in Glucose-Mediated Insulin Secretion  

PubMed Central

BETA2 (NeuroD1) is a member of the basic helix-loop-helix transcription factor family. BETA2 plays an important role in the development of the pancreas and the nervous system. Using microarray technology, we identified neuronatin (Nnat) as differentially expressed between wild-type (WT) and knockout (KO) pancreatic RNA from embryonic day 14 (e14.5). NNAT is a member of the proteolipid family of amphipathic polypeptides and is believed to be involved in ion channel transport or channel modulation. Northern blot and in situ hybridization analysis of WT and KO samples confirmed the downregulation of Nnat in pancreas of mutant BETA2 embryos. Chromatin immunoprecipitation and gel shift assays were performed and demonstrated the presence of BETA2 on the Nnat promoter, thus confirming the direct transcriptional regulation of Nnat by BETA2. To assess NNAT potential function, we performed knockdown studies by siRNA in NIT cells and observed a reduction in the ability of the NIT cells to respond to glucose. These results suggest for the first time an important role for NNAT in insulin secretion and for proper ?-cell function. PMID:15793245

Chu, Khoi; Tsai, Ming-Jer

2005-01-01

410

Regulation of the Pancreatic Islet-Specific Gene BETA2 (neuroD) by Neurogenin 3  

PubMed Central

The BETA2 (neuroD) gene is expressed in endocrine cells during pancreas development and is essential for proper islet morphogenesis. The objective of this study is to identify potential upstream regulators of the BETA2 gene during pancreas development. We demonstrated that the expression of neurogenin 3 (ngn3), an islet- and neuron-specific basic-helix-loop-helix transcription factor, partially overlaps that of BETA2 during early mouse development. More importantly, overexpression of ngn3 can induce the ectopic expression of BETA2 in Xenopus embryos and stimulate the endogenous RNA of BETA2 in endocrine cell lines. Furthermore, overexpression of ngn3 could cause a dose-dependent activation on the 1.0-kb BETA2 promoter in islet-derived cell lines. Deletion and mutation analyses revealed that two proximal E box sequences, E1 and E3, could bind to ngn3-E47 heterodimer and mediate ngn3 activation. Based on these results, we hypothesize that ngn3 is involved in activating the expression of BETA2 at an early stage of islet cell differentiation through the E boxes in the BETA2 promoter. PMID:10757813

Huang, Hsiang-Po; Liu, Min; El-Hodiri, Heithem M.; Chu, Khoi; Jamrich, Milan; Tsai, Ming-Jer

2000-01-01

411

Neurogenin 2 mediates amyloid-? precursor protein-stimulated neurogenesis.  

PubMed

Amyloid-? precursor protein (APP) is well studied for its role in Alzheimer disease, although its normal function remains uncertain. It has been reported that APP stimulates the proliferation and neuronal differentiation of neural stem/progenitor cells (NSPCs). In this study we examined the role of APP in NSPC differentiation. To identify proteins that may mediate the effect of APP on NSPC differentiation, we used a gene array approach to find genes whose expression correlated with APP-induced neurogenesis. We found that the expression of neurogenin 2 (Ngn2), a basic helix-loop-helix transcription factor, was significantly down-regulated in NSPCs from APP knock-out mice (APPKO) and increased in APP transgenic (Tg2576) mice. Ngn2 overexpression in APPKO NSPCs promoted neuronal differentiation, whereas siRNA knockdown of Ngn2 expression in wild-type NSPCs decreased neuronal differentiation. The results demonstrate that APP-stimulated neuronal differentiation of NSPCs is mediated by Ngn2. PMID:25217641

Bolós, Marta; Hu, Yanling; Young, Kaylene M; Foa, Lisa; Small, David H

2014-11-01

412

Transcriptional regulatory events initiated by ascl1 and neurog2 during neuronal differentiation of p19 embryonic carcinoma cells.  

PubMed

As members of the proneural basic-helix-loop-helix (bHLH) family of transcription factors, Ascl1 and Neurog2 direct the differentiation of specific populations of neurons at various times and locations within the developing nervous system. In order to characterize the mechanisms employed by these two bHLH factors, we generated stable, doxycycline-inducible lines of P19 embryonic carcinoma cells that express comparable levels of Ascl1 and Neurog2. Upon induction, both Ascl1 and Neurog2 directed morphological and immunocytochemical changes consistent with initiation of neuronal differentiation. Comparison of Ascl1- and Neurog2-regulated genes by microarray analyses showed both shared and distinct transcriptional changes for each bHLH protein. In both Ascl1- and Neurog2-differentiating cells, repression of Oct4 mRNA levels was accompanied by increased Oct4 promoter methylation. However, DNA demethylation was not detected for genes induced by either bHLH protein. Neurog2-induced genes included glutamatergic marker genes while Ascl1-induced genes included GABAergic marker genes. The Neurog2-specific induction of a gene encoding a protein phosphatase inhibitor, Ppp1r14a, was dependent on distinct, canonical E-box sequences within the Ppp1r14a promoter and the nucleotide sequences within these E-boxes were partially responsible for Neurog2-specific regulation. Our results illustrate multiple novel mechanisms by which Ascl1 and Neurog2 regulate gene repression during neuronal differentiation in P19 cells. PMID:25189318

Huang, Holly S; Redmond, Tanya M; Kubish, Ginger M; Gupta, Shweta; Thompson, Robert C; Turner, David L; Uhler, Michael D

2015-03-01

413

Screening of transcription factors with transcriptional initiation activity.  

PubMed

A majority of mammalian promoters are associated with CpG islands. CpG island promoters frequently lack common core promoter elements, such as the TATA box, and often have dispersed transcription start sites. The mechanism through which CpG island promoters are transcriptionally initiated remains unclear. We speculate that some transcription factors can direct transcription initiation by themselves. To test this hypothesis, we screened a variety of transcription factors to see whether they could initiate transcription. Most transcription factors, including specificity protein 1 (Sp1) and nuclear factor Y (NF-Y), showed little transcriptional initiation activity. However, nuclear respiratory factor 1 (NRF-1), the basic helix-loop-helix/leucine zipper (bHLH/ZIP) family of proteins and the E-twenty six (Ets) family of proteins had strong transcriptional activity. We further demonstrated that these transcription factors initiate dispersed transcription. Our studies provide perspectives to the mechanism of transcription initiation from CpG island promoters. PMID:23933270

Zhang, Lang; Yu, Haoyue; Wang, Pan; Ding, Qingyang; Wang, Zhao

2013-11-15

414

Organ-specific effects of brassinosteroids on stomatal production coordinate with the action of TOO MANY MOUTHS.  

PubMed

In Arabidopsis, stomatal development initiates after protodermal cells acquire stomatal lineage cell fate. Stomata or their precursors communicate with their neighbor epidermal cells to ensure the "one cell spacing" rule. The signals from EPF/EPFL peptide ligands received by TOO MANY MOUTHS (TMM) and ERECTA-family receptors are supposed to be transduced by YODA MAPK cascade. A basic helix-loop-helix transcription factor SPEECHLESS (SPCH) is another key regulator of stomatal cell fate determination and asymmetric entry divisions, and SPCH activity is regulated by YODA MAPK cascade. Brassinosteroid (BR) signaling, one of the most well characterized signal transduction pathways in plants, contributes to the control of stomatal production. But opposite organ-specific effects of BR on stomatal production were reported. Here we confirm that stomatal production in hypocotyls is controlled by BR levels. YODA and CYCD4 are not essential for BR stomata-promoting function. Furthermore, we found that BR could confer tmm hypocotyls clustered stomatal phenotype, indicating that the BR organ-specific effects on stomatal production might coordinate with the TMM organ-specific actions. PMID:25234048

Wang, Ming; Yang, Kezhen; Le, Jie

2015-03-01

415

Silencing of the inhibitor of DNA binding protein 4 (ID4) contributes to the pathogenesis of mouse and human CLL  

PubMed Central

Inhibitor of DNA binding protein 4 (ID4) is a member of the dominant-negative basic helix-loop-helix transcription factor family that lacks DNA binding activity and has tumor suppressor function. ID4 promoter methylation has been reported in acute myeloid leukemia and chronic lymphocytic leukemia (CLL), although the expression, function, and clinical relevance of this gene have not been characterized in either disease. We demonstrate that the promoter of ID4 is consistently methylated to various degrees in CLL cells, and increased promoter methylation in a univariable analysis correlates with shortened patient survival. However, ID4 mRNA and protein expression is uniformly silenced in CLL cells irrespective of the degree of promoter methylation. The crossing of ID4+/? mice with E?-TCL1 mice triggers a more aggressive murine CLL as measured by lymphocyte count and inferior survival. Hemizygous loss of ID4 in nontransformed TCL1-positive B cells enhances cell proliferation triggered by CpG oligonucleotides and decreases sensitivity to dexamethasone-mediated apoptosis. Collectively, this study confirms the importance of the silencing of ID4 in murine and human CLL pathogenesis. PMID:21098398

Chen, Shih-Shih; Claus, Rainer; Lucas, David M.; Yu, Lianbo; Qian, Jiang; Ruppert, Amy S.; West, Derek A.; Williams, Katie E.; Johnson, Amy J.; Sablitzky, Fred

2011-01-01

416

Temporal regulation of Ath5 gene expression during eye development  

PubMed Central

During central nervous system development the timing of progenitor differentiation must be precisely controlled to generate the proper number and complement of neuronal cell types. Proneural basic helix-loop-helix (bHLH) transcription factors play a central role in regulating neurogenesis, and thus the timing of their expression must be regulated to ensure that they act at the appropriate developmental time. In the developing retina, the expression of the bHLH factor Ath5 is controlled by multiple signals in early retinal progenitors, although less is known about how these signals are coordinated to ensure correct spatial and temporal pattern of gene expression. Here we identify a key distal Xath5 enhancer and show that this enhancer regulates the early phase of Xath5 expression, while the proximal enhancer we previously identified acts later. The distal enhancer responds to Pax6, a key patterning factor in the optic vesicle, while FGF signaling regulates Xath5 expression through sequences outside of this region. In addition, we have identified an inhibitory element adjacent to the conserved distal enhancer region that is required to prevent premature initiation of expression in the retina. This temporal regulation of Xath5 gene expression is comparable to proneural gene regulation in Drosophila, whereby separate enhancers regulate different temporal phases of expression. PMID:19059393

Willardsen, Minde I.; Suli, Arminda; Pan, Yi; Marsh-Armstrong, Nicholas; Chien, Chi-Bin; El-Hodiri, Heithem; Brown, Nadean L.; Moore, Kathryn B.; Vetter, Monica L.

2009-01-01

417

Mga is essential for the survival of pluripotent cells during peri-implantation development.  

PubMed

The maintenance and control of pluripotency is of great interest in stem cell biology. The dual specificity T-box/basic-helix-loop-helix-zipper transcription factor Mga is expressed in the pluripotent cells of the inner cell mass (ICM) and epiblast of the peri-implantation mouse embryo, but its function has not been investigated previously. Here, we use a loss-of-function allele and RNA knockdown to demonstrate that Mga depletion leads to the death of proliferating pluripotent ICM cells in vivo and in vitro, and the death of embryonic stem cells (ESCs) in vitro. Additionally, quiescent pluripotent cells lacking Mga are lost during embryonic diapause. Expression of Odc1, the rate-limiting enzyme in the conversion of ornithine into putrescine in the synthesis of polyamines, is reduced in Mga mutant cells, and the survival of mutant ICM cells as well as ESCs is rescued in culture by the addition of exogenous putrescine. These results suggest a mechanism whereby Mga influences pluripotent cell survival through regulation of the polyamine pool in pluripotent cells of the embryo, whether they are in a proliferative or quiescent state. PMID:25516968

Washkowitz, Andrew J; Schall, Caroline; Zhang, Kun; Wurst, Wolfgang; Floss, Thomas; Mager, Jesse; Papaioannou, Virginia E

2015-01-01

418

Id2 controls chondrogenesis acting downstream of BMP signaling during maxillary morphogenesis.  

PubMed

Maxillofacial dysmorphogenesis is found in 5% of the population. To begin to understand the mechanisms required for maxillofacial morphogenesis, we employed the inhibitors of the differentiation 2 (Id2) knock-out mouse model, in which Id proteins, members of the regulator of basic helix-loop-helix (bHLH) transcription factors, modulate cell proliferation, apoptosis, and differentiation. We now report that spatially-restricted growth defects are localized at the skull base of Id2 KO mice. Curiously, at birth, neither the mutant Id2 KO nor wild-type (WT) mice differed, based upon cephalometric and histological analyses of cranial base synchondroses. In postnatal week 2, a narrower hypertrophic zone and an inhibited proliferative zone in presphenoid synchondrosis (PSS) and spheno-occipital synchondrosis (SOS) with maxillary hypoplasia were identified in the Id2 mutant mice. Complementary studies revealed that exogenous bone morphogenetic proteins (BMPs) enhanced cartilage growth, matrix deposition, and chondrocyte proliferation in the WT but not in the mutant model. Id2-deficient chondrocytes expressed more Smad7 transcripts. Based on our results, we assert that Id2 plays an essential role, acting downstream of BMP signaling, to regulate cartilage formation at the postnatal stage by enhancing BMP signals through inhibiting Smad7 expression. As a consequence, abnormal endochondral ossification was observed in cranial base synchondroses during the postnatal growth period, resulting in the clinical phenotype of maxillofacial dysmorphogenesis. PMID:21985998

Sakata-Goto, Tomoko; Takahashi, Katsu; Kiso, Honoka; Huang, Boyen; Tsukamoto, Hiroko; Takemoto, Mitsuru; Hayashi, Tatsunari; Sugai, Manabu; Nakamura, Takashi; Yokota, Yoshifumi; Shimizu, Akira; Slavkin, Harold; Bessho, Kazuhisa

2012-01-01

419

High-temperature inhibition of biosynthesis and transportation of anthocyanins results in the poor red coloration in red-fleshed Actinidia chinensis.  

PubMed

In plants, the role of anthocyanins trafficking in response to high temperature has been rarely studied, and therefore poorly understood. Red-fleshed kiwifruit has stimulated the world kiwifruit industry owing to its appealing color. However, fruit in warmer climates have been found to have poor flesh coloration, and the factors responsible for this response remain elusive. Partial correlation and regression analysis confirmed that accumulative temperatures above 25°C (T25) was one of the dominant factors inhibiting anthocyanin accumulation in red-fleshed Actinidia chinensis, 'Hongyang'. Expression of structural genes, AcMRP and AcMYB1 in inner pericarp sampled from the two high altitudes (low temperature area), was notably higher than the low altitude (high temperature area) during fruit coloration. AcMYB1 and structural genes coordinate expression supported the MYB-bHLH (basic helix-loop-helix)-WD40 regulatory complex mediated downregulation of anthocyanin biosynthesis induced by high temperatures in kiwifruit. Moreover, cytological observations using the light and transmission electronic microscopy showed that there were a series of anthocyanic vacuolar inclusion (AVI)-like structures involved in their vacuolization process and dissolution of the pigmented bodies inside cells of fruit inner pericarp. Anthocyanin transport was inhibited by high temperature via retardation of vacuolization or reduction in AIV-like structure formation. Our findings strongly suggested that complex multimechanisms influenced the effects of high temperature on red-fleshed kiwifruit coloration. PMID:25143057

Man, Yu-Ping; Wang, Yan-Chang; Li, Zuo-Zhou; Jiang, Zheng-Wang; Yang, Hong-Li; Gong, Jun-Jie; He, Shi-Song; Wu, Shi-Quan; Yang, Zuo-Quan; Zheng, Jing; Wang, Zhong-Yan

2014-08-21

420

Disruption of neurogenesis and cortical development in transgenic mice misexpressing Olig2, a gene in the Down syndrome critical region.  

PubMed

The basic helix-loop-helix (bHLH) transcription factor Olig2 is crucial for mammalian central nervous system development. Human ortholog OLIG2 is located in the Down syndrome critical region in trisomy 21. To investigate the effect of Olig2 misexpression on brain development, we generated a developmentally regulated Olig2-overexpressing transgenic line with a Cre/loxP system. The transgenic mice with Olig2 misexpression in cortical neural stem/progenitor cells exhibited microcephaly, cortical dyslamination, hippocampus malformation, and profound motor deficits. Ectopic misexpression of Olig2 impaired cortical progenitor proliferation and caused precocious cell cycle exit. Massive neuronal cell death was detected in the developing cortex of Olig2-misexpressing mice. In addition, Olig2 misexpression led to a significant downregulation of neuronal specification factors including Ngn1, Ngn2 and Pax6, and a defect in cortical neurogenesis. Chromatin-immunoprecipitation and sequencing (ChIP-Seq) analysis indicates that Olig2 directly targets the promoter and/or enhancer regions of Nfatc4, Dscr1/Rcan1 and Dyrk1a, the critical neurogenic genes that contribute to Down syndrome phenotypes, and inhibits their expression. Together, our study suggests that Olig2 misexpression in neural stem cells elicits neurogenesis defects and neuronal cell death, which may contribute to developmental disorders including Down syndrome, where OLIG2 is triplicated on chromosomal 21. PMID:25747816

Liu, Wei; Zhou, Hui; Liu, Lei; Zhao, Chuntao; Deng, Yaqi; Chen, Lina; Wu, Laiman; Mandrycky, Nicole; McNabb, Christopher T; Peng, Yuanbo; Fuchs, Perry N; Lu, Jie; Sheen, Volney; Qiu, Mengsheng; Mao, Meng; Richard Lu, Q

2015-05-01

421

Sequence signatures and the probabilistic identification of proteins in the Myc-Max-Mad network  

PubMed Central

Accurate identification of specific groups of proteins by their amino acid sequence is an important goal in genome research. Here we combine information theory with fuzzy logic search procedures to identify sequence signatures or predictive motifs for members of the Myc-Max-Mad transcription factor network. Myc is a well known oncoprotein, and this family is involved in cell proliferation, apoptosis, and differentiation. We describe a small set of amino acid sites from the N-terminal portion of the basic helix-loop-helix (bHLH) domain that provide very accurate sequence signatures for the Myc-Max-Mad transcription factor network and three of its member proteins. A predictive motif involving 28 contiguous bHLH sequence elements found 337 network proteins in the GenBank NR database with no mismatches or misidentifications. This motif also identifies at least one previously unknown fungal protein with strong affinity to the Myc-Max-Mad network. Another motif found 96% of known Myc protein sequences with only a single mismatch, including sequences from genomes previously not thought to contain Myc proteins. The predictive motif for Myc is very similar to the ancestral sequence for the Myc group estimated from phylogenetic analyses. Based on available crystal structure studies, this motif is discussed in terms of its functional consequences. Our results provide insight into evolutionary diversification of DNA binding and dimerization in a well characterized family of regulatory proteins and provide a method of identifying signature motifs in protein families. PMID:15851686

Atchley, William R.; Fernandes, Andrew D.

2005-01-01

422

The mutational spectrum in Waardenburg syndrome  

SciTech Connect

101 individuals or families with Waardenburg syndrome (WS) or related abnormalities have been screened for mutations in the PAX3 gene. PAX3 mutations were seen in 19 of 35 individuals or families with features of Type I Waardenburg syndrome. None of the 47 Type 2 WS families showed any PAX3 mutation, nor did any of 19 individuals with other neural crest syndromes or pigmentary disturbances. PAX3 mutations included substitutions of highly conserved amino acids, splice site mutations, nonsense mutations and frameshifting deletions or insertions. One patient (with Type 1 WS, mental retardation and growth retardation) had a chromosomal deletion of 7-8 Mb encompassing the PAX3 gene. Mutations were seen in each of exons 2-6, with a concentration in the 5{prime} part of the paired box (exon 2) and the 3{prime} part of the homeobox (exon 6). There was no evident relation between the molecular change and the clinical manifestations in mutation carriers. We conclude that PAX3 dosage effects very specifically produce dystopia canthorum, the distinguishing feature of Type 1 WS, and variably produce the other features of Type 1 WS depending on genetic background or chance events. Two of the Type 2 families showed linkage to markers from 3p14, the location of the MITF gene. MITF encodes a basic helix-loop-helix-zipper protein which is the homologue of the mouse microphthalmia gene product. It is likely that mutations in MITF cause some but not all Type 2 WS.

Read, A.P.; Tassabehji, M.; Liu, X.Z. [and others

1994-09-01

423

Differential responsiveness of distinct retinal domains to Atoh7  

PubMed Central

During vertebrate eye development retinal progenitor cells (RPCs) differentiate into all neural cell types of the retina. Retinal ganglion cells (RGCs) represent the first cell type to be generated. For their development, Atoh7, a basic Helix Loop Helix (bHLH) transcription factor is crucial. Atoh7 loss of function results in a massive reduction or even a total loss of RGCs. However, inconsistent results have been obtained in atoh7 gain of function experiments with respect to ganglion cell genesis, implying that the effect of Atoh7 is likely to be dependent on the competence state of the RPC. In this study we addressed the differential susceptibilities of early RPCs to Atoh7 in vivo, using medaka. Unexpectedly, we observed a largely normal development of the dorsal retina, although atoh7 was precociously expressed. However, the development of the retina close to the optic nerve head (part of the ventral retina) was disturbed severely. Photoreceptors were largely absent and the Müller glia cell number was reduced significantly. The majority of cells in this domain were ganglion cells and the abnormal development of this area affected the closure of the optic fissure resulting in coloboma. PMID:25151399

Sinn, Rebecca; Peravali, Ravindra; Heermann, Stephan; Wittbrodt, Joachim

2014-01-01

424

stall Encodes an ADAMTS Metalloprotease and Interacts Genetically With Delta in Drosophila Ovarian Follicle Formation  

PubMed Central

Ovarian follicle formation in Drosophila melanogaster requires stall (stl) gene function, both within and outside the ovary, for follicle individualization, stalk cell intercalation, and oocyte localization. We have identified the stl transcript as CG3622 and confirmed the presence of three alternatively spliced isoforms, contrary to current genome annotation. Here we show that the gene is expressed in both ovarian and brain tissues, which is consistent with previous evidence of an ovary nonautonomous function. On the basis of amino acid sequence, stl encodes a metalloprotease similar to the “a disintegrin and metalloprotease with thrombospondin” (ADAMTS) family. Although stl mutant ovaries fail to maintain the branched structure of the fusome and periodically show improperly localized oocytes, stl mutants do not alter oocyte determination. Within the ovary, stl is expressed in pupal basal stalks and in adult somatic cells of the posterior germarium and the follicular poles. Genetically, stl exhibits a strong mutant interaction with Delta (Dl), and Dl mutant ovaries show altered stl expression patterns. Additionally, a previously described genetic interactor, daughterless, also modulates stl expression in the somatic ovary and may do so directly in its capacity as a basic helix-loop-helix (bHLH) transcription factor. We propose a complex model of long-range extraovarian signaling through secretion or extracellular domain shedding, together with local intraovarian protein modification, to explain the dual sites of Stl metalloprotease function in oogenesis. PMID:19752215

Ozdowski, Emily F.; Mowery, Yvonne M.; Cronmiller, Claire

2009-01-01

425

Soybean SAT1 (Symbiotic Ammonium Transporter 1) encodes a bHLH transcription factor involved in nodule growth and NH4+ transport.  

PubMed

Glycine max symbiotic ammonium transporter 1 was first documented as a putative ammonium (NH4(+)) channel localized to the symbiosome membrane of soybean root nodules. We show that Glycine max symbiotic ammonium transporter 1 is actually a membrane-localized basic helix-loop-helix (bHLH) DNA-binding transcription factor now renamed Glycine max bHLH membrane 1 (GmbHLHm1). In yeast, GmbHLHm1 enters the nucleus and transcriptionally activates a unique plasma membrane NH4(+) channel Saccharomyces cerevisiae ammonium facilitator 1. Ammonium facilitator 1 homologs are present in soybean and other plant species, where they often share chromosomal microsynteny with bHLHm1 loci. GmbHLHm1 is important to the soybean rhizobium symbiosis because loss of activity results in a reduction of nodule fitness and growth. Transcriptional changes in nodules highlight downstream signaling pathways involving circadian clock regulation, nutrient transport, hormone signaling, and cell wall modification. Collectively, these results show that GmbHLHm1 influences nodule development and activity and is linked to a novel mechanism for NH4(+) transport common to both yeast and plants. PMID:24707045

Chiasson, David M; Loughlin, Patrick C; Mazurkiewicz, Danielle; Mohammadidehcheshmeh, Manijeh; Fedorova, Elena E; Okamoto, Mamoru; McLean, Elizabeth; Glass, Anthony D M; Smith, Sally E; Bisseling, Ton; Tyerman, Stephen D; Day, David A; Kaiser, Brent N

2014-04-01

426

Dynamic expression and roles of Hes factors in neural development.  

PubMed

The basic helix-loop-helix factors Hes1 and Hes5 repress the expression of proneural factors such as Ascl1, thereby inhibiting neuronal differentiation and maintaining neural progenitor cells (NPCs). Hes1 expression oscillates by negative feedback with a period of about 2-3 h in proliferating NPCs. Induction of sustained expression of Hes1 in NPCs inhibits their cell-cycle progression, suggesting that the oscillatory expression of Hes1 is important for the proliferation of NPCs. Hes1 oscillation drives the oscillatory expression of proneural factors such as Ascl1 by periodic repression. By contrast, in differentiating neurons, Hes1 expression disappears and the expression of proneural factors is up-regulated and sustained. A new optogenetics approach that induces Ascl1 expression by blue light illumination demonstrated that sustained expression of Ascl1 induces neuronal differentiation, whereas oscillatory expression of Ascl1 activates the proliferation of NPCs. These results together indicate that Hes1 regulates the oscillatory versus sustained expression of the proneural factor Ascl1, which in turn regulates the proliferation of NPCs and the subsequent processes of cell-cycle exit and neuronal fate determination, depending on the expression dynamics. PMID:24850276

Kageyama, Ryoichiro; Shimojo, Hiromi; Imayoshi, Itaru

2015-01-01

427

Role of Dlx6 in regulation of an endothelin-1-dependent, dHAND branchial arch enhancer  

PubMed Central

Neural crest cells play a key role in craniofacial development. The endothelin family of secreted polypeptides regulates development of several neural crest sublineages, including the branchial arch neural crest. The basic helix–loop–helix transcription factor dHAND is also required for craniofacial development, and in endothelin-1 (ET-1) mutant embryos, dHAND expression in the branchial arches is down-regulated, implicating it as a transcriptional effector of ET-1 action. To determine the mechanism that links ET-1 signaling to dHAND transcription, we analyzed the dHAND gene for cis-regulatory elements that control transcription in the branchial arches. We describe an evolutionarily conserved dHAND enhancer that requires ET-1 signaling for activity. This enhancer contains four homeodomain binding sites that are required for branchial arch expression. By comparing protein binding to these sites in branchial arch extracts from endothelin receptor A (EdnrA) mutant and wild-type mouse embryos, we identified Dlx6, a member of the Distal-less family of homeodomain proteins, as an ET-1-dependent binding factor. Consistent with this conclusion, Dlx6 was down-regulated in branchial arches from EdnrA mutant mice. These results suggest that Dlx6 acts as an intermediary between ET-1 signaling and dHAND transcription during craniofacial morphogenesis. PMID:11711438

Charité, Jeroen; McFadden, David G.; Merlo, Giorgio; Levi, Giovanni; Clouthier, David E.; Yanagisawa, Masashi; Richardson, James A.; Olson, Eric N.

2001-01-01

428

MITF-M plays an essential role in transcriptional activation and signal transduction in Xiphophorus melanoma.  

PubMed

The teleost Xiphophorus provides a genetically well-described model system to study the molecular processes underlying melanoma formation. As transcriptional deregulation is a widespread phenomenon in many tumors, we have studied the regulation of melanoma-specific gene expression in this fish. A central regulator of melanocyte specific gene expression, which is also a marker for melanomas, is the transcription factor microphthalmia-associated transcription factor (MITF). One of its targets, the tyrosinase gene, codes for a key enzyme in the melanin synthesis pathway. We could show that the promoter of the medaka tyrosinase gene is highly active in the Xiphophorus melanoma cell line PSM (platyfish-swordtail melanoma) but not in non-melanoma cells. Functional dissection of the promoter revealed that three E-boxes are essential for its pigment cell-specific activity. These binding sites for basic helix-loop-helix transcription factors are recognized by a nuclear protein from the melanoma cell line PSM, most likely MITF, as its exogenous delivery could activate the promoter in non-melanoma cells. The use of specific signalling inhibitors demonstrated that the activity of the tyrosinase promoter is negatively regulated by the melanoma-inducing receptor tyrosine kinase Xmrk in PSM cells. This repression is mediated by MAPkinase and dependent on E-box integrity, again implicating the involvement of MITF. The cumulative evidence indicates that in Xiphophorus, Xmrk suppresses differentiation signals relayed by MITF as part of the transformation process finally resulting in melanoma formation. PMID:14597395

Delfgaauw, Jacqueline; Duschl, Jutta; Wellbrock, Claudia; Froschauer, Christin; Schartl, Manfred; Altschmied, Joachim

2003-11-27

429

MK615, a Prunus mume Steb. Et Zucc ('Ume') extract, attenuates the growth of A375 melanoma cells by inhibiting the ERK1/2-Id-1 pathway.  

PubMed

The Japanese apricot, a commonly consumed food called 'Ume' in Japan, has been used for a traditional Japanese medicine for centuries. MK615, an extract of compounds from 'Ume', has strong antitumorigenic and antiinflammatory effects including the induction of apoptosis and autophagy, and inhibition of cytokine production mediated via the inhibition of MAPKs signaling including ERK-1/2, JNK and p38MAPK. The inhibitor of DNA binding 1 (Id-1), a basic helix-loop-helix (bHLH) transcription factor family, is essential for DNA binding and the transcriptional regulation of various proteins that play important roles in the development, progression and invasion of tumors. In melanoma, Id-1 is constitutively expressed in the late and early stages, suggesting it as a therapeutic target in patients with melanoma. This study reports that MK615 profoundly reduced both the mRNA- and protein expression levels of Id-1 and inhibited cell growth in A375 melanoma cells. MK615 markedly inhibited the phosphorylation of ERK1/2, which is associated with Id-1 protein expression in A375 cells. Id-1-specific RNAi induced the death of A375 cells. Moreover, the expression of Bcl-2 was decreased by both MK615 and Id-1-specific RNAi in A375 cells. The results suggest that MK615 is a potential therapeutic agent for treating malignant melanoma. PMID:22076920

Tada, Ko-ichi; Kawahara, Ko-ichi; Matsushita, Shigeto; Hashiguchi, Teruto; Maruyama, Ikuro; Kanekura, Takuro

2012-06-01

430

The SWI/SNF KlSnf2 subunit controls the glucose signaling pathway to coordinate glycolysis and glucose transport in Kluyveromyces lactis.  

PubMed

In Kluyveromyces lactis, the expression of the major glucose permease gene RAG1 is controlled by extracellular glucose through a signaling cascade similar to the Saccharomyces cerevisiae Snf3/Rgt2/Rgt1 pathway. We have identified a key component of the K. lactis glucose signaling pathway by characterizing a new mutation, rag20-1, which impairs the regulation of RAG1 and hexokinase RAG5 genes by glucose. Functional complementation of the rag20-1 mutation identified the KlSNF2 gene, which encodes a protein 59% identical to S. cerevisiae Snf2, the major subunit of the SWI/SNF chromatin remodeling complex. Reverse transcription-quantitative PCR and chromatin immunoprecipitation analyses confirmed that the KlSnf2 protein binds to RAG1 and RAG5 promoters and promotes the recruitment of the basic helix-loop-helix Sck1 activator. Besides this transcriptional effect, KlSnf2 is also implicated in the glucose signaling pathway by controlling Sms1 and KlRgt1 posttranscriptional modifications. When KlSnf2 is absent, Sms1 is not degraded in the presence of glucose, leading to constitutive RAG1 gene repression by KlRgt1. Our work points out the crucial role played by KlSnf2 in the regulation of glucose transport and metabolism in K. lactis, notably, by suggesting a link between chromatin remodeling and the glucose signaling pathway. PMID:23002104

Cotton, Pascale; Soulard, Alexandre; Wésolowski-Louvel, Micheline; Lemaire, Marc

2012-11-01

431

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.  

PubMed

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

432

Insulin induces transcription of target genes through the hypoxia-inducible factor HIF-1alpha/ARNT.  

PubMed Central

Hypoxic stress induces the expression of genes associated with increased energy flux, including the glucose transporters Glut1 and Glut3, several glycolytic enzymes, nitric oxide synthase, tyrosine hydroxylase, erythropoietin and vascular endothelial growth factor (VEGF). Induction of these genes is mediated by a common basic helix-loop-helix-PAS transcription complex, the hypoxia-inducible factor-1alpha (HIF-1alpha)/aryl hydrocarbon nuclear translocator (ARNT). Insulin also induces some of these genes; however, the underlying mechanism is unestablished. We report here that insulin shares with hypoxia the ability to induce the HIF-1alpha/ARNT transcription complex in various cell types. This induction was demonstrated by electrophoretic mobility shift of the hypoxia response element (HRE), and abolished by specific antisera to HIF-1alpha and ARNT, and by transcription activation of HRE reporter vectors. Furthermore, basal and insulin-induced expression of Glut1, Glut3, aldolase A, phosphoglycerate kinase and VEGF was reduced in cells having a defective ARNT. Similarly, the insulin-induced activation of HRE reporter vectors and VEGF was impaired in these cells and was rescued by re-introduction of ARNT. Finally, insulin-like growth factor-I (IGF-I) also induced the HIF-1alpha/ARNT transcription complex. These observations establish a novel signal transduction pathway of insulin and IGF-I and broaden considerably the scope of activity of HIF-1alpha/ARNT. PMID:9724644

Zelzer, E; Levy, Y; Kahana, C; Shilo, B Z; Rubinstein, M; Cohen, B

1998-01-01

433

Sequential expressions of Notch1, Jagged2 and Math1 in molar tooth germ of mouse.  

PubMed

The Notch signaling pathway is an evolutionary conserved mechanism that plays an important role in cell-cell communication and cell fate in a wide range of tissues. The mammalian family of Notch receptors consists of 4 members: Notch1/2/3/4. The Notch ligand family consists of 5 members: Delta1/3/4 and Jagged1/2. Math1 encodes a murine basic helix-loop-helix (bHLH) transcription factor that acts as positive regulator of cell differentiation. Recently, links between Notch and Math1 pathways were demonstrated in various tissues. Expression of Notch1, Jagged2 and Math1 were analyzed in the mouse molar tooth germ during embryonic stage (E) 13 and E15 and during postnatal stage (PN) 1, PN3, PN5, PN10 and PN14 by using in situ hybridization. Positive Notch1 expression was found at the tooth bud during embryonic stages, but its expression was absent from the basal cells in contact with the dental mesenchyme. Jagged2 and Math1 were strongly expressed in differentiated ameloblasts and odontoblasts and Math1 strong expression was even maintained until PN14 stage. Math1 showed the strongest expression. Our results suggest that the Notch1 signaling pathway through Jagged2 could be importantly related to Math1, directing the process of odontogenesis toward cell differentiation. PMID:19181188

Borkosky, Silvia S; Nagatsuka, Hitoshi; Orita, Yorihisa; Tsujigiwa, Hidetsugu; Yoshinobu, Junko; Gunduz, Mehmet; Rodriguez, Andrea P; Missana, Liliana R; Nishizaki, Kazunori; Nagai, Noriyuki

2008-12-01

434

Bhlhe40 controls cytokine production by T cells and is essential for pathogenicity in autoimmune neuroinflammation.  

PubMed

TH1 and TH17 cells mediate neuroinflammation in experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis. Pathogenic TH cells in EAE must produce the pro-inflammatory cytokine granulocyte-macrophage colony stimulating factor (GM-CSF). TH cell pathogenicity in EAE is also regulated by cell-intrinsic production of the immunosuppressive cytokine interleukin 10 (IL-10). Here we demonstrate that mice deficient for the basic helix-loop-helix (bHLH) transcription factor Bhlhe40 (Bhlhe40(-/-)) are resistant to the induction of EAE. Bhlhe40 is required in vivo in a T cell-intrinsic manner, where it positively regulates the production of GM-CSF and negatively regulates the production of IL-10. In vitro, GM-CSF secretion is selectively abrogated in polarized Bhlhe40(-/-) TH1 and TH17 cells, and these cells show increased production of IL-10. Blockade of IL-10 receptor in Bhlhe40(-/-) mice renders them susceptible to EAE. These findings identify Bhlhe40 as a critical regulator of autoreactive T-cell pathogenicity. PMID:24699451

Lin, Chih-Chung; Bradstreet, Tara R; Schwarzkopf, Elizabeth A; Sim, Julia; Carrero, Javier A; Chou, Chun; Cook, Lindsey E; Egawa, Takeshi; Taneja, Reshma; Murphy, Theresa L; Russell, John H; Edelson, Brian T

2014-01-01

435

Molecular Characterisation, Evolution and Expression of Hypoxia-Inducible Factor in Aurelia sp.1  

PubMed Central

The maintenance of physiological oxygen homeostasis is mediated by hypoxia-inducible factor (HIF), a key transcriptional factor of the PHD-HIF system in all metazoans. However, the molecular evolutionary origin of this central physiological regulatory system is not well characterized. As the earliest eumetazoans, Cnidarians can be served as an interesting model for exploring the HIF system from an evolutionary perspective. We identified the complete cDNA sequence of HIF-1? (ASHIF) from the Aurelia sp.1, and the predicted HIF-1? protein (pASHIF) was comprised of 674 amino acids originating from 2,025 bp nucleotides. A Pairwise comparison revealed that pASHIF not only possessed conserved basic helix-loop-helix (bHLH) and Per-Arnt-Sim (PAS) domains but also contained the oxygen dependent degradation (ODD) and the C-terminal transactivation domains (C-TAD), the key domains for hypoxia regulation. As indicated by sequence analysis, the ASHIF gene contains 8 exons interrupted by 7 introns. Western blot analysis indicated that pASHIF that existed in the polyps and medusa of Aurelia. sp.1 was more stable for a hypoxic response than normoxia. PMID:24926666

Wang, Guoshan; Yu, Zhigang; Zhen, Yu; Mi, Tiezhu; Shi, Yan; Wang, Jianyan; Wang, Minxiao; Sun, Song

2014-01-01

436

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.  

PubMed

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

437

The mammalian single-minded (SIM) gene: Mouse cDNA structure and diencephalic expression indicate a candidate gene for Down syndrome  

SciTech Connect

We have recently isolated a human homolog (hSIM) of the Drosophila single-minded (sim) gene from the Down syndrome critical region of chromosome 21 using the exon trapping method. The Drosophila sim gene encodes a transcription factor that regulates the development of the central nervous system midline cell lineage. To elucidate the structure of the mammalian SIM protein, we have isolated cDNA clones from a mouse embryo cDNA library. The cDNA clones encode a polypeptide of 657 amino acids with a bHLH (basic-helix-loop-helix) domain, characteristic of a large family of transcription factors, and a PAS (Per-Arnt-Sim) domain in the amino-terminal half region. Both of these domains have striking sequence homology with human SIM and Drosophila SIM proteins. In contrast, the carboxy-terminal half of the mouse SIM protein consists of a proline-rich region with no sequence homology to the Drosophila SIM provator domain of a number of transcription factors. Whole-mount embryo in situ hybridization experiments revealed that the SIM mRNA is expressed prominently in the diencephalon during embryogenesis strongly suggest that the newly isolated mammalian SIM homolog may play a critical role in the development of the mammalian central nervous system. We propose that the human SIM gene may be one of the pathogenic genes of Down syndrome. 36 refs., 6 figs.

Yamaki, Akiko [Keio Univ. School of Medicine, Tokyo (Japan)] [Keio Univ. School of Medicine, Tokyo (Japan); [Kyorin Univ., Tokyo (Japan); Kudoh, Jun; Shindoh, Nobuaki [Keio Univ. School of Medicine, Tokyo (Japan)] [and others] [Keio Univ. School of Medicine, Tokyo (Japan); and others

1996-07-01

438

Tomato Male sterile 1035 is essential for pollen development and meiosis in anthers  

PubMed Central

Male fertility in flowering plants depends on proper cellular differentiation in anthers. Meiosis and tapetum development are particularly important processes in pollen production. In this study, we showed that the tomato male sterile (ms10 35) mutant of cultivated tomato (Solanum lycopersicum) exhibited dysfunctional meiosis and an abnormal tapetum during anther development, resulting in no pollen production. We demonstrated that Ms10 35 encodes a basic helix–loop–helix transcription factor that is specifically expressed in meiocyte and tapetal tissue from pre-meiotic to tetrad stages. Transgenic expression of the Ms10 35 gene from its native promoter complemented the male sterility of the ms10 35 mutant. In addition, RNA-sequencing-based transcriptome analysis revealed that Ms10 35 regulates 246 genes involved in anther development processes such as meiosis, tapetum development, cell-wall degradation, pollen wall formation, transport, and lipid metabolism. Our results indicate that Ms10 35 plays key roles in regulating both meiosis and programmed cell death of the tapetum during microsporogenesis. PMID:25262227

Jeong, Hee-Jin; Kang, Jin-Ho; Zhao, Meiai; Kwon, Jin-Kyung; Choi, Hak-Soon; Bae, Jung Hwan; Lee, Hyun-ah; Joung, Young-Hee; Choi, Doil; Kang, Byoung-Cheorl

2014-01-01

439

Crystal structure of the heterodimeric CLOCK:BMAL1 transcriptional activator complex.  

PubMed

The circadian clock in mammals is driven by an autoregulatory transcriptional feedback mechanism that takes approximately 24 hours to complete. A key component of this mechanism is a heterodimeric transcriptional activator consisting of two basic helix-loop-helix PER-ARNT-SIM (bHLH-PAS) domain protein subunits, CLOCK and BMAL1. Here, we report the crystal structure of a complex containing the mouse CLOCK:BMAL1 bHLH-PAS domains at 2.3 Å resolution. The structure reveals an unusual asymmetric heterodimer with the three domains in each of the two subunits--bHLH, PAS-A, and PAS-B--tightly intertwined and involved in dimerization interactions, resulting in three distinct protein interfaces. Mutations that perturb the observed heterodimer interfaces affect the stability and activity of the CLOCK:BMAL1 complex as well as the periodicity of the circadian oscillator. The structure of the CLOCK:BMAL1 complex is a starting point for understanding at an atomic level the mechanism driving the mammalian circadian clock. PMID:22653727

Huang, Nian; Chelliah, Yogarany; Shan, Yongli; Taylor, Clinton A; Yoo, Seung-Hee; Partch, Carrie; Green, Carla B; Zhang, Hong; Takahashi, Joseph S

2012-07-13

440

Geminin Regulates the Transcriptional and Epigenetic Status of Neuronal Fate-Promoting Genes during Mammalian Neurogenesis  

PubMed Central

Regulating the transition from lineage-restricted progenitors to terminally differentiated cells is a central aspect of nervous system development. Here, we investigated the role of the nucleoprotein geminin in regulating neurogenesis at a mechanistic level during both Xenopus primary neurogenesis and mammalian neuronal differentiation in vitro. The latter work utilized neural cells derived from embryonic stem and embryonal carcinoma cells in vitro and neural stem cells from mouse forebrain. In all of these contexts, geminin antagonized the ability of neural basic helix-loop-helix (bHLH) transcription factors to activate transcriptional programs promoting neurogenesis. Furthermore, geminin promoted a bivalent chromatin state, characterized by the presence of both activating and repressive histone modifications, at genes encoding transcription factors that promote neurogenesis. This epigenetic state restrains the expression of genes that regulate commitment of undifferentiated stem and neuronal precursor cells to neuronal lineages. However, maintaining geminin at high levels was not sufficient to prevent terminal neuronal differentiation. Therefore, these data support a model whereby geminin promotes the neuronal precursor cell state by modulating both the epigenetic status and expression of genes encoding neurogenesis-promoting factors. Additional developmental signals acting in these cells can then control their transition toward terminal neuronal or glial differentiation during mammalian neurogenesis. PMID:22949506

Yellajoshyula, Dhananjay; Lim, Jong-won; Thompson, Dominic M.; Witt, Jacob S.; Patterson, Ethan S.

2012-01-01

441

bHLH122 is important for drought and osmotic stress resistance in Arabidopsis and in the repression of ABA catabolism.  

PubMed

• Although proteins in the basic helix-loop-helix (bHLH) family are universal transcription factors in eukaryotes, the biological roles of most bHLH family members are not well understood in plants. • The Arabidopsis thaliana bHLH122 transcripts were strongly induced by drought, NaCl and osmotic stresses, but not by ABA treatment. Promoter::GUS analysis showed that bHLH122 was highly expressed in vascular tissues and guard cells. Compared with wild-type (WT) plants, transgenic plants overexpressing bHLH122 displayed greater resistance to drought, NaCl and osmotic stresses. In contrast, the bhlh122 loss-of-function mutant was more sensitive to NaCl and osmotic stresses than were WT plants. • Microarray analysis indicated that bHLH122 was important for the expression of a number of abiotic stress-responsive genes. In electrophoretic mobility shift assay and chromatin immunoprecipitation assays, bHLH122 could bind directly to the G-box/E-box cis-elements in the CYP707A3 promoter, and repress its expression. Further, up-regulation of bHLH122 substantially increased cellular ABA levels. • These results suggest that bHLH122 functions as a positive regulator of drought, NaCl and osmotic signaling. PMID:24261563

Liu, Wenwen; Tai, Huanhuan; Li, Songsong; Gao, Wei; Zhao, Meng; Xie, Chuanxiao; Li, Wen-Xue

2014-03-01

442

Achaete-Scute Complex Homolog-1 Promotes DNA Repair in the Lung Carcinogenesis through Matrix Metalloproteinase-7 and O(6)-Methylguanine-DNA Methyltransferase  

PubMed Central

Lung cancer is the leading cause of cancer-related deaths in the world. Achaete-scute complex homolog-1 (Ascl1) is a member of the basic helix-loop-helix (bHLH) transcription factor family that has multiple functions in the normal and neoplastic lung such as the regulation of neuroendocrine differentiation, prevention of apoptosis and promotion of tumor–initiating cells. We now show that Ascl1 directly regulates matrix metalloproteinase-7 (MMP-7) and O(6)-methylguanine-DNA methyltransferase (MGMT). Loss- and gain-of-function experiments in human bronchial epithelial and lung carcinoma cell lines revealed that Ascl1, MMP-7 and MGMT are able to protect cells from the tobacco-specific nitrosamine NNK-induced DNA damage and the alkylating agent cisplatin-induced apoptosis. We also examined the role of Ascl1 in NNK-induced lung tumorigenesis in vivo. Using transgenic mice which constitutively expressed human Ascl1 in airway lining cells, we found that there was a delay in lung tumorigenesis. We conclude that Ascl1 potentially enhances DNA repair through activation of MMP-7 and MGMT which may impact lung carcinogenesis and chemoresistance. The study has uncovered a novel and unexpected function of Ascl1 which will contribute to better understanding of lung carcinogenesis and the broad implications of transcription factors in tobacco-related carcinogenesis. PMID:23300791

Wang, Xiao-Yang; Jensen-Taubman, Sandra M.; Keefe, Kathleen M.; Yang, Danlei; Linnoila, R. Ilona

2012-01-01

443

Molecular actions of polyhalogenated arylhydrocarbons (PAHs) in female reproduction.  

PubMed

Polyhalogenated aromatic arylhydrocarbons (PAHs) such as polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs), the polychlorinated biphenyls (PCBs) and polybrominated diphenyl ethers (PBDEs) are persistent lipophilic pollutants, which affect female fertility resulting in severe reproductive dysregulation, including anovulation, reduced conception rates, abortion, menstrual abnormalities and developmental defects of female reproductive tissues. Many PAHs exert their effects by activating a family of basic helix-loop-helix (bHLH) transcription factors, the arylhydrocarbon receptor (AhR) and the arylhydrocarbon receptor nuclear translocator (ARNT), which result in the expression of AhR target molecules. Complex interactions between PAH-mediated AhR activation and ER signalling pathways have been discovered which may contribute to the developmental malformations, impact on reproductive dysfunctions and promote carcinogenic dedifferentiation of tissues within the female reproductive tract. This review will focus on the multifaceted roles of PAHs in key organs of the female reproductive tract, the ovary, uterus/ endometrium and the mammary gland. The complexity and diversity of actions unleashed by PAHs in these female reproductive tissues identify these environmental pollutants as important endocrine disrupting toxicants impacting on female fertility. PMID:15777215

Hombach-Klonisch, S; Pocar, P; Kietz, S; Klonisch, T

2005-01-01

444

Ah receptor and NF-kappaB interplay on the stage of epigenome.  

PubMed

The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that belongs to the basic helix-loop-helix/Per-ARNT-Sim (bHLH-PAS) family. Its ligands include many natural and synthetic compounds, some of which, such as polyhalogenated aromatic hydrocarbons and polycyclic aromatic hydrocarbons, are important environmental contaminants. NF-kappaB is a pleiotropic factor that regulates many physiological and pathophysiological processes including the immune and inflammatory responses. In the past decade, accumulating evidence suggests close interactions between AhR and NF-kappaB pathways, and these interactions are potentially important mechanisms for many pathological processes such as the chemical-induced immune dysfunctions, carcinogenesis and alteration of xenobiotic metabolism and disposition. AhR-NF-kappaB interaction has become a mechanistic linchpin linking certain pathological responses induced by environmental insults. Furthermore, the AhR-NF-kappaB interaction provides basis for therapeutic applications of certain AhR ligands to treat human diseases. The effects of AhR-NF-kappaB on the epigenome are an important area that is not well understood. In this review, I highlight current research regarding the AhR-NF-kappaB(RelA) interactions with emphasis on the epigenetic impacts of these interactions on chromatin modifications and transcription elongation control. PMID:19014911

Tian, Yanan

2009-02-15

445

A bHLH-Type Transcription Factor, ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR/JA-ASSOCIATED MYC2-LIKE1, Acts as a Repressor to Negatively Regulate Jasmonate Signaling in Arabidopsis[C][W  

PubMed Central

Jasmonates (JAs) are plant hormones that regulate the balance between plant growth and responses to biotic and abiotic stresses. Although recent studies have uncovered the mechanisms for JA-induced responses in Arabidopsis thaliana, the mechanisms by which plants attenuate the JA-induced responses remain elusive. Here, we report that a basic helix-loop-helix–type transcription factor, ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR/JA-ASSOCIATED MYC2-LIKE1 (JAM1), acts as a transcriptional repressor and negatively regulates JA signaling. Gain-of-function transgenic plants expressing the chimeric repressor for JAM1 exhibited substantial reduction of JA responses, including JA-induced inhibition of root growth, accumulation of anthocyanin, and male fertility. These plants were also compromised in resistance to attack by the insect herbivore Spodoptera exigua. Conversely, jam1 loss-of-function mutants showed enhanced JA responsiveness, including increased resistance to insect attack. JAM1 and MYC2 competitively bind to the target sequence of MYC2, which likely provides the mechanism for negative regulation of JA signaling and suppression of MYC2 functions by JAM1. These results indicate that JAM1 negatively regulates JA signaling, thereby playing a pivotal role in fine-tuning of JA-mediated stress responses and plant growth. PMID:23673982

Nakata, Masaru; Mitsuda, Nobutaka; Herde, Marco; Koo, Abraham J.K.; Moreno, Javier E.; Suzuki, Kaoru; Howe, Gregg A.; Ohme-Takagi, Masaru

2013-01-01

446

Heat shock protein 83 (Hsp83) facilitates methoprene-tolerant (Met) nuclear import to modulate juvenile hormone signaling.  

PubMed

Juvenile hormone (JH) receptors, methoprene-tolerant (Met) and Germ-cell expressed (Gce), transduce JH signals to induce Kr-h1 expression in Drosophila. Dual luciferase assay identified a 120-bp JH response region (JHRR) in the Kr-h1? promoter. Both in vitro and in vivo experiments revealed that Met and Gce transduce JH signals to induce Kr-h1 expression through the JHRR. DNA affinity purification identified chaperone protein Hsp83 as one of the proteins bound to the JHRR in the presence of JH. Interestingly, Hsp83 physically interacts with PAS-B and basic helix-loop-helix domains of Met, and JH induces Met-Hsp83 interaction. As determined by immunohistochemistry, Met is mainly distributed in the cytoplasm of fat body cells of the larval when the JH titer is low and JH induces Met nuclear import. Hsp83 was accumulated in the cytoplasm area adjunct to the nucleus in the presence of JH and Met/Gce. Loss-of-function of Hsp83 attenuated JH binding and JH-induced nuclear import of Met, resulting in a decrease in the JHRR-driven reporter activity leading to reduction of Kr-h1 expression. These data show that Hsp83 facilitates the JH-induced nuclear import of Met that induces Kr-h1 expression through the JHRR. PMID:25122763

He, Qianyu; Wen, Di; Jia, Qiangqiang; Cui, Chunlai; Wang, Jian; Palli, Subba R; Li, Sheng

2014-10-01

447

Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R  

PubMed Central

The maize Myb transcription factor C1 depends on the basic helix–loop–helix (bHLH) proteins R or B for regulatory function, but the closely related Myb protein P does not. We have used the similarity between the Myb domains of C1 and P to identify residues that specify the interaction between the Myb domain of C1 and the N-terminal region of R. Substitution of four predicted solvent-exposed residues in the first helix of the second Myb repeat of P with corresponding residues from C1 is sufficient to confer on P the ability to physically interact with R. However, two additional Myb domain amino acid changes are needed to make the P regulatory activity partially dependent on R in maize cells. Interestingly, when P is altered so that it interacts with R, it can activate the Bz1 promoter, normally regulated by C1 + R but not by P. Together, these findings demonstrate that the change of a few amino acids within highly similar Myb domains can mediate differential interactions with a transcriptional coregulator that plays a central role in the regulatory specificity of C1, and that Myb domains play important roles in combinatorial transcriptional regulation. PMID:11095727

Grotewold, Erich; Sainz, Manuel B.; Tagliani, Laura; Hernandez, J. Marcela; Bowen, Ben; Chandler, Vicki L.

2000-01-01

448

Identification of Novel MyoD Gene Targets in Proliferating Myogenic Stem Cells  

PubMed Central

A major control point for skeletal myogenesis revolves around the muscle basic helix-loop-helix gene family that includes MyoD, Myf-5, myogenin, and MRF4. Myogenin and MRF4 are thought to be essential to terminal differentiation events, whereas MyoD and Myf-5 are critical to establishing the myogenic cell lineage and producing committed, undifferentiated myogenic stem cells (myoblasts). Although mouse genetic studies have revealed the importance of MyoD and Myf-5 for myoblast development, the genetic targets of MyoD and Myf-5 activity in undifferentiated myoblasts remain unknown. In this study, we investigated the function of MyoD as a transcriptional activator in undifferentiated myoblasts. By using conditional expression of MyoD, in conjunction with suppression subtractive hybridizations, we show that the Id3 and NP1 (neuronal pentraxin 1) genes become transcriptionally active following MyoD induction in undifferentiated myoblasts. Activation of Id3 and NP1 represents a stable, heritable event that does not rely on continued MyoD activity and is not subject to negative regulation by an activated H-Ras G12V protein. These results are the first to demonstrate that MyoD functions as a transcriptional activator in myogenic stem cells and that this key myogenic regulatory factor exhibits different gene target specificities, depending upon the cellular environment. PMID:12167713

Wyzykowski, Jeffrey C.; Winata, Therry I.; Mitin, Natalia; Taparowsky, Elizabeth J.; Konieczny, Stephen F.

2002-01-01

449

Olig2-dependent developmental fate switch of NG2 cells  

PubMed Central

NG2-expressing cells (NG2 cells or polydendrocytes) generate oligodendrocytes throughout the CNS and a subpopulation of protoplasmic astrocytes in the gray matter of the ventral forebrain. The mechanisms that regulate their oligodendrocyte or astrocyte fate and the degree to which they exhibit lineage plasticity in vivo have remained unclear. The basic helix-loop-helix transcription factor Olig2 is required for oligodendrocyte specification and differentiation. We have found that Olig2 expression is spontaneously downregulated in NG2 cells in the normal embryonic ventral forebrain as they differentiate into astrocytes. To further examine the role of Olig2 in NG2 cell fate determination, we used genetic fate mapping of NG2 cells in constitutive and tamoxifen-inducible Olig2 conditional knockout mice in which Olig2 was deleted specifically in NG2 cells. Constitutive deletion of Olig2 in NG2 cells in the neocortex and corpus callosum but not in ventral forebrain caused them to convert their fate into astrocytes, with a concomitant severe reduction in the number of oligodendrocytes and myelin. Deletion of Olig2 in NG2 cells in perinatal mice also resulted in astrocyte generation from neocortical NG2 cells. These observations indicate that the developmental fate of NG2 cells can be switched by altering a single transcription factor Olig2. PMID:22627280

Zhu, Xiaoqin; Zuo, Hao; Maher, Brady J.; Serwanski, David R.; LoTurco, Joseph J.; Lu, Q. Richard; Nishiyama, Akiko

2012-01-01

450

Homozygous Mutations in NEUROD1 Are Responsible for a Novel Syndrome of Permanent Neonatal Diabetes and Neurological Abnormalities  

PubMed Central

OBJECTIVE NEUROD1 is expressed in both developing and mature ?-cells. Studies in mice suggest that this basic helix-loop-helix transcription factor is critical in the development of endocrine cell lineage. Heterozygous mutations have previously been identified as a rare cause of maturity-onset diabetes of the young (MODY). We aimed to explore the potential contribution of NEUROD1 mutations in patients with permanent neonatal diabetes. RESEARCH DESIGN AND METHODS We sequenced the NEUROD1 gene in 44 unrelated patients with permanent neonatal diabetes of unknown genetic etiology. RESULTS Two homozygous mutations in NEUROD1 (c.427_ 428del and c.364dupG) were identified in two patients. Both mutations introduced a frameshift that would be predicted to generate a truncated protein completely lacking the activating domain. Both patients had permanent diabetes diagnosed in the first 2 months of life with no evidence of exocrine pancreatic dysfunction and a morphologically normal pancreas on abdominal imaging. In addition to diabetes, they had learning difficulties, severe cerebellar hypoplasia, profound sensorineural deafness, and visual impairment due to severe myopia and retinal dystrophy. CONCLUSIONS We describe a novel clinical syndrome that results from homozygous loss of function mutations in NEUROD1. It is characterized by permanent neonatal diabetes and a consistent pattern of neurological abnormalities including cerebellar hypoplasia, learning difficulties, sensorineural deafness, and visual impairment. This syndrome highlights the critical role of NEUROD1 in both the development of the endocrine pancreas and the central nervous system in humans. PMID:20573748

Rubio-Cabezas, Oscar; Minton, Jayne A.L.; Kantor, Iren; Williams, Denise; Ellard, Sian; Hattersley, Andrew T.

2010-01-01

451

Arabidopsis thaliana ICE2 gene: phylogeny, structural evolution and functional diversification from ICE1.  

PubMed

The ability to tolerate environmental stresses is crucial for all living organisms, and gene duplication is one of the sources for evolutionary novelties. Arabidopsis thaliana INDUCER OF CBF EXPRESSION1 and 2 (ICE1 and ICE2) encode MYC-type bHLH (basic helix-loop-helix) transcription factors. They confer cold stress tolerance by induction of the CBF/DREB1 regulon and regulate stomata formation. Although ICE2 is closely related to ICE1, its origin and role in cold response remains uncertain. Here, we used a bioinformatics/phylogenetic approach to uncover the ICE2 evolutionary history, structural evolution and functional divergence from the putative ancestral gene. Sequence diversification from ICE1 included the gain of cis-acting elements in ICE2 promoter sequence that may provide meristem-specific and defense-related gene expression. By analyzing transgenic Arabidopsis lines with ICE2 over-expression we showed that it contributes to stomata formation, flowering time regulation and cold response. Constitutive ICE2 expression led to induced meristem freezing tolerance, resulting from activation of CBF1 and CBF3 genes and ABA biosynthesis by NCED3 induction. We presume that ICE2 gene has originated from a duplication event about 17.9MYA followed by sub- and neofunctionalization of the ancestral ICE1 gene. Moreover, we predict its role in pathogen resistance and flowering time regulation. PMID:25443829

Kurbidaeva, Amina; Ezhova, Tatiana; Novokreshchenova, Maria

2014-12-01

452

Generation of a germ cell-specific mouse transgenic CHERRY reporter, Sohlh1-mCherryFlag  

PubMed Central

SUMMARY Visualization of differentiating germ cells is critical to understanding the formation of primordial follicles in the ovary, and the commitment of spermatogonial stem cells to differentiation. We engineered and generated a BAC transgenic mouse line, Sohlh1-mCherryFlag (S1CF), under the direction of the native Sohlh1 promoter. Sohlh1 is a germ cell-specific gene that encodes the basic helix-loop-helix (bHLH) transcriptional regulator that is essential in oogenesis and spermatogenesis. Sohlh1 expression is unique, and is limited to perinatal and early follicle oocytes and differentiating spermatogonia. The Sohlh1-mCherryFlag transgene was engineered to fuse SOHLH1 to the red fluorescent protein CHERRY with 3-tandem-FLAG tags. S1CF animals fluoresce specifically in the oocytes of perinatal ovaries and small follicles in adult ovaries, as well as in spermatogonia, a pattern that is similar to endogenous SOHLH1. Moreover, S1CF rescued germ cell loss and infertility in both male and female Sohlh1?/? animals. The FLAG-tag on S1CF was effective for immunostaining and immunoprecipitation. The Sohlh1-mCherryFlag transgenic mouse provides a unique model to study early germ cell differentiation, as well as in vivo imaging and purification of differentiating germ cells. PMID:22965810

Suzuki, Hitomi; Dann, Christina Tenenhaus; Rajkovic, Aleksandar

2012-01-01

453

Arabidopsis HFR1 Is a Potential Nuclear Substrate Regulated by the Xanthomonas Type III Effector XopDXcc8004  

PubMed Central

XopDXcc8004, a type III effector of Xanthomonas campestris pv. campestris (Xcc) 8004, is considered a shorter version of the XopD, which lacks the N-terminal domain. To understand the functions of XopDXcc8004, in planta, a transgenic approach combined with inducible promoter to analyze the effects of XopDXcc8004 in Arabidopsis was done. Here, the expression of XopDXcc8004, in Arabidopsis elicited the accumulation of host defense-response genes. These molecular changes were dependent on salicylic acid and correlated with lesion-mimic phenotypes observed in XVE::XopDXcc8004 transgenic plants. Moreover, XopDXcc8004 was able to desumoylate HFR1, a basic helix-loop-helix transcription factor involved in photomorphogenesis, through SUMO protease activity. Interestingly, the hfr1-201 mutant increased the expression of host defense-response genes and displayed a resistance phenotype to Xcc8004. These data suggest that HFR1 is involved in plant innate immunity and is potentially regulated by XopDXcc8004. PMID:25647296

Tan, Choon Meng; Li, Meng-Ying; Yang, Pei-Yun; Chang, Shu Heng; Ho, Yi-Ping; Lin, Hong; Deng, Wen-Ling; Yang, Jun-Yi

2015-01-01

454

The rice RING finger E3 ligase, OsHCI1, drives nuclear export of multiple substrate proteins and its heterogeneous overexpression enhances acquired thermotolerance.  

PubMed

Thermotolerance is very important for plant survival when plants are subjected to lethally high temperature. However, thus far little is known about the functions of RING E3 ligase in response to heat shock in plants. This study found that one rice gene encoding the RING finger protein was specifically induced by heat and cold stress treatments but not by salinity or dehydration and named it OsHCI1 (Oryza sativa heat and cold induced 1). Subcellular localization results showed that OsHCI1 was mainly associated with the Golgi apparatus and moved rapidly and extensively along the cytoskeleton. In contrast, OsHCI1 may have accumulated in the nucleus under high temperatures. OsHCI1 physically interacted with nuclear substrate proteins including a basic helix-loop-helix transcription factor. Transient co-overexpression of OsHCI1 and each of three nuclear proteins showed that their fluorescent signals moved into the cytoplasm as punctuate formations. Heterogeneous overexpression of OsHCI1 in Arabidopsis highly increased survival rate through acquired thermotolerance. It is proposed that OsHCI1 mediates nuclear-cytoplasmic trafficking of nuclear substrate proteins via monoubiquitination and drives an inactivation device for the nuclear proteins under heat shock. PMID:23698632

Lim, Sung Don; Cho, Hyun Yong; Park, Yong Chan; Ham, Deok Jae; Lee, Ju Kyong; Jang, Cheol Seong

2013-07-01

455

Purification and cDNA cloning of a second apoptosis-related cysteine protease that cleaves and activates sterol regulatory element binding proteins.  

PubMed

We have purified from hamster liver a second cysteine protease that cleaves and activates sterol regulatory element binding proteins (SREBPs). cDNA cloning revealed that this enzyme is the hamster equivalent of Mch3, a human enzyme that is related to the interleukin 1beta converting enzyme. We call this enzyme Mch3/SCA-2. It is 54% identical to hamster CPP32/SCA-1, a cysteine protease that was earlier shown to cleave SREBPs at a conserved Asp between the basic helix-loop-helix leucine zipper domain and the membrane attachment domain. This cleavage liberates an NH2-terminal fragment of approximately 460 amino acids that activates transcription of genes encoding the low density lipoprotein receptor and enzymes of cholesterol synthesis. Mch3/SCA-2 and CPP32/SCA-I are synthesized as inactive 30-35 kDa precursors that are thought to be cleaved during apoptosis to generate active fragments of approximately 20 and approximately 10 kDa. The current data lend further support to the notion that SREBPs are cleaved and activated as part of the program in programmed cell death. PMID:8643593

Pai, J T; Brown, M S; Goldstein, J L

1996-05-28

456

Essential C-Terminal Region of the Baculovirus Minor Capsid Protein VP80 Binds DNA  

PubMed Central

The essential Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) minor capsid protein VP80 has been recently shown to interact with the virus-triggered, nuclear F-actin cytoskeleton. A role for VP80 in virus morphogenesis has been proposed in the maturation of progeny nucleocapsids and in their egress from the virogenic stroma toward the nuclear periphery by a mechanism, which also includes F-actin filaments. We performed functional mapping of VP80 demonstrating that its highly conserved C-terminal region plays a crucial role in virion morphogenesis. Protein database mining identified a putative basic helix-loop-helix (bHLH) domain, a DNA-binding module typical for eukaryotic transcription factors, in the essential C-terminal region of VP80. Using a molecular modeling approach, we predicted the three-dimensional structure of this domain, revealing some unique properties. Biochemical assays proved that VP80 can form homodimers, a critical prerequisite of DNA-binding bHLH proteins. The ability of VP80 to bind DNA was subsequently confirmed by an electrophoretic mobility shift assay. We further show that AcMNPV DNA replication occurs in the absence of VP80. Immunolabeling of VP80 in baculovirus-infected cells rather points toward its involvement in nucleocapsid maturation. The competence of VP80 to interact with both F-actin and DNA provides novel insight into baculovirus morphogenesis. PMID:22090126

Marek, Martin; Merten, Otto-Wilhelm; Francis-Devaraj, Feana

2012-01-01

457

Tcf15 Primes Pluripotent Cells for Differentiation  

PubMed Central

Summary The events that prime pluripotent cells for differentiation are not well understood. Inhibitor of DNA binding/differentiation (Id) proteins, which are inhibitors of basic helix-loop-helix (bHLH) transcription factor activity, contribute to pluripotency by blocking sequential transitions toward differentiation. Using yeast-two-hybrid screens, we have identified Id-regulated transcription factors that are expressed in embryonic stem cells (ESCs). One of these, Tcf15, is also expressed in the embryonic day 4.5 embryo and is specifically associated with a novel subpopulation of primed ESCs. An Id-resistant form of Tcf15 rapidly downregulates Nanog and accelerates somatic lineage commitment. We propose that because Tcf15 can be held in an inactive state through Id activity, it may prime pluripotent cells for entry to somatic lineages upon downregulation of Id. We also find that Tcf15 expression is dependent on fibroblast growth factor (FGF) signaling, providing an explanation for how FGF can prime for differentiation without driving cells out of the pluripotent state. PMID:23395635

Davies, Owen R.; Lin, Chia-Yi; Radzisheuskaya, Aliaksandra; Zhou, Xinzhi; Taube, Jessica; Blin, Guillaume; Waterhouse, Anna; Smith, Andrew J.H.; Lowell, Sally

2013-01-01

458

Generation of Atoh1-rtTA transgenic mice: a tool for inducible gene expression in hair cells of the inner ear  

PubMed Central

Atoh1 is a basic helix-loop-helix transcription factor that controls differentiation of hair cells (HCs) in the inner ear and its enhancer region has been used to create several HC-specific mouse lines. We generated a transgenic tetracycline-inducible mouse line (called Atoh1-rtTA) using the Atoh1 enhancer to drive expression of the reverse tetracycline transactivator (rtTA) protein and human placental alkaline phosphatase. Presence of the transgene was confirmed by alkaline phosphatase staining and rtTA activity was measured using two tetracycline operator (TetO) reporter alleles with doxycycline administered between postnatal days 0–3. This characterization of five founder lines demonstrated that Atoh1-rtTA is expressed in the majority of cochlear and utricular HCs. Although the tetracycline-inducible system is thought to produce transient changes in gene expression, reporter positive HCs were still observed at 6 weeks of age. To confirm that Atoh1-rtTA activity was specific to Atoh1-expressing cells, we also analyzed the cerebellum and found rtTA-driven reporter expression in cerebellar granule neuron precursor cells. The Atoh1-rtTA mouse line provides a powerful tool for the field and can be used in combination with other existing Cre recombinase mouse lines to manipulate expression of multiple genes at different times in the same animal. PMID:25363458

Cox, Brandon C.; Dearman, Jennifer A.; Brancheck, Joseph; Zindy, Frederique; Roussel, Martine F.; Zuo, Jian

2014-01-01

459

The window period of NEUROGENIN3 during human gestation.  

PubMed

The basic helix-loop-helix transcription factor, NEUROG3, is critical in causing endocrine commitment from a progenitor cell population in the developing pancreas. In human, NEUROG3 has been detected from 8 weeks post-conception (wpc). However, the profile of its production and when it ceases to be detected is unknown. In this study we have defined the profile of NEUROG3 detection in the developing pancreas to give insight into when NEUROG3-dependent endocrine commitment is possible in the human fetus. Immunohistochemistry allowed counting of cells with positively stained nuclei from 7 wpc through to term. mRNA was also isolated from sections of human fetal pancreas and NEUROG3 transcription analyzed by quantitative reverse transcription and polymerase chain reaction. NEUROG3 was detected as expected at 8 wpc. The number of NEUROG3-positive cells increased to peak levels between 10 wpc and 14 wpc. It declined at and after 18 wpc such that it was not detected in human fetal pancreas at 35-41 wpc. Analysis of NEUROG3 transcription corroborated this profile by demonstrating very low levels of transcript at 35-41 wpc, more than 10-fold lower than levels at 12-16 wpc. These data define the appearance, peak and subsequent disappearance of the critical transcription factor, NEUROG3, in human fetal pancreas for the first time. By inference, the window for pancreatic endocrine differentiation via NEUROG3 action opens at 8 wpc and closes between 21 and 35 wpc. PMID:25322831

Salisbury, Rachel J; Blaylock, Jennifer; Berry, Andrew A; Jennings, Rachel E; De Krijger, Ronald; Piper Hanley, Karen; Hanley, Neil A

2014-01-01

460

E2A suppresses invasion and migration by targeting YAP in colorectal cancer cells  

PubMed Central

Background E2A gene, which encodes two basic helix–loop–helix (bHLH) transcription factors E12 and E47, has been identified as regulator of B lymphoid hematopoiesis and suppressor of lymphoma. E47 protein was found to decrease E-cadherin expression and induce epithelial-mesenchymal transition (EMT). However, the role of E2A in colorectal cancer (CRC) metastasis is still elusive. Methods qRT-PCR and semi-qRT-PCR were performed to determine mRNA level of E2A in CRC specimens and colorectal cancer cells. RNAi was employed to downregulate E2A expression and subsequent protein level change was evaluated by immunoblot. Cell invasion and migration capacity were detected by transwell assay using cell culture inserts with or without basement membrane matrix, respectively. Results E2A expression was decreased in metastatic CRC tissues. Invasion and migration assays showed downregulation of E2A increased metastatic capacity of CRC cells while forced expression of E12 or E47 could offset this effect. Both E12 and E47 suppressed EMT induced by E2A downregulation. Moreover, Yes-Associated Protein (YAP) was a downstream target of E2A and suppression of YAP inhibited the pro-migration/invasion of E2A deficiency. Conclusion Our results suggest that E2A suppresses CRC cell metastasis, at least partially if not all, by inhibiting YAP expression. PMID:24369055

2013-01-01